WorldWideScience

Sample records for caupi vigna unguiculata

  1. Variabilidade e correlações entre caracteres agronômicos em caupi (Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Lopes Ângela Celis de Almeida

    2001-01-01

    Full Text Available O caupi (Vigna unguiculata (L. Walp é um alimento básico das populações do Nordeste brasileiro, devendo merecer atenção com vistas a melhoria da qualidade de grãos, resistência a doenças e pragas e aumento de produtividade. Este trabalho teve por objetivo estudar a variabilidade e o potencial genético de 28 linhagens, escolhidas após uma seleção para cor, tamanho de grãos e resistência a viroses. A produtividade apresentou coeficiente de variação genético de 23,90%, e o valor agronômico, de 3,56%. O número de vagens por pedúnculo apresentou a menor estimativa do coeficiente de determinação genético (4,51%, e o peso de 100 grãos, a maior (81,74%. O coeficiente de determinação genético da produtividade foi de 34,15%. As maiores estimativas de ganho genético foram as do peso de 100 grãos (21,73% e da produtividade (19,77%. As correlações genotípicas foram superiores às fenotípicas e às de ambiente, destacando-se as correlações entre número de ramos secundários e produtividade (68,13%, e valor agronômico e produtividade (100%. Estes resultados mostram amplas possibilidades de seleção entre as linhagens com relação à maioria dos caracteres estudados.

  2. Vigna unguiculata L.

    African Journals Online (AJOL)

    user

    2012-02-16

    Feb 16, 2012 ... via organogenesis from cotyledonary node of cowpea. (Vigna unguiculata L. ... cowpea (Vigna unguiculata L. Walp) has been established. The cotyledonary node ..... Genomic/Proteomic Technol. 3: 45-47. Pellegrineschi A ...

  3. Genetical analysis of the induced variation by gamma radiation in quantitative characters of Caupi [Vigna unguiculata (L.) Walp.

    International Nuclear Information System (INIS)

    Araujo, J.P.P. de.

    1987-10-01

    Genetical analysis procedures of the cobalt 60 gamma radiation effects in the induced mutations in quantitative characters of Caupi BR-1 Poty. The following characters were evaluated: day to first flower (FI), number of pods per plant (NVP), pod lenght (CMV), number of suds per pod (NSV), 100 seed wright (PCS), seed yield per plant (PSP) and seed yield per plant estimated by yield components (PSPE). The resistance of irradiated populations to cowpea aphid-borne mosaic virus (CpAMV)was also evaluated. (L.M.J.) [pt

  4. Vigna unguiculata [Linn] Walp varieties

    African Journals Online (AJOL)

    Walp) have differential effects on blood glucose when equal amounts are consumed. Objective: To ... Previous studies have described the benefit of consumption of ... Beans (Vigna unguiculata) are one of the staple local foods consumed by ...

  5. Soil compaction and gamma radiation ({sup 60}Co) in the development of the cowpea beans [Vigna unguiculata, (L) Walp]; Compactacao do solo e radiacao gama ({sup 60}Co) no desenvolvimento do feijao caupi [Vigna unguiculata, (L) Walp

    Energy Technology Data Exchange (ETDEWEB)

    Viana, Eliane Ferreira; Colaco, Waldeciro [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear. Radioagronomia]. E-mails: aroucha@ufpe.br; wcolaco@ufpe.br

    2005-08-15

    The objective is to investigate the effect of compaction and increased doses of gamma radiation on the development of cowpea [Vigna unguiculata, (L) Walp] var. IPA-206 cultivated in a Neossolo fluvic soil, artificially compacted. Significant differences were observed in plant height, with the increase doses in soil density (1.30 Mg.m{sup -3} - compacted soil and 1.70 Mg.m{sup -3} - non-compacted soil), and in response to increased doses of irradiation (y-rays) [ [0, 100, 200 and 300 Gy). The diameter of the stem was significantly reduced in response to the increase in soil density, however the same did not occur in relation to the doses of irradiation (y-rays) holding capacity of the soil was reduced in response to the increase in soil density. (author)

  6. Desenvolvimento do feijão caupi (vigna unguiculata l.walp utilizando as cinzas de bagaço da cana-de-açúcar e efluente tratado

    Directory of Open Access Journals (Sweden)

    José Airlys Garcia de Menezes

    2013-09-01

    Full Text Available A grande quantidade de cinzas gerada pelos engenhos, proveniente da queima do bagaço da cana-de-açúcar, ou seja, a necessidade de redução de emissões advindas dessa queima, fazem com que se busquem alternativas para diminuir essas emissões, assim como para a utilização racional dessas cinzas em diversas culturas, como na produção do feijão caupi.O presente trabalho teve como objetivo avaliar os efeitos das cinzas de bagaço de cana-de-açúcar com efluente tratados, no desenvolvimento inicial da cultura do Feijão caupi (Vigna unguiculata L.Walp. O estudo foi desenvolvido na estação de tratamento de esgoto da Faculdade de Tecnologia CENTEC – FATEC Cariri, utilizando-se de tratamentos T1- Efluente tratado do filtro anaeróbio juntamente com as cinzas do bagaço da cana-de-açúcar; T2- Água proveniente de poço juntamente com as cinzas do bagaço da cana-de-açúcar; T3- Água proveniente de poço sem aplicação de cinzas; com três épocas de coletas, compondo um modelo de experimento inteiramente casualizado. Contudo os valores de altura e o diâmetro caulinar foram mais elevados nas plantas cultivadas com a aplicação das cinzas de bagaço de cana-de-açúcar com efluente tratados. Normal 0 21 false false false PT-BR X-NONE X-NONE

  7. Resistência de genótipos de feijão-caupi [Vigna unguiculata (L. Walp.] ao Ataque do Caruncho Callosobruchus maculatus (Fabr. (Coleoptera: Chrysomelidae

    Directory of Open Access Journals (Sweden)

    Westerllanya Medeiros

    2017-04-01

    Abstract. The Cowpea weevil Callosobruchus maculatus (Fabr. is considered the main Prague during storage of grains of Cowpea [Vigna unguiculata (L. Walp.]. Due to the economic losses caused by this insect, is of paramount importance to develop studies to select varieties resistant to this pest. In this study assessed the effect of genotypes of V. unguiculata about the behavior and the development of C. maculatus in two consecutive generations. The study was conducted in laboratory with conditions of temperature and relative humidity monitored, in completely randomized design using BRS Epace 10, Capela, BRS Urubuquara, BRS Pajeu, Itaim, BRS Rouxinol, Pingo de ouro, BRS Corujinha, IT85 F-2687 and BR 17 Gurguéia genotypes with eight repetitions. In each genotype were confined 10 adults of c. maculatus for it was held the oviposition. After a period of five days, the adults were removed from the pots containing the genotypes. Waited-if the emergence of adults (first generation and new infestation was held in the same access to obtain the second generation. The parameters evaluated were number of eggs, egg viability, total number of adults emergency, viability of immature phase, average period of development and dry weight of adults. IT85 F2687 genotype presented resistance of non-preference for oviposition and the genotypes BR 17 Gurguéia and BRS Urubuquara presented antibiose type resistance in relation to C. maculatus. BR 17 Gurguéia genotype was the strongest among the genotypes studied in relation to c. maculatus. The genotypes Capela and Itaim were characterized as susceptible to C. maculatus.

  8. Atividade inseticida de óleos essenciais e fixos sobre Callosobruchus maculatus (FABR., 1775 (Coleoptera: Bruchidae em grãos de caupi [Vigna unguiculata (L. WALP.] Insecticide activity of essential and fixed oils in Callosobruchus maculatus (FABR., 1775 (Coleoptera: Bruchidae in cowpea grains [Vigna unguiculata (L. WALP.

    Directory of Open Access Journals (Sweden)

    Adriana Carla Ribeiro Lopes Pereira

    2008-06-01

    Full Text Available O caruncho, Callosobruchus maculatus (Fabr., é considerado a praga mais importante do caupi, Vigna unguiculata (L. Walp., armazenado em regiões tropicais e subtropicais. Visando minimizar os efeitos indesejáveis dos inseticidas químicos sintéticos, o controle dessa praga com óleos de origem vegetal vem se constituindo numa alternativa promissora, de baixo custo e segura para os aplicadores e consumidores. Foram testados os óleos essenciais [(Cymbopogon martini (Roxb. J.F. Watson], Piper aduncum L., Piper hispidinervum C.DC., Melaleuca sp., Lippia gracillis Shauer e fixos (Helianthus annuus L, Sesamum indicum L, Gossypium hirsutum L., Glycine max (L. Merr. e Caryocar brasiliense Camb., em grãos de caupi, cv. Sempre Verde. Os óleos foram utilizados nas concentrações 10, 20, 30, 40 e 50mL/20g, correspondendo a 0,5, 1,0, 1,5, 2,0 e 2,5 L/t e impregnados aos grãos no interior de recipientes de plástico, com auxílio de pipetador automático e agitados manualmente durante dois minutos. Parcelas de 20g de caupi foram infestadas com oito fêmeas de C. maculatus, com 0 a 48 h de idade. Cada óleo foi testado, separadamente, em delineamento inteiramente casualisado com seis repetições. Os óleos essenciais de C. martini, P. aduncum e L. gracillis causaram 100% de mortalidade em todas as concentrações, P. hispidinervum a partir de 1,5 L/t e Melaleuca sp. nas concentrações de 2,0 e 2,5 L/t. A redução do número de ovos viáveis e de insetos emergidos foi de 100% para todos os óleos essenciais, exceto Melaleuca sp. Por outro lado, os óleos fixos, apesar de apresentarem baixa mortalidade em todas as concentrações testadas, reduziram em praticamente 100% o número de ovos viáveis e de insetos emergidos.The weevil Callosobruchus maculatus (Fabr. is considered the most important pest of cowpea, Vigna unguiculata (L. Walp., stored in tropical and subtropical regions. Focusing to minimize the undesired effects of synthetic chemical

  9. Marcha de absorção do nitrogênio do solo, do fertilizante e da fixação simbiótica em feijão-caupi (Vigna unguiculata (L. walp. e feijão-comum (Phaseolus vulgaris L. determinada com uso de 15N Uptake rate of nitrogen from soil and fertilizer, and n derived from symbiotic fixation in cowpea (Vigna unguiculata (L. walp. and common bean (Phaseolus vulgaris L. determined using the 15N isotope

    Directory of Open Access Journals (Sweden)

    Marciano de Medeiros Pereira Brito

    2009-08-01

    Full Text Available O feijão-comum e o feijão-caupi estão entre as principais fontes de proteína vegetal para grande parte da população mundial, sobretudo aquela de baixa renda, e o N é o principal constituinte de proteínas. Os objetivos deste trabalho foram de avaliar, por meio da técnica isotópica e tendo como plantas-controle arroz e soja não nodulante, as contribuições relativas das fontes de N (N2-fixação simbiótica, N-solo e N-fertilizante no desenvolvimento do feijão-comum e caupi ao longo do ciclo e comparar o método isotópico (MI com o método da diferença (MD para avaliação da fixação simbiótica de N2. A pesquisa foi realizada em casa de vegetação no Centro de Energia Nuclear na Agricultura - CENA/USP, utilizando-se vasos com 5 kg de terra de um Latossolo Vermelho-Amarelo distrófico. O delineamento experimental foi o de blocos casualizados com 16 tratamentos e três repetições. Os tratamentos (fatorial 8 x 2 compreenderam oito épocas de coleta: 17, 24, 31, 38, 47, 58, 68 e 78 dias após a semeadura (DAS e duas culturas: feijão-comum e feijão-caupi. Utilizou-se uma dose de 10 mg kg-1 de N no solo, na forma de ureia, enriquecida com 10 % de átomos de 15N em excesso. A fixação simbiótica forneceu a maior parte do N acumulado nas plantas de feijão e caupi, seguida, em ordem decrescente, pelo solo e fertilizante. A maior taxa de fixação simbiótica de N ocorreu a partir da fase de prefloração do feijão e do caupi. Após a fase inicial (24 DAS, o arroz e a soja não nodulante tornaram-se adequadas plantas-controle da fixação simbiótica de N2. Houve boa concordância entre o MI e o MD, exceto nos estádios iniciais das culturas.Common bean (Phaseolus vulgaris L. and cowpea (Vigna unguiculata (L. Walp. are among the main sources of plant protein for a large part of the world population, mainly that of low income, and nitrogen is the main constituent of these proteins. The objectives of this study were to evaluate

  10. Transgene expression in cowpea ( Vigna unguiculata (L.) Walp ...

    African Journals Online (AJOL)

    Transgene expression in cowpea ( Vigna unguiculata (L.) Walp.) ... and Bar genes for β-glucuronidase expression and bialaphos resistance respectively. ... expression also showed positive signals under PCR and Southern analysis giving ...

  11. Pollination and yield responses of cowpea (Vigna unguiculata L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-04

    May 4, 2009 ... Key words: Apis mellifera adansonii, Vigna unguiculata, bee plant, foraging, pollination, increased yield. INTRODUCTION. There are ... several techniques such as fire-prone, crop rotations, ..... Inventory of melliferous plants.

  12. Pollination and yield responses of cowpea ( Vigna unguiculata L ...

    African Journals Online (AJOL)

    To determine the apicultural value of Vigna unguiculata (L.) Walp. (Fabaceae) and evaluate the Apis mellifera adansonii Latreille (Hymenoptera: Apidae) activity on its pod and seed yields, the bee foraging and pollinating activities were studied in Ngaoundéré. The experiment was carried out within the University of ...

  13. Susceptibility Of Five Cowpea ( Vigna unguiculata ) Varieties To ...

    African Journals Online (AJOL)

    Susceptibility Of Five Cowpea ( Vigna unguiculata ) Varieties To Attack By Callosobruchus maculatus (Fab.) ... in Ghana were screened for susceptibility to the cowpea beetle, C. maculatus, in storage for a period of 30 days in the laboratory at an ambient temperature of 27.5 ± 0.9oC and relative humidity of 64.6 ± 2%.

  14. Plants regeneration from African cowpea variety (Vigna unguiculata ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-18

    Aug 18, 2008 ... Vigna unguiculata (L.) Walp. plant was efficiently regenerated from cotyledonary node explants. The shoots multiplication rate was ... Africa, insect pests are often responsible for 100% losses of cowpea yields (Singh and .... 26 days after acclimatization first flower buds were observed; thus plants were ...

  15. Influência do período de armazenamento do caupi [Vigna unguiculata (L. Walp.], tratado com óleos essenciais e fixos, no controle de Callosobruchus maculatus (Fabricius, 1775 (Coleoptera, Chrysomelidae, Bruchinae Influence of the storage period of cowpea [Vigna unguiculata (L. Walp.] treated with essential and fixed oils, for the control of Callosobruchus maculatus (Fabricius, 1775 (Coleoptera, Chrysomelidae, Bruchinae

    Directory of Open Access Journals (Sweden)

    Adriana Carla Ribeiro Lopes Pereira

    2009-02-01

    Full Text Available Compostos secundários obtidos de plantas podem ser utilizados no controle de Callosobruchus maculatus, como uma tática alternativa potencial aos inseticidas sintéticos. Foram testados óleos essenciais (Cymbopogon martini Roxb., Piper aduncum L., Piper hispidinervum C.DC., Melaleuca sp., Lippia gracillis Shau e fixos (Helianthus annus L., Sesamum indicum L., Gossypium hirsutum L., Glycine max L. e Caryocar brasiliense Camb., na concentração de 50µl/20g, de acordo com estudos anteriores. Grãos de caupi, cv. Sempre Verde, foram impregnados com os óleos, em recipientes de vidro e submetidos à agitação manual por dois minutos. Cada parcela de 20g foi infestada com oito fêmeas de C. maculatus com 0 a 48h de idade, durante quatro dias. Os óleos foram avaliados logo após a impregnação e aos 30, 60, 90 e 120 dias de armazenamento. Na primeira avaliação, todos os óleos essenciais provocaram 100% de mortalidade e para os óleos fixos, a mortalidade variou entre 35% (G. hirsutum e 67,5% (G. max. Com o prolongamento do período de armazenamento, houve um aumento do número de ovos viáveis e de insetos emergidos, exceto para P. aduncum. Em relação aos óleos fixos, S. indicum, G. max, G. hirsutum e C. brasiliense foram os mais eficientes até os 30 dias de armazenamento. Os resultados indicam que os óleos testados na concentração de 50µl/20g apresentam baixo efeito residual, com exceção de P. aduncum, que foi efetivo durante todo o período de armazenamento.The secondary compounds extracted from plants are considered potential alternative to synthetic insecticides in the control of agricultural pests. Essential oils (Cymbopogon martini Roxb., Piper aduncum L., P. hispidinervum C.DC., Melaleuca sp. and Lippia gracillis Shau and fixed oils (Helianthus annus L., Sesamum indicum L., Gossypium hirsutum L., Glycine max L. and Caryocar brasiliense Camb. at the concentration of 50µl/20g were tested according to previous studies. Samples

  16. Uptake rate of nitrogen from soil and fertilizer, and N derived from symbiotic fixation in cowpea (Vigna unguiculata (L.) Walp.) and common bean (Phaseolus vulgaris L.) determined using the {sup 15}N isotope; Marcha de absorcao do nitrogenio do solo, do fertilizante e da fixacao simbiotica em feijao-caupi (Vigna unguiculata (L.) Walp.) e feijao-comum (Phaseolus vulgaris L.) determinada com uso de {sup 15}N

    Energy Technology Data Exchange (ETDEWEB)

    Brito, Marciano de Medeiros Pereira; Muraoka, Takashi; Silva, Edson Cabral da [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba SP (Brazil)], e-mail: marcianobrito@hotmail.com, e-mail: muraoka@cena.usp.br, e-mail: ecsilva@cena.usp.br

    2009-07-15

    Common bean (Phaseolus vulgaris L.) and cowpea (Vigna unguiculata (L.) Walp.) are among the main sources of plant protein for a large part of the world population, mainly that of low income, and nitrogen is the main constituent of these proteins. The objectives of this study were to evaluate, through the {sup 15}N-dilution technique and using rice and non-nodulating soybean as control plants, the relative contributions of nitrogen sources (symbiotically fixed N, soil native N and fertilizer N) on the growth of common bean and cowpea and to compare the isotopic technique (ID) with the difference methods (DM) for the evaluation of symbiotic N{sub 2} fixation. The study was carried out in a greenhouse of the Center for Nuclear Energy in Agriculture - CENA/USP, Sao Paulo State, Brazil, using 5 kg pots with a Typic Haplustox (Dystrophic Red-Yellow Latosol). The experiment was arranged in completely randomized blocks, with 16 treatments and three replications, in an 8 x 2 factorial design. The treatments were eight sampling times: 7, 24, 31, 38, 47, 58, 68 and 78 days after sowing (DAS) and two crops: common bean and cowpea. An N rate of 10 mg kg{sup -1} soil was used, as urea, enriched with an excess of 10 % of {sup 15}N atoms. Symbiotic N fixation supplied the bean and cowpea plants with the greatest amount of accumulated N, followed, in decreasing order, by soil and fertilizer. The highest rate of N symbiotic fixation was observed at the pre-flowering growth stage of the bean and cowpea plants. After the initial growth stage, 24 DAS, rice and non nodulating soybean were appropriate control plants to evaluate symbiotic N fixation. There was a good agreement between ID and DM, except in the initial growth stage of the crops. (author)

  17. Recent advances in cowpea [ Vigna unguiculata (L.) Walp.] “omics ...

    African Journals Online (AJOL)

    After decades of research on cowpea, significant amount of omics datasets are available and useful in understanding the genetic relationship between Vigna unguiculata ssp. unguiculata and other species belonging to the same genus as well as its genetic variation. Besides, the development of genetic map allowed the ...

  18. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  19. Evaluation of aminoacids in irradiated beans (Vigna unguiculata (L.) Walp) by high performance liquid chromatography (HPLC)

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Keila S. Cople; Souza, Luciana B.; Coelho, Maysa J.; Lima, Antonio L. Santos; Hernandes, Nilber K. [Instituto Militar de Engenharia (IME), Rio de Janeiro, RJ (Brazil). Secao de Engenharia Nuclear]. E-mail: keila@ime.eb.br; Godoy, Ronoel L.O. [EMBRAPA Agroindustria de Alimentos, Rio de Janeiro, RJ (Brazil)]. E-mail: ronoel@ctaa.embrapa.br

    2007-07-01

    Fradinho-bean (Vigna unguiculata (L.) Walp) is originated from Africa and is known in Brazil as 'caupi', 'corda' or 'macassar'. It is grown in the interior of Northeast Brazil (semi-arid region) and can be found in parts of the North, being one of the most important components of people's diet in those regions. The Northeast area produces around 429,375 ton of fradinho-bean per year. Leguminous plants are very important sources of proteins, vitamins, carbohydrates and minerals. This kind of bean is an excellent source of proteins (around 23- 25% of its nutritional content), being superior to regular beans (Phaseolus vulgaris). The irradiation process is an alternative to avoid post-harvesting losses, without changing the nutritional value of food. This study has the objective to evaluate the effect of different gamma irradiation doses (0.0; 0.5; 1.0; 2.5; 5.0 and 10.0 kGy) on aminoacid content of fradinho-bean by high performance liquid chromatography (HPLC) and the accompanying of the grains during storage time of 6 months. After irradiation, the bean grains went through a milling process in order to make flour for posterior extraction. A liquid chromatographer Waters, model Alliance 2695, with fluorescent detector Waters 2475, having a mobile phase with gradient elution of sodium acetate. acetonitrile and Milli-Q water, was employed. The flux used was 1 mL/min and the injection volume of 10 {mu}L. The column (C 18 150.0 x 3.9 mm) was kept at 36 deg C. The results show that gamma irradiation is a promise process for fradinho bean during conservation storage time of 6 months, until the dose of 10.0 kGy. Even the most radio-sensitive aminoacids like aromatics and basic lateral chains were preserved. (author)

  20. Regeneration and genetic transformation of cowpea (Vigna unguiculata Walp.)

    International Nuclear Information System (INIS)

    Filippone, E.; Colucci, G.; Ciardi, F.; Monti, L.

    1997-01-01

    Regeneration of cowpea (Vigna unguiculata Walp.) was achieved through massive bud formation induced in apical and lateral meristems by the herbicide Thidiazuron (TDZ). The effect of TDZ (5, 10, or 20 μM) was tested in vitro on four different cowpea genotypes. Thidiazuron, even at the highest concentration, had no effect on seed germination. After one month of culture, multiple bud cluster formation was observed in all genotypes tested; about 80% of shoot apices regenerated multiple buds, whilst only 34% of cotyledonary nodes behaved in the same way. Histology of regenerating multiple bud clusters revealed that regeneration initiated from pre-existing meristems in the apex and cotyledonary node. Thidiazuron at 10 μM appeared to be the best concentration to produce clusters with high number of buds, ranging from 5 to 10. Shoot elongation occurred only on MS medium without TDZ. On the same medium, 75% of elongated shoots rooted. For genetic transformation of cowpea, a direct DNA transfer methods in plants under in vivo conditions was tested by electroporation of plasmid DNA into the nodal meristematic cells. Some transformed plants were obtained, and produced T 1 transformed progenies; their transgenic nature was confirmed by Southern analysis. (author). 21 refs, 2 figs, 3 tabs

  1. Regeneration and genetic transformation of cowpea (Vigna unguiculata Walp.)

    Energy Technology Data Exchange (ETDEWEB)

    Filippone, E; Colucci, G; Ciardi, F; Monti, L [Department of Agronomy and Plant Genetics, Univ. of Naples Federico 11, Portici (Italy)

    1997-07-01

    Regeneration of cowpea (Vigna unguiculata Walp.) was achieved through massive bud formation induced in apical and lateral meristems by the herbicide Thidiazuron (TDZ). The effect of TDZ (5, 10, or 20 {mu}M) was tested in vitro on four different cowpea genotypes. Thidiazuron, even at the highest concentration, had no effect on seed germination. After one month of culture, multiple bud cluster formation was observed in all genotypes tested; about 80% of shoot apices regenerated multiple buds, whilst only 34% of cotyledonary nodes behaved in the same way. Histology of regenerating multiple bud clusters revealed that regeneration initiated from pre-existing meristems in the apex and cotyledonary node. Thidiazuron at 10 {mu}M appeared to be the best concentration to produce clusters with high number of buds, ranging from 5 to 10. Shoot elongation occurred only on MS medium without TDZ. On the same medium, 75% of elongated shoots rooted. For genetic transformation of cowpea, a direct DNA transfer methods in plants under in vivo conditions was tested by electroporation of plasmid DNA into the nodal meristematic cells. Some transformed plants were obtained, and produced T{sub 1} transformed progenies; their transgenic nature was confirmed by Southern analysis. (author). 21 refs, 2 figs, 3 tabs.

  2. Development of 12 Chloroplast Microsatellite Markers in Vigna unguiculata (Fabaceae and Amplification in Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2014-03-01

    Full Text Available Premise of the study: Vigna unguiculata is an economically important legume, and the complexity of its variability and evolution needs to be further understood. Based on publicly available databases, we developed chloroplast microsatellite primers to investigate genetic diversity within V. unguiculata and its related species Phaseolus vulgaris. Methods and Results: Twelve polymorphic chloroplast microsatellite markers were developed and characterized in 62 V. unguiculata individuals. The number of alleles per locus varied between two and four, the unbiased haploid diversity per locus ranged from 0.123 to 0.497, and the polymorphism information content varied from 0.114 to 0.369. In cross-species amplifications, nine of these markers showed polymorphism in 29 P. vulgaris individuals. Conclusions: The newly developed chloroplast microsatellite markers exhibit variation in V. unguiculata as well as their transferability in P. vulgaris. These markers can be used to investigate genetic diversity and evolution in V. unguiculata and P. vulgaris.

  3. Eficiência e diversidade fenotípica de bactérias diazotróficas que nodulam caupi [Vigna unguiculata (L. Walp] e feijoeiro (Phaseolus vulgaris L. em solos de mineração de bauxita em reabilitação Efficiency and phenotypic diversity among nitrogen-fixing bacteria that nodulate cowpea [Vigna unguiculata (L. Walp] and common bean (Phaseolus vulgaris L. in bauxite-mined soils under rehabilitation

    Directory of Open Access Journals (Sweden)

    Rogério Melloni

    2006-04-01

    Full Text Available A atividade de mineração provoca degradação ambiental em várias partes do mundo, e técnicas de revegetação, empregando diversas espécies vegetais, têm sido indicadas, com vistas em reabilitar essas áreas. A eficiência e a diversidade de grupos-chave de bactérias, como as que nodulam leguminosas e fixam N2 (BNLFN, são de extrema importância, uma vez que estas participam de processos de ciclagem de nutrientes e contribuem para a sustentabilidade dessas áreas. Com o objetivo de avaliar a eficiência e a diversidade de BNLFN, coletaram-se amostras de solo de áreas mineradas, sob diferentes estratégias e cronosseqüências de reabilitação, no verão de 1999, para instalação de ensaios, empregando feijoeiro e caupi como espécies de plantas-isca de BNLFN. Na floração, coletaram-se as plantas e avaliaram-se matéria seca da parte aérea, número, matéria fresca e atividade de nódulos. Não houve influência das diferentes estratégias de reabilitação na eficiência das populações de BNLFN no crescimento do feijoeiro. A diversidade fenotípica dos isolados de BNLFN foi avaliada por meio das características culturais destes em meio de cultivo 79. Após a caracterização fenotípica de 328 isolados de feijoeiro e 420 de caupi, verificou-se que este é mais indicado que o feijoeiro nos estudos de nodulação, eficiência e diversidade de BNLFN. O impacto negativo da mineração é maior na diversidade fenotípica cultural de BNLFN do que na nodulação das plantas-isca utilizadas. A revegetação contribuiu para aumentar a diversidade dessas bactérias em solos de áreas de mineração de bauxita, especialmente quando ocorreu a introdução de leguminosas.Mining activities promote severe environmental degradation in many parts of the world, and revegetation techniques with diverse plant species have been used for rehabilitation of these areas. Studies on the occurrence, efficiency and diversity of key microbial groups such

  4. Analysis of radiation-induced genome alterations in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    van der Vyver C

    2011-09-01

    Full Text Available Christell van der Vyver1, B Juan Vorster2, Karl J Kunert3, Christopher A Cullis41Institute for Plant Biotechnology, Department of Genetics, University of Stellenbosch, Stellenbosch, South Africa; 2Department of Plant Production and Soil Science, and 3Department of Plant Science, Forestry and Agricultural Biotechnology Institute, University of Pretoria, Pretoria, South Africa; 4Case Western Reserve University, Department of Biology, Cleveland, OH, USAAbstract: Seeds from an inbred Vigna unguiculata (cowpea cultivar were gamma-irradiated with a dose of 180 Gy in order to identify and characterize possible mutations. Three techniques, ie, random amplified polymorphic DNA, microsatellites, and representational difference analysis, were used to characterize possible DNA variation among the mutants and nonirradiated control plants both immediately after irradiation and in subsequent generations. A large portion of putative radiation-induced genome changes had significant similarities to chloroplast sequences. The frequency of mutation at three of these isolated polymorphic regions with chloroplast similarity was further determined by polymerase chain reaction screening using a large number of individual parental, M1, and M2 plants. Analysis of these sequences indicated that the rate at which various regions of the genome is mutated in irradiation experiments differs significantly and also that mutations have variable “repair” rates. Furthermore, regions of the nuclear DNA derived from the chloroplast genome are highly susceptible to modification by radiation treatment. Overall, data have provided detailed information on the effects of gamma irradiation on the cowpea genome and about the ability of the plant to repair these genome changes in subsequent plant generations.Keywords: mutation breeding, gamma radiation, genetic mutations, cowpea, representational difference analysis

  5. Effect of gamma radiation on seed germination and seedling vigour in cowpea [Vigna unguiculata (L.) Walp.

    International Nuclear Information System (INIS)

    Thimmaiah, S.K.; Mahadevu, P; Srinivasappa, K.N.; Shankara, A.N.

    1998-01-01

    Cowpea [Vigna unguiculata (L.) Walp.) is regarded as hardy and one of the important tropical legumes. The plants respond differently to mutagenic treatments. Ionizing radiations affect a wide range of physiological and biochemical activities of plants. The purpose of this paper is to report the effect of gamma radiation on seed germination and seedling vigour of two important cowpea varieties viz., KBC-1 and TVX-994-02E in M 1 generation under laboratory conditions. (author)

  6. Weed control in cowpea ( Vigna unguiculata (L) Walp) with ...

    African Journals Online (AJOL)

    Field experiments were conducted between 1994 and 1997 at the University of Ilorin Teaching and Research Farm, Ilorin (8o29`N; 4o35`E), in the southern Guinea savanna agro-ecological zone, to evaluate the efficacy of pre-emergence applications of two imidazolinone-based herbicide mixtures in cowpea (Vigna ...

  7. De novo transcriptomic analysis of cowpea (Vigna unguiculata L. Walp.) for genic SSR marker development.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Liu, Xiaoyan; Hu, Liangliang; Wang, Suhua; Cheng, Xuzhen

    2017-07-11

    Cowpea [Vigna unguiculata (L.) Walp.] is one of the most important legumes in tropical and semi-arid regions. However, there is relatively little genomic information available for genetic research on and breeding of cowpea. The objectives of this study were to analyse the cowpea transcriptome and develop genic molecular markers for future genetic studies of this genus. Approximately 54 million high-quality cDNA sequence reads were obtained from cowpea based on Illumina paired-end sequencing technology and were de novo assembled to generate 47,899 unigenes with an N50 length of 1534 bp. Sequence similarity analysis revealed 36,289 unigenes (75.8%) with significant similarity to known proteins in the non-redundant (Nr) protein database, 23,471 unigenes (49.0%) with BLAST hits in the Swiss-Prot database, and 20,654 unigenes (43.1%) with high similarity in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Further analysis identified 5560 simple sequence repeats (SSRs) as potential genic molecular markers. Validating a random set of 500 SSR markers yielded 54 polymorphic markers among 32 cowpea accessions. This transcriptomic analysis of cowpea provided a valuable set of genomic data for characterizing genes with important agronomic traits in Vigna unguiculata and a new set of genic SSR markers for further genetic studies and breeding in cowpea and related Vigna species.

  8. Infectividad y efectividad de rizobios aislados de Suelos de la Costa Caribe Colombiana en Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Jonathan Alberto Mendoza Labrador

    2014-07-01

    Full Text Available Título en español: Infectividad y efectividad de rizobios aislados de Suelos de la Costa Caribe Colombiana  en Vigna unguiculata Título en ingles: Infectivity and effectiveness of isolated rhizobia from colombian caribbean soils in Vigna unguiculata Título corto: Infectividad y efectividad de rizobios aislados de Suelos Resumen:  Es el primer estudio en Colombia que abarca una evaluación de rizobios nativos asociados a frijol Caupí (Vigna unguiculata L. Walp. en los departamentos del Cesar y la Guajira. En esta investigación, se demostró que la utilización de  aislamientos de rizobios nativos aislados a partir de  nódulos,  mejoraron el desarrollo del frijol Caupí  (Vigna unguiculata L. Walp., siendo estas bacterias más eficientes que los tratamientos químicos y absolutos (sin inóculo ni fertilización y que las cepas inducidas mejorando además, la fijación biológica de nitrógeno y la tasa fotosintética. Como aportes del estudio, se determinó que en condiciones de invernadero la fertilización biológica fue más eficiente que la química y que, de acuerdo a los resultados obtenidos de las diferentes variables agronómicas evaluadas, esto podría influir positivamente en los rendimientos nutricionales del cultivo, base alimentaria de los sistemas ganaderos de estas regiones del país y  fuente alimenticia  de la comunidad indígena y de bajos recursos económicos.  Palabras clave Nodulación, fijación Biológica de Nitrógeno, Fertilización, Tasa Fotosintética Abstract:  This is the first study in Colombia which covers an evaluation of native rhizobium associated to the Caupí bean   (Vigna unguiculata L. Walp. in the departaments of Cesar and Guajira. In this research it was demonstrated that the use of native rhizobium isolated from nodes, improved the development of the Caupí bean (Vigna unguiculata L. Walp., being this bacteria more efficient than the chemical and absolute treatments (without inoculum and

  9. Nodulação e produtividade de Vigna unguiculata (L. Walp. por cepas de rizóbio em Bom Jesus, PI Yield and nodulation of Vigna unguiculata (L. Walp. inoculated with rhizobia strains in Bom Jesus, PI

    Directory of Open Access Journals (Sweden)

    Elaine Martins Costa

    2011-03-01

    Full Text Available Objetivou-se avaliar a resposta de Vigna unguiculata (L. Walp. cv. "BR 17 Gurguéia" à inoculação com duas cepas isoladas de solos de mineração de bauxita em reabilitação: UFLA 3-164 e UFLA 3-155 e três cepas INPA 03 11B (BR 3301; UFLA 03 84 (BR 3302 e BR 3267 (SEMIA 6462, autorizadas pelo MAPA como inoculantes para a cultura do feijão-caupi. O experimento foi conduzido em campo na Universidade Federal do Piauí, Campus Professora Cinobelina Elvas, Bom Jesus, PI. Utilizou-se o delineamento experimental em blocos casualizados com sete tratamentos e com seis repetições, sendo cinco cepas citadas e dois controles não inoculados, um com N-mineral (70 kg ha-1 de N e outra sem N mineral. Foram avaliados a nodulação (número e massa seca de nódulos, o crescimento (massa seca da parte aérea, o rendimento de grãos e o teor e acúmulo de nitrogênio na parte aérea e nos grãos, além da eficiência relativa. A inoculação das sementes com as cepas de bactérias diazotróficas simbióticas resultou em rendimentos de grãos equivalente à testemunha adubada com nitrogênio mineral. A cepa em fase de teste, UFLA 3-155 apresentou rendimento de grãos igual à cepa recomendada INPA 03 11B (BR 3301, podendo também ser testada em outras regiões brasileiras. Entre as cepas aprovadas pelo MAPA a INPA 03 11B (BR 3301 apresentou a maior produção de grãos.It evaluates the effect of inoculation with two rhizobia strains isolated from soils under rehabilitation after bauxite mining: UFLA 3-164 and UFLA 3-155, compared to inoculation with strains INPA 03 11B (BR 3301; UFLA 03 84 (BR 3302 and BR 3267 (SEMIA 6462, officially authorized as inoculant to cowpea by MAPA, in Vigna unguiculata (L. Walp cv. "BR 17 Gurgueia". The experiment was carried out at the 'Universidade Federal do Piauí, Campus Professora Cinobelina Elvas, Bom Jesus, PI,' in a randomized block design, white seven treatments and six replications. Treatments were the five strains and

  10. First Report of Cowpea Mild Mottle Carlavirus on Yardlong Bean (Vigna unguiculata subsp. sesquipedalis in Venezuela

    Directory of Open Access Journals (Sweden)

    Edgloris Marys

    2012-12-01

    Full Text Available Yardlong bean (Vigna unguiculata subsp. sesquipedalis plants with virus-like systemic mottling and leaf distortion were observed in both experimental and commercial fields in Aragua State, Venezuela. Symptomatic leaves were shown to contain carlavirus-like particles. RT-PCR analysis with carlavirus-specific primers was positive in all tested samples. Nucleotide sequences of the obtained amplicons showed 84%–74% similarity to corresponding sequences of Cowpea mild mottle virus (CPMMV isolates deposited in the GenBank database. This is the first report of CPMMV in Venezuela and is thought to be the first report of CPMMV infecting yardlong bean.

  11. Genetic diversity and population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L.) Walp.] germplasm collection

    Science.gov (United States)

    Cowpea (Vigna unguiculata) is an important legume crop with diverse uses. The species is presently a minor crop, and evaluation of its genetic diversity has been very limited. In this study, a total of 200 genic and 100 genomic simple sequence repeat (SSR) markers were developed from cowpea unigene ...

  12. Transformation of Cowpea Vigna unguiculata Cells with an Antibiotic Resistance Gene Using a Ti-Plasmid-Derived Vector

    NARCIS (Netherlands)

    Hille, Jacques; Goldbach, Rob

    1986-01-01

    A chimaeric antibiotic resistance gene was transferred to cowpea (Vigna unguiculata), a member of the legume family. This transfer was established by inoculating cowpea leaf discs with an Agrobacterium tumefaciens strain harboring a Ti-plasmid-derived vector that contained two copies of a chimaeric

  13. Utilização da farinha de feijão-caupi (Vigna unguiculata L. Walp na elaboração de produtos de panificação Utilization of cowpea flour in the development of bakery products

    Directory of Open Access Journals (Sweden)

    Karoline de Macêdo Gonçalves Frota

    2010-05-01

    Full Text Available Este trabalho teve como objetivo enriquecer produtos de panificação do tipo biscoito e rocambole com farinha de feijão-caupi (FFC, avaliar sua aceitabilidade e composição química, incluindo o conteúdo dos minerais (ferro, zinco, magnésio, potássio e fósforo e das vitaminas (tiamina e piridoxina. Foram desenvolvidas três formulações de biscoito contendo 10, 20 e 30% FFC e duas formulações de rocambole contendo 10 e 20% FFC. Observou-se um aumento no teor protéico do biscoito 30% FFC e do rocambole 20% FFC e na quantidade de cinzas dos biscoitos 20 e 30% FFC e rocambole 20% FFC, quando comparados às formulações padrão. O teor dos minerais analisados e de piridoxina aumentou à medida que FFC foi adicionada, enquanto a concentração de tiamina aumentou somente no rocambole 20% FFC. O biscoito com 10% FFC apresentou maior aceitação (84,4%, dentre os biscoitos formulados com FFC, além disso, os rocamboles com 10 e 20% FFC tiveram boa aceitação (86,7 e 77,8%, respectivamente. Todas as formulações contendo FFC tiveram notas superiores a 6, mostrando que os produtos foram aceitos sensorialmente. Desta forma, a adição de FFC visando melhorar o valor nutritivo de formulações à base de cereais é viável.This work had as objective to enrich bakery products (biscuit and rocambole or Brazilian roll with cowpea flour (CF to analyze their acceptability and chemical composition including mineral contents (iron, zinc, magnesium, potassium, and phosphorus and vitamins (thiamine and pyridoxine. Three formulations of biscuits containing 10, 20, and 30% CF and two formulations of Brazilian rolls with 10 and 20% CF were developed. It was observed an increase in the protein contents of the 30% CF biscuits and 20% CF Brazilian roll, as well as in the ash value of 20 and 30% CF biscuits and 20% CF Brazilian roll, when compared to a standard formulation. The concentration of minerals and pyridoxine analyzed increased with the addition of

  14. Development of unigene-derived SSR markers in cowpea (Vigna unguiculata) and their transferability to other Vigna species.

    Science.gov (United States)

    Gupta, S K; Gopalakrishna, T

    2010-07-01

    Unigene sequences available in public databases provide a cost-effective and valuable source for the development of molecular markers. In this study, the identification and development of unigene-based SSR markers in cowpea (Vigna unguiculata (L.) Walp.) is presented. A total of 1071 SSRs were identified in 15 740 cowpea unigene sequences downloaded from the National Center for Biotechnology Information. The most frequent SSR motifs present in the unigenes were trinucleotides (59.7%), followed by dinucleotides (34.8%), pentanucleotides (4%), and tetranucleotides (1.5%). The copy number varied from 6 to 33 for dinucleotide, 5 to 29 for trinucleotide, 5 to 7 for tetranucleotide, and 4 to 6 for pentanucleotide repeats. Primer pairs were successfully designed for 803 SSR motifs and 102 SSR markers were finally characterized and validated. Putative function was assigned to 64.7% of the unigene SSR markers based on significant homology to reported proteins. About 31.7% of the SSRs were present in coding sequences and 68.3% in untranslated regions of the genes. About 87% of the SSRs located in the coding sequences were trinucleotide repeats. Allelic variation at 32 SSR loci produced 98 alleles in 20 cowpea genotypes. The polymorphic information content for the SSR markers varied from 0.10 to 0.83 with an average of 0.53. These unigene SSR markers showed a high rate of transferability (88%) across other Vigna species, thereby expanding their utility. Alignment of unigene sequences with soybean genomic sequences revealed the presence of introns in amplified products of some of the SSR markers. This study presents the distribution of SSRs in the expressed portion of the cowpea genome and is the first report of the development of functional unigene-based SSR markers in cowpea. These SSR markers would play an important role in molecular mapping, comparative genomics, and marker-assisted selection strategies in cowpea and other Vigna species.

  15. Improvement of the Chinese bean [Vigna Unguiculata (L.) Walp.], through radioinduced mutagenesis; Mejoramiento de Frijol Chino [Vigna Unguiculata (L.) Walp.], Mediante Mutagenesis Radioinducida

    Energy Technology Data Exchange (ETDEWEB)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Solis M, M. [Colegio Superior Agropecuario del Estado de Guerrero, Iguala (Mexico); Cervantes S, T. [Instituto de Recursos Geneticos y Productividad (Mexico); Cruz T, E. de la [ININ, Carretera Mexico-La Marquesa S/N, La Marquesa Ocoyoacac, Mexico. C.P. 52750 (Mexico)]. e-mail: csaegro@prodigy.net.mx

    2006-07-01

    The advances in the process of genetic improvement of the Chinese bean (Vigna Unguiculata (L.) are presented, high nutritious value that it is evaluating as alternative for marginal areas producers of the State of Guerrero. The method of improvement applied it is recurrent radiation, continued by selection cycles applying the method of progeny by plant. The applied radiation doses were 200 and 250 Gray. The established selection approaches are: resistant plants or tolerant to the plagues attack and illnesses, vigorous, with more height to the first sheath, of compact and certain growth, with short internodes, bigger number of sheaths by plant and of grains by sheath, bigger number of grain size, among others. The obtained results show that the dose that induces bigger variability and that it has propitiated the biggest quantity in possible mutants it is 200Gy. Precocious plants with more height to the first sheath, with certain growth as well as with bigger number and sheaths size have been detected. The selected plants have incorporated to an increment process by means of the progeny method by plant. (Author)

  16. Measurements of experimental precision for trials with cowpea (Vigna unguiculata L. Walp.) genotypes.

    Science.gov (United States)

    Teodoro, P E; Torres, F E; Santos, A D; Corrêa, A M; Nascimento, M; Barroso, L M A; Ceccon, G

    2016-05-09

    The aim of this study was to evaluate the suitability of statistics as experimental precision degree measures for trials with cowpea (Vigna unguiculata L. Walp.) genotypes. Cowpea genotype yields were evaluated in 29 trials conducted in Brazil between 2005 and 2012. The genotypes were evaluated with a randomized block design with four replications. Ten statistics that were estimated for each trial were compared using descriptive statistics, Pearson correlations, and path analysis. According to the class limits established, selective accuracy and F-test values for genotype, heritability, and the coefficient of determination adequately estimated the degree of experimental precision. Using these statistics, 86.21% of the trials had adequate experimental precision. Selective accuracy and the F-test values for genotype, heritability, and the coefficient of determination were directly related to each other, and were more suitable than the coefficient of variation and the least significant difference (by the Tukey test) to evaluate experimental precision in trials with cowpea genotypes.

  17. Programmed cell death during development of cowpea (Vigna unguiculata (L.) Walp.) seed coat.

    Science.gov (United States)

    Lima, Nathália Bastos; Trindade, Fernanda Gomes; da Cunha, Maura; Oliveira, Antônia Elenir Amâncio; Topping, Jennifer; Lindsey, Keith; Fernandes, Kátia Valevski Sales

    2015-04-01

    The seed coat develops primarily from maternal tissues and comprises multiple cell layers at maturity, providing a metabolically dynamic interface between the developing embryo and the environment during embryogenesis, dormancy and germination of seeds. Seed coat development involves dramatic cellular changes, and the aim of this research was to investigate the role of programmed cell death (PCD) events during the development of seed coats of cowpea [Vigna unguiculata (L.) Walp.]. We demonstrate that cells of the developing cowpea seed coats undergo a programme of autolytic cell death, detected as cellular morphological changes in nuclei, mitochondria, chloroplasts and vacuoles, DNA fragmentation and oligonucleosome accumulation in the cytoplasm, and loss of membrane viability. We show for the first time that classes 6 and 8 caspase-like enzymes are active during seed coat development, and that these activities may be compartmentalized by translocation between vacuoles and cytoplasm during PCD events. © 2014 John Wiley & Sons Ltd.

  18. PRODUCTION COMPONENTS OF Vigna unguiculata (L. Walp IRRIGATED WITH BRACKISH WATER UNDER DIFFERENT LEACHING FRACTIONS

    Directory of Open Access Journals (Sweden)

    JOSÉ FRANCISCO DE CARVALHO

    2016-01-01

    Full Text Available The objective of this work was to evaluate the production components of cowpea ( Vigna unguiculata L. Walp subjected to irrigation with brackish water and different leaching fractions. The experiment was conducted in a lysimeter system of the Department of Agricultural Engineering of the Federal Rural University of Pernambuco, Recife campus. The treatments, consisting of two water salinity levels (ECw (1.2 and 3.3 dS m - 1 and five leaching fractions (0, 5, 10, 15 and 20%, were evaluated using a completely randomized design in a 2x5 factorial arrangement with four replications. The variables evaluated were: number of pods per plant, 100 - grain weight, number of grains per pod, grain and shoot dry weight, grain yield and harvest index. The soil salinity increased with increasing salinity of the water used for irrigation, and reduced with increasing leaching fraction. The salinity of the water used for irrigation influenced only the variables number of pods per plant and grain yield. The estimated leaching fractions of 9.1% and 9.6% inhibited the damage caused by salinity on the number of pods per plant and grain yield, respectively. Therefore, the production of V. unguiculata irrigated with brackish water, leaching salts from the plant root environment, is possible under the conditions evaluated.

  19. Vigna unguiculata

    African Journals Online (AJOL)

    VIC

    2012-12-07

    Dec 7, 2012 ... Processing of raw meat into products does not only add value and extend the shelf life of meat ... The research was conducted at the Meat Processing Unit and Laboratories of the. University for ... oven (Turbofan, Blue seal, UK). .... therefore likely to reduce the sensory characteristics of food products [23].

  20. Vigna unguiculata

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-08

    Jul 8, 2015 ... significant economic importance worldwide with high protein and mineral ... Therefore, the rapid spread of this parasitic weed to new regions would constitute a severe threat to cowpea .... way to develop stable and durable Striga resistant cultivars. .... before reaching reproductive stage due to severe attack.

  1. Assembled genomic and tissue-specific transcriptomic data resources for two genetically distinct lines of Cowpea ( Vigna unguiculata (L.) Walp).

    Science.gov (United States)

    Spriggs, Andrew; Henderson, Steven T; Hand, Melanie L; Johnson, Susan D; Taylor, Jennifer M; Koltunow, Anna

    2018-02-09

    Cowpea ( Vigna unguiculata (L.) Walp) is an important legume crop for food security in areas of low-input and smallholder farming throughout Africa and Asia. Genetic improvements are required to increase yield and resilience to biotic and abiotic stress and to enhance cowpea crop performance. An integrated cowpea genomic and gene expression data resource has the potential to greatly accelerate breeding and the delivery of novel genetic traits for cowpea. Extensive genomic resources for cowpea have been absent from the public domain; however, a recent early release reference genome for IT97K-499-35 ( Vigna unguiculata  v1.0, NSF, UCR, USAID, DOE-JGI, http://phytozome.jgi.doe.gov/) has now been established in a collaboration between the Joint Genome Institute (JGI) and University California (UC) Riverside. Here we release supporting genomic and transcriptomic data for IT97K-499-35 and a second transformable cowpea variety, IT86D-1010. The transcriptome resource includes six tissue-specific datasets for each variety, with particular emphasis on reproductive tissues that extend and support the V. unguiculata v1.0 reference. Annotations have been included in our resource to allow direct mapping to the v1.0 cowpea reference. Access to this resource provided here is supported by raw and assembled data downloads.

  2. A SNP and SSR Based Genetic Map of Asparagus Bean (Vigna. unguiculata ssp. sesquipedialis) and Comparison with the Broader Species

    Science.gov (United States)

    Xu, Pei; Wu, Xiaohua; Wang, Baogen; Liu, Yonghua; Ehlers, Jeffery D.; Close, Timothy J.; Roberts, Philip A.; Diop, Ndeye-Ndack; Qin, Dehui; Hu, Tingting; Lu, Zhongfu; Li, Guojing

    2011-01-01

    Asparagus bean (Vigna. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea [Vigna. unguiculata (L.) Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as ‘long beans’ or ‘asparagus beans’. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs), with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs) identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level. PMID:21253606

  3. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  4. Genetic diversity of Rhizobia isolates from Amazon soils using cowpea (Vigna unguiculata as trap plant

    Directory of Open Access Journals (Sweden)

    F.V. Silva

    2012-06-01

    Full Text Available The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium.

  5. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars ( Vigna unguiculata L. Walp)

    Science.gov (United States)

    Ocloo, F. C. K.; Darfour, B.; Ofosu, D. O.; Wilson, D. D.

    2012-01-01

    Cowpeas ( Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly ( p>0.05) affected by the radiation. There was no significant ( p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly ( p>0.05) the acceptability of the treated cowpea cultivars.

  6. Simultaneous selection for cowpea (Vigna unguiculata L.) genotypes with adaptability and yield stability using mixed models.

    Science.gov (United States)

    Torres, F E; Teodoro, P E; Rodrigues, E V; Santos, A; Corrêa, A M; Ceccon, G

    2016-04-29

    The aim of this study was to select erect cowpea (Vigna unguiculata L.) genotypes simultaneously for high adaptability, stability, and yield grain in Mato Grosso do Sul, Brazil using mixed models. We conducted six trials of different cowpea genotypes in 2005 and 2006 in Aquidauana, Chapadão do Sul, Dourados, and Primavera do Leste. The experimental design was randomized complete blocks with four replications and 20 genotypes. Genetic parameters were estimated by restricted maximum likelihood/best linear unbiased prediction, and selection was based on the harmonic mean of the relative performance of genetic values method using three strategies: selection based on the predicted breeding value, having considered the performance mean of the genotypes in all environments (no interaction effect); the performance in each environment (with an interaction effect); and the simultaneous selection for grain yield, stability, and adaptability. The MNC99542F-5 and MNC99-537F-4 genotypes could be grown in various environments, as they exhibited high grain yield, adaptability, and stability. The average heritability of the genotypes was moderate to high and the selective accuracy was 82%, indicating an excellent potential for selection.

  7. Distribution and Prevalence of Parasitic Nematodes of Cowpea (Vigna unguiculata) in Burkina Faso.

    Science.gov (United States)

    Sawadogo, A; Thio, B; Kiemde, S; Drabo, I; Dabire, C; Ouedraogo, J; Mullens, T R; Ehlers, J D; Roberts, P A

    2009-06-01

    A comprehensive survey of the plant parasitic nematodes associated with cowpea (Vigna unguiculata) production fields was carried out in the three primary agro-climatic zones of Burkina Faso in West Africa. Across the three zones, a total of 109 samples were collected from the farms of 32 villages to provide a representative coverage of the cowpea production areas. Samples of rhizosphere soil and samples of roots from actively growing cowpea plants were collected during mid- to late-season. Twelve plant-parasitic nematode genera were identified, of which six appeared to have significant parasitic potential on cowpea based on their frequency and abundance. These included Helicotylenchus, Meloidogyne, Pratylenchus, Scutellonema, Telotylenchus, and Tylenchorhynchus. Criconemella and Rotylenchulus also had significant levels of abundance and frequency, respectively. Of the primary genera, Meloidogyne, Pratylenchus, and Scutellonema contained species which are known or suspected to cause losses of cowpea yield in other parts of the world. According to the prevalence and distribution of these genera in Burkina Faso, their potential for damage to cowpea increased from the dry Sahelian semi-desert zone in the north (annual rainfall < 600 mm/year), through the north-central Soudanian zone (annual rainfall of 600-800 mm/year), to the wet Soudanian zone (annual rainfall ≥ 1000 mm) in the more humid south-western region of the country. This distribution trend was particularly apparent for the endoparasitic nematode Meloidogyne and the migratory endoparasite Pratylenchus.

  8. Prioritising in situ conservation of crop resources: a case study of African cowpea (Vigna unguiculata).

    Science.gov (United States)

    Moray, C; Game, E T; Maxted, N

    2014-06-17

    Conserving crop wild relatives (CWR) is critical for maintaining food security. However, CWR-focused conservation plans are lacking, and are often based on the entire genus, even though only a few taxa are useful for crop improvement. We used taxonomic and geographic prioritisation to identify the best locations for in situ conservation of the most important (priority) CWR, using African cowpea (Vigna unguiculata (L.) Walp.) as a case study. Cowpea is an important crop for subsistence farmers in sub-Saharan Africa, yet its CWR are under-collected, under-conserved and under-utilised in breeding. We identified the most efficient sites to focus in situ cowpea CWR conservation and assessed whether priority CWR would be adequately represented in a genus-based conservation plan. We also investigated whether priority cowpea CWR are likely to be found in existing conservation areas and in areas important for mammal conservation. The genus-based method captured most priority CWR, and the distributions of many priority CWR overlapped with established conservation reserves and targets. These results suggest that priority cowpea CWR can be conserved by building on conservation initiatives established for other species.

  9. Effect of gamma irradiation and cooking on cowpea bean grains ( Vigna unguiculata L. Walp)

    Science.gov (United States)

    Lima, Keila dos Santos Cople; Souza, Luciana Boher e.; Godoy, Ronoel Luiz de Oliveira; França, Tanos Celmar Costa; Lima, Antônio Luís dos Santos

    2011-09-01

    Leguminous plants are important sources of proteins, vitamins, carbohydrates, fibers and minerals. However, some of their non-nutritive elements can present undesirable side effects like flatulence provoked by the anaerobic fermentation of oligosaccharides, such as raffinose and stachyose, in the gut. A way to avoid this inconvenience, without any change in the nutritional value and post-harvesting losses, is an irradiation process. Here, we evaluated the effects of gamma irradiation on the amino acids, thiamine and oligosaccharide contents and on the fungi and their toxin percentages in cowpea bean ( Vigna unguiculata L. Walp) samples. For irradiation doses of 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 kGy the results showed no significant differences in content for the uncooked samples. However, the combination of irradiation and cooking processes reduced the non-nutritive factors responsible for flatulence. Irradiation also significantly reduced the presence of Aspergillus, Penicilium, Rhizopus and Fusarium fungi and was shown to be efficient in grain conservation for a storage time of 6 months.

  10. Diallelic analysis to obtain cowpea (Vigna unguiculata L. Walp.) populations tolerant to water deficit.

    Science.gov (United States)

    Rodrigues, E V; Damasceno-Silva, K J; Rocha, M M; Bastos, E A

    2016-05-13

    The purpose of this study was to identify parents and obtain segregating populations of cowpea (Vigna unguiculata L. Walp.) with the potential for tolerance to water deficit. A full diallel was performed with six cowpea genotypes, and two experiments were conducted in Teresina, PI, Brazil in 2011 to evaluate 30 F2 populations and their parents, one under water deficit and the other under full irrigation. A triple-lattice experimental design was used, with six 2-m-long rows in each plot. Sixteen plants were sampled per plot. The data were subjected to analysis of variance, and general and specific combining ability estimates were obtained based on the means. Additive effects were more important than non-additive effects, and maternal inheritance had occurred. The genotypes BRS Xiquexique, Pingo de Ouro-1-2, and MNC99-510F-16-1 were the most promising for use in selection programs aimed at water deficit tolerance. The hybrid combinations Pingo de Ouro-1-2 x BRS Xiquexique, BRS Xiquexique x Santo Inácio, CNCx 698-128G x MNC99-510F-16-1, Santo Inácio x CNCx 698-128G, MNC99-510F-16-1 x BRS Paraguaçu, MNC99- 510F-16-1 x Pingo de Ouro-1-2, and MNC99-510F-16-1 x BRS Xiquexique have the potential to increase grain production and tolerate water deficit.

  11. Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Lo, Sassoum; Muñoz-Amatriaín, María; Boukar, Ousmane; Herniter, Ira; Cisse, Ndiaga; Guo, Yi-Ning; Roberts, Philip A; Xu, Shizhong; Fatokun, Christian; Close, Timothy J

    2018-04-19

    Cowpea (Vigna unguiculata L. Walp) is a warm-season legume with a genetically diverse gene-pool composed of wild and cultivated forms. Cowpea domestication involved considerable phenotypic changes from the wild progenitor, including reduction of pod shattering, increased organ size, and changes in flowering time. Little is known about the genetic basis underlying these changes. In this study, 215 recombinant inbred lines derived from a cross between a cultivated and a wild cowpea accession were used to evaluate nine domestication-related traits (pod shattering, peduncle length, flower color, days to flowering, 100-seed weight, pod length, leaf length, leaf width and seed number per pod). A high-density genetic map containing 17,739 single nucleotide polymorphisms was constructed and used to identify 16 quantitative trait loci (QTL) for these nine traits. Based on annotations of the cowpea reference genome, genes within these regions are reported. Four regions with clusters of QTL were identified, including one on chromosome 8 related to increased organ size. This study provides new knowledge of the genomic regions controlling domestication-related traits in cowpea as well as candidate genes underlying those QTL. This information can help to exploit wild relatives in cowpea breeding programs.

  12. Active aggregation among sexes in bean flower thrips (Megalurothrips sjostedti) on cowpea (Vigna unguiculata).

    Science.gov (United States)

    Niassy, Saliou; Ekesi, Sunday; Maniania, Nguya K; Orindi, Benedict; Moritz, Gerald B; de Kogel, Willem J; Subramanian, Sevgan

    2016-01-01

    Male sexual aggregations are a common territorial, mating-related or resource-based, behaviour observed in diverse organisms, including insects such as thrips. The influence of factors such as plant substrate, time of day, and geographic location on aggregation of thrips is uncertain, therefore we monitored the dispersion of male and female bean flower thrips (BFT), Megalurothrips sjostedti (Trybom) (Thysanoptera: Thripidae), on cowpea, Vigna unguiculata (L.) Walp. (Fabaceae), over three cowpea growth stages and across three cowpea-growing areas of Kenya. Our results indicated that for all the crop growth stages, the density of BFTs varied over the time of day, with higher densities at 10:00, 13:00, and 16:00 hours than at 07:00 hours. Thrips densities did not differ among blocks at the budding stage, but they did at peak flowering and podding stages. Dispersion indices suggested that both male and female BFTs were aggregated. Active male aggregation occurred only on green plant parts and it varied across blocks, crop stages, and locations. Similarly, active female aggregation was observed in peak flowering and podding stages. Such active aggregation indicates a semiochemical or behaviour-mediated aggregation. Identification of such a semiochemical may offer new opportunities for refining monitoring and management strategies for BFT on cowpea, the most important grain legume in sub-Saharan Africa.

  13. Highly distinct chromosomal structures in cowpea (Vigna unguiculata), as revealed by molecular cytogenetic analysis.

    Science.gov (United States)

    Iwata-Otsubo, Aiko; Lin, Jer-Young; Gill, Navdeep; Jackson, Scott A

    2016-05-01

    Cowpea (Vigna unguiculata (L.) Walp) is an important legume, particularly in developing countries. However, little is known about its genome or chromosome structure. We used molecular cytogenetics to characterize the structure of pachytene chromosomes to advance our knowledge of chromosome and genome organization of cowpea. Our data showed that cowpea has highly distinct chromosomal structures that are cytologically visible as brightly DAPI-stained heterochromatic regions. Analysis of the repetitive fraction of the cowpea genome present at centromeric and pericentromeric regions confirmed that two retrotransposons are major components of pericentromeric regions and that a 455-bp tandem repeat is found at seven out of 11 centromere pairs in cowpea. These repeats likely evolved after the divergence of cowpea from common bean and form chromosomal structure unique to cowpea. The integration of cowpea genetic and physical chromosome maps reveals potential regions of suppressed recombination due to condensed heterochromatin and a lack of pairing in a few chromosomal termini. This study provides fundamental knowledge on cowpea chromosome structure and molecular cytogenetics tools for further chromosome studies.

  14. Sprouting characteristics and associated changes in nutritional composition of cowpea (Vigna unguiculata).

    Science.gov (United States)

    Devi, Chingakham Basanti; Kushwaha, Archana; Kumar, Anil

    2015-10-01

    Cowpea (Vigna unguiculata), is an important arid legume with a good source of energy, protein, vitamins, minerals and dietary fibre. Sprouting of legumes enhances the bioavailability and digestibility of nutrients and therefore plays an important role in human nutrition. Improved varieties of grain cowpea viz. Pant Lobia-1 (PL-1) and Pant Lobia-2 (PL-2) and Pant Lobia-3 (PL-3) were examined for sprouting characteristics and associated changes in nutritional quality. Soaking time, sprouting time and sprouting temperature combinations for desirable sprout length of ¼ to ½ inch for cowpea seed samples were standardized. All the observations were taken in triplicate except soaking time, where six observations were taken in a completely randomized design of three treatments. Results revealed that optimum soaking time of PL-1 and PL-2 seed was 3 h whereas PL-3 required 9 h. Sprouting period of 24 h at 25 °C was found to be desirable for obtaining good sprouts. Significant improvement in nutritional quality was observed after sprouting at 25 °C for 24 h; protein increased by 9-12 %, vitamin C increased by 4-38 times, phytic acid decreased by 4-16 times, trypsin inhibitor activity decreased by 28-55 % along with an increase of 8-20 % in in-vitro protein digestibility.

  15. Toxic effects of Pb2+ on growth of cowpea (Vigna unguiculata)

    International Nuclear Information System (INIS)

    Kopittke, Peter M.; Asher, Colin J.; Kopittke, Rosemary A.; Menzies, Neal W.

    2007-01-01

    A concentration as low as 1 μM lead (Pb) is highly toxic to plants, but previous studies have typically related plant growth to the total amount of Pb added to a solution. In the present experiment, the relative fresh mass of cowpea (Vigna unguiculata) was reduced by 10% at a Pb 2+ activity of 0.2 μM for the shoots and at a Pb 2+ activity of 0.06 μM for the roots. The primary site of Pb 2+ toxicity was the root, causing severe reductions in root growth, loss of apical dominance (shown by an increase in branching per unit root length), the formation of localized swellings behind the root tips (due to the initiation of lateral roots), and the bending of some root tips. In the root, Pb was found to accumulate primarily within the cell walls and intercellular spaces. - The Pb 2+ ion reduced the growth of cowpea by 10% at a solution activity of 0.2 μM for the shoots and 0.06 μM for the roots

  16. TRUE METABOLIZABLE ENERGY AND DIGESTIBILITY OF FIVE Vigna unguiculata VARIETIES IN CHICKENS

    Directory of Open Access Journals (Sweden)

    Luis Armando Sarmiento-Franco

    2010-11-01

    Full Text Available This study was carried out to evaluate the effect of heat-treatment on grain true metabolizable energy (TME, dry matter and gross energy digestibilities of five Vigna unguiculata varieties: H82, T782, TM97, C666 y XL. The grain of the former three varieties were heat-treated, and offered raw or cooked, whereas grain of the late two varieties were used only row, resulting in a total of eight treatments. The heat treatment consisted of watering the grains with boiling water for 30 minutes and drying at 60°C.  Forty-five Hubbard male chickens (2.1 ± 0.2 kg housed in individual wire pens were used to evaluate the treatments. Five chickens from each treatment were fed 40 g of treated grain in mash form, using the force-feeding technique. Additionally, five fasted chickens were used to calculate the endogenous energy and DM losses. The data were submitted to an analysis of variance according to the randomized statistical model; to evaluate the effect of heat treatment orthogonal contrasts were performed. There were no significant differences in all the variables neither among varieties nor between heat treatments (P>0.05. TME values in this study were similar to those found in the literature and equivalent to the TME value of soybean meal, a conventional feedstuff used in the poultry industry.

  17. Evaluation of ecophysiological characteristics of intercropping of millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    A. Ghanbari

    2016-04-01

    Full Text Available In order to evaluate millet (Panicum miliaceum L. and cowpea (Vigna unguiculata L. intercropping, an experiment was conducted during 2008-2009 at Agriculture Research Center of Zabol University, Iran. The experiment was as randomized complete block design with three replications. Treatment s consisted of sole crop of millet, sole crop of cowpea, 25% millet + 100% cowpea, 50% millet + 50% cowpea, 75% millet + 100% cowpea and 100% millet + 100% cowpea. The results showed that intercropping treatments had significant effect (P < 1% on millet and bean seed yield, LER, dry matter of weeds, PAR, temperature and (P < 5% on soil moisture content. The highest seed yield of millet and cowpea obtained from treatments of sole crops. The LER for most intercrops was greater than one which indicated that intercropping had advantage over sole crop. For weeds management and control the results indicated that weed suppressing effects in intercropping treatments is better than sole crops treatment, so that the lowest dry matter of weeds obtained from 100% millet + 100% cowpea treatment. PAR in all of stages showed that the highest PAR interception obtained from intercropping treatments specially 100% millet + 100% cowpea treatment. In addition to the lowest of soil moisture content and temperature obtained from this treatment.

  18. Improvement of the Chinese bean [Vigna Unguiculata (L.) Walp.], through radioinduced mutagenesis

    International Nuclear Information System (INIS)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Solis M, M.; Cervantes S, T.; Cruz T, E. de la

    2006-01-01

    The advances in the process of genetic improvement of the Chinese bean (Vigna Unguiculata (L.) are presented, high nutritious value that it is evaluating as alternative for marginal areas producers of the State of Guerrero. The method of improvement applied it is recurrent radiation, continued by selection cycles applying the method of progeny by plant. The applied radiation doses were 200 and 250 Gray. The established selection approaches are: resistant plants or tolerant to the plagues attack and illnesses, vigorous, with more height to the first sheath, of compact and certain growth, with short internodes, bigger number of sheaths by plant and of grains by sheath, bigger number of grain size, among others. The obtained results show that the dose that induces bigger variability and that it has propitiated the biggest quantity in possible mutants it is 200Gy. Precocious plants with more height to the first sheath, with certain growth as well as with bigger number and sheaths size have been detected. The selected plants have incorporated to an increment process by means of the progeny method by plant. (Author)

  19. A study on Maruca vitrata infestation of Yard-long beans (Vigna unguiculata subspecies sesquipedalis

    Directory of Open Access Journals (Sweden)

    R.C. Jayasinghe

    2015-09-01

    Full Text Available Globally, Maruca vitrata (Geyer is a serious yield constraint on food legumes including Yard-long bean (Vigna unguiculata subspecies sesquipedalis. However, there is a dearth of information on its damage potential, distribution and population dynamics in Yard-long beans. In the present study, the level of M. vitrata larval infestation on flowers and pods of Yard-long beans in Sri Lanka was determined with respect to three consecutive cropping seasons, Yala, Off and Maha. Results indicated that larval infestation and abundance varied with developmental stage of flowers and pods, cropping season and their combined interactive effects. Flowers of Yard-long beans were more prone to M. vitrata larval attack compared to pods. Abundance and level of infestation of M. vitrata varied with plant parts, having a ranking of flower buds (highest > open flowers > mature pods > immature pods (lowest. Peak infestation was observed six and eight weeks after planting on flowers and pods, respectively. Among the three cropping seasons, M. vitrata infestation was found to be higher during Maha and Off seasons compared to Yala. The findings of this study contribute to the identified knowledge gap regarding the field biology of an acknowledged important pest, M. vitrata, in a previously understudied crop in Sri Lanka.

  20. Toxic effects of low concentrations of Cu on nodulation of cowpea (Vigna unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Kopittke, Peter M. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia)]. E-mail: p.kopittke@uq.edu.au; Dart, Peter J. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia); Menzies, Neal W. [School of Land and Food Sciences, University of Queensland, St. Lucia, Qld 4072 (Australia)

    2007-01-15

    Although Cu is phytotoxic at Cu{sup 2+} activities as low as 1-2 {mu}M, the effect of Cu{sup 2+} on the nodulation of legumes has received little attention. The effect of Cu{sup 2+} on nodulation of cowpea (Vigna unguiculata (L.) Walp. cv. Caloona) was examined in a dilute solution culture system utilising a cation exchange resin to buffer solution Cu{sup 2+}. The nodulation process was more sensitive to increasing Cu{sup 2+} activities than both shoot and root growth; whilst a Cu{sup 2+} activity of 1.0 {mu}M corresponded to a 10% reduction in the relative yield of the shoots and roots, a Cu{sup 2+} activity of 0.2 {mu}M corresponded to a 10% reduction in nodulation. This reduction in nodulation with increasing Cu{sup 2+} activity was associated with an inhibition of root hair formation in treatments containing {>=}0.77 {mu}M Cu{sup 2+}, rather than to a reduction in the size of the Rhizobium population. - The nodulation process was more sensitive to increasing Cu{sup 2+} activities than either shoot or root growth.

  1. Cluster analysis technique for assessing variability in cowpea (Vigna unguiculata L. Walp accessions from Nigeria

    Directory of Open Access Journals (Sweden)

    Ajayi Abiola Toyin

    2013-01-01

    Full Text Available The genetic variability among 10 accessions of cowpea, Vigna unguiculata (L. Walp was studied by the use of 13 qualitative and 13 quantitative traits. From the results on qualitative traits, dendrogram grouped the 10 accessions into two major clusters, 1 and 2.Cluster 1 had 3 accessions and cluster 2 had 2 sub-clusters (I and II, having 2 accessions in sub-cluster I and 5 accessions in sub-cluster II. The dendrogram revealed two major clusters, 1 and 2, for quantitative data, for the 10 accessions. At distance of 4 and 6, cluster 1 had two sub-clusters (I and II, with sub-cluster I having 5 accessions, sub-cluster II having 4 accessions while cluster 2 had only 1 accession. This study made the observation that identification of the right agro-morphological traits of high discriminating capacity is essential, before embarking on any genetic diversity; as it was revealed that some traits discriminated more efficiently among the accessions than others. A group of accessions, which are NGSA1, NGSA2, NGSA3, NGSA4, NGSA7, NGSA9 and NGSA10, was identified as being different from the others for number of seeds per pod, pod length, plant height, peduncle length, seed weight and number of pods per plant. These accessions may be good for cowpea improvement programs.

  2. Effect of gamma irradiation and cooking on cowpea bean grains (Vigna unguiculata L. Walp)

    Energy Technology Data Exchange (ETDEWEB)

    Santos Cople Lima, Keila dos, E-mail: keila@ime.eb.br [Nuclear Engineering Department, Military Institute of Engineering, Rio de Janeiro/RJ, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil); Boher e Souza, Luciana [Nuclear Engineering Department, Military Institute of Engineering, Rio de Janeiro/RJ, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil); Oliveira Godoy, Ronoel Luiz de [Technological Center, Embrapa Food Agroindustry, Av. das Americas, 29501, CEP 23020-470 Rio de Janeiro/RJ (Brazil); Costa Franca, Tanos Celmar; Santos Lima, Antonio Luis dos [Chemical Engineering Department, Military Institute of Engineering, Praca General Tiburcio, 80, CEP 22290-270 Rio de Janeiro/RJ (Brazil)

    2011-09-15

    Leguminous plants are important sources of proteins, vitamins, carbohydrates, fibers and minerals. However, some of their non-nutritive elements can present undesirable side effects like flatulence provoked by the anaerobic fermentation of oligosaccharides, such as raffinose and stachyose, in the gut. A way to avoid this inconvenience, without any change in the nutritional value and post-harvesting losses, is an irradiation process. Here, we evaluated the effects of gamma irradiation on the amino acids, thiamine and oligosaccharide contents and on the fungi and their toxin percentages in cowpea bean (Vigna unguiculata L. Walp) samples. For irradiation doses of 0.0, 0.5, 1.0, 2.5, 5.0 and 10.0 kGy the results showed no significant differences in content for the uncooked samples. However, the combination of irradiation and cooking processes reduced the non-nutritive factors responsible for flatulence. Irradiation also significantly reduced the presence of Aspergillus, Penicilium, Rhizopus and Fusarium fungi and was shown to be efficient in grain conservation for a storage time of 6 months. - Highlights: > In this study we evaluated cowpea beans subjected to different doses of gamma irradiation > Cowpea bean grains represent an important source of vegetal protein for Brazilian population. > Non-nutritive factors were reduced by irradiation and cooking. > Several genera of fungus were reduced by irradiation without affecting the nutritional content. > Irradiation helps the cooking process preserving thermosensible nutrients.

  3. Toxic effects of Pb{sup 2+} on growth of cowpea (Vigna unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Kopittke, Peter M. [School of Land, Crop and Food Sciences and CRC for Contamination Assessment and Remediation of the Environment, University of Queensland, St. Lucia, Queensland 4072 (Australia)], E-mail: p.kopittke@uq.edu.au; Asher, Colin J. [School of Land, Crop and Food Sciences, University of Queensland, St. Lucia, Queensland 4072 (Australia); Kopittke, Rosemary A. [Department of Primary Industries and Fisheries, 80 Meiers Road, Indooroopilly, Queensland 4068 (Australia); Menzies, Neal W. [School of Land, Crop and Food Sciences and CRC for Contamination Assessment and Remediation of the Environment, University of Queensland, St. Lucia, Queensland 4072 (Australia)

    2007-11-15

    A concentration as low as 1 {mu}M lead (Pb) is highly toxic to plants, but previous studies have typically related plant growth to the total amount of Pb added to a solution. In the present experiment, the relative fresh mass of cowpea (Vigna unguiculata) was reduced by 10% at a Pb{sup 2+} activity of 0.2 {mu}M for the shoots and at a Pb{sup 2+} activity of 0.06 {mu}M for the roots. The primary site of Pb{sup 2+} toxicity was the root, causing severe reductions in root growth, loss of apical dominance (shown by an increase in branching per unit root length), the formation of localized swellings behind the root tips (due to the initiation of lateral roots), and the bending of some root tips. In the root, Pb was found to accumulate primarily within the cell walls and intercellular spaces. - The Pb{sup 2+} ion reduced the growth of cowpea by 10% at a solution activity of 0.2 {mu}M for the shoots and 0.06 {mu}M for the roots.

  4. Toxic effects of low concentrations of Cu on nodulation of cowpea (Vigna unguiculata)

    International Nuclear Information System (INIS)

    Kopittke, Peter M.; Dart, Peter J.; Menzies, Neal W.

    2007-01-01

    Although Cu is phytotoxic at Cu 2+ activities as low as 1-2 μM, the effect of Cu 2+ on the nodulation of legumes has received little attention. The effect of Cu 2+ on nodulation of cowpea (Vigna unguiculata (L.) Walp. cv. Caloona) was examined in a dilute solution culture system utilising a cation exchange resin to buffer solution Cu 2+ . The nodulation process was more sensitive to increasing Cu 2+ activities than both shoot and root growth; whilst a Cu 2+ activity of 1.0 μM corresponded to a 10% reduction in the relative yield of the shoots and roots, a Cu 2+ activity of 0.2 μM corresponded to a 10% reduction in nodulation. This reduction in nodulation with increasing Cu 2+ activity was associated with an inhibition of root hair formation in treatments containing ≥0.77 μM Cu 2+ , rather than to a reduction in the size of the Rhizobium population. - The nodulation process was more sensitive to increasing Cu 2+ activities than either shoot or root growth

  5. Effects of ozone on growth, net photosynthesis and yield of two African varieties of Vigna unguiculata.

    Science.gov (United States)

    Tetteh, Rashied; Yamaguchi, Masahiro; Wada, Yoshiharu; Funada, Ryo; Izuta, Takeshi

    2015-01-01

    To assess the effects of O(3)on growth, net photosynthesis and yield of two African varieties of cowpea(Vigna unguiculata L.), Blackeye and Asontem were exposed as potted plants to air that was either filtered to remove O(3) (FA), non-filtered air (NF), non-filtered with added O3 of approximately 50 nL L(-1) (ppb) from 11:00 to 16:00 (NF + O(3)) for 88 days in open-top chambers. The mean O(3) concentration (11:00-16:00) during the exposure period had a range from 16 ppb in the FA treatment to 118 ppb in the NF + O(3) treatment. Net photosynthetic rate and leaf area per plant were significantly reduced by exposure to O(3), reducing the growth of both varieties. Exposure to O(3) significantly reduced the 100-seed weight and number of seeds per pod. As a result, cowpea yield was significantly reduced by long-term exposure to O(3), with no difference in sensitivity between the varieties.

  6. Growth, photosynthesis, and antioxidant responses of Vigna unguiculata L. treated with hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Syed Aiman Hasan

    2016-12-01

    Full Text Available Cowpea (Vigna unguiculata L. is an important legume well grown in semiarid and arid environment. Hydrogen peroxide solutions (0.1, 0.5, 1.0, and 1.5 mM have been used to optimize growth and photosynthetic performance of cowpea plant at two growth stages [30 and 45 DAS (days of sowing]. Foliar application of H2O2 at 0.5 > 1.0 mM solution at 29 DAS optimally promoted the photosynthetic attributes [leaf chlorophyll content, net photosynthetic rate (PN, water use efficiency, and maximum quantum yield of PSII (Fv/Fm] and growth performance [root and shoot length; fresh and dry weight] of plants where the responses were more significant at the later growth stage. It was favored by activity of enzymes as carbonic anhydrase [CA; E.C. 4.2.1.1] and nitrate reductase [NR, E.C. 1.6.6.1] and those of antioxidant enzymes viz. peroxidase [POX; EC 1.11.1.7], catalase [CAT; EC 1.11.1.6], and superoxide dismutase [SOD; EC 1.15.1.1] and leaf proline content. Strengthened root system and antioxidant activity, particularly leaf proline level appeared to be the key factor for efficient photosynthesis and growth responses.

  7. Genotypic Variation in Phosphorus Use Efficiency for Symbiotic Nitrogen Fixation in Cowpea (Vigna Unguiculata)

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A. [LRI-SRA, Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Abdou, M. Malam [Laboratoire Banques de genes CERRA / KOLLO, Institut National de Recherche Agronomique du Niger (INRAN), Niamey (Niger); Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier (France)

    2013-11-15

    Cowpea (Vigna unguiculata L. Walp) is an important food legume. In Africa, it is mostly cultivated under such environmental constraints as drought and pest, and nutrient deficiency. In particular low soil phosphorus strongly limits crop production for the poor farmers with limited access to P fertilizers. Therefore breeding cowpea for the tolerance to P deficiency is considered as an alternative to increase the productivity of traditional cowpea-cereal cropping systems in soils with low P availability. This paper reports cowpea genotypic-variation in P use efficiency for symbiotic nitrogen fixation as a contribution to select tolerant cowpea lines under P deficiency. Eighty cowpea cultivars inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 were pre-screened as a single replicate under hydroaeroponic culture for 6 weeks under P deficiency versus P sufficiency, namely 15 vs 30 {mu}mol plant{sup -1} week{sup -1}. Large variability in nodule number per plant, and in shoot growth as a function of nodule mass, was observed among the diversity of cowpea lines. From this pre-screening experiment, the 40 cowpea lines showing the highest SNF-potential, i.e. high nodulation linked with high N{sub 2}-dependent growth under P sufficiency, and the most contrasting tolerance to P deficiency, i.e. highest vs lowest N{sub 2}-dependent growth under P deficiency, were grown again in glasshouse hydroaeroponics with 6 replicates. As an illustration of the most contrasting lines, the nodulation was decreased under P deficiency by less than 20% for IT82E-18 whereas by more than 80% for IT95K-1105-5 or SUVITA 2. The variations in nodulation were correlated with variations in growth with mean value of additional growth per unit increase in nodule biomass of 23 g shoot DW g-1 nodule DW under P sufficiency, showing 3 lines showing exceptionally high potential for symbiotic nitrogen fixation, versus 28 g shoot DW g{sup -1} nodule DW showing large variation among lines

  8. Population structure analysis and association mapping of seed antioxidant content in USDA cowpea (Vigna unguiculata L. Walp.) core collection using SNPs

    Science.gov (United States)

    Cowpea (Vigna unguiculata (L) Walp.) is an important legume and the antioxidants in cowpea seeds have been recognized as health-promoting compounds for human. The objectives of this study were to analyze the population structure of cowpea collections using single nucleotide polymorphism (SNP) and to...

  9. Alleviation of Cu and Pb rhizotoxicities in cowpea (Vigna unguiculata) as related to ion activities at root-cell plasma membrane surface

    Science.gov (United States)

    Cations, such as Ca and Mg, are generally thought to alleviate toxicities of trace metals through site-specific competition (as incorporated in the biotic ligand model, BLM). Short term (48 h) experiments were conducted using cowpea (Vigna unguiculata L. Walp.) seedlings in simple nutrient solution...

  10. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars (Vigna unguiculata L. Walp)

    International Nuclear Information System (INIS)

    Ocloo, F.C.K.; Darfour, B.; Ofosu, D.O.; Wilson, D.D.

    2012-01-01

    Cowpeas (Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly (p>0.05) affected by the radiation. There was no significant (p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p>0.05) the acceptability of the treated cowpea cultivars. - Highlights: → We investigated the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. → Four cowpea cultivars were irradiated at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. → Physical parameters were not significantly (p>0.05) affected by the radiation. → Sensory attributes considered were not significantly influenced by the radiation doses used.

  11. Effects of cowpea (Vigna unguiculata) root mucilage on microbial community response and capacity for phenanthrene remediation.

    Science.gov (United States)

    Sun, Ran; Belcher, Richard W; Liang, Jianqiang; Wang, Li; Thater, Brian; Crowley, David E; Wei, Gehong

    2015-07-01

    Biodegradation of polycyclic aromatic hydrocarbons (PAHs) is normally limited by their low solubility and poor bioavailability. Prior research suggests that biosurfactants are synthesized as intermediates during the production of mucilage at the root tip. To date the effects of mucilage on PAH degradation and microbial community response have not been directly examined. To address this question, our research compared 3 cowpea breeding lines (Vigna unguiculata) that differed in mucilage production for their effects on phenanthrene (PHE) degradation in soil. The High Performance Liquid Chromatography results indicated that the highest PHE degradation rate was achieved in soils planted with mucilage producing cowpea line C1, inoculated with Bradyrhizobium, leading to 91.6% PHE disappearance in 5 weeks. In root printing tests, strings treated with mucilage and bacteria produced larger clearing zones than those produced on mucilage treated strings with no bacteria or bacteria inoculated strings. Experiments with 14C-PHE and purified mucilage in soil slurry confirmed that the root mucilage significantly enhanced PHE mineralization (82.7%), which is 12% more than the control treatment without mucilage. The profiles of the PHE degraders generated by Denaturing gradient gel electrophoresis suggested that cowpea C1, producing a high amount of root mucilage, selectively enriched the PHE degrading bacteria population in rhizosphere. These findings indicate that root mucilage may play a significant role in enhancing PHE degradation and suggests that differences in mucilage production may be an important criterion for selection of the best plant species for use in phytoremediation of PAH contaminated soils. Copyright © 2015. Published by Elsevier B.V.

  12. A novel symbiovar (aegeanense) of the genus Ensifer nodulates Vigna unguiculata.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-10-01

    Cowpea (Vigna unguiculata) forms nitrogen-fixing root nodules with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium, although a few studies have reported the isolation of fast-growing rhizobia under laboratory and field conditions. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, very limited information is available on cowpea rhizobia in European soils. The aim of this study was to study the genetic and phenotypic diversity of indigenous cowpea-nodulating rhizobia in Greece. The genetic diversity of indigenous rhizobia associated with cowpea was investigated through a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into three groups. Based on the analysis of the 16S rRNA genes, IGS and on the concatenation of six housekeeping genes (recA, glnII, gyrB, truA, thrA and SMc00019), rhizobial isolates were classified within the species Ensifer fredii. However, symbiotic gene phylogenies, based on nodC, nifH and rhcRST genes, showed that the Ensifer isolates are markedly diverged from type and reference strains of E. fredii and formed one clearly separate cluster. The E. fredii strains were able to nodulate and fix nitrogen in cowpea but not in soybean and common bean. The present study showed that cowpea is nodulated under field conditions by fast-growing rhizobia belonging to the species E. fredii. Based on the phylogenies, similarity levels of symbiotic genes and the host range, the Ensifer isolates may constitute a new symbiovar for which the name 'aegeanense' is proposed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  13. Effects of irradiation on physical and sensory characteristics of cowpea seed cultivars (Vigna unguiculata L. Walp)

    Energy Technology Data Exchange (ETDEWEB)

    Ocloo, F.C.K., E-mail: fidelis_ocloo@yahoo.com [Radiation Technology Centre, Biotechnology and Nuclear Agriculture Research Institute, Ghana Atomic Energy Commission. P.O. Box LG 80, Legon (Ghana); Darfour, B.; Ofosu, D.O. [Radiation Technology Centre, Biotechnology and Nuclear Agriculture Research Institute, Ghana Atomic Energy Commission. P.O. Box LG 80, Legon (Ghana); Wilson, D.D. [Department of Zoology, University of Ghana, Legon (Ghana)

    2012-01-15

    Cowpeas (Vigna unguiculata L. Walp) are leguminous seeds widely produced and consumed in most developing countries of sub-Saharan Africa where they are a good source of affordable proteins, minerals and vitamins to the mainly carbohydrate-based diet of sub-Saharan Africa. At storage cowpea may be attacked by insects that cause severe damage to the seeds. The objective of this study was to investigate the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. Moisture content, thousand grain weight and bulk densities were determined as well as the amount of water absorbed during soaking and some sensory characteristics were equally determined. All the physical parameters studied were not significantly (p>0.05) affected by the radiation. There was no significant (p>0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p>0.05) the acceptability of the treated cowpea cultivars. - Highlights: > We investigated the effects of gamma irradiation on some physical and sensory characteristics of cowpea seed cultivars. > Four cowpea cultivars were irradiated at dose levels of 0.25, 0.50, 0.75, 1.0 and 1.5 kGy. > Physical parameters were not significantly (p>0.05) affected by the radiation. > Sensory attributes considered were not significantly influenced by the radiation doses used.

  14. Effect of Nitrogen Nutritional Stress on some Mineral Nutrients and Photosynthetic Apparatus of Zea mays L. and Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Akinbode Foluso OLOGUNDUDU

    2013-08-01

    Full Text Available The study investigated the responses of maize (Zea mays L. and cowpea (Vigna unguiculata L. Walp. seedlings metabolic activities and photosynthetic apparatus to nitrogen nutritional stress. Germination of seeds was done using treated sand in sixty plastic pots and the seedlings were divided into four nutrient regimes. A group of the seedlings was nutrient stressed by administering 200 ml of complete nutrient solution minus nitrogen (-N while the other groups were fed with five times (X5N and ten times (X10N the optimal concentration of nitrogen and the last regime was fed with full nutrient solution (FN. The photosynthetic parameters studied included chlorophylls ‘a’ and ‘b’ respectively; carotenes and xanthophyll while the mineral elements investigated include potassium, calcium and magnesium. The result of the growth analysis showed that nitrogen deficiency promotes an increase in the content of abscisic acid (ABA, causing stomatal closure and a reduction in photosynthesis. This explains the higher rate of leaf abscission in -N plants. A comparison of calcium ion and magnesium ion concentrations in both optimal and stressed conditions reveals that the two ions show antagonism in uptake. There is a correlation between nitrogen and magnesium accumulation as magnesium ion plays a vital role in chlorophyll biosynthesis, protein synthesis and photosynthesis. The pattern of accumulation of photosynthetic apparatus in both maize and cowpea follow a similar pattern. Chlorophyll a dictated the growth pattern of other photosynthetic apparatus in both Zea mays and Vigna unguiculata.

  15. Effect of Nitrogen Nutritional Stress on Some Growth Parameters of Zea mays L. and Vigna unguiculata (L. Walp.

    Directory of Open Access Journals (Sweden)

    Akinbode Foluso OLOGUNDUDU

    2013-02-01

    Full Text Available This study investigated the responses of maize (Zea mays L. and cowpea (Vigna unguiculata L. Walp. seedlings growth parameters to nitrogen nutritional stress. This was with a view to determining whether nitrogen nutritional stress would retard or enhance maize and cowpea growth, partly, wholly or not at all through its effect on biomass accumulation and some morphological parameters. Germination of seeds was done using treated sand in sixty plastic pots. A group of the seedlings was nutrient stressed by administering 200 ml of complete nutrient solution minus nitrogen (-N while the other groups were fed with five times (X5N and ten times (X10N the optimal concentration of nitrogen and the last regime was fed with full nutrient solution (FN. The effects of optimal concentration and nitrogen stress on the growth rates (as measured by their fresh and dry weight were studied. The result of the growth analysis showed that there was increase in shoot height with supraoptimal concentrations of nitrogen treatments (X10N and X5N while there was a decrease in shoot height with minus nitrogen (-N regimes. The observed higher biomass (dry matter yield under the FN regimes in both Zea mays and Vigna unguiculata were attributed to optimal nutrient assimilation rate.

  16. Association analysis of salt tolerance in cowpea (Vigna unguiculata (L.) Walp) at germination and seedling stages.

    Science.gov (United States)

    Ravelombola, Waltram; Shi, Ainong; Weng, Yuejin; Mou, Beiquan; Motes, Dennis; Clark, John; Chen, Pengyin; Srivastava, Vibha; Qin, Jun; Dong, Lingdi; Yang, Wei; Bhattarai, Gehendra; Sugihara, Yuichi

    2018-01-01

    This is the first report on association analysis of salt tolerance and identification of SNP markers associated with salt tolerance in cowpea. Cowpea (Vigna unguiculata (L.) Walp) is one of the most important cultivated legumes in Africa. The worldwide annual production in cowpea dry seed is 5.4 million metric tons. However, cowpea is unfavorably affected by salinity stress at germination and seedling stages, which is exacerbated by the effects of climate change. The lack of knowledge on the genetic underlying salt tolerance in cowpea limits the establishment of a breeding strategy for developing salt-tolerant cowpea cultivars. The objectives of this study were to conduct association mapping for salt tolerance at germination and seedling stages and to identify SNP markers associated with salt tolerance in cowpea. We analyzed the salt tolerance index of 116 and 155 cowpea accessions at germination and seedling stages, respectively. A total of 1049 SNPs postulated from genotyping-by-sequencing were used for association analysis. Population structure was inferred using Structure 2.3.4; K optimal was determined using Structure Harvester. TASSEL 5, GAPIT, and FarmCPU involving three models such as single marker regression, general linear model, and mixed linear model were used for the association study. Substantial variation in salt tolerance index for germination rate, plant height reduction, fresh and dry shoot biomass reduction, foliar leaf injury, and inhibition of the first trifoliate leaf was observed. The cowpea accessions were structured into two subpopulations. Three SNPs, Scaffold87490_622, Scaffold87490_630, and C35017374_128 were highly associated with salt tolerance at germination stage. Seven SNPs, Scaffold93827_270, Scaffold68489_600, Scaffold87490_633, Scaffold87490_640, Scaffold82042_3387, C35069468_1916, and Scaffold93942_1089 were found to be associated with salt tolerance at seedling stage. The SNP markers were consistent across the three models and

  17. A stakeless yard long bean cultivar derived from an interspecific cross between cowpea Vigna unguiculata L. (Walp) and yard long bean Vigna sesquipedalis L. (Verdc.)

    International Nuclear Information System (INIS)

    Luadthong, Sanit

    1990-01-01

    Full text: 'Yard long bean' is an important vegetable in the Thai diet, particularly in Northeast Thailand. However, growing 'yard long beans' requires stakes for supporting the twining stems and keeping the pod from touching the ground. Staking costs money, takes time and needs labour. An ideal cultivar would be a 'yard long bean' with erect plant type and under 80 cm in height that produces typical long bean pods and allows convenient picking during the harvest time. An attempt to breed such a cultivar was made by crossing cowpea Vigna unguiculata L. (Walp.) with' yard long bean' Vigna sesquipedalis L. (Verdc.) in 1984. This resulted in a new cultivar 'KKU 25'. This cultivar, having erect plant type, requires no staking for supporting the stem and produces long fresh pods with acceptable taste which can be harvested within 43 days. The average pod length is 48 cm, and pod diameter 1.43 cm. In a preliminary yield trial, an average fresh pod yield of 16 t/ha was obtained. (author)

  18. Effect of storage on the amino acid composition and biological quality of irradiated macacar beans Vigna unguiculata (L.) Walp

    International Nuclear Information System (INIS)

    Coelho, L.C.B.B.; de Medeiros, R.B.; Flores, H.

    1978-01-01

    The effects of two doses of gamma radiation (100 and 1,000 krad) upon the stability over a 6-month storage period of the amino acid composition and protein efficiency ratio (PER) of the macacar bean Vigna unguiculata (L.) Walp were investigated. No important differences were noted when the aminograms of irradiated and nonirradiated beans, either raw or cooked were compared. Nevertheless, the losses of lysine, arginine, and histidine due to cooking were greater in the irradiated beans. The PER of nonirradiated was higher than that of irradiated beans before and after the 6 months of storage, and was always lowest in the beans subjected to the higher dose of radiation. Qualitatively, an association was observed between the nutritional value (PER) and small decreases in the content of certain amino acids which resulted mainly from increased thermal lability of the irradiated bean protein

  19. Genetic variability in dinitrogen fixation between cowpea [Vigna unguiculata (L.) Walp] cultivars determined using the nitrogen-15 isotope dilution technique

    International Nuclear Information System (INIS)

    Ndiaye, M.A.F.; Spencer, M.M.; Gueye, M.

    2000-01-01

    N fixed in 16 cultivars of cowpea [Vigna unguiculata (L.) Walp] inoculated with effective Bradyrhizobium strains collected from the West African MIRCEN culture collection was measured by 15N isotope dilution technique. In all plant parts, significant differences in the percentage of N derived from the atmosphere (%Ndfa) and the amount of Ndfa occurred between the cultivars. Ndoute variety exhibited the highest %Ndfa (74.33% in shoots; 60.90% in roots) and accumulated more fixed N (960 mg N plant–1 and 38 mg N plant–1 in shoots and roots, respectively). Therefore this cultivar should be selected as the highest N-fixing cowpea cultivar. It also should be used in a breeding programme to contribute to the development of cultivars that could stimulate an intensive use of cowpea in many different cropping systems in Africa with a view to maintaining soil fertility. (Authors)

  20. Antioxidant Activity of the Extracts of Some Cowpea (Vigna unguiculata (L Walp. Cultivars Commonly Consumed in Pakistan

    Directory of Open Access Journals (Sweden)

    Vincenzo De Feo

    2013-02-01

    Full Text Available The present investigation has been carried out to determine the antioxidant activity of the methanolic extracts obtained from four cultivars of cowpea (Vigna unguiculata (L Walp. seeds. Phenolic compounds present in the extracts showed the antioxidant and antiradical properties when investigated using a linoleic acid peroxidation model, FRAP, ORAC and TRAP assays, as well as DPPH, hydroxyl, nitric oxide and superoxide radical scavenging activity. The HPLC analysis of the cowpea extracts showed the presence of neochlorogenic acid, chlorogenic acid and caffeic acids. The results indicated that methanolic extract of the cowpea resembled in the aforementioned activities those from other leguminous seeds and pulses. Phenolic constituents contained in cowpea may have a future role as ingredients in the development of functional foods.

  1. Effect of biologically treated petroleum sludge on seed germination and seedling growth of Vigna unguiculata (L. Walp. (Fabaceae

    Directory of Open Access Journals (Sweden)

    Jeyabalan Sangeetha

    2014-06-01

    Full Text Available The present investigation was carried out to study the response of different concentrations of treated petroleum sludge on seed germination, root and shoot length and tolerance of Vigna unguiculata (L. Walp. The biologically treated petroleum sludge with bacterial consortium showed 54.8% reduction in total petroleum hydrocarbons. Treated sludge was utilized with agricultural soil in known concentration for the assessment of growth of V. unguiculata. A remarkable absence of seed germination was observed at higher sludge concentration. The different concentrations of treated petroleum sludge showed severe decline on the length, weight and vigour index of the tested seedlings with increasing sludge concentrations. The results showed that the difference in rate of seed germination was significant among various concentrations. Under environmental stress condition, germination is the most critical phase of life cycle in crop plants. In this present study, the high oil content found to alter the osmotic relation between seed and water and thus reduce the amount of water absorbed. It was concluded that the concentration of nutrients and oil present in the treated sludge were toxic to the plant.

  2. Simple and rapid methods for purification and characterization of active coagulants from the seeds of Vigna unguiculata and Parkinsonia aculeata.

    Science.gov (United States)

    Marobhe, N J; Dalhammar, G; Gunaratna, K R

    2007-06-01

    The coagulating properties of aqueous crude extracts and purified proteins of Vigna unguiculata and Parkinsonia aculeata seeds, which are traditional water coagulants in rural areas of Tanzania, were studied. The coagulation activity assays were done using one millilitre (ml) of kaolin water samples. Coagulating proteins were purified in two-step ion exchange chromatography. The properties of coagulant protein were compared with Moringa oleifera. Coagulating components eluted by 0.6 M NaCl in both coagulants are cationic proteins that have the molecular mass of about 6 kDa, which is very similar to that of M. oleifera. The proteins of V. unguiculata and P. aculeata eluted by 0.3 M NaCl also harbour coagulation activity but proteins eluted with 0.6 M NaCl have higher activity. The dosage for coagulation using purified proteins of both coagulants is about 5 to 10 times lower than that of crude seed extracts. The optimum floc settling time of water treated by crude seed extracts and purified proteins ranged between two and two and half hours. Coagulating proteins of both coagulants eluted by 0.6 M NaCl are thermoresistant and retained coagulation activity of 87% to 92% after boiling for two hours at 80 degrees C and one hour at 95 degrees C. Thermotolerant proteins of V. unguiculata eluted by 0.6 M NaCl and P. aculeata have wider pH range of 5.5 to 8.5 for coagulation activity than those of M. oleifera proteins. The present investigation reveals the possibility of using purified natural coagulants for water treatment to produce safe drinking water.

  3. Characterisation and determination of virus resistance among cowpea [Vigna unguiculata (L.) Walp.] Genotypes

    International Nuclear Information System (INIS)

    Tettey, Carlos Kweku

    2017-07-01

    Several households in Ghana feed on cowpea [Vigna unguiculata (L.) Walp.] which serves as good source of protein. However, cowpea viral diseases and the lack of adaptable cultivars have become a limiting factor in cowpea production. This work therefore sought to explore morphogenetic diversity and viral resistance traits in cowpea germplasm to improve productivity. Thirty-eight exotic and local cowpea genotypes were cultivated at the Teaching and Research Field of the School of Agriculture, the University of Cape Coast. Two plants were maintained per stand at planting distance of 50 cm x 30 cm with three replications in a randomized complete block layout during the major (June – September) and minor seasons (November – February). The cowpea genotypes were characterised using both morphological and molecular methods to assess diversity in the coastal savanna agro-ecological zone of Ghana. They were also screened for resistance to cowpea viruses using visual scale on-field and DAS-ELISA protocol. The cowpeas showed significant (P < 0.05) variations in plant height, canopy diameter, number of branches, area of leaf, days to 50% flowering, days to pod maturity, pod length, number of seeds per pod and hundred seed weight. There were significant and positive correlations between pod weight and seed yield (r = 0.985, P < 0.05), plant height and canopy diameter (r = 0.576, P < 0.05), canopy diameter and number of branches (r = 0.576) as well as pod length and the number of seeds per pod (r = 0.530, P < 0.05). Hundred seed weight ranged from 10.03 g to 22.7 g. On the whole, 23 quantitative and qualitative parameters differentiated the cowpea genotypes into two main clusters with sub-clusters. Genomic analysis involving nine polymorphic SSR primers showed a mean genetic diversity of 0.7, polymorphic information content of 0.67 and allele frequency of 0.4 among the cowpea genotypes, which were differentiated into two main clusters with sub-clusters. Incidence and severity

  4. CGKB: an annotation knowledge base for cowpea (Vigna unguiculata L. methylation filtered genomic genespace sequences

    Directory of Open Access Journals (Sweden)

    Spraggins Thomas A

    2007-04-01

    Full Text Available Abstract Background Cowpea [Vigna unguiculata (L. Walp.] is one of the most important food and forage legumes in the semi-arid tropics because of its ability to tolerate drought and grow on poor soils. It is cultivated mostly by poor farmers in developing countries, with 80% of production taking place in the dry savannah of tropical West and Central Africa. Cowpea is largely an underexploited crop with relatively little genomic information available for use in applied plant breeding. The goal of the Cowpea Genomics Initiative (CGI, funded by the Kirkhouse Trust, a UK-based charitable organization, is to leverage modern molecular genetic tools for gene discovery and cowpea improvement. One aspect of the initiative is the sequencing of the gene-rich region of the cowpea genome (termed the genespace recovered using methylation filtration technology and providing annotation and analysis of the sequence data. Description CGKB, Cowpea Genespace/Genomics Knowledge Base, is an annotation knowledge base developed under the CGI. The database is based on information derived from 298,848 cowpea genespace sequences (GSS isolated by methylation filtering of genomic DNA. The CGKB consists of three knowledge bases: GSS annotation and comparative genomics knowledge base, GSS enzyme and metabolic pathway knowledge base, and GSS simple sequence repeats (SSRs knowledge base for molecular marker discovery. A homology-based approach was applied for annotations of the GSS, mainly using BLASTX against four public FASTA formatted protein databases (NCBI GenBank Proteins, UniProtKB-Swiss-Prot, UniprotKB-PIR (Protein Information Resource, and UniProtKB-TrEMBL. Comparative genome analysis was done by BLASTX searches of the cowpea GSS against four plant proteomes from Arabidopsis thaliana, Oryza sativa, Medicago truncatula, and Populus trichocarpa. The possible exons and introns on each cowpea GSS were predicted using the HMM-based Genscan gene predication program and the

  5. Improvement of the antioxidant and hypolipidaemic effects of cowpea flours (Vigna unguiculata) by fermentation: results of in vitro and in vivo experiments.

    Science.gov (United States)

    Kapravelou, Garyfallia; Martínez, Rosario; Andrade, Ana M; López Chaves, Carlos; López-Jurado, María; Aranda, Pilar; Arrebola, Francisco; Cañizares, Francisco J; Galisteo, Milagros; Porres, Jesús M

    2015-04-01

    The antioxidant capacity and hypolipidaemic effects of Vigna unguiculata, as well as their potential improvement by different fermentation and thermal processes were studied using in vitro and in vivo methods. Phenolic content and reducing capacity of legume acetone extract were significantly increased by different fermentation processes, and by the thermal treatment of fermented legume flours. TBARS inhibiting capacity was increased by fermentation but not by thermal treatment. A higher ability to decrease Cu(2+)/H2O2-induced electrophoretic mobility of LDL was found in fermented when compared to raw legume extracts, and a higher protective effect on short term metabolic status of HT-29 cells was found for raw and lactobacillus-fermented Vigna followed by naturally fermented Vigna extracts. Significant improvements in plasma antioxidant capacity and hepatic activity of antioxidant enzymes were observed in rats that consumed fermented legume flours when compared to the untreated legume or a casein-methionine control diet. In addition, liver weight and plasma levels of cholesterol and triglycerides were also positively affected by untreated or naturally fermented Vigna. V. unguiculata has demonstrated its potential as a functional food with interesting antioxidant and lipid lowering properties, which can be further augmented by fermentation processes associated or not to thermal processing. © 2014 Society of Chemical Industry.

  6. Phylogenetic multilocus sequence analysis of indigenous slow-growing rhizobia nodulating cowpea (Vigna unguiculata L.) in Greece.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-04-01

    Cowpea (Vigna unguiculata) is a promiscuous grain legume, capable of establishing efficient symbiosis with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, little is known about the genetic and symbiotic diversity of indigenous cowpea rhizobia in European soils. In the present study, the genetic and symbiotic diversity of indigenous rhizobia isolated from field-grown cowpea nodules in three geographically different Greek regions were studied. Forty-five authenticated strains were subjected to a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into seven groups and representative strains of each group were further analyzed. The analysis of the rrs gene showed that the strains belong to different species of the genus Bradyrhizobium. The analysis of the 16S-23S IGS region showed that the strains from each geographic region were characterized by distinct IGS types which may represent novel phylogenetic lineages, closely related to the type species of Bradyrhizobium pachyrhizi, Bradyrhizobium ferriligni and Bradyrhizobium liaoningense. MLSA analysis of three housekeeping genes (recA, glnII, and gyrB) showed the close relatedness of our strains with B. pachyrhizi PAC48 T and B. liaoningense USDA 3622 T and confirmed that the B. liaoningense-related isolate VUEP21 may constitute a novel species within Bradyrhizobium. Moreover, symbiotic gene phylogenies, based on nodC and nifH genes, showed that the B. pachyrhizi-related isolates belonged to symbiovar vignae, whereas the B. liaoningense-related isolates may represent a novel symbiovar. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Description du système racinaire de trois espèces fourragères en zone soudano-sahélienne: Andropogon gayanus, Vigna unguiculata et Stylosanthes hamata

    OpenAIRE

    Groot, J.J.R.; Traoré, M.; Koné, D.

    1998-01-01

    Description of root systems of three fodder crops in the Soudano-Sahelian area: Andropogon gayanus, Vigna unguiculata and Stylosanthes hamata. Root systems of fodder crops (Andropogon gayanus, Vigna unguiculata and Stylosanthes hamata) were studied at two Research Stations in Mali in 1992, using soil monoliths. In this method, roots are studied throughout the soil profile in cubical compartments of 1 dm3. Root biomass production of A. gayanus planted in 1951 was 4 t.ha-1 against 5 t.ha-1 ...

  8. Evaluating the freezing impact on the proximate composition of immature cowpea (Vigna unguiculata L.) pods: classical versus spectroscopic approaches.

    Science.gov (United States)

    Machado, Nelson; Oppolzer, David; Ramos, Ana; Ferreira, Luis; Rosa, Eduardo As; Rodrigues, Miguel; Domínguez-Perles, Raúl; Barros, Ana Irna

    2017-10-01

    Freezing represents a common conservation practice regarding vegetal foodstuffs. Since compositional features need to be monitored during storage, the development of rapid monitoring tools suitable for assessing nutritional characteristics arises as a pertinent issue. In this study, cowpea (Vigna unguiculata L.) pods, both fresh and after 6 and 9 months of freezing at -18 °C, were evaluated by high-performance liquid chromatography for their content of protein as well as of essential and nonessential amino acids, while their Fourier transform infrared spectra in the mid infrared (MIR) and near infrared (NIR) ranges were concomitantly registered to assess the feasibility of this approach for the traceability of these frozen matrices. For the NIR interval, the application of the 1st derivative to the spectral data retrieved the best results, while for lower concentrations the application of the Savitzky-Golay algorithm was indispensable to achieve quantification models for the amino acids. MIR is also suitable for this purpose, though being unable to quantify amino acids with concentrations below 0.07 mmol g -1 dry weight, irrespective of the data treatment used. The spectroscopic approach constitutes a methodology suitable for monitoring the impact of freezing on the nutritional properties of cowpea pods, allowing accurate quantification of the protein and amino acid contents, while NIR displayed better performance. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  9. A protein with amino acid sequence homology to bovine insulin is present in the legume Vigna unguiculata (cowpea

    Directory of Open Access Journals (Sweden)

    Venâncio T.M.

    2003-01-01

    Full Text Available Since the discovery of bovine insulin in plants, much effort has been devoted to the characterization of these proteins and elucidation of their functions. We report here the isolation of a protein with similar molecular mass and same amino acid sequence to bovine insulin from developing fruits of cowpea (Vigna unguiculata genotype Epace 10. Insulin was measured by ELISA using an anti-human insulin antibody and was detected both in empty pods and seed coats but not in the embryo. The highest concentrations (about 0.5 ng/µg of protein of the protein were detected in seed coats at 16 and 18 days after pollination, and the values were 1.6 to 4.0 times higher than those found for isolated pods tested on any day. N-terminal amino acid sequencing of insulin was performed on the protein purified by C4-HPLC. The significance of the presence of insulin in these plant tissues is not fully understood but we speculate that it may be involved in the transport of carbohydrate to the fruit.

  10. Combined Effects of Ozone and Drought on the Physiology and Membrane Lipids of Two Cowpea (Vigna unguiculata (L.) Walp) Cultivars.

    Science.gov (United States)

    Rebouças, Deborah Moura; De Sousa, Yuri Maia; Bagard, Matthieu; Costa, Jose Helio; Jolivet, Yves; De Melo, Dirce Fernandes; Repellin, Anne

    2017-03-03

    The interactive effects of drought and ozone on the physiology and leaf membrane lipid content, composition and metabolism of cowpea (Vigna unguiculata (L.) Walp.) were investigated in two cultivars (EPACE-1 and IT83-D) grown under controlled conditions. The drought treatment (three-week water deprivation) did not cause leaf injury but restricted growth through stomatal closure. In contrast, the short-term ozone treatment (130 ppb 12 h daily during 14 day) had a limited impact at the whole-plant level but caused leaf injury, hydrogen peroxide accumulation and galactolipid degradation. These effects were stronger in the IT83-D cultivar, which also showed specific ozone responses such as a higher digalactosyl-diacylglycerol (DGDG):monogalactosyldiacylglycerol (MGDG) ratio and the coordinated up-regulation of DGDG synthase (VuDGD2) and ω-3 fatty acid desaturase 8 (VuFAD8) genes, suggesting that membrane remodeling occurred under ozone stress in the sensitive cultivar. When stresses were combined, ozone did not modify the stomatal response to drought and the observed effects on whole-plant physiology were essentially the same as when drought was applied alone. Conversely, the drought-induced stomatal closure appeared to alleviate ozone effects through the reduction of ozone uptake.

  11. Using artificial neural networks to select upright cowpea (Vigna unguiculata) genotypes with high productivity and phenotypic stability.

    Science.gov (United States)

    Barroso, L M A; Teodoro, P E; Nascimento, M; Torres, F E; Nascimento, A C C; Azevedo, C F; Teixeira, F R F

    2016-11-03

    Cowpea (Vigna unguiculata) is grown in three Brazilian regions: the Midwest, North, and Northeast, and is consumed by people on low incomes. It is important to investigate the genotype x environment (GE) interaction to provide accurate recommendations for farmers. The aim of this study was to identify cowpea genotypes with high adaptability and phenotypic stability for growing in the Brazilian Cerrado, and to compare the use of artificial neural networks with the Eberhart and Russell (1966) method. Six trials with upright cowpea genotypes were conducted in 2005 and 2006 in the States of Mato Grosso do Sul and Mato Grosso. The data were subjected to adaptability and stability analysis by the Eberhart and Russell (1966) method and artificial neural networks. The genotypes MNC99-537F-4 and EVX91-2E-2 provided grain yields above the overall environment means, and exhibited high stability according to both methods. Genotype IT93K-93-10 was the most suitable for unfavorable environments. There was a high correlation between the results of both methods in terms of classifying the genotypes by their adaptability and stability. Therefore, this new approach would be effective in quantifying the GE interaction in upright cowpea breeding programs.

  12. NaCl Effects on In Vitro Germination and Growth of Some Senegalese Cowpea (Vigna unguiculata (L.) Walp.) Cultivars

    Science.gov (United States)

    Thiam, Mahamadou; Ourèye SY, Mame

    2013-01-01

    Cowpea (Vigna unguiculata (L.) Walp.) is one of the most important grain legumes in sub-Saharian regions. It contributes to man food security by providing a protein-rich diet. However, its production is limited by abiotic stresses such as salinity. This study aims to evaluate the salt tolerance of 15 cowpea cultivars, at germination stage. The seed germination process consisted of sowing them in agarified water (8 g·L−1) supplemented with 6 different concentrations of NaCl (0, 10, 50, 100, 150, and 200 mM). Results highlighted that high salt concentrations drastically reduced germination and significantly delayed the process for all varieties. A cowpea varietal effect towards the salt tolerance was noticed. Genotypes Diongoma, 58-78, and 58-191 were more salt-tolerant cultivars while Mougne and Yacine were more salt-sensitive ones as confirmed in the three groups of the dendrogram. NaCl effects on the early vegetative growth of seedlings were assessed with a tolerant (58-191) and a susceptible (Yacine) cultivar. Morphological (length and dry biomass) and physiological (chlorophyll and proline contents) parameter measurements revealed a negative effect of high (NaCl). However, 58-191 was much more salt tolerant, and the chlorophyll and proline contents were higher than those of Yacine genotype at increasing salt concentrations. PMID:25937976

  13. New observations on gametogenic development and reproductive experimental tools to support seed yield improvement in cowpea [Vigna unguiculata (L.) Walp].

    Science.gov (United States)

    Salinas-Gamboa, Rigel; Johnson, Susan D; Sánchez-León, Nidia; Koltunow, Anna M G; Vielle-Calzada, Jean-Philippe

    2016-06-01

    Cowpea reproductive tools. Vigna unguiculata L. Walp. (cowpea) is recognized as a major legume food crop in Africa, but seed yields remain low in most varieties adapted to local conditions. The development of hybrid cowpea seed that could be saved after each generation, enabling significant yield increases, will require manipulation of reproductive development from a sexual to an asexual mode. To develop new technologies that could support the biotechnological manipulation of reproductive development in cowpea, we examined gametogenesis and seed formation in two transformable, African-adapted, day-length-insensitive varieties. Here, we show that these two varieties exhibit distinct morphological and phenological traits but share a common developmental sequence in terms of ovule formation and gametogenesis. We present a reproductive calendar that allows prediction of male and female gametogenesis on the basis of sporophytic parameters related to floral bud size and reproductive organ development, determining that gametogenesis occurs more rapidly in the anther than in the ovule. We also show that the mode of megagametogenesis is of the Polygonum-type and not Oenothera-type, as previously reported. Finally, we developed a whole-mount immunolocalization protocol and applied it to detect meiotic proteins in the cowpea megaspore mother cell, opening opportunities for comparing the dynamics of protein localization during male and female meiosis, as well as other reproductive events in this emerging legume model system.

  14. Detection and validation of single feature polymorphisms in cowpea (Vigna unguiculata L. Walp using a soybean genome array

    Directory of Open Access Journals (Sweden)

    Wanamaker Steve

    2008-02-01

    Full Text Available Abstract Background Cowpea (Vigna unguiculata L. Walp is an important food and fodder legume of the semiarid tropics and subtropics worldwide, especially in sub-Saharan Africa. High density genetic linkage maps are needed for marker assisted breeding but are not available for cowpea. A single feature polymorphism (SFP is a microarray-based marker which can be used for high throughput genotyping and high density mapping. Results Here we report detection and validation of SFPs in cowpea using a readily available soybean (Glycine max genome array. Robustified projection pursuit (RPP was used for statistical analysis using RNA as a surrogate for DNA. Using a 15% outlying score cut-off, 1058 potential SFPs were enumerated between two parents of a recombinant inbred line (RIL population segregating for several important traits including drought tolerance, Fusarium and brown blotch resistance, grain size and photoperiod sensitivity. Sequencing of 25 putative polymorphism-containing amplicons yielded a SFP probe set validation rate of 68%. Conclusion We conclude that the Affymetrix soybean genome array is a satisfactory platform for identification of some 1000's of SFPs for cowpea. This study provides an example of extension of genomic resources from a well supported species to an orphan crop. Presumably, other legume systems are similarly tractable to SFP marker development using existing legume array resources.

  15. Seed yield and agronomic parameters of cowpea (Vigna ...

    African Journals Online (AJOL)

    Jane

    2011-10-12

    Oct 12, 2011 ... 1Department of Field Crops, Faculty of Agriculture, Bozok University, Sivas ... Key words: Vigna unguiculata, seed yield, thousand seed weight, Black Sea. INTRODUCTION. The cowpea (Vigna unguiculata L.) is an important.

  16. Genetic diversity and a population structure analysis of accessions in the Chinese cowpea [Vigna unguiculata (L. Walp.] germplasm collection

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    2017-10-01

    Full Text Available Cowpea (Vigna unguiculata is an important legume crop with diverse uses. The species is presently a minor crop, and evaluation of its genetic diversity has been very limited. In this study, a total of 200 genic and 100 genomic simple sequence repeat (SSR markers were developed from cowpea unigene and genome sequences, respectively. Among them, 27 genic and 27 genomic SSR markers were polymorphic and were used for assessment of genetic diversity and population structure in 105 selected cowpea accessions. A total of 155 alleles and 2.9 alleles per marker were identified, and the average polymorphic information content (PIC value was 0.3615. The average PIC of genomic SSRs (0.3996 was higher than that of genic SSRs (0.3235, and most of the polymorphic genomic SSRs were composed of di- and trinucleotide repeats (51.9% and 37.0% of all loci, respectively. The low level of detected genetic diversity may be attributed to a severe genetic bottleneck that occurred during the cowpea domestication process. The accessions were classified by structure and cluster analysis into four subgroups that correlated well with their geographic origins or collection sites. The classification results were also consistent with the results from principal coordinate analysis and can be used as a guide during future germplasm collection and selection of accessions as breeding materials for cultivar improvement. The newly developed genic and genomic SSR markers described in this study will be valuable genomic resources for the assessment of genetic diversity, population structure, evaluation of germplasm accessions, construction of genetic maps, identification of genes of interest, and application of marker-assisted selection in cowpea breeding programs.

  17. A compendium of transcription factor and Transcriptionally active protein coding gene families in cowpea (Vigna unguiculata L.).

    Science.gov (United States)

    Misra, Vikram A; Wang, Yu; Timko, Michael P

    2017-11-22

    Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed

  18. Diel pattern of circadian clock and storage protein gene expression in leaves and during seed filling in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Weiss, Julia; Terry, Marta I; Martos-Fuentes, Marina; Letourneux, Lisa; Ruiz-Hernández, Victoria; Fernández, Juan A; Egea-Cortines, Marcos

    2018-02-14

    Cowpea (Vigna unguiculata) is an important source of protein supply for animal and human nutrition. The major storage globulins VICILIN and LEGUMIN (LEG) are synthesized from several genes including LEGA, LEGB, LEGJ and CVC (CONVICILIN). The current hypothesis is that the plant circadian core clock genes are conserved in a wide array of species and that primary metabolism is to a large extent controlled by the plant circadian clock. Our aim was to investigate a possible link between gene expression of storage proteins and the circadian clock. We identified cowpea orthologues of the core clock genes VunLHY, VunTOC1, VunGI and VunELF3, the protein storage genes VunLEG, VunLEGJ, and VunCVC as well as nine candidate reference genes used in RT-PCR. ELONGATION FACTOR 1-A (ELF1A) resulted the most suitable reference gene. The clock genes VunELF3, VunGI, VunTOC1 and VunLHY showed a rhythmic expression profile in leaves with a typical evening/night and morning/midday phased expression. The diel patterns were not completely robust and only VungGI and VungELF3 retained a rhythmic pattern under free running conditions of darkness. Under field conditions, rhythmicity and phasing apparently faded during early pod and seed development and was regained in ripening pods for VunTOC1 and VunLHY. Mature seeds showed a rhythmic expression of VunGI resembling leaf tissue under controlled growth chamber conditions. Comparing time windows during developmental stages we found that VunCVC and VunLEG were significantly down regulated during the night in mature pods as compared to intermediate ripe pods, while changes in seeds were non-significant due to high variance. The rhythmic expression under field conditions was lost under growth chamber conditions. The core clock gene network is conserved in cowpea leaves showing a robust diel expression pattern except VunELF3 under growth chamber conditions. There appears to be a clock transcriptional reprogramming in pods and seeds compared to

  19. Performance of cowpea (Vigna unguiculata) and pearl millet (Pennisetum glaucum) intercropped under Parkia biglobosa in an agroforestry system in Burkina Faso

    DEFF Research Database (Denmark)

    Osman, Ahmed Nur; Ræbild, Anders; Christiansen, Jørgen Lindskrog

    2011-01-01

    In agroforestry systems, crop yields under trees are often low compared to outside. This study explored crop management under trees for improved production and income for farmers. Cowpea (Vigna unguiculata) and pearl millet (Pennisetum glaucum) sole and intercrops were grown under and outside...... the trees and intercrops flowered earlier than sole crops. Cowpea sole crops had significant grain yield losses of up to 21% under trees compared to outside, and pearl millet yield was reduced up to 67% under trees. Intercrop yields were less affected by growth under trees. LER was significantly higher...... under the trees than outside, and were always larger than unity indicating benefits of intercropping over sole cropping. Intercropping with two rows of cowpea and one row of millet gave significantly higher economic benefit than mixture with one row of each of the crops. Results indicate...

  20. Effect of extrusion conditions and lipoxygenase inactivation treatment on the physical and nutritional properties of corn/cowpea (Vigna unguiculata) blends.

    Science.gov (United States)

    Sosa-Moguel, Odri; Ruiz-Ruiz, Jorge; Martínez-Ayala, Alma; González, Rolando; Drago, Silvina; Betancur-Ancona, David; Chel-Guerrero, Luis

    2009-01-01

    The influence of lipoxygenase inactivation and extrusion cooking on the physical and nutritional properties of corn/cowpea (Vigna unguiculata) blends was studied. Corn was blended in an 80:15 proportion with cowpea flour treated to inactivate lipoxygenase (CI) or non-inactivated cowpea flour (CNI). Extrusion variables were temperature (150 degrees C, 165 degrees C and 180 degrees C) and moisture (15%, 17% and 19%). Based on their physical properties, the 165 degrees C/15% corn:CNI, and 165 degrees C/15% corn:CI, and 150 degrees C/15% corn:CI blends were chosen for nutritional quality analysis. Extrudate chemical composition indicated high crude protein levels compared with standard corn-based products. With the exception of lysine, essential amino acids content in the three treatments met FAO requirements. Extrusion and lipoxygenase inactivation are promising options for developing corn/cowpea extruded snack products with good physical properties and nutritional quality.

  1. Crescimento de genótipos de feijão caupi inoculados com rizóbio e irrigado com água salina

    Directory of Open Access Journals (Sweden)

    Jailma Ribeiro de Andrade

    2012-10-01

    Full Text Available O feijão-caupi (Vigna unguiculata conhecido popularmente como feijão-de-corda, feijão fradinho ou feijão-da-colônia é uma leguminosa alimentar muito importante por ser uma rica fonte de proteína. É cultivado predominantemente nas regiões Norte e Nordeste, principalmente por sua adaptação às condições edafoclimáticas, constituindo um importante recurso alimentar para a população. Devido à importância do feijão-caupi para os pequenos agricultores do nordeste objetivou-se neste trabalho analisar cinco cultivares (MNC01-649F-1-3, BRS-JURUÁ, MNC02-675F-4-9, MNC03-736F-7 e MNC02-684F-5-6 inoculadas com o rizóbio Br 3267 irrigadas com quatro níveis de salinidade (1,5; 3,0; 4,5 e 6,0 dS m-1, visando o seu reflexo no desenvolvimento da cultura. Dentre os genótipos estudados, o genótipo 2 BRS-JURUÁ se destacou em  todos os níveis de salinidade. A salinidade afeta a área foliar em feijão caupi.

  2. Effet comparé des poudres de Nicotiana tabacum L, Cymbopogon citratus (D.C. Stapf et de l'huile de Ricinus communis L sur la conservation des graines de Vigna unguiculata (L Walp

    Directory of Open Access Journals (Sweden)

    Gakuru, S.

    1995-01-01

    Full Text Available Compared Effect of Nicotiana tabacum L, Cymbopogon citratus (D.C. Stapf Powders and Castor Oil Ricinus communis L. on Conservation of Cowpea Vigna Unguiculata (L. Walp Grains. The effect of powder of tobacco Nicotiana tabacum L. and citronella grass Cymbopogon citratus (D.C. Stapf and castor oil Ricinus communis L. on conservation of cowpea Vigna unguiculata (L. Walp. grains was investigated in Kisangani, Zaire. After 5 months of conservation, infestation rates by bean weevil Acanthoscelides obtectus Say were 72.5 %, 74.5 %, 49.5 % and 5 % respectively for the check, the samples treated by 1 % of citronella grass and tobacco powder and 1 % of castor oil. The powder dose of 7.5 % did not give more interesting results.

  3. Influence du décalage du semis du niébé (Vigna unguiculata (L.) Walp) par rapport au maïs (Zea mays L.) sur la croissance et le rendement du niébé

    OpenAIRE

    Osiru, DSO.; Ocaya, CP.; Adipala, E.

    2002-01-01

    Effect of Time of Planting Cowpea (Vigna unguiculata (L.) Walp) Relative to Maize (Zea mays L.) on Growth and Yield of Cowpea. Field investigations were carried out for three seasons in two locations of Uganda to examine yield benefits when cowpea and maize are planted under intensive farming conditions. Additive mixtures of cowpea were planted into maize thrice at 2 weekly intervals together with sole crops. Time of introducing cowpea into maize significantly affected both the growth and yie...

  4. A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2017-09-01

    Full Text Available Cowpea [Vigna unguiculata (L. Walp.] is an annual legume of economic importance and widely grown in the semi-arid tropics. However, high-density genetic maps of cowpea are still lacking. Here, we identified 34,868 SNPs (single nucleotide polymorphisms that were distributed in the cowpea genome based on the RAD sequencing (restriction-site associated DNA sequencing technique using a population of 170 individuals (two cowpea parents and 168 F2:3 progenies. Of these, 17,996 reliable SNPs were allotted to 11 consensus linkage groups (LGs. The length of the genetic map was 1,194.25 cM in total with a mean distance of 0.066 cM/SNP marker locus. Using this map and the F2:3 population, combined with the CIM (composite interval mapping method, eleven quantitative trait loci (QTL of yield-related trait were detected on seven LGs (LG4, 5, 6, 7, 9, 10, and 11 in cowpea. These QTL explained 0.05–17.32% of the total phenotypic variation. Among these, four QTL were for pod length, four QTL for thousand-grain weight (TGW, two QTL for grain number per pod, and one QTL for carpopodium length. Our results will provide a foundation for understanding genes related to grain yield in the cowpea and genus Vigna.

  5. COWPEA (VIGNA UNGUICULATA)

    African Journals Online (AJOL)

    DR. AMINU

    The protein contents of the weaning food blends met ... Dietary Allowance (RDA) for infants (0 – 1 year), though the fat contents were ... foods along side breast milk as from four months, ... grams (100g) of the cleaned pearl millet (raw grain).

  6. Efectividad de cepas rizobianas nativas de sabana en Vigna unguiculata (L. Walp. cv. C4A-3

    Directory of Open Access Journals (Sweden)

    Juliana Mayz

    2010-07-01

    Full Text Available Título en inglés: Effectiveness of savannah native rhizobial strains in Vigna unguiculata (L. Walp. cv. C4A-3 Resumen Se estima que la población mundial se incrementará y demandará mayor cantidad de alimentos y uso de fertilizantes nitrogenados. En Venezuela, el frijol es altamente consumido y se cultiva en las sabanas orientales, cuyas características edáficas pueden afectar negativamente la población rizobiana. Estos planteamientos refuerzan la importancia de la evaluación de la flora rizobiana nativa, y enfatizan la necesidad de aumentar la explotación de la fijación biológica de nitrógeno. En este contexto, se evaluaron 6 cepas rizobianas en el cultivar C4A-3, aisladas, de frijol cv. Tejero Criollo y previamente catalogadas como efectivas (JV91, JV94 y JV101 e inefectivas (JV99, JV103, y JV104 en el cultivar TC9-6. El experimento se llevó a cabo en umbráculo por 45 días, donde además se incluyeron dos tratamientos control no inoculados. La suspensión de las cepas individualmente cultivadas se usó para inoculación. De acuerdo con la tipología de la nodulación (número de nódulos, peso total y por nódulo, tamaño y color, los valores de los parámetros de crecimiento (peso seco, altura y número de hojas del vástago y los estimados de la concentración de nitrógeno y nitrógeno total, las cepas JV91, JV99 y JV101, fueron las más efectivas en la fijación de nitrógeno. El nitrógeno total y la concentración de nitrógeno tuvieron una correlación significativa con peso seco, altura y número de hojas del vástago. Los resultados muestran la existencia de cepas efectivas en los suelos de sabana para este cultivar, y enfatizan la importancia de evaluar las cepas indígenas, antes de proceder a la inoculación con foráneas. Palabras clave: Rhizobium; frijol; fijación de nitrógeno; Venezuela. Abstract It is estimated that world-wide population will increase and demand higher amount of food and use of nitrogen

  7. Interferência de plantas daninhas na cultura do feijão-caupi Weed interference in cowpea

    Directory of Open Access Journals (Sweden)

    F.C.L. Freitas

    2009-06-01

    Full Text Available Objetivou-se com este trabalho determinar os períodos de interferência das plantas daninhas na cultura do feijão-caupi (Vigna unguiculata. A semeadura do feijão-caupi cultivar BR 16 foi realizada em julho de 2007, no sistema de plantio convencional. O delineamento experimental foi em blocos casualizados, com os tratamentos constituídos de períodos de controle ou convivência das plantas daninhas com a cultura. No primeiro grupo, a cultura permaneceu livre da interferência das plantas daninhas, por meio de capinas, nos períodos de: 0-09, 0-18, 0-27, 0-36, 0-45 e 0-60 (colheita. No segundo grupo, a cultura permaneceu sob a interferência desde a emergência até os mesmos períodos descritos anteriormente. O período crítico de prevenção à interferência (PCPI foi de 11 a 35 dias após a emergência da cultura. A interferência das plantas daninhas reduziu o estande final, o número de vagens por planta e o rendimento de grãos do feijão-caupi em até 90%.This work aimed to determine the periods of weed interference in cowpea (Vigna unguiculata, sown under the conventional system in July 2007. The experiment was arranged in randomized blocks, with the treatments consisting of periods of control or intercropping of the weeds with the crop. In the first group, the bean crop remained free of weed interference in the periods 0-09, 0-18, 0-27, 0-36, 0-45 and 0-60 (harvest. .In the second group, the bean crop remained under interference from the time of emergence up to the same periods previously described. The critical period of weed interference prevention (CPIP was from 11 to 35 days after crop emergence. Weed interference reduced the final stand, number of pods per plant, and grain yield up to 90%.

  8. Influence of Rhizobacterium Inoculation on NaCl Salinity Tolerance in Pusa Sukomal and RC101 Varieties of Cowpea (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Sadhna Chaturvedi

    2017-06-01

    Full Text Available Soil salinity is one of the most severe factors limiting growth and physiological response in cowpea plants. In the present study, the effect of rhizobacterium strains BR2 and BR3 on the growth of cowpea (Vigna unguiculata L. varieties—Pusa Sukomal and RC101—tolerance to 0, 25, 50, and 75 mM concentrations of NaCl salinity was evaluated. The rate of growth, in general, was high in plants irrigated with 25 mM NaCl saline water as compared to control, and thereafter, the growth reduced with increase in salinity concentrations. The results revealed that treating the seeds with rhizobacteria accompanied by NaCl salinity increased growth parameters of the cowpea plant as compared to the seeds irrigated with sodium chloride alone. Treatment with rhizobacteria mitigated the harmful effect of NaCl, and the growth was significantly better than the plants growing in saline water without rhizobacterium inoculation. The overall performance of Pusa Sukomal with BR3 strain was found to be better than the other combinations tested. Flowering in field plants started within 45 days of sowing, and the seeds in plants irrigated with saline water, in the presence of rhizobacterium, were found to be healthy as compared to control seeds. Seed protein profile was analyzed by SDS PAGE gel studies.

  9. Curbing the Growth of Wax Bean (Vigna unguiculata L. via a Novel Complex of Nano Zinc Oxide/Vermicompost

    Directory of Open Access Journals (Sweden)

    Farideh BEHBOUDI

    2016-12-01

    Full Text Available Vermicompost (VC samples were prepared from manure and spent mushroom compost (SMC and were impregnated with zinc oxide nanoparticles (ZnO NPs, giving ZnO NPs/VC complexes that were added into the soil in which wax beans (Vigna unguiculata L. were then planted. The study was carried out through a factorial experiment in a randomized complete block design with three factors. The experimental factors included: ZnO NPs (0, 0.4, 0.8 and 1.2 mg kg-1, two substrate types (cow manure and SMC and VC (2.5, 5 and 7.5 weight percentages. To the substrate types, adult earthworms (Eisenia fetida were added. Specifically, after three months, the prepared VC was soaked in ZnO NPs solutions, mixed with soil (according to cultivation substrate weight, then employed in wet plantation of wax beans. The obtained results showed that with increasing ZnO NPs, leaves’ chlorophyll, grains number per pod, stem length, hundred grains weight, grain yield, and the grain protein content significantly decreased. In general, the usage of these NPs in the applied amounts could curb the undesired growth of this species.

  10. Use of two varieties of hard-to-cook beans (Phaseolus vulgaris) and cowpeas (Vigna unguiculata) in the processing of koki (a steamed legume product).

    Science.gov (United States)

    Mbofung, C M; Rigby, N; Waldron, K

    1999-01-01

    Koki is a nutritious cowpea-based food product usually processed by steam cooking whipped cowpea (Vigna unguiculata) paste mixed with spices and palm oil. A study was carried out to investigate the effect of the partial replacement of cowpeas (CP) with hard-to-cook (HTC) beans on the chemical, nutritional and sensory characteristics of koki. Towards this objective, two varieties of beans--Phaseolus vulgaris (red kidney beans--RKB and mottled brown beans--MBB), each with the HTC defect, were separately incorporated into cowpea paste in the following Bean:CP ratios 0:100, 20:80, 30:70, 40:60, 50:50, 60:40 and processed into koki. Incorporation of dry HTC beans into cowpeas in the making of koki affected the bulking properties of the uncooked paste, the nutrient composition, essential amino acid content, antinutritional factors, digestibility as well as the sensory attributes of cooked koki. Sensory tests showed that a highly acceptable, nutritious and digestible koki can be processed from cowpeas partially replaced with dry HTC bean paste up to levels of about 40-50% depending on the variety of dry bean used.

  11. Biochemical studies of amylase, lipase and protease in Callosobruchus maculatus (Coleoptera: Chrysomelidae) populations fed with Vigna unguiculata grain cultivated with diazotrophic bacteria strains.

    Science.gov (United States)

    Silva, L B; Torres, É B; Nóbrega, R A S; Lopes, G N; Vogado, R F; Pavan, B E; Fernandes-Junior, P I

    2017-12-01

    The objective of this study was to evaluate the enzymatic activity of homogenates of insects fed on grain of cowpea, Vigna unguiculata (L.), cultivars grown with different nitrogen sources. For the experiment we used aliquots of the homogenate of 100 unsexed adult insects, emerged from 10 g of grain obtained from four cowpea cultivars: 'BRS Acauã', 'BRS Carijó', 'BRS Pujante', and 'BRS Tapaihum' grown under different regimes of nitrogen sources: mineral fertilizer, inoculation with strains of diazotrophs (BR 3267, BR 3262, BR 3299; INPA 03-11B, 03-84 UFLA, as well as the control (with soil nitrogen). The parameters evaluated were enzymatic activities of insect protease, amylase and lipase and the starch content of the grains. There were differences in the enzymatic activity of amylase, lipase and protease of insect homogenate according to the food source. A lower activity of the enzyme amylase from C. maculatus homogenate was observed when insects were fed grain of the cultivar BRS Carijó. A lower activity of lipase enzyme from C. maculatus homogenate was observed when the insects fed on grain from the interaction of the cultivar Tapaihum inoculated with BR 3262 diazotrophs. The lowest proteolytic activity was observed in homogenate of insects fed on interaction of 'BRS Carijó' inoculated with BR 3262 diazotrophs. Starch content correlated positively with the amylase activity of C. maculatus homogenate. The cultivar BRS Carijó had a different behavior from the other cultivars, according to the cluster analysis.

  12. Cowpea (Vigna unguiculata L. Walp), a renewed multipurpose crop for a more sustainable agri-food system: nutritional advantages and constraints.

    Science.gov (United States)

    Gonçalves, Alexandre; Goufo, Piebiep; Barros, Ana; Domínguez-Perles, Raúl; Trindade, Henrique; Rosa, Eduardo A S; Ferreira, Luis; Rodrigues, Miguel

    2016-07-01

    The growing awareness of the relevance of food composition for human health has increased the interest of the inclusion of high proportions of fruits and vegetables in diets. To reach the objective of more balanced diets, an increased consumption of legumes, which constitutes a sustainable source of essential nutrients, particularly low-cost protein, is of special relevance. However, the consumption of legumes also entails some constraints that need to be addressed to avoid a deleterious impact on consumers' wellbeing and health. The value of legumes as a source of nutrients depends on a plethora of factors, including genetic characteristics, agro-climatic conditions, and postharvest management that modulate the dietary effect of edible seeds and vegetative material. Thus, more comprehensive information regarding composition, especially their nutritional and anti-nutritional compounds, digestibility, and alternative processing procedures is essential. These were the challenges to write this review, which focusses on the nutritional and anti-nutritional composition of Vigna unguiculata L. Walp, an emerging crop all over the world intended to provide a rational support for the development of valuable foods and feeds of increased commercial value. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  13. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp) consumed in Brazil.

    Science.gov (United States)

    Pereira, Elenilda J; Carvalho, Lucia M J; Dellamora-Ortiz, Gisela M; Cardoso, Flávio S N; Carvalho, José L V

    2016-01-01

    The cowpea (Vigna unguiculata L. Wap.) is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  14. Use of ex vitro composite plants to study the interaction of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides

    Science.gov (United States)

    2012-01-01

    Background Cowpea (Vigna unguiculata L.) is an important grain and forage legume grown throughout sub-Saharan Africa primarily by subsistence farmers on poor, drought prone soils. Genetic improvement of the crop is being actively pursued and numerous functional genomics studies are underway aimed at characterizing gene controlling key agronomic characteristics for disease and pest resistances. Unfortunately, similar to other legumes, efficient plant transformation technology is a rate-limiting step in analysis of gene function in cowpea. Results Here we describe an optimized protocol for the rapid generation of transformed hairy roots on ex vitro composite plants of cowpea using Agrobacterium rhizogenes. We further demonstrate the applicability of cowpea composite plants to study gene expression involved in the resistance response of the plant roots to attack by the root parasitic weed, Striga gesnerioides. The utility of the new system and critical parameters of the method are described and discussed herein. Conclusions Cowpea composite plants offer a rapid alternative to methods requiring stable transformation and whole plant regeneration for studying gene expression in resistance or susceptibility responses to parasitic weeds. Their use can likely be readily adapted to look at the effects of both ectopic gene overexpression as well as gene knockdown of root associated defense responses and to the study of a broader range of root associated physiological and aphysiological processes including root growth and differentiation as well as interactions with other root pests, parasites, and symbionts. PMID:22741546

  15. A multi-parent advanced generation inter-cross (MAGIC) population for genetic analysis and improvement of cowpea (Vigna unguiculata L. Walp.).

    Science.gov (United States)

    Huynh, Bao-Lam; Ehlers, Jeffrey D; Huang, Bevan Emma; Muñoz-Amatriaín, María; Lonardi, Stefano; Santos, Jansen R P; Ndeve, Arsenio; Batieno, Benoit J; Boukar, Ousmane; Cisse, Ndiaga; Drabo, Issa; Fatokun, Christian; Kusi, Francis; Agyare, Richard Y; Guo, Yi-Ning; Herniter, Ira; Lo, Sassoum; Wanamaker, Steve I; Xu, Shizhong; Close, Timothy J; Roberts, Philip A

    2018-03-01

    Multi-parent advanced generation inter-cross (MAGIC) populations are an emerging type of resource for dissecting the genetic structure of traits and improving breeding populations. We developed a MAGIC population for cowpea (Vigna unguiculata L. Walp.) from eight founder parents. These founders were genetically diverse and carried many abiotic and biotic stress resistance, seed quality and agronomic traits relevant to cowpea improvement in the United States and sub-Saharan Africa, where cowpea is vitally important in the human diet and local economies. The eight parents were inter-crossed using structured matings to ensure that the population would have balanced representation from each parent, followed by single-seed descent, resulting in 305 F 8 recombinant inbred lines each carrying a mosaic of genome blocks contributed by all founders. This was confirmed by single nucleotide polymorphism genotyping with the Illumina Cowpea Consortium Array. These lines were on average 99.74% homozygous but also diverse in agronomic traits across environments. Quantitative trait loci (QTLs) were identified for several parental traits. Loci with major effects on photoperiod sensitivity and seed size were also verified by biparental genetic mapping. The recombination events were concentrated in telomeric regions. Due to its broad genetic base, this cowpea MAGIC population promises breakthroughs in genetic gain, QTL and gene discovery, enhancement of breeding populations and, for some lines, direct releases as new varieties. © 2018 The Authors. The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  16. A major QTL corresponding to the Rk locus for resistance to root-knot nematodes in cowpea (Vigna unguiculata L. Walp.).

    Science.gov (United States)

    Huynh, Bao-Lam; Matthews, William C; Ehlers, Jeffrey D; Lucas, Mitchell R; Santos, Jansen R P; Ndeve, Arsenio; Close, Timothy J; Roberts, Philip A

    2016-01-01

    Genome resolution of a major QTL associated with the Rk locus in cowpea for resistance to root-knot nematodes has significance for plant breeding programs and R gene characterization. Cowpea (Vigna unguiculata L. Walp.) is a susceptible host of root-knot nematodes (Meloidogyne spp.) (RKN), major plant-parasitic pests in global agriculture. To date, breeding for host resistance in cowpea has relied on phenotypic selection which requires time-consuming and expensive controlled infection assays. To facilitate marker-based selection, we aimed to identify and map quantitative trait loci (QTL) conferring the resistance trait. One recombinant inbred line (RIL) and two F2:3 populations, each derived from a cross between a susceptible and a resistant parent, were genotyped with genome-wide single nucleotide polymorphism (SNP) markers. The populations were screened in the field for root-galling symptoms and/or under growth-chamber conditions for nematode reproduction levels using M. incognita and M. javanica biotypes. One major QTL was mapped consistently on linkage group VuLG11 of each population. By genotyping additional cowpea lines and near-isogenic lines derived from conventional backcrossing, we confirmed that the detected QTL co-localized with the genome region associated with the Rk locus for RKN resistance that has been used in conventional breeding for many decades. This chromosomal location defined with flanking markers will be a valuable target in marker-assisted breeding and for positional cloning of genes controlling RKN resistance.

  17. Polyphenolic extracts from cowpea (Vigna unguiculata) protect colonic myofibroblasts (CCD18Co cells) from lipopolysaccharide (LPS)-induced inflammation--modulation of microRNA 126.

    Science.gov (United States)

    Ojwang, Leonnard O; Banerjee, Nivedita; Noratto, Giuliana D; Angel-Morales, Gabriela; Hachibamba, Twambo; Awika, Joseph M; Mertens-Talcott, Susanne U

    2015-01-01

    Cowpea (Vigna unguiculata) is a drought tolerant crop with several agronomic advantages over other legumes. This study evaluated varieties from four major cowpea phenotypes (black, red, light brown and white) containing different phenolic profiles for their anti-inflammatory property on non-malignant colonic myofibroblasts (CCD18Co) cells challenged with an endotoxin (lipopolysaccharide, LPS). Intracellular reactive oxygen species (ROS) assay on the LPS-stimulated cells revealed antioxidative potential of black and red cowpea varieties. Real-time qRT-PCR analysis in LPS-stimulated cells revealed down-regulation of proinflammatory cytokines (IL-8, TNF-α, VCAM-1), transcription factor NF-κB and modulation of microRNA-126 (specific post-transcriptional regulator of VCAM-1) by cowpea polyphenolics. The ability of cowpea polyphenols to modulate miR-126 signaling and its target gene VCAM-1 were studied in LPS-stimulated endothelial cells transfected with a specific inhibitor of miR-126, and treated with 10 mg GAE/L black cowpea extract where the extract in part reversed the effect of the miR-126 inhibitor. This suggests that cowpea may exert their anti-inflammatory activities at least in part through induction of miR-126 that then down-regulate VCAM-1 mRNA and protein expressions. Overall, Cowpea therefore is promising as an anti-inflammatory dietary component.

  18. Efetividade de rizóbios e caracterização fenotípica dos isolados que nodulam feijão-caupi em solos da Amazônia Central Effectiveness and phenotypic characterization of cowpea rhizobia isolated from central Amazonian soils

    Directory of Open Access Journals (Sweden)

    Aloísio Freitas Chagas Junior

    2009-09-01

    Full Text Available O feijão-caupi (Vigna unguiculata é uma cultura importante na Amazônia Central, mas os rizóbios associados a essa leguminosa são poucos estudados. O objetivo deste estudo foi avaliar a efetividade e caracterizar fenotipicamente os isolados de rizóbio que nodulam feijão-caupi na região. As populações de rizóbio de Novo Ayrão proporcionaram as maiores produções de matéria seca da parte aérea e total, raiz, número de nódulos e peso dos nódulos secos nas plantas de feijão-caupi; porém, não diferiram do tratamento testemunha com N. Com base nos critérios fenotípicos avaliados, foi possível identificar uma ampla diversidade de populações de rizóbios contidos nos solos da Amazônia.Cowpea (Vigna unguiculata is an important legume cultivated in central Amazonia, but its rhizobia have been little studied. The present study aimed to evaluate the effectiveness and to characterize phenotypically the population of indigenous rhizobia that infect cowpea in the region. The rhizobia population from Novo Ayrão soils provided the highest shoot, root and total dry matter yields, number of nodules and nodule dry weights in cowpea plants; however, they were not different from those found for the control treatment with N. Based on phenotypic criteria, it was possible to identify a wide diversity of populations of rhizobia contained in Amazonian soils.

  19. Influence de différents traitements de prégermination des graines de Vigna unguiculata (L. Walp. sur les performances germinatives et la tolérance au stress hydrique

    Directory of Open Access Journals (Sweden)

    Boucelha, L.

    2015-01-01

    Full Text Available Influence of different pre-germination treatments of Vigna unguiculata (L. Walp. seeds on germination performance and water stress tolerance. Description of the subject. Priming or hardening is a pregermination treatment. This treatment consists of incorporating an osmotic seed treatment (osmopriming or a hormonal (hormopriming and/or a redehydration (hydropriming treatment. The approach allows the elimination of dormancy, homogenization (synchronization of germination, better growth, earlier flowering and a tolerance to abiotic stresses such as drought and salinity. In this kind of treatment, the seed is soaked and then dehydrated before radicle breakthrough, i.e. during the reversible phase of germination. Thus, the seed can return to its initial stage without any damage. Objectives. In this paper, we aimed to study the consequences of hydropriming and osmopriming (by PEG6000 at 10 and 30% on cowpea seeds (Vigna unguiculata, on germination performance and on the water stress tolerance of plants from these seeds. Method. Vigna unguiculata seeds were hydroprimed, hydroprimed twice or osmoprimed (with PEG6000 10 and 30%. For each treatment, germination performance (germination capacity, speed and the water stress tolerance of the plants were studied. Results. Results showed that increased hardness of the seed allowed a faster, more uniform germination and better growth of both the radicle and aerial parts. We also demonstrated that a double redehydration was more effective in improving these parameters. Conclusions. Application of these pretreatments, adapted according to the plant species, will has the capacity to improve seed germination and crop yield, as well as tolerance to water deficit.

  20. Índice spad em feijão caupi inoculado com rizóbio e submetidos a diferentes níveis de salinidade

    Directory of Open Access Journals (Sweden)

    Jailma Ribeiro de Andrade

    2012-10-01

    Full Text Available O feijão-caupi (Vigna unguiculata também conhecido como feijão macassar ou feijão-de corda representa alimento básico para as populações de baixa renda do Nordeste brasileiro. Apresenta ciclo curto, baixa exigência hídrica e capacidade para fixar nitrogênio do ar, através de bactérias fixadoras, na forma de simbiose, que pode permitir o aumento do rendimento da cultura. Objetivou-se com esse trabalho comparar os níveis de clorofila nas folhas da cultivar BRS-JURUÁ através do uso do SPAD-512 (Soil Plant Analysis Development, inoculados com o rizóbio Br 3267. O experimento foi conduzido em casa de vegetação. Utilizou-se o delineamento inteiramente ao acaso, num fatorial 5x4(cinco genótipos de feijão caupi e quatro níveis de salinidade com 4 repetições. O melhor resultado encontrado em porcentagem de clorofila total (SPAD foi aos 7 dias após o desbaste no nível de 6,0 dSm-1.

  1. Fotossíntese e acúmulo de solutos em feijoeiro caupi submetido à salinidade

    Directory of Open Access Journals (Sweden)

    Rogéria Pereira Souza

    2011-06-01

    Full Text Available O objetivo deste trabalho foi determinar as respostas fotossintéticas e a acumulação de carboidratos, íons salinos e prolina em feijoeiro caupi (Vigna unguiculata submetido à salinidade. As plantas foram submetidas à quatro tratamentos, dos 28 aos 35 dias de idade: 0, 50, 100 e 200 mmol L-1 de NaCl. Avaliaramse as trocas gasosas, a emissão de fluorescência pela clorofila a, o potencial hídrico foliar, e as concentrações de carboidratos, Na+, Cl- e prolina nas folhas. Os tratamentos não tiveram efeito sobre a eficiência quântica potencial do fotossistema II, mas causaram leve diminuição na eficiência quântica efetiva e maior dissipação do excesso de energia de excitação por processos não fotoquímicos. As concentrações foliares de amido diminuíram, e as de sacarose e prolina aumentaram nas maiores concentrações de NaCl. Ocorreu exclusão do Na+ e acúmulo do Cl- nas folhas, e as relações hídricas das folhas foram pouco afetadas, exceto no tratamento mais severo. O acúmulo de Cl- esteve envolvido na redução da assimilação de CO2, decorrente da queda na condutância estomática e na eficiência de carboxilação da Rubisco. O feijoeiro caupi apresenta características fisiológicas que favorecem a manutenção da atividade fotossintética sob curta exposição à salinidade.

  2. Effect of different home-cooking methods on the bioaccessibility of zinc and iron in conventionally bred cowpea (Vigna unguiculata L. Walp consumed in Brazil

    Directory of Open Access Journals (Sweden)

    Elenilda J. Pereira

    2016-03-01

    Full Text Available Background: The cowpea (Vigna unguiculata L. Wap. is an excellent source of iron and zinc. However, iron from plant sources is poorly absorbed compared with iron from animal sources. Objectives: The objective of this study was to evaluate iron and zinc bioaccessibility in cowpea cultivars after processing. Methods: Zinc and iron bioaccessibilities in cowpea samples were determined based on an in vitro method involving simulated gastrointestinal digestion with suitable modifications. Results: When water-soaked beans were cooked in a regular pan, the highest percentage of bioaccessible iron obtained was 8.92%, whereas when they were cooked in a pressure cooker without previous soaking, the highest percentage was 44.33%. Also, the percentage of bioaccessible zinc was 52.78% when they were cooked in a regular pan without prior soaking. Higher percentages of bioaccessible iron were found when cooking was done in a pressure cooker compared with regular pan cooking. In all cultivars, cooking of cowpea beans in both pressure cooker and in a regular pan yielded higher percentages of bioaccessible zinc compared with availability of bioaccessible iron. Conclusions: Iron bioaccessibility values suggest that cooking in a regular pan did not have a good effect on iron availability, since the percentage of bioaccessible iron was lower than that of zinc. The determination of iron and zinc bioaccessibility makes it possible to find out the actual percentage of absorption of such minerals and allows the development of efficient strategies for low-income groups to access foods with high levels of these micronutrients.

  3. Gel-free/label-free proteomic, photosynthetic, and biochemical analysis of cowpea (Vigna unguiculata [L.] Walp.) resistance against Cowpea severe mosaic virus (CPSMV).

    Science.gov (United States)

    Varela, Anna Lidia N; Komatsu, Setsuko; Wang, Xin; Silva, Rodolpho G G; Souza, Pedro Filho N; Lobo, Ana Karla M; Vasconcelos, Ilka M; Silveira, Joaquim A G; Oliveira, Jose T A

    2017-06-23

    Cowpea severe mosaic virus (CPSMV) causes significant losses in cowpea (Vigna unguiculata) production. In this present study biochemical, physiological, and proteomic analysis were done to identify pathways and defense proteins that are altered during the incompatible interaction between the cowpea genotype BRS-Marataoã and CPSMV. The leaf protein extracts from mock- (MI) and CPSMV-inoculated plantlets (V) were evaluated at 2 and 6days post-inoculation (DPI). Data support the assumptions that increases in biochemical (high hydrogen peroxide, antioxidant enzymes, and secondary compounds) and physiological responses (high photosynthesis index and chlorophyll content), confirmed by label-free comparative proteomic approach, in which quantitative changes in proteasome proteins, proteins related to photosynthesis, redox homeostasis, regulation factors/RNA processing proteins were observed may be implicated in the resistance of BRS-Marataoã to CPSMV. This pioneering study provides information for the selection of specific pathways and proteins, altered in this incompatible relationship, which could be chosen as targets for detailed studies to advance our understanding of the molecular, physiological, and biochemistry basis of the resistance mechanism of cowpea and design approachs to engineer plants that are more productive. This is a pioneering study in which an incompatible relationship between a resistant cowpea and Cowpea severe mosaic virus (CPSMV) was conducted to comparatively evaluate proteomic profiles by Gel-free/label-free methodology and some physiological and biochemical parameters to shed light on how a resistant cowpea cultivar deals with the virus attack. Specific proteins and associated pathways were altered in the cowpea plants challenged with CPSMV and will contribute to our knowledge on the biological process tailored by cowpea in response to CPSMV. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Transcriptional profiling of root-knot nematode induced feeding sites in cowpea (Vigna unguiculata L. Walp. using a soybean genome array

    Directory of Open Access Journals (Sweden)

    Das Sayan

    2010-08-01

    Full Text Available Abstract Background The locus Rk confers resistance against several species of root-knot nematodes (Meloidogyne spp., RKN in cowpea (Vigna unguiculata. Based on histological and reactive oxygen species (ROS profiles, Rk confers a delayed but strong resistance mechanism without a hypersensitive reaction-mediated cell death process, which allows nematode development but blocks reproduction. Results Responses to M. incognita infection in roots of resistant genotype CB46 and a susceptible near-isogenic line (null-Rk were investigated using a soybean Affymetrix GeneChip expression array at 3 and 9 days post-inoculation (dpi. At 9 dpi 552 genes were differentially expressed in incompatible interactions (infected resistant tissue compared with non-infected resistant tissue and 1,060 genes were differentially expressed in compatible interactions (infected susceptible tissue compared with non-infected susceptible tissue. At 3 dpi the differentially expressed genes were 746 for the incompatible and 623 for the compatible interactions. When expression between infected resistant and susceptible genotypes was compared, 638 and 197 genes were differentially expressed at 9 and 3 dpi, respectively. Conclusions In comparing the differentially expressed genes in response to nematode infection, a greater number and proportion of genes were down-regulated in the resistant than in the susceptible genotype, whereas more genes were up-regulated in the susceptible than in the resistant genotype. Gene ontology based functional categorization revealed that the typical defense response was partially suppressed in resistant roots, even at 9 dpi, allowing nematode juvenile development. Differences in ROS concentrations, induction of toxins and other defense related genes seem to play a role in this unique resistance mechanism.

  5. Genome wide linkage disequilibrium in Chinese asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm: implications for domestication history and genome wide association studies.

    Science.gov (United States)

    Xu, P; Wu, X; Wang, B; Luo, J; Liu, Y; Ehlers, J D; Close, T J; Roberts, P A; Lu, Z; Wang, S; Li, G

    2012-07-01

    Association mapping of important traits of crop plants relies on first understanding the extent and patterns of linkage disequilibrium (LD) in the particular germplasm being investigated. We characterize here the genetic diversity, population structure and genome wide LD patterns in a set of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) germplasm from China. A diverse collection of 99 asparagus bean and normal cowpea accessions were genotyped with 1127 expressed sequence tag-derived single nucleotide polymorphism markers (SNPs). The proportion of polymorphic SNPs across the collection was relatively low (39%), with an average number of SNPs per locus of 1.33. Bayesian population structure analysis indicated two subdivisions within the collection sampled that generally represented the 'standard vegetable' type (subgroup SV) and the 'non-standard vegetable' type (subgroup NSV), respectively. Level of LD (r(2)) was higher and extent of LD persisted longer in subgroup SV than in subgroup NSV, whereas LD decayed rapidly (0-2 cM) in both subgroups. LD decay distance varied among chromosomes, with the longest (≈ 5 cM) five times longer than the shortest (≈ 1 cM). Partitioning of LD variance into within- and between-subgroup components coupled with comparative LD decay analysis suggested that linkage group 5, 7 and 10 may have undergone the most intensive epistatic selection toward traits favorable for vegetable use. This work provides a first population genetic insight into domestication history of asparagus bean and demonstrates the feasibility of mapping complex traits by genome wide association study in asparagus bean using a currently available cowpea SNPs marker platform.

  6. Sensitivity studies of the common bean (Vigna unguiculata) and maize (Zea mays) to different soil types from the crude oil drilling site at Kutchalli, Nigeria

    Energy Technology Data Exchange (ETDEWEB)

    Anoliefo, G.O. [Dept. of Botany, Univ. of Benin, Benin City (Nigeria); Isikhuemhen, O.S. [Dept. of Natural Resources and Environmental Design, NC Agricultural and Technical State Univ., Greensboro, NC (United States); Ohimain, E.I. [Rohi Biotechnologies Ltd., Port Harcourt (Nigeria)

    2006-02-15

    Background, aims and scope. The economic growth that Nigeria has enjoyed as a result of oil revenue has its drawback through exposure of people in the oil producing areas to environmental contamination, due largely to the increase in the movement of oil. Activities associated with oil well drilling on agricultural lands have led to serious economic losses on the communities affected. The local people in most of these communities are peasants who do not know how to react to drilling wastes or polluted fields where they have their crops. A case under study is the Kutchalli oil drilling area. Methods. Waste pit soil from drilling waste dumps in Kutchalli oil drilling area was tested whole and in combinations with 'clean' soil for their abilities to support plant growth and development in common bean (Vigna unguiculata) and maize (Zea mays). Seed germination, plant height, leaf area, biomass accumulation, respiratory activity as well as soil chemical analysis were used to access the ability of waste pit soil to support plant growth and development in the test plants. Results, discussion and conclusions. Waste pit soil completely inhibited the germination of bean and maize seeds. Waste pit soil in combinations with different proportions of Kutchalli soil gave growth (germination, height of plants, number of leaves, leaf area, etc.) values that were inferior to the control soil (Kutchalli) and the independent control soil (Monguno). Seeds planted in the test soil combinations containing waste pit soil showed significantly low respiratory activity. Waste pit soil seems to be toxic to plant growth and development. Drilling mud in combination with native Kutchalli soil significantly enhanced plant growth and development. Recommendations and outlook. The seed germination, growth and development inhibition by waste pit soil suggests its toxicity. We want to suggest the need for strict control and monitoring of waste pit soil in oil drilling sites. (orig.)

  7. CARACTERÍSTICAS DA SOLUBILIDADE PROTÉICA E ISOLAMENTO DA GLOBULINA PRINCIPAL DE CAUPÍ (Vigna unguiculata (L. Walp. CULTIVAR BR 14-MULATO

    Directory of Open Access Journals (Sweden)

    Valdir Augusto NEVES

    2009-07-01

    Full Text Available

    O objetivo do trabalho foi determinar a composição química, características de solubilidade das proteínas e o isolamento da globulina principal de caupí cultivar BR-14 Mulato. A farinha descorticada apresentou 29,32% de proteína, 3,59% de cinzas, 1,4% de extrato etéreo. A solubilidade das proteínas da farinha mostrou-se dependente das condições de extração, tais como: tipo e concentração de sal, tempo e pH. A extração fracionada e seqüencial das proteínas mostrou que 77,94% da proteína total foi solubilizada, a fração globulina com 41,99% do total, seguido da albumina 10,11% e glutelina 7,81%. A globulina principal isolada e submetida à cromatografia de filtração em gel mostrou um peso molecular de 174 kDa. Apresentou um elevado grau de homogeneidade na eletroforese em gel de poliacrilamida contendo dodecilsulfato de sódio, revelando ser constituída de cerca de 5 subunidades, com predomínio de duas majoritárias na faixa de 40 a 50 kDa e um teor de glícides de 1,10%. PALAVRAS-CHAVE: Caupí BR-14 MULATO; Vigna unguiculata; composição química; solubilidade; fracionamento.

  8. Preferência do pulgão-preto, Aphis craccivora Koch, a diferentes genótipos de feijão-de-corda, Vigna unguiculata (L. Walp Black aphid, Aphis craccivora Koch, preference to different cowpea, Vigna unguiculata (L. Walp. cultivars

    Directory of Open Access Journals (Sweden)

    João Gutemberg Leite Moraes

    2007-12-01

    Full Text Available Este trabalho foi desenvolvido visando a avaliar a resposta de cultivares de feijão-de-corda, Vigna unguiculata (L. Walp., à presença do pulgão-preto (Aphis craccivora Koch. Os experimentos foram conduzidos de agosto a outubro de 2004, em casa-de-vegetação da Universidade Federal do Ceará (UFC. As cultivares foram: "Epace-10", "Epace-11", "Patativa", "Pingo de Ouro", "Pitiúba", "BR-10 Piauí", "BR-12 Canindé", "BR-14 Mulato" e "BR-17 Gurguéia". O experimento constou de três ensaios, cada um com cinco tratamentos e seis repetições, sendo o delineamento estatístico inteiramente casualizado. Os genótipos foram cultivados em copos plásticos de 300ml e mantidos em gaiolas protegidas por tela antiafídeos. As plantas foram infestadas após doze dias do plantio através da liberação de cinco fêmeas adultas do pulgão-preto por planta. As avaliações foram realizadas após o terceiro e o quinto dia da infestação, constando da contagem direta das formas adulta e jovem do inseto presentes nas plantas. Os dados obtidos foram analisados através de análise de variância e pelo teste de Tukey em 5% de probabilidade de erro. As cultivares "Epace-10" e "Patativa" foram as menos preferidas por A. craccivora.This research was conducted with the intention of evaluating the response of different cowpea, Vigna unguiculata (L. Walp, cultivars to the black aphid (Aphis craccivora Koch. The bioassays were conducted from August through October of 2004 in a greenhouse at the Ceará Federal University (UFC campus. The cowpea cultivars used were: Epace-10, Epace-11, Patativa, Pingo de Ouro, Pitiúba, BR-10 Piauí, BR-12 Canindé, BR-14 Mulato and BR-17 Gurguéia. Each assay had five treatments and six replications in a completely randomized block design. The genotypes were raised in a 300ml plastic cup and maintained in cages protected by an insect proof net. Plants were infested twelve days after planting with five adult females per plant

  9. Assessment of genetic diversity in Vigna unguiculata L. (Walp) accessions using inter-simple sequence repeat (ISSR) and start codon targeted (SCoT) polymorphic markers.

    Science.gov (United States)

    Igwe, David Okeh; Afiukwa, Celestine Azubike; Ubi, Benjamin Ewa; Ogbu, Kenneth Idika; Ojuederie, Omena Bernard; Ude, George Nkem

    2017-11-17

    Assessment of genetic diversity of Vigna unguiculata (L.) Walp (cowpea) accessions using informative molecular markers is imperative for their genetic improvement and conservation. Use of efficacious molecular markers to obtain the required knowledge of the genetic diversity within the local and regional germplasm collections can enhance the overall effectiveness of cowpea improvement programs, hence, the comparative assessment of Inter-simple sequence repeat (ISSR) and Start codon targeted (SCoT) markers in genetic diversity of V. unguiculata accessions from different regions in Nigeria. Comparative analysis of the genetic diversity of eighteen accessions from different locations in Nigeria was investigated using ISSR and SCoT markers. DNA extraction was done using Zymogen Kit according to its manufacturer's instructions followed by amplifications with ISSR and SCoT and agarose gel electrophoresis. The reproducible bands were scored for analyses of dendrograms, principal component analysis, genetic diversity, allele frequency, polymorphic information content, and population structure. Both ISSR and SCoT markers resolved the accessions into five major clusters based on dendrogram and principal component analyses. Alleles of 32 and 52 were obtained with ISSR and SCoT, respectively. Numbers of alleles, gene diversity and polymorphic information content detected with ISSR were 9.4000, 0.7358 and 0.7192, while SCoT yielded 11.1667, 0.8158 and 0.8009, respectively. Polymorphic loci were 70 and 80 in ISSR and SCoT, respectively. Both markers produced high polymorphism (94.44-100%). The ranges of effective number of alleles (Ne) were 1.2887 ± 0.1797-1.7831 ± 0.2944 and 1.7416 ± 0.0776-1.9181 ± 0.2426 in ISSR and SCoT, respectively. The Nei's genetic diversity (H) ranged from 0.2112 ± 0.0600-0.4335 ± 0.1371 and 0.4111 ± 0.0226-0.4778 ± 0.1168 in ISSR and SCoT, respectively. Shannon's information index (I) from ISSR and SCoT were 0

  10. Effet du mode de conservation de l'huile de Jatropha curcas L. sur son efficacité dans la lutte contre les principaux insectes ravageurs du niébé (Vigna unguiculata (L. Walp. au Niger

    Directory of Open Access Journals (Sweden)

    Abdoul Habou, Z.

    2014-01-01

    Full Text Available Influence of the Conservation Mode of Jatropha curcas L. oil on its Efficacy in the Control of Major Insect Pests of Cowpea (Vigna unguiculata (L. Walp in Niger. Jatropha curcas oil has an insecticidal activity harnessed by the farmers in Niger. In this study, we compared the insecticidal activity of two batches of oil conserved during 70 days, one exposed to light and the other kept in the dark. The insecticidal efficacy was evaluated in a field with three concentrations (5, 10 and 15% trial on the main pests of Cowpea (Vigna unguiculata (L. Walp and in a laboratory test on Megalurothrips sjostedti Trybon (Thysanoptera: Thripidae with different concentrations of crude oil (50; 100; 150 and 200 µl. No difference in insecticidal effect was found between the two modes of oil conservation, both in the laboratory and in the field. In the field, regardless of the mode of conservation, the concentrations of 10% of J. curcas oil enables a reduction of over than 80% of thrips, aphids, and bugs compared to the control. Its increased seeds yield more than 50%. The concentration of 15% gives an insecticidal effect comparable to that of the reference treatment (deltaméthrine but induces phytotoxicity symptoms on the leaves of Cowpea.

  11. Escala diagramática para avaliação da severidade da cercosporiose em caupi Diagrammatic scale for assessment of Cercospora leaf spot severity in cowpea

    Directory of Open Access Journals (Sweden)

    Igor Corrêa Lima Albert

    2008-10-01

    Full Text Available A cercosporiose, causada por Cercospora cannescens e Pseudocercospora cruenta, é uma importante doença do caupi (Vigna unguiculata no Brasil. Devido à inexistência de métodos padronizados para quantificação dessa doença, foi desenvolvida uma escala diagramática com níveis de 1, 2, 4, 8, 16, 32, 64 e 82% de área foliar lesionada. A escala diagramática foi validada por 10 avaliadores, usando 50 folíolos de caupi com diferentes níveis de severidade, mensurados previamente com o programa Assess®. A acurácia, a precisão e a reprodutibilidade das estimativas de cada avaliador foi determinada por regressão linear simples entre a severidade real e a estimada, com e sem o auxílio da escala. Com a escala, os avaliadores obtiveram melhores níveis de acurácia e precisão das estimativas, com os erros absolutos concentrando-se na faixa de 10%. Os avaliadores apresentaram elevada repetibilidade (94% e reprodutibilidade (90% em 82,3% dos casos das estimativas com a utilização da escala. Portanto, a escala diagramática proposta é adequada para avaliação da severidade da cercosporiose do caupi.Cercospora leaf spot caused by Cercospora canescens and Pseudocercospora cruenta is an important disease of cowpea (Vigna unguiculata in Brazil. Due to the inexistence of standard methods for the assessment of this disease, a diagrammatic scale was developed with 1, 2, 4, 8, 16, 32, 64 and 82% of diseased leaf area. The diagrammatic scale was validated by 10 raters using 50 cowpea leaflets with different levels of severity previously measured by the software Assess®. The accuracy, precision and reproducibility of the estimative of each rater were determined by simple linear regression between actual and estimated severity, with and without the use of the scale. With the scale raters obtained better levels of accuracy and precision, with absolute errors concentrating around 10%. Raters showed high repeatability (94% and reproducibility ( 90% in

  12. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis Cultivars Differing in Chilling Tolerance under Cold Stress.

    Directory of Open Access Journals (Sweden)

    Huaqiang Tan

    Full Text Available Cowpea (V. unguiculata L. Walp. is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars-"Dubai bean" and "Ningjiang-3", which are tolerant and sensitive to chilling, respectively-were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18% had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic

  13. Número de repetições para avaliação de caracteres em genótipos de feijão-caupi

    Directory of Open Access Journals (Sweden)

    Francisco Eduardo Torres

    2015-06-01

    Full Text Available O objetivo deste trabalho foi determinar o número de medições (repetições necessário para avaliar caracteres de genótipos de feijão-caupi (Vigna unguiculata. Vinte genótipos de feijão-caupi de porte ereto e vinte de porte semiprostrado foram avaliados no Estado do Mato Grosso do Sul, em seis e quatro ensaios, respectivamente. Os dez ensaios foram conduzidos no delineamento blocos ao acaso, com quatro repetições. Foram mensurados os caracteres comprimento de vagem, massa de vagem, massa de grãos por vagem, número de grãos por vagem, massa de cem grãos e produtividade de grãos. Foram verificados os pressupostos do modelo matemático, realizada a análise de variância, estimado o coeficiente de repetibilidade e calculado o número de repetições. Ensaios com quatro repetições identificam genótipos superiores de feijão-caupi em relação aos caracteres comprimento de vagem, massa de vagem, massa de grãos por vagem, número de grãos por vagem, massa de cem grãos e produtividade de grãos, com, respectivamente, 84,57, 75,62, 73,14, 75,25, 81,53 e 79,19% de exatidão no prognóstico de seu valor real.

  14. Evapotranspiration of caupi beans culture in the Zona da Mata of Pernambuco State, Brazil

    International Nuclear Information System (INIS)

    Bernardo, Ana Lucia; Antonino, Antonio Celso Dantas; Dall'Olio, Attilio; Carneiro, Clemente Jose Gusmao

    1996-01-01

    A water balance experiment was carried out in a red-yellow podzolic soil of the Northern Zona da Mata region, in the State of Pernambuco, Brazil. Six 11 m x 3m plots were planted with the IPA-206 variety of caupi beans (Vigna unguiculata (L.) Walp), which was genetically modified at the IPA Research Center in order to improve its resistance to water stress. The experiments were performed in two different periods of the year, so that the influence of the amount of rainfall on the crop yield could be evaluated. Stored water and water potential gradient at the 0-90 cm depth layer, were measured through the use of neutron probes and mercury manometers, respectively. The dry season results a water stress throughout the growing cycle, resulting in a low yield (548 Kg/ha). In contrast, the large amount of rainfall that occurred during the wet season, was sufficient to avoid water stress to the plant root system, leading to a significant increase in the crop yield, (1014 kg/ha). The evapotranspiration component has been estimated as 3,57 mm/day and 4,07 mm/day, respectively. (author)

  15. Bioactive Properties of Phaseolus lunatus (Lima Bean) and Vigna unguiculata (Cowpea) Hydrolyzates Incorporated into Pasta. Residual Activity after Pasta Cooking.

    Science.gov (United States)

    Drago, Silvina R; Franco-Miranda, Hanai; Cian, Raúl E; Betancur-Ancona, David; Chel-Guerrero, Luis

    2016-09-01

    The aims of the study were to study the inclusion of P. lunatus (PLH) and V. unguiculata (VUH) protein hydrolyzates with bioactive properties into a pasta-extruded product and determine residual activity after extrusion or pasta cooking. Both protein hydrolyzates showed angiotensin-converting enzyme inhibition (ACEI) and antioxidant activity (TEAC). PLH showed higher ACEI but lower TEAC than VUH (97.19 ± 0.23 vs. 91.95 ± 0.29 % and 244.7 ± 3.4 vs. 293.7 ± 3.3 μmol Trolox/g, respectively). They were included at 5 or 10 % into wheat pasta. Control pasta had the lowest ACEI activity or TEAC (22.01 ± 0.76 % or 14.14 ± 1.28 μmol Trolox/g, respectively). Higher activity remained in pasta with PLH than VUH after extrusion, and higher the level of addition, higher the ACEI was. Pasta had practically the same ACEI activity after cooking, thus active compounds were not lost by temperature or lixiviation. Regarding TEAC, higher activity remained in pasta with 10 % VUH (31.84 ± 0.17 μmol Trolox/g). Other samples with hydrolyzates had the same activity. After cooking, pasta with hydrolyzates had higher TEAC values than control, but these were not modified by the level of incorporation. Moreover, the profile changed because pasta with PLH had the highest TEAC values (21.39 ± 0.01 and 20.34 ± 0.15 for 5 or 10 % hydrolyzates, respectively). Cooking decreased this activity (~ 20 %), for all samples. Although a certain loss of antioxidant activity was observed, pasta could be a good vehicle for bioactive compounds becoming a functional food.

  16. Global changes in gene expression during compatible and incompatible interactions of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides.

    Science.gov (United States)

    Huang, Kan; Mellor, Karolina E; Paul, Shom N; Lawson, Mark J; Mackey, Aaron J; Timko, Michael P

    2012-08-17

    Cowpea, Vigna unguiculata L. Walp., is one of the most important food and forage legumes in the semi-arid tropics. While most domesticated forms of cowpea are susceptible to the root parasitic weed Striga gesnerioides, several cultivars have been identified that show race-specific resistance. Cowpea cultivar B301 contains the RSG3-301 gene for resistance to S. gesnerioides race SG3, but is susceptible to race SG4z. When challenged by SG3, roots of cultivar B301 develop a strong resistance response characterized by a hypersensitive reaction and cell death at the site of parasite attachment. In contrast, no visible response occurs in B301 roots parasitized by SG4z. Gene expression in the roots of the cowpea cultivar B301 during compatible (susceptible) and incompatible (resistant) interactions with S. gesnerioides races SG4z and SG3, respectively, were investigated at the early (6 days post-inoculation (dpi)) and late (13 dpi) stages of the resistance response using a Nimblegen custom design cowpea microarray. A total of 111 genes were differentially expressed in B301 roots at 6 dpi; this number increased to 2102 genes at 13 dpi. At 13 dpi, a total of 1944 genes were differentially expressed during compatible (susceptible) interactions of B301 with SG4z. Genes and pathways involved in signal transduction, programmed cell death and apoptosis, and defense response to biotic and abiotic stress were differentially expressed in the early resistance response; at the later time point, enrichment was primarily for defense-related gene expression, and genes encoding components of lignifications and secondary wall formation. In compatible interactions (B301-SG4z), multiple defense pathways were repressed, including those involved in lignin biosynthesis and secondary cell wall modifications, while cellular transport processes for nitrogen and sulfur were increased. Distinct changes in global gene expression profiles occur in host roots following successful and unsuccessful

  17. Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species.

    Science.gov (United States)

    Pottorff, Marti; Ehlers, Jeffrey D; Fatokun, Christian; Roberts, Philip A; Close, Timothy J

    2012-06-12

    Cowpea [Vigna unguiculata (L.) Walp] exhibits a considerable variation in leaf shape. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Leaf morphology was studied in the cowpea RIL population, Sanzi (sub-globose leaf shape) x Vita 7 (hastate leaf shape). A QTL for leaf shape, Hls (hastate leaf shape), was identified on the Sanzi x Vita 7 genetic map spanning from 56.54 cM to 67.54 cM distance on linkage group 15. SNP marker 1_0910 was the most significant over the two experiments, accounting for 74.7% phenotypic variance (LOD 33.82) in a greenhouse experiment and 71.5% phenotypic variance (LOD 30.89) in a field experiment. The corresponding Hls locus was positioned on the cowpea consensus genetic map on linkage group 4, spanning from 25.57 to 35.96 cM. A marker-trait association of the Hls region identified SNP marker 1_0349 alleles co-segregating with either the hastate or sub-globose leaf phenotype. High co-linearity was observed for the syntenic Hls region in Medicago truncatula and Glycine max. One syntenic locus for Hls was identified on Medicago chromosome 7 while syntenic regions for Hls were identified on two soybean chromosomes, 3 and 19. In all three syntenic loci, an ortholog for the EZA1/SWINGER (AT4G02020.1) gene was observed and is the candidate gene for the Hls locus. The Hls locus was identified on the cowpea physical map via SNP markers 1_0910, 1_1013 and 1_0992 which were identified in three BAC contigs; contig926, contig821 and contig25. This study has demonstrated how integrated genomic resources can be utilized for a candidate gene approach. Identification of genes which control leaf morphology may be utilized to improve the quality of cowpea leaves for vegetable and or forage markets as well as contribute to more fundamental research understanding the control of leaf shape in legumes.

  18. Contribución de Vigna unguiculata L. a la sustentabilidad de sistemas de cultivo de caña de azúcar

    Directory of Open Access Journals (Sweden)

    Oscar Eduardo Sanclemente Reyes

    2015-12-01

    Full Text Available  Con el objetivo de evaluar la contribución del abono verde (AV Vigna unguiculata L., a la producción sostenible de caña de azúcar (CA Saccharum officinarum L. Var. CC 85-92 en un Vertisol del Valle del Cauca (Colombia, se usó diseño experimental en bloques completos al azar y cinco repeticiones. Los tratamientos fueron: (C Control- soca de CA, (AV1 siembra 1X1 AV- CA, (AV2 siembra 2X1 AV- CA, (AV1+R siembra 1X1 AV inoculada con Rhizobium sp.- CA, y (AV2+R siembra 2X1 AV inoculada con Rhizobium sp.- CA. Se evaluó el aporte de biomasa del AV, la biomasa de arvenses asociadas y la humedad del suelo, durante el mes dos. En maduración de CA (mes once se evaluó la concentración de sólidos y sacarosa en tallos. En cosecha de CA (mes trece se evaluaron las toneladas de caña por hectárea (TCH, el rendimiento y las toneladas de azúcar por hectárea (TAH, como efecto de los tratamientos. Se observó que el inóculo Rhizobium sp., no tuvo efectos aparentes, por baja especificidad simbiótica con el AV. El AV2, registró aporte significativo (p<0.05 de materia seca (14.5 t ha-1 incidiendo en reducción de arvenses y retención de humedad (161 m3 ha-1, frente al C. El AV1 registró productividad en TCH (131.5 t ha-1 y TAH (15.5 t ha-1, significativamente (p<0.05 altas con respecto a los demás tratamientos. Estos resultados muestran las bondades del uso de sistemas intercalados AV- caña de azúcar, sobre la economía y sustentabilidad del sector.

  19. Genic SNP markers and legume synteny reveal candidate genes underlying QTL for Macrophomina phaseolina resistance and maturity in cowpea [Vigna unguiculata (L Walp.

    Directory of Open Access Journals (Sweden)

    Ehlers Jeffrey D

    2011-01-01

    Full Text Available Abstract Background Macrophomina phaseolina is an emerging and devastating fungal pathogen that causes significant losses in crop production under high temperatures and drought stress. An increasing number of disease incidence reports highlight the wide prevalence of the pathogen around the world and its contribution toward crop yield suppression. In cowpea [Vigna unguiculata (L Walp.], limited sources of low-level host resistance have been identified, the genetic basis of which is unknown. In this study we report on the identification of strong sources of host resistance to M. phaseolina and the genetic mapping of putative resistance loci on a cowpea genetic map comprised of gene-derived single nucleotide polymorphisms (SNPs and amplified fragment length polymorphisms (AFLPs. Results Nine quantitative trait loci (QTLs, accounting for between 6.1 and 40.0% of the phenotypic variance (R2, were identified using plant mortality data taken over three years in field experiments and disease severity scores taken from two greenhouse experiments. Based on annotated genic SNPs as well as synteny with soybean (Glycine max and Medicago truncatula, candidate resistance genes were found within mapped QTL intervals. QTL Mac-2 explained the largest percent R2 and was identified in three field and one greenhouse experiments where the QTL peak co-located with a SNP marker derived from a pectin esterase inhibitor encoding gene. Maturity effects on the expression of resistance were indicated by the co-location of Mac-6 and Mac-7 QTLs with maturity-related senescence QTLs Mat-2 and Mat-1, respectively. Homologs of the ELF4 and FLK flowering genes were found in corresponding syntenic soybean regions. Only three Macrophomina resistance QTLs co-located with delayed drought-induced premature senescence QTLs previously mapped in the same population, suggesting that largely different genetic mechanisms mediate cowpea response to drought stress and Macrophomina infection

  20. Analysis of ibuprofen and its main metabolites in roots, shoots, and seeds of cowpea (Vigna unguiculata L. Walp) using liquid chromatography-quadrupole time-of-flight mass spectrometry: uptake, metabolism, and translocation.

    Science.gov (United States)

    Picó, Yolanda; Alvarez-Ruiz, Rodrigo; Wijaya, Leonard; Alfarhan, Ahmed; Alyemeni, Mohammed; Barceló, Damià

    2018-01-01

    A liquid chromatography quadruple time-of-flight mass spectrometry (LC-QqTOF-MS/MS) method was developed for simultaneous quantitative analysis of ibuprofen (IBU), 1- and 2-hydroxyibuprofen (1-OH IBU and 2-OH IBU), and carboxyibuprofen (CBX IBU) while preserving the ability of the instrument to get precursor and product ion mass spectra of non-target compounds. The trigger was the precursor ions reaching 100 cps intensity. Sample preparation was carried out by ultrasound solid-liquid extraction with methanol as extraction solvent at pH  70% for all target analytes at low and high concentration levels. The lowest limit of quantification was cowpea (Vigna unguiculata (L.) Walp) treated at high IBU concentrations and its presence in vegetables irrigated with treated water. Up to 46 metabolites, mostly hydroxylated metabolites and conjugates with hexosides and amino acids, were identified. The most abundant metabolites were also identified in an eggplant sample. Graphical Abstract ᅟ Ibuprofen metabolite identification.

  1. Eficiência da farinha desengordurada de gergelim como complemento protéico da farinha extrudada de caupi1

    Directory of Open Access Journals (Sweden)

    Geraldo Arraes Maia

    1999-07-01

    Full Text Available O objetivo deste trabalho foi promover uma avaliação nutricional da mistura protéica desengordurada, obtida do gergelim (Sesamum indicum L., com a farinha extrudada do caupi (Vigna unguiculata L. Walp, utilizando-se métodos físicos, bioquímicos, nutricionais e sensoriais. Usando-se semente integral do gergelim, com 54,08% de óleo e 21,83% de proteína, obteve-se a semente descascada com baixa concentração de oxalatos, que foi usada para a produção de farinha desengordurada de gergelim (FDG contendo 2,81% de óleo e 59,16% de proteína. A principal característica desta farinha foi sua alta concentração de aminoácidos sulfurados (30,88 mg/g proteína. Esta FDG foi usada como complemento da proteína da farinha do caupi obtida pelo processo de cozimento por extrusão (FEC, o que ocasionou a inativação de grande parte dos inibidores de tripsina. A proteína da farinha FEC mostrou uma concentração de 24,29%, um baixo conteúdo de aminoácidos sulfurados (17,22 mg/g proteína e alto teor de lisina (58,47 mg/g proteína. O alimento formulado foi considerado de boa qualidade nutricional.

  2. Tamaño de Parcela Experimental y Número de Repeticiones para Ensayos de Rendimiento con Caupi, Vigna ungiculata (l Walp

    Directory of Open Access Journals (Sweden)

    Escobar Soto Carlos

    1990-09-01

    Full Text Available La presente investigación se realizó con el propósito de estimar el tamaño óptimo de parcela experimental y el número de repeticiones para ensayos de rendimiento con caupl Vigna ungiculata (L Walp. El ensayo de campo, ensayo en blanco de 20 surcos de 25 m cada uno, se sembró durante el segundo semestre de 1990, en el Centro de Investigación Cotové, municipio de Santa Fe de Antioquia, propiedad de la Facultad de Ciencias Agropecuarias de la Universidad Nacional de Colombia, Seccional Medellín. La zona de vida corresponde a la de bosque seco tropical (bs -T. Se sembró la variedad experimental Licatur-1 OCA Calamar, a 0,60 m entre surcos y 0,10 m entre plantas dentro de surcos. La unidad básica se consideró de un surco de un metro de longitud. Para la estimación del tamaño óptimo de parcela experimental se combinaron las unidades básicas para obtener arreglos de diferentes tamaños y formas, a los que se determinó el coeficiente de variación GVij: CVij –Sij/Yij i:1,2, ... L;j = 1, 2, ... A Con el conjunto de los CVij se obtuvo un modelo de regresión cuya expresión real se asume que es un modelo cuadrático en (largo y r (ancho, esto es: CVij= β12+β1α +β2γ+β21αˆ2+β22γˆ2+β12αγ El tamaño óptimo de parcela experimental se estimó en unidades de 6 surcos (a 0,60 m. entre sí de 5 m de longitud (0,10 m entre plantas dentro de surcos, con un coeficiente de variación del 16%. El número de repeticiones estimado, para lograr un coeficiente de variación de 16% y una precisión razonable del 25% es de 4, asumiendo que las pruebas de comparación se hagan con un nivel de significancia de 0,05. A partir del modelo de regresión encontrado, para valores constantes del coeficiente de variación y número de surcos se estimó longitud de los mismos y con todos estos datos se generó una familia de curvas, de tal suerte que para un valor deseado de CV se puede escoger entre varias alternativas de tamaño de

  3. Produtividade e morfologia de acessos de caupi, em Mossoró, RN Yield and morphology of cowpea accessions in Mossoró, Rio Grande do Norte State, Brazil

    Directory of Open Access Journals (Sweden)

    Salvador B Torres

    2008-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a produtividade e caracterizar a morfologia de dez acessos de caupi [Vigna unguiculata (L. Walp.], nas condições edafoclimáticas do município de Mossoró, RN. Dez acessos (Amapá, BRS Potiguar, Canapu, Casca-de-seda, Coruja, Costela-de-vaca, João-vieira, Pingo-de-ouro, Rabo-de-peba e Sempre-verde foram avaliados em experimento de campo, de agosto/2006 a junho/2007, em Mossoró. Verificou-se que todos os genótipos de caupi apresentaram hábito de crescimento indeterminado e semi-enramador volúvel, exceto o "BRS Potiguar" que revelou comportamento semi-enramador. O número de sementes variou de 12 a 16 por vagem. Para a região de Mossoró, pode ser indicado como melhor alternativa ao produtor, o acesso Amapá, por ser mais precoce, possuir maior número de vagens por planta e maior produtividade, seguido de BRS Potiguar e Casca-de-seda.The objective of this work was to evaluate the productivity and to describe the morphology of ten cowpea [Vigna unguiculata (L. Walp.] accessions in the edaphoclimatic conditions of Mossoró, Brazil. The accessions Amapá, BRS Potiguar, Canapu, Casca-de-seda, Coruja, Costela-de-vaca, João-vieira, Pingo-de-ouro, Rabo-de-peba and Sempre-verde were evaluated in a field experiment from August 2006 to June 2007. The majority of accessions was of indeterminate and semi-branched voluble growth habit; only BRS Potiguar was semibranched. The number of seeds per pod varied from 12 to 16. For the Mossoró region, the accession Amapá is considered be the best alternative for small farmers. This accession is earlier maturing, presents a high number of pods per plant and high yield. Other promising genotypes are BRS Potiguar and Casca-de-seda.

  4. Potencial genético de progênies de feijão-caupi segregantes quanto ao tipo da inflorescência

    Directory of Open Access Journals (Sweden)

    Fábio Ribeiro Barros

    2011-02-01

    Full Text Available O objetivo deste trabalho foi avaliar o potencial genético produtivo de progênies de feijão-caupi (Vigna unguiculata segregantes quanto ao tipo da inflorescência. Foram avaliadas 68 progênies F4 obtidas dos retrocruzamentos: (TV x 5058-09C x Cacheado-roxo x TV x 5058-09C e (AU94-MOB-816 x Cacheado-roxo x AU94-MOB-816, com os genitores. Dois experimentos foram conduzidos no delineamento de blocos ao acaso, tendo-se avaliado 17 progênies, com quatro repetições, em parcelas subdivididas quanto à inflorescência: simples e composta. A análise estatística foi realizada por modelos mistos via procedimento REML/BLUP. As estimativas das variâncias genéticas foram significativas para todos os caracteres estudados. Os caracteres comprimento do pedúnculo, número médio de vagens por pedúnculo e floração inicial apresentaram alta variabilidade e expressão do componente genético para a inflorescência composta. As progênies de inflorescência simples apresentam potencial genético produtivo similar às progênies de inflorescência composta. As progênies resultantes do retrocruzamento (AU94-MOB-816 x Cacheado-roxo x AU94-MOB-816 são promissoras como estratégia para aumentar os níveis atuais de produtividade do feijão-caupi.

  5. survey of the symptoms and viruses associated with cowpea (vigna

    African Journals Online (AJOL)

    Osondu

    2012-10-29

    Oct 29, 2012 ... of the prevalence of virus disease symptoms and to specifically identify the viruses infecting cowpea. (Vigna unguiculata . ... 1Department of Crop Protection, Faculty of Agriculture,. University of ..... emerging viruses. This will ...

  6. Supplementation of native grass hay with cowpea (Vigna unguiculata hay, wilted leucaena (Leucaena leucocephala forage, wilted tagasaste (Chamaecytisus palmensis forage or a wheat middling for young Friesian x Zebu (Boran crossbred steers

    Directory of Open Access Journals (Sweden)

    Tuomo Varvikko

    1992-03-01

    Full Text Available A 100-day experiment of a randomized block design was conducted with forty Friesian x Zebu (Boran crossbred growing steers to compare the value of wheat middling, an agro-industrial by-product (diet W, cowpea (Vigna unguiculata hay (diet C, and wilted forages of leucaena (Leucaena leucocephala, diet L and tagasaste (Chamaecytisus palmensis, diet T as cattle feed. These feeds were fed daily at a level of 1.5 kg (on an air dry basis to supplement the basal diet (diet H of native hay. A mineral supplement containing 50 g bone meal and 10 g common salt was also given daily. The steers were group-fed, but during the last two weeks at the end of the experiment the animals were housed individually in feeding pens to estimate the feed intake and apparent digestibilities of the diets. The animals were weighed at the beginning of the experiment, thereafter every two weeks, and finally at the end of the experiment. The animals consumed all the offered supplements, except for tagasaste forage, of which one third remained unconsumed. The mean daily total dry matter intake during the individual feeding period ranged from 4.0 to 5.0 kg between the diets (P

  7. Effects of substituting roasted soybean (Glycine max seeds by those of cowpea (Vigna unguiculata, and of the protein level in the diet, on growth performance and profitability of local-breed chickens (Gallus gallus in Burkina

    Directory of Open Access Journals (Sweden)

    S. Ouattara

    2014-07-01

    Full Text Available This study aimed to evaluate the effects of substituting roasted seeds of soya (Glycine max by those of cowpea (Vigna unguiculata, and of the protein level in the diet, on growth performance and economic profitability of local-breed chickens (Gallus gallus in Burkina Faso. Three hundred 12-day-old chicks were divided into 12 batches of 25 chicks each. Four diets incorporating seeds of cowpea or soya, with different protein levels for starting and growing/finishing, were prepared. Data on various parameters (body weight, weight gain, intake and feed conversion, mortality were recorded once every two weeks from the 12th to the 138th day of age. At the 138th day, four chickens (two males and two females from each batch were slaughtered to assess the characteristics of carcasses and selected organs. The comparative profitability of the different treatments was evaluated. Results indicate that the substitution of roasted seeds of soya by those of cowpea had no devaluing effect on growth performance nor on carcass characteristics of the local chicken. In addition, the use of these seeds did not decrease profitability. Lastly, increasing the protein level in the diets significantly (p ≤ 0.05 improved weight gains and reduced the duration of the breeding period by two weeks.

  8. Effects of Cropping System and Cowpea Variety on Symbiotic Potential and Yields of Cowpea (Vigna unguiculata L. Walp and Pearl Millet (Pennisetum glaucum L. in the Sudano-Sahelian Zone of Mali

    Directory of Open Access Journals (Sweden)

    Zoumana Kouyaté

    2012-01-01

    Full Text Available Many cowpea varieties (Vigna unguiculata L. Walp have been proposed by research in Mali. None of these varieties were investigated for their symbiotic potential in terms of root nodulation and mycorrhizal infection. An experiment was conducted at Cinzana Research Station, from 2007 to 2009 with an objective to identify a cowpea variety with high symbiotic potential which may improve millet/cowpea cropping global production. Randomized complete block (RCBD design with a factorial combination of 3 cowpea varieties (IT89KD-374, CZ1-94-23-1, and CZ11-94-5C and 2 cropping systems (millet/cowpea intercropping and cowpea-millet rotation was used. On farm test was conducted to evaluate CZ11-94-5C and IT89KD-374 nodulation performance. Cowpea variety CZ11-94-5-C had the highest nodule number and nodule weight. Millet/cowpea alternate rows intercropping (1/1, only, had a significant influence on cowpea root infection rates by mycorrhizae, on the 45th day after emergence. IT89KD-374 gave the best cowpea grain yield (1540 kg ha−1 in sole crop. The highest millet grain yield (1650 kg ha−1 was obtained under CZ11-94-5C-millet rotation. Farmers' fields assessments results confirmed CZ11-94-5C performance on research station. The CZ11-94-5C cowpea variety needs to be more characterized.

  9. Silicon and Nitrate Differentially Modulate the Symbiotic Performances of Healthy and Virus-Infected Bradyrhizobium-nodulated Cowpea (Vigna unguiculata), Yardlong Bean (V. unguiculata subsp. sesquipedalis) and Mung Bean (V. radiata).

    Science.gov (United States)

    Izaguirre-Mayoral, Maria Luisa; Brito, Miriam; Baral, Bikash; Garrido, Mario José

    2017-09-15

    The effects of 2 mM silicon (Si) and 10 mM KNO₃ (N)-prime signals for plant resistance to pathogens-were analyzed in healthy and Cowpea chlorotic mottle virus (CCMV) or Cowpea mild mottle virus (CMMV)-infected Bradyrhizobium -nodulated cowpea, yardlong bean and mung bean plants. In healthy plants of the three Vigna taxa, nodulation and growth were promoted in the order of Si + N > N > Si > controls. In the case of healthy cowpea and yardlong bean, the addition of Si and N decreased ureide and α-amino acids (AA) contents in the nodules and leaves in the order of Si + N> N > Si > controls. On the other hand, the addition of N arrested the deleterious effects of CCMV or CMMV infections on growth and nodulation in the three Vigna taxa. However, the addition of Si or Si + N hindered growth and nodulation in the CCMV- or CMMV-infected cowpea and yardlong bean, causing a massive accumulation of ureides in the leaves and nodules. Nevertheless, the AA content in leaves and nodules of CCMV- or CMMV-infected cowpea and yardlong bean was promoted by Si but reduced to minimum by Si + N. These results contrasted to the counteracting effects of Si or Si + N in the CCMV- and CMMV-infected mung bean via enhanced growth, nodulation and levels of ureide and AA in the leaves and nodules. Together, these observations suggest the fertilization with Si + N exclusively in virus-free cowpea and yardlong bean crops. However, Si + N fertilization must be encouraged in virus-endangered mung bean crops to enhance growth, nodulation and N-metabolism. It is noteworthy to see the enhanced nodulation of the three Vigna taxa in the presence of 10 mM KNO₃.

  10. Estabilidade da resistência de genótipos de caupi a Callosobruchus maculatus (Fabr. em gerações sucessivas

    Directory of Open Access Journals (Sweden)

    Lima Marcileyne Pessôa Leite de

    2002-01-01

    Full Text Available Callosobruchus maculatus (Fabr. (Coleoptera: Bruchidae é a principal praga do caupi (Vigna unguiculata L. armazenado em condições tropicais e subtropicais. Avaliaram-se a estabilidade da resistência e a capacidade de adaptação de C. maculatus a genótipos de caupi, durante seis gerações. Utilizou-se o teste sem chance de escolha, em delineamento experimental inteiramente casualizado, em esquema fatorial, com dez tratamentos, seis gerações do inseto e cinco repetições. Cada repetição constou de 30 grãos infestados com dois casais da praga. O número de ovos/fêmea diferiu entre os genótipos de caupi apenas na sexta geração, e entre as gerações em BR14-Mulato, Bico de Pato, TE90-180-3E e TE87-98-8G. A viabilidade de ovos diferiu entre as gerações em BR17-Gurguéia, BR14-Mulato, IT89KD-260 e IT89KD-245, e entre os genótipos nas terceira, quinta e sexta gerações. Os genótipos diferiram entre e dentro das gerações, em relação à duração e a viabilidade da fase imatura. Observou-se redução na emergência, especialmente em IT89KD-245, IT89KD-260, CNC 0434, Bico de Pato, TE90-180-10F e BR14-Mulato, provavelmente devido a substâncias químicas presentes nos grãos que afetaram a sobrevivência dos insetos, ao longo das gerações. Os genótipos IT89KD-245 e IT89KD-260 comportaram-se como moderadamente resistentes. Não se observou adaptação de C. maculatus aos genótipos, mantendo-se a resistência estável através das gerações.

  11. Uptake rate of nitrogen from soil and fertilizer, and N derived from symbiotic fixation in cowpea (Vigna unguiculata (L.) Walp.) and common bean (Phaseolus vulgaris L.) determined using the 15N isotope

    International Nuclear Information System (INIS)

    Brito, Marciano de Medeiros Pereira; Muraoka, Takashi; Silva, Edson Cabral da

    2009-01-01

    Common bean (Phaseolus vulgaris L.) and cowpea (Vigna unguiculata (L.) Walp.) are among the main sources of plant protein for a large part of the world population, mainly that of low income, and nitrogen is the main constituent of these proteins. The objectives of this study were to evaluate, through the 15 N-dilution technique and using rice and non-nodulating soybean as control plants, the relative contributions of nitrogen sources (symbiotically fixed N, soil native N and fertilizer N) on the growth of common bean and cowpea and to compare the isotopic technique (ID) with the difference methods (DM) for the evaluation of symbiotic N 2 fixation. The study was carried out in a greenhouse of the Center for Nuclear Energy in Agriculture - CENA/USP, Sao Paulo State, Brazil, using 5 kg pots with a Typic Haplustox (Dystrophic Red-Yellow Latosol). The experiment was arranged in completely randomized blocks, with 16 treatments and three replications, in an 8 x 2 factorial design. The treatments were eight sampling times: 7, 24, 31, 38, 47, 58, 68 and 78 days after sowing (DAS) and two crops: common bean and cowpea. An N rate of 10 mg kg -1 soil was used, as urea, enriched with an excess of 10 % of 15 N atoms. Symbiotic N fixation supplied the bean and cowpea plants with the greatest amount of accumulated N, followed, in decreasing order, by soil and fertilizer. The highest rate of N symbiotic fixation was observed at the pre-flowering growth stage of the bean and cowpea plants. After the initial growth stage, 24 DAS, rice and non nodulating soybean were appropriate control plants to evaluate symbiotic N fixation. There was a good agreement between ID and DM, except in the initial growth stage of the crops. (author)

  12. Genetic control of cowpea seed sizes Controle genético do tamanho das sementes de caupi

    Directory of Open Access Journals (Sweden)

    Francisco Cláudio da Conceição Lopes

    2003-01-01

    Full Text Available Cowpea [Vigna unguiculata (L. Walp.] is one of the most widely adapted grain legumes in hot regions of Africa, Asia and the Americas. In the semiarid Northeast of Brazil, it is the main subsistence crop, an excellent protein source of low cost, for the poor population. The objective of this work was to estimate genetic parameters to understand the inheritance of seed sizes in cowpea. The parents P1 and P2 and the generations, F1, F2, BC1 and BC2 of the cross TVx5058-09C X Manteiguinha formed the genetic material for this study. These six generates (P1, P2, F1, F2, BC1 and BC were evaluated in a completely randomized block-design with six replications, in Teresina - PI, Brazil, in 1998. The genetic parameters estimated were: phenotypic and total genetic variance, additive and dominance genetic components of variance and the variance attributed to the environment, heritability in the broad and narrow senses, average degree of dominance and the number of genes controlling the character. The additive - dominance model fitted the data for 100-seeds weight in as much as the midparental value and the additive effect were the more important genetic parameters for the determination of this character. The number of genes that control its expression is five. The occurrence of high values for narrow sense heritability indicates that the selection for seed size can be made in early generations.Caupi [Vigna unguiculata (L. Walp.] é uma das leguminosas mais adaptadas às regiões quentes da África, Ásia e das Américas. No semi-árido do nordeste do Brasil é a principal cultura de subsistência, por ser uma excelente fonte de proteína de baixo custo para a população mais carente. O objetivo deste trabalho foi estimar parâmetros genéticos que podem explicar a herança do tamanho das sementes de caupi. Os genótipos parentais P1 e P2 e as gerações F1, F2, RC1 e RC2 do cruzamento TVx5058-09C X Manteiguinha, constituíram o material genético utilizado

  13. Controle genético do comprimento do pedúnculo em feijão-caupi Genetic control of peduncle length in cowpea

    Directory of Open Access Journals (Sweden)

    Maurisrael de Moura Rocha

    2009-03-01

    Full Text Available O objetivo deste trabalho foi estudar o controle genético do caráter comprimento do pedúnculo em feijão-caupi (Vigna unguiculata. Para isso, foi realizado um cruzamento entre os parentais TVx-5058-09C, de pedúnculo curto, e TE96-282-22G, de pedúnculo longo. Os parentais e as gerações F1, F2, RC1 (P1xF1 e RC2 (P2xF1 foram avaliados em delineamento de blocos ao acaso, com quatro repetições. Foram estimados: variâncias fenotípica, genotípica, ambiental, aditiva e de dominância; herdabilidades no sentido amplo e restrito; grau médio de dominância e número mínimo de genes que determinam o caráter. O modelo aditivo-dominante foi adequado para explicar a variação observada. O efeito gênico aditivo foi o mais importante no controle do comprimento do pedúnculo, que é, aparentemente, controlado por cinco genes.The objective of this work was to investigate the genetic control of peduncle length in cowpea (Vigna unguiculata L.. A short peduncle cowpea line (TVx-5058-09C was crossed with a long peduncle line (TE 96-282-22G. The parents and the F1, F2, RC1 (P1xF1, and RC2 (P2xF1 generations were evaluated in randomized block design with four replications. Genotypic, phenotypic, environmental, additive, and dominance variances for peduncle length were determined. Narrow and broad sense heritability, the degree of dominance, and the minimum number of genes determining peduncle length were estimated. The additive-dominant model was adequate to explain the observed variation. The additive gene effect was the most important in controlling peduncle length, which appeared to be controlled by five genes.

  14. Physiological and molecular characterization of cowpea [Vigna ...

    African Journals Online (AJOL)

    Diaga Diouf

    Cowpea, Vigna unguiculata (L.) Walp. presents phenotypical variabilities and in order to study the genetic diversity of cultivated Senegalese varieties, two experimental approaches were used. First, a physiological characterization based on nitrogen fixation was used to assess cowpea breeding lines. Inoculation with two ...

  15. Effect of Six Different Audio Frequencies on Growth of Cowpea ( Vigna unguiculata ) during Seedling Stage%6种不同声频对豇豆苗期生长影响的研究

    Institute of Scientific and Technical Information of China (English)

    姜仕仁; 黄俊

    2011-01-01

    [目的]研究不同类型、频率特征的声波对豇豆苗期生长的影响.[方法]以古典音乐与昆虫鸣声的混合声波(MI)、杜鹃鸣声、蟋蟀鸣声、单一频率的400 Hz声波和多种频率合成的F5,Fn声波进行试验比较,对豇豆苗高、苗重进行测定,采用EXCEL进行统计分析和多重比较.[结果]经6种不同类型和频率声频处理后,豇豆苗期生长状况均显著优于对照组,表明声波能显著促进株高生长,对豇豆苗期助长效果较好的是400Hz、杜鹃鸣声和蟋蟀鸣声,其次是MI,Fn和F5;与对照组相比,杜鹃鸣声和蟋蟀鸣声处理组在生长期间能显著促进苗株增重.[结论]不同类型、频率特征的声波对豇豆苗期生长都有明显的助长作用,但作用效果有所差异.%[ Objective] The aim was to study the effects of acoustic waves with different types and frequency characteristics on the growth of cowpea (Vigna unguiculata) during seedling stage. [ Method] The insect-music mixed sound (MS), cuckoo acoustic song, cricket acoustic song, single 400 Hz frequency acoustic wave, F5 and Fn acoustic waves composed of different frequencies were designed to investigate the effects on height and weight of cowpea seedling, and experimental data were statistically analyzed and multiple-compared by EXCEL. [ Result ] After treatment by six different types and frequencies of acoustic waves, the growth situations of cowpea were better than control. This indicated that acoustic waves could significantly promote height growth of plant. The treatments with good growth promotion effect included 400 Hz frequency acoustic wave, cuckoo acoustic song and cricket acoustic song, followed by MI, Fn and F5. Cuckoo and cricket acoustic song treatment could promote the weight of cowpea seedling during growth stage. [ Conclusion ] Acoustic waves with different types and frequency characteristics had significant growth-promotion effect on growth of cowpea during seedling stage, but

  16. Impacto do aquecimento global no cultivo do feijão-caupi, no Estado da Paraíba Impact of global warming on the cowpea cultivation in the State of Paraíba

    Directory of Open Access Journals (Sweden)

    João H. B. da C. Campos

    2010-04-01

    Full Text Available No presente estudo se avaliam os impactos da mudança do clima com base nos relatórios do Painel Intergovernamental em Mudanças do Clima (IPCC, no zoneamento agrícola de riscos climáticos para a cultura do feijão-caupi (Vigna unguiculata L. Walp cultivado em sistema de sequeiro, no Estado da Paraíba. Utilizou-se o modelo do balanço hídrico associado a técnicas de geoprocessamento, e se objetivou a identificação das regiões do Estado em que a cultura do feijão-caupi sofrerá restrições em face das mudanças climáticas. As variáveis consideradas no modelo foram precipitação pluvial, coeficientes de cultura, evapotranspiração potencial e duração das fases fenológicas da cultura. Adotou-se, como limite para o índice de satisfação da necessidade de água para a cultura (ISNA, o valor de 0,50. A data foi considerada adequada para a semeadura quando a simulação do balanço hídrico apresentou resultados de ISNA com frequência mínima de 80%, superior ao valor do critério adotado. Tendo em vista um aumento de temperatura do ar de 3 e 6 oC, como sugerido pelo IPCC, o cultivo do feijão-caupi sofrerá uma redução significativa nas áreas atualmente favoráveis ao seu cultivo no Estado da Paraíba.This study evaluates the impacts of climate change, based on the reports of the IPCC, on the agricultural zoning of climatic risk of the rainfed cowpea (Vigna unguiculata L. Walp crop grown in the Paraíba state. The water balance model combined with GIS techniques was used for identifying areas in the state where the cowpea crop will suffer yield restrictions due to climate changes. Model input variables were: rainfall, crop coefficients, potential evapotranspiration and duration of the crop cycle. The limit value of 0.5 was adopted for the water requirement satisfaction index (WRSI. The date acceptable for seeding was that when the water balance simulation presented, for at least 80% minimum frequency, WRSI value greater than

  17. Resistência de genótipos de caupi ao caruncho

    Directory of Open Access Journals (Sweden)

    BARRETO PAULO DIÓGENES

    2000-01-01

    Full Text Available A utilização de resistência genética ao ataque de Callosobruchus maculatus (Fabr. tem sido alvo de investigação científica, especialmente no que diz respeito à identificação de fontes de resistência. O presente trabalho objetivou incorporar, ao grupo de caracteres desejáveis para o cultivo de caupi (Vigna unguiculata (L. Walp., resistência genética ao caruncho (C. maculatus. Foram realizadas hibridações dos genótipos IT81D-1045 e IT81D-1064 (portadores de resistência ao inseto com CNCx 252-1E/FB, CNCx 187-22D-1 e BR 1-Poty (capazes de transferir resistência a viroses, tolerância à seca, formação de grãos com padrão comercial, elevado potencial de produção e adaptabilidade a diferentes condições ambientais. Populações segregantes obtidas destes cruzamentos foram conduzidas pelo método SPD (descendência de uma única vagem, e na geração F5 foram realizadas seleções individuais. As linhagens obtidas foram avaliadas em conjunto com materiais de origens diferentes, utilizando-se parâmetros associados à infestação da praga. Foi constatado que os genótipos avaliados apresentaram variabilidade quanto à preferência à postura, número de insetos emergidos e número de sementes danificadas; as linhas EVx 37-15E e EVx 37-2E foram as que sofreram menor dano causado pelo caruncho; as variáveis número de ovos, número de insetos emergidos e número de sementes danificadas mostraram-se positiva e significativamente correlacionadas entre si; o grupo das linhagens que descendem de genitores resistentes apresenta valores significativamente inferiores aos obtidos pelas demais, o que indica que a resistência ao inseto se transmite geneticamente.

  18. Obtenção de plantas de feijão-caupi resistentes ao Cowpea severe mosaic virus e ao Cowpea aphid-borne mosaic virus

    Directory of Open Access Journals (Sweden)

    Gislanne Brito Barros

    2013-06-01

    Full Text Available Dentre os vírus que infectam o feijão-caupi (Vigna unguiculata L. Walp. destacam-se, respectivamente, pela severidade e ampla ocorrência o Cowpea severe mosaic virus (CPSMV e o Cowpea aphid-borne mosaic virus (CABMV. Portanto, objetivaram-se, no presente trabalho, obter e avaliar plantas de feijão-caupi com resistência ao CPSMV e ao CABMV, visando ao desenvolvimento de cultivares essencialmente derivadas e novas cultivares. Realizaram-se oito cruzamentos seguidos de retrocruzamentos, utilizando a linhagem TE 97-309G-9 e a cultivar Patativa como genitores resistentes, e as cultivares BR3-Tracuateua, BRS-Urubuquara, BRS-Novaera, BRS-Guariba e Pretinho como genitores suscetíveis. As gerações F2 e F2RC1 foram desafiadas quanto à resistência por meio de inoculação mecânica com isolados do CPSMV e do CABMV. Nas gerações F2RC1, além da resistência foram avaliados os caracteres: número de dias para o início da floração, comprimento das vagens, número de grãos. vagem-1, peso de cem grãos e produção de grãos.planta-1. Todos os indivíduos F2 e F2RC1 foram analisados pelo teste χ² e se ajustaram à frequência esperada de 15 plantas suscetíveis 1 planta resistente a ambos os vírus. As médias das plantas F2RC1 resistentes, de cada retrocruzamento, foram comparadas com a média do seu respectivo genitor recorrente pelo teste 't' e as médias dos retrocruzamentos foram comparadas pelo teste de Scott-Knott. Foi detectada variabilidade genética entre os retrocruzamentos para todos os caracteres. Todos os retrocruzamentos foram considerados promissores para produção de cultivares essencialmente derivadas resistentes ao CPSMV e ao CABMV e as plantas selecionadas possuem características que possibilitam a seleção de linhagens com grãos de bom padrão comercial e altamente produtivas.

  19. Estratégias de manejo de água em caupi irrigado Strategies of irrigation scheduling in cowpea

    Directory of Open Access Journals (Sweden)

    Rubens Sonsol Gondim

    2000-04-01

    Full Text Available Este trabalho foi conduzido no período de setembro a dezembro de 1997, numa área irrigada da Fazenda Experimental do Vale do Curu, pertencente à Universidade Federal do Ceará, no município de Pentecoste, CE, localizada a 100 km de Fortaleza. O objetivo do experimento foi avaliar a utilização do tensiômetro de mercúrio, do Tanque Classe A e da equação de Hargreaves, na determinação da lâmina de água a ser aplicada na irrigação. O delineamento foi inteiramente casualizado, com três tratamentos e quatro repetições, enquanto os tratamentos foram representados pelos três diferentes métodos de estimação citados, de quando e quanto irrigar (Tratamento 1 - Tensiômetro; Tratamento 2 - Tanque Classe A e Tratamento 3 - equação de Hargreaves e a cultura utilizada foi o caupi (Vigna unguiculata (L. Walp para consumo em estado verde, cultivar João Paulo II, no espaçamento de 0,90 x 0,40 m, com duas plantas por cova, irrigada por aspersão convencional. A análise dos resultados constatou uma economia de água no tratamento 1, de 28 e 23%, em relação aos tratamentos 2 e 3, respectivamente, e também evidenciou a inexistência de diferenças significativas entre as produtividades alcançadas em todos os tratamentos. O tensiômetro pode ser indicado como instrumento de racionalização do uso da água em irrigação.A field study was conducted from September to December 1997 at the Federal University of Ceará Experimental Farm in Pentecoste, Brazil. The irrigation scheduling was based on a tensiometer, Class A pan evaporation and Hargreaves equation. The purpose of the research was to evaluate the three treatments (Treatment 1 - tensiometer, Treatment 2 - pan evaporation and Treatment 3 - Hargreaves equation with four replications in a completely randomized design. Sprinkler irrigated cowpea (Vigna unguiculata (L. Walp, cultivar João Paulo II for fresh consumption was grown on the experimental area. Plants were spaced at 0.90 x 0

  20. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    haulm growth at the expense of the tubers (Ewing,. 1981), increased rate of respiration (Sale, 1974), reduced dry matter accumulation (Bushnell, 1925), delayed tuber initiation (Menzel, 1980, Nowak and. Coleborne, 1989) and maturity (Amadi, 2005) and a significant loss of tuber yield and quality (Levy, 1983,. 1984).

  1. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    enable movement and measurement in built-up areas. Green et al (1999) ... Akure, Nigeria. M. A. Isogun, Department of Geology, Obafemi Awolowo University, Ile-Ife, Nigeria .... their Significance in Refuse Dump Classification. Variations in ...

  2. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    In recent years molecular sieve catalysts have ... 43. I. P. Okoye, Department of Pure & Industrial Chemistry, University of Port Harcourt, P. M. B. 5323 Choba, Port-Harcourt. .... “Nature and. Localization of poisoning carbonaceous matter.

  3. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    Following the first appearance of T. b. gambiense parasitaemia, the animals developed ... of sleep and wakefulness between weeks 8 and 10 when the animals were in the classical diurnal sleepiness with 8 -. 10 sleep ..... transgenic mice.

  4. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    batatas,14.27 ± 0.41mg/100g of calcium ... B1, 4.57 ± 0.86mg/100g; folic acid, 3.24±0.00mg/100g occurred in P. .... reactions e.g. glycogen and protein synthesis (Robson ... excess loss of sodium can occur during intense ... Deficiency leads to.

  5. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    a more reliable and decentralized information system, meant to improve reporting .... This is done after the exchange of the .... Communication: it is simplified for the ... Picture. Passport Photograph of Buyer (must have). WITNESS 1. Character.

  6. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    2003-07-20

    Jul 20, 2003 ... E. B. Ntasin, Department of Geology and Environmental Science, .... of the aircraft cable and secured by cable clamps. The ..... automatic recording system to detect the critical ... control and triggering mechanism of landslides.

  7. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    existing information to assist fish farmers. MATERIALS AND METHODS ... J. F. Alfred-Ockiya, Department of Fisheries, Faculty of Agricultural Technology, Niger Delta University, Wilberforce Island,. Bayelsa State .... Biometrics, 11: 1- 42.

  8. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    (p≥0.05) in the soil pH, zinc and copper contents between and within treatments throughout the study period, indicating that ... interferes with water and nutrient supply to plants. (Grummer .... increased energy (carbon) demand since the oil.

  9. Purification And Characterization Of Vigna unguiculata Cultiver ...

    African Journals Online (AJOL)

    AspII had a Km value 1.25 mM for asparagine and a pH optimum at 8.0. Asp II had a temperature optimum and heat stability at 40 oC. The fodder cultivar asp II activity was specific for Lasparagine and did not hydrolyze D-asparagine. It is not specific for. L-glutamine. Ni2+ and Co2+ had activator effects on asp II but other

  10. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    A three-dimensional study is made to improve the theoretical approach of spectral response of bifacial polycrystalline silicon solar cells. This study has allowed taking into account new parameters like grain size and grain boundaries recombination velocity, which reduce the cell efficiency. Losses in emitter region and ...

  11. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    About 5g of each. 15 ... E. D. Paul, National Research Institute for Chemical Technology, P.M.B 1052, Zaria, Nigeria. O. B. Adesina .... by phosphorylation, and can be used for cell signaling. ... products seems an unlikely human health problem.

  12. (Vigna unguiculata (L.) Walp.) through Agrobacterium transformation ...

    African Journals Online (AJOL)

    Administrator

    2011-09-26

    Sep 26, 2011 ... two 24-mer primers homologous to the Bar gene were used in the. PCR analysis. The base sequences of the primers are as follows: GUS P1 5'-TTG CCC AGC TAT CTG TCA CTT CAC T-3'. GUS P2 5'-ATG TCA CAT CAA TCC ACT TGC TTT G-3'. Bar P1 5'-GGG ACT TCA GCA GGT GGG TGT AGA-3'.

  13. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    OLS is best with large negative or positive correlation, while 3SLS is best with feebly correlated error terms in the case .... the asymptotic covariance matrix of the FIML estimator achieves the ... defined only when all equations in the system are.

  14. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    GLOBAL JOURNAL OF PURE AND APPLIED SCIENCES VOL 15, NO. ... Both quantitative and qualitative analytical methods were implemented ... S. S. Ikiensikimama, Department of Chemical Engineering, University of Lagos, Lagos, Nigeria.

  15. PHYTOREMEDIATION POTENTIAL OF Vigna unguiculata IN A ...

    African Journals Online (AJOL)

    FRANK

    Aspartame and Sucrose are food additives widely used ... additives and their toxic potential in humans. Thus ..... GPCRs) that activated the enzyme, leading to the .... class with maternal diet and the dimension of ... Biological Psychiatry, 28.

  16. Effectiveness and efficiency of chemical mutagens in cowpea (Vigna ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-11-19

    Nov 19, 2008 ... A study was undertaken in a cowpea (Vigna unguiculata (L.) Walp.) variety CO 6 to assess the efficiency and effectiveness of chemical mutagens; ethyl methane sulphonate (EMS), diethyl sulphate (DES) and sodium azide (SA). EMS treatments were found highly effective than the other chemicals.

  17. Generation mean analysis of dual purpose traits in cowpea (Vigna ...

    African Journals Online (AJOL)

    Fadiji

    2012-06-07

    Jun 7, 2012 ... Frequency analysis showed that all the F2 populations for fodder yield exhibited a continuous distribution, suggesting that inheritance of fodder yield is ... Key words: Gene effects, fodder, Vigna unguiculata, generation mean analysis. .... using the ABC scaling test (Mather, 1949), incorporating the weighted ...

  18. Effect Of Sprouting On Available Lysine Content Of Cowpea ( Vigna ...

    African Journals Online (AJOL)

    This study was conducted to determine the effect of sprouting on available Lysine content of cowpea (Vigna unguiculata) flour and the performance of the flour used for producing “moi – moi” (steamed bean cake). Cowpea seed was subjected to sprouting for different periods of 1 day, 2 days and 3 days for samples B, C and ...

  19. Preferência do pulgão-preto e da cigarrinha-verde em diferentes genótipos de feijão-caupi em Roraima = Preference of the black aphid and green leafhopper in different genotypes of cowpea in Roraima, Brazil

    Directory of Open Access Journals (Sweden)

    Hugo Falkyner da Silva Bandeira

    2015-03-01

    Full Text Available A ocorrência de insetos praga está entre os fatores que mais afetam a produtividade do feijão-caupi. Objetivou-se, com este trabalho, avaliar a resistência de nove genótipos de feijão-caupi ao ataque do pulgão-preto, Aphis craccivora Koch, 1854, e da cigarrinha-verde, (Empoasca sp., e a flutuação populacional de A. craccivora sobre a cultura, em condições de campo. Foram selecionados nove genótipos de feijão-caupi (Vigna unguiculata (L. Walp, a saber: BR-17 Gurgueia, BRS Guariba, BRS Cauamé, Pretinho Precoce 1, UFRR Grão Verde, Apiaú, Iracema, Cara-Preta e Sempre Verde. O delineamento experimental foi realizado em blocos casualizados, em esquema de parcela subdividida, com quatro repetições. Cada variedade foi plantada em quatro linhas paralelas, considerando as duas fileiras centrais como área útil. A contagem dos pulgões foi feita diretamente na última folha trifoliolada completamente aberta, enquanto que a das cigarrinhas foi realizada pelo método da batida de plantas em bandeja com água. Nos genótipos BRS Cauamé, BRS Guariba e Pretinho Precoce 1 foram observados os menores índices de infestação por A. craccivora, apresentando, portanto, resistência do tipo não preferência em relação aos demais avaliados. O genótipo Apiaú mostrou-se suscetível a Empoasca sp., e os BR-17 Gurgueia, Cara-Preta, Sempre Verde, UFRR Grão Verde e BRS Cauamé foram os mais resistentes, em função da menor preferência pelas cigarrinhas, registrada, principalmente, aos 28 e 35 dias após a emergência das plantas. = The occurrence of insect pests is among the most important factors affecting cowpea productivity. This study aimed at evaluating the resistance of nine genotypes of cowpea attack in black aphid Aphis craccivora Koch, 1854, and of green leafhopper (Empoasca sp., and the population fluctuation of A. craccivora on culture, under field conditions. Nine cowpea (Vigna unguiculata (L. Walp genotypes were chosen: BR-17

  20. Caracterização físico-química do grândulo do amido do feijão caupi Physico-chemical characteristics of the granule of the starch of the cowpea bean

    Directory of Open Access Journals (Sweden)

    S.M. Salgado

    2005-09-01

    Full Text Available O presente trabalho objetivou caracterizar quimica e fisicamente o amido de feijão caupi nos estádios de maturação em que o grão é consumido. Grãos verdes e maduros de feijão caupi (Vigna unguiculata L. Walp foram submetidos à determinação da composição centesimal: proteína por Kjeldahl, lipídio por Soxleth, umidade a 105º, cinzas a 550ºC, fibra alimentar por método gravimétrico-enzimático, carboidratos totais por diferença, amido total, glicídios redutores e não redutores, por óxido-redução em solução de Fehling. O amido isolado das distintas amostras foi analisado quanto ao amido resistente (baseado no uso de enzimas amilolíticas, amilose e amilopectina (por espectrofotometria e tipificação (difração de raio-X. Os dados paramétricos foram avaliados pelo teste t de Student. Os resultados obtidos demonstraram que as frações de carboidratos diferiram em função do estádio de maturação dos grãos. O amido de feijão verde apresentou maior teor de amido resistente (AR tipo 2 em relação ao amido total e baixo conteúdo de amilose. A maturação influenciou nos padrões de cristalinidade, sendo encontrado padrão tipo C para o feijão verde e o A para o maduro. O estádio de maturação exerceu influência sobre aspectos qualitativos e quantitativos dos constituintes dos feijões. O aspecto morfológico dos grânulos de amido não sofreu influência do estádio de maturação dos grãos. O feijão verde apresenta um percentual da fibra alimentar solúvel compatível com a recomendação do FDA.This work aimed at characterizing the starch of the cowpea bean in the stages of maturation in which it is consumed both chemically and physically. The unripe and ripe grains of the cowpea bean (Vigna unguiculata L. Walp were submitted to determine the centesimal composition: protein by Kjeldahl, lipids by Soxleth, moisture at 105°C, ashes at 550°C, alimentary fiber by gravimetric-enzymatic method, total carbohydrates

  1. Simulation of growth and development of irrigated cowpea in Piauí State by CROPGRO model Simulação do crescimento e desenvolvimento do caupi irrigado no Estado do Piauí pelo modelo CROPGRO

    Directory of Open Access Journals (Sweden)

    Edson Alves Bastos

    2002-10-01

    Full Text Available The objective of this work was to adapt the CROPGRO model, which is part of the DSSAT system, for simulating the cowpea (Vigna unguiculata growth and development under soil and climate conditions of the Baixo Parnaíba region, Piauí State, Brazil. In the CROPGRO, only input parameters that define crop species, cultivars, and ecotype were changed in order to characterize the cowpea crop. Soil and climate files were created for the considered site. Field experiments without water deficit were used to calibrate the model. In these experiments, dry matter (DM, leaf area index (LAI, yield components and grain yield of cowpea (cv. BR 14 Mulato were evaluated. The results showed good fit for DM and LAI estimates. The medium values of R² and medium absolute error (MAE were, respectively, 0.95 and 264.9 kg ha-1 for DM, and 0.97 and 0.22 for LAI. The difference between observed and simulated values of plant phenology varied from 0 to 3 days. The model also presented good performance for yield components simulation, excluding 100-grain weight, for which the error ranged from 20.9% to 34.3%. Considering the medium values of crop yield in two years, the model presented an error from 5.6%.O objetivo deste trabalho foi adaptar o modelo CROPGRO, o qual faz parte do sistema DSSAT, para simular o crescimento e desenvolvimento do caupi (Vigna unguiculata nas condições de solo e clima do Baixo Parnaíba, Piauí. No CROPGRO, foram modificados apenas parâmetros que definem os arquivos de espécie, de cultivar e de ecótipo, visando caracterizar a cultura do caupi. Foram criados arquivos contendo as características de solo e de clima do referido local. Na calibração do modelo, foram utilizados experimentos de campo sem restrições hídricas nos quais foram avaliados a matéria seca (MS, o índice de área foliar (IAF, os componentes de produção e a produtividade de grãos da cultivar BR 14 Mulato. Os valores médios dos R² e do erro absoluto médio (EAM

  2. Caracterização genética de rizóbios nativos dos tabuleiros costeiros eficientes em culturas do guandu e caupi

    Directory of Open Access Journals (Sweden)

    Fernandes Marcelo Ferreira

    2003-01-01

    Full Text Available O objetivo deste trabalho foi caracterizar geneticamente sete estirpes de rizóbios nativos dos tabuleiros costeiros de Sergipe com alta eficiência de fixação biológica do N2 em associação com guandu (Cajanus cajan e caupi (Vigna unguiculata. A amplificação do DNA pela técnica de PCR (polymerase chain reaction com o oligonucleotídeo específico BOX indicou um grau elevado de diversidade genética, uma vez que todas as estirpes apresentaram perfis únicos de DNA. A análise por BOX-PCR revelou, ainda, que essa metodologia é eficiente para diferenciar estirpes, mas não para a diferenciação de espécies de rizóbio. Pela técnica do RFLP (restriction fragment length polymorphism da região do DNA que codifica o gene 16S rRNA e da região intergênica entre os genes 16S e 23S rRNA, com cinco enzimas de restrição, bem como pelo seqüenciamento parcial da região do 16S rRNA, foi possível classificar as estirpes nos gêneros Bradyrhizobium e Rhizobium. Houve coerência entre as análises envolvendo a região do 16S rRNA, mas o agrupamento com uma das estirpes diferiu pela análise do espaço intergênico. Os resultados obtidos com a estirpe R11 indicam variabilidade genética elevada em relação às espécies de rizóbios descritas, inclusive diferindo em diversas bases da região do 16S rRNA, e podem indicar uma nova espécie.

  3. Expressão diferencial dos genes VuUCP1a e VuUCP1b em caupi sob estresse salino Differential expression of VuUCP1a and VuUCP1b in caupi under salt stress

    Directory of Open Access Journals (Sweden)

    Francisco Edson Alves Garantizado

    2011-06-01

    Full Text Available O estresse salino afeta o crescimento e o desenvolvimento das plantas, induzindo respostas bioquímicas e fisiológicas como mecanismo de adaptação para sua sobrevivência. As proteínas desacopladoras de planta (pUCPs dissipam o gradiente eletroquímico mitocondrial de prótons como calor e são codificadas por famílias multigênicas. Elas atuam como sistema de defesa evitando a formação de espécies reativas de oxigênio geradas em resposta a estresses ambientais. O objetivo do trabalho foi estudar a expressão de genes das pUCPs (VuUCP1a e VuUCP1b em raízes e folhas de plântulas de Vigna unguiculata submetidas ao estresse salino (NaCl 100 mM. Sementes foram germinadas no escuro e após 3 dias, as plântulas foram transferidas para solução de Hoagland, permanecendo 3 dias antes da aplicação do estresse. As raízes e folhas foram coletadas com 0; 6; 12 e 24 horas, após adição de NaCl, para avaliar o perfil de expressão dos genes da pUCP por RT- PCR. A análise de transcritos mostrou que VuUCP1a é expresso em raízes e folhas revelando um perfil constitutivo enquanto que VuUCP1b é dependente do tecido, isto é, expresso nas folhas, sem alteração em resposta ao estresse e induzido pelo estresse salino nas raízes. A peculiaridade da duplicação gênica de pUCP1 em caupi com perfil diferencial de expressão, sugere tanto um papel dessa enzima nos mecanismos de ajustamento ao estresse salino quanto promove essa espécie como um modelo atrativo para compreensão do papel da família multigênica da pUCP em plantas.Salt stress affects growth and development of plants, inducing a variety of physiological and biochemical responses as an adaptation mechanism for survival. The plant uncoupling mitochondrial proteins (pUCPs are able to dissipate the proton electrochemical gradient as heat and are encoded by a multigene family. They works as defence systems avoiding the formation of reactive oxygen species promoted by environmental

  4. Vigna unguiculasta

    African Journals Online (AJOL)

    Vigna ... content, level of starch damage and foaming capacity; Iron was least affected in TDF and SI while. Ife brown was the least ... cowpea in storage is reported to reach 100% sometimes, if left ..... potato flake quality as influenced by free starch.

  5. Identificação de Genótipos de Feijão-caupi Tolerantes a Acidez em um Latossolo Vermelho-Amarelo do Estado de Roraima = Identification of cowpea genotypes sensitivity to acidicy conditions in an Oxisol of Roraima State (Brazil.

    Directory of Open Access Journals (Sweden)

    Sandra Cátia Pereira Uchôa

    2007-12-01

    Full Text Available O presente trabalho foi realizado com o objetivo de identificar genótipos de feijão-caupi (Vigna unguiculata (L Walp., tolerantes à acidez. O trabalho foi realizado em casa de vegetação localizada no Campus do Cauamé, da Universidade Federal de Roraima, utilizando um Latossolo Vermelho-Amarelo de Boa Vista-RR. Foi adotado o delineamento experimental de Blocos Inteiramente Casualizados em esquema fatorial 2 x 5 x 10 com três repetições. Os tratamentos resultaram de duas formas de localização do calcário (localizada e não-localizada, 5 profundidades (0-5; 5-10; 10-15; 15-20; 20-25 cm e 10 genótipos de feijão-caupi(IT85D-3428-4-R2,4-HM; Apiaú; Hikari Graúdo; Pretinho Precoce 1; IT85D-3428-4-3-HP; USA; UFRR Grão Verde; BRS-Mazagão; Canapum e Sempre Verde. A unidade experimental foi constituída por 2dm3 de solo, dispostos em tubo de PVC com 25cm de altura,10cm de diâmetro e duas plantas de feijão. Os tubos foram confeccionados por meio da junção de 5 anéis com 5 cm cada, sendo que no anel inferior foi colocada uma placa delgada de isopor para permitir a acomodação do solo. Aos 40 dias após a emergência, as plantas foram coletadas, sendo determinada à produção de matéria seca das raízes e parte aérea. Os genótipos IT85D-3428-4-3-HP e UFRRGRÃO VERDE foram classificados como sendo de baixa tolerância, os genótipos USA, BRS-Mazagão, IT85D-3428-4-R2,4-HM e Sempre Verde, medianamente tolerantes e os genótipos Apiaú, Hikari Graúdo, Pretinho Precoce 1 e Canapum, tolerantes à acidez.= This research was carried out objecting to identify the sensibility of cowpea (Vigna unguiculata (L Walp genotypes to acidity conditions. The experiment was installed in a greenhouse located at Campus of Cauamé (Universidade Federal de Roraima in an oxisol of Roraima State (Brazil. The experimental design adopted was a completely andomized blocks in a factorial scheme 2 x 5 x 10 with three replicates. The terms of this factorial

  6. Preferência para alimentação e oviposição do manhoso, Chalcodermus bimaculatus Fiedler (Coleoptera: Curculionidae, em genótipos de feijão-caupi. = The feeding and oviposition preference of Chalcodermus bimaculatus Fiedler (Coleoptera: Curculionidae in cowpea genotype.

    Directory of Open Access Journals (Sweden)

    Antonio Cesar Silva Lima

    2009-12-01

    Full Text Available Objetivou-se com este trabalho avaliar a resistência do tipo antixenose de dez genótipos de feijão-caupi (Vigna unguiculata (L. Walp. ao manhoso (Chalcodermus bimaculatus Fiedler, em condições de campo. Os tratamentos consistiram de dez genótipos, sendo: Pretinho Precoce 1, UFRR Grão Verde, Apiaú, Iracema, BRS Mazagão, IT85D-3428-4-3-HP e IT85D-3428-4-R2-4-HM, Pingo de Ouro, Epace 10 e Pitiúba. O delineamento experimental utilizado foi o de blocos ao acaso com quatro repetições. A parcela experimental (2,8 x 5,0 m continha quatro fileiras de 5,0 m, espaçadas de 0,70 m com área total de 14 m2, deixando-se após o desbaste cinco plantas por metro. O cultivo se deu em condições de campo nos anos agrícolas 2004 e 2005. As avaliações foram realizadas semanalmente coletando-se aleatoriamente 10 vagens (no ponto de grão verde de cada genótipo nas fileiras centrais das parcelas. No laboratório de Entomologia Agrícola do CCA/UFRR fazia-se a contagem do número de cicatrizes superficiais na vagem, número de grãos perfurados na vagem, comprimento da vagem e o número de grãos cheios na vagem. Concluiu-se que BRS Mazagão apresenta resistência do tipo não-preferência para oviposição de C. bimaculatus; que Pingo de Ouro foi o mais preferido pelo manhoso tanto para alimentação quanto para a oviposição; e que há correlação positiva entre o número de cicatrizes superficiais por 10 cm de vagem do feijão-caupi e a percentagem de grãos perfurados na vagem. = The objective of this study was to evaluate the type antixenosis resistance of 10 cowpea genotypes, Vigna unguiculata (L. Walp., (Pretinho Precoce 1, UFRR Grão Verde, Apiaú, Iracema, BRS-Mazagão, IT85D-3428-4-3-HP and IT85D-3428-4-R2-4-HM, Pingo de Ouro, Epace 10, and Pitiúba to curculio, Chalcodermus bimaculatus Fiedler, during field conditions. Theexperimental design used consisted of randomized blocks with four replications. The genotypes were sowed in field

  7. Diversity and efficiency of bradyrhizobium strains isolated from soil samples collected from around sesbania virgata roots using cowpea as trap species Diversidade e eficiência simbiótica de estirpes de bradyrhizobium capturadas próximo ao sistema radicular de sesbania virgata usando caupi como planta-isca

    Directory of Open Access Journals (Sweden)

    Ligiane Aparecida Florentino

    2010-08-01

    Full Text Available The genetic diversity of ten Bradyrhizobium strains was evaluated for tolerance to high temperatures, to different salinity levels and for the efficiency of symbiosis with cowpea plants (Vigna unguiculata (L. Walp.. Eight of these strains were isolated from nodules that appeared on cowpea after inoculation with suspensions of soil sampled from around the root system of Sesbania virgata (wand riverhemp in ecosystems of South Minas Gerais. The other two strains used in our analyses as references, were from the Amazon and are currently recommended as cowpea inoculants. Genetic diversity was analyzed by amplifying repetitive DNA elements with the BOX primer, revealing high genetic diversity with each strain presenting a unique band profile. Leonard jar assays showed that the strains UFLA 03-30 and UFLA 03-38 had the highest N2-fixing potentials in symbiosis with cowpea. These strains had more shoot and nodule dry matter, more shoot N accumulation, and a higher relative efficiency than the strains recommended as inoculants. All strains grew in media of pH levels ranging from 4.0 to 9.0. The strains with the highest N2-fixing efficiencies in symbiosis with cowpea were also tolerant to the greatest number of antibiotics. However, these strains also had the lowest tolerance to high salt concentrations. All strains, with the exceptions of UFLA 03-84 and UFLA 03-37, tolerated temperatures of up to 40 ºC. The genetic and phenotypic characteristics of the eight strains isolated from soils of the same region were highly variable, as well as their symbiotic efficiencies, despite their common origin. This variability highlights the importance of including these tests in the selection of cowpea inoculant strains.Dez estirpes de rizóbios, sendo oito isoladas de amostras de solos coletadas próximo ao sistema radicular de Sesbania virgata, no Sul de Minas Gerais, e duas recomendadas como inoculante para o caupi (Vigna unguiculata (L. Walp. usadas como refer

  8. Salt stress in cowpea plants on biofertilized soil = Estresse salino em plantas de feijão-caupi em solo com fertilizantes orgânicos.

    Directory of Open Access Journals (Sweden)

    Geocleber Gomes de Sousa

    2014-12-01

    Full Text Available The use of organic fertilizer from animal waste can mitigate the harmful effects of salinity of irrigation water on the plants. This experiment was performed in the experimental area of the Universidade Federal do Ceará, Weather Station (Estação Meteorológica, from September to November 2012, aiming at evaluate the response of the cowpea (Vigna unguiculata L. to salinity levels and biofertilizer types in a greenhouse. The experimental design was that of completely randomized, 5x3 factorialwith five replications. The first factor consisted of electrical conductivity of irrigation water levels, as follows: 0.8 dS m-1; 1.5 dS m-1; 3.0 dS m-1; 4.5 dS m-1 and 6.0 dS m-1; and the second factor comprised three conditions: without biofertilizers (B0, with enriched crabbio fertilizer (B1 and with bovine common biofertilizer (B3. The evaluated variables were: photosynthesis, leaf temperature, transpiration, stomatal conductance, plant height, stem diameter, number of leaves, leaf area, and shoot dry mass. The crab enriched biofertilizer more efficiently mitigates the salt stress on plant height, stem diameter, number of leaves, leaf area, photosynthesis, transpiration and stomatal conductance of cowpea cultivar BRS ITAIM compared to plants with biofertilizer and biofertilizer bovine common. The biofertilizer of crab enriched more efficiently mitigates the salt stress on plant height, stem diameter, number of leaves, leaf area, photosynthesis, transpiration and stomatal conductance of cowpea cultivar BRS ITAIM compared to plants without biofertilizer and bovine common biofertilizer. = O uso de fertilizantes orgânicos provenientes de resíduos de origem animal pode atenuar os efeitos danosos da salinidade da água de irrigação sobre as plantas. Um experimento foi conduzido na área experimental da Estação Agrometeorológica da Universidade Federal do Ceará, Fortaleza, Ceará, no período de setembro a novembro de 2012, objetivando-se avaliar a

  9. Eficiência e diversidade fenotípica de bactérias diazotróficas que nodulam caupi [Vigna unguiculata (L.) Walp] e feijoeiro (Phaseolus vulgaris L.) em solos de mineração de bauxita em reabilitação Efficiency and phenotypic diversity among nitrogen-fixing bacteria that nodulate cowpea [Vigna unguiculata (L.) Walp] and common bean (Phaseolus vulgaris L.) in bauxite-mined soils under rehabilitation

    OpenAIRE

    Rogério Melloni; Fátima Maria de Sousa Moreira; Rafaela Simão Abrahão Nóbrega; José Oswaldo de Siqueira

    2006-01-01

    A atividade de mineração provoca degradação ambiental em várias partes do mundo, e técnicas de revegetação, empregando diversas espécies vegetais, têm sido indicadas, com vistas em reabilitar essas áreas. A eficiência e a diversidade de grupos-chave de bactérias, como as que nodulam leguminosas e fixam N2 (BNLFN), são de extrema importância, uma vez que estas participam de processos de ciclagem de nutrientes e contribuem para a sustentabilidade dessas áreas. Com o objetivo de avaliar a eficiê...

  10. Aspectos fisiológicos do feijão-caupi e crescimento de tiririca (Cyperus rotundus L. sob competição em solo compactado

    Directory of Open Access Journals (Sweden)

    E. N. Silva Terceiro

    2016-01-01

    Full Text Available Vários fatores estão envolvidos na interferência das plantas daninhas sobre as culturas e os aspectos fisiológicos ainda são pouco estudados. Assim, objetivou-se avaliar a interferência de diferentes populações de Cyperus rotundus L. e da compactação do solo nos caracteres fisiológicos do feijão-caupi [Vigna unguiculata (L. Walp] e na fenologia de C. rotundus. O experimento foi realizado em casa de vegetação no Centro de Ciências e Tecnologia Agroalimentar da Universidade Federal de Campina Grande, CCTA/UFCG, Campus de Pombal-PB. As unidades experimentais foram compostas por vasos com capacidade de 6 litros. Utilizou-se o delineamento inteiramente casualizado com tratamentos distribuídos em esquema fatorial 3 x 2, sendo os fatores três populações de C. rotundus (0, 2 e 3 tubérculos por vaso e dois níveis de compactação (solo sem compactação e solo com subsuperfície compactada artificialmente, com quatro repetições. Foram coletados os dados de: taxa de assimilação de CO2 (µmol m-2 s-1, transpiração (mmol de H2O m-2 s-1, condutância estomática (mol de H2O m-2 s-1 e concentração interna de CO2, com um analisador de gás infravermelho – IRGA LCpro (Infra-red Gas Analyzer. Com relação a Cyperaceae, foram coletados os seguintes dados: produção de fitomassa fresca e seca e relação raiz/parte aérea, número de tubérculos por vaso, produção diária de tubérculos e produção de tubérculos por unidade plantada; os quais foram submetidos à análise da variância e teste de médias, quando necessário. A presença de C. rotundus, reduziu a fotossíntese líquida do feijão-caupi de forma mais intensa do que a compactação do solo. C. rotundus expressou notável capacidade de reprodução vegetativa.Physiological Characters of Cowpea and Growth of nut grass (Cyperus rotundus L. under competition in the soil compressiveAbstract - Several factors are involved in weed interference on crops and physiological

  11. Resposta do feijão-caupi as lâminas de irrigação e as doses de fósforo no cerrado de Roraima Response of cowpea to water levels and phosphate fertilizer on the savanna of Roraima

    Directory of Open Access Journals (Sweden)

    Gabriela Almeida Oliveira

    2011-12-01

    Full Text Available O objetivo do trabalho foi estudar o comportamento do feijão-caupi (Vigna ungüiculata (L. Walp. cv. BRS Novaera sob quatro lâminas de água (273; 257; 241 e 187 mm e doses de fósforo (0; 70; 140; 210 kg ha-1 de P2O5, aplicados na forma de superfosfato triplo, em Boa Vista, Roraima. O delineamento experimental adotado foi o de blocos ao acaso, no esquema de parcelas subdivididas com quatro repetições. As parcelas foram constituídas pelas lâminas de água e as sub parcelas pelas doses de fósforo, resultando em 16 tratamentos. A irrigação foi realizada por um sistema convencional de aspersão, montado no campo segundo o sistema de "aspersão em linha". As massas seca da parte aérea e de 100 grãos foram influenciadas significativamente pela interação entre lâminas de água e doses de fósforo, enquanto o número de grãos por vagem e o comprimento da vagem foram influenciados somente pelas doses de fósforo. A dose de máxima eficiência econômica foi de 89,45 kg de P2O5, com produtividade de 1.306 kg ha-1.This work was carried out to evaluate the effect of irrigation depth and phosphate fertilizer (0; 70; 140; 210 kg ha-1 de P2O5 on yield and production components of cowpea (Vigna unguiculata L. Walp cv. Novaera at the Savanna of Roraima, Brazil. The experimental design was arranged in a completely randomized block in split-plot and four replications. Irrigation depths were applied through a sprinkler line source system. The principal treatments constituted on the depths of irrigation and the secondary treatments by the phosphate fertilizer. Significant effects (p < 0.05 of the depth of irrigation and phosphate fertilizer interaction with aerial mass production and mass of 100 grains were observed. The number of grains per pods and size of pod were affected by the phosphate fertilizer only. The highest economical yield (1,306 kg ha-1 was obtained by 89.45 kg of P2O5.

  12. Efeito de extratos vegetais no controle de Fusarium oxysporum f. sp tracheiphilum em sementes de caupi Effect of naturals extracts on the control of Fusarium oxysporum f. sp tracheiphilum in cowpea seeds

    Directory of Open Access Journals (Sweden)

    Jandiê Araújo da Silva

    2009-04-01

    environment. The present work had the objective to compare the effect of natural extracts on the control of Fusarium oxysporum f. sp tracheiphlum, originated from seeds of cowpea (Vigna unguiculata L, compared to chemical fungicide effect. Extracts of Allium sativum, Anadenanthera colubrine, and Ocimum basilicum were used alone or in combination with Mancozeb. A 50 µL aliquot of each treatment was added in a hole (6 mm of diameter made in the center of Petri dishes with BDA and a fungus mycelia disk was inoculated on it. Evaluations were done during seven days, measuring the pathogen mycelial growth. Seeds of cowpea were disinfected with sodium hypochlorite, sowed in plastic bags with autoclaved soil. Eight days after germination, wounds were made on the basal part of the plantlets, and fungus spore suspension (1.4 x 10-5 con/mL was applied on it. Evaluations of the disease severity were accomplished daily during 30 days after inoculation, using a disease index. Combination of extracts of A. sativum + Ocimum basilicum and Anadenanthera colubrina + Ocimum basilicum did not reduce fungus mycelial growth, whereas Ocimum basilicum extract alone showed minor mycelial growth, indicating fungicide action of this treatment on F. oxysporum f. sp tracheipphlum under the conditions studied. Combination of Mancozeb + Anadenanthera colubrina was responsible for lower average of severity on the evaluated plants.

  13. Comparação entre cultivares de soja quanto à preferência alimentar de Cerotoma arcuata e suscetibilidade a um isolado do vírus do mosaico severo do caupi Comparison among soybean cultivars concerning the feed preference of Cerotoma arcuata and susceptibility to an isolate of CpSMV

    Directory of Open Access Journals (Sweden)

    Fernando Javier Sanhueza Salas

    1998-01-01

    Full Text Available Entre as viroses que causam prejuízos às culturas de leguminosas no Brasil, principalmente soja (Glycine max, feijão (Pliaseolus vulgaris e caupi (Vigna unguiculata, inclui-se o mosaico severo do caupi, "cowpea severe mosaic Comovirus" - CpSMV, transmitido por Cerotoma arcuata (Coleóptera; Chrysomelidae. Um isolado deste vírus, denominado CpSMV-SP, proveniente de plantas de Vigna luteola coletadas no litoral sul do Estado de São Paulo, está sendo estudado no Laboratório de Fitovirologia e Fisiopatologia/ Instituto Biológico. O objetivo do presente trabalho consistiu em uma avaliação da preferência alimentar de C. arcuata em cultivares de soja e da suscetibilidade destes cultivares ao vírus. Na avaliação da preferência alimentar, os ensaios foram feitos com discos foliares colocados em placas de Petri, cobertas por copos plásticos, constituindo "arenas". Introduziu-se um coleóptero em cada "arena", realizando-se testes em confinamento, tanto com múltipla escolha (11 cultivares como sem (um único cultivar. Os cultivares avaliados foram: 'BR-4', 'COODEPEC-201', 'EMBRAPA-48', 'EMBRAPA-59', 'IAC-177IAC-15-1', 'IAC-20', 'IAC-100', 'IAS-5', 'IGUAÇU' e 'PL-1'. Os ensaios de transmissão foram feitos através de inoculação mecânica e pelo vetor C. arcuata. Os resultados mostraram que os 11 cultivares são suscetíveis ao vírus, quando a inoculação é feita por extrato (mecanicamente. Ocorre também transmissão pelo coleóptero, porém não no caso de IAC-20 e IAC-100. C. arcuata alimenta-se de todos os cultivares, em maior ou em menor intensidade, exceção feita ao IAC-20, fato que pode justificar a não transmissão pelo menos para estas plantas. Considerando que a disseminação natural do CpSMV-SP ocorre através do vetor, e que ela é negativa para os dois cultivares referidos, pode-se recomendar preferencialmente o seu plantio, no Estado de São Paulo.In Brazil, among the viruses causing crop losses in leguminous plants

  14. Timing of insecticidal application in vigna unguiculata (l.) Walp, cv ...

    African Journals Online (AJOL)

    In the 1990 planting, there was no significant difference in yield of treated and untreated plants (P = 0.05), but all treatments except at 7 DEA significantly reduced pod damage by the legume pod borer, Maruca testulalis Geyr. Though some of the treatments significantly reduced the percentage of seed damage when ...

  15. Genetic linkage map of cowpea (Vigna unguiculata (L.) Walp) using ...

    African Journals Online (AJOL)

    DR.ADETUNMBI

    2016-05-18

    May 18, 2016 ... Constructed map provides basic information that could assist in genetic improvement of .... mix contains two universal (FRET) fluorescent resonance energy transfer cassettes. (FAM and HEX), ROX™ passive reference dye, Taq polymerase, free nucleotides and MgCl2 in an optimized buffer solution, while ...

  16. Assessment of Phaseolus vulgaris L and Vigna unguiculata (L ...

    African Journals Online (AJOL)

    SAM

    2014-04-09

    Apr 9, 2014 ... searching natural compounds with biological activity. .... remain permanently open access under the terms of the Creative Commons Attribution License 4.0 ... (TLC) plate silica gel 60 F254 (Merck 2 × 6 cm), each plate was.

  17. Genetic linkage map of cowpea ( Vigna unguiculata (L.) Walp) using ...

    African Journals Online (AJOL)

    Genetic linkage maps provide a genomic framework for quantitative trait loci identification applied in marker assisted selection breeding in crops with limited resources. It serves as a powerful tool to breeders for analysing the mode of inheritance of genes of interest and monitoring of the transmission of target genes from ...

  18. Chemical composition of Lablab purpureus and Vigna unguiculata ...

    African Journals Online (AJOL)

    Esnart Mukumbo

    2018-02-06

    Feb 6, 2018 ... condensed tannins, and saponins using standard methods. ..... Analysis of variance was used to determine the effects of legume species and ..... of tannins in the plant kingdom: hydrolysable tannins (HTs) and condensed.

  19. Effect of variety mixtures on cowpea (Vigna unguiculata) vegetable ...

    African Journals Online (AJOL)

    jokonya

    AN EVALUATION OF SIX COWPEA VARIETIES GROWN ... provide cheap sources of protein, micronutrients and mineral elements that can ... traditional vegetables is that, these leafy vegetables are present in most home ..... REFERENCES. 1.

  20. Fungal species associated with Vigna unguiculata (L.) Walp (Cowpea)

    African Journals Online (AJOL)

    Aspergillus niger Van Tieghem, Botryodiplodia theobromae (Pat) Novel, Fusarium oxysporum Schlecht and Rhizopus stolonifer Ehrenb ex Link were isolated from both blotter and agar methods. Botryodiplodia theobromae had the highest mean occurrence (42.37%) followed by Fusarium oxysporum (30.02%), Aspergillus ...

  1. Genetic variability in cowpea (Vigna unguiculata (L.) Walp.) genotypes

    African Journals Online (AJOL)

    sive protein in human diets with grains containing about. 23–25% protein ... Keywords: heritability, phenotype, principal component analysis, variance. Introduction .... be due to genotype, environment, and the interaction of genotype and ...

  2. Storing cowpea (Vigna unguiculata) seeds in active cattle kraals for ...

    African Journals Online (AJOL)

    Yomi

    2012-10-09

    Oct 9, 2012 ... propagation of crops through seeds (Hartmann et al.,. 1988). Previously, Bremner and Krogmeier (1989) demonstrated that the adverse effect of urea fertilisers on seed germination in soil was due to ammonia and CO2, which are released during hydrolysis of urea by soil urease. Apparently, in this storage ...

  3. FIXING ABILITY OF COWPEA (Vigna unguiculata (L) Walp)

    African Journals Online (AJOL)

    sys01

    2011-09-03

    Sep 3, 2011 ... mixture and later thinned to two plants per stand at two weeks after planting (2 WAP).,This gave a total population of about 80, 000 plants per ... nitrogen requirement from the atmosphere. Root nodules formed by soil rhizobia ..... solar radiation requirements on growth and nitrogen fixation of soybean,.

  4. Genetic engineering in Cowpea (Vigna unguiculata): history, status and prospects.

    Science.gov (United States)

    Citadin, Cristiane T; Ibrahim, Abdulrazak B; Aragão, Francisco J L

    2011-01-01

    In the last three decades, a number of attempts have been made to develop reproducible protocols for generating transgenic cowpea that permit the expression of genes of agronomic importance. Pioneer works focused on the development of such systems vis-à-vis an in vitro culture system that would guarantee de novo regeneration of transgenic cowpea arising from cells amenable to one form of gene delivery system or another, but any such system has eluded researchers over the years. Despite this apparent failure, significant progress has been made in generating transgenic cowpea, bringing researchers much nearer to their goal than thirty years ago. Now, various researchers have successfully established transgenic procedures for cowpea with evidence of inherent transgenes of interest, effected by progenies in a Mendelian fashion. New opportunities have thus emerged to optimize existing protocols and devise new strategies to ensure the development of transgenic cowpea with desirable agronomic traits. This review chronicles the important milestones in the last thirty years that have marked the evolution of genetic engineering of cowpea. It also highlights the progress made and describes new strategies that have arisen, culminating in the current status of transgenic technologies for cowpea.

  5. Mycological evaluation of the phylloplane of Vigna unguiculata (L ...

    African Journals Online (AJOL)

    PROF HORSFALL

    2018-04-15

    Apr 15, 2018 ... plate technique and eleven fungal isolates were obtained from nine of the cultivars. Pathogenicity ... southern pea, field pea, china pea, crowder pea, lubia, niebe ... nutritious providing protein, vitamins and minerals. Fatokun ...

  6. Effects of feeding different levels of cowpea (Vigna unguiculata) on ...

    African Journals Online (AJOL)

    glucose by the hexokinase method (Gemeni, ENI Company). Total protein was ... compared by an 8 by 2 chi-square contingency test, using sin- .... small intestinal morphology caused by feeding cowpea diet ... Similar views were documented.

  7. Stable gene transformation in cowpea (Vigna unguiculata L. walp ...

    African Journals Online (AJOL)

    The size of microcarriers, microflight distance and helium pressure significantly affected transient expression of reporter genes. A total of 1692 explants were bombarded with DNA-coated particles and placed on 3 mg/l bialaphos selective medium. Only 12 regenerated shoots produced seeds eventually, and all were Gus ...

  8. CRESCIMENTO DO FEIJÃO-CAUPI IRRIGADO COM ÁGUA RESIDUÁRIA DE ESGOTO DOMÉSTICO TRATADO

    Directory of Open Access Journals (Sweden)

    JONATAS RAFAEL LACERDA REBOUÇAS

    2010-01-01

    Full Text Available In order to evaluate foliar production of cowpea (Vigna unguiculata (L. Walp. was accomplished in an experiment under greenhouse conditions. The study was conducted in a completely randomized design with six treatments: T1 - tap water; T2, T3, and T4 mixture of wastewater and tap water (25-75%; 50-50% and 75-25%, respectively, T5 - wastewater only, and T6 - tap water + mineral fertilization, and four replications. The results showed that increasing the proportion of wastewater in the treatments T2 to T5 there was a simultaneous increase in dry mater production of root, stem and leaf. In the absence of mineral fertilization, soils irrigated with treated wastewater were able to attend nutritional requirements of the tested plant, proving wastewater to be a viable source of water and nutrients for plants.

  9. Comparative nutritional analysis between Vigna radiata and Vigna ...

    African Journals Online (AJOL)

    Vigna radiata (mung bean) and Vigna mungo (mash bean) of the family Fabaceae are among staple food in Pakistan. The experiments were conducted on these beans to determine the proximate composition such as moisture, ash, fibre, fat and protein content. The protein isolates from V. radiata and V. mungo was ...

  10. Métodos para avaliação da qualidade fisiológica de sementes de feijão vigna Methods for evaluation of physiological quality of vigna bean seeds

    Directory of Open Access Journals (Sweden)

    Antonieta Laurinda Francisco Bias

    1999-07-01

    Full Text Available Visando comparar diferentes testes de vigor quanto à avaliação da qualidade fisiológica, quatro lotes de sementes de feijão vigna (Vigna unguiculata W. de duas cultivares ('EPACE-10' e 'IPA-206' foram armazenados por 180 dias (novembro/94 a maio/95, em condições normais de ambiente em Pelotas, RS. Bimestralmente, foram conduzidos testes de germinação, envelhecimento acelerado, condutividade elétrica, frio sem solo, emergência de plântulas em campo e peso de matéria seca da parte aérea das plântulas. A análise e a interpretação dos resultados indicaram que a avaliação da qualidade fisiológica de sementes de feijão vigna deve ser fundamentada no conjunto das informações fornecidas por diferentes testes de vigor. O teste de frio sem solo, dentre os testes estudados, é o que apresenta melhor relação com a emergência das plântulas em campo. O peso de matéria seca da parte aérea das plântulas não é eficiente na separação de lotes de sementes de feijão vigna em diferentes níveis de vigor.The aim of this research was to compare vigor tests for seed quality evaluation. Four seed lots of vigna bean (Vigna unguiculata W. of two cultivares (EPACE-10 and IPA-206, were stored for six months (november/94 to may/95 at natural environmen conditions of Pelotas, RS, Brazil and evaluated at two month intervals, throught the following tests: germination, accelerated aging, cold test without soil, electrical condutivity, seedling dry weight and field emergence tests. The analysis and interpretation of the results showed that the evaluation of the physiological quality of vigna bean seeds needs to be based on different vigor tests. Among the tests, the cold test without soil was the best related with seedling field emergence. The seedling dry weight was not effective to separate vigna bean seed lots in different vigor levels.

  11. Detection of Aflatoxin Producing Aspergillus flavus in Post-harvest Contaminated Vigna ungulculata Seeds

    Directory of Open Access Journals (Sweden)

    Ajay Kumar Gautam

    2014-07-01

    Full Text Available The present study was carried out with a specific objective to study postharvest spoilage of Lobhiya (Vigna unguiculata seeds contaminated with Aspergillus flavus. Infected seeds were collected and cultured on potato dextrose agar (PDA media, at 25±2 °C. Aspergillus flavus isolates were primarily characterized by its morphological and microscopic characteristics. Collected fungal isolates were also screened for their afaltoxigenic nature on preliminary basis and at molecular level. For preliminary screening, 5 mm disc of fungal culture was soaked with few drops of liquid ammonia. Color change from yellow pigment to plum-red with different intensities showed the mycotoxic nature of the fungus. DNA from fungal isolates was isolated and amplified using PCR with aflatoxin specific primers, apa-2, ver-1 and omt-1. Amplicons of 1032 bp, 895 bp and 596 bp were obtained in most of the isolates regardless of primer set used which was useful to differentiate between mycotoxic and nontoxic isolates of A. flavus. The isolation of aflatoxigenic strains of A. flavus during post-harvest period of lobhiya seeds raise a serious concern over the quality of seeds and a threat to heath of consumers. It was concluded that Aspergillus flavus is responsible for postharvest spolilage of Lobhiya (Vigna unguiculata.

  12. DOSES DE NÍQUEL EM FEIJÃO CAUPI CULTIVADO EM DOIS SOLOS

    Directory of Open Access Journals (Sweden)

    MARCELA CAMPANHARO

    2013-01-01

    Full Text Available Ni was the last nutrient characterized like essenti al for plants. Its essentiality is due to participa - tion as constituent of urease enzyme, which makes i t extremely important for the metabolism of N. Thus , the objective of this study was to investigate the grow th, content and accumulation of urea and nutrients in cowpea bean plants ( Vigna unguiculata (L. Walp. ‘IPA 206’ according to nickel rate and two soil types. The experi- ment was carried out in a greenhouse at Universidad e Estadual do Norte Fluminense Darcy Ribeiro, using a 5 x 2 factorial scheme in a randomized block design wit h four replications. Treatments consisted of foliar applica- tions of five nickel concentrations (0, 20, 40, 60 and 100 mg L -1 Ni in the form of NiCl 2 .6H 2 O and two soils, a Typic Quartzipsamment and a Tb dystrophic Red-Yello w Ultisol. Ni rates promoted Ni toxicity symptoms j ust on young leaves of bean. These symptoms were charac terized by small reddish spots that have not progre ssed during the time and did not influence on the plants development. The foliar application of Ni increase d levels of this micronutrient in stems, mature leaves, youn g leaves and pods of cowpea bean, indicating high m obility of this micronutrient in the plant, but did not alt er the urea contents, indicating no effect on the a ctivity of urease enzyme. The dry mass of the shoots and the c ontent of others nutrients were not affected by fol iar appli- cation of Ni. Plants grown in Ultisol showed higher growth and higher content of urea and Cu in mature leaves; K and B in mature leaves, young leaves and twigs an d Zn in mature leaves and stem.

  13. Barrières pré-zygotiques chez les hybrides entre formes sauvages du niébé, Vigna unguilata (L. Walp.

    Directory of Open Access Journals (Sweden)

    Baudoin JP.

    2006-01-01

    Full Text Available Hybrids pre-zygotic barriers between wild forms of cowpea. The wild forms of cowpea, Vigna unguiculata, constitute an important gene pool insufficiently exploited for the improvement of the cultivated form. In order to promote the use of these wild forms in the genetic improvement programmes, we undertook to understand the various incompatibility reactions which appear in the crosses between wild forms. Efforts were concentrated to understand the incompatibility barriers in the hybridizations between subsp. baoulensis NI 933 and the other wild forms of V. unguiculata. Thanks to the use of the aniline blue fluorescence, we observed a high frequency of pre-zygotic barriers. They appear in three sites, i.e. the higher and lower third of the style, and within the ovary. However, these incompatibility barriers are not absolute. Indeed, in our hybridizations, more than 4% of the ovules were fertilized in the various studied combinations.

  14. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  15. First Report of Cucumber mosaic virus Isolated from Wild Vigna angularis var. nipponensis in Korea

    Directory of Open Access Journals (Sweden)

    Mi-Kyeong Kim

    2014-06-01

    Full Text Available A viral disease causing severe mosaic, necrotic, and yellow symptoms on Vigna angularis var. nipponensis was prevalent around Suwon area in Korea. The causal virus was characterized as Cucumber mosaic virus (CMV on the basis of biological and nucleotide sequence properties of RNAs 1, 2 and 3 and named as CMV-wVa. CMV-wVa isolate caused mosaic symptoms on indicator plants, Nicotiana tabacum cv. Xanthi-nc, Petunia hybrida, and Cucumis sativus. Strikingly, CMV-wVa induced severe mosaic and malformation on Cucurbita pepo, and Solanum lycopersicum. Moreover, it caused necrotic or mosaic symptoms on V. angularis and V. radiate of Fabaceae. Symptoms of necrotic local or pin point were observed on inoculated leaves of V. unguiculata, Vicia fava, Pisum sativum and Phaseolus vulgaris. However, CMV-wVa isolate failed to infect in Glycine max cvs. ‘Sorok’, ‘Sodam’ and ‘Somyeong’. To assess genetic variation between CMV-wVa and the other known CMV isolates, phylogenetic analysis using 16 complete nucleotide sequences of CMV RNA1, RNA2, and RNA3 including CMV-wVa was performed. CMV-wVa was more closely related to CMV isolates belonging to CMV subgroup I showing about 85.1–100% nucleotide sequences identity to those of subgroup I isolates. This is the first report of CMV as the causal virus infecting wild Vigna angularis var. nipponensis in Korea.

  16. Association analysis of salt tolerance in cowpea (Vigna unguiculata (L.) Walp) at germination and seedling stages

    Science.gov (United States)

    Cowpea is one of the most important cultivated legumes in Africa. The worldwide annual production in cowpea dry seed is 5.4 million metric tons. However, cowpea is unfavorably affected by salinity stress at germination and seedling stages, which is exacerbated by the effects of climate change. The l...

  17. Dual-purpose cowpea ( Vigna unguiculata (L.) Walp.) straw as sole ...

    African Journals Online (AJOL)

    L.) Walp.) (IT89KD-391; IT86D-716; IT86D-719; IT81D-994) using 24 West African dwarf (WAD) rams solefed the straw over a 60-d period. Voluntary dry matter (57 to 88 g kg-1 W0.75 d-1), organic matter (OM) ranged from 50.5 to 78.9 g kg-1 ...

  18. Symbiotic functioning and bradyrhizobial biodiversity of cowpea (Vigna unguiculata L. Walp. in Africa

    Directory of Open Access Journals (Sweden)

    Dakora Felix D

    2010-03-01

    Full Text Available Abstract Background Cowpea is the most important food grain legume in Sub-Saharan Africa. However, no study has so far assessed rhizobial biodiversity and/or nodule functioning in relation to strain IGS types at the continent level. In this study, 9 cowpea genotypes were planted in field experiments in Botswana, South Africa and Ghana with the aim of i trapping indigenous cowpea root-nodule bacteria (cowpea "rhizobia" in the 3 countries for isolation, molecular characterisation using PCR-RFLP analysis, and sequencing of the 16S - 23S rDNA IGS gene, ii quantifying N-fixed in the cowpea genotypes using the 15N natural abundance technique, and iii relating the levels of nodule functioning (i.e. N-fixed to the IGS types found inside nodules. Results Field measurements of N2 fixation revealed significant differences in plant growth, δ15N values, %Ndfa and amounts of N-fixed between and among the 9 cowpea genotypes in Ghana and South Africa. Following DNA analysis of 270 nodules from the 9 genotypes, 18 strain IGS types were found. Relating nodule function to the 18 IGS types revealed significant differences in IGS type N2-fixing efficiencies. Sequencing the 16S - 23S rDNA gene also revealed 4 clusters, with cluster 2 forming a distinct group that may be a new Bradyrhizobium species. Taken together, our data indicated greater biodiversity of cowpea bradyrhizobia in South Africa relative to Botswana and Ghana. Conclusions We have shown that cowpea is strongly dependant on N2 fixation for its N nutrition in both South Africa and Ghana. Strain IGS type symbiotic efficiency was assessed for the first time in this study, and a positive correlation was discernible where there was sole nodule occupancy. The differences in IGS type diversity and symbiotic efficiency probably accounts for the genotype × environment interaction that makes it difficult to select superior genotypes for use across Africa. The root-nodule bacteria nodulating cowpea in this study all belonged to the genus Bradyrhizobium. Some strains from Southern Africa were phylogenetically very distinct, suggesting a new Bradyrhizobium species.

  19. Gas exchange and mass distribution of the cowpea (Vigna unguiculata [L.] Walp. under water deficit

    Directory of Open Access Journals (Sweden)

    Cardona-Ayala Carlos Enrique

    2013-12-01

    Full Text Available Drought tolerance is important for the survival and productivity of plants in environments where drought periods are increasing as a result of climate variability attributable to natural causes and climate change caused by human activities. The objective of this study was to evaluate the dynamics of photosynthesis (A, stomatal conductance (gs and intrinsic water-use efficiency (WUE=A/gs as a function of soil moisture content over a period of drought and the post-stress recovery of 14 cowpea genotypes. The studied genotypes tolerated soil moisture tensions close to -2 Mpa with no permanent wilting. Starting at a soil hydric potential of -0.7 MP a, decreases in photosynthesis (A, stomatal conductance (gs and transpiration (E were evident, as well as an increase in A/gs, which varied by genotype. Estimating with regression models allowed for the discrimination of the degrees of drought tolerance between the cultivars. At 4 days after resuming hydration, no significant differences were found between the means of A, gs, A/gs and E, suggesting drought tolerance in all genotypes. The genotypes: L-047 and L-034 conserved between 4 and 6 leaves, displaying the highest delayed leaf senescence during drought. Furthermore, they presented the highest biomass at 16 days post-stress recovery

  20. Kenaf (Hibiscus cannabinus) and cowpea (Vigna unguiculata) as sugarcane cover crops

    Science.gov (United States)

    A Louisiana sugarcane field is typically replanted every four years due to declining yields, and, although, it is a costly process, it is both necessary and an opportunity to maximize the financial return during the next four year cropping cycle. Fallow planting systems (FPS) during the fallow perio...

  1. Determination of Urease Biochemical Properties of Asparagus Bean (Vigna unguiculata ssp sesquipedalis L.)

    Science.gov (United States)

    Zusfahair; Ningsih, D. R.; Fatoni, A.; Pertiwi, D. S.

    2018-04-01

    Urease is enzyme that plays a role in nitrogen metabolism during plant germination. Plants that produce a lot of urease are grains. This study used asparagus bean as source of urease. The purpose of this research is to learn the effect of germination time on the activity of urease enzyme from asparagus bean and its biochemical properties. The research was started by germination of asparagus bean on day 2, 4, 6, 8, 10 and 12. Asparagus bean sprouts were extracted using acetone and separated by centrifugation to obtain the crude extract of urease. The biochemical properties of the crude extract of urease was further determined including: the effect of temperature, pH, substrate concentration, and metal addition to urease activity. The urease activity is determined by the Nessler method. The germination time of asparagus bean in yielding urease enzyme reached the optimum activity on the 8th day with activity value of 593.7 U/mL. The biochemical properties of urease from asparagus bean have optimum activity at 35 °C, pH 7.0 and substrate concentration 0.125% with activity value of 600 U/mL. Addition of CaCl2, SnCl2 and ZnCl2 metals decrease the activity of urease.

  2. Complete sterility studies in three mutants of cowpea (Vigna Unguiculata (L.) walp

    International Nuclear Information System (INIS)

    Adu-Dapaah, H. K.; Singh, B. B.; Fatokun, C. A.

    1999-01-01

    Three completely-sterile cowpea mutants IT85D-3625, IT85D-3628, IT85D-3641 obtained from spontaneous mutation and gamma irradiation were-characterized. Reciprocal crosses between them and fertile plants failed to set pods. These lines showed significant differences with respect to various traits such as number of pollen grain per anther, anther length and width, plant height, anther indehiscence,unopened flower buds, and premature abortion of pods and seeds. The major cause of sterility was chromosome aberrations. Complete sterility in each of the three lines was conditioned by a simple recessive gene pair. Sterility in each of the three mutants was associated with floral aberrations. The symbols cs 1 , cs 2 and cs 3 are being assigned to IT85D-3625, IT85D-2628 and IT85D-3641 respectively. The three mutants were homogeneous with reference to sterility inheritance. (au)

  3. Proanthocyanidin profile of cowpea (Vigna unguiculata) reveals catechin-O-glucoside as the dominant compound.

    Science.gov (United States)

    Ojwang, Leonnard O; Yang, Liyi; Dykes, Linda; Awika, Joseph

    2013-08-15

    Proanthocyanidin (PA) profile and content can have important nutritional and health implications on plant foods. Six diverse cowpea phenotypes (black, red, green, white, light-brown and golden-brown) were investigated for PA composition using normal-phase HPLC and reversed-phase UPLC-TQD-MS. Catechin and (epi)afzelechin were the major flavan-3-ol units. Unusual composition was observed in all cowpea phenotypes with significant degrees of glycosylation in the monomers and dimers. The PA content of cowpea (dry basis) ranged between 2.2 and 6.3 mg/g. Monomeric flavan-3-ols were the largest group of PA (36-69%) in cowpea, with catechin-7-O-glucoside accounting for most (about 88%) of the monomers. The oligomers with degree of polymerization (DP) 2-4 ranged from 0.41 to 1.3 mg/g (15-20%), whereas DP>10 polymers accounted for only 13.5% of PA. Future studies that highlight the impact of the unusual cowpea PA profile on nutritional and bioactive properties of this important legume are warranted. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Determination of some mineral components of cowpea (Vigna unguiculata (L.) Walp) using instrumental neutron activation analysis

    International Nuclear Information System (INIS)

    Asante, I.K; Acheampong, A.O.; Adu-Dapaah, H.

    2007-01-01

    Some mineral elements in the seeds of the cowpea were determined using instrumental neutron activation analysis. The cowpea cultivars were made up of improved varieties (Soronko, Gbeho, Ayiyi, Asontem, Asontem1, Bengpla, Asetenapa and Adom), farmers' accessions (87/7, 87/1, 87/27, 87/147, 87/34, 87/49, 87/83, 87/157, 87/149, 87/30, 87/153, 96/046, 87/137, 96/129, BTB 96/091, OAA 96/30, BTB 96/054), and experimental materials (IT870-677-2, Caroni, Kaase Market, 1977 and 1239). A total of 14 elements (Al, Ca, Mg, V, Mn, Br, Cl, K, Na, Zn, Cu, Ta, Si and In) were detected in the seeds of the 30 cowpea cultivars. Five of the elements (Na, K, Mg, Ca and Cl) identified are classified as major elements in the human body, while four (Mn, Zn, V, Si) are trace elements. The major elements K, Na, Ca, Mg and Cl were detected in high concentration in cultivars 96/129, 87/137, Ayiyi, 87/34 and 87/49, respectively. The trace elements Mn, Zn, V, Si, Cu and Al were detected in high concentration in cultivars 87/34, 87/27, 87/34, Bengpla, 87/34 and 87/34, respectively. From the results the following accessions could be selected and incorporated into a cowpea mineral nutritional improvement programme: 96/129, 87/137, Ayiyi, 87/34, 87/49 and 87/27. The presence of the five major elements and the trace elements indicates that cowpea has a rich source of mineral elements and, therefore, can be used to improve the diet of both humans and livestock. (au)

  5. Genetic differentiation and diversity upon genotype and phenotype in cowpea (Vigna unguiculata L. Walp.)

    Science.gov (United States)

    The evolution of species is complex and subtle, which always associates with the genetic variation and environment adaption during active/ passive spread or migration. In crops, this process is usually driven and influenced by human activities such as domestication, cultivation and immigration. One ...

  6. Additive interactions of unrelated viruses in mixed infections of cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Nsa, Imade Y; Kareem, Kehinde T

    2015-01-01

    This study was carried out to determine the effects of single infections and co-infections of three unrelated viruses on three cowpea cultivars (one commercial cowpea cultivar "White" and 2 IITA lines; IT81D-985 and TVu 76). The plants were inoculated with Cowpea aphid-borne mosaic virus (CABMV), genus Potyvirus, Cowpea mottle virus (CMeV), genus Carmovirus and Southern bean mosaic virus (SBMV), genus Sobemovirus singly and in mixture (double and triple) at 10, 20, and 30 days after planting (DAP). The treated plants were assessed for susceptibility to the viruses, growth, and yield. In all cases of infection, early inoculation resulted in higher disease severity compared with late infection. The virus treated cowpea plants were relatively shorter than buffer inoculated control plants except the IT81D-985 plants that were taller and produced more foliage. Single infections by CABMV, CMeV, and SBMV led to a complete loss of seeds in the three cowpea cultivars at 10 DAP; only cultivar White produced some seeds at 30 DAP. Double and triple virus infections led to a total loss of seeds in all three cowpea cultivars. None of the virus infected IITA lines produced any seeds except IT81D-985 plants co-infected with CABMV and SBMV at 30 DAP with a reduction of 80%. Overall, the commercial cultivar "White" was the least susceptible to the virus treatments and produced the most yield (flowers, pods, and seeds). CABMV was the most aggressive of these viruses and early single inoculations with this virus resulted in the premature death of some of the seedlings. The presence of the Potyvirus, CABMV in the double virus infections did not appear to increase disease severity or yield loss. There was no strong evidence for synergistic interactions between the viruses in the double virus mixtures.

  7. Screening selected genotypes of cowpea [Vigna unguiculata (L.) Walp.] for salt tolerance during seedling growth stage.

    Science.gov (United States)

    Gogile, A; Andargie, M; Muthuswamy, M

    2013-07-15

    The environmental stress such as, salinity (soil or water) are serious obstacles for field crops especially in the arid and semi-arid parts of the world. This study was conducted to assess the potential for salt tolerance of cowpea genotypes during the seedling stage. The experimental treatments were 9 cowpea genotypes and 4 NaCl concentrations (0, 50, 100 and 200 mM) and they were tested in greenhouse. The experimental design was completely randomized design in factorial combination with three replications. Data analysis was carried out using SAS (version 9.1) statistical software. Seedling shoots and root traits, seedling shoots and root weight, number of leaves and total biological yield were evaluated. The analyzed data revealed highly significant (p cowpea genotypes, treatments and their interactions. It is found that salt stress significantly decreased root length, shoot length, seedling shoot and root weight of cowpea genotypes. The extent of decrease varied with genotypes and salt concentrations. Most genotypes were highly susceptible to 200 mM NaCl concentration. The correlation analysis revealed positive and significant association among most of the parameters. Genotypes 210856, 211557 and Asebot were better salt tolerant. The study revealed the presence of broad intra specific genetic variation in cowpea varieties for salt stress with respect to their early biomass production.

  8. Genetic Diversity and Population Structure of Cowpea (Vigna unguiculata L. Walp).

    Science.gov (United States)

    Xiong, Haizheng; Shi, Ainong; Mou, Beiquan; Qin, Jun; Motes, Dennis; Lu, Weiguo; Ma, Jianbing; Weng, Yuejin; Yang, Wei; Wu, Dianxing

    2016-01-01

    The genetic diversity of cowpea was analyzed, and the population structure was estimated in a diverse set of 768 cultivated cowpea genotypes from the USDA GRIN cowpea collection, originally collected from 56 countries. Genotyping by sequencing was used to discover single nucleotide polymorphism (SNP) in cowpea and the identified SNP alleles were used to estimate the level of genetic diversity, population structure, and phylogenetic relationships. The aim of this study was to detect the gene pool structure of cowpea and to determine its relationship between different regions and countries. Based on the model-based ancestry analysis, the phylogenetic tree, and the principal component analysis, three well-differentiated genetic populations were postulated from 768 worldwide cowpea genotypes. According to the phylogenetic analyses between each individual, region, and country, we may trace the accession from off-original, back to the two candidate original areas (West and East of Africa) to predict the migration and domestication history during the cowpea dispersal and development. To our knowledge, this is the first report of the analysis of the genetic variation and relationship between globally cultivated cowpea genotypes. The results will help curators, researchers, and breeders to understand, utilize, conserve, and manage the collection for more efficient contribution to international cowpea research.

  9. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Dhanasekar, P; Reddy, K S

    2015-02-01

    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  10. Diversity in 113 cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers.

    Science.gov (United States)

    Egbadzor, Kenneth F; Ofori, Kwadwo; Yeboah, Martin; Aboagye, Lawrence M; Opoku-Agyeman, Michael O; Danquah, Eric Y; Offei, Samuel K

    2014-01-01

    Single Nucleotide Polymorphism (SNP) markers were used in characterization of 113 cowpea accessions comprising of 108 from Ghana and 5 from abroad. Leaf tissues from plants cultivated at the University of Ghana were genotyped at KBioscience in the United Kingdom. Data was generated for 477 SNPs, out of which 458 revealed polymorphism. The results were used to analyze genetic dissimilarity among the accessions using Darwin 5 software. The markers discriminated among all of the cowpea accessions and the dissimilarity values which ranged from 0.006 to 0.63 were used for factorial plot. Unexpected high levels of heterozygosity were observed on some of the accessions. Accessions known to be closely related clustered together in a dendrogram drawn with WPGMA method. A maximum length sub-tree which comprised of 48 core accessions was constructed. The software package structure was used to separate accessions into three groups, and the programme correctly identified varieties that were known hybrids. The hybrids were those accessions with numerous heterozygous loci. The structure plot showed closely related accessions with similar genome patterns. The SNP markers were more efficient in discriminating among the cowpea germplasm than morphological, seed protein polymorphism and simple sequence repeat studies reported earlier on the same collection.

  11. Association mapping of aphid resistance in USDA cowpea (Vigna unguiculata L. Walp.) core collection using SNPs

    Science.gov (United States)

    Cowpea aphid (CPA; Aphis craccivora) is a destructive insect pest of cowpea, as well as other legume crops including alfalfa, beans, chickpea, lentils, lupins and peanuts. The utilization of aphid resistance in cowpea breeding is one of the most efficient and environmental friendly methods to contro...

  12. New molecular features of cowpea bean (Vigna unguiculata, l. Walp) β-vignin.

    Science.gov (United States)

    de Souza Ferreira, Ederlan; Capraro, Jessica; Sessa, Fabio; Magni, Chiara; Demonte, Aureluce; Consonni, Alessandro; Augusto Neves, Valdir; Maffud Cilli, Eduardo; Duranti, Marcello; Scarafoni, Alessio

    2018-02-01

    Cowpea seed β-vignin, a vicilin-like globulin, proved to exert various health favourable effects, including blood cholesterol reduction in animal models. The need of a simple scalable enrichment procedure for further studies for tailored applications of this seed protein is crucial. A chromatography-independent fractionation method allowing to obtain a protein preparation with a high degree of homogeneity was used. Further purification was pursued to deep the molecular characterisation of β-vignin. The results showed: (i) differing glycosylation patterns of the two constituent polypeptides, in agreement with amino acid sequence features; (ii) the seed accumulation of a gene product never identified before; (iii) metal binding capacity of native protein, a property observed only in few other legume seed vicilins.

  13. Penambahan kelapa (Cocos nucifera dan kacang tolo (Vigna unguiculata terhadap nilai indeks glikemik singkong (Manihot utilissima

    Directory of Open Access Journals (Sweden)

    Rini Astuti

    2013-07-01

    Full Text Available Backgound: The glycemic index (GI is a notion that defences the glycaemic potency of foods. Foods with low GI will be digested and turned into glucose gradually and slowly. As a result blood glucose peak will not be so high and its fluctuation relatively in short time. Although cassava is a good source of carbohydrate, it has a high GI and low protein. Its GI factor needs to be reduced by any efforts to make it a healthy alternative food in spite of rice. Objective: To analize the effect of adding coconut and black-eyed pea to the GI factor of cassava. Method: The study used experimental observation design. There were three groups of treatment with 9 persons in each goup. After fasting for 10 hours, blood glucose were tested and 50 g of true glucose were given. Blood glucose of the subjects were tested again after 30, 60, 90 and 120 minutes giving true glucose. Next on the seventh day, they were given boiled cassava, cassava with coconut (sawut and cassava with black-eyed pea (gintul. After which their blood glucose were also tested. Results: GI factor of steam cassava, shredded cassava and shredded cassava with black-eyed pea (gintul was 100,40; 70,90; and 61,88; respectively. There was a significant difference of GI level between three products (p=0,031. Conclusion: Food processing by adding coconut and black-eyed pea has effect in reducing the GI level of cassava.

  14. Enhancing the digestibility of cowpea (Vigna unguiculata) by traditional processing and fermentation

    NARCIS (Netherlands)

    Madode, Y.E.; Nout, M.J.R.; Bakker, E.J.; Linnemann, A.R.; Hounhouigan, D.J.; Boekel, van M.A.J.S.

    2013-01-01

    Flatulence is an important drawback for the consumption of legumes. Therefore, the ability of traditional processing (dehulling, boiling, soaking) and fermentation (bacterial, fungal or yeast) of cowpeas to reduce flatulence was investigated. Raw and processed cowpeas were assessed for their

  15. Evaluation of the Genetic Variation of Cowpea Landraces (Vigna unguiculata from Western Cameroon Using Qualitative Traits

    Directory of Open Access Journals (Sweden)

    Toscani NGOMPE-DEFFO

    2017-12-01

    Full Text Available Characterization of the genetic diversity and analysis of the genetic relationship between accessions of a crop species is a key step in breeding superior cultivars. The main objective of the hereby study was to determine the genetic variation between 30 cowpea accessions collected throughout the eight divisions of the Western Region of Cameroon using qualitative traits. Phenotypic variation of these accessions was evaluated using diversity indices and cluster analyses. A total of twenty qualitative traits were used for the study. Fifteen of them (75% were polymorphic, displaying each at least two phenotypic classes. The monomorphic characters were growth pattern, leaf color, leaf hairiness, plant hairiness and pod hairiness, each with only one phenotypic class. Results showed a relatively significant level of genetic diversity among the studied cowpea accessions. Overall, the average of the observed and effective number of phenotypic classes per qualitative trait were Na = 2.350 and Ne = 1.828 respectively. The Nei’s genetic diversity and the Shannon weaver diversity index were He = 0.369, ranging from zero (monomorphic trait to 0.655 (growth habit and H’ = 0.609, ranging from zero (monomorphic trait to 0.996 (seed crowding, respectively. The dendrogram constructed from the twenty qualitative traits revealed 05 accessions clusters with the number of accessions in each cluster varying from one to eleven. Information obtained from this study is likely be useful for future cowpea breeding program.

  16. Association studies and legume synteny reveal haplotypes determining seed size in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Mitchell R Lucas

    2013-04-01

    Full Text Available Highly specific seed market classes for cowpea and other grain legumes exists because grain is most commonly cooked and consumed whole. Size, shape, color, and texture are critical features of these market classes and breeders target development of cultivars for market acceptance. Resistance to biotic and abiotic stresses that are absent from elite breeding material are often introgressed through crosses to landraces or wild relatives. When crosses are made between parents with different grain quality characteristics, recovery of progeny with acceptable or enhanced grain quality is problematic. Thus genetic markers for grain quality traits can help in pyramiding genes needed for specific market classes. Allelic variation dictating the inheritance of seed size can be tagged and used to assist the selection of large-seeded lines. In this work we applied SNP genotyping and knowledge of legume synteny to characterize regions of the cowpea genome associated with seed size. These marker-trait associations will enable breeders to use marker based selection approaches to increase the frequency of progeny with large seed. For ~800 samples derived from eight bi-parental populations, QTL analysis was used to identify markers linked to ten trait determinants. In addition, the population structure of 171 samples from the USDA core collection was identified and incorporated into a genome-wide association study which supported more than half of the trait-associated regions important in the bi-parental populations. Seven of the total ten QTL were supported based on synteny to seed size associated regions identified in the related legume soybean. In addition to delivering markers linked to major trait determinants in the context of modern breeding, we provide an analysis of the diversity of the USDA core collection of cowpea to identify genepools, migrants, admixture, and duplicates.

  17. Association Studies and Legume Synteny Reveal Haplotypes Determining Seed Size in Vigna unguiculata.

    Science.gov (United States)

    Lucas, Mitchell R; Huynh, Bao-Lam; da Silva Vinholes, Patricia; Cisse, Ndiaga; Drabo, Issa; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J

    2013-01-01

    Highly specific seed market classes for cowpea and other grain legumes exist because grain is most commonly cooked and consumed whole. Size, shape, color, and texture are critical features of these market classes and breeders target development of cultivars for market acceptance. Resistance to biotic and abiotic stresses that are absent from elite breeding material are often introgressed through crosses to landraces or wild relatives. When crosses are made between parents with different grain quality characteristics, recovery of progeny with acceptable or enhanced grain quality is problematic. Thus genetic markers for grain quality traits can help in pyramiding genes needed for specific market classes. Allelic variation dictating the inheritance of seed size can be tagged and used to assist the selection of large seeded lines. In this work we applied 1,536-plex SNP genotyping and knowledge of legume synteny to characterize regions of the cowpea genome associated with seed size. These marker-trait associations will enable breeders to use marker-based selection approaches to increase the frequency of progeny with large seed. For 804 individuals derived from eight bi-parental populations, QTL analysis was used to identify markers linked to 10 trait determinants. In addition, the population structure of 171 samples from the USDA core collection was identified and incorporated into a genome-wide association study which supported more than half of the trait-associated regions important in the bi-parental populations. Seven of the total 10 QTLs were supported based on synteny to seed size associated regions identified in the related legume soybean. In addition to delivering markers linked to major trait determinants in the context of modern breeding, we provide an analysis of the diversity of the USDA core collection of cowpea to identify genepools, migrants, admixture, and duplicates.

  18. Comparison of phyto-accumulation of metals by Vigna unguiculata L ...

    African Journals Online (AJOL)

    Three viable seeds of bean and maize were planted in a set of 60 bags of sandy loam soil with no history of crude oil contamination, which served as control, 180 bags of sandy ... The values of Cu, Pb, Zn and Fe decreased in the crude oil contaminated soil and increased in both seedlings as the number of days increased.

  19. REQUERIMENTO HÍDRICO E COEFICIENTE DE CULTURA DO MILHO E FEIJÃO-CAUPI EM SISTEMAS EXCLUSIVO E CONSORCIADO

    Directory of Open Access Journals (Sweden)

    LUCIANA SANDRA BASTOS DE SOUZA

    2015-01-01

    Full Text Available In order to determine the water requirement and crop coefficient for the different phenological stages on corn plants ( Zea mays L. and cowpea plants ( Vigna unguiculata (L. Walp in intercropping and sole cropping systems under the climatic conditions of the Brazilian semiarid. The experiment was conducted in the city of Petrolina, PE. Shoots total dry mass and photosynthetically active radiation intercepted for both crops were monitored. Furthermore, it was obtained the evapotranspiration (ETc by the soil water balance method. With these data and reference evapotranspiration it was obtained crop coefficient (Kc, which were subsequent- ly used to adjust models as a function of accumulated degree days. With the results, it was found the water re- quirements from maize and cowpea intercropped system were greater than the sole system. Kc in the inter- cropped system was 0.90, 1.30, 1.20 and 0.72 for maize and 0.86, 1.30, 1.21 and 0.91 for cowpea, respectively, for the vegetative, flowering, grain filling and ripening stages. In the sole system, these values were, 0.86, 1.23, 0.97 and 0.52 for maize and 0.68, 1.02, 1.06 and 0.63 for cowpea in those phases mentioned. The variations of the Kc values for both systems and cultures have been associated to the increase of biomass and light intercep- tion. The Gaussian model adjusted properly described the relationship between Kc and accumulated degree days.

  20. COMPOSICIÓN NUTRICIONAL Y FACTORES ANTINUTRICIONAL DE ESPECIES POCO CONOCIDAS DE VIGNA

    Directory of Open Access Journals (Sweden)

    Chinnamadasamy Kalidass

    2012-11-01

    Full Text Available Las semillas de Vigna trilobata, V. radiata var. sublobata, V. umbellata, V. unguiculata subsp. cylindrica, V. aconitifolia, V. vexillata and V. bourneae se colectaron de diferentes regiones geográficas en el oeste de Ghats Tamil Nadu. Se analizó su composición proximal y mineral, vitaminas (niacina y ácido ascórbico, perfiles de ácidos grasos, perfiles de aminoácidos de la proteína total de la semillas, digestibilidad de la proteína in vitro (IVPD y algunos factores antinutricionales. La proteína cruda tuvo un rango entre 18.24 a 26.12%, lípidos totales de 3.8 a 6.48%, fibra dietética total de 3.42 a 7.48%, cenizas de 3.10 a 4.12% y carbohidratos de 59.44 a 72.06%. Los valores de energía de la semilla estuvieron entre 1584.87 a 1644.34 kJ100g-1MS, los cuales fueron comparables con otras leguminosas. Los perfiles de ácidos grasos de todas las especies de Vigna revelaron altas concentraciones de ácido oleico, linoleico y linolenico. Los perfiles de aminoácidos esenciales del total de proteína de la semilla se compararon favorablemente con los requerimientos de la FAO/WHO (1991, con excepción de ciertas deficiencias de aminoácidos azufrados en todas las especies de Vigna El IVPD de las diferentes especies de Vigna tuvo un rango de 70.38 a 79.12%. Sustancias antinutricionales como el total de fenoles libres, taninos, L-DOPA (3-4 dihidroxifenilalanina, ácido fitico, cinacina hidrogenada, actividad inhibidora de la tripsina, oligosacáridos y actividad fitohematoaglutinadora también se determinaron. Los factores antinutricionales que fueron detectados, se presume que presentan una pequeña significancia si los frijoles son procesados correctamente.

  1. Construction of an SSR and RAD-Marker Based Molecular Linkage Map of Vigna vexillata (L.) A. Rich.

    Science.gov (United States)

    Marubodee, Rusama; Ogiso-Tanaka, Eri; Isemura, Takehisa; Chankaew, Sompong; Kaga, Akito; Naito, Ken; Ehara, Hiroshi; Tomooka, Norihiko

    2015-01-01

    Vigna vexillata (L.) A. Rich. (tuber cowpea) is an underutilized crop for consuming its tuber and mature seeds. Wild form of V. vexillata is a pan-tropical perennial herbaceous plant which has been used by local people as a food. Wild V. vexillata has also been considered as useful gene(s) source for V. unguiculata (cowpea), since it was reported to have various resistance gene(s) for insects and diseases of cowpea. To exploit the potential of V. vexillata, an SSR-based linkage map of V. vexillata was developed. A total of 874 SSR markers successfully amplified single DNA fragment in V. vexillata among 1,336 SSR markers developed from Vigna angularis (azuki bean), V. unguiculata and Phaseolus vulgaris (common bean). An F2 population of 300 plants derived from a cross between salt resistant (V1) and susceptible (V5) accessions was used for mapping. A genetic linkage map was constructed using 82 polymorphic SSR markers loci, which could be assigned to 11 linkage groups spanning 511.5 cM in length with a mean distance of 7.2 cM between adjacent markers. To develop higher density molecular linkage map and to confirm SSR markers position in a linkage map, RAD markers were developed and a combined SSR and RAD markers linkage map of V. vexillata was constructed. A total of 559 (84 SSR and 475 RAD) markers loci could be assigned to 11 linkage groups spanning 973.9 cM in length with a mean distance of 1.8 cM between adjacent markers. Linkage and genetic position of all SSR markers in an SSR linkage map were confirmed. When an SSR genetic linkage map of V. vexillata was compared with those of V. radiata and V. unguiculata, it was suggested that the structure of V. vexillata chromosome was considerably differentiated. This map is the first SSR and RAD marker-based V. vexillata linkage map which can be used for the mapping of useful traits.

  2. Comportamento hídrico e crescimento do feijão vigna cultivado em solos salinizados Hydric behaviour and growth of cowpea cultivated in salinized soils

    Directory of Open Access Journals (Sweden)

    José B. M. Coelho

    2013-04-01

    Full Text Available A salinização dos solos reduz a capacidade das plantas de absorver água o que, em geral, provoca diminuição na sua taxa de crescimento. As respostas das plantas ao estresse salino são melhor correlacionadas com o potencial osmótico do que com a condutividade elétrica do extrato de saturação do solo. Com o objetivo de avaliar os efeitos do estresse salino no crescimento, evapotranspiração e potencial osmótico foliar do feijoeiro vigna [Vigna unguiculata L. (Walp.] conduziu-se um experimento em casa de vegetação da Universidade Federal Rural de Pernambuco (Recife, PE, Brasil. Os tratamentos constaram de um arranjo fatorial 2 x 4 composto de duas texturas de solo e quatro níveis de salinidade do solo (4, 8 e 12 dS m-1 a 25 ºC além da testemunha sem a adição de sais com cinco repetições. Concluiu-se que a salinidade do solo causa redução no consumo de água, no potencial osmótico foliar, na altura das plantas, no número de folhas e na biomassa seca da parte aérea do feijoeiro vigna.Soil salinization reduces the capacity of plants to absorb water, and in general causes decrease in plant growth. Plant responses to salt stress are better correlated with osmotic potential compared to electrical conductivity of soil saturation extract. In order to evaluate the effect of salt stress on growth, water use and leaf osmotic potential of cowpea [Vigna unguiculata L. (Walp.], an experiment was carried out in a greenhouse of the Federal Rural University of Pernambuco (Recife-PE, Brazil. The Treatments were in a factorial arrangement of 2 x 4, comprising of two soil textures and four levels of soil salinity (4, 8 and 12 dS m-1 at 25 °C, and the control without salt addition with five replications. It was concluded that soil salinity causes reduction in water consumption, leaf osmotic potential, plant height, number of leaves and dry biomass of shoot of cowpea.

  3. Male sterile mutant in Vigna radiata

    International Nuclear Information System (INIS)

    Pande, Kalpana; Raghuvanshi, S.S.

    1987-01-01

    Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)

  4. SISTEMAS DE MANEJO E EFEITO RESIDUAL DO POTÁSSIO NA PRODUTIVIDADE E NUTRIÇÃO DO FEIJÃO-CAUPI

    Directory of Open Access Journals (Sweden)

    JESSIVALDO RODRIGUES GALVÃO

    2013-01-01

    Full Text Available Cowpea [Vigna unguiculata (L Walp] have great social and economic importance for the Para State. It grows well in areas with low precipitation and two crop cycles can be obtained annually. This study aimed to assess the effect of the residual fertilization from a previous culture (Sorghum bicolor L. Moench and crop systems on cowpea yield and macronutrient concentration on leaves of three cowpea cultivars (BRS- Milênio, BRS-Urubuquara e BRS-Guariba. The study was conducted at the UFRA. The treatments were two crop systems (minimum tillage and conventional, four levels of potassium (50, 100, 200 e 300 kg de KCl ha-1 applied to a previous sorghum culture and the three cowpea cultivars. Treatments were organized as a three (4 x 2 x 3 factor experiment on a randomized complete block design. The soil was a yellow latosol. In each ex- periment plot five plants were selected to determine shoot dry matter and foliar nutrient concentration. Grain yield was determined after harvesting all plants on the experiment plot. The residual KCl fertilization affected foliar nutrient content, but did not affect shoot dry mass or yield of grain. Yield was higher in the minimum tillage system. Highest yield (1590 kg ha-1 was recorded int the cv. ‘Guariba’ when 100 kg of KCl ha-1 had been used in the previous crop. The highest content of leaf N and K was found in cowpea under minimum till- age system. The amount of P and Mg were higher in the conventional system whereas the amount of Ca did not change.

  5. Effect of temperature and relative-humidity on the development of Liriomyza sativae Blanchard (Diptera: Agromyzidae) in Vigna unguiculata; Efeito da temperatura e umidade relativa do ar no desenvolvimento de Liriomyza sativae Blanchard (Diptera: Agromyzidae) em Vigna unguiculata

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Tiago C. Costa; Geremias, Leandro D; Parra, Jose R.P. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil)], e-mail: tcclima@esalq.usp.br, e-mail: geremias@esalq.usp.br, e-mail: jrpparra@esalq.usp.br

    2009-07-01

    This research aimed to study the influence of temperature and relative-humidity (RH) on the development of Liriomyza sativae Blanchard during the egg-adult period, in cowpea, to provide essential information for future biological control projects against the pest. An inverse relation was observed between temperature increase in the range from 15 deg C to 32 deg C and development duration. Larval survival was not affected in the temperature range studied, while a high mortality of pupae was observed at 32 deg C (59.9%). RH did not affect the development time of the immature stages, although it influenced their survival. The lower developmental temperature threshold obtained for the egg-adult period was low (7.3 deg C) when compared with other species of Liriomyza, and was rather low for the larval stage (3.4 deg C ). Based on the thermal requirements for L. sativae, it was possible to estimate the occurrence of 24.5 annual generations at a melon producing region in state of Rio Grande do Norte, Brazil. For laboratory rearing aimed at biological control pest programs, the best rearing conditions are 30 deg C and 50% RH for the larval stage and 90% RH for the pupal stage. (author)

  6. Morphological and Genetic Diversity of Rhizobia Nodulating Cowpea (Vigna unguiculata L. from Agricultural Soils of Lower Eastern Kenya

    Directory of Open Access Journals (Sweden)

    Damaris K. Ondieki

    2017-01-01

    Full Text Available Limited nitrogen (N content in the soil is a major challenge to sustainable and high crop production in many developing countries. The nitrogen fixing symbiosis of legumes with rhizobia plays an important role in supplying sufficient N for legumes and subsequent nonleguminous crops. To identify rhizobia strains which are suitable for bioinoculant production, characterization of rhizobia is a prerequisite. The objective of this study was to assess the morphological and genetic diversity of rhizobia that nodulates cowpea in agricultural soils of lower eastern Kenya. Twenty-eight rhizobia isolates were recovered from soil samples collected from farmers’ fields in Machakos, Makueni, and Kitui counties in lower eastern Kenya and characterized based on morphological characteristics. Thirteen representative isolates were selected and characterized using BOX repetitive element PCR fingerprinting. Based on the dendrogram generated from morphological characteristics, the test isolates were distributed into two major clusters at a similarity of 75%. Phylogenetic tree, based on BOX repetitive element PCR, grouped the isolates into two clusters at 90% similarity level. The clustering of the isolates did not show a relationship to the origin of soil samples, although the isolates were genetically diverse. This study is a prerequisite to the selection of suitable cowpea rhizobia to develop bioinoculants for sustainable crop production in Kenya.

  7. Bowman-Birk Protease Inhibitor from Vigna unguiculata Seeds Enhances the Action of Bradykinin-Related Peptides

    Directory of Open Access Journals (Sweden)

    Alice da Cunha M. Álvares

    2014-10-01

    Full Text Available The hydrolysis of bradykinin (Bk by different classes of proteases in plasma and tissues leads to a decrease in its half-life. Here, Bk actions on smooth muscle and in vivo cardiovascular assays in association with a protease inhibitor, Black eyed-pea trypsin and chymotrypsin inhibitor (BTCI and also under the effect of trypsin and chymotrypsin were evaluated. Two synthetic Bk-related peptides, Bk1 and Bk2, were used to investigate the importance of additional C-terminal amino acid residues on serine protease activity. BTCI forms complexes with Bk and analogues at pH 5.0, 7.4 and 9.0, presenting binding constants ranging from 103 to 104 M−1. Formation of BTCI-Bk complexes is probably driven by hydrophobic forces, coupled with slight conformational changes in BTCI. In vitro assays using guinea pig (Cavia porcellus ileum showed that Bk retains the ability to induce smooth muscle contraction in the presence of BTCI. Moreover, no alteration in the inhibitory activity of BTCI in complex with Bk and analogous was observed. When the BTCI and BTCI-Bk complexes were tested in vivo, a decrease of vascular resistance and consequent hypotension and potentiating renal and aortic vasodilatation induced by Bk and Bk2 infusions was observed. These results indicate that BTCI-Bk complexes may be a reliable strategy to act as a carrier and protective approach for Bk-related peptides against plasma serine proteases cleavage, leading to an increase in their half-life. These findings also indicate that BTCI could remain stable in some tissues to inhibit chymotrypsin or trypsin-like enzymes that cleave and inactivate bradykinin in situ.

  8. Genetic Diversity of Cowpea (Vigna unguiculata (L.) Walp.) Accession in Kenya Gene Bank Based on Simple Sequence Repeat Markers.

    Science.gov (United States)

    Wamalwa, Emily N; Muoma, John; Wekesa, Clabe

    2016-01-01

    Increased agricultural production is an urgent issue. Projected global population is 9 million people by mid of this century. Estimation projects death of 1 million people for lack of food quality (micronutrient deficit) and quantity (protein deficit). Majority of these people will be living in developing countries. Other global challenges include shrinking cultivable lands, salinity, and flooding due to climate changes, new emerging pathogens, and pests. These affect crop production. Furthermore, they are major threats to crop genetic resources and food security. Genetic diversity in cultivated crops indicates gene pool richness. It is the greatest resource for plant breeders to select lines that enhance food security. This study was conducted by Masinde Muliro University to evaluate genetic diversity in 19 cowpea accessions from Kenya national gene bank. Accessions clustered into two major groups. High divergence was observed between accessions from Ethiopia and Australia and those from Western Kenya. Upper Volta accessions were closely related to those from Western Kenya. Low variation was observed between accessions from Eastern and Rift Valley than those from Western and Coastal regions of Kenya. Diversity obtained in this study can further be exploited for the improvement of cowpea in Kenya as a measure of food security.

  9. Genetic Diversity of Cowpea (Vigna unguiculata (L. Walp. Accession in Kenya Gene Bank Based on Simple Sequence Repeat Markers

    Directory of Open Access Journals (Sweden)

    Emily N. Wamalwa

    2016-01-01

    Full Text Available Increased agricultural production is an urgent issue. Projected global population is 9 million people by mid of this century. Estimation projects death of 1 million people for lack of food quality (micronutrient deficit and quantity (protein deficit. Majority of these people will be living in developing countries. Other global challenges include shrinking cultivable lands, salinity, and flooding due to climate changes, new emerging pathogens, and pests. These affect crop production. Furthermore, they are major threats to crop genetic resources and food security. Genetic diversity in cultivated crops indicates gene pool richness. It is the greatest resource for plant breeders to select lines that enhance food security. This study was conducted by Masinde Muliro University to evaluate genetic diversity in 19 cowpea accessions from Kenya national gene bank. Accessions clustered into two major groups. High divergence was observed between accessions from Ethiopia and Australia and those from Western Kenya. Upper Volta accessions were closely related to those from Western Kenya. Low variation was observed between accessions from Eastern and Rift Valley than those from Western and Coastal regions of Kenya. Diversity obtained in this study can further be exploited for the improvement of cowpea in Kenya as a measure of food security.

  10. Inheritance of Early Maturity in Some Cowpea (Vigna unguiculata (L. Walp. Genotypes under Rain Fed Conditions in Northern Ghana

    Directory of Open Access Journals (Sweden)

    Emmanuel Yaw Owusu

    2018-01-01

    Full Text Available A field experiment was conducted at Savanna Agricultural Research Institute in 2015 cropping season to examine the inheritance of early maturity among an extra-early maturing landrace Sanzi and a medium maturing variety Padi-Tuya and their progenies. The results indicated highly significant (P0.05 were observed between F1 and RF1, implying absence of maternal effect. The segregation ratio in the F2 population for early and medium maturity fitted into the ratio 3 : 1, indicating single dominant gene mode of inheritance. Significant positive correlations were found between DNPM, DFFI, DFF, and DFPM; hence selection criteria to improve early maturity of cowpea should focus on these traits. Grain yield also had significant positive correlations with maturity indices indicating high grain yield is associated with late maturity; therefore, high grain yield should be considered alongside early maturity when selecting progenies for earliness.

  11. Estimation of dinitrogen fixation by cowpea (Vigna unguiculata) using residual soil 15N in poppy (Papaver somniferum L) cowpea sequence

    International Nuclear Information System (INIS)

    Patra, D.D.; Chand, Sukhmal; Anwar, M.

    1994-01-01

    Estimation of dinitrogen fixation by cowpea was carried out under greenhouse conditions using pots each containing 12 kg soil. Different 15 N sources included residual soil 15 N where urea was applied to opium poppy before planting of cowpea as fixing and maize as non-fixing crop. Other N sources were labelled urea, 15 N labelled poppy straw, and labelled urea + unlabelled poppy straw. The amount of N 2 fixed varied with the source of 15 N in soil. Plant material treatment gave a higher estimate at 40 days, whereas the estimate was highest with residual 15 N at 75 days. Such variation is attributed to variation in 1 5N enrichment which can be reduced by utilizing the residual 15 N which gives a more stable enrichment of soil 15 N with time. It may also alleviate the errors resulting from the differential pattern of 15 N uptake by fixing and nonfixing plant due to temporal variation in 15 N enrichment in soil. (author). 8 refs., 3 tabs

  12. Lucrative status of improved dual purpose cowpea (Vigna unguiculata L., Walp) in Damboa, Borno State, North-Eastern Nigeria

    OpenAIRE

    B.H. Gabdo

    2017-01-01

    Abstract.Thisstudydivulgedthecost-returnsanalysisbetweenimproveddualpurposecowpea (IDPC)varietiesandothernon-IDPC/localcowpeavarieties in Azir, Damboa town, Kuboa and Sabongari villages of Damboa local council, Borno State, Nigeria. Socio-economic stratification of the villages into Low Population Low Market (LPLM) and Low Population High Market (LPHM) on the basis of human demographic profile and proximity to wholesale market were the criteria adopted for selecting the villages for this stud...

  13. Cowpea (Vigna unguiculata L. Walp. Metabolomics: Osmoprotection as a Physiological Strategy for Drought Stress Resistance and Improved Yield

    Directory of Open Access Journals (Sweden)

    Piebiep Goufo

    2017-04-01

    Full Text Available Plants usually tolerate drought by producing organic solutes, which can either act as compatible osmolytes for maintaining turgor, or radical scavengers for protecting cellular functions. However, these two properties of organic solutes are often indistinguishable during stress progression. This study looked at individualizing properties of osmotic adjustment vs. osmoprotection in plants, using cowpea as the model species. Two cultivars were grown in well-watered soil, drought conditions, or drought followed by rewatering through fruit formation. Osmoadaptation was investigated in leaves and roots using photosynthetic traits, water homoeostasis, inorganic ions, and primary and secondary metabolites. Multifactorial analyses indicated allocation of high quantities of amino acids, sugars, and proanthocyanidins into roots, presumably linked to their role in growth and initial stress perception. Physiological and metabolic changes developed in parallel and drought/recovery responses showed a progressive acclimation of the cowpea plant to stress. Of the 88 metabolites studied, proline, galactinol, and a quercetin derivative responded the most to drought as highlighted by multivariate analyses, and their correlations with yield indicated beneficial effects. These metabolites accumulated differently in roots, but similarly in leaves, suggesting a more conservative strategy to cope with drought in the aerial parts. Changes in these compounds roughly reflected energy investment in protective mechanisms, although the ability of plants to adjust osmotically through inorganic ions uptake could not be discounted.

  14. Preservation of Cowpea (Vigna unguiculata (L.) Walp) Grains against Cowpea Bruchids (Callosobruchus maculatus) Using Neem and Moringa Seed Oils

    OpenAIRE

    Ilesanmi, Joana O.; Gungula, Daniel T.

    2010-01-01

    This study was conducted to determine the effects of neem (Azadirachta indica A. Juss) and moringa (Moringa oleifera) seed oils on the storability of cowpea grain. Cowpea samples were treated with various concentrations (0.5, 1.0, and 1.5 mL/200 g cowpea) of pure neem and moringa oils and their mixtures in ratios of 1:1, 1:2, and 1:3. The treated cowpea samples were stored for 180 days. Data were collected every 30 days on number of eggs laid, total weevil population, and percentage of uninfe...

  15. Morphological and Genetic Diversity of Rhizobia Nodulating Cowpea (Vigna unguiculata L.) from Agricultural Soils of Lower Eastern Kenya.

    Science.gov (United States)

    Ondieki, Damaris K; Nyaboga, Evans N; Wagacha, John M; Mwaura, Francis B

    2017-01-01

    Limited nitrogen (N) content in the soil is a major challenge to sustainable and high crop production in many developing countries. The nitrogen fixing symbiosis of legumes with rhizobia plays an important role in supplying sufficient N for legumes and subsequent nonleguminous crops. To identify rhizobia strains which are suitable for bioinoculant production, characterization of rhizobia is a prerequisite. The objective of this study was to assess the morphological and genetic diversity of rhizobia that nodulates cowpea in agricultural soils of lower eastern Kenya. Twenty-eight rhizobia isolates were recovered from soil samples collected from farmers' fields in Machakos, Makueni, and Kitui counties in lower eastern Kenya and characterized based on morphological characteristics. Thirteen representative isolates were selected and characterized using BOX repetitive element PCR fingerprinting. Based on the dendrogram generated from morphological characteristics, the test isolates were distributed into two major clusters at a similarity of 75%. Phylogenetic tree, based on BOX repetitive element PCR, grouped the isolates into two clusters at 90% similarity level. The clustering of the isolates did not show a relationship to the origin of soil samples, although the isolates were genetically diverse. This study is a prerequisite to the selection of suitable cowpea rhizobia to develop bioinoculants for sustainable crop production in Kenya.

  16. Monitoring and exposure assessment of pesticide residues in cowpea (Vigna unguiculata L. Walp) from five provinces of southern China.

    Science.gov (United States)

    Huan, Zhibo; Xu, Zhi; Luo, Jinhui; Xie, Defang

    2016-11-01

    Residues of 14 pesticides were determined in 150 cowpea samples collected in five southern Chinese provinces in 2013 and 2014.70% samples were detected one or more residues. 61.3% samples were illegal mainly because of detection of unauthorized pesticides. 14.0% samples contained more than three pesticides. Deterministic and probabilistic methods were used to assess the chronic and acute risk of pesticides in cowpea to eight subgroups of people. Deterministic assessment showed that the estimated short-term intakes (ESTIs) of carbofuran were 1199.4%-2621.9% of the acute reference doses (ARfD) while the rates were 985.9%-4114.7% using probabilistic assessment. Probabilistic assessment showed 4.2%-7.8% subjects may suffer from unacceptable acute risk from carbofuran contaminated cowpeas from the five provinces (especially children). But undue concern is not necessary, because all the estimations are based on conservative assumption. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Drought increases cowpea (Vigna unguiculata [L.] Walp.) susceptibility to cowpea severe mosaic virus (CPSMV) at early stage of infection.

    Science.gov (United States)

    Silva, Rodolpho G G; Vasconcelos, Ilka M; Martins, Thiago F; Varela, Anna L N; Souza, Pedro F N; Lobo, Ana K M; Silva, Fredy D A; Silveira, Joaquim A G; Oliveira, Jose T A

    2016-12-01

    The physiological and biochemical responses of a drought tolerant, virus-susceptible cowpea genotype exposed to drought stress (D), infected by Cowpea severe mosaic virus (CPSMV) (V), and to these two combined stresses (DV), at 2 and 6 days post viral inoculation (DPI), were evaluated. Gas exchange parameters (net photosynthesis, transpiration rate, stomatal conductance, and internal CO 2 partial pressure) were reduced in D and DV at 2 and 6 DPI compared to control plants (C). Photosynthesis was reduced by stomatal and biochemical limitations. Water use efficiency increased at 2 DPI in D, DV, and V, but at 6 DPI only in D and DV compared to C. Photochemical parameters (effective quantum efficiency of photosystem II and electron transport rate) decreased in D and DV compared to C, especially at 6 DPI. The potential quantum efficiency of photosystem II did not change, indicating reversible photoinhibition of photosystem II. In DV, catalase decreased at 2 and 6 DPI, ascorbate peroxidase increased at 2 DPI, but decreased at 6 DPI. Hydrogen peroxide increased at 2 and 6 DPI. Peroxidase increased at 6 DPI and chitinase at 2 and 6 DPI. β-1,3-glucanase decreased in DV at 6 DPI compared to V. Drought increased cowpea susceptibility to CPSMV at 2 DPI, as verified by RT-PCR. However, at 6 DPI, the cowpea plants overcome this effect. Likewise, CPSMV increased the negative effects of drought at 2 DPI, but not at 6 DPI. It was concluded that the responses to combined stresses are not additive and cannot be extrapolated from the study of individual stresses. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  18. Using violet laser-induced chlorophyll fluorescence emission spectra for crop yield assessment of cowpea (Vigna unguiculata (L) Walp) varieties

    Science.gov (United States)

    Anderson, Benjamin; Buah-Bassuah, Paul K.; Tetteh, Jonathan P.

    2004-07-01

    The use of violet laser-induced chlorophyll fluorescence (LICF) emission spectra to monitor the growth of five varieties of cowpea in the University of Cape Coast Botanical Garden is presented. Radiation from a continuous-wave violet laser diode emitting at 396 nm through a fibre is closely incident on in vivo leaves of cowpea to excite chlorophyll fluorescence, which is detected by an integrated spectrometer with CCD readout. The chlorophyll fluorescence spectra with peaks at 683 and 731 nm were used for growth monitoring of the cowpea plants over three weeks and analysed using Gaussian spectral functions with curve fitted parameters to determine the peak positions, area under the spectral curve and the intensity ratio F683/F731. The variation in the intensity ratio of the chlorophyll bands showed sensitive changes indicating the photosynthetic activity of the cowpea varieties. A discussion of the fluorescence result as compared to conventional assessment is presented with regard to discrimination between the cowpea varieties in terms of crop yield performance.

  19. Biopotency of serine protease inhibitors from cowpea (Vigna unguiculata) seeds on digestive proteases and the development of Spodoptera littoralis (Boisduval).

    Science.gov (United States)

    Abd El-latif, Ashraf Oukasha

    2015-05-01

    Serine protease inhibitors (PIs) have been described in many plant species and are universal throughout the plant kingdom, where trypsin inhibitors is the most common type. In the present study, trypsin and chymotrypsin inhibitory activity was detected in the seed flour extracts of 13 selected cultivars/accessions of cowpea. Two cowpea cultivars, Cream7 and Buff, were found to have higher trypsin and chymotrypsin inhibitory potential compared to other tested cultivars for which they have been selected for further purification studies using ammonium sulfate fractionation and DEAE-Sephadex A-25 column. Cream7-purified proteins showed two bands on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) corresponding to molecular mass of 17.10 and 14.90 kDa, while the purified protein from Buff cultivar showed a single band corresponding mass of 16.50 kDa. The purified inhibitors were stable at temperature below 60°C and were active at wide range of pH from 2 to 12. The kinetic analysis revealed noncompetitive type of inhibition for both inhibitors against both enzymes. The inhibitor constant (Ki ) values suggested high affinity between inhibitors and enzymes. Purified inhibitors were found to have deep and negative effects on the mean larval weight, larval mortality, pupation, and mean pupal weight of Spodoptera littoralis, where Buff PI was more effective than Cream7 PI. It may be concluded that cowpea PI gene(s) could be potential insect control protein for future studies in developing insect-resistant transgenic plants. © 2014 Wiley Periodicals, Inc.

  20. Modeling of the water uptake process for cowpea seeds (vigna unguiculata l.) under common treatment and microwave treatment

    International Nuclear Information System (INIS)

    Demirhan, E.

    2015-01-01

    The water uptake kinetics of cowpea seeds were carried out at two different water absorption treatments - common treatment and microwave treatment - to evaluate the effects of rehydration temperatures and microwave output powers on rehydration. Water uptake of cowpea seeds during soaking in water was studied at various temperatures of 20 - 45 degree C, and at various microwave output powers of 180 - 900 W. As the rehydration temperature and microwave output power increased, the water uptake of cowpea seeds increased and the rehydration time decreased. The Peleg and Richards Models were capable of predicting water uptake of cowpea seeds undergoing common treatment and microwave treatment, respectively. The effective diffusivity values were evaluated by fitting experimental absorption data to Fick second law of diffusion. The effective diffusivity coefficients for cowpea seeds varied from 7.75*10-11 to 1.99*10-10 m2/s and from 2.23*10-9 to 9.78*10-9 m2/s for common treatment and microwave treatment, respectively. (author)

  1. Potential use of cowpea (Vigna unguiculata (L.) Walp.) stover treated with white-rot fungi as rabbit feed.

    Science.gov (United States)

    Andrade, Ederson; Pinheiro, Victor; Gonçalves, Alexandre; Cone, John W; Marques, Guilhermina; Silva, Valéria; Ferreira, Luis; Rodrigues, Miguel

    2017-10-01

    Lignin inhibitory effects within the cell wall structure constitute a serious drawback in maximizing the utilization of fibrous feedstuffs in animal feeding. Therefore treatments that promote efficient delignification of these materials must be applied. This study evaluated the potential of white-rot fungi to upgrade the nutritive value of cowpea stover for rabbit feeding. There was an increase in the crude protein content of all substrates as a result of fungi treatments, reaching a net gain of 13% for Pleurotus citrinopileatus incubation. Overall, net losses of dry and organic matter occurred during fungi treatments. Although the fiber content remained identical, higher consumption of cell wall contents was measured for P. citrinopileatus incubation (between 40 and 45%). The incubation period did not influence lignin degradation for any of the fungi treatments. Differences within the fungal degradation mechanisms indicate that P. citrinopileatus treatment was most effective, enhancing in vitro organic matter digestibility by around 30% compared with the control. Treatment of cowpea stover with P. citrinopileatus led to an efficient delignification process which resulted in higher in vitro organic matter digestibility, showing its potential in the nutritional valorization of this feedstuff. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  2. Genetic variability and resistance of cultivars of cowpea [Vigna unguiculata (L.) Walp] to cowpea weevil (Callosobruchus maculatus Fabr.).

    Science.gov (United States)

    Vila Nova, M X; Leite, N G A; Houllou, L M; Medeiros, L V; Lira Neto, A C; Hsie, B S; Borges-Paluch, L R; Santos, B S; Araujo, C S F; Rocha, A A; Costa, A F

    2014-03-31

    The cowpea weevil (Callosobruchus maculatus Fabr.) is the most destructive pest of the cowpea bean; it reduces seed quality. To control this pest, resistance testing combined with genetic analysis using molecular markers has been widely applied in research. Among the markers that show reliable results, the inter-simple sequence repeats (ISSRs) (microsatellites) are noteworthy. This study was performed to evaluate the resistance of 27 cultivars of cowpea bean to cowpea weevil. We tested the resistance related to the genetic variability of these cultivars using ISSR markers. To analyze the resistance of cultivars to weevil, a completely randomized test design with 4 replicates and 27 treatments was adopted. Five pairs of the insect were placed in 30 grains per replicate. Analysis of variance showed that the number of eggs and emerged insects were significantly different in the treatments, and the means were compared by statistical tests. The analysis of the large genetic variability in all cultivars resulted in the formation of different groups. The test of resistance showed that the cultivar Inhuma was the most sensitive to both number of eggs and number of emerged adults, while the TE96-290-12-G and MNC99-537-F4 (BRS Tumucumaque) cultivars were the least sensitive to the number of eggs and the number of emerged insects, respectively.

  3. Quality characteristics of gamma irradiated cowpea (vigna unguiculata, L. walp) cultivars in Ghana and their resultant flours

    International Nuclear Information System (INIS)

    Darfour, B.

    2010-01-01

    Cowpeas are leguminous seeds widely produced and consumed in most developing countries of sub Saharan Africa. During storage, cowpeas may be attacked by a number of biological agents (microorganisms, rodents, and insects) which results in losses in the quality and quantity of the stored seeds. These losses can be minimized by irradiating the stored cowpea against microorganisms and insects attacks primarily Callosobruchus maculatus. The aim of this study was to evaluate quality characteristics of gamma irradiated cowpea cultivars and their resultant flours. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25 kGy, 0.5 kGy, 0.75 kGy, 1.0 kGy and 1.5 kGy. The unirradiated cultivars were used as controls. A portion of the samples were hammer milled, passed through sieve of 250μm and stored at 4 o C for analysis. Physicochemical, functional, pasting and sensory properties were determined using standards and/or appropriate methods. Moisture sorption isotherms of the cowpea samples were also determined. Radiosensitivity and storage studies on Callosobruchus maculatus were also done for one month. In general, significant effect (p 0.05) affected by the irradiation. All the physical parameters studied were not significantly (p > 0.05) affected by the radiation. Generally, significant increase (p o C. There was no significant (p > 0.05) effect of the radiation on the sensory attributes like flavour, taste, texture, softness and colour of the cowpea seeds. Similarly, the radiation did not affect significantly (p > 0.05) the acceptability of the treated cowpea cultivars. Irradiating at even a dose of 0.25 kGy killed the insects on average within eight days. There was significant difference (p < 0.05) in the percent mortality between the irradiated and the non-irradiated weevils. The percent mortality increased with increase in the radiation dose. It was established that at the lower doses studied although the radiation effect did not follow any clear pattern with increase in the radiation dose, there was significant (p < 0.05) effect on some proximate parameters (protein, fat, moisture and mineral), functional and pasting properties. The radiation did not affect sensory qualities and acceptability of the cowpea seeds. For cowpea insects disinfestation a radiation dose of 0.25 kGy would be economically beneficial. (au)

  4. Cowpea (Vigna unguiculata L. Walp.) Metabolomics: Osmoprotection as a Physiological Strategy for Drought Stress Resistance and Improved Yield.

    Science.gov (United States)

    Goufo, Piebiep; Moutinho-Pereira, José M; Jorge, Tiago F; Correia, Carlos M; Oliveira, Manuela R; Rosa, Eduardo A S; António, Carla; Trindade, Henrique

    2017-01-01

    Plants usually tolerate drought by producing organic solutes, which can either act as compatible osmolytes for maintaining turgor, or radical scavengers for protecting cellular functions. However, these two properties of organic solutes are often indistinguishable during stress progression. This study looked at individualizing properties of osmotic adjustment vs. osmoprotection in plants, using cowpea as the model species. Two cultivars were grown in well-watered soil, drought conditions, or drought followed by rewatering through fruit formation. Osmoadaptation was investigated in leaves and roots using photosynthetic traits, water homoeostasis, inorganic ions, and primary and secondary metabolites. Multifactorial analyses indicated allocation of high quantities of amino acids, sugars, and proanthocyanidins into roots, presumably linked to their role in growth and initial stress perception. Physiological and metabolic changes developed in parallel and drought/recovery responses showed a progressive acclimation of the cowpea plant to stress. Of the 88 metabolites studied, proline, galactinol, and a quercetin derivative responded the most to drought as highlighted by multivariate analyses, and their correlations with yield indicated beneficial effects. These metabolites accumulated differently in roots, but similarly in leaves, suggesting a more conservative strategy to cope with drought in the aerial parts. Changes in these compounds roughly reflected energy investment in protective mechanisms, although the ability of plants to adjust osmotically through inorganic ions uptake could not be discounted.

  5. Physical, proximate, functional and pasting properties of flour produced from gamma irradiated cowpea (Vigna unguiculata, L. Walp)

    International Nuclear Information System (INIS)

    Darfour, B.; Wilson, D.D.; Ofosu, D.O.; Ocloo, F.C.K.

    2012-01-01

    Cowpeas are leguminous seeds widely produced and consumed in most developing countries of sub Saharan Africa. The aim of this study was to determine the physical, proximate, functional and pasting properties of flour obtained from gamma irradiated cowpea. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.5, 0.75, 1.0 and 1.5 kGy with the unirradiated cultivars serving as controls. The samples were hammer milled, sieved and stored at 4 °C for analysis. Physical, proximate, functional, pasting properties were determined using appropriate methods. In general, the irradiation dose applied to cowpea for insect control did not significantly affect the physical and proximate properties of the flour. However, significant increase (p<0.05) was achieved in paste bulk density, water and oil absorption capacities, foam capacities and least gelation concentrations of flour in general, which may be attributed to the irradiation. The radiation reduced the swelling power and water solubility index significantly. The peak temperature, peak viscosity and setback viscosity of the pastes were significantly (p<0.05) reduced while breakdown viscosity was significantly (p<0.05) increased by the radiation. It was established that the doses used on cowpea affected both the functional and pasting properties of the flour. - Highlights: ► We investigated the effects of gamma irradiation of cowpea on quality characteristics of its resultant flour. ► Flour was prepared from four cowpea cultivars irradiated at 0, 0.25, 0.5, 0.75, 1.0 and 1.5 kGy. ► Proximate and physical properties of flour from irradiated cowpea were generally not affected by the radiation doses used. ► Functional properties of flour samples were affected by gamma irradiation of cowpea. ► Pasting parameters studied were also affected by the radiation at various radiation doses.

  6. Genetic mapping and legume synteny of aphid resistance in African cowpea (Vigna unguiculata L. Walp.) grown in California.

    Science.gov (United States)

    Huynh, Bao-Lam; Ehlers, Jeffrey D; Ndeve, Arsenio; Wanamaker, Steve; Lucas, Mitchell R; Close, Timothy J; Roberts, Philip A

    The cowpea aphid Aphis craccivora Koch (CPA) is a destructive insect pest of cowpea, a staple legume crop in Sub-Saharan Africa and other semiarid warm tropics and subtropics. In California, CPA causes damage on all local cultivars from early vegetative to pod development growth stages. Sources of CPA resistance are available in African cowpea germplasm. However, their utilization in breeding is limited by the lack of information on inheritance, genomic location and marker linkage associations of the resistance determinants. In the research reported here, a recombinant inbred line (RIL) population derived from a cross between a susceptible California blackeye cultivar (CB27) and a resistant African breeding line (IT97K-556-6) was genotyped with 1,536 SNP markers. The RILs and parents were phenotyped for CPA resistance using field-based screenings during two main crop seasons in a 'hotspot' location for this pest within the primary growing region of the Central Valley of California. One minor and one major quantitative trait locus (QTL) were consistently mapped on linkage groups 1 and 7, respectively, both with favorable alleles contributed from IT97K-556-6. The major QTL appeared dominant based on a validation test in a related F2 population. SNP markers flanking each QTL were positioned in physical contigs carrying genes involved in plant defense based on synteny with related legumes. These markers could be used to introgress resistance alleles from IT97K-556-6 into susceptible local blackeye varieties by backcrossing.

  7. Effects of light quality on pod elongation in soybean (Glycine max (L.) Merr.) and cowpea (Vigna unguiculata (L.) Walp.).

    Science.gov (United States)

    Tanaka, Seiya; Ario, Nobuyuki; Nakagawa, Andressa Camila Seiko; Tomita, Yuki; Murayama, Naoki; Taniguchi, Takatoshi; Hamaoka, Norimitsu; Iwaya-Inoue, Mari; Ishibashi, Yushi

    2017-06-03

    Soybean pods are located at the nodes, where they are in the shadow, whereas cowpea pods are located outside of the leaves and are exposed to sunlight. To compare the effects of light quality on pod growth in soybean and cowpea, we measured the length of pods treated with white, blue, red or far-red light. In both species, pods elongated faster during the dark period than during the light period in all light treatments except red light treatment in cowpea. Red light significantly suppressed pod elongation in soybean during the dark and light periods. On the other hand, the elongation of cowpea pods treated with red light markedly promoted during the light period. These results suggested that the difference in the pod set sites between soybean and cowpea might account for the difference in their red light responses for pod growth.

  8. Distribution and Phylogeny of Microsymbionts Associated with Cowpea (Vigna unguiculata) Nodulation in Three Agroecological Regions of Mozambique.

    Science.gov (United States)

    Chidebe, Ifeoma N; Jaiswal, Sanjay K; Dakora, Felix D

    2018-01-15

    Cowpea derives most of its N nutrition from biological nitrogen fixation (BNF) via symbiotic bacteroids in root nodules. In Sub-Saharan Africa, the diversity and biogeographic distribution of bacterial microsymbionts nodulating cowpea and other indigenous legumes are not well understood, though needed for increased legume production. The aim of this study was to describe the distribution and phylogenies of rhizobia at different agroecological regions of Mozambique using PCR of the BOX element (BOX-PCR), restriction fragment length polymorphism of the internal transcribed spacer (ITS-RFLP), and sequence analysis of ribosomal, symbiotic, and housekeeping genes. A total of 122 microsymbionts isolated from two cowpea varieties (IT-1263 and IT-18) grouped into 17 clades within the BOX-PCR dendrogram. The PCR-ITS analysis yielded 17 ITS types for the bacterial isolates, while ITS-RFLP analysis placed all test isolates in six distinct clusters (I to VI). BLAST n sequence analysis of 16S rRNA and four housekeeping genes ( glnII , gyrB , recA , and rpoB ) showed their alignment with Rhizobium and Bradyrhizobium species. The results revealed a group of highly diverse and adapted cowpea-nodulating microsymbionts which included Bradyrhizobium pachyrhizi , Bradyrhizobium arachidis , Bradyrhizobium yuanmingense , and a novel Bradyrhizobium sp., as well as Rhizobium tropici , Rhizobium pusense , and Neorhizobium galegae in Mozambican soils. Discordances observed in single-gene phylogenies could be attributed to horizontal gene transfer and/or subsequent recombinations of the genes. Natural deletion of 60 bp of the gyrB region was observed in isolate TUTVU7; however, this deletion effect on DNA gyrase function still needs to be confirmed. The inconsistency of nifH with core gene phylogenies suggested differences in the evolutionary history of both chromosomal and symbiotic genes. IMPORTANCE A diverse group of both Bradyrhizobium and Rhizobium species responsible for cowpea nodulation in Mozambique was found in this study. Future studies could prove useful in evaluating these bacterial isolates for symbiotic efficiency and strain competitiveness in Mozambican soils. Copyright © 2018 Chidebe et al.

  9. Essential oil optimizes the susceptibility of Callosobruchus maculatus and enhances the nutritional qualities of stored cowpea Vigna unguiculata.

    Science.gov (United States)

    Akami, Mazarin; Chakira, Hamada; Andongma, Awawing A; Khaeso, Kanjana; Gbaye, Olajire A; Nicolas, Njintang Y; Nukenine, E-N; Niu, Chang-Ying

    2017-08-01

    The intensive use of synthetic pesticides in cowpea storage has led to the development of resistance by Callosobruchus maculatus and subsequent degradation of grain quality. In an attempt to circumvent these constraints, the susceptibility of C. maculatus to 2,2-dichlorovinyldimethyl phosphate (DDVP) and Lippia adoensis essential oil (EO) was investigated and variations in the proportions of nutritional values of treated grains 150 days after storage were assessed. The survival rate was recorded after five generations. The resistance index and biochemical parameters of grains were determined. The results from this study revealed that the survival rate and resistance index significantly increased proportionally with damage in DDVP treatments ( r  = 0.889; p  = 0.018) while in EO treatments, those values remained low without significant variations ( p  = 0.0764) throughout the generations. DDVP stored grains yielded higher crude protein values, but lower carbohydrates, tannins, phenolics and minerals compared to EO. Eighteen amino acids were detected in EO treated grains and 14 in DDVP which was devoid of albumin and prolamin. Lippia adoensis EO could therefore represent a safe alternative bio-pesticide to cope with insect resistance and enhance the nutritional qualities of stored cowpea seeds.

  10. A study on zinc distribution in calcareous soils for cowpea (Vigna Unguiculata L.) and barely ( Hordeum Vulgare L.)

    Science.gov (United States)

    Boroomand, Naser; Maleki, Mohammad Reza

    2010-05-01

    Compared to other cereals, such as wheat and barley cultivars which have low sensitivity to Zn deficiency, cowpea is sensitive to zinc (Zn) deficiency, however it extensively grows even in soils with deficient in Zn. A 8-week greenhouse experiment was conducted to study the response of cowpea and barely to Zn in calcareous soils with different DTPA- Zn. The soil samples were taken from soil surface up to 0.3 m in which their DTPA- Zn ranged from 0.5 to 3.5 mg kg-1. Shoot dry matter, concentration and uptake of Zn were found to be significantly correlated with soil DTPA- Zn in cowpea and barely. Critical deficiency level of Zn in cowpea was 1.3 mg kg-1 in soil and 28.5 mg kg-1 in shoot dry matter, however, to barely symptoms of Zn deficiency was not observed and concentration of Zn was higher than the critical level reported in literatures. Organic carbon (OC), calcium carbonate equivalent (CCE), pH and field capacity soil moisture content(FC) were significantly correlated with plant responses to Zn which were the most influenced characteristics to Zn uptake by plants.

  11. Evaluation of dwarf mutant of cowpea (Vigna Unguiculata L. Walp.) developed through gamma irradiation for nitrogen fixation characters

    International Nuclear Information System (INIS)

    Anjana, G.; Thimmaiah, S.K.

    2002-01-01

    A dwarf mutant developed through gamma-irradiation and mutation breeding of its parent cowpea variety, namely KBC-1 has been characterized for nitrogen-fixation characters such as root nodule acetylene reduction activity (ARA) and legthemoglobin content at different days after sowing (DAS). Significant variations in these characters were noticed among the varieties and for interactions between the varieties and DAS. The ARA was nearly one-and-a half fold higher in the mutant at both 30 (12.69 μmoles)C 2 H 4 formed/h/g fr.wt. of nodules) and 50 DAS (6.74 μmoles) over its parent (9.20 and 4.46 μmoles at 30 and 50 DAS, respectively). Further, the ARA in the mutant decreased linearly with an increase in the DAS. The leghemoglobin (Lb) content was also higher in the mutant over the parent at all the DAS. However, it decreased linearly with an increase in the DAS in both the mutant and the parent. The highest leghemoglobin content was noticed at 30 DAS in both mutant (2.1 mg/g fr. wt. of nodules) and the parent (1.45 mg/g). Thus, the dwarf cowpea mutant was found to be associated with higher nitrogen-fixing ability which could be exploited in future breeding programmes. (author)

  12. Physical, proximate, functional and pasting properties of flour produced from gamma irradiated cowpea (Vigna unguiculata, L. Walp)

    Science.gov (United States)

    Darfour, B.; Wilson, D. D.; Ofosu, D. O.; Ocloo, F. C. K.

    2012-04-01

    Cowpeas are leguminous seeds widely produced and consumed in most developing countries of sub Saharan Africa. The aim of this study was to determine the physical, proximate, functional and pasting properties of flour obtained from gamma irradiated cowpea. Four cowpea cultivars were irradiated with gamma radiation at dose levels of 0.25, 0.5, 0.75, 1.0 and 1.5 kGy with the unirradiated cultivars serving as controls. The samples were hammer milled, sieved and stored at 4 °C for analysis. Physical, proximate, functional, pasting properties were determined using appropriate methods. In general, the irradiation dose applied to cowpea for insect control did not significantly affect the physical and proximate properties of the flour. However, significant increase (pcowpea affected both the functional and pasting properties of the flour.

  13. Effect of temperature and relative-humidity on the development of Liriomyza sativae Blanchard (Diptera: Agromyzidae) in Vigna unguiculata

    International Nuclear Information System (INIS)

    Lima, Tiago C. Costa; Geremias, Leandro D; Parra, Jose R.P.

    2009-01-01

    This research aimed to study the influence of temperature and relative-humidity (RH) on the development of Liriomyza sativae Blanchard during the egg-adult period, in cowpea, to provide essential information for future biological control projects against the pest. An inverse relation was observed between temperature increase in the range from 15 deg C to 32 deg C and development duration. Larval survival was not affected in the temperature range studied, while a high mortality of pupae was observed at 32 deg C (59.9%). RH did not affect the development time of the immature stages, although it influenced their survival. The lower developmental temperature threshold obtained for the egg-adult period was low (7.3 deg C) when compared with other species of Liriomyza, and was rather low for the larval stage (3.4 deg C ). Based on the thermal requirements for L. sativae, it was possible to estimate the occurrence of 24.5 annual generations at a melon producing region in state of Rio Grande do Norte, Brazil. For laboratory rearing aimed at biological control pest programs, the best rearing conditions are 30 deg C and 50% RH for the larval stage and 90% RH for the pupal stage. (author)

  14. [Effect of temperature and relative-humidity on the development of Liriomyza sativae Blanchard (Diptera: Agromyzidae) in Vigna unguiculata].

    Science.gov (United States)

    Lima, Tiago C Costa; Geremias, Leandro D; Parra, José R P

    2009-01-01

    This research aimed to study the influence of temperature and relative-humidity (RH) on the development of Liriomyza sativae Blanchard during the egg-adult period, in cowpea, to provide essential information for future biological control projects against the pest. An inverse relation was observed between temperature increase in the range from 15 degrees Celsius to 32 degrees Celsius and development duration. Larval survival was not affected in the temperature range studied, while a high mortality of pupae was observed at 32 degrees Celsius (59.9%). RH did not affect the development time of the immature stages, although it influenced their survival. The lower developmental temperature threshold obtained for the egg-adult period was low (7.3 degrees Celsius) when compared with other species of Liriomyza, and was rather low for the larval stage (3.4 degrees Celsius). Based on the thermal requirements for L. sativae, it was possible to estimate the occurrence of 24.5 annual generations at a melon producing region in state of Rio Grande do Norte, Brazil. For laboratory rearing aimed at biological control pest programs, the best rearing conditions are 30 degrees Celsius and 50% RH for the larval stage and 90% RH for the pupal stage.

  15. Lucrative status of improved dual purpose cowpea (Vigna unguiculata L., Walp in Damboa, Borno State, North-Eastern Nigeria

    Directory of Open Access Journals (Sweden)

    B.H. Gabdo

    2017-12-01

    Full Text Available Abstract.Thisstudydivulgedthecost-returnsanalysisbetweenimproveddualpurposecowpea (IDPCvarietiesandothernon-IDPC/localcowpeavarieties in Azir, Damboa town, Kuboa and Sabongari villages of Damboa local council, Borno State, Nigeria. Socio-economic stratification of the villages into Low Population Low Market (LPLM and Low Population High Market (LPHM on the basis of human demographic profile and proximity to wholesale market were the criteria adopted for selecting the villages for this study. A total of 150 cowpea farmers responded to the questionnaire instrument; administered between December, 2006 and February, 2007. Results of the budgetary techniques used show that adopters of IDPC varieties generate $386.01ha-1 as net income as against $248.37ha-1 for the non-IDPC adopters; proportional to 55.42% rise in net income per hectare of cowpea resulting from the impact factor of IDPC adoption alone. Similarly, farmers in Sabongari village realized the highest net income of $491.99ha-1 as against Azir the lowest net income of $247.21ha-1 across the four villages owing to demand factor; interplay between human population and proximity to wholesale market; both in favour of Sabongari but none in favour of Azir. In terms of ratios, farmers in Sabongari were adjudged as more lucrative across adopters’ category, socio-economic domain and villages respectively owing to higher return on sale ratio and lower operating ratio. Azir and Sabongari villages were found to exhibit potentiality for comparative cost advantage and comparative sales advantage respectively. Thus, the research concludes that an expansion path for cowpea is feasible if cultivation and sales are premised on cost and sales advantages.

  16. Translocation and distribution of 14C-photosynthate in asparagus bean [vigna unguiculata W. ssp. sesquipedals (L.) Verd

    International Nuclear Information System (INIS)

    Liu Houcheng; Guan Peicong; Chen Riyuan

    1996-01-01

    Photosynthate translocation and distribution were studied by feeding 14 CO 2 on different leaf position during vegetative and reproductive periods in asparagus bean, cv. Jinsui and New-green. Radioactivity were measured in different organs after leaves being labelled 24 hours. The results showed that photosynthate export rate was lower (54.85%) during vegetative period and it was higher (average 88.74%) during reproductive period and increased with the rise of leaf position. Photosynthate were translated to both upper and lower organs during vegetative period, more than 95% of photosynthate was transported to stem and leaf. During reproductive period, photosynthate of leaf on upper, middle, lower leaf position were transported to each organ, mainly to pod, few to others. Photosynthate was mainly transported to nearby pods. Distribution of photosynthate was mainly controlled by podding condition and development of pods

  17. Transformation of Cowpea Vigna unguiculata with a Full-Length DNA Copy of Cowpea Mosaic Virus M-RNA

    NARCIS (Netherlands)

    Hille, Jacques; Goldbach, Rob

    1987-01-01

    A full-length DNA copy of the M-RNA of cowpea mosaic virus (CPMV), supplied with either the 35S promoter from cauliflower mosaic virus (CaMV) or the nopaline synthase promoter from Agrobacterium tumefaciens, was introduced into the T-DNA region of a Ti-plasmid-derived gene vector and transferred to

  18. 1H NMR spectra dataset and solid-state NMR data of cowpea (Vigna unguiculata)

    DEFF Research Database (Denmark)

    Alves Filho, Elenilson G.; Silva, Lorena M. A.; Teofilo, Elizita M.

    2017-01-01

    In this article the NMR data from chemical shifts, coupling constants, and structures of all the characterized compounds were provided, beyond a complementary PCA evaluation for the corresponding manuscript (E.G. Alves Filho, L.M.A. Silva, E.M. Teofilo, F.H. Larsen, E.S. de Brito, 2017) [3]. In a...

  19. Potential use of cowpea (Vigna unguiculata (L.) Walp.) stover treated with white-rot fungi as rabbit feed

    NARCIS (Netherlands)

    Andrade, Ederson; Pinheiro, Victor; Gonçalves, Alexandre; Cone, John W.; Marques, Guilhermina; Silva, Valéria; Ferreira, Luis; Rodrigues, Miguel

    2017-01-01

    BACKGROUND: Lignin inhibitory effects within the cell wall structure constitute a serious drawback in maximizing the utilization of fibrous feedstuffs in animal feeding. Therefore treatments that promote efficient delignification of these materials must be applied. This study evaluated the

  20. Evaluation of Dual-purpose Cowpea (Vigna unguiculata (L. Walp. Varieties for Grain and Fodder Production at Shika, Nigeria

    Directory of Open Access Journals (Sweden)

    Omokanye, AT.

    2003-01-01

    Full Text Available A three-year field study of eight new and one check dual-purpose cowpea varieties was carried out to evaluate their grain and fodder production potential. Germination and seedling establishment were both high and greater than 80%.Mean dry fodder and seed yields varied from 1,262 to 3,598 kg/ha and 528 to 1,149 kg/ha respectively, with varieties IAR 4/48/15-1, IAR 72 and TVU 12349 retaining larger amounts (> 50% of fresh green leaves at pod harvest during the dry season. Crude protein (CP content of fodder averaged between 15.2 and 21.6%. There were more pods/plant for varieties IAR 4/48/15-1, IAR 7/180-4-5 and TVU 12349. 100-seed weight was highest with IT89KD-288 and Kananado (check. Fodder yield, pods/plant and leaf content were moderately correlated with seed yield. Results showed that varieties TVU 12349, IT89KD-288, IAR 2/180/4-12 and IAR 4/48/15-1 appeared suitable for both fodder and grain production. The use of appropriate cowpea varieties to enhance farmer income in an integrated production system is suggested.

  1. Date et densité optimales de semis du niébé [ Vigna unguiculata (L ...

    African Journals Online (AJOL)

    Objectifs : Au Sénégal, la production de mil est faible à cause de plusieurs facteurs parmi lesquels la pauvreté des sols, la pression des adventices. Ce présent travail envisage l'utilisation des cultures associées (mil et niébé) pour lutter contre les adventices et améliorer à la fois la qualité des sols et la production agricole.

  2. Genetic analysis of Myanmar Vigna species in responses to salt ...

    African Journals Online (AJOL)

    Genetic analysis of Myanmar Vigna species in responses to salt stress at the ... of reduction was highly dependent on different genotypes and salinity levels. ... the mechanism of salt tolerance and for the provision of genetic resources for ...

  3. Gamma radiosensitivity in common bean plant and cowpea; Gama radiossensitividade em feijoeiro comum e caupi

    Energy Technology Data Exchange (ETDEWEB)

    Guimaraes, Sandra da Silva; Colaco, Waldeciro [Pernambuco Univ., Recife, PE (Brazil). Dept. de Energia Nuclear

    2002-07-01

    An indispensable step in mutation induction experiments is the determination of the sensitivity to mutagens to be used. Taking this into consideration the radiosensitivity of bean cultivars Carioca, Princesa (P. vulgaris L.), and IPA-206 [V. unguiculata (L.) Walp] to gamma rays from a {sup 60} Co source was evaluated. Sets of seeds (40 seeds/sample) were irradiated with 100, 150, 200, 250 Gy, and compared to a control without irradiation (0 Gy), under greenhouse conditions. Bean and cowpea seeds were respectively inoculated with a suspension of Rhizobium (SEMIA-4077) and Bradyrhizobium (SEMIA-6145) strains. The radiosensitivity was evaluated through seedling height reduction determined at 15 days after emergence (15-DAE), and also through dry matter yield of above-ground part and root nodules at 40-DAE. Seedling height was significantly reduced with increased dose of radiation in relation to the control. The dose causing reduction of 50% seedling height for P. vulgaris cultivar Princesa was set up between 150-250 Gy. Cowpea (IPA-206) was less sensitive to radiation than common bean cultivars, considering the dose range of radiation studied, and a 75% seedling height reduction was reached in the range of 150-250 Gy. Dry mater yield of the above-ground part, root and nodule, were inversely related to the doses. It is recommended a dose range of 300-350 Gy for mutation breeding purposes using the cowpea cultivar (IPA-206). (author)

  4. Recovery of herbicide-resistant Azuki bean [ Vigna angularis (Wild ...

    African Journals Online (AJOL)

    ... of the bar gene as determined by assaying for resistance to bialaphos applied directly to leaves. This result demonstrates the feasibility of introducing potentially useful agronomic traits into azuki bean through genetic engineering. Key Words: Agrobacterium tumefaciens, bar gene, bialaphos, transgenic, Vigna angulazris.

  5. Genetic diversity of Bambara groundnut ( Vigna subterranea (L ...

    African Journals Online (AJOL)

    The existence of genetic diversity in germplasm collections is crucial for cultivar development. Genetic relationships among 105 Bambara groundnuts (Vigna subterranea (L) Verdc.) accessions from Kenya were evaluated using 12 microsatellite markers. The Bambara landraces were collected from farmers in the western ...

  6. Heat stable peroxidases from Vigna species (V) | Mbassi | African ...

    African Journals Online (AJOL)

    Shoots of three landraces of a Vigna species from two climatic areas of Cameroon were evaluated for their content of heat-resistant peroxidases. The peroxidase activity in the three landraces was detected with a greater catalytic efficiency for oxidation of O-dianisidine relative to ABTS (2, 2'-azino-bis-(3- ...

  7. Selection and evaluation of Rhizobial strains of Vigna radiata L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Selection and evaluation of Rhizobial strains of Vigna radiata L. beneficial to ... This study aimed to select suitable strains that can be used as inoculants to enhance legume production and simultaneously reduce the use of ... contributor to natural or biological N2 fixation and allows legumes to grow in the ...

  8. Biofertilizing efficiency of Sargassum polycystum extract on growth and biochemical composition of Vigna radiata and Vigna mungo

    Directory of Open Access Journals (Sweden)

    B Bharath

    2018-01-01

    Full Text Available Objective: To evaluate the effect of marine brown alga Sargassum polycystum extract on growth and biochemical parameters of Vigna radiata and Vigna mungo.Methods: Different concentrations of algal extracts (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0% were prepared and applied to the crops at every 10-day intervals under natural conditions. After 30 d, the plants were harvested to evaluate the growth and biochemical parameters.Results: Seaweed liquid fertilizers treated seedlings showed maximum growth in 3.0% concentration when compared to the untreated seedlings. Similarly, biochemical parameters such as photosynthetic pigments, protein, reducing sugar, total sugar and amino acids exhibited increases in 3.0% concentration seaweed extract. Decreases in growth and biochemical parameters were noticed in concentrations higher than 3.0%.Conclusions: Presence of micronutrients and growth regulating substances in the liquid extract help healthier and faster productivity of the crop.

  9. Crescimento e trocas gasosas de genótipos de feijão-caupi sob estratégias de cultivo

    Directory of Open Access Journals (Sweden)

    Aldemir da Silva

    2016-06-01

    Full Text Available O feijão-caupi tem grande importância econômica, alimentar e social. No Nordeste brasileiro, notadamente nas regiões semiáridas, sua produção é limitada pelo déficit hídrico, sendo necessário identificar genótipos tolerantes atrelados ao uso de tecnologias em seu cultivo. Com isto, objetivou-se avaliar o rendimento de fitomassa e as trocas gasosas de genótipos de feijão-caupi cultivados em diferentes técnicas de conservação de água. O experimento foi realizado em campo, no município de Pombal, na Paraíba, estudando-se quatro técnicas de retenção de água in situ (camalhão, sulco, bacia e sistema convencional e seis genótipos de feijão-caupi (1. Costela de Vaca, 2. BRS Itaim, 3. BRS Guariba, 4. BR-17 Gurguéia, 5. BRS Potengi e 6. BRS Aracé semeados no espaçamento de 0,5 m x 0,5 m, usando o delineamento experimental de blocos ao acaso, com quatro repetições. Os dados das estimativas do rendimento de fitomassa seca e das trocas gasosas das plantas foram submetidos à análise de variância, ao teste F, seguido de testes de comparação de médias, teste de Tukey. O cultivo em sulcos e em camalhão deram melhor resultados do que o sistema convencional de plantio e em bacia. As variedades BRS - Potengi, BRS - Aracé e BRS - Guariba tiveram melhor crescimento e trocas gasosas das plantas.

  10. Produção de feijão-caupi e gergelim consorciado com mamoneira no Semiárido paraibano

    Directory of Open Access Journals (Sweden)

    Guilherme de Freitas Furtado

    2017-02-01

    Full Text Available Objetivou-se avaliar os componentes de produção do feijão-caupi e gergelim, consorciado com a mamoneira no semiárido paraibano. O experimento foi desenvolvido no período de março a novembro de 2011 em condições de campo em Pombal, Paraíba. Realizou-se sob delineamento experimental em blocos ao acaso com três sistemas de cultivo em dois ensaios experimentais: feijão-caupi (cv. BRS Novaera e gergelim (cv. BRS Seda em monocultivo, consórcio com mamona cv. IAC 2028 e consórcio com mamona cv. BRS Nordestina, com 4 repetições, totalizando 12 parcelas experimentais em cada ensaio. O consórcio com a mamoneira reduz os componentes de produção e produção do feijão-caupi e gergelim, sendo a cv. BRS Nordestina mais competitiva. Considerando as variáveis estudadas, a melhor opção para cultivo consorciado do feijão-caupi ou gergelim na região é a cv. IAC 2028. Production of cowpea and sesame intercropped with castor bean in semiarid region of ParaibaAbstract: The objective was to evaluate yield components of cowpea and sesame grown as secondary crops, intercropping with castor bean in the semiarid region of Paraiba. The experiment was carried out from March to November 2011 under field conditions in Pombal, Paraíba state. Three experimental systems were used in a randomized block design in two experimental trials: cowpea (cv. BRS Novaera and sesame (cv. BRS Seda in monoculture, intercropping with castor bean cv. IAC 2028 and intercropping with castor bean cv. BRS Nordestina, with 4 replicates, totaling 12 experimental plot in each trial. The intercrop with castor bean reduces yield components and yield of cowpea and sesame, with an cv. BRS Nordestina more competitive. Considering the variables studied, the best option for intercropping cowpea or sesame in the region is the cv. IAC 2028.

  11. Promoção do crescimento vegetal e diversidade genética de bactérias isoladas de nódulos de feijão-caupi

    Directory of Open Access Journals (Sweden)

    Elaine Martins da Costa

    2013-09-01

    Full Text Available O objetivo deste trabalho foi avaliar o potencial de promoção do crescimento vegetal e a diversidade genética de bactérias isoladas de nódulos de feijão-caupi cultivado em solos do Cerrado piauiense. Avaliaram-se 26 estirpes quanto à capacidade de fixar nitrogênio em vida livre, solubilizar fosfatos inorgânicos, produzir ácido-3-indolacético (AIA na ausência e na presença do aminoácido triptofano (100 mg L-1, produzir nódulos e promover o crescimento de feijão-caupi em vasos Leonard. Nenhuma estirpe fixou nitrogênio em vida livre, e 69% foram capazes de solubilizar fosfato de cálcio in vitro. Na presença de triptofano, todas as estirpes foram capazes de sintetizar o AIA em meio 79, e 80% sintetizaram o AIA em meio DYGS. Apenas quatro estirpes nodularam o feijão-caupi. O sequenciamento do gene 16S rRNA identificou as estirpes nodulíferas como pertencentes aos gêneros Bradyrhizobium, Rhizobium, Bacillus e Paenibacillus. Entre as estirpes não nodulíferas promotoras do crescimento do feijão-caupi, estão os gêneros Bacillus e Paenibacillus.

  12. Effect of garlic extraction on injury by cowpea, Curculio Chalcodermes aenus Boheman (Coleoptera: Cucurlionidae), and other pests, to cowpea, Vigna unguiculata L. Walp

    Science.gov (United States)

    Garlic-based oils and extract formulations have been used as insecticides against various insects on numerous crops, but there are contradictions among findings on the insecticidal or repellent properties of garlic-based products. In a field plot test, the effects of garlic extract on control of th...

  13. Effects of volatiles from Maruca vitrata larvae and caterpillar-infested flowers of their host plant Vigna unguiculata on the foraging behavior of the parasitoid Apanteles taragamae

    NARCIS (Netherlands)

    Dannon, A.E.; Tamò, M.; Huis, van A.; Dicke, M.

    2010-01-01

    The parasitoid wasp Apanteles taragamae is a promising candidate for the biological control of the legume pod borer Maruca vitrata, which recently has been introduced into Benin. The effects of volatiles from cowpea and peabush flowers and Maruca vitrata larvae on host selection behavior of the

  14. Effects of volatiles from Maruca vitrata larvae and caterpillar-infested flowers of their host plant Vigna unguiculata on the foraging behavior of the parasitoid Apanteles taragamae.

    Science.gov (United States)

    Dannon, Elie A; Tamò, Manuele; Van Huis, Arnold; Dicke, Marcel

    2010-10-01

    The parasitoid wasp Apanteles taragamae is a promising candidate for the biological control of the legume pod borer Maruca vitrata, which recently has been introduced into Benin. The effects of volatiles from cowpea and peabush flowers and Maruca vitrata larvae on host selection behavior of the parasitoid Apanteles taragamae were investigated under laboratory conditions by using a Y-tube olfactometer. Naïve and oviposition-experienced female wasps were given a choice between several odor sources that included (1) uninfested, (2) Maruca vitrata-infested, and (3) mechanically damaged cowpea flowers, as well as (4) stem portions of peabush plants carrying leaves and flowers, (5) healthy M. vitrata larvae, and moribund (6), and live (7) virus-infected M. vitrata larvae. Responses of naïve and oviposition-experienced female wasps did not differ for any of the odor source combinations. Wasps were significantly attracted to floral volatiles produced by cowpea flowers that had been infested with M. vitrata larvae and from which the larvae had been removed. Apanteles taragamae females also were attracted to Maruca vitrata-infested flowers after removal of both the larvae and their feces. Female wasps discriminated between volatiles from previously infested flowers and mechanically damaged flowers. Uninfested cowpea flowers attracted only oviposition-experienced wasps that had received a rewarding experience (i.e. the parasitization of two M. vitrata larvae feeding on cowpea flowers) before the olfactometer test. Wasps also were attracted to uninfested leaves and flowers of peabush. Moreover, they were also attracted to healthy and live virus-infected M. vitrata larvae, but not when the latter were moribund. Our data show that, similarly to what has been extensively been reported for foliar volatiles, flowers of plants also emit parasitoid-attracting volatiles in response to being infested with an herbivore.

  15. Effect of thermal treatments on the chemical and biological value of irradiated and non-irradiated cowpea bean (Vigna unguiculata L. Walp) flour

    International Nuclear Information System (INIS)

    Dario, A.C.; Salgado, J.M.

    1994-01-01

    Chemical and nutritional characteristics of irradiated and nonirradiated cowpea bean at 0.2 kGy submitted to several thermal treatments were studied. The cowpea bean flours irradiated at 0.2 kGy were superior to those non-irradiated concerning digestibility and the flours submitted to microwave oven were superior to those cooked under low pressure, autoclaved or even raw from the nutritional point of view. As to the presence of anti-nutritional factors, the results showed that the variety of cowpea bean under research presented neither trypsin inhibitor nor haemagglutinin activity, however, regarding tannin, a 0.006% content was found and considered negligible

  16. Grain legume improvement in Ghana with induced mutagenesis - Special reference to winged bean Psophocarpus tetragonolobus (L.) DC and cowpea Vigna unguiculata (L) Walp

    International Nuclear Information System (INIS)

    Acquaah, G.; Klu, G.Y.P.

    1983-01-01

    Two varieties each of winged bean and cowpea were exposed to various doses of gamma irradiation from a 60 Co source. Seed emergence, seedling height, seedling survival, plant survival at maturity, and plant and pod fertility were all progressively reduced with increasing dosage of irradiation. Mutants isolated in th M 2 for winged bean included a single stem erect mutant, a multiple branch bush, early, extra long-poded, strap and a spectrum of seed size and colour mutants. In cowpea an erect mutant was isolated. (author)

  17. Impact of the energy crop Jatropha curcas L. on the composition of rhizobial populations nodulating cowpea (Vigna unguiculata L.) and acacia (Acacia seyal L.).

    Science.gov (United States)

    Dieng, Amadou; Duponnois, Robin; Floury, Antoine; Laguerre, Gisèle; Ndoye, Ibrahima; Baudoin, Ezékiel

    2015-03-01

    Jatropha curcas, a Euphorbiaceae species that produces many toxicants, is increasingly planted as an agrofuel plant in Senegal. The purpose of this study was to determine whether soil priming induced by J. curcas monoculture could alter the rhizobial populations that nodulate cowpea and acacia, two locally widespread legumes. Soil samples were transferred into a greenhouse from three fields previously cultivated with Jatropha for 1, 2, and 15 years, and the two trap legumes were grown in them. Control soil samples were also taken from adjacent Jatropha-fallow plots. Both legumes tended to develop fewer but larger nodules when grown in Jatropha soils. Nearly all the nifH sequences amplified from nodule DNA were affiliated to the Bradyrhizobium genus. Only sequences from Acacia seyal nodules grown in the most recent Jatropha plantation were related to the Mesorhizobium genus, which was much a more conventional finding on A. seyal than the unexpected Bradyrhizobium genus. Apart from this particular case, only minor differences were found in the respective compositions of Jatropha soil versus control soil rhizobial populations. Lastly, the structure of these rhizobial populations was systematically imbalanced owing to the overwhelming dominance of a very small number of nifH genotypes, some of which were identical across soil types or even sites. Despite these weak and sparse effects on rhizobial diversity, future investigations should focus on the characterization of the nitrogen-fixing abilities of the predominant rhizobial strains. Copyright © 2014 Elsevier GmbH. All rights reserved.

  18. Relating sensory profiles of canned amaranth (Amaranthus cruentus), cleome (Cleome gynandra), cowpea (Vigna unguiculata) and Swiss chard (Beta vulgaris) leaves to consumer acceptance.

    Science.gov (United States)

    Onyeoziri, Isiguzoro O; Kinnear, Marise; de Kock, Henriëtta L

    2018-04-01

    The younger generation of South Africans generally do not consume traditional meals prepared using African green leafy vegetables, primarily because they are regarded as bitter, "poverty" foods. Canning of these vegetables could create value-added products that can be sold in the commercial market. Descriptive sensory evaluation and consumer acceptance testing with young females were used to assess the potential of such products. The sensory attributes of amaranth, cleome and cowpea leaves canned in brine and in a cream sauce were described using 21 attributes grouped by aroma, taste, texture/mouthfeel and aftertaste. Amaranth and Swiss chard products were described as sweet with a popcorn-like aroma. Cleome products were described as bitter, sour, pungent, chemical-tasting, astringent, sandy with a metallic mouthfeel and strong aftertaste. Cowpea products were described as having woody and tobacco aromas as well as a chewy and cohesive texture. Among the products canned with a cream sauce, young female consumers preferred amaranth and Swiss chard; cowpea was less liked, while cleome was least liked. Canned amaranth leaves have potential as a commercial product that may be well liked by young consumers. The cowpea leaves product has consumer potential, but the formulation needs revision, while canned cleome leaves need further research work. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. Supplementation of irradiated and non-irradiated cowpea bean (Vigna unguiculata L. Walp) protein with cereal proteins - supplementation of soup with a protein blend of appropriate nutritional value

    International Nuclear Information System (INIS)

    Dario, A.C.; Salgado, J.M.

    1994-01-01

    The quality of the cowpea bean protein was improved through supplementations with flours from beans exposed to microwave oven treated with cereal proteins such as wheat, rice, corn, and sorghum. Biological assays results with these blends showed that the casein exceeded the other diets concerning digestibility only; however, in parameters such as biological value, net protein utilization (NPU), protein efficiency ratio (PER) and nutritional efficiency ratio (NER), no significant differences occurred. Among all elaborated blends, the one with irradiated beans submitted to microwave oven for 30 minutes (65%) + rice (35%) presented the best results. The soup elaborated with the best supplemented blend was satisfactory concerning color, odor, flavor and texture

  20. Evaluation of MALDI-TOF mass spectrometry for the competitiveness analysis of selected indigenous cowpea (Vigna unguiculata L. Walp.) Bradyrhizobium strains from Kenya.

    Science.gov (United States)

    Ndungu, Samuel Mathu; Messmer, Monika M; Ziegler, Dominik; Thuita, Moses; Vanlauwe, Bernard; Frossard, Emmanuel; Thonar, Cécile

    2018-06-01

    Cowpea N 2 fixation and yield can be enhanced by selecting competitive and efficient indigenous rhizobia. Strains from contrasting agro-ecologies of Kilifi and Mbeere (Kenya) were screened. Two pot experiments were established consisting of 13 Bradyrhizobium strains; experiment 1 (11 Mbeere + CBA + BK1 from Burkina Faso), experiment 2 (12 Kilifi + CBA). Symbiotic effectiveness was assessed (shoot biomass, SPAD index and N uptake). Nodule occupancy of 13 simultaneously co-inoculated strains in each experiment was analyzed by matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) to assess competitiveness. Strains varied in effectiveness and competitiveness. The four most efficient strains were further evaluated in a field trial in Mbeere during the 2014 short rains. Strains from bacteroids of cowpea nodules from pot and field experiments were accurately identified as Bradyrhizobium by MALDI-TOF based on the SARAMIS™ database. In the field, abundant indigenous populations 7.10 × 10 3 rhizobia g -1 soil, outcompeted introduced strains. As revealed by MALDI-TOF, indigenous strains clustered into six distinct groups (I, II, III, IV, V and VI), group III were most abundant occupying 80% of nodules analyzed. MALDI-TOF was rapid, affordable and reliable to identify Bradyrhizobium strains directly from nodule suspensions in competition pot assays and in the field with abundant indigenous strains thus, its suitability for future competition assays. Evaluating strain competitiveness and then symbiotic efficacy is proposed in bioprospecting for potential cowpea inoculant strains.

  1. Identification of candidate genes and molecular markers for heat-induced brown discoloration of seed coats in cowpea [Vigna unguiculata (L.) Walp].

    Science.gov (United States)

    Pottorff, Marti; Roberts, Philip A; Close, Timothy J; Lonardi, Stefano; Wanamaker, Steve; Ehlers, Jeffrey D

    2014-05-01

    Heat-induced browning (Hbs) of seed coats is caused by high temperatures which discolors the seed coats of many legumes, affecting the visual appearance and quality of seeds. The genetic determinants underlying Hbs in cowpea are unknown. We identified three QTL associated with the heat-induced browning of seed coats trait, Hbs-1, Hbs-2 and Hbs-3, using cowpea RIL populations IT93K-503-1 (Hbs positive) x CB46 (hbs negative) and IT84S-2246 (Hbs positive) x TVu14676 (hbs negative). Hbs-1 was identified in both populations, accounting for 28.3% -77.3% of the phenotypic variation. SNP markers 1_0032 and 1_1128 co-segregated with the trait. Within the syntenic regions of Hbs-1 in soybean, Medicago and common bean, several ethylene forming enzymes, ethylene responsive element binding factors and an ACC oxidase 2 were observed. Hbs-1 was identified in a BAC clone in contig 217 of the cowpea physical map, where ethylene forming enzymes were present. Hbs-2 was identified in the IT93K-503-1 x CB46 population and accounted for of 9.5 to 12.3% of the phenotypic variance. Hbs-3 was identified in the IT84S-2246 x TVu14676 population and accounted for 6.2 to 6.8% of the phenotypic variance. SNP marker 1_0640 co-segregated with the heat-induced browning phenotype. Hbs-3 was positioned on BAC clones in contig512 of the cowpea physical map, where several ACC synthase 1 genes were present. The identification of loci determining heat-induced browning of seed coats and co-segregating molecular markers will enable transfer of hbs alleles into cowpea varieties, contributing to higher quality seeds.

  2. A novel feedstuff: ensiling of cowpea (Vigna unguiculata L.) stover and apple (Malus domestica Borkh.) mixtures. Evaluation of the nutritive value, fermentation quality and aerobic stability.

    Science.gov (United States)

    Andrade, Ederson; Gonçalves, Alexandre; Mendes-Ferreira, Ana; Silva, Valéria; Pinheiro, Victor; Rodrigues, Miguel; Ferreira, Luis

    2017-10-01

    Agro-industrial by-products are of low economic value as foods for human consumption but may have potential value as animal feedstuffs. This study evaluated a novel feedstuff, ensiled discarded apple (85%) and cowpea stover (15%) mixtures with two different ensiling periods (45 and 60 days), regarding the nutritive value, fermentation quality and aerobic stability. Generally, no differences (P > 0.05) were observed between ensiling periods for nutritive value and fermentation characteristics. Silages were stable after ensiling, presenting high lactic acid (77.3 g kg -1 dry matter (DM)) and acetic acid (54.7 g kg -1 DM) and low ethanol (15.7 g kg -1 DM) and NH 3 -N (105.6 g kg -1 total N) concentrations. No butyric acid was detected in silages, and they were aerobically stable for up to 216 h. Lactic acid bacteria numbers were high at silo opening (7.14 log colony-forming units (CFU) g -1 ), while Enterobacteriaceae were not detected and yeasts/moulds were low (2.44 log CFU g -1 ). Yeast/mould and Enterobacteriaceae numbers grew considerably during 12 days of air exposure. A mixture of low calibre discarded apples with cowpea stover can be used as animal feed after the ensiling process owing to its nutritive value and long aerobic stability. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  3. Genetic and physical mapping of candidate genes for resistance to Fusarium oxysporum f.sp. tracheiphilum race 3 in cowpea [Vigna unguiculata (L.) Walp].

    Science.gov (United States)

    Pottorff, Marti; Wanamaker, Steve; Ma, Yaqin Q; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J

    2012-01-01

    Fusarium oxysporum f.sp. tracheiphilum (Fot) is a soil-borne fungal pathogen that causes vascular wilt disease in cowpea. Fot race 3 is one of the major pathogens affecting cowpea production in California. Identification of Fot race 3 resistance determinants will expedite delivery of improved cultivars by replacing time-consuming phenotypic screening with selection based on perfect markers, thereby generating successful cultivars in a shorter time period. Resistance to Fot race 3 was studied in the RIL population California Blackeye 27 (resistant) x 24-125B-1 (susceptible). Biparental mapping identified a Fot race 3 resistance locus, Fot3-1, which spanned 3.56 cM on linkage group one of the CB27 x 24-125B-1 genetic map. A marker-trait association narrowed the resistance locus to a 1.2 cM region and identified SNP marker 1_1107 as co-segregating with Fot3-1 resistance. Macro and microsynteny was observed for the Fot3-1 locus region in Glycine max where six disease resistance genes were observed in the two syntenic regions of soybean chromosomes 9 and 15. Fot3-1 was identified on the cowpea physical map on BAC clone CH093L18, spanning approximately 208,868 bp on BAC contig250. The Fot3-1 locus was narrowed to 0.5 cM distance on the cowpea genetic map linkage group 6, flanked by SNP markers 1_0860 and 1_1107. BAC clone CH093L18 was sequenced and four cowpea sequences with similarity to leucine-rich repeat serine/threonine protein kinases were identified and are cowpea candidate genes for the Fot3-1 locus. This study has shown how readily candidate genes can be identified for simply inherited agronomic traits when appropriate genetic stocks and integrated genomic resources are available. High co-linearity between cowpea and soybean genomes illustrated that utilizing synteny can transfer knowledge from a reference legume to legumes with less complete genomic resources. Identification of Fot race 3 resistance genes will enable transfer into high yielding cowpea varieties using marker-assisted selection (MAS).

  4. A Single Nucleotide Polymorphism (SNP)-based association analysis for plant growth habit in worldwide Cowpea (Vigna unguiculata (L.) Walp) germplasm

    Science.gov (United States)

    Cowpea is a legume widely grown in Africa, North, Central and South America, and Asia. The Cowpea plant growth habits consist of erect, semi-prostrate, and prostrate types. Developing a cultivar while considering plant growth habit is essential within a breeding program since the need for a particul...

  5. H2O2 plays an important role in the lifestyle of Colletotrichum gloeosporioides during interaction with cowpea [Vigna unguiculata (L.) Walp].

    Science.gov (United States)

    Eloy, Ygor R G; Vasconcelos, Ilka M; Barreto, Ana L H; Freire-Filho, Francisco R; Oliveira, Jose T A

    2015-08-01

    Plant-fungus interactions usually generate H(2)O(2) in the infected plant tissue. H(2)O(2) has a direct antimicrobial effect and is involved in the cross-linking of cell walls, signaling, induction of gene expression, hypersensitive cell death and induced systemic acquired resistance. This has raised the hypothesis that H(2)O(2) manipulation by pharmacological compounds could alter the lifestyle of Colletotrichum gloeosporioides during interaction with the BR-3-Tracuateua cowpea genotype. The primary leaves of cowpea were excised, infiltrated with salicylic acid (SA), glucose oxidase + glucose (GO/G), catalase (CAT) or diphenyliodonium chloride (DPI), followed by spore inoculation on the adaxial leaf surface. SA or GO/G-treated plantlets showed increased H(2)O(2) accumulation and lipid peroxidation. The fungus used a subcuticular, intramural necrotrophic strategy, and developed secondary hyphae associated with the quick spread and rapid killing of host cells. However, CAT or DPI-treated leaves exhibited decreased H(2)O(2) concentration and lipid peroxidation and the fungus developed intracellular hemibiotrophic infection with vesicles, in addition to primary and secondary hyphal formation. These results suggest that H(2)O(2) plays an important role in the cowpea (C. gloeosporioides) pathosystem given that it affected fungal lifestyle during interaction. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  6. Production in Pichia pastoris, antifungal activity and crystal structure of a class I chitinase from cowpea (Vigna unguiculata): Insights into sugar binding mode and hydrolytic action.

    Science.gov (United States)

    Landim, Patrícia G Castro; Correia, Tuana O; Silva, Fredy D A; Nepomuceno, Denise R; Costa, Helen P S; Pereira, Humberto M; Lobo, Marina D P; Moreno, Frederico B M B; Brandão-Neto, José; Medeiros, Suelen C; Vasconcelos, Ilka M; Oliveira, José T A; Sousa, Bruno L; Barroso-Neto, Ito L; Freire, Valder N; Carvalho, Cristina P S; Monteiro-Moreira, Ana C O; Grangeiro, Thalles B

    2017-04-01

    A cowpea class I chitinase (VuChiI) was expressed in the methylotrophic yeast P. pastoris. The recombinant protein was secreted into the culture medium and purified by affinity chromatography on a chitin matrix. The purified chitinase migrated on SDS-polyacrylamide gel electrophoresis as two closely-related bands with apparent molecular masses of 34 and 37 kDa. The identity of these bands as VuChiI was demonstrated by mass spectrometry analysis of tryptic peptides and N-terminal amino acid sequencing. The recombinant chitinase was able to hydrolyze colloidal chitin but did not exhibit enzymatic activity toward synthetic substrates. The highest hydrolytic activity of the cowpea chitinase toward colloidal chitin was observed at pH 5.0. Furthermore, most VuChiI activity (approximately 92%) was retained after heating to 50 °C for 30 min, whereas treatment with 5 mM Cu 2+ caused a reduction of 67% in the enzyme's chitinolytic activity. The recombinant protein had antifungal activity as revealed by its ability to inhibit the spore germination and mycelial growth of Penicillium herquei. The three-dimensional structure of VuChiI was resolved at a resolution of 1.55 Å by molecular replacement. The refined model had 245 amino acid residues and 381 water molecules, and the final R-factor and R free values were 14.78 and 17.22%, respectively. The catalytic domain of VuChiI adopts an α-helix-rich fold, stabilized by 3 disulfide bridges and possessing a wide catalytic cleft. Analysis of the crystallographic model and molecular docking calculations using chito-oligosaccharides provided evidences about the VuChiI residues involved in sugar binding and catalysis, and a possible mechanism of antifungal action is suggested. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  7. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  8. Genotype evaluation of cowpea seeds (Vigna unguiculata) using 1H qNMR combined with exploratory tools and solid-state NMR.

    Science.gov (United States)

    Alves Filho, Elenilson G; Silva, Lorena M A; Teofilo, Elizita M; Larsen, Flemming H; de Brito, Edy S

    2017-01-01

    The ultimate aim of this study was to apply a non-targeted chemometric analysis (principal component analysis and hierarchical clustering analysis using the heat map approach) of NMR data to investigate the variability of organic compounds in nine genotype cowpea seeds, without any complex pre-treatment. In general, both exploratory tools show that Tvu 233, CE-584, and Setentão genotypes presented higher amount mainly of raffinose and Tvu 382 presented the highest content of choline and least content of raffinose. The evaluation of the aromatic region showed the Setentão genotype with highest content of niacin/vitamin B3 whereas Tvu 382 with lowest amount. To investigate rigid and mobile components in the seeds cotyledon, 13 C CP and SP/MAS solid-state NMR experiments were performed. The cotyledon of the cowpea comprised a rigid part consisting of starch as well as a soft portion made of starch, fatty acids, and protein. The variable contact time experiment suggests the presence of lipid-amylose complexes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Influence of farmyard manure on some morphological and biochemical parameters of cowpea (Vigna unguiculata) seedling grown in cadmium-treated soil.

    Science.gov (United States)

    Asagba, Samuel Ogheneovo; Ezedom, Theresa; Kadiri, Helen

    2017-10-01

    The present study aims to assess the effects of the two kinds of farmyard manure (poultry and pig manures) as amendments for soil on cadmium (Cd) toxicity in plants using cowpea seedlings as plant model. Cd toxicity was evaluated by assessing the effect of the metal on the growth rate and antioxidant status as well as the ability of the plant to metabolise xenobiotic. There was a significantly (p cowpea seedlings grown in all the treated soils relative to control. Addition of poultry manure to the soil significantly (p cowpea seedlings grown in Cd-treated soil augmented with poultry manure but not in cowpea seedlings in cadmium-treated soil with pig manure amendments. Similarly, augmentation of Cd-treated soil with pig manure did not alter the Cd-induced effect on the levels of superoxide dismutase (SOD) and lipid peroxidation (LPO) in leaf, stem and roots, as SOD remained significantly (p cowpea seedlings grown in Cd-treated soils amended with poultry manure were restored to a level not significantly (p > 0.05) different from control. Like in the case of SOD, the Cd-induced inhibition of the activity of xenobiotic metabolising enzymes, aldehyde oxidase and sulphite oxidase remained significantly (p  0.05) different from control. In conclusion, the findings of the study revealed that supplementation of Cd-treated soils with pig and poultry manures reversed effects of Cd on cowpea seedlings. However, poultry manure was more effective than pig manure in ameliorating the effects of Cd.

  10. Cowpea pod (Vigna unguiculata) biomass as a low-cost biosorbent for removal of Pb(II) ions from aqueous solution.

    Science.gov (United States)

    Guyo, U; Moyo, M

    2017-01-01

    The use of cowpea pod (CPP) biomass for the removal of Pb(II) ions from aqueous solution was investigated. The effects of factors such as dosage concentration (0.2 to 1.6 g L -1 ), pH (2 to 8), contact time (5 to 120 min), metal ion concentrations (10 to 80 mg L -1 ) and temperature (20 to 50 °C) were examined through batch studies. The biosorption data conformed best to the Langmuir model at the three working temperatures (20, 30 and 40 °C) as revealed by the correlation coefficients (R 2 ) which were greater than 0.940. The maximum sorption capacity of the CPP for Pb(II) was 32.96 mg g -1 at 313 K. Furthermore, the kinetic data fitted well to the pseudo-second-order model as it had the lowest sum of square error (SSE) values and correlation coefficients close to unity (R 2  > 0.999). The thermodynamic parameters (ΔG°, ΔS° and ΔH°) showed that the biosorption process was spontaneous, feasible and endothermic. The results obtained in the present study indicated that cowpea pod biomass could be used for the effective removal of Pb(II) from aqueous solution.

  11. Label-free Proteomic Reveals that Cowpea Severe Mosaic Virus Transiently Suppresses the Host Leaf Protein Accumulation During the Compatible Interaction with Cowpea (Vigna unguiculata [L.] Walp.).

    Science.gov (United States)

    Paiva, Ana L S; Oliveira, Jose T A; de Souza, Gustavo A; Vasconcelos, Ilka M

    2016-12-02

    Viruses are important plant pathogens that threaten diverse crops worldwide. Diseases caused by Cowpea severe mosaic virus (CPSMV) have drawn attention because of the serious damages they cause to economically important crops including cowpea. This work was undertaken to quantify and identify the responsive proteins of a susceptible cowpea genotype infected with CPSMV, in comparison with mock-inoculated controls, using label-free quantitative proteomics and databanks, aiming at providing insights on the molecular basis of this compatible interaction. Cowpea leaves were mock- or CPSMV-inoculated and 2 and 6 days later proteins were extracted and analyzed. More than 3000 proteins were identified (data available via ProteomeXchange, identifier PXD005025) and 75 and 55 of them differentially accumulated in response to CPSMV, at 2 and 6 DAI, respectively. At 2 DAI, 76% of the proteins decreased in amount and 24% increased. However, at 6 DAI, 100% of the identified proteins increased. Thus, CPSMV transiently suppresses the synthesis of proteins involved particularly in the redox homeostasis, protein synthesis, defense, stress, RNA/DNA metabolism, signaling, and other functions, allowing viral invasion and spread in cowpea tissues.

  12. Natural infection of cowpea (Vigna unguiculata (L.) Walp.) by toxigenic fungi and mycotoxin contamination in Benin, West Africa

    DEFF Research Database (Denmark)

    Houssou, P.A.; Ahohuendo, B.C.; Fandohan, P.

    2009-01-01

    for the two periods. About 23 fungal species were identified on cowpea seed samples across zones of which Aspergillus flavus, a fungus that produces aflatoxins, was most frequently encountered. Fusarium species shown to produce fumonisins were not recorded from cowpea seeds. Overall incidence of A. flavus...... infection was found to increase after storage from 7.6% at T0 to 28.25% at T3. In spite of this natural infection of cowpea, very low levels of fumonisin and aflatoxin were detected. Only three out of the 92 cowpea samples, all collected at T0, were found to be fumonisin B1 positive with a mean level of 0.......03 mg/g. Similarly, only six samples out of the 92, all collected at T3, were aflatoxin B1 positive with mean levels of 3.58 µg/kg. Fumonisin (B2 and B3) and aflatoxin (B2, G1 and G2) were not detected in any of the samples. Contrary to the situation with maize and groundnut where high levels of toxin...

  13. The cowpea (Vigna unguiculata L. Walp and its response to the application of humic acids (HA´s in Canton Jipijapa in Ecuador

    Directory of Open Access Journals (Sweden)

    Ayón Fernando

    2017-05-01

    Full Text Available This research was carried out in the Jipijapa canton, Manabi province of Ecuador, with the following objectives: i to identify the dose of humic acid in the caupí crop, ii to determine the time for foliar application of humic acid, and iii determine the marginal rate of return in terms of cost/benefit. A plot in experimental design of completely randomized blocks (DCRB with factorial arrangement of 4 x 3 with four replications was implemented. The variables plant height (PH, stem diameter (SD, sheath length (SL, number of decks (ND and average weight of decks (AWD were evaluated. The results showed that to improve cowpea production, the addition of significant amounts of iron is required. The dose of leaf application was 1000 cm3/ha of humic acids, the PH was 48.76 cm and SD of 9.66 mm. The time for foliar application of humic acids was at 30 days, the length of pod was obtained with 21.16 cm and numbers of decks with 14.34. For the weight of the mallets, the treatment was the application to the 15 days after the sowing. There was a high and significant correlation between PH and SD (0.54. When the economic analysis was carried out, the T8 treatment, 1000 cm3/ha of humic acid was applied, applied 30 days after sowing was the one with the marginal return rate with 271.43%.

  14. Effect of gamma radiation of 60Co in the variability of chinese bean [Vigna unguiculata (l.) Walpers] en R4M4

    International Nuclear Information System (INIS)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F.; Cervantes S, T.; Cruz T, E. De la

    2007-01-01

    Selection of plants of Chinese bean coming from seed irradiated with gammas of 60 Co in the generation R 4 M 4 (fourth recurrent irradiation, fourth segregate generation) were carried out, taking as selection approaches the plant architecture, the numbers of sheaths for plant, sheath longitude, position of the sheaths, grain size and resistance to plagues and illnesses. 17 lines were selected for grain and 3 lines with fodder characteristics of black grain color were also obtained. (Author)

  15. In vitro Control of Anthracnose Disease of Cowpea (Vigna unguiculata L. Walp caused by Colletotrichum destructivum with Cyathula prostrata L and Diodia scandens SW leaf extracts

    Directory of Open Access Journals (Sweden)

    Gideon Ikechukwu Ogu

    2013-02-01

    Conclusion: These findings suggest that C. prostrata and D. scandens leaf extract have the potentials as veritable control agents of anthracnose disease of cowpea in Africa. [J Intercult Ethnopharmacol 2013; 2(1.000: 29-36

  16. Effect of Osmopriming Duration on Germination, Emergence, and Early Growth of Cowpea (Vigna unguiculata (L. Walp. in the Sudan Savanna of Nigeria

    Directory of Open Access Journals (Sweden)

    Ajit Singh

    2014-01-01

    Full Text Available Seed osmopriming could be a sustainable method to increase crop establishment, uniform emergence, and growth of plant on the field. Laboratory and field studies were carried out in 2010 cropping season at Usmanu Danfodiyo University, Sokoto, to study the effect of seed osmopriming duration on the germination, emergence, and growth of cowpea seeds. Treatments consisted of three osmopriming duration (soaking in 1% KNO3 salt for 6, 8, and 10 hrs, one hydroprimed control (10 hr, and an unprimed control. These five treatments were laid out in a completely randomized design (CRD replicated four times. The results showed that osmopriming with KNO3 for different durations was at par but was superior to unprimed treatments in terms of seed germination, emergence, plant height, and dry matter accumulation at 3 weeks after sowing. From this study, it can therefore be concluded that seeds of cowpea could be primed (both hydro and osmopriming for increased performance. However, osmopriming with KNO3 salt (soaked in 1% KNO3 salt solution and dried before sowing for 6 hours could result in greater seed germination and seedling height than hydropriming.

  17. Effect of rotation of cowpea (Vigna unguiculata) with fonio (Digitaria exilis) and millet (Pennisetum glaucum) on Macrophomina phaseolina densities and cowpea yield

    NARCIS (Netherlands)

    Ndiaye, M.; Termorshuizen, A.J.; Bruggen, van A.H.C.

    2008-01-01

    Macrophomina phaseolina, the causal agent of charcoal rot, causes great damage to cowpea in the Sahel. One of the few options to manage the disease is by cropping nonhosts that may reduce the soil inoculum below a damage threshold level. To test this, fonio (Digitaria exilis) and millet (Pennisetum

  18. DETERMINATION OF THE EFFICACY OF BEST ACTION, FURADAN, AND NEEM EMULSION IN THE CONTROL OF MAJOR INSECT PESTS OF COWPEA [Vigna unguiculata (L. WALP

    Directory of Open Access Journals (Sweden)

    2016-11-01

    Full Text Available Field experiments to determine the efficacy of Best Action (30g/litre cypermethrine plus 250g/litre dimethoate as water emulsifiable concentrates, Furadan 10G (carbofuran, Neem emulsion (Azadiracta indica as insecticide treatments in the control of major insect pests of cowpea were conducted in two agro-environments simultaneously in Enugu Area, South Eastern Nigeria in 2014 cropping season using two cowpea varieties (Ife brown, and Potiskum as test crops. The experimental design was a split plot in a randomized compete block (RCB replicated three times. Best Action was more effective in controlling cowpea insect pests, followed by Furandan 10G, and Neem emulsion respectively and their effectiveness was not affected by climatic factors variations in the two agro-environments (Nsukka and Agbani. Ife brown and Potiskum did not significantly resist the attack of major insect pests of cowpea. Insecticides and cowpea varieties did not have a significant interaction effect on the control of major insect pests of cowpea.

  19. INFLUENCE OF CROPPING SYSTEM AND WEED MANAGEMENT PRACTICE ON EMERGENCE, GROWTH OF WEEDS, YIELD OF MAIZE (Zea mays L. AND COWPEA (Vigna unguiculata L.

    Directory of Open Access Journals (Sweden)

    Felix Ogar Takim

    2014-06-01

    Full Text Available The effects of cropping system and weed management practice on weed seedling emergence, weed biomass production and yield of maize and cowpea were examined at Ilorin, in the southern Guinea savanna (9°29' N, 4°35' E and 307 m ASL of Nigeria. Weed emergence occurred throughout the 3-15 weeks after planting (WAP. Forty-three weed species belonging to 38 genera within 20 families were encountered. Fimbristylis littoralis Gaudet, Tridax procumbens L and Eleusine indica Gaertn were the most prevalent weed species. Cropping system and weed management practice significantly affected weed emergence. Significantly (p≤0.05 lower number of weeds emerged in the intercropped and herbicide treated plots while higher weed densities and weed biomass were recorded in the uncropped and unweeded control plots than in the other plots. While aggregate crop yields were significantly higher in the intercropped than in the sole plots, component crop yields were higher under the sole cropping than in the intercrop. The implication of the results on weed management is discussed.

  20. Cowpea (Vigna unguiculata L. Walp) and groundnut (Arachis hypogea L.) haulms as supplements to sorghum (Sorghum bicolor L. Moench) stover : intake, digestibility and optimum feeding levels

    NARCIS (Netherlands)

    Savadogo, M.; Zemmelink, G.; Nianogo, A.J.; Keulen, van H.

    2000-01-01

    Two feeding trials were conducted to study the combined effects of (i) varying degrees of selective consumption and (ii) supplementation with cowpea (Trail 1) or groundnut haulms (Trial 2), on intake of organic matter (IOM) from sorghum stover, and total intake of digestible organic matter (IDOM).

  1. EFFECT OF CRUDE CASSAVA WATER EXTRACT AS A NATURAL HERBICIDE ON PROXIMATE COMPOSITION AND BIOACCUMULATION OF HYDROCYANIC ACID IN FOOD COMPONENTS OF COWPEA -VIGNA UNGUICULATA (L WALP

    Directory of Open Access Journals (Sweden)

    Olajumoke Oke FAYINMINNU

    2013-06-01

    Full Text Available This study was a field trial of two experiments to examine the effect of crude cassava water extract (CCWE as a natural post-emergence herbicide on nutritional quality and bioaccumulation of hydrocyanic acid in cowpea seeds. The spraying of CCWE on cowpea plants was carried out weekly for 5weeks. Treatments of CCWE at 25 and 50% concentrations of MS6 (Manihot Selection, TMS30555 (Tropical Manihot Selection and Bulk CCWE (different cassava varieties, hand weeded and unweeded (controls were laid in randomised complete block design with three replications respectively. At maturity, dry samples of cowpea `Ife brown` seeds were ground to fine powder and the proximate composition and bioaccumulation of hydrocyanic acid in the two experiments were determined. Significant variations (p0.05 among the herbicide treatments. It was therefore recommended that CCWE could be used as a natural post-emergence herbicide in cowpea production without altering the nutritional quality and residue of hydrocyanic acid in cowpea seeds.

  2. Fluxo de calor sensível em cultivo de feijão-caupi Sensible heat flux in cowpea

    Directory of Open Access Journals (Sweden)

    José R. de S Lima

    2011-10-01

    Full Text Available O presente trabalho objetivou comparar o fluxo de calor sensível obtido pelo método do balanço de energia-razão de Bowen (H_B e pelo método aerodinâmico (H_A, em uma área de 4 ha cultivada com feijão-caupi em Areia-PB (6º 58' 12" S e 35º 42' 15" O, 620 m. Foram coletados dados de saldo de radiação, fluxo de calor no solo, temperatura e umidade do solo, temperatura e umidade relativa do ar, velocidade do vento e precipitação pluvial, os quais eram lidos a cada minuto, e armazenados, em uma central de aquisição de dados, como médias a cada 30 min, com exceção da pluviometria, cujo valor foi totalizado no período. Obteve-se excelente concordância entre H_A e H_B, com um índice "d " de 0,980, um erro padrão (EP de 14,88 W m-2, e sem diferença significativa entre H_A e H_B, pelo teste t-Student. Deste modo, o método aerodinâmico pode ser usado em conjunto com medidas de saldo de radiação e de fluxo de calor no solo, para se estimar o fluxo de calor latente e, consequentemente, a evapotranspiração da cultura do feijão-caupi, para as condições edafoclimáticas do Brejo Paraibano.A study was performed to compare the bulk aerodynamic (H_A and Bowen ratio energy balance (H_B methods in the estimation of the sensible heat flux in a cowpea crop. Data of net radiation, soil heat flux, soil water content, soil temperature, air temperature, relative humidity, wind speed and rainfall were collected on 30-min time intervals in an area of 4 ha belonging to the municipality of Areia, PB (6º 58' 12" S e 35º 42' 15" W, 620 m. Results showed that there was a good agreement between H_A and H_B with an index "d" of 0.98 and standard error of estimate (SEE of 14.88 W m-2, no significant difference between H_A H_B, by the t-Student test. Thus, the bulk aerodynamic method can be used in conjunction with measurements of net radiation and soil heat flux to estimate the evapotranspiration of the cowpea under soil and climatic condition of

  3. Efeito de coberturas do solo sobre a sobrevivência de Macrophomina phaseolina no feijão-caupi

    Directory of Open Access Journals (Sweden)

    Cheyla Magdala de Sousa Linhares

    2016-06-01

    Full Text Available RESUMO Com o objetivo de avaliar a sobrevivência de Macrophomina phaseolina em solo submetido a diferentes coberturas, conduziu-se dois experimentos em casa de vegetação, no delineamento inteiramente casualizado, em esquema fatorial 5 x 2, com cinco coberturas (Brachiaria brizantha, Pennisetum glaucum, Crotalaria spectabilis, solo coberto com filme de polietileno e solo sem cobertura e solo esterilizado e não esterilizado. No primeiro experimento, as plantas foram cultivadas em vasos e dessecadas, para posterior plantio do feijão-caupi e no segundo, a semeadura da cultura foi realizada em sucessão ao primeiro cultivo. Nos dois experimentos foram colocadas em cada vaso a 10 cm de profundidade, no dia do plantio da cultura, quatro bolsas de tecido contendo, cada uma, 10 gramas de inóculo de M. phaseolina, das quais, duas foram retiradas aos 30 dias após o plantio e duas no final do ciclo da cultura, para posterior plaqueamento e determinação da sobrevivência. Realizou-se também o monitoramento das temperaturas máximas e mínimas diárias do solo. Os tratamentos com solo coberto com material vegetal apresentaram menor elevação da temperatura em relação ao solo coberto com filme de polietileno e sem cobertura, que elevaram a temperatura em até 5,9 e 3,9 ºC, respectivamente, em relação ao solo coberto com palhada de P. glaucum. O solo coberto com filme de polietileno e sem cobertura apresentaram maiores taxas de sobrevivência de M. phaseolina e o solo coberto com palhada de P. glaucum a menor taxa. Maior sobrevivência foi observada no solo não esterilizado.

  4. Avaliação de genótipos de caupi sob salinidade Assessment of cowpea genotypes under salinity

    Directory of Open Access Journals (Sweden)

    José P. Dantas

    2002-12-01

    Full Text Available Foram conduzidos ensaios em abrigo telado de vegetação com cobertura de telha de fibra de vidro com o objetivo de se avaliar a tolerância de 50 genótipos de caupi sob salinidade. Os tratamentos de salinidade aplicados no solo, em termos de condutividade elétrica do extrato de saturação (CE, foram: CE1 - 0,3, CE2 - 3,0, CE3 - 6,0, CE4 - 9,0 e CE5 - 12,0 dS m-1. Os genótipos foram classificados para tolerância à salinidade com base na redução percentual do peso de matéria seca da parte aérea. No tratamento CE2, 36 genótipos foram tolerantes (T, 12 moderadamente tolerantes (MT e 2 moderadamente sensíveis (MS; no tratamento CE3, 3 foram T, 14 MT, 30 MS e 3 sensíveis (S; no tratamento CE4, um foi MS e 49 S e, no tratamento CE5, todos foram S. O teor de proteína nos grãos foi influenciado pela salinidade e variou de genótipo para genótipo.To assess the tolerance of 50 cowpea genotypes under salinity, experiments were conducted in greenhouse covered with fiberglass sheets. The salinity treatments applied in terms of electrical conductivity of saturation extract of soil (EC were EC1 - 0.3; EC2 - 3.0; EC3 - 6.0; EC4 - 9.0 and EC5 - 12.0 dS m-1. The genotypes were classified for the salinity tolerance on the basis of the reduction in dry weight (% of shoot. Under EC2, 36 genotypes were tolerant (T, 12 moderately tolerant (MT and 2 moderately susceptible (MS; under EC3, 3 were T, 14 MT, 30 MS and 3 susceptible (S; under EC4, one was MS and 49 S and under EC5, all were S. The protein content of seed was influenced by salinity and varied with the genotype.

  5. Acúmulo de massa seca em feijão-caupi sob adubação orgânica

    Directory of Open Access Journals (Sweden)

    Paulo Cássio Alves Linhares

    2016-12-01

    Full Text Available O feijão-caupi responde bem à adubação orgânica, aumentando sua produtividade quando o solo é adubado com estercos de animais, compostos orgânicos, húmus de minhoca e biofertilizante. Assim, objetivou-se avaliar o acúmulo de massa seca do feijão-caupi em função de diferentes quantidades de húmus de minhoca incorporadas ao solo e biofertilizantes orgânicos nas condições do semiárido nordestino. O experimento foi conduzido em condições de campo, na Universidade Estadual da Paraíba, em delineamento experimental em blocos completos casualizados, no esquema fatorial 4 x 2, com 5 repetições. O primeiro fator correspondeu a quatro quantidades de húmus de minhoca incorporadas ao solo (0,0; 0,5; 1,0 e 1,5 kg m-1 e o segundo fator, duas adubações via foliar na forma líquida (biofertilizante comum e húmus de minhoca. Avaliaram-se os rendimentos de massa seca da: folha, caule, raiz, parte aera, total e da relação parte/aérea. Não houve interação significativa entre os fatores tratamentos testados para nenhuma das características avaliadas. O maior acúmulo de massa seca do feijão-caupi foi registrado com a incorporação ao solo de 0,14 Kg m-1 de húmus de minhoca. Em termos de valores absolutos, o biofertilizante comum proporcionou maior massa seca do feijão-caupi.Dry matter accumulation in cowpea under organic fertilizationAbstract: Cowpea responds well to organic fertilization, increasing its productivity when the soil is fertilized with animal manures, organic compounds, earthworm humus and biofertilizer. Thus, the objective of this research was to evaluate the dry mass accumulation of cowpea as a function of different amounts of earthworm humus incorporated in the soil and organic biofertilizers under the conditions of the northeastern semi-arid region. The experiment was conducted under field conditions, at Universidade Estaudal da Paraíba, in a randomized complete block design, in the 4 x 2 factorial scheme, with

  6. Teores de pigmentos fotossintéticos em caupi inoculado com rizóbio e em condições salinas

    Directory of Open Access Journals (Sweden)

    Jailma Ribeiro de Andrade

    2012-10-01

    Full Text Available RESUMO: A salinidade é um fator estressante que limita a produção das culturas quando encontra-se em quantidades além do limiar tolerável pelas mesmas. Nesse sentido objetivou-se com este trabalho avaliar o teor de clorofila a, b, total e carotenóides em feijoeiro caupi irrigado com diferentes níveis de água salina. O experimento foi conduzido em casa de vegetação na Universidade Federal de Campina Grande (UFCG, a qual, está localizada na zona centro oriental do Estado da Paraíba, no Planalto da Borborema, cujas coordenadas geográficas são latitude sul 7º13’11’’, longitude oeste 35º53’31’’ e altitude de 547,56 m. As variáveis avaliadas foram: clorofilas a, clorofila b, carotenóides, relação clorofila a/clorofila b e relação clorofila total/ carotenóides. A interação de rizóbios e salinidade não teve efeito significativo sobre as variáveis. Já o fator sal isolado foi significativo sobre todas as variáveis avaliadas. Os teores de clorofilas e carotenóides indicam as condições do aparato fotossintético em feijoeiro caupi quando submetido a estresse salino.

  7. Eficiência do uso da água das culturas do milho e do feijão-caupi sob sistemas de plantio exclusivo e consorciado no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Luciana Sandra Bastos de Souza

    2011-01-01

    Full Text Available O objetivo deste trabalho foi analisar a resposta produtiva, a eficiência do uso de água e a viabilidade econômica de cultivos de milho e de feijão-caupi em sistemas de plantio exclusivo e consorciado na região semiárida do Nordeste brasileiro. O experimento foi desenvolvido no município de Petrolina (PE. As culturas, nos diferentes sistemas de plantio (exclusivo e consorciado, foram submetidas a cinco lâminas de irrigação, aplicadas logo após o pendoamento no milho e na fase de floração do feijão-caupi aos 40 dias depois da semeadura. Combinando as configurações de sistema de cultivo e as diferentes lâminas de irrigação, as culturas do milho e do feijão-caupi foram submetidas a 15 tratamentos distintos. Para avaliar o desempenho das culturas nos diferentes tratamentos foram utilizados indicadores que consideram a resposta produtiva da cultura e o desempenho de aplicação de água no sistema de produção. Estes foram calculados por meio de dados de rendimento total, da relação entre os preços da produção comercial de grãos e da lâmina de água aplicada ao sistema. A produtividade de grãos das culturas do milho e feijão-caupi em resposta à disponibilidade hídrica no solo foi menor no plantio consorciado, em relação ao plantio exclusivo. Mesmo assim, em termos econômicos a adoção do consórcio foi mais vantajosa.

  8. Modificação da concentração de amido resistente em feijão macassar (Vigna unguiculata L. Walp por tratamento hidrotérmico e congelamento Modification of the concentration of resistant starch in macassar bean (Vigna unguiculata L. Walp hydrothermal process and freezing

    Directory of Open Access Journals (Sweden)

    Silvana Magalhães Salgado

    2005-06-01

    Full Text Available Considerando a importância das propriedades funcionais do amido resistente para a saúde, o elevado consumo de feijão macassar no Nordeste brasileiro e os efeitos do processo térmico e da estocagem sobre a estrutura do amido, foi realizado este trabalho com o objetivo de avaliar a influência de diferentes tratamentos hidrotérmicos (cocção sob pressão e sem pressão e do armazenamento a 20ºC por 15 e 30 dias, sobre a formação de amido resistente do feijão macassar em dois estádios de maturação (verde e seco. Para analisar os fatores combinados foi realizado um planejamento fatorial do tipo 2³ com três variáveis independentes (fatores e uma variável dependente (resposta. Todas as variáveis exerceram efeitos significativos na produção de AR e a maior formação foi registrada para o feijão seco devido à hidratação prévia a cocção sem pressão, além do tempo de armazenamento congelado de 30 dias. No que diz respeito às analises físicas, após os tratamentos hidrotérmicos, ocorreram transformações nos padrões de cristalinidade e no aspecto morfológico dos feijões.Considering the importance of the functional properties of resistant starch for health, the high consumption of the macassar bean in the northeast of Brazil and the effects of the thermal process and storage on the structure of the starch, this work was implemented to evaluate the influence of different hydrothermal treatments (cooking under pressure and whithout pressure and of storage at 20ºC for 15 and 30 days, on the formation of resistant starch in the macassar bean, in two stages of maturation (green and dryed. To analyse the combined factors, a factorial design type 2³ was realized with three independent variables (factors and one dependent variable (response. All the variables exercised significant effects on the production of the resistant starch and the highest formation was registered for the dried bean due to the previous hydration before cooking without pressure, as well as the 30 day frozen storage. Concerning the physics analysis after the hydrothermic treatments there are transformations in the cristalinity patterns and in the morphologic aspect of the beans.

  9. Effect of gamma radiation of {sup 60}Co in the variability of chinese bean [Vigna unguiculata (l.) Walpers] en R{sub 4}M{sub 4}; Efecto de la radiacion gamma de {sup 60}Co en la variabilidad de frijol chino [Vigna unguiculata (l.) Walpers] en R{sub 4}M{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Salmeron E, J.; Bueno J, J.E.; Valencia E, F. [CSAEGro, Iguala, Guerrero, Tel and Fax 01 733 (33) 24328 (Mexico); Cervantes S, T. [IREGEP (Mexico); Cruz T, E. De la [ININ, Departamento de Biologia, 52750 La Marquesa, Estado de Mexico (Mexico)]. e-mail: csaegro@prodigy.net.mx

    2007-07-01

    Selection of plants of Chinese bean coming from seed irradiated with gammas of {sup 60}Co in the generation R{sub 4}M{sub 4} (fourth recurrent irradiation, fourth segregate generation) were carried out, taking as selection approaches the plant architecture, the numbers of sheaths for plant, sheath longitude, position of the sheaths, grain size and resistance to plagues and illnesses. 17 lines were selected for grain and 3 lines with fodder characteristics of black grain color were also obtained. (Author)

  10. The Vigna Genome Server, 'VigGS': A Genomic Knowledge Base of the Genus Vigna Based on High-Quality, Annotated Genome Sequence of the Azuki Bean, Vigna angularis (Willd.) Ohwi & Ohashi.

    Science.gov (United States)

    Sakai, Hiroaki; Naito, Ken; Takahashi, Yu; Sato, Toshiyuki; Yamamoto, Toshiya; Muto, Isamu; Itoh, Takeshi; Tomooka, Norihiko

    2016-01-01

    The genus Vigna includes legume crops such as cowpea, mungbean and azuki bean, as well as >100 wild species. A number of the wild species are highly tolerant to severe environmental conditions including high-salinity, acid or alkaline soil; drought; flooding; and pests and diseases. These features of the genus Vigna make it a good target for investigation of genetic diversity in adaptation to stressful environments; however, a lack of genomic information has hindered such research in this genus. Here, we present a genome database of the genus Vigna, Vigna Genome Server ('VigGS', http://viggs.dna.affrc.go.jp), based on the recently sequenced azuki bean genome, which incorporates annotated exon-intron structures, along with evidence for transcripts and proteins, visualized in GBrowse. VigGS also facilitates user construction of multiple alignments between azuki bean genes and those of six related dicot species. In addition, the database displays sequence polymorphisms between azuki bean and its wild relatives and enables users to design primer sequences targeting any variant site. VigGS offers a simple keyword search in addition to sequence similarity searches using BLAST and BLAT. To incorporate up to date genomic information, VigGS automatically receives newly deposited mRNA sequences of pre-set species from the public database once a week. Users can refer to not only gene structures mapped on the azuki bean genome on GBrowse but also relevant literature of the genes. VigGS will contribute to genomic research into plant biotic and abiotic stresses and to the future development of new stress-tolerant crops. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  11. Serrated leaf mutant in mungbean (Vigna radiata (L) Wilczek)

    International Nuclear Information System (INIS)

    Malik, I.A.; Ghulam, Sarwar; Yousaf, Ali; Saleem, M.

    1988-01-01

    Dry dormant seeds of mungbean (Vigna radiata (L) Wilczek) were treated with gamma rays (15, 30 and 60 kR). The serrated leaf mutation was noticed in M 2 of cultivar Pak 32 treated with 60 kR. Cf 14 plants, 3 showed the altered leaf structure and the others were normal. The feature of this mutant was the deep serration of leaflet margins. The mutant had large thick leaflets with prominent venation. The mutant bred true in the M 3 and successive generation. Details of the morphological characteristics of the mutant are presented. The mutant exhibited slower growth particularly during the early stages of development, flowered later and attained shorter height. There was an increase in the number of pods, in seed weight and in seed protein content, but number of seed per pod was considerably reduced. The seed coat colour showed a change from green to yellowish green. In the mutant's flowers the stamina were placed much below the stigma level and the stigma sometimes protruded the corolla. Outcrossing of 4% recorded in some of the mutant lines revealed a reduced cleistogamy. The low number of seeds per pod in the mutant could be due to reduced pollen fertility. The mutant behaved as monogenic recessive. The symbols SL/sl are proposed for this allelic pair. The mutant may have use as a green manure crop because of its large foliage and for the breeders as a genetic marker

  12. Adzuki beans (Vigna angularis seed quality under several drying conditions

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.

  13. USO DE BIOPREPARADOS EN EL COMPOSTAJE DE RESIDUOS ORGÁNICOS URBANOS

    Directory of Open Access Journals (Sweden)

    Einstein Churchill Aveiga Villacis

    2016-12-01

    Full Text Available El trabajo tuvo como objetivo evaluar la aplicación de biopreparados microbianos como aceleradores del proceso de compostaje de residuos orgánicos generados en la Universidad Laica Eloy Alfaro de Manabí. En el proceso se emplearon cajoneras de madera que contenian 170 kg de material inicial, el cual fue inoculado con los aceleradores del proceso de compostaje, ensayando tres variantes: T1, testigo (sin inoculo; T2, EM comercial y T3, microorganismos nativos. El inóculo fue asperjado al inicio del proceso de compostaje que duró ocho semanas, en este lapso se monitoreó pH, humedad y temperatura. Al final del proceso se tomó una muestra compuesta de cada tratamiento y se realizaron determinaciones físico-químicas y pruebas de fitotoxicidad empleando semillas de caupi (Vigna unguiculata. Los resultados determinaron que la temperatura, pH y humedad no variaron significativamente; sin embargo, los indicadores de estabilidad y madurez del compost (C/N, MO, N, P, microelementos y porcentaje de germinación de semillas de caupi fueron favorables en el compost que había sido inoculado con microorganismos nativos, alcanzando valores óptimos, según la norma técnica colombiana 5167. Los resultados demuestran que los inóculos son eficientes en el proceso de compostaje y que el compost obtenido puede ser utilizado con fines agrícolas.

  14. Nodulation studies with induced mutants of black gram (Vigna mungo L.)

    International Nuclear Information System (INIS)

    Mahna, S.K.; Garg, Rekha; Parvateesam, M.

    1990-01-01

    Mutation breeding has been widely used to generate genetic variability in plants, but reports of mutations affecting the root system are less common. In the present work, black gram (Vigna mungo L. var T9), has been used for studies on the effect of induced mutations on nodulation patterns

  15. Photoperiod regulation of development and growth in bambara groundnut (Vigna subterranea).

    NARCIS (Netherlands)

    Linnemann, A.R.; Westphal, E.; Wessel, M.

    1995-01-01

    The influence of constant photoperiods of 10, 12, 14 and 16 h on development and growth in two bambara groundnut genotypes (Vigna subterranea (L.) Verdc., syn. Voandzeia subterranea (L.) Thouars) was studied in a greenhouse experiment in the Netherlands. Data on dry matter accumulation were

  16. Aperçu de la culture du voandzou ( Vigna subterranea (L.) Verdcourt ...

    African Journals Online (AJOL)

    Aperçu de la culture du voandzou ( Vigna subterranea (L.) Verdcourt) au Burkina Faso: enjeux et perspectives d'amélioration de sa productivité. ... 2016 International Formulae Group. All rights reserved. ... The favorite variety is the cream-colored white hilum for its organoleptic, agronomic and aesthetic qualities. Lack of ...

  17. Potential biochemical markers for selection of disease resistance in Vigna radiata

    International Nuclear Information System (INIS)

    Badere, R.S.; Koche, D.K.; Choudhary, A.D.; Pawar, S.E.

    2001-01-01

    The Vigna radiata (L.) Wilczek (Green gram), a major pulse crop is prone to damaging diseases caused by Erysiphe polygoni, Cercospora canescens and Rhizoctonia sp. Therefore, the development of multiple resistance is a major breeding objective in green gram. Resistance to powdery mildew has already been developed, however, there are no reports on the development of resistance to Cercospora in green gram. Owing to limitation of conventional screening methods, the improvement for multiple disease resistance is inadequate, in this crop. It needs an efficient and quick selection method, for screening the plant population at an early stage. It is well established that the resistant interaction, in plants, involves accumulation of antibiotic compound phytoalexin (Genestein in Vigna radiata) and induction of enzymes such as β-1,3 gulcanase and Chitinases. These compounds are not only induced by pathogens but also pathogen-derived elicitors. These biochemical compounds can be used as resistance indicative biochemical markers for screening the natural or mutagen induced genetic diversity in populations of Vigna radiata in non-destructive manner. It, however, needs a systematic study of plant defense response. This paper deals with the response of resistant and susceptible cultivars of vigna radiata to Cercospora elicitor and development of non-destructive selection method for disease resistance. (author)

  18. PERFIL SOCIOECONÔMICO E TECNOLÓGICO DOS PEQUENOS PRODUTORES DE FEIJÃO-CAUPI DO MUNICÍPIO DE PRIMAVERA, NORDESTE PARAENSE

    Directory of Open Access Journals (Sweden)

    Marcos Antônio Souza dos Santos

    2013-04-01

    Full Text Available O artigo analisa o perfil socioeconômico e tecnológico dos pequenos produtores de feijão-caupi do município de Primavera, localizado na região Nordeste do Estado do Pará. Foram aplicados questionários numa amostra de 60 agricultores distribuídos em quatro comunidades rurais tradicionais no cultivo desse produto. No âmbito socioeconômico os resultados identificam características gerais dos agricultores e de suas famílias, tais como: origem, faixa etária, escolaridade, composição familiar e da renda. Em termos de tecnologia são caracterizadas a estrutura das propriedades, os sistemas de produção e os níveis de produtividade da cultura. Adicionalmente destacam-se aspectos referentes ao associativismo, assistência técnica, crédito e comercialização da produção.

  19. Use of Strategic Placement of Dredged Sediments to Support Horseshoe Island in the Atchafalaya River, Louisiana: A Preliminary Ecological Survey

    Science.gov (United States)

    2014-08-01

    cowpea (Vigna luteola), broadleaf cattail (Typha latifolia), invasive Chinese tallowtree (Triadica sebifera), rosemallow (Hibiscus lasiocarpos), and...Benth. hairypod cowpea Fabaceae N Vigna unguiculata (L.) Walp. cowpea Fabaceae - Hydrilla verticillata (L. f.) Royle waterthyme Hydrocharitaceae I

  20. Interação entre salinidade e bioestimulante na cultura do feijão caupi Interaction between water salinity and biostimulant in the cowpea plants

    Directory of Open Access Journals (Sweden)

    Francisco de A. de Oliveira

    2013-05-01

    Full Text Available Objetivou-se, neste trabalho, avaliar a interação entre salinidade e o uso de bioestimulante (Stimulate® sobre o desenvolvimento do feijão caupi. A semeadura foi feita em vasos utilizando-se, como substrato, um Argissolo Vermelho Amarelo. O experimento obedeceu a um delineamento inteiramente casualizado em esquema fatorial 2 x 7. Os tratamentos se constituíram da combinação de dois níveis de sais da água de irrigação e seis formas de aplicação de bioestimulante (Ausência, Tratamento de sementes, Foliar aos 20 dias após semeadura (DAS, Foliar aos 40 DAS, Tratamentos de sementes + Foliar aos 20 DAS, Tratamento de sementes + foliar aos 40 DAS e Aplicação foliar aos 20 e 40 DAS. Foram realizadas duas avaliações não destrutivas (20 e 40 DAS e uma destrutiva (60 DAS e avaliados a altura, o número de folhas, a área foliar e a massa seca de folhas, de caule e da parte aérea. Todos os parâmetros fisiológicos avaliados foram afetados pela salinidade. Nas formas de aplicação adotadas o bioestimulante não proporcionou melhorias no desenvolvimento das plantas quando submetidas ao estresse salino; a salinidade inibiu o efeito benéfico do bioestimulante sobre o desenvolvimento do feijão caupi; enfim, o uso de bioestimulante não é viável em plantas cultivadas sob estresse salino.The objective of this study was to evaluate the interaction between salinity levels of the water and the use of biostimulant (Stimulate® in the initial development stage of cowpea plants. The sowing of seeds was done in pots, using as a substrate Alfissol and two plants per pot. The experimental design was completely randomized in a 2 x 7 factorial scheme. The treatments consisted of combination of two salinity levels (0.5 and 5.0 dS m-1 with seven biostimulant application forms (without application, seed treatment, sprinkled 20 days after sowing (DAS, sprinkled 40 DAS, seed treatment + sprinkled 20 DAS, seed treatment + sprinkled 40 DAS and sprinkled

  1. Comportamento dos preços de milho e feijão caupi no mercado do estado do Ceará

    Directory of Open Access Journals (Sweden)

    A. M. Sousa

    2015-12-01

    Full Text Available A agricultura de subsistência (geralmente milho e feijão caupi é a atividade econômica mais importante na Região Nordeste, sendo a baixa disponibilidade de água o principal obstáculo para a produção agrícola. O estudo dos preços dessas culturas torna-se importante ferramenta de tomada de decisão por parte de produtores, sendo a análise de sazonalidade a metodologia mais empregada no âmbito de análise de preços. O presente trabalho teve como objetivo analisar a sazonalidade dos preços do milho e feijão caupi produzidas no Estado do Ceará. Foi analisado o período de janeiro de 2005 à dezembro de 2014. A determinação dos índices estacionais de preços para a realização da análise de sazonalidade foi realizada através do método da média aritmética móvel centrada em 12 meses. O índice foi utilizado com a base em dezembro de 2014. Com a série de preços deflacionados calculou-se a média móvel centrada para cada mês a partir mês de julho de 2005 até o mês de junho de 2014. Com as médias determinadas calculou-se o IEP (índice estacional de preço. As culturas de milho e feijão apresentam padrões distintos de sazonalidade, podendo esta característica servir de base para o planejamento de produtores. Behavior of corn prices and bean cowpea marketing of Ceará stateAbstract: The subsistence agriculture (usually corn and cowpea is the most important economic activity in the Northeast and the availability of water is the main obstacle to agricultural production. The study price of these cultures it is important decision-making tool by producers, and seasonality analysis methodology employed within more price analysis. This study aimed to analyze the seasonality of prices of the maize and cowpea produced in the state of Ceará. Analyzed the period from January 2005 to December 2014. The determination of seasonal price indices for the realization of seasonality analysis was performed using the method of mobile

  2. PENGARUH JENIS DAN DOSIS PUPUK BOKASHI TERHADAP PERTUMBUHAN DAN HASIL KACANG PANJANG (Vigna sinensis L.

    Directory of Open Access Journals (Sweden)

    Achmad Djunaedy

    2009-03-01

    Full Text Available The purpose of this Research to determine the effect of fertilizer type and dose of bokashi of growth and yield bean (Vigna sinensis L.. Results of research: 1 bokashi fertilizer and chicken manure effect on plant length and number of leaves at the age of 24 days after the plant, 2 dose of fertilizer bokashi or chicken manure is best for the total fruit weight per plant is 20 tons / ha.

  3. Genotypic Variation in Phosphorus Use Efficiency for Symbiotic Nitrogen Fixation in Voandzou (Vigna Subterranea)

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A.; Rabeharisoa, L. [Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Abdou, M. Malam [Laboratoire Banques de genes CERRA / KOLLO, Institut National de Recherche Agronomique du Niger (INRAN), Niamey (Niger); Masse, D. [Institut de Recherche pour le Developpement, UMR Eco and Sols, Montpellier, (France); Amenc, L.; Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier (France)

    2013-11-15

    Vigna subterranea, known as voandzou or Bambara groundnut as an African indigenous crop which is often neglected or under-used in African subsistence agriculture. Preliminary research and country perceptions have shown its agronomic and nutritional properties, in particular under atypical climates of arid and tropical areas, and in saline soils. There is a high potential to increase the production by optimizing symbiotic nitrogen fixation (SNF) through effective inoculation even in nitrate-rich environments. In this study, Vigna subterranea inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 was studied in order to assess the symbiotic fixation potential of different cultivars and landraces of Madagascar, Niger and Mali under low-P and sufficient-P conditions. Six voandzou cultivars inoculated with Bradyrhizobium sp. Vigna CB756, were grown under hydroaeroponic culture for 6 weeks supplied with four phosphorus levels of 15, 30, 75 and 250 {mu}mol plant{sup -1} week{sup -1} in order to establish the response curve of voandzou to P supply, and to induce P deficient and sufficient levels. In another experiment five tolerant cultivars with high SNF and five sensitive cultivars with low SNF were chosen after a preliminary screening of 54 voandzou genotypes, including 50 landraces from Madagascar, Niger and Mali supplied with 2 P levels as P deficient and P sufficient (30 and 75 {mu}mol plant{sup -1} week{sup -1} ) under hydroaeroponic conditions. Genotypic variation in SFN for the high phosphorus use efficiency (PUE) was observed among the 54 cultivars and landraces. Variability was especially related to the nodule and shoot biomass, nodule permeability, nodule respiration and gene phytase expression. Contrasting cultivars and landraces in terms of PUE for SNF were selected for further evaluation under field conditions. (author)

  4. Enhancing Growth of Vigna radiata in the Presence of Pseudomonas aeruginosa Biopolymer and Metarhizium anisopliae Spores

    Directory of Open Access Journals (Sweden)

    Bhagwan N. Rekadwad

    2016-01-01

    Full Text Available Exopolysaccharide producing Pseudomonas aeruginosa NCIM 2945 (PANCL belonging to gamma-proteobacterium and entomopathogenic fungus Metarhizium anisopliae MCC 1129 (MAMCC belonging to Ascomycota were studied for their morphological features biochemical characteristics and plant growth promotion ability. Optimum growth of PANCL was recorded after 24 h at temperature 30°C and pH 7.0. Gram-negative PANCL appeared as white in color, one mm size, circular, opaque, and nonconsistent elevated colonies with entire margin. It has utilized dextrose, fructose, maltose, and sorbitol as carbon source and produced acid in the medium. PANCL was sensitive to Polymyxin B (300 µgm/disc followed by Neomycin (30 µgm/disc, Gentamycin (10 µgm/disc, and Chloramphenicol (30 µgm/disc. PANCL has secreted extracellular lipase, amylase, protease, and exopolysaccharides (EPS. Another fungal strain MAMCC sporulated after 168 h at temperature 30°C and pH 7.0. MAMCC has septate-white mycelium and bears dirty green colored spores. Growth of MAMCC was enhanced in the presence of Neem and Karela-Amla oil (0.1 mL each. Extracellular polysaccharide produced by PANCL and spores of MAMCC promoted growth of dicotyledon Vigna radiata (Mung individually as well as in consortium. Considerable increase in dry weight of Vigna radiata was recorded. Thus, reported PANCL and MAMCC strains have promoted growth Vigna radiata and may be a solution for sustainable agriculture.

  5. Resposta do silício em condições de estresse salino em feijão caupi variedade Gurgéia

    Directory of Open Access Journals (Sweden)

    Anatercia Ferreira Alves

    2014-12-01

    Full Text Available Conduziu-se um experimento em casa de vegetação do Departamento de Ciência do Solo da Universidade Federal de Lavras com o objetivo de avaliar o efeito do silício na produção de matéria seca na cultura de feijão caupi variedade Gurgéia, submetidas a estresse salino. Adotou-se esquema fatorial em delineamento inteiramente casualizado, com 4 repetições e duas plantas por vaso de 3 L de capacidade, em que o primeiro fator referiu-se aos níveis de  NaCl (0; 25; 50; 100 e 150 mmol.L-1 e o segundo  aos níveis de SiO2 (0 e 50 mg.L-1. As soluções foram renovadas em intervalos de 15 dias e aos 90 dias após a semeadura, as plantas foram colhidas e separadas em parte aérea, vagens e raízes, em seguida foram secas para determinação da produção de matéria seca. Observou-se que a adição de silício na dose de 50 ml.L -1 de solução nutritiva contendo NaCl  diminuiu o teor de matéria seca na parte aérea e raíz, com exceção das vagens. Na ausência de silício, a produção de matéria seca nas raízes e parte aérea foram maiores nas mesmas condições de estresse salino e em baixas concentrações de NaCl. A produção de matéria seca foi estimulada na ausência de silício.

  6. Author Details

    African Journals Online (AJOL)

    Kossou, DK. Vol 4, No 1 (2007) - Articles Evaluation de l\\'activité insecticide de deux plantes Hyptis suaveolens (Linn) et Khaya senegalensis (A. Juss) sur les insectes ravageurs du niébé (Vigna unguiculata L. Walp.)/Use of two insecticidial plants for sustainable cowpea (Vigna unguiculata L. Walp.) protection. Abstract PDF.

  7. Crescimento do feijão caupi submetido a inoculação com rizóbio e irrigação com água salina

    Directory of Open Access Journals (Sweden)

    Jailma Ribeiro de Andrade

    2012-10-01

    Full Text Available A fixação biológica do nitrogênio (FBN é caracterizada pela conversão do nitrogênio gasoso (N2 em nitrogênio amoniacal (NH4, forma disponível às plantas. A cultura do feijão caupi gera em média 1.055.334 empregos, o potencial de suprimento alimentar é de 26.486.755 pessoas e o valor da produção é de R$ 643,09 milhões. Objetivou-se com esse trabalho avaliar parâmetros de crescimento no Feijão caupi irrigado com água salina. O experimento foi conduzido em casa de vegetação da Universidade Federal de Campina Grande (UFCG. Os tratamentos foram constituídos de diferentes níveis de salinidade da água de irrigação (1,5; 3,0; 4,5 e 6,0 dS m-1, sendo cada unidade experimental representada por uma planta/vaso, com capacidade de 1,5 Kg de solo. Os resultados obtidos foram submetidos às análises de variância, pelo teste de Tukey a 1 e 5% de significância. O acréscimo da salinidade afeta o número de folhas, diâmetro do caule e área foliar. Quanto ao desenvolvimento da cultura, todas as variáveis são afetadas após os 30 DAE.

  8. Overwintering of Uranotaenia unguiculata adult females in central Europe: a possible way of persistence of the putative new lineage of West Nile virus?

    Czech Academy of Sciences Publication Activity Database

    Rudolf, Ivo; Šebesta, Oldřich; Straková, Petra; Betášová, Lenka; Blažejová, Hana; Venclíková, Kristýna; Seidel, B.; Tóth, S.; Hubálek, Zdeněk; Schaffner, F.

    2015-01-01

    Roč. 31, č. 4 (2015), s. 364-365 ISSN 8756-971X EU Projects: European Commission(XE) 261504 - EDENEXT Institutional support: RVO:68081766 Keywords : mosquito * mosquito-borne viruses * overwintering * Uranotaenia unguiculata * West Nile virus Subject RIV: EE - Microbiology, Virology Impact factor: 0.824, year: 2015

  9. Características agronômicas do feijão caupi inoculado em função de lâminas de irrigação e de níveis de nitrogênio

    Directory of Open Access Journals (Sweden)

    Cristiano Tagliaferre

    2013-04-01

    Full Text Available Objetivou-se, com este trabalho, estudar o efeito de diferentes lâminas de irrigação e doses de nitrogênio sobre as características agronômicas do feijão caupi inoculado. O experimento foi montado em parcelas subdivididas, tendo nas parcelas os níveis de nitrogênio e, nas subparcelas, as lâminas de irrigação, no delineamento em blocos ao acaso, com duas repetições. As lâminas de irrigação corresponderam a 578 mm (L1, 512 mm (L2, 429 mm (L3, 299 mm (L4 e 240 mm (L5 e, os níveis de nitrogênio, a 0, 30, 60 e 90 kg ha-1 de N. Os níveis de nitrogênio apresentaram respostas significativas nos componentes de produção de feijão caupi. As lâminas de irrigação proporcionaram efeitos significativos na produtividade do feijão caupi, sendo a lâmina de 426,21 mm a estimada para obtenção da produtividade máxima de 2820,03 kg ha-1.

  10. THE ALLELOPATHIC EFFECT OF SHREDDED LEAVES OF ARTOCARPUS HETEROPHYLLUS AND A. ALTILIS ON VIGNA RADIATA L

    OpenAIRE

    Romilly Margaret Mendez* & Glaxy Ezekel.V

    2017-01-01

    In the present study, an attempt has been made to study the effect of Artocarpus heterophyllus Lam. and Artocarpus altilis (Parkinson) Fosberg on seed germination, seedling growth and total phenolic content of Vigna radiata L. The objective of this study is to assess the rate of germination, growth of the seedlings and the chlorophyll content of the cultivar seeds exposed to four concentrations (10 ppm, 1 ppm, 0.1 ppm and 0.01 ppm) of the leaf extracts of A. heterophyllus and A. altilis. I...

  11. Induction of chlorophyll chimeras and chlorophyll mutations in mungbean (Vigna radiata) cv. T44

    International Nuclear Information System (INIS)

    Singh, V.P.; Yadav, R.D.S.

    1993-01-01

    Uniform and healthy seeds of mungbean (Vigna radiata) cv. T44 were exposed to varying doses of gamma rays, ethyl methane sulphonate (EMS) and combination treatment of gamma rays with EMS. The data were recorded for seed germination, plant survival, frequency and spectrum of chlorophyll chimeras in M 1 and chlorophyll mutations in M 2 generation. Among all, the combination treatments were found most effective for inducing chlorophyll chimeras and chlorophyll mutations than the gamma rays or EMS alone. Of the mutants under reference, the albino, xantha and chlorina showed monogenic recessive while viridis exhibited digenic recessive inheritance. (author). 8 refs., 2 tabs

  12. biostudy on vigna sinensis beetle, callosobruchus chinensis l.and its control by gamma radiation

    International Nuclear Information System (INIS)

    Hasan, A.I.A.

    2005-01-01

    the present study carried out to determine: 1.the effects of the separate and combined effect of bacillus thuringiensis and gamma radiation on some biological aspects of callosobruchus chinensis. 2. the weight loss in infected seeds and total population of the pest after store it for different on adult beetles to determine the proteins, lipids and carbohydrates contents. 4. some analysis in the cowpea vigna anguiculata seeds to investigate the nutritive value after different treatments with bacillus thuringiensis (b.t) and gamma radiation

  13. The phosphorus and nitrogen nutrition of bambara groundnut (Vigna subterranea (L.) Verdc.) in Botswana soils : an exploratory study

    NARCIS (Netherlands)

    Ramolemana, G.M.

    1999-01-01

    Bambara groundnut ( Vigna subterranea (L.) Verdec.) is a legume crop grown especially by small farmers mainly in semi-arid parts of Africa both in mixed cultivation and pure stands. It is considered as a hardy crop because of its drought tolerance, resistance to pests

  14. DEVELOPMENTAL CHANGES IN THE GERMINATION, GROWTH AND CHLOROPHYLLASE ACTIVITY OF VIGNA MUNGO L. USING SEAWEED EXTRACT OF ULVA RETICULATA FORSSKAL.

    OpenAIRE

    Ganapathy Selvam G.; Balamurugan M.; Thinakaran T.; Sivakumar K

    2013-01-01

    The effect of seaweed extract prepared from Ulva reticulata on seed germination, seedling growth and chlorophyllase activity of Vigna mungo L. was studied. 100% germination was recorded in the seeds treated with lower concentration of seaweed extract. The V. mungo seeds soaked with lower concentrations of the seaweed extracts showed higher rates of germination, while the higher concentrations of the extracts inhibited the germination.

  15. The behavior, ecology and control of legume flower thrips, #Megalurothrips sjostedti# (Trybom) in cowpea #Vigna unguiculata# (L.) towards the development of an integrated pest management (IPM) program in Kenya

    OpenAIRE

    Abtew, Andnet Bayleyegn

    2015-01-01

    The overarching aim of this thesis is to investigate the behaviour and ecology of the legume flower thrips Megalurothrips sjostedti Trybom and develop alternative control method. Its specific goals are to: (1) assess pest problems and management methods practiced by grain legume producers, and identifying the cropping systems in the study areas in Kenya; (2) study the impact of climate change on the geographic distribution of legume flower thrips on cowpea growing regions of Sub Saharn Africa...

  16. Bioactivity of Powder and Extracts from Garlic, Allium sativum L. (Alliaceae and Spring Onion, Allium fistulosum L. (Alliaceae against Callosobruchus maculatus F. (Coleoptera: Bruchidae on Cowpea, Vigna unguiculata (L. Walp (Leguminosae Seeds

    Directory of Open Access Journals (Sweden)

    Abiodun A. Denloye

    2010-01-01

    Full Text Available Laboratory bioassays were conducted to investigate the bioactivity of powders, extracts, and essential oils from Allium sativum L. (Alliaceae and A. fistulosum L. (Liliaceae against adults, eggs, and larvae of Callosobruchus maculatus F. (Coleoptera: Bruchidae. On the basis of 48 hr median lethal toxicity (LC50, test plant powders and extracts from A. sativum were more toxic to C. maculatus adults than those from A. fistulosum. The 48 hr LC50 values for the powder against the test insect species were 9.66 g/kg and 26.29 g/kg for A. sativum and A. fistulosum, respectively. Also the 48 hr LC50 values obtained show that aqueous extracts of the test plant species, 0.11 g/L (A. sativum and 0.411 g/L (A. fistulosum were more toxic to C. maculatus than the corresponding ethanol extracts. There was no significant difference in the toxicity of vapours from the two test plant species against C. maculatus, although A. sativum gave lower values. The study shows that A. sativum and A. fistulosum have potentials for protecting stored cowpea from damage by C. maculatus.

  17. Genotype evaluation of cowpea seeds (Vigna unguiculata) using 1H qNMR combined with exploratory tools and solid-state NMR

    DEFF Research Database (Denmark)

    Alves Filho, Elenilson G.; Silva, Lorena M. A.; Teofilo, Elizita M.

    2017-01-01

    The ultimate aim of this study was to apply a non-targeted chemometric analysis (principal component analysis and hierarchical clustering analysis using the heat map approach) of NMR data to investigate the variability of organic compounds in nine genotype cowpea seeds, without any complex pre-tr...

  18. Morphology of seeds and seedlings of four species of Vigna Savi (Leguminosae, Phaseolinae

    Directory of Open Access Journals (Sweden)

    Fabiana Soledad Ojeda

    2013-09-01

    Full Text Available Four neotropical species of Vigna Savi (Leguminosae, Phaseolinae have potential value as forage crops or ornamentals and could be cultivated in tropical or subtropical areas, even on floodplains. In order to obtain useful data for their culture and taxonomy, the seed morphology, germination pattern (hypogeal or epigeal and seedling development were studied. The studied species belong to different sections of the genus: V. adenantha (G.F.W. Meyer Maréchal, Mascherpa & Stainier (Sect. Leptospron; V. candida (Vell. Maréchal, Mascherpa & Stainier (Sect. Sigmoidotropis; V. caracalla (L. Verdc. (Sect. Caracallae and V. luteola (Jacq. Benth. (Sect. Vigna. The seeds were collected during fieldwork conducted in northwestern and northeastern Argentina. The qualitative and quantitative characters of the seeds were registered, after which they were sown. The development of the emerged seedlings was followed, first in a greenhouse and thereafter in open field. We recorded the type of germination, the thigmotropic movements of the hypocotyl and of the stem, seedling architecture and plant longevity. These traits allowed us to differentiate the species and construct an identification key that could be useful for agronomic or floricultural purposes. The data obtained partially support the current taxonomic treatment of the genus.

  19. [Use of Phaseolus vulgaris and Vigna sinensis in a fermented dairy drink].

    Science.gov (United States)

    Granito, Marisela; Trujillo, Lesma; Guerra, Marisa

    2004-06-01

    The objective of this work was to develop a new kind fermented dairy drink, partially substituted with clear varieties of Phaseolus vulgaris (caraota) and Vigna sinensis (frijol). The formulation of fermented dairy drinks included sterile extracts of caraota and frijol, as partial substitutes which replaced milk: 10, 20 and 30%. The mixtures were inoculated with 2% of a mixture of Lactobacillus acidophillus, Streptococcus thermophilus and Bifidobacterium sp. and were incubated at 42 degrees C for 7 hours. Mango and guava jams were used as flavorings at 20%. On the basis of the sensorial evaluation the mixtures 10% frijol-mango, 10% frijol-guava, 30% caraota-mango and 20% caraota-guava were selected. In the selected fermented dairy drinks, the levels of protein, soluble and insoluble fiber, available and resistant starches were increased and the protein digestibility was 81%. The technical feasibility of partial substitution of milk with extracts of Phaseolus vulgaris or Vigna sinensis. For the elaboration of a fermented dairy drink similar to the liquid yogurt kind was demonstrated.

  20. Development and Validation of EST-SSR Markers from the Transcriptome of Adzuki Bean (Vigna angularis).

    Science.gov (United States)

    Chen, Honglin; Liu, Liping; Wang, Lixia; Wang, Suhua; Somta, Prakit; Cheng, Xuzhen

    2015-01-01

    The adzuki bean (Vigna angularis (Ohwi) Ohwi and Ohashi) is an important grain legume of Asia. It is cultivated mainly in China, Japan and Korea. Despite its importance, few genomic resources are available for molecular genetic research of adzuki bean. In this study, we developed EST-SSR markers for the adzuki bean through next-generation sequencing. More than 112 million high-quality cDNA sequence reads were obtained from adzuki bean using Illumina paired-end sequencing technology, and the sequences were de novo assembled into 65,950 unigenes. The average length of the unigenes was 1,213 bp. Among the unigenes, 14,547 sequences contained a unique simple sequence repeat (SSR) and 3,350 sequences contained more than one SSR. A total of 7,947 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats (99.0%) as the most abundant motif class, followed by AG/CT (68.4%), AAG/CTT (30.0%), AAAG/CTTT (26.2%), AAAAG/CTTTT (16.1%), and AACGGG/CCCGTT (6.0%). A total of 500 SSR markers were randomly selected for validation, of which 296 markers produced reproducible amplicons with 38 polymorphic markers among the 32 adzuki bean genotypes selected from diverse geographical locations across China. The large number of SSR-containing sequences and EST-SSR markers will be valuable for genetic analysis of the adzuki bean and related Vigna species.

  1. COMPONENTES DE PRODUÇÃO DO FEIJÃO VIGNA SOB ESTRESSE SALINO E DOSES DE NITROGÊNIO

    Directory of Open Access Journals (Sweden)

    Guilherme de Freitas Furtado

    2014-08-01

    Full Text Available O feijão-caupi é uma cultura de grande importância econômica e alimentar, sendo muito cultivada no semiárido brasileiro, porém, faz-se necessário otimizar a utilização da água, sendo possível, através medidas como a viabilização do uso de águas salinas. Objetivou-se avaliar os componentes de produção e qualidade pós-colheita dos grãos de feijão-caupi cv. BRS Pajeú, submetido a diferentes níveis de salinidade da água e adubação nitrogenada. O experimento foi desenvolvido em lisímetros de drenagem, no período de junho a setembro de 2013 em ambiente protegido da UEAg/CTRN/UFCG. Utilizou-se o delineamento experimental em blocos casualizados, em esquema fatorial (5x5, sendo cinco níveis de condutividade elétrica da água de irrigação - CEa (0,9; 1,8; 2,7; 3,6 e 4,5 dS m-1 e cinco doses de adubação nitrogenada (70; 100; 130; 160 e 190% da recomendação indicada para ensaio em vaso. Avaliaram-se o número de vagens por planta (NVP, comprimento médio de vagens (CV, diâmetro médio de vagens (DV, peso de mil grãos (PMIL, percentagem de debulha de grãos (PD, porcentagem de cinzas, de proteínas, de umidade, o pH, a condutividade elétrica e a acidez titulável. A irrigação com água salina proporcionou redução do NVP e DV, no entanto verificou-se incremento na PD com o aumento da CEa. O CV não foi influenciado pelos tratamentos aplicados, sendo em média 18,20 cm. A adubação nitrogenada afetou positivamente o PMIL do feijão-caupi. O incremento da dose de fertilização de nitrogênio elevou a porcentagem de cinzas dos grãos de feijão-caupi. Houve interação entre a salinidade da água de irrigação e a fertilização nitrogenada para a porcentagem de proteínas.

  2. Produtividade de raízes de mandioca consorciada com milho e caupi em sistema orgânico Yield of cassava roots intercropped with corn and cowpea in an organic system

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Pries Devide

    2009-01-01

    Full Text Available Foram avaliados sistemas orgânicos de produção de mandioca "de mesa", em Seropédica (RJ. O experimento constou dos seguintes tratamentos: monocultivo de mandioca (cv. IAC 576-70 e consórcios com milho experimental (cv. Eldorado, caupi (cv. Mauá e milho+caupi. O manejo orgânico foi padronizado e toda a área experimental irrigada durante o período de permanência do milho no sistema. Do milho, foram colhidas espigas verdes (imaturas e a parte aérea acamada na superfície do solo. O caupi foi incluído como adubo verde e cortado na floração, sendo mantidos os resíduos na superfície do solo. Ambos os consortes ocuparam as entrelinhas da mandioca, de modo alternado, semeados após a primeira capina da cultura principal. A cultivar IAC 576-70 mostrou-se adaptada ao manejo orgânico, com produtividade de raízes de padrão comercial próxima a 31 Mg ha-1. Não houve diferenças significativas entre o monocultivo e os três tipos de consórcios testados. A inclusão do milho representou potencial de renda adicional ao produtor, colhendo-se, em média, 18.125 espigas ha-1, o que correspondeu a 5,1 Mg ha-1. Os resíduos provenientes da roçada do caupi proporcionaram um aporte de biomassa fresca de 12 Mg ha-1, com uma expressiva contribuição em nitrogênio (cerca de 44 kg de N ha-1. A fabácea (leguminosa cobriu por completo as entrelinhas da mandioca, demonstrando seu potencial de controle à erosão e a ervas espontâneas. O consórcio triplo mostrou-se vantajoso tendo em vista que a receita obtida com a venda do milho verde justificaria os custos da irrigação, além dos benefícios da inclusão do caupi e da não interferência dos consortes na produtividade da mandioca.Organic systems were evaluated for cassava root production directed to human comsumption in natura, at Seropédica-RJ. Treatments consisted of: cassava ('IAC 576-70' in single cropping and its intercropping with corn ('Eldorado', cowpea ('Mauá' or corn plus cowpea

  3. Genomic regions, cellular components and gene regulatory basis underlying pod length variations in cowpea (V. unguiculata L. Walp).

    Science.gov (United States)

    Xu, Pei; Wu, Xinyi; Muñoz-Amatriaín, María; Wang, Baogen; Wu, Xiaohua; Hu, Yaowen; Huynh, Bao-Lam; Close, Timothy J; Roberts, Philip A; Zhou, Wen; Lu, Zhongfu; Li, Guojing

    2017-05-01

    Cowpea (V. unguiculata L. Walp) is a climate resilient legume crop important for food security. Cultivated cowpea (V. unguiculata L) generally comprises the bushy, short-podded grain cowpea dominant in Africa and the climbing, long-podded vegetable cowpea popular in Asia. How selection has contributed to the diversification of the two types of cowpea remains largely unknown. In the current study, a novel genotyping assay for over 50 000 SNPs was employed to delineate genomic regions governing pod length. Major, minor and epistatic QTLs were identified through QTL mapping. Seventy-two SNPs associated with pod length were detected by genome-wide association studies (GWAS). Population stratification analysis revealed subdivision among a cowpea germplasm collection consisting of 299 accessions, which is consistent with pod length groups. Genomic scan for selective signals suggested that domestication of vegetable cowpea was accompanied by selection of multiple traits including pod length, while the further improvement process was featured by selection of pod length primarily. Pod growth kinetics assay demonstrated that more durable cell proliferation rather than cell elongation or enlargement was the main reason for longer pods. Transcriptomic analysis suggested the involvement of sugar, gibberellin and nutritional signalling in regulation of pod length. This study establishes the basis for map-based cloning of pod length genes in cowpea and for marker-assisted selection of this trait in breeding programmes. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Uniformidade de sementes de genótipos de feijão-caupi cultivados em dois ambientes no Estado de Roraima. = Seeds uniformity from cowpea genotypes cultivated in two environments of the State of Roraima.

    Directory of Open Access Journals (Sweden)

    Katherine Rodrigues Arruda

    2009-06-01

    Full Text Available - Objetivou-se com o presente trabalho avaliar a uniformidade de sementes de 19 genótipos de feijão-caupi cultivados em dois ambientes no Estado de Roraima. Foram utilizadas sementes produzidas nos Campos Experimentais Serra da Prata (CESP e do Monte Cristo (CEMC pertencentes a Embrapa Roraima, produzidas durante o ano de 2008. Amostras de 400 g de sementes de feijão-caupi foram separadas e pesadas. Após a pesagem, cada amostra foi classifi cada por cinco peneiras de crivos redondos e oblongos de diferentes dimensões. As sementes retidas em cada peneira foram pesadas separadamente. Sementes da maior porção foram avaliadas quanto a massa de mil sementes e germinação. Na análise dos resultados de uniformidade verificou-se que 89,5% das sementes produzidas no CEMC são maiores que 4,5 x 22 mm e no CESP 90,0%. Quanto a massa média de mil sementes não se verifica diferenças entre os dois ambientes, e entre os materiais variação de 127,5 a 219,6 g. As sementes do CESP apresentam qualidade fisiológica superior as do CEMC. = The objective of this study was to evaluated the uniformity of seeds from 19 cowpea genotypes in two environment of Roraima State. The seeds utilized were produced in the experimental fields of Serra da Prata (CESP and Monte Cristo (CEMC, belonging to Embrapa Roraima. Samples of 400 g of cowpea seeds were separated and weighed and classified by five sieves with round and oblong holes of different dimensions, being weighed separately. Seeds retained in each sieve were weighed separately. Seeds withheld in 4.5 x 22 mm sieve were assessed according to mass of a thousand seeds and germination. Results showed that 89.5 % of seeds produced in CEMC are bigger than 4.5 x 22 mm and in CESP 9 0.0%. Concerning to average mass of a thousand seeds, no differences were verified between the two environments, while materials ranged from 127.5 to 219.6 g. Seeds of CESP showed physiological quality superior than CEMC.

  5. Utilization of Diamine Oxidase Enzyme from Mung Bean Sprouts (Vigna radiata L) for Histamine biosensors

    Science.gov (United States)

    Karim, Abdul; Wahab, A. W.; Raya, I.; Natsir, H.; Arif, A. R.

    2018-03-01

    This research is aimed to utilize the diamine oxidase enzyme (DAO) which isolated from mung bean sprouts (Vigna radiata L) to develop histamine biosensors based on electode enzyme with the amperometric method (cyclic voltammetry).The DAO enzyme is trapped inside the membrane of chitin-cellulose acetate 2:1 and glutaraldehyde which super imposed on a Pt electrode. Histamine will be oxidized by DAO enzyme to produce aldehydes and H2O2 that acting as electron transfer mediators.The performance of biosensors will be measured at various concentrations of glutaraldehyde, temperature changes and different range of pH. Recently, it has been found that the optimal conditions obtained from the paramaters as follows; at 25% of glutaraldehyde, temperature of 37°C and pH of 7.4. Eventually, the results provided an expectation for applying histamine biosensors in determining the freshness and safety of fish specifically skombroidae families.

  6. GENETIC OF DIVERSITY AND RELATIONSHIP BAMBARA GROUNDNUT (Vigna Subteranea L. GENOTYPE LANDRACES OF WEST JAVA

    Directory of Open Access Journals (Sweden)

    Enceng Sobari

    2017-12-01

    Full Text Available Bambara groundnut (Vigna subteranea L. is one of underutliized crops in Indonesia. Bambara groundnut is potential to be developed and can be utilized as an alternative food source in Indonesia. Bambara groundnut greatly varies and has a very wide area of adaptation. The experiment was conducted at the experimental field station at Ciparanje in Padjadjaran University. Starting on September 2014 until March 2015 with Randomized Block Design (RBD and repeated two times. The research used 30 accessions originally from various locations in West Java (Bandung, Tasikmalaya, Garut, Sumedang, Bogor, Majalengka and East Java (Lamongan, Madura. Genetic variability of Bambara groundnut landrace  in some West Java showed broad criteria on the characters fresh pod weight, dry pod weight, weight of 100 seeds, and weight per plot. Genotypes which had many similarities in some characters based on euclidian distance coefficient had close relationship.

  7. The inhibitory effect of metals and other ions on acid phosphatase activity from Vigna aconitifolia seeds.

    Science.gov (United States)

    Srivastava, Pramod Kumar; Anand, Asha

    2015-01-01

    Sensitivity of acid phosphatase from Vigna aconitifolia seeds to metal ions, fluoride, and phosphate was examined. All the effectors had different degree of inhibitory effect on the enzyme. Among metal ions, molybdate and ferric ion were observed to be most potent inhibitors and both exhibited mixed type of inhibition. Acid phosphatase activity was inhibited by Cu2+ in a noncompetitive manner. Zn and Mn showed mild inhibition on the enzyme activity. Inhibition kinetics analysis explored molybdate as a potent inhibitor for acid phosphatase in comparison with other effectors used in this study. Fluoride was the next most strong inhibitor for the enzyme activity, and caused a mixed type of inhibition. Phosphate inhibited the enzyme competitively, which demonstrates that inhibition due to phosphate is one of the regulatory factors for enzyme activity.

  8. Solid state characterization and rheological properties of native and modified Bambara groundnut (Vigna subterranean starches

    Directory of Open Access Journals (Sweden)

    Michael Odeniyi

    2017-09-01

    Full Text Available This study was designed to determine the suitability of native, pregelatinized and carboxymethylated Vigna subterranean (Bambara nut starches for pharmaceutical applications, through their characterization by means of physicochemical, rheological, thermal, morphological and instrumental spectroscopic methods. The native starch was extracted from Bambara nut, after which it was used to prepare both pregelatinized and carboxymethylated forms. Microscopy revealed increased in granular size on modification. Both pregelatinized and carboxymethylated Bambara starches had better flow properties and swellability compared to the native starch. Native Bambara starch had greater tendency to retrogradation, was more sensitive to heat and heat change, these were alleviated by both pregelatinization and carboxymethylation. DSC confirmed that carboxymethylated Bambara starch was the most thermally stable starch. Presence of functional groups and crystallinity were established by FTIR and XRD, respectively. Native and modified Bambara starches can be used as locally and readily available alternative excipients in pharmaceutical formulations.

  9. Yield and Quality of Mung Bean (Vigna radiata (l. R. Wilczek Seeds Produced in Poland

    Directory of Open Access Journals (Sweden)

    Kamil MISIAK

    2017-11-01

    Full Text Available The aim of the experiment was to do field and laboratory assessments of yield and quality of mung bean (Vigna radiata (L. R. Wilczek seeds cultivated in Western Poland. Mean yield of seeds per plant was higher for common bean (Phaseolus vulgaris L. than for mung one: 13.1 g and 2.58 g, respectively. The mean 1000 mung seeds weight was 50.9 g and their germination – 78 %. Germination capacities of seeds of both beans in the field were similar. Mung beans, compared to common bean, had much smaller seeds, started to bloom later and produced mature seeds later than the latter. Mung bean seeds had more total proteins and Magnesium and Copper than common bean seeds. In Western Poland, production of high quality mung bean seeds was possible.

  10. Vigna radiata as a New Source for Biotransformation of Hydroquinone to Arbutin

    Directory of Open Access Journals (Sweden)

    Zahra Tofighi, Mohsen Amini, Mahzad Shirzadi, Hamideh Mirhabibi, Negar Ghazi Saeedi, Narguess Yassa

    2016-06-01

    Full Text Available Background: The suspension culture of Vigna radiata was selected for biotransformation of hydroquinone to its β-D-glucoside form (arbutin as an important therapeutic and cosmetic compound. Methods: The biotransformation efficiency of a Vigna radiata cell culture in addition to different concentrations of hydroquinone (6-20 mg/100 ml was investigated after 24 hours in comparison to an Echinacea purpurea cell culture and attempts were made to increase the efficacy of the process by adding elicitors. Results: Arbutin was accumulated in cells and found in the media only in insignificant amounts. The arbutin content of the biomass extracts of V. radiata and E. purpurea was different, ranging from 0.78 to 1.89% and 2.00 to 3.55% of dry weight, respectively. V. radiata demonstrated a bioconversion efficiency of 55.82% after adding 8 mg/100 ml precursor, which was comparable with result of 69.53% for E. purpurea cells after adding 10 mg/100 ml hydroquinone (P>0.05. In both cultures, adding hydroquinone in two portions with a 24-hour interval increased the biotransformation efficiency. Different concentrations of methyl jasmonate (25, 50, and 100 µM and chitosan (50 and 100 µg/ml as elicitors increased the bio-efficiency percentage of the V. radiata culture in comparison with the flask containing only hydroquinone. Conclusion: This is the first report of the biotransformation possibility of V. radiata cultures. It was observed the bioconversion capacity increased by adding hydroquinone in two portions, which was comparable to adding an elicitor.

  11. Physiological Responses of Bambara Groundnut (Vigna subterranea L. Verdc) to Short Periods of Water Stress During Different Developmental Stages

    OpenAIRE

    R. Vurayai; V. Emongor and B. Moseki

    2011-01-01

    The study was conducted to evaluate the responses of bambara groundnut (Vigna subterranea L. Verdc) to short periods of water stress imposed at different growth stages, and the recuperative ability of the species from drought stress. A major problem associated with Bambara groundnut production is its very low yields due to intra-seasonal and inter-seasonal variability in rainfall in semi-arid regions. The response pattern of physiological processes to water stress imposed at different growth ...

  12. The mitochondrial genome of the legume Vigna radiata and the analysis of recombination across short mitochondrial repeats.

    Directory of Open Access Journals (Sweden)

    Andrew J Alverson

    2011-01-01

    Full Text Available The mitochondrial genomes of seed plants are exceptionally fluid in size, structure, and sequence content, with the accumulation and activity of repetitive sequences underlying much of this variation. We report the first fully sequenced mitochondrial genome of a legume, Vigna radiata (mung bean, and show that despite its unexceptional size (401,262 nt, the genome is unusually depauperate in repetitive DNA and "promiscuous" sequences from the chloroplast and nuclear genomes. Although Vigna lacks the large, recombinationally active repeats typical of most other seed plants, a PCR survey of its modest repertoire of short (38-297 nt repeats nevertheless revealed evidence for recombination across all of them. A set of novel control assays showed, however, that these results could instead reflect, in part or entirely, artifacts of PCR-mediated recombination. Consequently, we recommend that other methods, especially high-depth genome sequencing, be used instead of PCR to infer patterns of plant mitochondrial recombination. The average-sized but repeat- and feature-poor mitochondrial genome of Vigna makes it ever more difficult to generalize about the factors shaping the size and sequence content of plant mitochondrial genomes.

  13. Vigna radiata

    Indian Academy of Sciences (India)

    Table 2. Cluster mean for different traits. Characters/ Days to 50% Days to Plant height Plant yield. 100-seed. Pods per Pods per Pod length Seeds per clusters flowering maturity. (cm). (gm) weight (gm) plant cluster. (cm) pod. Cluster I. 34.00. 6.20. 29.64. 4.89. 4.71. 13.15. 3.29. 6.69. 8.74. Cluster II. 35.17. 61.00. 31.29. 5.26.

  14. Vigna un

    African Journals Online (AJOL)

    user

    2010-11-11

    Nov 11, 2010 ... storage duration on the levels of anti-nutrients: nitrates, oxalates and ... local markets, sorted to remove blemished leaves and foreign materials, washed in ... C. Fermentation, heat-treatment and drying of vegetables led to ...

  15. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    Full Text Available Rice bean (Vigna umbellata Thunb., a warm-season annual legume, is grown in Asia mainly for dried grain or fodder and plays an important role in human and animal nutrition because the grains are rich in protein and some essential fatty acids and minerals. With the aim of expediting the genetic improvement of rice bean, we initiated a project to develop genomic resources and tools for molecular breeding in this little-known but important crop. Here we report the construction of an SSR-enriched genomic library from DNA extracted from pooled young leaf tissues of 22 rice bean genotypes and developing SSR markers. In 433,562 reads generated by a Roche 454 GS-FLX sequencer, we identified 261,458 SSRs, of which 48.8% were of compound form. Dinucleotide repeats were predominant with an absolute proportion of 81.6%, followed by trinucleotides (17.8%. Other types together accounted for 0.6%. The motif AC/GT accounted for 77.7% of the total, followed by AAG/CTT (14.3%, and all others accounted for 12.0%. Among the flanking sequences, 2928 matched putative genes or gene models in the protein database of Arabidopsis thaliana, corresponding with 608 non-redundant Gene Ontology terms. Of these sequences, 11.2% were involved in cellular components, 24.2% were involved molecular functions, and 64.6% were associated with biological processes. Based on homolog analysis, 1595 flanking sequences were similar to mung bean and 500 to common bean genomic sequences. Comparative mapping was conducted using 350 sequences homologous to both mung bean and common bean sequences. Finally, a set of primer pairs were designed, and a validation test showed that 58 of 220 new primers can be used in rice bean and 53 can be transferred to mung bean. However, only 11 were polymorphic when tested on 32 rice bean varieties. We propose that this study lays the groundwork for developing novel SSR markers and will enhance the mapping of qualitative and quantitative traits and marker

  16. Identification of Mungbean yellow mosaic India virus infecting Vigna mungo var. silvestris L.

    Directory of Open Access Journals (Sweden)

    Kamaal NAIMUDDIN

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yellow mosaic of Vigna mungo var.  silvestris, a wild relative of blackgram (Vigna mungo [L.] Hepper, was noticed at the Indian Institute of Pulses Research, Kanpur, India during 2008–2010, with an incidence of 100 per cent. The observed symptoms, consisting of veinal yellowing and scattered bright yellow spots, were suggestive of infection with a begomovirus. To characterize the virus, several sets of primer pairs were designed to amplify the targeted DNA fragments of the causal virus. The sequence data revealed that the coat protein (AV1 gene of the begomovirus under study contained a single open reading frame with 774 nucleotides, coding for 257 amino acids. Comparative analysis of the coat protein (AV1 gene of the virus under study (FJ821189 showed a 97 and 99% similarity with Mungbean yellow mosaic India virus (MYMIV-Mungbean strain at the nucleotide and the amino acid levels respectively. Sequence homology of different genes (AC1, AC2, AC3 and AC4 of the isolate under study (FJ663015 with MYMIV-Mungbean (EU523045 was 94–97% for the nucleotides and 91–99% for the amino acids sequence. Therefore, the begomovirus infecting V. mungo var. silvestris at Kanpur is to be considered a strain of MYMIV and is

  17. The Effect of Shoot/Root Competition of Black night shade (Solanum nigrum on Growth and Seed Yield of Mung Bean (Vigna radiate L.

    Directory of Open Access Journals (Sweden)

    M Goldani

    2015-04-01

    Full Text Available In order to study the competition effects of Solanum nigrum on Vigna radiate yield, an additive experiment was conducts at Ferdowsi University of Mashhad experimental Greenhouse. The type of design was completely randomized block. Treatments included three density of Solanum nigrum (2, 4, and 6 plants m-2 and three types of competition (root, shoot and both of them planted at constant density of Vigna radiate plus weed free check in each block. The results indicated that competitions had significant effects (P

  18. In Vitro Seeds Germination and Seedling Growth of Bambara Groundnut (Vigna subterranea (L.) Verdc. (Fabaceae)).

    Science.gov (United States)

    Koné, Mongomaké; Koné, Tchoa; Silué, Nakpalo; Soumahoro, André Brahima; Kouakou, Tanoh Hilaire

    2015-01-01

    Bambara groundnut (Vigna subterranea (L.) Verdc.) is an indigenous grain legume. It occupies a prominent place in the strategies to ensure food security in sub-Saharan Africa. Development of an efficient in vitro regeneration system, a prerequisite for genetic transformation application, requires the establishment of optimal conditions for seeds germination and plantlets development. Three types of seeds were inoculated on different basal media devoid of growth regulators. Various strengths of the medium of choice and the type and concentration of carbon source were also investigated. Responses to germination varied with the type of seed. Embryonic axis (EA) followed by seeds without coat (SWtC) germinated rapidly and expressed a high rate of germination. The growth performances of plantlets varied with the basal medium composition and the seeds type. The optimal growth performances of plants were displayed on half strength MS basal medium with SWtC and EA as source of seeds. Addition of 3% sucrose in the culture medium was more suitable for a maximum growth of plantlets derived from EA.

  19. Vigna subterranea ammonium transporter gene (VsAMT1: Some bioinformatics insights

    Directory of Open Access Journals (Sweden)

    Adewole T. Adetunji

    2015-12-01

    Full Text Available Ammonium transporters (AMTs play a role in the uptake of ammonium, the form in which nitrogen is preferentially absorbed by plants. Vigna subterranea (VsAMT1 and Solanum tuberosum (StAMT1 AMT1s were characterized using molecular biology and bioinformatics methods. AMT1-specific primers were designed and used to amplify the AMT1 internal regions. Nucleotide sequencing, alignment and phylogenetic analysis assigned VsAMT1 and StAMT1 to the AMT1 family. The deduced amino acid sequences showed that VsAMT1 is 92% and 89% similar to Phaseolus vulgaris PvAMT1.1 and Glycine max AMT1 respectively, while StAMT1 is 92% similar to Solanum lycopersicum LeAMT1.1, and correspond to the 5th–10th trans-membrane domains. Residues VsAMT1 D23 and StAMT1 D15 are predicted to be essential for ammonium transport, while mutations of VsAMT1 W1A-L and S87A and StAMT1 S76A may further enhance ammonium transport. In addition to nitrogen uptake from the roots, VsAMT1 may also contribute to interactions with rhizobia.

  20. The AVRDC - The World Vegetable Center mungbean (Vigna radiata) core and mini core collections.

    Science.gov (United States)

    Schafleitner, Roland; Nair, Ramakrishnan Madhavan; Rathore, Abhishek; Wang, Yen-wei; Lin, Chen-yu; Chu, Shu-hui; Lin, Pin-yun; Chang, Jian-Cheng; Ebert, Andreas W

    2015-04-29

    Large ex situ germplasm collections generally harbor a wide range of crop diversity. AVRDC--The World Vegetable Center is holding in trust the world's second largest mungbean (Vigna radiata) germplasm collection with more than 6,700 accessions. Screening large collections for traits of interest is laborious and expensive. To enhance the access of breeders to the diversity of the crop, mungbean core and mini core collections have been established. The core collection of 1,481 entries has been built by random selection of 20% of the accessions after geographical stratification and subsequent cluster analysis of eight phenotypic descriptors in the whole collection. Summary statistics, especially the low differences of means, equal variance of the traits in both the whole and core collection and the visual inspection of quantile-quantile plots comparing the variation of phenotypic traits present in both collections indicated that the core collection well represented the pattern of diversity of the whole collection. The core collection was genotyped with 20 simple sequence repeat markers and a mini core set of 289 accessions was selected, which depicted the allele and genotype diversity of the core collection. The mungbean core and mini core collections plus their phenotypic and genotypic data are available for distribution to breeders. It is expected that these collections will enhance the access to biodiverse mungbean germplasm for breeding.

  1. Increased stability of thylakoid components in Vigna sinensis seedlings grown under ultraviolet-B enhanced radiation

    International Nuclear Information System (INIS)

    Nedunchezhian, N.; Kulandaivelu, G.

    1994-01-01

    Chloroplasts isolated from Vigna sinensis L. seedlings grown under cool fluorescent (control chloroplasts) and ultraviolet-B (UV-B)-enhanced fluorescent (UV chloroplasts) radiation, when incubated at 10, 20, 30 and 40-degrees-C, showed large variations in the photosynthetic electron transport reactions. The overall electron transport activity in both control and UV chloroplasts incubated at 40-degrees-C decreased rapidly. In contrast to this, at 30-degrees-C the control chloroplasts got inactivated very rapidly during the 30 min of incubation while the UV chloroplasts showed high stability. A similar trend was also noticed at 20-degrees-C. At 10-degrees-C, although the rate of inactivation was slow, UV chloroplasts were more stable than control chloroplasts. A similar trend was noticed in photosystem (PS) 2 activity. In contrast to overall electron transport and PS2 reactions, PS1 activity showedonly marginal changes at all temperatures. The polypeptide profiles of chloroplasts exposed to UV-B irradiation for 60 min at different temperatures revealed marked decreases in the level of the 23 and 33 kDa polypeptides in control chloroplasts while in UV chloroplasts these polypeptides were highly stable. In addition, UV chloroplasts contained several new polypeptides of both high and low molecular masses. The polypeptide pattern indicated that higher photochemical activity of UV chloroplasts over the control chloroplasts could be due to stabilization of PS2 core complexes by the new polypeptides induced under UV-B enhanced radiation

  2. The effect of sodium chloride salinity on germination and productivity of mung bean (Vigna Mungo Linn.)

    International Nuclear Information System (INIS)

    Jabeen, M.; Azim, F.; Ibrar, M.; Hussain, F.; Ilahi, I.

    2003-01-01

    The germination was significantly declined at salinity levels of 5.0 dSm/sup -1/ and above in the laboratory experiment while in the pot experiment germination significantly reduced at salinity levels of 7.5 dSm/sup -1/ and above. Radicle and plumule lengths were also significantly reduced at 5.0 dSm/sup -1/ and higher levels of NaCl. Plant height, number of branches and number of leaves significantly decreased at 10.0 dSm/sup -1/ and higher levels of salinity. The number of seeds was significantly dwindled at 7.5 dSm/sup -1/ and above. Similarly, chlorophyll contents were also significantly low at 7.5 dSm/sup -1/ and higher concentrations. It was concluded that Vigna mungo might not show promising growth and productivity in saline habitats. However, under mild saline conditions it might be grown not only to supplement the crop yield, but also as a source of fodder and soil reclamation measure. (author)

  3. 28-Homobrassinolide mitigates boron induced toxicity through enhanced antioxidant system in Vigna radiata plants.

    Science.gov (United States)

    Yusuf, Mohammad; Fariduddin, Qazi; Ahmad, Aqil

    2011-11-01

    The objective of this study was to establish relationship between boron induced oxidative stress and antioxidant system in Vigna radiata plants and also to investigate whether brassinosteroids will enhance the level of antioxidant system that could confer tolerance to the plants from the boron induced oxidative stress. The mung bean (V. radiata cv. T-44) plants were administered with 0.50, 1.0 and 2.0 mM boron at 6 d stage for 7 d along with nutrient solution. At 13 d stage, the seedlings were sprayed with deionized water (control) or 10(-8) M of 28-homobrassinolide and plants were harvested at 21 d stage to assess growth, leaf gas-exchange traits and biochemical parameters. The boron treatments diminished growth, water relations and photosynthetic attributes along with nitrate reductase and carbonic anhydrase activity in the concentration dependent manner whereas, it enhanced lipid peroxidation, electrolyte leakage, accumulation of H(2)O(2) as well as proline, and various antioxidant enzymes in the leaves of mung bean which were more pronounced at higher concentrations of boron. However, the follow-up application of 28-homobrassinolide to the boron stressed plants improved growth, water relations and photosynthesis and further enhanced the various antioxidant enzymes viz. catalase, peroxidase and superoxide dismutase and content of proline. The elevated level of antioxidant enzymes as well as proline could have conferred tolerance to the B-stressed plants resulting in improved growth, water relations and photosynthetic attributes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Effect of simulated acid rain (sar) on some morphochemical aspects of mash (vigna mungo l.)

    International Nuclear Information System (INIS)

    Imran, H.A.; Hussain, M.; Hussain, S.

    2014-01-01

    The studies were conducted to evaluate the effect of simulated acid rain (SAR) at early plant growth on some morphochemical characters of two varieties of Mash (Vigna mungo L.) namely Mash 97 and Var. 95009. Different pH values were made by using H/sub 2/SO/sub 4/, HNO/sub 3/, and combination of both. The data revealed that low pH (3.5) of either sulphuric acid or the combination of H/sub 2/SO/sub 4/ and HNO/sub 3/ affected more severely at all parameters including number of leaves, shoot: root ratio, water contents of shoot and Potassium ion concentration. Whereas for a few parameters like plant height and number of branches the simulated acid rain of solution of pH 4.5 and 3.5 by using HNO/sub 3/ proved a bit better for plant growth, the root length was increased in case of SAR of solution of pH 3.5 by using H/sub 2/SO/sub 4/+HNO/sub 3/. Foliar application of SAR of solution of pH greater than 4.5 showed some improvement in crop growth due to fertilizer effect of solution's components. (author)

  5. De novo transcriptome assembly of two Vigna angularis varieties collected from Korea

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2016-06-01

    Full Text Available The adzuki bean (Vigna angularis, a member of the family Fabaceae, is widely grown in Asia, from East Asia to the Himalayas. The adzuki bean is known as an ingredient that adds sweetness to diverse desserts made in Eastern Asian countries. Libraries prepared from two V. angularis varieties referred to as Taejin Black and Taejin Red were paired-end sequenced using the Illumina HiSeq 2000 system. The raw data in this study can be available in NCBI SRA database with accession numbers of SRR3406660 and SRR3406553. After de novo transcriptome assembly using Trinity, we obtained 324,219 and 280,056 transcripts from Taejin Black and Taejin Red, respectively. We predicted a total of 238,321 proteins and 179,519 proteins for Taejin Black and Taejin Red, respectively, by the TransDecoder program. We carried out BLASTP on the predicted proteins against the Swiss-Prot protein sequence database to predict the putative functions of identified proteins. Taken together, we provide transcriptomes of two adzuki bean varieties by RNA-Seq, which might be usefully applied to generate molecular markers.

  6. Biochemical Changes under Chromium Stress on Germinating Seedlings of Vigna radiata

    Directory of Open Access Journals (Sweden)

    Bhavin SUTHAR

    2014-03-01

    Full Text Available Hexavalant chromium is considered the most toxic form because of its high solubility in water. Cr is known to induce production of elevated concentration of reactive oxygen species (ROS resulted in macromolecule damage. Plants are having unique mechanisms to overcome ROS induced damage by accumulation of proline, ascorbate and glutathione and increasing the activities of antioxidant enzymes such as superoxide dismutase (SOD, catalase (CAT, glutathione reductase (GR, and ascorbate peroxidaes (APX, peroxidise (POX. In the present investigation effects of chromium on seed germination of Mung bean (Vigna radiata 'Gujarat Mung-4’ were studied. Seeds were treated with different Cr concentrations (50, 100, 150 and 200 4M for seven days. On 7th day root and shoot length was measured and activities of antioxidant enzyme SOD, APX, POX, CAT and GR were checked along with protein, proline and lipid peroxidation. It was observed that there is gradual decrease in shoot and root length with respect to the increase in Cr concentration. Level of lipid peroxidation significantly increased along with proline and antioxidant enzyme activity at higher Cr concentration. Lipid peroxidation is an indication of membrane damage due to elevated production of reactive oxygen species (ROS. To combat oxidative damage by ROS antioxidant enzyme activity increased significantly, which indicates that antioxidant enzymes (SOD, CAT, APX and GR play a crucial role during Cr stress during germination of V. radiata.

  7. Identification of Bradyrhizobium elkanii Genes Involved in Incompatibility with Vigna radiata

    Directory of Open Access Journals (Sweden)

    Hien P. Nguyen

    2017-12-01

    Full Text Available The establishment of a root nodule symbiosis between a leguminous plant and a rhizobium requires complex molecular interactions between the two partners. Compatible interactions lead to the formation of nitrogen-fixing nodules, however, some legumes exhibit incompatibility with specific rhizobial strains and restrict nodulation by the strains. Bradyrhizobium elkanii USDA61 is incompatible with mung bean (Vigna radiata cv. KPS1 and soybean cultivars carrying the Rj4 allele. Here, we explored genetic loci in USDA61 that determine incompatibility with V. radiata KPS1. We identified five novel B. elkanii genes that contribute to this incompatibility. Four of these genes also control incompatibility with soybean cultivars carrying the Rj4 allele, suggesting that a common mechanism underlies nodulation restriction in both legumes. The fifth gene encodes a hypothetical protein that contains a tts box in its promoter region. The tts box is conserved in genes encoding the type III secretion system (T3SS, which is known for its delivery of virulence effectors by pathogenic bacteria. These findings revealed both common and unique genes that are involved in the incompatibility of B. elkanii with mung bean and soybean. Of particular interest is the novel T3SS-related gene, which causes incompatibility specifically with mung bean cv. KPS1.

  8. Bruchid egg induced transcript dynamics in developing seeds of black gram (Vigna mungo.

    Directory of Open Access Journals (Sweden)

    Indrani K Baruah

    Full Text Available Black gram (Vigna mungo seeds are a rich source of digestible proteins, however, during storage these seeds are severely damaged by bruchids (Callosobruchus spp., reducing seed quality and yield losses. Most of the cultivated genotypes of black gram are susceptible to bruchids, however, few tolerant genotypes have also been identified but the mechanism of tolerance is poorly understood. We employed Suppression Subtractive Hybridization (SSH to identify specifically, but rarely expressed bruchid egg induced genes in black gram. In this study, Suppression Subtractive Hybridization (SSH library was constructed to study the genes involved in defense response in black gram against bruchid infestation. An EST library of 277 clones was obtained for further analyses. Based on CAP3 assembly, 134 unigenes were computationally annotated using Blast2GOPRO software. In all, 20 defense related genes were subject to quantitative PCR analysis (qPCR out of which 12 genes showed up-regulation in developing seeds of the pods oviposited by bruchids. Few major defense genes like defensin, pathogenesis related protein (PR, lipoxygenase (LOX showed high expression levels in the oviposited population when compared with the non-oviposited plants. This is the first report on defense related gene transcript dynamics during the bruchid-black gram interaction using SSH library. This library would be useful to clone defense related gene(s such as defensin as represented in our library for crop improvement.

  9. Reduction in flatulence factors in mung beans (Vigna radiata) using low-dose gamma-irradiation

    International Nuclear Information System (INIS)

    Machaiah, J.P.; Pednekar, M.D.; Thomas, P.

    1999-01-01

    Mungbeans (Vigna radiata), control and gamma-irradiated at insect disinfestation dose levels (0.25 and 0.75 kGy) were germinated (0-6 Bays) and the qualitative and quantitative changes in soluble carbohydrates were studied in detail. The key flatulence-producing raffinose family oligosaccharides inmungbeans were degraded in the irradiated samples at the onset of the germination (0-2 days) compared to the control where it occurred much later (>4days). However, the reducing sugars, mainly glucose, fructose and galactose, which are metabolised easily, were enhanced in the irradiated samples. At low dose (0.25 kGy), irradiation had no effect on germination and sprout length, indicating that irradiated beans are suitable for use as sprouted beans. These observations clearly indicate that gamma-irradiation at insect disinfestation dose levels improved the digestibility and nutritional quality of mung beans by reducing the content of oligosaccharides responsible for intestinal gas production. (C) 1999 Society of Chemical Industry

  10. Increased antioxidant activity and polyphenol metabolites in methyl jasmonate treated mung bean (Vigna radiata sprouts

    Directory of Open Access Journals (Sweden)

    Li LI

    Full Text Available Abstract Mung bean sprouts are a popular health food both in China and worldwide. We determined the optimal concentration of exogenous methyl jasmonate (MeJA for the promotion of the sprouting in mung beans (Vigna radiata. The 1,1-diphenyl-2- picrylhydrazyl radical (DPPH scavenging test showed that MeJA application resulted in significantly improved antioxidant capacity in the sprouts 72 h later. Measurement of total polyphenols in MeJA-treated beans from 0 to 168 h, using Folin–Ciocalteu colorimetry, showed that the polyphenols changing was significantly correlated with antioxidant activity. The main polyphenols isovitexin, kaempferol-3-O-rutinoside, daidzein, genistein, isoquercitrin, p-coumaric acid, and caffeic acid were quantified using high-performance liquid chromatography (HPLC/QqQ MS and partial least squares discriminant analysis (PLS-DA. MeJA promoted the production of polyphenols, metabolites, and antioxidants in the sprouts; therefore, its use may allow sprouts to be prepared more quickly or increase their nutritional value.

  11. Dinâmica de populações e fitossociologia de plantas daninhas no cultivo do feijão-caupi e mandioca no sistema corte e queima com o uso de arado Phytosociology of weeds in cowpea and cassava crops under the slash-and-burn with plow

    Directory of Open Access Journals (Sweden)

    L.J.P Marques

    2011-01-01

    Full Text Available Este estudo investigou a composição florística das plantas daninhas em área queimada durante três anos agrícolas. A pesquisa foi conduzida no município de Zé Doca, Maranhão. O preparo da área no primeiro ano agrícola (2006/2007 foi realizado com corte e queima da vegetação para o cultivo de milho seguido do feijão-caupi. No segundo e no terceiro ano agrícola, o preparo da área consistiu de aração para o cultivo do milho seguido de mandioca (2007/2008 e depois para o feijão-caupi em sucessão à cultura de mandioca (2008/2009. A coleta das plantas daninhas ocorreu nas culturas de feijão-caupi e mandioca aos 30 e 60 dias após a semeadura (DAS, no primeiro e no segundo ano agrícola, respectivamente, e no feijão-caupi aos 30 DAS do terceiro ano agrícola, com retângulo (0,5 x 0,3 m lançado 10 vezes ao acaso na área cultivada. A cada lançamento, as plantas daninhas foram colhidas, para contagem, identificação, secagem e, assim, obter os índices fitossociológicos. O fogo reduziu a diversidade e o número das plantas daninhas. As espécies com maior valor de IVI foram Imperata brasiliensis, Sida glomerata e Corchorus argutus, após o fogo na cultura do feijãocaupi; e Juncus sp., Spermacoce verticillata, Aeschynomene americana e Cyperus sp., após preparo da área com aração nas culturas de mandioca e feijão-caupi. As plantas de capoeira ocorreram depois da queima, porém sua importância foi reduzida com o passar do tempo.This study investigated the floristic composition of weeds in a burnt area in Zé Doca, Maranhão, during three agricultural years. The preparation of the area at the first crop year (2006/ 2007 was by slash-and-burn for maize cultivation, followed by cowpea. In the second and third crop years, the preparation of the area consisted of plowing for maize cultivation, followed by cassava (2007/2008 and later, by cowpea in rotation with cassava (2008/2009. Weed collection in the cowpea and cassava crops

  12. Nitrogen and micronutrients on grain yield of cowpea inoculatedNitrogênio e micronutrientes na produção de grãos de feijão-caupi inoculado

    Directory of Open Access Journals (Sweden)

    José Ferreira Lustosa Filho

    2013-09-01

    Full Text Available This work aimed to study the effect of nitrogen and micronutrients addition on nodulation and on the productivity of cowpea inoculated with strain INPA 03 11B. The study was carried out in the experimental area of Universidade Federal do Piauí, Bom Jesus, PI. The experiment was a complete randomized block, with four replications and a 5 x 2 factorial arrangement. Treatments consisted of five nitrogen doses (0, 35, 70, 105, 140 kg ha¹, associated with and without foliar micronutrients application (300 g ha¹ boric acid; 500 g ha¹ copper sulphate, manganese sulphate, zinc sulphate and 60 g ha¹ ammonium molibdate. Nodulation, shoot, root and total dry mass, relative efficiency, components of yield and crop productivity, besides N accumulation in shoot and grains were evaluated. Fresh and dry mass of nodules reduced linearly with the increase of N doses. Yield components were not affected by nitrogen and micronutrients fertilization. The application of micronutrients in the absence of nitrogen promoted an increase of 12.4% in grain yield of cowpea inoculated.O presente trabalho teve por objetivo avaliar o efeito da adubação nitrogenada e aplicação de micronutrientes na nodulação e produtividade do feijão-caupi inoculado com a cepa INPA 03 11B. O estudo foi conduzido na área experimental da Universidade Federal do Piauí, Bom Jesus, PI. O delineamento experimental utilizado foi em blocos casualizados, em esquema fatorial 5 x 2, com quatro repetições. Os tratamentos foram constituídos de cinco doses de nitrogênio (0, 35, 70, 105, 140 kg ha-1, associadas ou não a aplicação foliar de micronutrientes (300 g ha-1 de ácido bórico; 500 g ha- 1de sulfato de cobre, sulfato de manganês e sulfato de zinco e 60 g ha-1 de molibdato de amônio. Avaliaram-se a nodulação, a massa seca da parte aérea, da raiz e total, eficiência relativa, componentes da produção, produtividade da cultura e acúmulo de N na parte aérea e nos grãos. As

  13. Avaliação de linhagens e cultivares de feijão-caupi, em Areia, PB Evaluation of breeding lines and cultivars of cowpea-beans in Areia, Paraiba, Brazil

    Directory of Open Access Journals (Sweden)

    Ademar P. de Oliveira

    2002-06-01

    Full Text Available Dez linhagens e três cultivares de feijão-caupi foram avaliadas em ensaio conduzido em Areia (PB, de abril a julho de 2000, em Latossolo Vermelho-Amarelo. As linhagens TE-92-199-20F;TE-90-170-29F; TE-90-170-76F; CNCX-405-17F; CNCX-409-12F; TE-90-180-10F; TE 87-108-6G, Linhagem avançada e as cultivares, IPA 206 e BR-03 Tracuateua, apresentaram comprimento e peso médio de vagens dentro dos padrões comerciais e número médio de vagens por planta dentro do padrão para a espécie (acima de vinte vagens. A produtividade de vagens verdes e de grãos verdes e secos obtida pelas linhagens TE-90-170-76F; CNCX-409-12F; CNCX-405-17F; TE-90-180-10F; TE-87-108-6G, Linhagem avançada e pela cultivar IPA 206, foram superiores a 5,0 t/ha para vagens verdes, a 3,0 t/ha para grãos verdes e a 1,2 t/ha para grãos secos, consideradas altas para o feijão-caupi. As maiores produtividade de vagens verdes (6,5 e 6,5 t/ha, de grãos verdes (3,8 e 3,8 t/ha, e de grãos secos (1,8 e 1,8 t/ha foram obtidas, respectivamente, com as linhagem CNCX-409-12F e cultivar IPA 206.Ten breeding lines and three cultivars of cowpea-bean were evaluated. The experiment was set up in Areia, Brazil, between April and July/00, in Red-yellow Latossoil. The breeding lines TE-92-199-20F; TE-90-170-29F; TE-90-170-76F; CNCX-405-17F; CNCX-409-12F; TE-90-180-10F; TE-87-108-6G, Linhagem avançada, and IPA 206, BR-03 Tracuateua, cvs., presented length and average weight of pods according to the commercial patterns and number of pods by plant according to the pattern of the species (above twenty pods. The yield of green pods, green and dry grains, obtained by the breeding lines TE-90-170-76F; CNCX-409-12F; CNC-405-17F; TE-90-180-0F; TE-87-108-6G, Linhagem avançada and IPA 206, cultivar, were superior to 5.0 t/ha for green pods, to 3.0 t/ha for green grains and to 1.2 t/ha for dry grains, considered highest for the cowpea-beans. Highest yield of green pods (6.5 and 6.5 t/ha, green grains (3

  14. Eficiência de fungos micorrízicos arbusculares isolados de solos sob diferentes sistemas de uso na região do Alto Solimões na Amazônia Effectiveness of arbuscular mycorrhiza fungal isolated from soils under different land use systems in the Alto Solimões river region in the Amazon

    Directory of Open Access Journals (Sweden)

    Gláucia Alves e Silva

    2009-09-01

    Full Text Available Os fungos micorrízicos arbusculares (FMAs são importantes componentes dos ecossistemas terrestres onde acredita-se desempenharem papel fundamental para a sustentabilidade destes. Estes fungos sofrem influência de diversos fatores antrópicos como o uso da terra, que modificam a estrutura e diversidade das comunidades podendo comprometer suas funções ecológicas. No presente estudo avaliou-se o comportamento de FMAs isolados de solos sob diferentes sistemas de uso (SUT. Fungos isolados de amostras de solo sob diferentes SUT foram testados em caupi [Vigna unguiculata (L. Walp] em condições controladas. Verificou-se que todos os cinqüenta e um fungos avaliados colonizaram o caupi, porém de modo muito diferenciado, tal como ocorreu para os efeitos destes na absorção de fósforo e crescimento da planta. A colonização variou de 1 a 68%, e os efeitos positivos no crescimento variaram de 33 a 148%, sendo mais comuns nos fungos isolados de pastagem e roça. O aumento nos teores de fósforo foi generalizado (95% dos fungos testados, no entanto, nem todos foram capazes de promover o crescimento do Caupi. Apenas 39% dos fungos foram considerados eficientes, sendo estes isolados de quase todos os SUT. Os tratamentos fúngicos de mais alta eficiência continham as espécies: A. foveata, Glomus sp.1, Acaulospora sp.1 e mistura dos dois primeiros mais E. infrequens e A. bireticulata-like. Os resultados indicam ampla diversidade de eficiência dos FMAs do Alto Solimões. Embora a eficiência não tenha relação direta com o SUT, a proporção de isolados eficientes variou com a origem de isolamento.Arbuscular mycorrhizal fungi (AMF are important components of terrestrial ecosystems where they are believed to play a fundamental role for their sustainability. These fungi are influenced by a number of anthropic factors such as, land use which modifies the structure and diversity of fungal communities and this may compromise their ecological functions

  15. African Journal of Biotechnology - Vol 8, No 20 (2009)

    African Journals Online (AJOL)

    Identification of differentially expressed genes in seeds of two Brassica napus ... DNA in burial place remains of Turkey using real time polymerase chain reaction ... Varietal response of four cowpea cultivars (Vigna unguiculata L. Walp) to ...

  16. African Journal of Biotechnology - Vol 10, No 15 (2011)

    African Journals Online (AJOL)

    Recent advances in cowpea [Vigna unguiculata (L.) Walp.] ... Assessment of genetic diversity among accessions of two traditional leafy ... using two-step polymerase chain reaction (PCR) · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  17. African Journal of Biotechnology - Vol 10, No 43 (2011)

    African Journals Online (AJOL)

    Genetic variability of Indian yaks using random amplified polymorphic DNA markers ... on nutrient uptake, growth and productivity of cowpea (Vigna unguiculata) ... their detection by PCR · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  18. Nutritional and physicochemical properties of stored solar-dried ...

    African Journals Online (AJOL)

    ACSS

    Preservation techniques for cowpea (Vigna unguiculata L.) leaves, a green leafy vegetable ... fresh (control) cowpea leaves were ..... (Solanum aethiopicum) production ... Manual of methods for Analysis of Foods. Cereal and Cereal Products.

  19. African Journal of Biotechnology - Vol 12, No 36 (2013)

    African Journals Online (AJOL)

    Genetic differentiation of watermelon landraces in Mozambique using microsatellite ... Phytase activity of fungi from oil polluted soils and their ability to degrade ... (Vigna unguiculata) flour and roasted melon seed (Citrullus vulgaris) paste ...

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 101 - 150 of 775 ... ... (watermelon) extract against lipid oxidation in fish during cooking, Abstract PDF ... Vol 8, No 2 (2015), Assessment of cotton-seed (Gossypium ... to Vigna unguiculata l (beans) grown on crude oil contaminated soil ...

  1. Bayero Journal of Pure and Applied Sciences - Vol 8, No 1 (2015)

    African Journals Online (AJOL)

    ... metals to Vigna unguiculata l (beans) grown on crude oil contaminated soil · EMAIL ... niloticus) fed on diets containing watermelon (Citrullus lanatus) seedmeal ... methods on the proximate composition of Piliostegma reticulatum seed meal ...

  2. Download this PDF file

    African Journals Online (AJOL)

    KEROSENE TREATED SOIL GROWN WITH COWPEA(Vigna unguiculata). Adetitun ... and adapted micro-organisms are more efficient for biodegradation of oil pollutant. (Bharathi ... into twenty four (24) transparent plastic planting pots. Soil ...

  3. Genetic variability of cultivated cowpea in Benin assessed by random amplified polymorphic DNA

    NARCIS (Netherlands)

    Zannou, A.; Kossou, D.K.; Ahanchédé, A.; Zoundjihékpon, J.; Agbicodo, E.; Struik, P.C.; Sanni, A.

    2008-01-01

    Characterization of genetic diversity among cultivated cowpea [Vigna unguiculata (L.) Walp.] varieties is important to optimize the use of available genetic resources by farmers, local communities, researchers and breeders. Random amplified polymorphic DNA (RAPD) markers were used to evaluate the

  4. ORANGE PEEL POWDER AND ITS EXTRACTS AS PRE ...

    African Journals Online (AJOL)

    User

    Ethanolic crude extract gave the least F1 adult emergence compared with other treatments and control. ... Synthetic chemical insecticides have been an important part of pest ..... Vigna unguiculata with the neem seed Pro- tection ecology 5: ...

  5. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  6. Browse Title Index

    African Journals Online (AJOL)

    PAHS) concentrations in catfish and tilapia muscles, Abstract PDF ... Vol 13, No 1 (2009), Effectiveness of Vigna Unguiculata as a Phytoremediation Plant in the remediation of Crude Oil polluted soil for Cassava (Manihot ...

  7. Ghana Journal of Agricultural Science - Vol 42, No 1-2 (2009)

    African Journals Online (AJOL)

    Economics of backyard poultry production in Akure South Local Government Area of ... production in the northern Guinea Savanna agroecological zone of Ghana ... Causes of differences in seed quality among cowpea (Vigna unguiculata (L.) ...

  8. Biogenic synthesis and spatial distribution of silver nanoparticles in the legume mungbean plant (Vigna radiata L.).

    Science.gov (United States)

    Kumari, Rima; Singh, Jay Shankar; Singh, Devendra Pratap

    2017-01-01

    The present investigation aimed to study the in vivo synthesis of silver nanoparticles (AgNPs) in the legume Vigna radiata. The level of plant metabolites such as total phenolics, lipid, terpenoids, alkaloids and amino acid increased by 65%, 133%, 19%, 67% and 35%, respectively, in AgNO 3 (100 mg L -1 ) treated plants compared to control. Whereas protein and sugar contents in the treated plants were reduced by 38% and 27%, respectively. FTIR analysis of AgNO 3 (20-100 mg L -1 ) treated plants exhibited changes in the IR regions between 3297 and 3363 cm -1 , 1635-1619 cm -1 , 1249-1266 cm -1 and that corresponded to alterations in OH groups of carbohydrates, OH and NH groups of amide I and II regions of protein, when compared with the control. Transmission electron micrographs showed the spatial distribution of AgNPs in the chloroplast, cytoplasmic spaces, vacuolar and nucleolar plant regions. Metal quantification in different tissues of plants exposed to 20-100 mg L -1 AgNO 3 showed about a 22 fold accumulation of Ag in roots as compared to shoots. The phytotoxic parameters such as percent seed germination and shoot elongation remained almost unaltered at low AgNO 3 doses (20-50 mg L -1 ). However, at higher levels of exposure (100 mg L -1 ), the percent seed germination as well as root and shoot elongation exhibited concentration dependent decline. In conclusion, synthesis of AgNPs in V. radiata particularly at lower doses of AgNO 3 , could be used as a sustainable and environmentally safe technology for large scale production of metal nanoparticles. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. Quarantine treatment by gamma radiation for different development stages of Callosobruchus maculatus in bean Vigna sinensis

    International Nuclear Information System (INIS)

    Arthur, Valter; Machi, André R.; Franco, Suely S.H.

    2017-01-01

    The loss of stored grain caused by insects generates a problem of economic order of importance, due to concern about the increased supply of food for the world population is expanding. Associated with this fact, there is the problem of nutritional deficiency due to lack of protein, especially for the less privileged populations. The use of ionizing radiation in grains and products stored without a doubt can solve the problem of the losses in these products, since it does not induce resistance to insects and leaves no toxic residue in the products, and is considered an effective and safe method. The aim of the experiment was to determine the effect of ionizing radiation from cobalt-60 as a quarantine treatment for the different stages of development of Callosobruchus maculatus (Fabr., 1972) (Coleóptera, Chysomilidae) in bean Vigna sinensis. The experiment was conducted in the laboratory of Radiobiology and Environment CENA/USP, Piracicaba, SP, Brazil. Bean samples infested with eggs, larvae, pre-pupae and pupae C. maculatus, the experiment consisted of 4 replicates for each stage of the insect's life cycle, and each repetition consisted of 20 individuals (eggs, larvae, pre-pupae and pupae), a total of 200 subjects per treatment which were irradiated with doses of 0 (control), 25, 50, 75 and 100 Gy, a source of cobalt-60, Gammabeam-650 type, in a rate dose of 1.3 kGy / h. The experiment was conducted in a room with a relative of 25 ± 2 ° C temperature and humidity of 70 ± 5%. After 35 days of irradiation process were carried out evaluations of the number of insects emerged in each repetition within the treatments. From the results obtained it was concluded that the dose lethal to eggs and larvae was 25 Gy, while for pre-pupae was 50 Gy, to pupae 100 Gy was not sufficient to control the adult emergence. (author)

  10. [Use of cowpea (Vigna sinensis) as a chicken complement in an infant formula].

    Science.gov (United States)

    Modernell, Marisa Guerra; Granito, Marisela; Paolini, Mariangel; Olaizola, Cristina

    2008-09-01

    Legumes represent an important protein source worldwide. In Venezuela, they are generally prepared at home and are consumed by adults, as soup or stew, while children eat them in very small quantities. In order to include legumes in the children's diet, the following work was done using cowpea (Vigna sinensis) as an complement of chicken in the preparation of a nutritionally balanced formula, adapted to the requirements of children. Several formulas were developed and three of them were selected based on their acceptability. In the first formula, the protein source was only of chicken. In the second formula, the chicken was partially substituted by cowpea, and in the third formula, the protein source was only made of cowpea. Other formula ingredients included rice, pumpkin (Curcubita maxima), carrot and some seasonings. Proximal analysis, protein quality (as protein efficiency ratio and protein digestibility) and sensory evaluation (7-point hedonic scale) were performed on the formulas. The proximal composition was similar in the three formulas: protein (3.5%), fat (1.3%) and carbohydrates (19.7%), with a good distribution of the energy contribution (98.9 kcal/100 g or 413.8 kJ/100 g). The protein quality and protein digestibility were higher for the chicken-cowpea formula than for the cowpea one. The acceptability with the mothers was higher for the chicken-cowpea formula than for the cowpea one. The acceptability of the chicken-cowpea formula with children was 77% (7-point hedonic facial scale) and 92% (measuring consumption). Due to the high acceptability and good protein quality, the chicken-cowpea formula could be included in the lunch meal of the children in daycare homes.

  11. Genetic variation for phytic acid content in mungbean (Vigna radiata L. Wilczek

    Directory of Open Access Journals (Sweden)

    Vinod Janardan Dhole

    2015-03-01

    Full Text Available Mungbean (Vigna radiata L. Wilczek is a short-duration legume crop cultivated for seeds that are rich in protein and carbohydrates. Mungbeans contain phytic acid (PA, an anti-nutritional factor that is the main storage form of organic phosphorus in seeds. It is a strong inhibitor against the absorption of nutrients including iron, zinc, calcium and magnesium in monogastric animals. Genotypes with low phytic acid (lpa in seed may show increased assimilation of nutrients and be useful in breeding lpa cultivars. The present study was conducted to identify lpa sources, genetic variation, heritability, and association with seed coat color, inorganic phosphorus (IP, and seed size in 102 mungbean genotypes including released varieties, land races, mutants, and wild species grown in two seasons: summer 2011 and rabi 2012. PA and IP in dry seeds were estimated by modified colorimetric method and Chen's modified method, respectively. PA, IP, and 100-seed weight differed significantly in the two seasons. PA content in 102 genotypes ranged from 5.74 to 18.98 mg g− 1 and 5.85 to 20.02 mg g− 1 in summer 2011 and rabi 2012, respectively. High heritability was found for PA (0.87 and 0.86 and seed size (0.82 and 0.83 but low heritability for IP (0.61 and 0.60. A negative correlation was found between PA and seed size (r = − 0.183 and − 0.267. Yellow and green seed coat genotypes contained significantly less PA than black seed coat genotypes. Cluster analysis revealed the distinctness of wild species, land races and cultivated varieties on the basis of PA content. The genotypes YBSM (6.001 mg g− 1 and JL-781 (6.179 mg g− 1 showed lowest PA. These lpa sources can be used to develop high-yielding mungbean cultivars with low phytic acid.

  12. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ved Parkash [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Department of Zoology, Panjab University, Chandigarh 160014 (India); Singh, Harminder Pal, E-mail: hpsingh_01@yahoo.com [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Kohli, Ravinder Kumar; Batish, Daizy Rani [Department of Botany, Panjab University, Chandigarh 160014 (India)

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 {mu}W cm{sup -2}; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H{sub 2}O{sub 2}) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at {>=}2 h), and radicle and plumule growths ({>=}1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H{sub 2}O{sub 2} accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  13. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    International Nuclear Information System (INIS)

    Sharma, Ved Parkash; Singh, Harminder Pal; Kohli, Ravinder Kumar; Batish, Daizy Rani

    2009-01-01

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 μW cm -2 ; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H 2 O 2 ) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at ≥2 h), and radicle and plumule growths (≥1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H 2 O 2 accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  14. Phosphorus Response and Amino Acid Composition of Different Green Gram (Vigna radiata L. Genotypes from Myanmar

    Directory of Open Access Journals (Sweden)

    M. Kywe

    2007-10-01

    Full Text Available Mungbean or green gram (Vigna radiata L. is an important component of rice-based cropping systems in Myanmar, where grain yields of around 800 kg ha^(-1 are much below its yield potential of 3000 kg ha^(-1. The reasons for this shortfall are as under-investigated as is the genotype-specific response of this crop to phosphorus (P application, which is critically low in many Myanmar soils, and the genetic variation in grain quality. For green gram quality, the concentration of lysine, an essential amino acid is particularly important given its scarcity in many cereal-based diets of Southeast Asia. The purpose of this study therefore was to investigate the effects of P application on the root and shoot growth, yield and its components for a range of green gram varieties, and to analyse the protein concentration and amino acid composition in green gram seed of different origins. To this end from 2001 to 2003, field experiments were conducted under rain-fed conditions in Yezin and Nyaung Oo. Fifteen landraces and five introduced green gram cultivars were grown at two levels of P (0 and 15 kg ha^(-1. There were large genotypic differences in P effects and a significant interaction between green gram genotypes and P for shoot and root growth. An unexpected benefit of P application was a reduction of pest and plant virus infestation in the field. Significant genotypic differences in the amino acid profile of seeds were also observed. The results indicate the potential for breeding efforts to increase seed yield and protein quality in green gram.

  15. Quarantine treatment by gamma radiation for different development stages of Callosobruchus maculatus in bean Vigna sinensis

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, Valter; Machi, André R.; Franco, Suely S.H., E-mail: arthur@cena.usp.br [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). laboratório de Radiobiologia e Ambiente; Fontes, Lucia da Silva, E-mail: lsfontes@uol.com.br [Universidade Federal do Piauí (UFPI), Teresina, PI (Brazil). Dept. de Biologia; Harder, Márcia N.C., E-mail: marcia.harder@fatec.sp.gov.br [Faculdade de Tecnologia de Piracicaba (FATEC), SP (Brazil). Dep. Roque Trevisan; Rossi, Rodrigo S.; Arthur, Paula B.; Franco, José G., E-mail: paula.arthur@hotmail.com, E-mail: zegilmar60@gamil.com, E-mail: gilmita@uol.com.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

    2017-07-01

    The loss of stored grain caused by insects generates a problem of economic order of importance, due to concern about the increased supply of food for the world population is expanding. Associated with this fact, there is the problem of nutritional deficiency due to lack of protein, especially for the less privileged populations. The use of ionizing radiation in grains and products stored without a doubt can solve the problem of the losses in these products, since it does not induce resistance to insects and leaves no toxic residue in the products, and is considered an effective and safe method. The aim of the experiment was to determine the effect of ionizing radiation from cobalt-60 as a quarantine treatment for the different stages of development of Callosobruchus maculatus (Fabr., 1972) (Coleóptera, Chysomilidae) in bean Vigna sinensis. The experiment was conducted in the laboratory of Radiobiology and Environment CENA/USP, Piracicaba, SP, Brazil. Bean samples infested with eggs, larvae, pre-pupae and pupae C. maculatus, the experiment consisted of 4 replicates for each stage of the insect's life cycle, and each repetition consisted of 20 individuals (eggs, larvae, pre-pupae and pupae), a total of 200 subjects per treatment which were irradiated with doses of 0 (control), 25, 50, 75 and 100 Gy, a source of cobalt-60, Gammabeam-650 type, in a rate dose of 1.3 kGy / h. The experiment was conducted in a room with a relative of 25 ± 2 ° C temperature and humidity of 70 ± 5%. After 35 days of irradiation process were carried out evaluations of the number of insects emerged in each repetition within the treatments. From the results obtained it was concluded that the dose lethal to eggs and larvae was 25 Gy, while for pre-pupae was 50 Gy, to pupae 100 Gy was not sufficient to control the adult emergence. (author)

  16. Influence of distillery effluent on germination and growth of mung bean (Vigna radiata) seeds

    Energy Technology Data Exchange (ETDEWEB)

    Kannan, A. [Biomembrane Toxicology Division, Industrial Toxicology Research Centre, Post Box No. 80, M.G. Marg, Lucknow 226001 (India); Upreti, Raj K. [Biomembrane Toxicology Division, Industrial Toxicology Research Centre, Post Box No. 80, M.G. Marg, Lucknow 226001 (India)], E-mail: upretirk@rediffmail.com

    2008-05-01

    Distillery effluent or spent wash discharged as waste water contains various toxic chemicals that can contaminate water and soil and may affect the common crops if used for agricultural irrigation. Toxic nature of distillery effluent is due to the presence of high amounts of organic and inorganic chemical loads and its high-acidic pH. Experimental effects of untreated (Raw) distillery effluent, discharged from a distillery unit (based on fermentation of alcohol from sugarcane molasses), and the post-treatment effluent from the outlet of conventional anaerobic treatment plant (Treated effluent) of the distillery unit were studied in mung bean (Vigna radiata, L.R. Wilczek). Mung bean is a commonly used legume crop in India and its neighboring countries. Mung bean seeds were presoaked for 6 h and 30 h, respectively, in different concentrations (5-20%, v/v) of each effluent and germination, growth characters, and seedling membrane enzymes and constituents were investigated. Results revealed that the leaching of carbohydrates and proteins (solute efflux) were much higher in case of untreated effluent and were also dependent to the presoaking time. Other germination characters including percentage of germination, speed of germination index, vigor index and length of root and embryonic axis revealed significant concentration-dependent decline in untreated effluent. Evaluation of seedlings membrane transport enzymes and structural constituents (hexose, sialic acid and phospholipids) following 6 h presoaking of seeds revealed concentration-dependent decline, which were much less in treated effluent as compared to the untreated effluent. Treated effluent up to 10% (v/v) concentration reflected low-observed adverse effect levels.

  17. Efficacy of insecticides against army worm (spodoptera mauritia) on mung bean (vigna radiata l.) under arid climate

    International Nuclear Information System (INIS)

    Abbas, G.; Aslam, M.; Khokhar, M.B.; Khattak, J.Z.K.; Malik, A.U.

    2011-01-01

    Influence of Bifenthrine (Talstar) at the rate 375 ml ha/sup -1/, Deltaphos 10+350 EC at the rate 500 ml ha/sup -1/, Lorsban 40 EC at the rate 850 ml ha/sup -1/, Triazofos (20/400 EC) at the rate 750 ml ha/sup -1/and Karate 5 EC at the rate 1250 ml ha/sup -1/ was studied on mung bean (Vigna radiata L.) yield under arid climate at Adaptive Research Farm, Karor during two kharif seasons of 2007 and 2008. Experiments were laid out in randomized complete block design with six a test variety. All the chemicals showed significant impact on mung crop as compared to that in control treatments. AZRI- 2006, a promising variety of mung bean (Vigna radiata L.) for arid climate was used as plots, but the treatment of Deltaphos 10+350 EC at the rate 350 ml ha/sup -1/consistently proved better than other treatments. (author)

  18. Ionizing radiation induced changes in phenotype, photosynthetic pigments and free polyamine levels in Vigna radiata (L.) Wilczek

    International Nuclear Information System (INIS)

    Sengupta, Mandar; Chakraborty, Anindita; Raychaudhuri, Sarmistha Sen

    2013-01-01

    Effects of gamma rays on the free polyamine (PA) levels were studied in Vigna radiata (L.) Wilczek. Seeds exposed to different doses of gamma rays were checked for damage on phenotype, germination frequency and alteration in photosynthetic pigments. Free polyamine levels were estimated from seeds irradiated in dry and water imbibed conditions. Polyamine levels of seedlings grown from irradiated seeds, and irradiated seedlings from unexposed seeds were also measured. Damage caused by gamma irradiation resulted in decrease in final germination percentage and seedling height. Photosynthetic pigments decreased in a dose dependent manner as marker of stress. Polyamines decreased in irradiated dry seeds and in seedlings grown from irradiated seeds. Radiation stress induced increase in free polyamines was seen in irradiated imbibed seeds and irradiated seedlings. Response of polyamines towards gamma rays is dependent on the stage of the life cycle of the plant. - Highlights: ► Gamma irradiation of Vigna radiata (L.) Wilczek seeds and seedlings. ► Decrease in germination frequency. ► Increase in seedling injury with increased dosage of gamma rays. ► Decrease in chlorophyll and carotenoid pigments. ► Change in free polyamine levels

  19. La collection de base des espèces sauvages de Phaseolus et Vigna : historique, gestion et conservation

    Directory of Open Access Journals (Sweden)

    Thierry Vanderborght

    1998-01-01

    Full Text Available The base collection of wild species of Phaseolus and Vigna: history, management and conservation.The National Botanic Garden of Belgium ensures the management of a base collection of botanical and wild forms in the tribe Phaseoleae and the sub-tribe Phaseolinae. The main objective is to conserve on a long terni basic the largest possible genetic diversity through seed semples stored at - 20°C. The collection provided the basic material for the investigations conducted at the University Faculty of Agricultural Sciences of Gembloux in fields as diverse as taxonomy, genome analysis, definition of genetic réservoirs, agronomie and chemical evaluations, interspecific hybridization and plant breeding. The results have allowed to becter understand the organization of genetic diversity in the studied plant material and to highlight the wealthy genetic potentiel of the collection. The latter should be preserved and valorized for the genetic improvement of food legumes, in particular within the two genera Phaseolus and Vigna.

  20. Adzuki beans (Vigna angularis seed quality under several drying conditions Qualidade de sementes de feijão adzuki (Vigna angularis submetidas a diversas condições de secagem

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.Objetivou-se no presente trabalho analisar o processo de secagem do feijão adzuki (Vigna angularis, bem como avaliar a qualidade das sementes, submetidas à secagem em diversas condições de ar. Foram utilizados grãos de feijão adzuki (Vigna angularis, colhidos com teor de água de 1,14 (decimal base seca e secos até o teor de 0,11 (decimal base seca. A secagem do feijão adzuki foi realizada em secador experimental mantido nas temperaturas controladas de 30, 40, 50, 60 e 70 ºC e umidades relativas de 52,0; 28,0; 19,1; 13,1 e 6,8%, respectivamente. Para analisar a qualidade fisiológica e tecnológica das sementes realizou-se o teste de germinação, Índice de Velocidade de Germinação (IVG, condutividade elétrica e absorção de água, respectivamente. Nas condições em que foi desenvolvido o presente trabalho,conclui-se que o tempo de secagem do feijão adzuki diminui para as temperaturas mais elevadas do ar de 60 e 70 ºC e afetam as qualidades fisiológica e tecnológica das sementes. Assim, para

  1. Transcriptome sequencing of mung bean (Vigna radiate L.) genes and the identification of EST-SSR markers.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen

    2015-01-01

    Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  2. 7 CFR 201.2 - Terms defined.

    Science.gov (United States)

    2010-01-01

    ... antidotale Retz. Panicgrass, green—Panicum maximum Jacq. var. trichoglume Robyns Pea, field—Pisum sativum L.... Chard, Swiss—Beta vulgaris L. subsp. cicla (L.) Koch Chicory—Cichorium intybus L. Chives—Allium....) Laterrade Cowpea—Vigna unguiculata (L.) Walp. subsp. unguiculata Cress, garden—Lepidium sativum L. Cress...

  3. Regulatory considerations surrounding the deployment of Bt-expressing cowpea in Africa: Report of the deliberations of an expert panel

    Science.gov (United States)

    Cowpea (Vigna unguiculata spp. unguiculata) is adapted to the drier agro-ecological zones of West Africa where it is a major source of dietary protein and widely used as a fodder crop. Improving the productivity of cowpea can enhance food availability and security in West Africa. Insect predation -...

  4. First report of natural infection of Vigna mungo var. silvestris L. by Groundnut bud necrosis virus, a tospovirus

    Directory of Open Access Journals (Sweden)

    Mohammad AKRAM

    2010-09-01

    Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.

  5. Constituents from Vigna vexillata and Their Anti-Inflammatory Activity

    Directory of Open Access Journals (Sweden)

    Guo-Feng Chen

    2012-08-01

    Full Text Available The seeds of Vigna genus are important food resources and there have already been many reports regarding their bioactivities. In our preliminary bioassay, the chloroform layer of methanol extracts of V. vexillata demonstrated significant anti-inflammatory bioactivity. Therefore, the present research is aimed to purify and identify the anti-inflammatory principles of V. vexillata. One new sterol (1 and two new isoflavones (2,3 were reported from the natural sources for the first time and their chemical structures were determined by the spectroscopic and mass spectrometric analyses. In addition, 37 known compounds were identified by comparison of their physical and spectroscopic data with those reported in the literature. Among the isolates, daidzein (23, abscisic acid (25, and quercetin (40 displayed the most significant inhibition of superoxide anion generation and elastase release.

  6. Effect of Gamma Irradiation Doses and Micro Elements on Some Physical, Chemical and Crop Parameters of Vigna sinensis

    International Nuclear Information System (INIS)

    Hussein, L.O.S.; Saleh, O.I.; Abdullah, M.I.

    2011-01-01

    The present work aim to expose Vigna sinensis L. (cowpea) seeds to gamma rays at dose levels 40, 80 and 120 Gy and to spray the growing plants with micro elements; boron (B) and zinc (Zn) after one month of planting; until harvest date, for increasing crop quality and quantity. Some physical parameters, some chemical analysis, the yield and net percentage of the produced crop were evaluated. The result obtained refer that, the 40 Gy dose enhanced most of physical, chemical and yield parameters of cowpea crop. Moreover, the harvested crop was increased and improved in case of those produced from plants sprayed with different concentrations of B or Zn plus 40 Gy dose as compared with the other treatments used followed by the dose of 80 Gy. Meanwhile, the dose of 120 Gy gave the least enhancement on the quality and quantity of the aforementioned treatments in cowpea crop

  7. Identification of water storage tissue in the stem of cowpea plant (Vigna unguliculata Walp) by neutron radiography

    International Nuclear Information System (INIS)

    Nakanishi, T.M.; Don-Jin, K.; Ishii, R.; Matsubayashi, M.

    1999-01-01

    Cowpea (Vigna unguliculata Walp) is considered one of the most drought resistant species among the pulse crops. It was suggested that in the lower part of the stem, parenchymatous tissue for storing water has been developed for the function of drought resistance. However, such tissue has not been identified yet. In order to identify the water storing tissue in the stem of cowpea plant, the authors performed neutron radiography, which provides a non-destructive image of water distribution pattern in a plant. Common bean plant and soybean plant were used as references. Comparing the neutron radiograph for the stems of the plants, i.e., cowpea, common bean and soybean plants, the parenchymatous tissue with water storing function was distinguished in the intermode between primary leaf and the first trifoliate leaf specifically in cowpea plant. (author)

  8. Effect of (/sup 60/cobalt) gamma rays on growth and root rot diseases in mungbean (vigna radiata L.)

    International Nuclear Information System (INIS)

    Ikram, N.; Dawar, S.; Zaki, M.J.; Abass, Z.

    2010-01-01

    Present investigation showed that gamma rays influences suppressive effect on root rot fungi such as Macrophomina phaseolina (Tassi) Goid, Rhizoctonia solani Kuhn and Fusarium spp., and inducive effect on growth parameters of mung bean (Vigna radiata L.). Seeds of mung bean were treated with gamma rays (/sup 60/Cobalt) at time periods of 0 and 4 minutes and stored for 90 days at room temperature to determine its effect on growth parameters and infection of root infecting fungi. All treatments of gamma rays enhanced the growth parameters as compared to untreated plants. Infection of M. phaseolina, R. solani and Fusarium spp., were significantly decreased on mung bean seeds treated with gamma rays. Gamma rays significantly increased the growth parameters and controlled the root rot fungi up to 90 days of storage of seeds. (author)

  9. Species differences in ligand specificity of auxin-controlled elongation and auxin transport: comparing Zea and Vigna

    Science.gov (United States)

    Zhao, Hu; Hertel, Rainer; Ishikawa, Hideo; Evans, Michael L.

    2002-01-01

    The plant hormone auxin affects cell elongation in both roots and shoots. In roots, the predominant action of auxin is to inhibit cell elongation while in shoots auxin, at normal physiological levels, stimulates elongation. The question of whether the primary receptor for auxin is the same in roots and shoots has not been resolved. In addition to its action on cell elongation in roots and shoots, auxin is transported in a polar fashion in both organs. Although auxin transport is well characterized in both roots and shoots, there is relatively little information on the connection, if any, between auxin transport and its action on elongation. In particular, it is not clear whether the protein mediating polar auxin movement is separate from the protein mediating auxin action on cell elongation or whether these two processes might be mediated by one and the same receptor. We examined the identity of the auxin growth receptor in roots and shoots by comparing the response of roots and shoots of the grass Zea mays L. and the legume Vigna mungo L. to indole-3-acetic acid, 2-naphthoxyacetic acid, 4,6-dichloroindoleacetic acid, and 4,7-dichloroindoleacetic acid. We also studied whether or not a single protein might mediate both auxin transport and auxin action by comparing the polar transport of indole-3-acetic acid and 2-naphthoxyacetic acid through segments from Vigna hypocotyls and maize coleoptiles. For all of the assays performed (root elongation, shoot elongation, and polar transport) the action and transport of the auxin derivatives was much greater in the dicots than in the grass species. The preservation of ligand specificity between roots and shoots and the parallels in ligand specificity between auxin transport and auxin action on growth are consistent with the hypothesis that the auxin receptor is the same in roots and shoots and that this protein may mediate auxin efflux as well as auxin action in both organ types.

  10. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L. Based on Transcriptome Data.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Rice bean (Vigna umbellata (Thunb. Ohwi & Ohashi is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length of 986 bp. Of these unigenes, 38,840 (33.2% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases. Furthermore, 30,170 (76.3% could be classified into gene ontology categories, 25,451 (64.4% into Swiss-Prot categories and 21,982 (55.6% into KOG database categories (E-value < 1.0E-5. A total of 9,301 (23.5% were mapped onto 118 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. A total of 3,011 genic SSRs were identified as potential molecular markers. AG/CT (30.3%, AAG/CTT (8.1% and AGAA/TTCT (20.0% are the three main repeat motifs. A total of 300 SSR loci were randomly selected for validation by using PCR amplification. Of these loci, 23 primer pairs were polymorphic among 32 rice bean accessions. A UPGMA dendrogram revealed three major clusters among 32 rice bean accessions. The large number of SSR-containing sequences and genic SSRs in this study will be valuable for the construction of high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  11. 2432-IJBCS-Article-Alexandre Dansi

    African Journals Online (AJOL)

    hp

    Endogenous knowledge and farmers' perceptions of the impact of the climatic changes on the production and the diversity of cowpea (Vigna unguiculata. (L.) Walp.) and Bambara groundnut (Vigna subterranea (L.) Verdc.) in. Benin. ABSTRACT. The existence of harmful impacts of climate change on the agricultural ...

  12. Efficacy of Carbofuran in Controlling Root-Knot Nematode (Meloidogyne javanica Whitehead, 1949) on Cultivars of Bambara Groundnut (Vigna subterranea (L.) Verdc.) in Yola, Nigeria

    OpenAIRE

    Jada, M. Y.; Gungula, D. T.; Jacob, I.

    2011-01-01

    Bambara groundnut (Vigna subterrenea L. Verdc.) is an important crop produced in Adamawa State of Nigeria. However, the production of the crop is seriously threatened by root-knot nematodes (RKNs; Meloidogyne spp.). Since cultural methods have not been very effective in controlling RKN, carbofuran was evaluated to determine its efficacy in controlling M. javanica in Yola during 2002 and 2003. Three bambara groundnut cultivars (Kwachanjiwa, Kwaheuma, and Kwatolotolo) were evaluated using three...

  13. Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

  14. Balanço de energia em um solo cultivado com feijão caupi no brejo paraibano Energy balance in a soil cultivated with cowpeas in a mountaineous area in Paraiba, Brazil

    Directory of Open Access Journals (Sweden)

    José R. de S. Lima

    2005-12-01

    Full Text Available Os componentes do balanço de energia num solo cultivado com feijão caupi nas condições do Brejo Paraibano, foram determinados numa área de 4 ha do Centro de Ciências Agrárias, da UFPB, localizada no município de Areia, PB (6o 58' S, 35o 41' W e 620 m. Para tal, instalou-se uma torre no centro da área, contendo um pluviógrafo, um piranômetro, um saldo radiômetro e sensores para medida da temperatura e da umidade relativa do ar, em dois níveis acima do dossel da cultura; além disso, dois locais no solo foram instrumentados, cada um com duas sondas térmicas instaladas horizontalmente, nas profundidades de z1 = 2,0 cm e z2 = 8,0 cm, além de uma placa destinada à medida do fluxo de calor no solo, a 5,0 cm. Essas medidas foram armazenadas a cada 30 min, num sistema de aquisição de dados. Verificou-se que o valor médio do saldo de radiação (Rn foi de 78%, sendo a Rn utilizada, em média, como 71% no fluxo de calor latente (LE, 19% como fluxo de calor sensível (H e 10% como fluxo de calor no solo (G. A fração do saldo de radiação utilizada como fluxo de calor latente aumentou com a evolução da cobertura do solo pela cultura, enquanto a fração utilizada como fluxo de calor sensível e de calor no solo, diminuiu.The energy balance components in a cowpea crop growing in the mountain region of Paraiba, Brazil ("Brejo Paraibano" was determined in a 4 ha area in the Centro de Ciências Agrárias, UFPB, in the municipality of Areia, PB (6o 58' S, 35o 41' W e 620 m. Measurements of rainfall, net and global radiation were made. Sensors at two levels above the canopy were also mounted, allowing the measurements of air temperature and relative humidity. Below the soil surface, two different sites were provided with two thermal probes, horizontally installed at depths of 2.0 and 8.0 cm, besides a heat flux plate 5.0 cm deep for soil heat flux measurements. All data were stored in a datalogger each 30 min. The average value of the net

  15. UNGUICULATA (L.) WALP

    African Journals Online (AJOL)

    DR. AMINU

    ABSTRACT. Hybridization experiments were conducted in the screen house to study the inheritance of seed colour pattern in cowpea. Cowpea varieties of varying seed coat colour were used as parents for the investigation. Parental, F1 and segregating F2 populations were raised in the field and the study revealed that self ...

  16. Infestação por larvas de Cerotoma arcuata (Olivier (Coleoptera: Chrysomelidae em nódulos de feijoeiro em cultivo com cobertura morta ou em consórcio com milho ou com caupi Infestation by Cerotoma arcuata (Olivier (Coleoptera: Chrysomelidae larvae on Phaseolus bean with mulching or intercropped with maize or cowpea

    Directory of Open Access Journals (Sweden)

    Maria Lucia França Teixeira

    2007-12-01

    Full Text Available A vaquinha Cerotoma arcuata ataca folhas de leguminosas e suas larvas alimentam-se de raízes e também de nódulos, onde a fixação de nitrogênio (FBN ocorre. O ataque das larvas aos nódulos pode causar mais danos à cultura do feijoeiro do que o consumo das folhas pelas formas adultas. Este estudo foi conduzido em condições de campo para avaliar os efeitos da infestação de C. arcuata no cultivo do feijoeiro com ou sem cobertura morta ou consorciado com caupi ou com milho. A nodulação, o crescimento e a produção de grãos de feijoeiro quando consorciado com caupi não diferiram do controle. A barreira aos insetos formada pelo milho adensado falhou, provavelmente devido à infestação precoce de C. arcuata e ao sombreamento causado pelo milho, com redução na produtividade de feijoeiro. O consumo dos nódulos pelas larvas na cultura de feijão solteiro e nos consórcios foi superior ao do tratamento com cobertura morta. A barreira física imposta pela cobertura morta agiu provavelmente através da redução da oviposição diretamente no solo e do ressecamento dos ovos sobre a palha e resultou em menor porcentagem de nódulos furados, com conseqüente aumento no número e peso de nódulos, no peso de raiz e na produção de grãos. Os consórcios com milho ou com caupi não reduziram a infestação de feijoeiro por C. arcuata, mas a aplicação da cobertura morta antes da infestação reduziu os danos causados pelas larvas aos nódulos e favoreceu a FBN e a produtividade.The bean leaf beetle Cerotoma arcuata is a legume leaf eater and its larvae feed on roots and also nodules where nitrogen fixation occurs. The attack of larvae to nodule may result in more damage to the bean crop than the consumption of leaves by adults. This study was conducted under field conditions to test the effects of C. arcuata infestation on Phaseolus bean with or without straw mulching or intercropped with maize or cowpea. Nodulation, growth and grain

  17. Caracterização de isolados de Rhizoctonia associados à queima foliar em Roraima = Characterization of Rhizoctonia isolates associated with foliar blight in Roraima.

    Directory of Open Access Journals (Sweden)

    Dayane Rodrigues Youssef

    2012-08-01

    Full Text Available O objetivo desse trabalho foi caracterizar isolados do fungo Rhizoctonia associados à queima foliar, obtidos de hospedeiros de importância econômica no estado de Roraima. Os isolados foram obtidos de plantas de feijão-caupi (Vigna unguiculata, soja (Glycine max, seringueira (Hevea brasiliensis, melancia (Citrullus lanatus, alface (Lactuca sativa e feijão-guandu (Cajanus cajan. Os parâmetros utilizados foram números de núcleos, grupo de anastomose e as características culturais da colônia, taxa de crescimento micelial e a formação de escleródios nos meios de cultura: batata dextrose agar (BDA, BDA+asparagina, BDA+extrato de levedura, Czapek Agar, maltose-peptona-agar, soil extract agar, sacarose-yeast-asparagina e V-8. Todos os 10 isolados estudados foram caracterizados como multinucleados e pertencentes à espécie Rhizoctonia solani. Três isolados de feijão-caupi, um de soja e o isolado de melancia foram identificados como AGI-1A e um isolado de feijãocaupi, um de soja e o isolado de feijão-guandu como AGI-1B. O isolado de seringueira não foi identificado como nenhum dos padrões de anastomose utilizado. Para a maioria dos isolados as maiores taxas de crescimento micelialforam obtidas no meio de cultura Soil Extract Agar. Dois tipos de escleródios, característicos do grupo AGI, foram observados: formação de 2-20 tufos placa-1 coloração variável, 1-2 mm e formação de 38-611 microescleródios placa-1, de coloração marrom, medindo 100 μm. A produção e o tipo de escleródio variaram com o isolado e o meio de cultura utilizado.The aim of this work was to characterize Rhizoctonia isolates associated with foliar blight symptom from hosts with economic importance at Roraima state. The isolates were recovered from cowpea (Vigna unguiculata, soybean (Glycine max, rubber tree (Hevea brasiliensis, watermelon (Citrullus lanatus, lettuce (Lactuca sativa and pigeonpea (Cajanus cajan. The evaluated characteristics were nuclear

  18. Práticas agrícolas no cultivo da mandioca e suas relações com o escoamento superficial, perdas de solo e água

    Directory of Open Access Journals (Sweden)

    Cleene Agostinho de Lima

    Full Text Available RESUMOObjetivou-se com esta pesquisa avaliar as características hidráulicas do escoamento superficial e o desempenho de práticas agrícolas sob a cultura da mandioca, no controle da erosão hídrica em Latossolo Amarelo álico coeso de textura franco argilo-arenosa. O experimento foi conduzido em uma área de 240 m2 e declividade de 0,07 m m-1, na Universidade Federal do Recôncavo da Bahia, Cruz das Almas, Bahia, Brasil. O arranjo experimental foi em delineamento inteiramente casualizado, com quatro tratamentos e três repetições, em parcelas de erosão com área de 3 m2, sob três intensidades de chuva simulada: 62 mm h-1, 90 mm h-1 (intensidade constante e 40 e 90 mm h-1 (intensidade variável e condições de cobertura. Foram adotados os seguintes tratamentos: Mandioca morro abaixo (MMA, mandioca morro abaixo com cobertura morta (MMA+CM, mandioca em nível consorciada com feijão-caupi (Vigna unguiculata L. Walp. e cobertura morta (MN+F+CM e mandioca em nível consorciada com feijão-caupi (MN+F. A classificação do regime de escoamento superficial como laminar lento permitiu indicar a ocorrência de erosão entressulcos nos tratamentos MMA e MN+F. O tratamento MMA mostrou-se uma prática susceptível à erosão hídrica, proporcionando perda total de solo de 3.912 kg ha-1 e 21,5% de água, sendo 8,1 e 9,3 vezes maior em relação ao tratamento MN+F, enquanto nos tratamentos com cobertura morta não ocorreu erosão hídrica. A aplicação de cobertura morta e consórcio de culturas reduziram significativamente as perdas de solo e água, podendo ser utilizada pelos agricultores como técnica de conservação do solo e água.

  19. Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

    Science.gov (United States)

    Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

    2014-03-01

    16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

  20. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi, E-mail: shilpi@dbeb.iitd.ac.in

    2015-06-30

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture.

  1. In silico genome-wide identification and characterization of the glutathione S-transferase gene family in Vigna radiata.

    Science.gov (United States)

    Vaish, Swati; Awasthi, Praveen; Tiwari, Siddharth; Tiwari, Shailesh Kumar; Gupta, Divya; Basantani, Mahesh Kumar

    2018-05-01

    Plant glutathione S-transferases (GSTs) are integral to normal plant metabolism and biotic and abiotic stress tolerance. The GST gene family has been characterized in diverse plant species using molecular biology and bioinformatics approaches. In the current study, in silico analysis identified 44 GSTs in Vigna radiata. Of the total 44 GSTs identified, chromosomal locations of 31 GSTs were confirmed. The pI value of GST proteins ranged from 5.10 to 9.40. The predicted molecular weights ranged from 13.12 to 50 kDa. Subcellular localization analysis revealed that all GSTs were predominantly localized in the cytoplasm. The active site amino acids were confirmed to be serine in tau, phi, theta, zeta, and TCHQD; cysteine in lambda, DHAR, and omega; and tyrosine in EF1G. The gene architecture conformed to the two-exon/one-intron and three-exon/two-intron organization in the case of tau and phi classes, respectively. MEME analysis identified 10 significantly conserved motifs with the width of 8-50 amino acids. The motifs identified were either specific to a specific GST class or were shared by multiple GST classes. The results of the current study will be of potential importance in the characterization of the GST gene family in V. radiata, an economically important leguminous crop.

  2. Nontarget effects of chemical pesticides and biological pesticide on rhizospheric microbial community structure and function in Vigna radiata.

    Science.gov (United States)

    Singh, Sunil; Gupta, Rashi; Kumari, Madhu; Sharma, Shilpi

    2015-08-01

    Intensive agriculture has resulted in an indiscriminate use of pesticides, which demands in-depth analysis of their impact on indigenous rhizospheric microbial community structure and function. Hence, the objective of the present work was to study the impact of two chemical pesticides (chlorpyrifos and cypermethrin) and one biological pesticide (azadirachtin) at two dosages on the microbial community structure using cultivation-dependent approach and on rhizospheric bacterial communities involved in nitrogen cycle in Vigna radiata rhizosphere through cultivation-independent technique of real-time PCR. Cultivation-dependent study highlighted the adverse effects of both chemical pesticide and biopesticide on rhizospheric bacterial and fungal communities at different plant growth stages. Also, an adverse effect on number of genes and transcripts of nifH (nitrogen fixation); amoA (nitrification); and narG, nirK, and nirS (denitrification) was observed. The results from the present study highlighted two points, firstly that nontarget effects of pesticides are significantly detrimental to soil microflora, and despite being of biological origin, azadirachtin exerted negative impact on rhizospheric microbial community of V. radiata behaving similar to chemical pesticides. Hence, such nontarget effects of chemical pesticide and biopesticide in plants' rhizosphere, which bring out the larger picture in terms of their ecotoxicological effect, demand a proper risk assessment before application of pesticides as agricultural amendments.

  3. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata.

    Science.gov (United States)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-06-30

    With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Spectrum and frequency of chlorophyll mutations in urdbean (Vigna mungo L. Hepper) induced by EMS and gamma rays

    International Nuclear Information System (INIS)

    Sharma, A.K.; Singh, V.P.; Sarma, M.K.

    2006-01-01

    In mutation breeding experiment, plants with altered characteristics such as chlorophyll changes, sterility, plant lethality etc. could be the marker of the mutability of a variety. In fact, spectrum and frequency of chlorophyll mutations have been studied in the great detail. The chlorophyll mutation is the clear-cut indication of non-directional nature of mutation and possibility of induction of useful mutations. The spectrum and frequency of chlorophyll mutation was estimated by using gamma rays (100, 200, 300 and 400 Gy doses), EMS (0.2, 0.4, 0.6 and 0.8%) and combination of gamma rays (100, 200, 300 400 Gy) with 0.2 % concentration EMS on two cultivars, namely, Pant Urd-19 and Pant Urd-30 of urdbean ( Vigna mungo L. Hepper). Five different types of chlorophyll mutations viz., albina, xantha, viridis, chlorina and maculata were identified in both the cultivars. Almost all the combination treatments produced maximum frequency and wider spectrum of chlorophyll mutations followed by single treatment of gamma rays or EMS. The frequency of chlorophyll mutation increased with higher doses of mutagens but decreased at highest dose. Proc. Nat. Acad. Sci. India. 76(8), I, 2006. 64-68. (author)

  5. RESIDU PESTISIDA PADA SAYURAN KUBIS (Brassica oleracea L. DAN KACANG PANJANG ( Vigna sinensis L. YANG DIPASARKAN DI PASAR BADUNG DENPASAR

    Directory of Open Access Journals (Sweden)

    K Agung Sudewa

    2012-11-01

    Full Text Available Pesticides residue of organophosphate and carbamate i.e. diazinon, chlorpyriphos, fentoate, carbaril and BPMC were tested on cabbage (Brassica oleracea L. and long bean (Vigna sinensis L.. The purpose of this study was to know the level of pesticides residue remaining on cabbage and long bean marketed in Badung Market, Denpasar.The samples were determined proportionally based on purposive sampling method. The proportion of sample was 10% of the total cabbage and snake bean sold in Badung market.Result of present study showed that residue of insecticides such as diazinon, chlorpyriphos, fentoate, carbaril, and BPMC remaining on the head of cabbage and snake bean marketed in Badung market was affected by the frequencies of their use in the field, in which chlorpyriphos was used by 60-65% of the farmers and carbaril by 40% of the farmers. Their residues on cabbage anf snake bean were 0.525 ppm and 1.296 ppm for chlorpyriphos (organophosphate; 0.303 ppm and 0.471 ppm for carbaril (carbamate. These result suggested that residue of chlorpyriphos on cabbage and snake bean were higher than MRL (Maximum Residue Limit for vegetable crops, i.e. 0.5 ppm.

  6. Tolerance and toxicity levels of boron in mung bean (vigna radiata (l.) wilczek) cultivars at early growth stages

    International Nuclear Information System (INIS)

    Hasnain, A.; Mahmood, S.; Akhtar, S.; Malik, S.A.; Bashir, N.

    2011-01-01

    Boron (B) toxicity has been recognized as a serious problem in arid and semi arid regions of the world. This study was aimed to determine critical levels of B by studying phenotypic variation for B-tolerance/ toxicity at the germination and seedling stage in three mung bean (Vigna radiata) cultivars; M-6, M-8 and 96009. Boron levels ranging from 0-20 ppm were applied using Boric acid. Germination, growth and photosynthetic attributes were significantly (p<0.001) influenced by varying B levels. However, the cultivars were significantly invariable for germination, seedling height and leaf number. B levels (5-10 ppm) appeared to be nutritionally critical whereas, 15-20 ppm induced B toxicity. The toxicity was expressed in terms of reduction in plant's growth as well as by visible symptoms which included chlorosis and necrosis of the foliage. The present study also demonstrated variation in B tolerance at the seedling stage in these cultivars. Among the tested cultivars, M-6 and M-8 exhibited better growth responses as compared with 96009. Fresh biomass and shoot: root ratio appeared to serve as selection criteria for B tolerance. The study further suggested screening of cultivars/ accessions on a large scale to explore more diversity of traits as well as the use of biochemical markers for mechanistic understanding of B tolerance. (author)

  7. Effects of chemical and biological pesticides on plant growth parameters and rhizospheric bacterial community structure in Vigna radiata

    International Nuclear Information System (INIS)

    Singh, Sunil; Gupta, Rashi; Sharma, Shilpi

    2015-01-01

    Highlights: • Non-target effects of pesticides employing qualitative and quantitative approaches. • Qualitative shifts in resident and active bacterial community structure. • Abundance of 16S rRNA gene and transcripts were reduced significantly. • Effects of biological pesticide similar to chemical pesticides on rhizospheric bacteria. - Abstract: With increasing application of pesticides in agriculture, their non-target effects on soil microbial communities are critical to soil health maintenance. The present study aimed to evaluate the effects of chemical pesticides (chlorpyrifos and cypermethrin) and a biological pesticide (azadirachtin) on growth parameters and the rhizospheric bacterial community of Vigna radiata. Qualitative and quantitative analysis by PCR-denaturing gradient gel electrophoresis (DGGE) and q-PCR, respectively, of the 16S rRNA gene and transcript were performed to study the impact of these pesticides on the resident and active rhizospheric bacterial community. While plant parameters were not affected significantly by the pesticides, a shift in the bacterial community structure was observed with an adverse effect on the abundance of 16S rRNA gene and transcripts. Chlorpyrifos showed almost complete degradation toward the end of the experiment. These non-target impacts on soil ecosystems and the fact that the effects of the biopesticide mimic those of chemical pesticides raise serious concerns regarding their application in agriculture

  8. Yield and Yield Components of Vetch (Vigna radiata as Affected by the Use of Vermicompost and Phosphate Bio-fertilizer

    Directory of Open Access Journals (Sweden)

    Mohammad Mehdi Rahimi

    2016-06-01

    Full Text Available To evaluate the effects different levels of phosphate biofertilizer barvar-2 and vermi compost on yield and yield components of vetch plant (Vigna radiata L.in Yasouj a factorial experiments was performed in completely randomized design in crop year of 2013. Experimental treatments were phosphate biofertilizer barvar-2 at 3 levels (0, 50, 100 gram per hectare and vermicompost at 4 levels (0, 10, 20, 30 ton per hectare. In this study stem height, root length, biological yield, seed yield and harvest index was measured. ANOVA and comparison of means showed that vermicompost significantly increased stem height, economic and biological yields. Results, also, indicated that highest yield and biomass, 4.3 and 18.8 g/plant, observed respectively when 100 g/ha of barvar-2 and 30 t/ha of vermi compost were used. Using both of phosphate biofertilizer barvar-2 and vermicompost was better than their individnal usage. This indicates that combined use of these 2 factors would produce higher yield. It can be concluded that application of 100 g/ha of barvar-2 and 30 t/ha of vermicompost would a proper recommendation.

  9. Economic evaluation (quantitative for Mung bean (Vigna radiata production in the Kamin Region, Sadat Shahr, Fars province

    Directory of Open Access Journals (Sweden)

    Mahmood Reza Sadikhani

    2016-11-01

    Full Text Available Although one of the biggest disadvantages of an economic evaluation, is volatility of price and instability of economic conditions, But for land use planning, economic considerations play a key role in land use and making decision. Cost is an important factor that encourage farmers to grow special crop. Thus, in addition to the qualitative and quantitative evaluation, Land Suitability can be based on net or gross profit per unit area of land to be assessed in economic terms. The economic evaluation is based on net income or gross income from the land. The purpose of this study was to assess the economic evaluation for part of Saadat Shahr (Kamin region for Mung bean (Vigna radiata. 8 drilled profiles in order to see the profiles were chosen and after collecting data on real output, the variable cost of producing the product and the critical values and estimated gross profit are calculated and land suitability classes were determined. The results showed that one unit has a moderate suitability (S2 and two units have suitable classes (S1 from separate units.

  10. Soil salinization and maize and cowpea yield in the crop rotation system using saline waters Salinização do solo e produtividade de milho e feijão caupi em sistema de rotação cultural utilizando águas salinas

    Directory of Open Access Journals (Sweden)

    Claudivan F. Lacerda

    2011-01-01

    sobre o acúmulo de sais no solo e a produtividade de milho e feijão-de-corda em sistema de rotação. O experimento foi conduzido em campo, utilizando-se do delineamento em blocos ao acaso, com cinco repetições. O primeiro cultivo foi instalado durante a estação seca de 2007, com a cultura do milho irrigada com água de diferentes salinidades (0,8; 2,2; 3,6 e 5,0 dS m-1. As plantas foram coletadas aos 90 dias após a semeadura (DAS, sendo realizadas as avaliações: crescimento vegetativo, produção de grãos por planta, matéria seca de 1.000 grãos e produtividade. Durante a estação chuvosa de 2008, foi cultivado o feijão caupi nas mesmas parcelas que foram cultivadas com milho. Ao final do ciclo, as plantas foram coletadas, sendo realizadas avaliações de crescimento vegetativo e produtividade. Amostras de solo foram coletadas antes e após o cultivo do milho e ao final do cultivo com feijão caupi. A salinidade da água de irrigação acima 2,2 dS m-1 reduziu a produtividade do milho durante o período seco. Os elevados totais de precipitação pluviométrica durante a estação chuvosa proporcionaram a lixiviação dos sais acumulados durante o cultivo na estação seca e eliminaram os possíveis efeitos negativos da salinidade sobre o feijão caupi. Porém, o feijão caupi apresentou um comportamento atípico com uma expressiva proporção de massa vegetativa e baixa produção de vagens, o que reduziu a eficiência dessa estratégia de rotação de culturas, nas condições do presente estudo.

  11. Phosphorus Use Efficiency for Symbiotic Fixation Nitrogen in Voandzou (Vigna Subterranea) Using Isotopic Exchange Method in Rhizotron

    Energy Technology Data Exchange (ETDEWEB)

    Andriamananjara, A.; Rabeharisoa, L. [Laboratoire des Radio-isotopes, Universite d' Antananarivo, Antananarivo (Madagascar); Masse, D. [Institut de Recherche pour le Developpement, UMR Eco and Sols, Montpellier, (France); Amenc, L.; Pernot, C.; Drevon, J. J. [Institut National de la Recherche Agronomique, UMR Eco and Sols, Montpellier, (France); Morel, C. [INRA-ENITA, Villenave d' Ornon (France)

    2013-11-15

    Low bioavailability of nitrogen and phosphorus is one of the main constraints in the acid soils with high P-fixing capacity. Plants adapt to low nutrient availability through various biological and physico-chemical mechanisms. Since genetic variation of N{sub 2} fixation exists in numerous legume species, optimization of symbiotic nitrogen fixation (SNF) under P deficiency could be a way to the replenishment of soil fertility in tropical soils. As the genetic potential of crops like Vigna subterranea (Bambara groundnut or voandzou) is little studied, although its agronomic potential is interesting for the farmers of Africa, a physiological study through legume screening for N{sub 2} fixation was performed with 54 cultivars from Madagascar, Niger and Mali, inoculated with the reference strain of Bradyrhizobium sp. Vigna CB756 in hydroponic culture under P deficiency and sufficiency (30 and 75 {mu}mol KH{sub 2}PO{sub 4} plant{sup -1} week {sup -1}, respectively), corresponding respectively to 28 and 70 mg P kg{sup -1} of soil. Large variability of nodulation and plant biomass was found among cultivars. These two parameters were generally correlated and the slope of the plant biomass regression as a function of nodulation was considered as an indicator of the efficiency in use of the rhizobial symbiosis. For the two cultivars most tolerant to P deficiency, V1 and V4 from Madagascar, the increase in use efficiency of the rhizobial symbiosis under P deficiency was linked with an increase in nodulated root O{sub 2} consumption linked to N{sub 2} fixation, and in phytase gene expression observed on the nodule sections by in situ RT- PCR. As the complexity of P compartments makes it difficult to assess the P bioavailability in the plant rhizosphere, an isotopic {sup 32}P exchange method was carried out in a rhizotron in order to assess the direct effect of the roots on P mobilization in rhizosphere soil, comparing V1 and V4 with 28 or 70 mg P kg{sup -1} of soil. Throughout

  12. Phytotoxicity attenuation in Vigna radiata under heavy metal stress at the presence of biochar and N fixing bacteria.

    Science.gov (United States)

    Seneviratne, Mihiri; Weerasundara, Lakshika; Ok, Yong Sik; Rinklebe, Jörg; Vithanage, Meththika

    2017-01-15

    This study assesses the effect of N-fixing bacteria and biochar synergism on plant growth and development of Vigna mungo under heavy metal stress (HM). Heavy metal stress is a worldwide problem, which causes critical effects on plant life due to oxidative stress. Application of biochar is a recent biological remediation technique, which often leads to an immobilization of heavy metals in soil. . Synergism of bacteria and biochar is a novel aspect to enhance plant growth under heavy metal stress. Woody biochar a byproduct of a dendro power industry was added as 1, 2.5 and 5% amounts combination with Bradyrhizobium japonicum, where mung seedlings were planted in serpentine soil rich in Ni, Mn, Cr and Co. Pot experiments were conducted for 12 weeks. The plant height, heavy metal uptake by plants, soil bioavailable heavy metal contents, soil N and P and microbial biomass carbon (MBC) were measured. The plant growth was enhanced with biochar amendment but a retardation was observed with high biochar application (5%). The soil N and P increased with the increase of biochar addition percentage while soil MBC showed reductions at 5% biochar amendment. Both soil bioavailable fractions of HM and up take of HMs by plants were gradually reduced with increase in biochar content. Based on the results, 2.5% biochar synergism with bacteria was the best for plant growth and soil nutrition status. Despite the synergism, available N was negatively correlated with the decrease of bioavailable metal percentage in soil whereas it was conversely for P. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Halopriming of seeds imparts tolerance to NaCl and PEG induced stress in Vigna radiata (L.) Wilczek varieties.

    Science.gov (United States)

    Jisha, K C; Puthur, Jos T

    2014-07-01

    The investigation was carried out to study the effect of halopriming on NaCl and polyethylene glycol-6000 (PEG-6000) induced stress tolerance potential of three Vigna radiata (L.) Wilczek varieties, with varied abiotic stress tolerance potential. Halopriming is a seed priming technique in which the seeds were soaked in various salt solutions (in this study NaCl was used). The results of the study indicated that the application of stresses (both NaCl and PEG) induced retardation of growth attributes (measured in terms of shoot length, fresh weight, dry weight) and decrease in physiological attributes like total chlorophyll content, metabolites, photosynthetic and mitochondrial activity of the seedlings in all three V. radiata (L.) varieties. However, halopriming of the seeds could reduce the extent of decrease in these biological attributes. NaCl and PEG stress also caused increase in MDA content (a product of membrane lipid peroxidation) in all the varieties studied and this increase was significantly minimized under halopriming. From the present investigation it was evident that among the green gram varieties studied, Pusa Vishal, a NaCl tolerant variety showed enhanced tolerance to NaCl and PEG induced stress, when the seeds were subjected to halopriming followed by Pusa Ratna (stress sensitive variety). Pusa 9531 (drought tolerant variety) also showed positive halopriming effects but it was less significant when compared to other two varieties. It could be concluded that halopriming improved the drought and salinity stress tolerance potential of all varieties and it was significantly higher in the Pusa Vishal as compared to Pusa 9531 and Pusa Ratna.

  14. Physicochemical and micro-structural properties of flours, starch and proteins from two varieties of legumes: bambara groundnut (Vigna subterranea).

    Science.gov (United States)

    Kaptso, Kuaté Giscard; Njintang, Yanou Nicolas; Nguemtchouin, Mbouga Marie Goletti; Scher, Joël; Hounhouigan, Joseph; Mbofung, Carl Moses

    2015-08-01

    This work is part of a large study aimed to evaluate the potential of bambara groundnut (Vigna subterranea) flour as starting raw material for the preparation of a widely cherished legume-based food product known as koki. Towards this objective, the flours from two varieties of bambara groundnut along with their respective starch and protein isolates were analyzed for some physicochemical and microstructural properties. It was observed that bambara flour contained appreciable amount of proteins (24.0-25.5 g/100 g), carbohydrates (57.9-61.7 g/100 g), fiber (3.45-3.68 g/100 g) and ash (3.65-3.85 g/100 g) with marginal differences between both varieties. The properties of starch and proteins isolated from the flours were different from one variety to another. In particular the starch granules of the white variety were larger (size range 10-35 μm) and polygonal while those from the black variety were smaller (size range 6-15 μm) and spherical in shape. In addition, the peak of gelatinization temperature was higher for white variety (81.7 °C) than for black variety (77.5 °C). The gelatinization temperature and the enthalpy of gelatinization of starch in the flours were systematically lower than for the starch isolates, suggesting an interaction of starch with other components on the gelatinization process.

  15. Characterization of a novel Y2K-type dehydrin VrDhn1 from Vigna radiata.

    Science.gov (United States)

    Lin, Chia-Hui; Peng, Po-Hsin; Ko, Chia-Yun; Markhart, Albert H; Lin, Tsai-Yun

    2012-05-01

    A novel dehydrin gene (VrDhn1) was isolated from an embryo cDNA library of Vigna radiata (L.) Wilczek (mungbean) variety VC1973A. The intronless VrDhn1 gene encodes a protein belonging to the Y(2)K-type dehydrin family. VrDhn1 protein accumulated in embryos and cotyledons during seed maturation and disappeared 2 days after seed imbibition (DAI). The expression of VrDhn1 mRNA and accumulation of VrDhn1 protein were at high levels in mature seeds, but neither mRNA nor protein was detected in mungbean vegetative tissues under normal growth conditions. The VrDhn1 mRNA level was extremely high in mature seeds and decreased to ∼30% at 1 DAI, and was not detectable at ~7 DAI. Tissue dehydration, salinity and exogenous ABA markedly induced VrDhn1 transcripts in plants as measured by quantitative real-time reverse transcription-PCR (qRT-PCR). VrDhn1 protein was not detected using immunoblots in seedlings under stress treatments. In mature seeds or 1 DAI seedlings, VrDhn1 proteins were immunolocalized in the nucleus and cytoplasm. VrDhn1 exhibited low affinity for non-specific interaction with DNA using electrophoretic mobility shift assays (EMSAs), and the exogenous addition of Zn(2+) or Ni(2+) stimulated interaction. The His-tagged VrDhn1 (30.17 kDa) protein showed a molecular mass of 63.1 kDa on gel filtration, suggesting a dimer form. This is the first report showing that a Y(2)K-type VrDhn1 enters the nucleus and interacts with DNA during seed maturation.

  16. Combined efficacy of Vigna radiata (L. R. Wilczek and Amorphophallus paeoniifolius (Dennst. Nicolson on serum lipids in albino rats

    Directory of Open Access Journals (Sweden)

    P.B. Benil

    2017-09-01

    Full Text Available Coronary Artery Disease (CAD is a major killer disease throughout the world. Dyslipidemia is a major contributor to the risk of CAD. Several dietary articles traditionally used in India and other South Asian countries reduced dyslipidemia. The present study was undertaken to evaluate the combined effect of Mung bean (Vigna radiata and Elephant foot yam (Amorphophallus paeoniifolius on serum lipids and atherogenic indices in albino rats and to compare it with a standard drug Cholestyramine. Thirty healthy albino rats of both sexes (150–200 g were randomized to 5 groups of 6 animals each. The grouping were done based on the following criteria: Group I: Normal Control Group, Group II: (Standard Group: Cholestyramine resin 5 mg/kg bw, Group III: (Half Dose Group: Drug powder at 540 mg/kg bw, Group IV: (Effective Dose Group: Drug powder at 1080 mg/kg bw, and Group V: (Double Dose Group: Drug powder at 2160 mg/kg bw. Lipid profile was estimated at the beginning and after 30 days of treatment. The Effective and Double doses of the drug reduced Total cholesterol along with levels of Triglycerides, Low density lipoprotein and Very low density lipoprotein levels significantly (p < 0.01 along with a significant (p < 0.01 increase in high density lipoproteins (HDL in rats. There was also significant (p < 0.01 improvement in atherogenic indices like Castelli Risk Index I, Non HDL C/HDL, Castelli risk Index II, TG/HDL, Atherogenic coefficient and Atherogenic Index of Plasma. The combination of powdered sprouted mung bean and yam powder have excellent lipid lowering potential.

  17. Expanding the repertoire of microsatellite markers for polymorphism studies in Indian accessions of mung bean (Vigna radiata L. Wilczek).

    Science.gov (United States)

    Shrivastava, Divya; Verma, Priyanka; Bhatia, Sabhyata

    2014-09-01

    Limited availability of validated, polymorphic microsatellite markers in mung bean (Vigna radiata), an important food legume of India, has been a major hurdle towards its improvement and higher yield. The present study was undertaken in order to develop a new set of microsatellite markers and utilize them for the analysis of genetic diversity within mung bean accessions from India. A GA/CT enriched library was constructed from V. radiata which resulted in 1,250 putative recombinant clones of which 850 were sequenced. SSR motifs were identified and their flanking sequences were utilized to design 328 SSR primer pairs. Of these, 48 SSR markers were employed for assessing genetic diversity among 76 mung bean accessions from various geographical locations in India. Two hundred and thirty four alleles with an average of 4.85 alleles per locus were detected at 48 loci. The polymorphic information content (PIC) per locus varied from 0.1 to 0.88 (average: 0.49 per locus). The observed and expected heterozygosities ranged from 0.40 to 0.95 and 0.40 to 0.81 respectively. Based on Jaccard's similarity matrix, a dendrogram was constructed using the unweighted pair-group method with arithmetic averages (UPGMA) analysis which revealed that one accession from Bundi, Rajasthan was clustered out separately while remaining accessions were grouped into two major clusters. The markers generated in this study will help in expanding the repertoire of the available SSR markers thereby facilitating analysis of genetic diversity, molecular mapping and ultimately broadening the scope for genetic improvement of this legume.

  18. Mechanism of Resistance in Mungbean [Vigna radiata (L. R. Wilczek var. radiata] to bruchids, Callosobruchus spp. (Coleoptera: Bruchidae

    Directory of Open Access Journals (Sweden)

    Abdul R. War

    2017-06-01

    Full Text Available Mungbean [Vigna radiata (L. R. Wilczek var. radiata] is an important pulse crop in Asia, and is consumed as dry seeds and as bean sprouts. It is an excellent source of digestible protein. Bruchids [Callosobruchus chinensis (L. and Callosobruchus maculatus (F.] are the important pests of mungbean and cause damage in the field and in storage. Bruchid infestation reduces the nutritional and market value of the grain and renders seeds unfit for human consumption, agricultural and commercial uses. These pests are controlled mainly by fumigation with highly toxic chemicals such as carbon disulfide, phosphene, and methyl bromide, or by dusting with several other insecticides, which leave residues on the grain, thus, threatening food safety. Some plant-based extracts have been found useful in controlling bruchids, but are not fully successful due to their short-term activity, rapid degradability, and potentially negative effect on seed germination. Although some wild sources of bruchid resistance in mungbean have been reported, which have been used to develop bruchid- resistant lines, undesirable genetic linkages threaten the proper exploitation of genetic diversity from wild germplasm into commercial cultivars. Further, biotype variation in bruchids has rendered some mungbean lines susceptible that otherwise would have been resistant to the pest. Host plant resistance is a cost-effective and a safe alternative to control bruchids in mungbean and is associated with morphological, biochemical, and molecular traits. These traits affect insect growth and development, thereby, reduce the yield losses by the pests. Understanding the defense mechanisms against insect pests could be utilized in exploiting these traits in crop breeding. This review discusses different traits in mungbean involved in defense against bruchids and their utility in pest management. We also highlight the breeding constraints for developing bruchid-resistant mungbean and how can these

  19. Changes in some biophysical and biochemical parameters of mungbean [vigna radiata (L.) wilczek] grown on chromium-contaminated soils treated with solid tea wastage

    International Nuclear Information System (INIS)

    Azmat, R.; Akhtar, H.

    2010-01-01

    The success of solid tea wastage treatment technology in remediating chromium (111) contamination in the soil has been demonstrated on growth of Vigna radiata. The present research was designed to study the effect of chromium (Cr3/sup +/) on plant growth, potassium (K), phosphorus (P), protease activity and proline profile of Vigna radiata as a bio indicator in the presence and absence of the solid tea surface as a bio sorbent to control the mobility of Cr3/sup +/ in the soil. Results showed toxic effects of Cr3/ sup +/ on plant growth and development, which include high protease activity with prominent proline and decreased potassium and phosphorus contents at elevated concentration of metal. Proline content is the only amino acid that accumulates to a greater extent in the leaves of plants under stress. An increase in proline contents in leaves, stem and root with high concentration of Cr3/s sup +/ gets reduced in a solid tea wastage amended plants. Metabolic alteration by Cr3/ sup +/exposure and their control by solid tea wastage already described in the first report, showed direct effect on enzymes or other metabolites or by its ability to generate reactive oxygen species which may cause oxidative stress. It is suggested that the plant can grow under chromium stress if some suitable adsorbent (like tea wastage) is mixed with the soil which can protect the plants from the phyto toxicity of Cr 3/sup +/ by altering various metabolic processes. (author)

  20. Effect of bambara groundnut flour (Vigna subterranea (L.) Verdc.) supplementation on chemical, physical, nutritional and sensory evaluation of wheat bread.

    Science.gov (United States)

    Abdualrahman, Mohammed A Y; Ali, Ali O; Elkhalifa, Elamin A; Sulieman, Abdelmoneim E

    2012-09-01

    Bambara groundnut (Vigna subterrenea (L) Verdc) is a major source of vegetable protein in sub-Saharan Africa. And the aim of this study was to enhance the nutritional value of wheat bread through the addition of bambara groundnut flour to wheat four. For this, bambara groundnut seeds were soaked in tap water, manually decorticated, sun dried and milled into fine flour. Proximate analysis of flours of de-hulled bambara groundnut and wheat were conducted. Flour of de-hulled bambara groundnut was used for bread supplementation in ratios of 5, 10 and 15%. Rheological properties of the control flour and wheat flour supplemented with 10% of de-hulled bambara groundnut flour were conducted. The total area and dough development time increased. However, water absorption, stability and extensibility respectively decreased, from 71.3; 8.5; 190 in the control flour to 71.0; 5.5; 180 in the 10% supplemented flour. The increases in the resistance to extension and proportional number from 260 to 280 and 1.37 to 1.56, respectively resulted in stiff dough. The most important effect of wheat bread supplementation was the improvement of protein quantity from 13.74 +/- 0.02% for the control bread to 15.49 +/- 0.02, 17.00 +/- 0.05 and 18.98 +/- 0.02% for the 5, 10 and 15% blending ratios, respectively. The in-vitro protein digestibility progressively increased from 84.33 +/- 0.03 in the control bread to 85.42 +/- 0.04, 86.57 +/- 0.04 and 87.64 +/- 0.03 in breads containing 5, 10 and 15% bambara groundnut flour. The sensory attributes of different types of bread showed that, a significant difference was observed in texture, colour and overall acceptability. However, the panelists gave higher score for 10% de-hulled bambara groundnut flour bread than bread made from other blends. The loaf weights, loaf volume and specific volume increased. However, while the loaf weight increased with addition of 15% de-hulled bambara groundnut flour, both of loaf volume and specific volume decreased

  1. Leaf crinkle disease in urdbean (Vigna mungo L. Hepper): An overview on causal agent, vector and host.

    Science.gov (United States)

    Gautam, Narinder Kumar; Kumar, Krishna; Prasad, Manoj

    2016-05-01

    Urdbean leaf crinkle disease (ULCD) is an economically significant widespread and devastating disease resulting in extreme crinkling, puckering and rugosity of leaves inflicting heavy yield losses annually in major urdbean-producing countries of the world. This disease is caused by urdbean leaf crinkle virus (ULCV). Urdbean (Vigna mungo L. Hepper) is relatively more susceptible than other pulses to leaf crinkle disease. Urdbean is an important and useful crop cultivated in various parts of South-East Asia and well adapted for cultivation under semi-arid and subtropical conditions. Aphids, insects and whiteflies have been reported as vectors of the disease. The virus is also transmitted through sap inoculation, grafting and seed. The loss in seed yield in ULCD-affected urdbean crop ranges from 35 to 81%, which is dependent upon type of genotype location and infection time. The diseased material and favourable climatic conditions contribute for the widespread viral disease. Anatomical and biochemical changes take place in the affected diseased plants. Genetic variations have been reported in the germplasm screening which suggest continuous screening of available varieties and new germplasm to search for new traits (new genes) and identify new sources of disease resistance. There are very few reports on breeding programmes for the development and release of varieties tolerant to ULCD. Mostly random amplified polymorphic DNA (RAPD) as well as inter-simple sequence repeat (ISSR) molecular markers have been utilized for fingerprinting of blackgram, and a few reports are there on sequence-tagged micro-satellite site (STMS) markers. There are so many RNA viruses which have also developed strategies to counteract silencing process by encoding suppressor proteins that create hindrances in the process. But, in the case of ULCV, there is no report available indicating which defence pathway is operating for its resistance in the plants and whether same silencing suppression

  2. Yield components, yield and seed quality of cowpea in Vitória da Conquista, Bahia = Componentes de produção, produtividade e qualidade de sementes de feijão-caupi em Vitória da Conquista, Bahia.

    Directory of Open Access Journals (Sweden)

    Alexandre Carneiro da Silva

    2014-12-01

    Full Text Available The objective with this study was to evaluate the components of production, productivity and quality of seeds of cowpea cultivars grown in Vitória da Conquista, Bahia. For this, an experiment was conducted in the statistical design of randomized blocks, with eight cultivars (BRS Marataoã, BRS Paraguaçu, BRS Pajeú, BRS Xiquexique, BRS Guariba, BRS Potengi, BRS Cauamé and BRS Itaim and four replications. Were evaluated the yield components: number of pods per plant (NVP; number of seeds per pod (NSV; weight of hundred seeds (P100; percentage of plant survival (%SBV and seed yield (PROD. To evaluate the physiological quality of the seeds, was determined the water content (%U and mass of thousand seeds (MMIL, and performed tests of germination percentage (%G, germination first count (PC, electrical conductivity (CE, percentage (%E and speed index of seedling emergence (IVE. Data were subjected to analysis of variance and mean ratings compared by Tukey test at 5% probability of error, and yield components correlated by the method of Pearson. The high seed yield achieved for all cultivars, averaging 1749.08 kg ha-1, and the good seed quality, which meets the standards of production and marketing indicate that Vitoria da Conquista, Bahia has favorable conditions for production of seeds of cowpea, with sowing in November. The number of pods per plant is the yield component that most influences in seed yield.= - Objetivou-se com este trabalho avaliar os componentes de produção, a produtividade e a qualidade de sementes de cultivares de feijão-caupi cultivadas em Vitória da Conquista, Bahia. Para isso, um experimento foi conduzido no delineamento estatístico de blocos ao acaso, com oito cultivares (BRS Marataoã, BRS Paraguaçu, BRS Pajeú, BRS Xiquexique, BRS Guariba, BRS Potengi, BRS Cauamé e BRS Itaim e quatro repetições. Foram avaliados os componentes de produção: número de vagens por planta (NVP; número de sementes por vagem (NSV

  3. Screening of Passiflora species for reaction to Cowpea aphid-borne mosaic virus reveals an immune wild species Seleção de espécies de Passiflora inoculadas com o vírus do mosaico do caupi revela a imunidade de uma espécie selvagem

    Directory of Open Access Journals (Sweden)

    Scheila da Conceição Maciel

    2009-06-01

    Full Text Available Cowpea aphid-borne mosaic virus (CABMV is a potyvirus that causes the most serious virus disease of passion fruit crops in Brazil. It is transmitted by several species of aphids in a non-persistent, non-circulative manner. The reaction of 16 species of Passiflora to infection by mechanical inoculation with four Brazilian isolates of CABMV was evaluated under greenhouse conditions. Only P. suberosa, a wild species, was resistant to infection by all virus isolates, in two independent assays. P. suberosa grafted onto infected P. edulis f. flavicarpa did not develop symptoms; neither was the virus detected by RT-PCR in the upper leaves, suggesting that this species is immune to CABMV.O vírus do mosaico do caupi (Cowpea aphid-borne mosaic virus - CABMV é um potyvirus que causa uma das mais importantes doenças do maracujazeiro no Brasil. O vírus é transmitido por diversas espécies de afídeos de maneira não persistente, não circulativa. A reação de 16 espécies de Passiflora à infecção com quatro isolados brasileiros do CABMV, por meio de inoculação mecânica foi avaliada em condições de casa-de-vegetação. Somente a espécie selvagem P. suberosa foi resistente à infecção com todos os isolados do CABMV, em dois ensaios independentes. Plantas de P. suberosa enxertadas em plantas de P. edulis f. flavicarpa infectadas com o CABMV também não desenvolveram sintomas da doença. O vírus também não foi detectado por RT-PCR nas folhas superiores das plantas, sugerindo que essa espécie é imune ao CABMV.

  4. Biodiversity of rhizobia associated with cowpea cultivars in soils of the lower half of the São Francisco River Valley Biodiversidade de rizóbio associado a cultivares de feijão-caupi em solos do submédio do Vale do São Francisco

    Directory of Open Access Journals (Sweden)

    Jakson Leite

    2009-10-01

    Full Text Available The biodiversity of rhizobium in soils of the São Francisco Valley is unknown and can be studied using cowpea as trap plants. The objective of this study was to verify the diversity of diazotrophic bacteria that nodulate cowpea in soils of the lower half of the São Francisco River Valley by morphological and genotypic characterization. Seven soil samples (A1, A2, A3, A4, C1, C2 and MC were collected to capture bacteria associated to five cowpea cultivars (IPA 206, BRS Pujante, BRS Marataoã, Canapu Roxo, and Sempre Verde, in a 5x7 factorial design with three replications. Thirty days after plant emergence, the nodules were collected and the bacteria isolated and analyzed in relation to their growth characteristics in YMA medium. The 581 isolates were grouped in 49 morphologic groups. Of this total, 62.3 % formed colonies in up to three days, 33.4 % grew from the 6th day on, and 4.3 % began to grow 4 to 5 days after incubation. Regarding the formation of acids and alkalis, 63 % acidified the medium, 12 % made it alkaline and 25 % maintained the medium at neutral pH. The highest diversity was observed in the A3 sample and in isolates associated with the cultivars Canapu Roxo and BRS Pujante. Thirty-eight representative isolates were chosen for the genotypic characterization, clustered in four groups based on the restriction analysis of 16s rDNA. This grouping was strongly correlated with the sampling site; 13 rhizobium isolates had an electrophoretic profile distinct from the standard rhizobium strains used in this study.A biodiversidade de rizóbio de solos do Vale do São Francisco é desconhecida e pode ser estudada utilizando feijão-caupi como planta-isca. Este trabalho teve por objetivo verificar a diversidade de bactérias diazotróficas que nodulam feijão-caupi em solos do Submédio do Vale do São Francisco por meio da caracterização morfológica e genotípica. Sete amostras de solos (A1, A2, A3, A4, C1, C2 e MC foram coletadas para

  5. Effect of soaking and fermentation on content of phenolic compounds of soybean (Glycine max cv. Merit) and mung beans (Vigna radiata [L] Wilczek).

    Science.gov (United States)

    María Landete, José; Hernández, Teresa; Robredo, Sergio; Dueñas, Montserrat; de Las Rivas, Blanca; Estrella, Isabel; Muñoz, Rosario

    2015-03-01

    Mung beans (Vigna radiata [L] Wilczek) purchased from a Spanish company as "green soybeans", showed a different phenolic composition than yellow soybeans (Glycine max cv. Merit). Isoflavones were predominant in yellow soybeans, whereas they were completely absent in the green seeds on which flavanones were predominant. In order to enhance their health benefits, both types of bean were subjected to technological processes, such as soaking and fermentation. Soaking increased malonyl glucoside isoflavone extraction in yellow beans and produced an increase in apigenin derivatives in the green beans. Lactobacillus plantarum CECT 748 T fermentation produced an increase in the bioactivity of both beans since a conversion of glycosylated isoflavones into bioactive aglycones and an increase of the bioactive vitexin was observed in yellow and green beans, respectively. In spite of potential consumer confusion, since soybean and "green soybean" are different legumes, the health benefits of both beans were enhanced by lactic fermentation.

  6. Induction of heat shock-like proteins in Vigna sinensis seedlings growing under ultraviolet-B (280-320 nm) enhanced radiation

    International Nuclear Information System (INIS)

    Nedunchezhian, N.; Annamalainathan, K.; Kulandaivelu, G.

    1992-01-01

    The effect of ultraviolet-B (UV-B) enhanced fluorescent radiation on protein profile and protein synthesis has been investigated in Vigna sinensis L. cv. Walp seedlings growing at various temperatures. In seedlings growing at 30°C, UV-B radiation decreased the level of several proteins as seen in Coomassie brilliant blue stained gel. However, fluorography of the same gel indicates induction of three sets of proteins in the range of 70. 53 and 16 k Da. Such induction under UV-B enhanced radiation resembled that found after heat shock treatments. In seedlings at 10 and 20°C, induction of such proteins varied both qualitatively and quantitatively. At 40°C. UV-B enhanced radiation caused a cumulative effect with temperature. Strong induction of specific proteins by UV-B radiation in seedlings growing under normal temperature indicates a possible protective role

  7. Efficacy of Carbofuran in Controlling Root-Knot Nematode (Meloidogyne javanica Whitehead, 1949 on Cultivars of Bambara Groundnut (Vigna subterranea (L. Verdc. in Yola, Nigeria

    Directory of Open Access Journals (Sweden)

    M. Y. Jada

    2011-01-01

    Full Text Available Bambara groundnut (Vigna subterrenea L. Verdc. is an important crop produced in Adamawa State of Nigeria. However, the production of the crop is seriously threatened by root-knot nematodes (RKNs; Meloidogyne spp.. Since cultural methods have not been very effective in controlling RKN, carbofuran was evaluated to determine its efficacy in controlling M. javanica in Yola during 2002 and 2003. Three bambara groundnut cultivars (Kwachanjiwa, Kwaheuma, and Kwatolotolo were evaluated using three application timings (at planting, 3 and 6 weeks after planting, and none. Results indicated that applying carbofuran at planting provided the greatest reduction in M. javanica population levels, which lead to increased yields in bambara groundnuts compared to the other two application timings. Furthermore, both Kwachanjiwa and Kwatolotolo provided similar high yields compared to Kwaheuma, which was most likely related to the M. javanica tolerance in these cultivars.

  8. Effect of Nano-ZnO Particle Suspension on Growth of Mung (Vigna radiata and Gram (Cicer arietinum Seedlings Using Plant Agar Method

    Directory of Open Access Journals (Sweden)

    Pramod Mahajan

    2011-01-01

    Full Text Available The present study demonstrates an effect of nano-ZnO particles on the growth of plant seedlings of mung (Vigna radiate and gram (Cicer arietinum. The study was carried out in plant agar media to prevent precipitation of water-insoluble nanoparticles in the test units. Various concentrations of nano-ZnO particles in suspension form were introduced to the agar media, and their effect on the root and shoot growth of the seedlings was examined. The main experimental approach, using correlative light and scanning electron microscopy provided evidence of adsorption of nanoparticles on the root surface. Absorption of nanoparticles by seedlings root was also detected by inductive coupled plasma/atomic emission spectroscopy (ICP-AES. It was found that at certain optimum concentration, the seedlings displayed good growth over control, and beyond that, retardation in growth was observed.

  9. Nitrogen fixation by mung bean (Vigna radiata L.) under field conditions in the Philippines as quantified by 15N isotope dilution

    International Nuclear Information System (INIS)

    Rosales, C.M.; Rivera, F.; Hautia, R.A.; Del Rosario, E.

    1995-05-01

    Nitrogen fixation by five mung bean genotypes (Vigna radiata L.) was estimated using two reference crops at two locations in the Philippines. The percentage of N derived from fixation and the amount of N-fixed ranged from 64 to 87% and 43 to 85 kg N/ha respectively at one location and from 36.6 to 72% and 21 to 85 kg N/ha at another location using cotton as reference crop. Maize was not a good reference crop. The highest mung bean seed yields obtained were 1.99 t/ha and 0.86 t/ha in the two locations. As to residual benefits, corn dry matter seeds yield were higher when grown following N 2 -fixing mung bean than after non-fixing corn or cotton. (author). 25 refs., 1 fig., 5 tabs

  10. Isolation and screening of rhizobia for auxin biosynthesis and growth promotion of mung bean (Vigna radiata L. seedlings under axenic conditions

    Directory of Open Access Journals (Sweden)

    Muhammad Ashfaq Anjum, Zahir Ahmad Zahir, Muhammad Arshad and Muhammad Ashraf

    2011-04-01

    Full Text Available A series of screening experiments to evaluate the effectiveness of rhizobia for producing auxins and improvegrowth and nodulation of mungbean (Vigna radiata L. were carried out under axenic conditions. Forty fouriolatess of rhizobia were isolated using standard procedures. Auxin biosynthesis by these rhizobial isolates wasdetermined in the absence and presence of L-Trp, a physiological precursor of auxins. Rhizobial isolates variedwidely in auxins biosynthesis capabilities. On the basis of auxins biosynthesis, a pouch experiment was conductedfor screening thirty four efficient isolates of rhizobia for the growth promotion of mung bean. Results of pouch studyshowed that inoculation with selected rhizobial isolates increased the root /shoot length, fresh, and dry shoot weightof mung bean up to 33, 59, 71, 148, 107 and 188%, respectively, over untreated control. Further studies are neededunder glasshouse and field conditions for confirmation of these results.

  11. Observations préliminaires de la variabilité entre quelques morphotypes de voandzou (Vigna subterranea L. Verdc., Fabaceae de Côte d'Ivoire

    Directory of Open Access Journals (Sweden)

    Zoro Bi IA.

    2005-01-01

    Full Text Available Preliminary observations of variability between some morphotypes of bambara groundnut (Vigna subterranea L. Verdc., Fabaceae from Côte d’Ivoire. Bambara groundnut (Vigna subterranea L. Verdc., is a food legume mainly cultivated by women for whom it represents a source of income for the household. In Côte d’Ivoire, the cultivation of bambara groundnut is located in the western and northern parts of the country. These zones are characterised by contrasted agroecology including tropical rain forest and dry savanna. In these zones, bambara groundnut plays a key role in both food and culture of peoples. Four morphotypes of Côte d’Ivoire (ICU, BPR, RBU, NFU were used in a preliminary study to assess the phenotypic variability between morphotypes. For each morphotype, 100 individuals were sampled to analyse 26 agromorphological traits selected from the list of bambara groundnut descriptors. Results of statistical analyses showed an important variability among morphotypes suggesting that 22 of these characters could be powerful to distinguish diversity among bambara groundnut morphotypes of Côte d’Ivoire. Three morphotypes (ICU, BPR and RBU show a shorter reproductive cycle than the other (NFU. In our experimental conditions, morphotypes with a shorter reproductive cycle give a higher percentage of matured pods (87 to 95%, compared to morphotype NFU (60%. The morphotype ICU was particularly earlier, maturing 90 days after sowing (DAS, whereas the long reproductive cycle morphotype (NFU required about 137 days. Based on the analysed agronomic traits, possibilities to improve bambara groundnut yield and to promote its cultivation in Côte d’Ivoire are discussed.

  12. Vigna mungo L. Hepper

    African Journals Online (AJOL)

    satyam

    2013-03-13

    Mar 13, 2013 ... Genetic engineering allows these genes to be transferred to cultivated varieties in order to enhance the tolerance to various stresses and hence stabilize .... primer: 5'. AATATCACGGGTAGCCAACG 3' and reverse primer 5'.

  13. Vigna mungo (L.) Hepper

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Available online at http://www.academicjournals.org/AJB .... g/100 g, Trifolium alexandrianum green manure (GM) @ 4 g/100 g. (on dry weight ... MN-S with concentrated sugar solution as an ad- ..... as an alternative fertilizer.

  14. Vigna subterranea L. Verdc

    African Journals Online (AJOL)

    2015-07-04

    Jul 4, 2015 ... This leads to significant non-productive water losses through soil ... esized that total crop water use could be improved if crop estab- lishment was ...... which allowed for maintenance of high tissue water potential. The red ...

  15. (VIGNA SUBTERRANEA [L.] VERDC.)

    African Journals Online (AJOL)

    User

    2015-12-02

    Dec 2, 2015 ... Latin America, probably through the slave trade, and is found in Sri-Lanka, Malaysia, Philippines and India, and. Brazil (Rassel, 1960; Goli et al., 1997). Bambara nut is an important source of dietary protein in sub-Saharan Africa, with protein levels of 16-25%. (Brough et al., 1993); carbohydrates and oil ...

  16. Vigna subterranea L. Verdc

    African Journals Online (AJOL)

    2012-05-14

    May 14, 2012 ... Effects of irrigation levels and seed coat colour on growth, development, yield and water-use efficiency of local bambara groundnut landrace selections were ..... Therefore, there is a need to down-regulate photosynthesis in.

  17. (Vigna radiata) seeds

    African Journals Online (AJOL)

    hp

    and maximum activity was observed at 70°C. The optimal pH value of the enzyme activity was found to be 5.2. There was a ... expresses its isozymes in many plants such as soyabean .... Firstly, it can change the ionization of the enzyme.

  18. (Vigna radiata (L.) Wilczek)

    Indian Academy of Sciences (India)

    hectare with 1.02 million tonne production (average during. 2000–2003). This crop provides ... rinsed with 70% ethanol for 10–15 min and dried at room temperature overnight. .... gating generation led to differentiation. Cluster IV exhibited.

  19. Construction and analysis of an SSH cDNA library of early heat-induced genes of Vigna aconitifolia variety RMO-40.

    Science.gov (United States)

    Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar

    2012-11-01

    Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.

  20. Nutritive Evaluation of the Bambara Groundnut Ci12 Landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] Produced in Côte d'Ivoire.

    Science.gov (United States)

    Yao, Denis N'Dri; Kouassi, Kouakou Nestor; Erba, Daniela; Scazzina, Francesca; Pellegrini, Nicoletta; Casiraghi, Maria Cristina

    2015-09-07

    The nutritional evaluation of the Bambara groundnut Ci12 landrace (Vigna subterranea (L.) Verdc.) seeds produced in Côte d'Ivoire shows a 19% content of protein, containing all the essential amino acids with tryptophan as the limiting amino acid, a total dietary fiber level of 10%, with a low soluble fraction content, and a fat content of 1.4%, with a high proportion of total unsaturated fatty acids (61%) of which 36% were n-6 fatty acids. This legume contains phosphorus, as the major mineral, followed by magnesium and calcium, and trace elements (iron, copper and zinc). It is characterized by the same amount of α-tocopherol and antioxidant capacity as common legumes. The high concentration of essential amino acids, n-6 fatty acids and minerals, mainly Fe, in the Ci12 landrace of Bambara groundnut indicates that this local legume has the potentiality to improve the nutritional status in Côte d'Ivoire and it could be regarded as a nutrient dense food.

  1. Nutritive Evaluation of the Bambara Groundnut Ci12 Landrace [Vigna subterranea (L.) Verdc. (Fabaceae)] Produced in Côte d’Ivoire

    Science.gov (United States)

    N’Dri Yao, Denis; Kouassi, Kouakou Nestor; Erba, Daniela; Scazzina, Francesca; Pellegrini, Nicoletta; Casiraghi, Maria Cristina

    2015-01-01

    The nutritional evaluation of the Bambara groundnut Ci12 landrace (Vigna subterranea (L.) Verdc.) seeds produced in Côte d’Ivoire shows a 19% content of protein, containing all the essential amino acids with tryptophan as the limiting amino acid, a total dietary fiber level of 10%, with a low soluble fraction content, and a fat content of 1.4%, with a high proportion of total unsaturated fatty acids (61%) of which 36% were n-6 fatty acids. This legume contains phosphorus, as the major mineral, followed by magnesium and calcium, and trace elements (iron, copper and zinc). It is characterized by the same amount of α-tocopherol and antioxidant capacity as common legumes. The high concentration of essential amino acids, n-6 fatty acids and minerals, mainly Fe, in the Ci12 landrace of Bambara groundnut indicates that this local legume has the potentiality to improve the nutritional status in Côte d’Ivoire and it could be regarded as a nutrient dense food. PMID:26370971

  2. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. �UG157� and �DPU915� were good general combiners. Two crosses namely �PDB 88-31�/�DPU 915� and �PLU 277�/�KAU7� had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  3. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. UG157 and DPU915 were good general combiners. Two crosses namely PDB 88-31/DPU 915 and PLU 277/KAU7 had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  4. Treatment of Cr/sup 3+/ contaminated soil by solid tea wastage I. A study of physiological processes of Vigna radiata

    International Nuclear Information System (INIS)

    Azmat, R.; Akhter, Y.; Sara Qureshi, S.; Ahmed, T.

    2010-01-01

    This study describes the option of using domestic tea waste in soil contaminated with the Cr/sup 3+/ trace metal due to industrial and mine activity, continuously discharging in the land and aquatic resources. This disposal of industrial wastage without proper treatment is responsible for the lowering of crop productivity with the accumulation of essential and non essential trace metals in the plants. On the other hand domestic waste management in soil and aquatic resources are also accountable for the reduced field productivity. This research discusses the proper domestic waste management in the agriculture land for the cultivation of crop in the contaminated soil. Vigna radiata has been selected as a crop to check the effects of Cr/sup 3+/ and its deletion in the contaminated soil. The highest yield was obtained when soil was mixed with tea wastage instead of spreaded tea wastage. Seed germination, morphology and physiology of 15 days old plant showed remarkable improvement in the plant growth including seed germination with activated tea wastage in the presence of Cr/sup 3+/ as compared to those plants which were grown in Cr/sup 3+/ contaminated soil only. Biochemical analysis of seedling showed an increase in the concentration of chlorophyll, carbohydrates, protein and amino acids, which confirms the remediation of contaminated soil through tea wastage. It was concluded that proper use of domestic waste can be helpful to increase the soil fertility and can concentrate the heavy toxic metals in it through complex formation. (author)

  5. Characterization of VuMATE1 expression in response to iron nutrition and aluminum stress reveals adaptation of rice bean (Vigna umbellata to acid soils through cis regulation

    Directory of Open Access Journals (Sweden)

    Meiya eLiu

    2016-04-01

    Full Text Available Rice bean (Vigna umbellata VuMATE1 appears to be constitutively expressed at vascular system but root apex, and Al stress extends its expression to root apex. Whether VuMATE1 participates in both Al tolerance and Fe nutrition, and how VuMATE1 expression is regulated is of great interest. In this study, the role of VuMATE1 in Fe nutrition was characterized through in planta complementation assays. The transcriptional regulation of VuMATE1 was investigated through promoter analysis and promoter-GUS reporter assays. The results showed that the expression of VuMATE1 was regulated by Al stress but not Fe status. Complementation of frd3-1 with VuMATE1 under VuMATE1 promoter could not restore phenotype, but restored with 35SCaMV promoter. Immunostaining of VuMATE1 revealed abnormal localization of VuMATE1 in vasculature. In planta GUS reporter assay identified Al-responsive cis-acting elements resided between -1228 and -574 bp. Promoter analysis revealed several cis-acting elements, but transcription is not simply regulated by one of these elements. We demonstrated that cis regulation of VuMATE1 expression is involved in Al tolerance mechanism, while not involved in Fe nutrition. These results reveal the evolution of VuMATE1 expression for better adaptation of rice bean to acidic soils where Al stress imposed but Fe deficiency pressure released.

  6. Impact of pesticides on plant growth promotion of Vigna radiata and non-target microbes: comparison between chemical- and bio-pesticides.

    Science.gov (United States)

    Gupta, Sukriti; Gupta, Rashi; Sharma, Shilpi

    2014-08-01

    To compare the target and non-target effects of two chemical-pesticides (chlorpyrifos and endosulfan) with that of a bio-pesticide (azadirachtin), Vigna radiata (mung bean) was grown in a randomized pot experiment with recommended and higher application rates of pesticides. Colony counts enumerating specific microbial populations, viz. fungi, Pseudomonas, nitrogen-fixing bacteria, and phosphate-solubilizing microorganisms, were performed. In addition, several plant growth parameters such as root and shoot lengths were also monitored. It was observed that the pesticides exerted a suppressive effect on different microbial communities under study in the initial 30 days period. The bacterial and fungal populations in chlorpyrifos treated plants increased thereafter. Endosulfan resulted in enhancement of fungi and nitrogen-fixing bacteria, although phosphate-solubilizing microorganisms were suppressed at higher application rates. Azadirachtin, which is gaining popularity owing to its biological origin, did not result in enhancement of any microbial populations; on the other hand, it had a deleterious effect on phosphate-solubilizing bacteria. This study is the first to evaluate the non-target effects of pesticides with a comparison between chemical- and bio-pesticides, and also stresses the importance of critical investigation of bio-pesticides before their wide spread application in agriculture.

  7. Tillage and residue management effect on soil properties, crop performance and energy relations in greengram (Vigna radiata L. under maize-based cropping systems

    Directory of Open Access Journals (Sweden)

    J.R. Meena

    2015-12-01

    Full Text Available Effect of tillage and crop residue management on soil properties, crop performance, energy relations and economics in greengram (Vigna radiata L. was evaluated under four maize-based cropping systems in an Inceptisol of Delhi, India. Soil bulk density, hydraulic conductivity and aggregation at 0–15 cm layer were significantly affected both by tillage and cropping systems, while zero tillage significantly increased the soil organic carbon content. Yields of greengram were significantly higher in maize–chickpea and maize–mustard systems, more so with residue addition. When no residue was added, conventional tillage required 20% higher energy inputs than the zero tillage, while the residue addition increased the energy output in both tillage practices. Maize–wheat–greengram cropping system involved the maximum energy requirement and the cost of production. However, the largest net return was obtained from the maize–chickpea–greengram system under the conventional tillage with residue incorporation. Although zero tillage resulted in better aggregation, C content and N availability in soil, and reduced the energy inputs, cultivation of summer greengram appeared to be profitable under conventional tillage system with residue incorporation.

  8. Effect of Trichoderma harzianum biomass and Bradyrhizobium sp. strain NC 92 to control leaf blight disease of bambara groundnut (Vigna subterranea caused by Rhizoctonia solani in the field

    Directory of Open Access Journals (Sweden)

    Mana Kanjanamaneesathian

    2007-01-01

    Full Text Available Four hundred and sixty two strains of Trichoderma spp. were isolated from 23 soil samples in which groundnut (Arachis hypogaea L. and bambara groundnut (Vigna subterranea L. had been planted in Songkhla, Phattalung, Nakhon Si Thammarat, Narathiwat and Yala provinces. These fungi were tested against Rhizoctonia solani, a causal agent of leaf blight of bambara groundnut, using dual culture technique on PDA medium. Among 462 isolates tested, 226 isolates had an ability to overgrow R. solani completely. Further testing found 13 isolates having the ability to parasitize mycelia of R. solani. Among these isolates, ThB-1-54 produced a cellulolytic enzyme on congo-red agar. This isolate was later identified as T. harzianum Rifai. In the field test, applying biomass of the isolate ThB-1-54 cultured on ground mesocarp fiber of oil palm, the combination of the isolate ThB-1-54 on ground mesocarp fiber of oil palm and Bradyrhizobium sp. (strain NC 92, or fungicide (iprodione had no effect on disease severity, yield, or the amount of total nitrogen content in stems or seeds of bambara groundnut plant.

  9. A facile biomimetic preparation of highly stabilized silver nanoparticles derived from seed extract of Vigna radiata and evaluation of their antibacterial activity

    Science.gov (United States)

    Choudhary, Manoj Kumar; Kataria, Jyoti; Cameotra, Swaranjit Singh; Singh, Jagdish

    2016-01-01

    The significant antibacterial activity of silver nanoparticles draws the major attention toward the present nanobiotechnology. Also, the use of plant material for the synthesis of metal nanoparticles is considered as a green technology. In this context, a non-toxic, eco-friendly, and cost-effective method has been developed for the synthesis of silver nanoparticles using seed extract of mung beans ( Vigna radiata). The synthesized nanoparticles have been characterized by UV-visible spectroscopy (UV-Vis), Fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM), atomic absorption spectroscopy (AAS), and X-ray diffraction (XRD). The UV-visible spectrum showed an absorption peak at around 440 nm. The different types of phytochemicals present in the seed extract synergistically reduce the Ag metal ions, as each phytochemical is unique in terms of its structure and antioxidant function. The colloidal silver nanoparticles were observed to be highly stable, even after 5 months. XRD analysis showed that the silver nanoparticles are crystalline in nature with face-centered cubic geometry and the TEM micrographs showed spherical particles with an average size of 18 nm. Further, the antibacterial activity of silver nanoparticles was evaluated by well-diffusion method and it was observed that the biogenic silver nanoparticles have an effective antibacterial activity against Escherichia coli and Staphylococcus aureus. The outcome of this study could be useful for nanotechnology-based biomedical applications.

  10. Structural characterization of silver nanoparticles phyto-mediated by a plant waste, seed hull of Vigna mungo and their biological applications

    Science.gov (United States)

    Varadavenkatesan, Thivaharan; Vinayagam, Ramesh; Selvaraj, Raja

    2017-11-01

    Nanobiotechnology has rapidly become a critical facet of nanotechnology. The green synthesis of silver nanoparticles, making use of the hull of black gram (Vigna mungo), paves the way for a simple and eco-friendly utilization of a domestic waste to a product with antioxidant and anticoagulant activities. The emergence of silver nanoparticles was characterized by a variety of methods UV-visible spectrophotometry, scanning electron microscopy added to energy dispersive spectroscopy, X-ray diffractometry, particle size distribution and FT-IR spectroscopy analyses. A discrete band at 421 nm was obtained from UV-visible spectroscopy of the silver nanoparticle suspension. The extract sourced from the hull of black gram showed evidence of the presence of a variety of functional moieties of phytochemicals using FTIR spectroscopy. These were also deemed responsible for maintaining the stability of silver nanoparticles. SEM and EDAX techniques combined, proved that the zero-valent silver nanoparticles were lesser than 100 nm in size. The crystallinity of the nanoparticles was confirmed, as deduced by the (1 1 1) plane, from XRD analysis. The potential of the phytochemicals in maintaining the steadiness of nanoparticles was implied by the zeta potential value that stood at -30.3 mV. In the current study, we have endeavored to comprehend the antioxidant and anticoagulant nature of the green-synthesized benign silver nanoparticles.

  11. Exogenous Spermidine Alleviates Low Temperature Injury in Mung Bean (Vigna radiata L. Seedlings by Modulating Ascorbate-Glutathione and Glyoxalase Pathway

    Directory of Open Access Journals (Sweden)

    Kamrun Nahar

    2015-12-01

    Full Text Available The role of exogenous spermidine (Spd in alleviating low temperature (LT stress in mung bean (Vigna radiata L. cv. BARI Mung-3 seedlings has been investigated. Low temperature stress modulated the non-enzymatic and enzymatic components of ascorbate-glutathione (AsA-GSH cycle, increased H2O2 content and lipid peroxidation, which indicate oxidative damage of seedlings. Low temperature reduced the leaf relative water content (RWC and destroyed leaf chlorophyll, which inhibited seedlings growth. Exogenous pretreatment of Spd in LT-affected seedlings significantly increased the contents of non-enzymatic antioxidants of AsA-GSH cycle, which include AsA and GSH. Exogenous Spd decreased dehydroascorbate (DHA, increased AsA/DHA ratio, decreased glutathione disulfide (GSSG and increased GSH/GSSG ratio under LT stress. Activities of AsA-GSH cycle enzymes such as ascorbate peroxidase (APX, monodehydroascorbate reductase (MDHAR, dehydroascorbate reductase (DHAR and glutathione reductase (GR increased after Spd pretreatment in LT affected seedlings. Thus, the oxidative stress was reduced. Protective effects of Spd are also reflected from reduction of methylglyoxal (MG toxicity by improving glyoxalase cycle components, and by maintaining osmoregulation, water status and improved seedlings growth. The present study reveals the vital roles of AsA-GSH and glyoxalase cycle in alleviating LT injury.

  12. Uso de bentonita na remediação de solos contaminados com zinco: efeito na produção de feijão Use of bentonite in the remediation of soils contaminated with zinc: effect on bean production

    Directory of Open Access Journals (Sweden)

    Gilvanise A. Tito

    2011-09-01

    Full Text Available Diversos procedimentos têm sido propostos para reduzir a concentração de metais pesados nos solos, e, conseqüentemente, seus efeitos poluidores. Dentre eles destacam-se a aplicação de materiais, como a bentonita, capazes de adsorver estes elementos, tornando-os menos disponíveis para as plantas. Objetivou-se com este trabalho avaliar a capacidade da bentonita na remediação de solos contaminados com zinco. Conduziu-se experimento em condições de casa de vegetação com delineamento inteiramente casualizado com três repetições e uma planta por parcela, utilizando-se como planta indicadora o feijão caupi (Vigna unguiculata L.. Os tratamentos consistiram de uma combinação fatorial 3 x 3, sendo o primeiro fator composto por três doses de Zn (50, 250 e 450 mg kg-1 e o segundo fator por três doses de bentonita (0, 30 e 60 t ha-1. Para o estudo, utilizou-se vasos com capacidade de18 kg, preenchidos com 15 kg de solo em mistura com as respectivas doses de bentonita e com o zinco. Os tratamentos permaneceram incubados por um período de 10 dias, e em seguida foi realizada a semeadura da planta indicadora. Aos 65 dias após a semeadura colheram-se folhas, caules, raízes, sementes e casca, que, depois de secos em estufa de circulação de ar (65°C, foram pesados, moídos e analisados quanto aos teores de zinco. Os resultados evidenciaram que a bentonita parece ser um excelente material inorgânico para remediar solos contaminados com zinco. A incorporação de bentonita ao solo aumenta a adsorção do zinco diminuindo a disponibilidade deste elemento para a planta tendendo, consequentemente, aumentar a produção de massa seca.Several procedures have been proposed to reduce the concentration of heavy metals in soils and consequently, to reduce polluting effects. One of the most used procedures is the application of materials such as bentonite capable of adsorbing these elements making them less available to plants. The objective of this

  13. Enzymatic activity and mineralization of carbon and nitrogen in soil cultivated with coffee and green manures Atividade enzimática e mineralização do carbono e nitrogênio sob solo cultivado com adubos verdes na cultura do cafeeiro

    Directory of Open Access Journals (Sweden)

    Elcio Liborio Balota

    2010-10-01

    cafeeiro. Foram feitas amostragens em um experimento de campo de longa duração instalado em Latossolo Vermelho distrófico em Miraselva, PR, na profundidade de 0-10 cm, na projeção da copa e na entrelinha, nos seguintes tratamentos: testemunha, leucena (Leucaena leucocephala, Crotalaria spectabilis, Crotalaria breviflora, amendoim-cavalo (Arachis hypogaea tipo virginia, mucuna-cinza (Mucuna pruriens, mucuna-anã (Mucuna deeringiana e caupi (Vigna unguiculata. As amostragens de solo foram feitas em quatros estádios de desenvolvimento dos adubos verdes: pré-plantio (setembro, pós-plantio (novembro, florescimento (fevereiro e pós-incorporação (abril, de 1997 a 1999. O cultivo de adubos verdes influenciou a atividade das enzimas do solo (urease, arilsulfatase e fosfatase e a mineralização do C e N tanto na projeção da copa como na entrelinha. O cultivo da leucena aumentou a atividade da fosfatase ácida e da arilsulfatase e a mineralização de C e N na projeção da copa e na entrelinha do cafeeiro. O cultivo de leucena aumentou a atividade da urease na projeção da copa, enquanto C. breviflora incrementou a atividade da urease na entrelinha.

  14. Diversidade genética de Begomovirus que infectam plantas invasoras na região nordeste Genetic diversity of Begomovirus infecting weeds in northeastern Brazil

    Directory of Open Access Journals (Sweden)

    I.P. Asssunção

    2006-06-01

    Full Text Available Os Begomovirus fazem parte de uma família numerosa de fitovírus denominada Geminiviridae. Eles infectam ampla gama de hospedeiras, incluindo muitas espécies cultivadas, como tomate (Lycopersicon esculentum, feijão (Phaseolus vulgaris, pimentão (Capsicum annuum, caupi (Vigna unguiculata, mandioca (Manihot esculenta etc., além de plantas invasoras de várias espécies. Em alguns casos, plantas invasoras podem funcionar como reservatórios desses vírus para plantas cultivadas, mediante transmissão pelo inseto-vetor. No presente trabalho, plantas invasoras com sintomas de mosaico amarelo, deformação do limbo foliar e redução do crescimento foram avaliadas no tocante à presença de Begomovirus mediante a técnica de PCR, empregando-se oligonucleotídeos universais para detecção desses vírus. Foram avaliadas 11 amostras, correspondendo a 10 espécies, coletadas em municípios dos Estados de Alagoas, Pernambuco e Bahia. Algumas, como Herissantia crispa, Waltheria indica e Triumfetta semitriloba, são relatadas pela primeira vez como espécies hospedeiras de Begomovirus. Para estimar a variabilidade genética dos Begomovirus detectados, o produto de amplificação dos diversos isolados foi clivado com as enzimas de restrição EcoRI, HinfI e TaqI. Confirmando resultados obtidos para plantas cultivadas por outros grupos de pesquisa, foram observados padrões distintos de clivagem para os isolados estudados, evidenciando a grande variabilidade genética desses vírus.Genus Begomovirus belong to the family Geminiviridae. Begomovirus is associated with a wide range of hosts, including many cultivated species such as tomato (Lycopersicon esculentum, dry beans (Phaseolus vulgaris, pepper (Capsicum annuum, cowpea (Vigna unguiculata, cassava (Manihot esculenta, etc., besides many weed species. It has been demonstrated that in some cases weeds act as virus reservoirs for cultivated plants. In the present work, weed samples presenting yellow

  15. Plantio direto, adubação verde e suplementação com esterco de aves na produção orgânica de berinjela No-tillage, green manure and supplementation with poltry manure on organic eggplant production

    Directory of Open Access Journals (Sweden)

    Cristina Maria de Castro

    2005-05-01

    Full Text Available Sob manejo orgânico, foram avaliados, em Seropédica, RJ, os sistemas de plantio direto da berinjela (Solanum melongena nas palhadas de Crotalaria juncea (crotalária, Pennisetum glaucum (milheto, cv. BRS 1501 e vegetação espontânea (pousio, em comparação com o plantio convencional (aração e gradagem ou enxada rotativa. Simultaneamente, foram avaliados três tipos de cultivo: berinjela em monocultura, em consórcio com crotalária e em consórcio com caupi (Vigna unguiculata, cv. Mauá. Não houve diferença entre os sistemas de plantio direto e convencional quanto à produção comercial da berinjela. A palhada da crotalária foi mais eficiente que a do milheto e do pousio para cobertura morta do solo e conseqüentemente o controle de plantas espontâneas foi maior. O cultivo simultâneo com as leguminosas não acarretou redução da produtividade da berinjela. Em um segundo estudo, foram comparados plantio direto (palhadas de crotalária e da vegetação espontânea e plantio convencional, combinados com doses crescentes de cama de aviário (0, 100, 200 e 400 kg ha-1 de N aplicada em cobertura. Em termos de aporte de biomassa, a crotalária foi novamente superior à vegetação espontânea. A berinjela respondeu à adubação orgânica, com produtividade máxima de 50,6 t ha-1 , correspondendo à maior dose empregada, contra 36,9 t ha-1 referentes ao controle.No-tillage systems were evaluated within an eggplant (Solanum melongena organic management in Seropédica, Rio de Janeiro State. Crotalaria juncea and Pennisetum glaucum cv. BRS 1501 were used as pre-plantings besides fallowing, in comparison to conventional system (plowing. Simultaneously, three cropping managements were tested: eggplant single-cropping, intercropping with C. juncea, and intercropping with cowpea (Vigna unguiculata cv. Mauá. No differences were found among planting systems concerning eggplant yield. Crotalaria juncea was more effective than Pennisetum glaucum

  16. Tolerância de bactérias diazotróficas simbióticas à salinidade in vitro Tolerance of diazotrophic symbiotic bacteria to salinity

    Directory of Open Access Journals (Sweden)

    Rafaela Simão Abrahão Nóbrega

    2004-08-01

    Full Text Available A busca de estirpes de bactérias diazotróficas simbióticas tolerantes à salinidade, em conjunto com a seleção de hospedeiros, tem por objetivo aumentar o desempenho da simbiose e manter a produtividade vegetal de forma sustentada em condições de estresse salino. Doze estirpes de bactérias diazotróficas de diferentes procedências foram estudadas quanto à tolerância a diferentes concentrações de NaCl em meios de cultura 79 e LB. As estirpes que apresentaram maior tolerância à salinidade (30 g L-1 em meio 79 foram: BR 6806 e BR 4007, ambas de crescimento rápido isoladas de solos do nordeste brasileiro, UFLA 03-51 e UFLA 03-65, de crescimento rápido e UFLA 03-84, de crescimento lento, sendo as três últimas oriundas da região Amazônica. Essas também estiveram entre as mais tolerantes em meio de cultura LB. A estirpe UFLA 03-84, selecionada em trabalhos prévios por sua alta eficiência para caupi (Vigna unguiculata, pode ser indicada para estudos de inoculação, visando a aumentar o rendimento dessa cultura em solos salinos. Os meios de cultura 79 e LB foram eficientes para avaliar a tolerância relativa de rizóbio a NaCl, mas o meio 79 é mais indicado, pois permite o crescimento de todas as estirpes. Pelos resultados, infere-se haver relação entre tolerância in vitro à salinidade e origem dos microssimbiontes, pois as estirpes BR 4007 e BR 6806, oriundas do Ceará, estiveram entre as mais tolerantes.Tolerance to salinity of diazotrophic bacteriaand their host species could increase plant growth and sustainability in salt stressed soils. Twelve diazotrophic bacteria strains were studied regarding their tolerance to different NaCl concentrations in 79 and LB media. More tolerant (30 g L-1 strains in 79 medium were: the fast growers BR 6806 and BR 4007, isolated from northeast Brazil, UFLA 03-51 and UFLA 03-65, and slow growing strain UFLA03-84, being these last three isolated from Amazon region. These strains were among

  17. Nutritional and physicochemical properties of stored solar-dried ...

    African Journals Online (AJOL)

    Preservation techniques for cowpea (Vigna unguiculata L.) leaves, a green leafy vegetable mainly consumed in the eastern and northern parts of Uganda, are still lacking. The study aimed at determining the effect of blanching, open sun and solar-drying on the nutrient content, organoleptic acceptability and ...

  18. Effects of soil treatment with abattoir effluent on morphological and ...

    African Journals Online (AJOL)

    The effects of abattoir wastewater treated soil on morphological and biochemical profiles of cowpea seedlings (Vigna unguiculata) grown in gasoline polluted soil was studied. Percentage germination, shoot length, root length and leaf area of cowpea seedlings grown in gasoline treated soil decreased significantly (P ...

  19. Plant species responses to oil degradation and toxicity reduction in ...

    African Journals Online (AJOL)

    Vegetated plots were established by planting different plant species – legumes and vegetable (Abelmoschus, esculentus, Telfaria occidentalis and Vigna unguiculata) and applied with sawdust and chromolaena leaves at different intensities of oil pollution. Toxicity of the soil was evaluated using germination percentage, ...

  20. Effect of gasoline diesel fuel mixture on the germination and the ...

    African Journals Online (AJOL)

    EJIRO

    The effects of gasoline fuel/diesel mixture on the germination of seeds of Vigna unguiculata, the survival of the ... products on plants have been evaluated by many studies. (Siddiqui and Adams ..... much of the solar energy emitted by sun would not be absorbed by ... balance and biological equilibrium (Baran et al., 2002).