WorldWideScience

Sample records for cauliflower

  1. Hollow stem in cauliflower

    NARCIS (Netherlands)

    Everaarts, A.P.; Putter, de H.

    2003-01-01

    The occurrence of, sometimes large, cavities in the stem of cauliflower formed a serious quality problem for Dutch cauliflower growers in recent years. The cause of the problem under the local conditions was not clear. In field experiments, the application of boron and variation in the growth rate

  2. Aggregates, broccoli and cauliflower

    Science.gov (United States)

    Grey, Francois; Kjems, Jørgen K.

    1989-09-01

    Naturally grown structures with fractal characters like broccoli and cauliflower are discussed and compared with DLA-type aggregates. It is suggested that the branching density can be used to characterize the growth process and an experimental method to determine this parameter is proposed.

  3. Nitrogen balance during growth of cauliflower

    NARCIS (Netherlands)

    Everaarts, A.P.

    2000-01-01

    The potential for loss of nitrogen to the environment during growth of cauliflower was investigated. A comparison was made between cauliflower growth and nitrogen uptake without, and with, nitrogen application of the recommended amount (=225 kg ha-1 minus mineral nitrogen in the soil layer 0–60 cm,

  4. 77 FR 6772 - United States Standards for Grades of Cauliflower

    Science.gov (United States)

    2012-02-09

    ... Service [Doc. AMS-FV-10-0047] United States Standards for Grades of Cauliflower AGENCY: Agricultural... Standards for Grades of Cauliflower. AMS is reviewing all fresh fruit and vegetable grade standards for... provisions for grading purple, orange or green cauliflower. The proposed revision will amend the color...

  5. CuO cauliflowers for supercapacitor application: Novel potentiodynamic deposition

    International Nuclear Information System (INIS)

    Dubal, Deepak P.; Gund, Girish S.; Lokhande, Chandrakant D.; Holze, Rudolf

    2013-01-01

    Graphical abstract: Schematic experimental setup used for the potentiodynamic mode of electrodeposition for the synthesis of CuO cauliflower onto stainless steel substrate. Highlights: ► Synthesis of CuO using potentiodynamic mode of electrodeposition. ► Uniformly spread cauliflower-like nanostructure. ► CuO cauliflowers provide high specific capacitance with good stability. ► CuO cauliflowers show high power and energy density values. -- Abstract: In present investigation, synthesis and characterization of novel cauliflower-like copper oxide (CuO) and its electrochemical properties have been performed. The utilized CuO cauliflowers were prepared by potentiodyanamic mode from an aqueous alkaline bath. X-ray diffraction pattern confirm the formation of monoclinic CuO cauliflowers. Scanning electron micrograph analysis reveals that CuO cauliflowers are uniformly spread all over the substrate surface with the surface area of 49 m 2 g −1 with bimodal pore size distribution. Electrochemical analysis shows that CuO cauliflower exhibits high specific capacitance of 179 Fg −1 in 1 M Na 2 SO 4 electrolyte with 81% capacity retention after 2000 cycles. The Ragone plot discovers better power and energy densities of cauliflowers-like CuO sample. Present investigation illustrates that the potentiodynamic approach for the direct growth of cauliflower-like CuO is simple and cost-effective and can be applied for synthesis of other metal oxides, polymers etc.

  6. Agrobacterium-mediated transformation of cauliflower: optimization ...

    Indian Academy of Sciences (India)

    Unknown

    2.1 Plant material and culture conditions. Seeds of cauliflower variety Pusa Snowball K-1 used for transformation were obtained from the National Seeds. Corporation, New Delhi. Seeds, surface sterilized in. 0⋅1% HgCl2 and 0⋅1% SDS for 10 min, were placed on half-strength MS (Murashige and Skoog 1962) medium.

  7. Effects of defoliation on growth of cauliflower

    NARCIS (Netherlands)

    Boogaard, van den R.; Grevsen, K.; Thorup Kristensen, K.

    2001-01-01

    Three experiments were performed with defoliation of young cauliflower plants in the field. The leaves were removed 3–6 weeks after planting and about 65 f the leaf area were removed. After defoliation, several plant processes contributed to compensate for the loss of leaf area. Right after

  8. Postharvest characteristics of two cultivars of cauliflower

    Directory of Open Access Journals (Sweden)

    Adenilson Mroginski de Souza

    2010-06-01

    Full Text Available The cauliflower has a great economic importance, especially for small producers, and it turns out to be a profitable crop in small areas. However, at postharvest period it is difficult to store it at a given room temperature due to sweating and a heavy breathing process, which leads to a discoloration of the inflorescence. Thus, the current study aimed to characterize the postharvest storage of cauliflower hybrids Snow Mystique and Graffiti kept at room temperature corresponding to an air temperature of 20 ± 2oC and a relative humidity (RH of 75%. Evaluations were made every three days during a period of 12 days of storage. The parameters studied were percentage of weight loss in fresh weight terms, firmness of stem, soluble solids, pH and measurable acidity. By evaluating the results, it was concluded that the cauliflower is not supposed to be stored at an air temperature of 20 ± 2oC and a 75% RH for more than three days, since the inflorescence presented a high water loss through the transpiration process under the environmental conditions in study.

  9. CuO cauliflowers for supercapacitor application: Novel potentiodynamic deposition

    Energy Technology Data Exchange (ETDEWEB)

    Dubal, Deepak P., E-mail: deepak.dubal@chemie.tu-chemnitz.de [Technische Universität Chemnitz, Institut für Chemie, AG Elektrochemie, D-09107 Chemnitz (Germany); Gund, Girish S.; Lokhande, Chandrakant D. [Thin Film Physics Laboratory, Department of Physics, Shivaji University, Kolhapur, 416004 (M.S) (India); Holze, Rudolf, E-mail: rudolf.holze@chemie.tu-chemnitz.de [Technische Universität Chemnitz, Institut für Chemie, AG Elektrochemie, D-09107 Chemnitz (Germany)

    2013-02-15

    Graphical abstract: Schematic experimental setup used for the potentiodynamic mode of electrodeposition for the synthesis of CuO cauliflower onto stainless steel substrate. Highlights: ► Synthesis of CuO using potentiodynamic mode of electrodeposition. ► Uniformly spread cauliflower-like nanostructure. ► CuO cauliflowers provide high specific capacitance with good stability. ► CuO cauliflowers show high power and energy density values. -- Abstract: In present investigation, synthesis and characterization of novel cauliflower-like copper oxide (CuO) and its electrochemical properties have been performed. The utilized CuO cauliflowers were prepared by potentiodyanamic mode from an aqueous alkaline bath. X-ray diffraction pattern confirm the formation of monoclinic CuO cauliflowers. Scanning electron micrograph analysis reveals that CuO cauliflowers are uniformly spread all over the substrate surface with the surface area of 49 m{sup 2} g{sup −1} with bimodal pore size distribution. Electrochemical analysis shows that CuO cauliflower exhibits high specific capacitance of 179 Fg{sup −1} in 1 M Na{sub 2}SO{sub 4} electrolyte with 81% capacity retention after 2000 cycles. The Ragone plot discovers better power and energy densities of cauliflowers-like CuO sample. Present investigation illustrates that the potentiodynamic approach for the direct growth of cauliflower-like CuO is simple and cost-effective and can be applied for synthesis of other metal oxides, polymers etc.

  10. The endophyte Verticillium Vt305 protects cauliflower against Verticillium wilt.

    Science.gov (United States)

    Tyvaert, L; França, S C; Debode, J; Höfte, M

    2014-06-01

    To investigate the interaction between cauliflower and the isolate VerticilliumVt305, obtained from a field suppressive to Verticillium wilt of cauliflower, and to evaluate the ability of VerticilliumVt305 to control Verticillium wilt of cauliflower caused by V. longisporum. Single and combined inoculations of VerticilliumVt305 and V. longisporum were performed on cauliflower seedlings. Symptom development was evaluated, and fungal colonization was measured in the roots, hypocotyl and stem with real-time PCR. No symptoms were observed after single inoculation of VerticilliumVt305, although it colonized the plant tissues. Pre-inoculation of VerticilliumVt305 reduced symptom development and colonization of plant tissues by V. longisporum. VerticilliumVt305 is an endophyte on cauliflower plants and showed effective biological control of V. longisporum in controlled conditions. This work can contribute to the development of a sustainable control measure of V. longisporum in Brassicaceae hosts, which is currently not available. Additionally, this study provides evidence for the different roles of Verticillium species present in the agro-ecosystem. © 2014 The Society for Applied Microbiology.

  11. Plant abiotic stress tolerance analysis in cauliflower using a curd micropropagation system

    OpenAIRE

    Rihan, HZ; Al-Issawi, M; Al-Shamari, M; Elmahrouk, M; Fuller, MP

    2015-01-01

    © 2015 ISHS. An effective protocol for cauliflower micropropagation was optimised and developed which enabled the production of tens of thousands of cauliflower microshoots from one cauliflower curd. The large number of microshoots that can be produced per culture unit facilitates the use of this protocol to analyse both the physiological and molecular components of abiotic stress tolerance. The protocol was used for cauliflower cold tolerance analysis and it was demonstrated that low tempera...

  12. Sensory, physicochemical and microbiological quality of irradiated minimally processed cauliflower

    International Nuclear Information System (INIS)

    Bib, Nizakat; Khan, Misal; Badshah, Amal; Ashraf Chaudry, Muhammad

    2005-01-01

    Minimally processed cauliflower samples were irradiated, stored at 5 deg C for 2 weeks and analyzed for sensory, physicochemical and microbiological qualities at 0th, 7th and 14th days. The data showed highest mean values of 7.93 and 7.57 for appearance and flavor, respectively, for 1.0 kGy treated samples. The D 10 values of contaminating microorganisms on cauliflower were 0.20 (Escherischia coli) and 0.24 kGy (Salmonella paratyphae A.) and the resulting 5D 10 value was 1.2 kGy. The study revealed that a dose of 1.5 kGy is enough for retention of quality and reduction of microbial load to 5D 10 values in cauliflower during 2 weeks storage at refrigerated temperature

  13. Preventing Cauliflower Ear with a Modified Tie-Through Technique.

    Science.gov (United States)

    Dimeff, Robert J.; Hough, David O.

    1989-01-01

    Describes a quick, simple tie-through suture technique (in which a collodion packing is secured to the auricle with two buttons) for preventing cauliflower ear following external ear trauma in wrestlers and boxers. The technique ensures constant compression; multiple treatments for fluid reaccumulation are rarely necessary. (SM)

  14. Estimation of cauliflower mass transfer parameters during convective drying

    Science.gov (United States)

    Sahin, Medine; Doymaz, İbrahim

    2017-02-01

    The study was conducted to evaluate the effect of pre-treatments such as citric acid and hot water blanching and air temperature on drying and rehydration characteristics of cauliflower slices. Experiments were carried out at four different drying air temperatures of 50, 60, 70 and 80 °C with the air velocity of 2.0 m/s. It was observed that drying and rehydration characteristics of cauliflower slices were greatly influenced by air temperature and pre-treatment. Six commonly used mathematical models were evaluated to predict the drying kinetics of cauliflower slices. The Midilli et al. model described the drying behaviour of cauliflower slices at all temperatures better than other models. The values of effective moisture diffusivities ( D eff ) were determined using Fick's law of diffusion and were between 4.09 × 10-9 and 1.88 × 10-8 m2/s. Activation energy was estimated by an Arrhenius type equation and was 23.40, 29.09 and 26.39 kJ/mol for citric acid, blanch and control samples, respectively.

  15. An analysis of the development of cauliflower seed as a model to improve the molecular mechanism of abiotic stress tolerance in cauliflower artificial seeds.

    Science.gov (United States)

    Rihan, Hail Z; Al-Issawi, Mohammed; Fuller, Michael P

    2017-07-01

    The development stages of conventional cauliflower seeds were studied and the accumulation of dehydrin proteins through the maturation stages was investigated with the aim of identifying methods to improve the viability of artificial seeds of cauliflower. While carbohydrate, ash and lipids increased throughout the development of cauliflower traditional seeds, proteins increased with the development of seed and reached the maximum level after 75 days of pollination, however, the level of protein started to decrease after that. A significant increase in the accumulation of small size dehydrin proteins (12, 17, 26 KDa) was observed during the development of cauliflower seeds. Several experiments were conducted in order to increase the accumulation of important dehydrin proteins in cauliflower microshoots (artificial seeds). Mannitol and ABA (Absisic acid) increased the accumulation of dehydrins in cauliflower microshoots while cold acclimation did not have a significant impact on the accumulation of these proteins. Molybdenum treatments had a negative impact on dehydrin accumulation. Dehydrins have an important role in the drought tolerance of seeds and, therefore, the current research helps to improve the accumulation of these proteins in cauliflower artificial seeds. This in turns improves the quality of these artificial seeds. The current results suggest that dehydrins do not play an important role in cold tolerance of cauliflower artificial seeds. This study could have an important role in improving the understanding of the molecular mechanism of abiotic stress tolerance in plants. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. An analysis of the development of cauliflower seed as a model to improve the molecular mechanism of abiotic stress tolerance in cauliflower artificial seeds

    OpenAIRE

    Rihan, HZ; Al-Issawi, M; Fuller, MP

    2017-01-01

    publisher: Elsevier articletitle: An analysis of the development of cauliflower seed as a model to improve the molecular mechanism of abiotic stress tolerance in cauliflower artificial seeds journaltitle: Plant Physiology and Biochemistry articlelink: http://dx.doi.org/10.1016/j.plaphy.2017.05.011 content_type: article copyright: © 2017 Elsevier Masson SAS. All rights reserved.

  17. The effect of irradiation on the DNA of cauliflower

    International Nuclear Information System (INIS)

    Harmey, M.A.

    1991-01-01

    The cellular DNA is one of the components most affected by ionizing radiation. Lesions caused range from single and double stranded breaks to chemical modification of bases depending on the radiation dosage and the metabolic status of the tissue. In attempting to assess the DNA damage induced by irradiation of vegetables in a speedy and convenient manner, we examined the effect on the DNA by subjecting cauliflower to a dose of 1 kGy. If DNA is nicked by irradiation, the extent of the damage can be assessed by using DNA polymerase to repair the nicks. Comparisons were made between irradiated and non irradiated cauliflower and incorporation of 32 p deoxy GTP in the presence of the Klenow fragment of DNA polymerase measured

  18. Effects of gamma radiation in cauliflower (Brassica spp) minimally processed

    International Nuclear Information System (INIS)

    Nunes, Thaise C.F.; Rogovschi, Vladimir D.; Thomaz, Fernanda S.; Trindade, Reginaldo A.; Villavicencio, Anna L.C.H.; Alencar, Severino M.

    2007-01-01

    Consumers demand for health interests and the latest diet trends. The consumption of vegetables worldwide has increased every year over the past decade, consequently, less extreme treatments or additives are being required. Minimally processed foods have fresh-like characteristics and satisfy the new consumer demand. Food irradiation is an exposure process of the product to controlled sources of gamma radiation with the intention to destroy pathogens and to extend the shelf life. Minimally processed cauliflower (Brassica oleraceae) exposed to low dose of gamma radiation does not show any change in sensory attributes. The aim of this study was to analyze the effects of the low doses of gamma radiation on sensorial aspects like appearance, texture and flavor of minimally processed cauliflower. (author)

  19. Factors Affecting Adoption of Recommended Cauliflower Production Technology in Nepal

    Directory of Open Access Journals (Sweden)

    Pankaj Raj Dhital

    2016-05-01

    Full Text Available Binary logit regression model of econometrics was used to identify the factors affecting adoption of recommended agricultural technology by the commercial farmers of Nepal. A survey was carried out in 2012 in 120 households from Kavre district, Nepal. The objective was to appraise factors affecting adoption of recommended technology of cauliflower, finding out the level of adoption, identifying the constraints of cauliflower cultivation, assessing the perceived level of satisfaction and studying the relationship of certain selected variables on the adoption. Education, Occupation, contact with Personal Localite sources of information, Group membership and Experience were the most influencing factors for adoption of recommended technology. Though, other factors were not strong enough to contribute significantly but indirectly influence the adoption decision of farmers as combined effects. Occupation was found as negatively associated. Landholding size was strongly and positively influencing among the non significant factors. The level of satisfaction and the constraints of cauliflower production were also identified. Transfer of technology will be effective if and only if the client adopts the technology. For an effective transfer of technology, it is better to go for activities for the welfare of the socioeconomic factors of the farmers.

  20. Enhanced resistance to Spodoptera litura in endophyte infected cauliflower plants.

    Science.gov (United States)

    Thakur, Abhinay; Kaur, Sanehdeep; Kaur, Amarjeet; Singh, Varinder

    2013-04-01

    Endophytic fungi, which live within host plant tissues without causing any visible symptom of disease, are important mediators of plant-herbivore interactions. These endophytes enhance resistance of host plant against insect herbivores mainly by productions of various alkaloid based defensive compounds in the plant tissue or through alterations of plant nutritional quality. Two endophytic fungi, i.e., Nigrospora sp. and Cladosporium sp., were isolated from Tinospora cordifolia (Thunb.) Miers, a traditional indian medicinal plant. Cauliflower (Brassica oleracea L.) plants were inoculated with these two endophytic fungi. The effect of endophyte infected and uninfected cauliflower plants were measured on the survival and development of Spodoptera litura (Fab.), a polyphagous pest. Endophyte infected cauliflower plants showed resistance to S. litura in the form of significant increase in larval and pupal mortality in both the fungi. Inhibitory effects of endophytic fungi also were observed on adult emergence, longevity, reproductive potential, as well as hatchability of eggs. Thus, it is concluded that antibiosis to S. litura could be imparted by artificial inoculation of endophytes and this could be used to develop alternative ecologically safe control strategies.

  1. In vitro propagation of cauliflower using curd microexplants.

    Science.gov (United States)

    Kieffer, Martin; Fuller, Michael P

    2013-01-01

    Cauliflower (Brassica oleracea var. botrytis) with its distinctive pre-inflorescence or curd is a remarkable member of the Brassica cabbage group. During curd development, intense and repetitive branching leads to a spectacular increase in size and the accumulation of millions of meristems at its surface. Although destined to produce flowers, most of these meristems are capable of regenerating vegetative shoots in vitro, making curd fragments an excellent material for the micropropagation of cauliflower. Most reported methods using these tissues were devised for the production of small clones of vitroplants as the true potential of curd fragments remained highly underestimated. We describe a technique exploiting fully this abundance of meristems and optimized for the large-scale in vitro propagation of cauliflower. The curd surface is first mechanically disrupted to break up the meristem clusters and generate microexplants carrying 1-3 meristems. These microexplants are then cultured at high density 1:100 (v:v) (microexplants:medium) in liquid medium containing Kinetin and indole-3-butyric acid (IBA) and produce thousands of microshoots in 12 days. After selecting the best quality microshoots on a sucrose pad, they are transferred en masse to a rooting medium supplemented with IBA. Four weeks later, rooted microshoots are carefully acclimatized before transfer to the field. This semi-automated protocol is rapid, cost effective, and well adapted for the production of clones of several thousands of plants by a single worker in a short space of time.

  2. Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana

    NARCIS (Netherlands)

    Ji, X.

    2014-01-01

    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana.

    I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and

  3. Decontamination of chlorantraniliprole residues on cabbage and cauliflower through household processing methods.

    Science.gov (United States)

    Kar, Abhijit; Mandal, Kousik; Singh, Balwinder

    2012-04-01

    A supervised field trial was conducted to study the residues of chlorantraniliprole on cabbage and cauliflower. Three applications of chlorantraniliprole at 10 days interval were made @ 9.25 and 18.50 g a.i. ha(-1). The samples of marketable size heads and curds of cabbage and cauliflower were collected at 0 and 1 day after the last application. QuEChERS sample preparation was used for the determination of chlorantraniliprole residues on cabbage heads and cauliflower curds. The residues of chlorantraniliprole were quantified by high performance liquid chromatography (HPLC) with photo diode array (PDA) detector and confirmed by high performance thin layer chromatography (HPTLC). Washing of cabbage and cauliflower with tap water removed about 17%-40% of chlorantraniliprole residues. However, boiling removed 100% of chlorantraniliprole residues on cabbage and cauliflower in both the cases.

  4. Phosphate fertilization on production and quality of cauliflower seeds

    Directory of Open Access Journals (Sweden)

    Antonio Ismael Inácio Cardoso

    2016-08-01

    Full Text Available ABSTRACT: Due to the scarcity of information related to the effect of fertilizers on production and quality of vegetable seeds, mainly on species which present an increase in the cycle, like cauliflower, more studies are necessary about the influence of nutrients rates which provide high production of high-quality seeds. This research aimed to evaluate the influence of rates of phosphorus (P on the production and quality of cauliflower seeds. Five rates of phosphorus were studied (0, 300, 600, 900 and 1200kg ha-1 of P2O5, in a randomized complete block design, with four replications. Production and quality (weight of a thousand seeds, germination test, first count of germination test and emergence in substrate of the seeds and soil chemical characteristics were evaluated. The higher the rate of phosphorus, the higher P content in the soil and values of sum of bases, cation exchange capacity and saturation of bases were observed at the end of the cycle. Seed quality was not affected by P fertilization, with the exception of the weight of a thousand seeds which was adjusted to a linear model. For seed production quadratic effect was obtained. The highest weight of seeds per plant was estimated for the rate of 862kg ha-1 of P2O5.

  5. How-To-Do-It: Using Cauliflower to Demonstrate Plant Tissue Culture.

    Science.gov (United States)

    Haldeman, Janice H.; Ellis, Jane P.

    1988-01-01

    Presents techniques used for disinfestation of plant material, preparation of equipment and media, and laboratory procedures for tissue culture using cauliflower. Details methods for preparing solutions and plant propagation by cloning. (CW)

  6. FERTILISATION IMPACT ON THE CONTENT OF SELECTED BIOACTIVE COMPOUNDS IN CAULIFLOWER

    Directory of Open Access Journals (Sweden)

    Anton UHER

    2013-03-01

    Full Text Available Nitrogen and sulphur fertilization positively affected on crop yields and bioactive compounds (vitamin C, E1 and -carotene content in cauliflower edible heads. Applying fertilization doses of 250 kg N.ha-1 and 60 kg S.ha-1 compared to the control improved cauliflower harvest by 15,2 t.ha-1. Increased fertilization doses of nitrogen and sulphur significantly increased vitamin C and -carotene content in the cauliflower. High significant difference in vitamin C level was found comparing the control variant and variant of nitrogen fertilization at the level of 200 kg N.ha-1. In percentage terms this is an increase in vitamin C level by 22,4%. Fertilization with increased doses of nitrogen and sulphur affected significantly the amount of -carotene compared to unfertilized variant. Increased doses of N and S did not respond adequately to vitamin E1 content in cauliflower.

  7. A Single Swede Midge (Diptera: Cecidomyiidae) Larva Can Render Cauliflower Unmarketable.

    Science.gov (United States)

    Stratton, Chase A; Hodgdon, Elisabeth A; Zuckerman, Samuel G; Shelton, Anthony M; Chen, Yolanda H

    2018-05-01

    Swede midge, Contarinia nasturtii Kieffer (Diptera: Cecidomyiidae), is an invasive pest causing significant damage on Brassica crops in the Northeastern United States and Eastern Canada. Heading brassicas, like cauliflower, appear to be particularly susceptible. Swede midge is difficult to control because larvae feed concealed inside meristematic tissues of the plant. In order to develop damage and marketability thresholds necessary for integrated pest management, it is important to determine how many larvae render plants unmarketable and whether the timing of infestation affects the severity of damage. We manipulated larval density (0, 1, 3, 5, 10, or 20) per plant and the timing of infestation (30, 55, and 80 d after seeding) on cauliflower in the lab and field to answer the following questions: 1) What is the swede midge damage threshold? 2) How many swede midge larvae can render cauliflower crowns unmarketable? and 3) Does the age of cauliflower at infestation influence the severity of damage and marketability? We found that even a single larva can cause mild twisting and scarring in the crown rendering cauliflower unmarketable 52% of the time, with more larvae causing more severe damage and additional losses, regardless of cauliflower age at infestation.

  8. Genetic analisys of a cross of gaillon (Brassica oleracea var. alboglabra) with cauliflower (B.oleracea var. botrytis)

    OpenAIRE

    Spini, Vanessa B.M.G.; Kerr, Warwick Estevam

    2000-01-01

    The cauliflower (Brassica oleracea var. botrytis) is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra), produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these c...

  9. Phenological and phytochemical changes correlate with differential interactions of Verticillium dahliae with broccoli and cauliflower.

    Science.gov (United States)

    Njoroge, S M C; Vallad, G E; Park, S-Y; Kang, S; Koike, S T; Bolda, M; Burman, P; Polonik, W; Subbarao, K V

    2011-05-01

    Cauliflower (Brassica oleracea var. botrytis subvar. cauliflora) is susceptible to wilt caused by Verticillium dahliae but broccoli (B. oleracea var. italica subvar. cyamosa) is not. Infection of broccoli and cauliflower by a green fluorescent protein-expressing isolate of V. dahliae was examined using epifluorescence and confocal laser-scanning microscopy to follow infection and colonization in relation to plant phenology. Plant glucosinolate, phenolic, and lignin contents were also assayed at 0, 4, 14, and 28 days postinoculation. V. dahliae consistently infected and colonized the vascular tissues of all cauliflower plants regardless of age at inoculation, with the pathogen ultimately appearing in the developing seed; however, colonization decreased with plant age. In broccoli, V. dahliae infected and colonized root and stem xylem tissues of plants inoculated at 1, 2, or 3 weeks postemergence. However, V. dahliae colonized only the root xylem and the epidermal and cortical tissues of broccoli plants inoculated at 4, 5, and 6 weeks postemergence. The frequency of reisolation of V. dahliae from the stems (4 to 22%) and roots (10 to 40%) of mature broccoli plants was lower than for cauliflower stems (25 to 64%) and roots (31 to 71%). The mean level of aliphatic glucosinolates in broccoli roots was 6.18 times higher than in the shoots and did not vary with age, whereas it was 3.65 times higher in cauliflower shoots than in the roots and there was a proportional increase with age. Indole glucosinolate content was identical in both cauliflower and broccoli, and both indole and aromatic glucosinolates did not vary with plant age in either crop. Qualitative differences in characterized glucosinolates were observed between broccoli and cauliflower but no differences were observed between inoculated and noninoculated plants for either broccoli or cauliflower. However, the phenolic and lignin contents were significantly higher in broccoli following inoculation than in

  10. Antimicrobial potential of cauliflower, broccoli, and okara byproducts against foodborne bacteria.

    Science.gov (United States)

    Sanz-Puig, Maria; Pina-Pérez, Maria C; Criado, Maria Nieves; Rodrigo, Dolores; Martínez-López, Antonio

    2015-01-01

    The antimicrobial potential of cauliflower, broccoli, and okara byproducts was assessed against Gram-positive and Gram-negative bacteria. Salmonella enterica serovar Typhimurium, Escherichia coli O157:H7, Bacillus cereus, and Listeria monocytogenes serovar 4b growth behavior was assessed under exposure to 5% vegetable byproducts added to the reference medium, buffered peptone water (0.1% [wt/vol]), at 37°C. Although the byproducts were not effective against L. monocytogenes, they were bactericidal against Salmonella Typhimurium, E. coli O157:H7, and B. cereus. The most promising results were achieved with the cauliflower-Salmonella Typhimurium combination, because the bacterial population was reduced by 3.11 log10 cycles after 10 h of incubation at 37°C as a result of 5% cauliflower addition. Further studies were carried out for this combination, at different cauliflower concentrations (0, 0.5, 1, 5, 10, and 15%) and at temperatures in the range of 5-37°C. The greatest inactivation level (6.11 log10 cycles) was achieved at refrigeration temperature (5°C) using 15% cauliflower addition. Both temperature and cauliflower concentration significantly (p≤0.05) influenced the Salmonella Typhimurium inactivation level. The kinetic parameters were adjusted to mathematical models. The modified Gompertz mathematical model provided an accurate fit (root-mean-square error (RMSE) [0.00009-0.21] and adjusted-R(2) [0.81-0.99]) to experimental Salmonella Typhimurium survival curves describing inactivation kinetics of the pathogen to the antimicrobial effect of cauliflower byproduct.

  11. Cauliflower-like CuI nanostructures: Green synthesis and applications as catalyst and adsorbent

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Yi [College of Chemistry and Environmental Science, Henan Normal University, Xinxiang, Henan 453007 (China); Gao Shuyan, E-mail: shuyangao@htu.cn [College of Chemistry and Environmental Science, Henan Normal University, Xinxiang, Henan 453007 (China); Li Zhengdao; Jia Xiaoxia; Chen Yanli [College of Chemistry and Environmental Science, Henan Normal University, Xinxiang, Henan 453007 (China)

    2011-08-15

    Highlights: > In this study we report a green, environment-friendly, efficient, and direct one-step process for the preparation of CuI cauliflower. > The as-formed CuI cauliflower shows excellent catalytic activity for coupling reaction between benzylamine and iodobenzene. > The cauliflower-like CuI nanostructures have been successfully demonstrated as adsorbent for Cd (II) with high removal capacity. > To the best of our knowledge, it is the first report that nanostructured CuI acts as catalyst for coupling reaction and adsorbent for heavy metal ion. > It is also a good example for the organic combination of green chemistry and functional materials. - Abstract: Cauliflower-like CuI nanostructures is realized by an ampicillin-assisted clean, nontoxic, environmentally friendly synthesis strategy at room temperature. The morphology, composition, and phase structure of as-prepared powders were characterized by field emission scanning electron microscopy, X-ray diffraction, and X-ray photoelectron spectroscopy. The results show that ampicillin plays dual roles, reducing and morphology-directing agents, in the formation of the products. A possible growth mechanism of the cauliflower-like CuI nanostructures is tentatively proposed. The preliminary investigations show that the cauliflower-like CuI structure not only exhibits high catalytic activity with respect to coupling reaction between benzylamine and iodobenzene but also possesses high removal capacity for Cd (II), which may be ascribed to the high specific surface area of the special configuration. To the best of our knowledge, it is the first report that cauliflower-like CuI nanoparticles act as catalyst for coupling reaction and adsorbent for heavy metal ion.

  12. Cauliflower-like CuI nanostructures: Green synthesis and applications as catalyst and adsorbent

    International Nuclear Information System (INIS)

    Jiang Yi; Gao Shuyan; Li Zhengdao; Jia Xiaoxia; Chen Yanli

    2011-01-01

    Highlights: → In this study we report a green, environment-friendly, efficient, and direct one-step process for the preparation of CuI cauliflower. → The as-formed CuI cauliflower shows excellent catalytic activity for coupling reaction between benzylamine and iodobenzene. → The cauliflower-like CuI nanostructures have been successfully demonstrated as adsorbent for Cd (II) with high removal capacity. → To the best of our knowledge, it is the first report that nanostructured CuI acts as catalyst for coupling reaction and adsorbent for heavy metal ion. → It is also a good example for the organic combination of green chemistry and functional materials. - Abstract: Cauliflower-like CuI nanostructures is realized by an ampicillin-assisted clean, nontoxic, environmentally friendly synthesis strategy at room temperature. The morphology, composition, and phase structure of as-prepared powders were characterized by field emission scanning electron microscopy, X-ray diffraction, and X-ray photoelectron spectroscopy. The results show that ampicillin plays dual roles, reducing and morphology-directing agents, in the formation of the products. A possible growth mechanism of the cauliflower-like CuI nanostructures is tentatively proposed. The preliminary investigations show that the cauliflower-like CuI structure not only exhibits high catalytic activity with respect to coupling reaction between benzylamine and iodobenzene but also possesses high removal capacity for Cd (II), which may be ascribed to the high specific surface area of the special configuration. To the best of our knowledge, it is the first report that cauliflower-like CuI nanoparticles act as catalyst for coupling reaction and adsorbent for heavy metal ion.

  13. Nitrogen utilisation of lowland cauliflower grown on coconut coir dust

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, Asiah

    2004-07-01

    Strong wind, high rainfall, the spread of diseases during rainy season and pests problems in open field agriculture have led to the current trend in growing vegetables under protected environment. The occurrence of soil borne disease, and limited suitable land for agriculture are some of the reasons to look for alternative media such as coconut coir dust. The basic properties of coconut coir dust as a soil less growing medium and the utilisation of nitrogen (n) fertiliser for the lowland cauliflower grown in them have not been thoroughly investigated and are therefore not well understood. This study has been conducted by the need to provide a basis for determining optimal levels/ concentration and forms of nitrogen supply, and by the need to minimize environmental consequences of lowland cauliflower production. It focuses on the effects of N supply in terms of different levels of N and ionic N forms in the nutrient solution, on the growth, development and N utilisation of cauliflower grown in coconut coir dust under greenhouse condition in the lowlands. Based on the plant growth parameters studied coconut coir dust was found to be more suitable than oil palm empty fruit bunch as a growing medium. From the growth and development study using coconut coir dust, it can be deduced that the N requirement by the plant is less at later growth stage regardless of low or high level of N in the nutrient solution. However, low level of N of 50 mg l{sup -1} was found to be inadequate for plant growth and curd yield. The N concentration levels of 200 mg l{sup -1} in the nutrient solution optimised both the vegetative and curd production. A somewhat lower level of N (170 mg l{sup -1}) produced curd weight not significantly different from N level of 200 mg l{sup -1}. The plant growth and curd yield was reduced by about 29.0 % at 400 mg N l{sup -1}. The N level of 400 mg l{sup -1} in the nutrient solution may be in excess to that actually required by the plant, resulting in a high

  14. Nitrogen utilisation of lowland cauliflower grown on coconut coir dust

    International Nuclear Information System (INIS)

    Asiah Ahmad

    2004-01-01

    Strong wind, high rainfall, the spread of diseases during rainy season and pests problems in open field agriculture have led to the current trend in growing vegetables under protected environment. The occurrence of soil borne disease, and limited suitable land for agriculture are some of the reasons to look for alternative media such as coconut coir dust. The basic properties of coconut coir dust as a soil less growing medium and the utilisation of nitrogen (n) fertiliser for the lowland cauliflower grown in them have not been thoroughly investigated and are therefore not well understood. This study has been conducted by the need to provide a basis for determining optimal levels/ concentration and forms of nitrogen supply, and by the need to minimize environmental consequences of lowland cauliflower production. It focuses on the effects of N supply in terms of different levels of N and ionic N forms in the nutrient solution, on the growth, development and N utilisation of cauliflower grown in coconut coir dust under greenhouse condition in the lowlands. Based on the plant growth parameters studied coconut coir dust was found to be more suitable than oil palm empty fruit bunch as a growing medium. From the growth and development study using coconut coir dust, it can be deduced that the N requirement by the plant is less at later growth stage regardless of low or high level of N in the nutrient solution. However, low level of N of 50 mg l -1 was found to be inadequate for plant growth and curd yield. The N concentration levels of 200 mg l -1 in the nutrient solution optimised both the vegetative and curd production. A somewhat lower level of N (170 mg l -1 ) produced curd weight not significantly different from N level of 200 mg l -1 . The plant growth and curd yield was reduced by about 29.0 % at 400 mg N l -1 . The N level of 400 mg l -1 in the nutrient solution may be in excess to that actually required by the plant, resulting in a high unused N nutrient

  15. Reaction of Cauliflower Genotypes to Black Rot of Crucifers

    Directory of Open Access Journals (Sweden)

    Lincon Rafael da Silva

    2015-06-01

    Full Text Available This study aimed to evaluate six cauliflower genotypes regarding their resistance to black rot and their production performance. To do so, it was conducted two field experiments in Ipameri, Goiás, Brazil, in 2012 and 2013. It was used a randomized block design, with four replications (total of 24 plots. Each plot consisted of three planting lines 2.5 m long (six plants/line, spaced 1.0 m apart, for a total area of 7.5 m². Evaluations of black rot severity were performed at 45 days after transplanting, this is, 75 days after sowing (DAS, and yield evaluations at 90 to 105 DAS. The Verona 184 genotype was the most resistant to black rot, showing 1.87 and 2.25% of leaf area covered by black rot symptom (LACBRS in 2012 and 2013. However, it was not among the most productive materials. The yield of the genotypes varied between 15.14 and 25.83 t/ha in both years, Lisvera F1 (21.78 and 24.60 t/ha and Cindy (19.95 and 23.56 t/ha being the most productive. However, Lisvera F1 showed 6.37 and 9.37% of LACBRS and Cindy showed 14.25 and 14.87% of LACBRS in 2012 and 2013, being both considered as tolerant to black rot.

  16. Metabolite profiling approach reveals the interface of primary and secondary metabolism in colored cauliflowers (Brassica oleracea L. ssp. botrytis).

    Science.gov (United States)

    Park, Soo-Yun; Lim, Sun-Hyung; Ha, Sun-Hwa; Yeo, Yunsoo; Park, Woo Tae; Kwon, Do Yeon; Park, Sang Un; Kim, Jae Kwang

    2013-07-17

    In the present study, carotenoids, anthocyanins, and phenolic acids of cauliflowers ( Brassica oleracea L. ssp. botrytis) with various colored florets (white, yellow, green, and purple) were characterized to determine their phytochemical diversity. Additionally, 48 metabolites comprising amino acids, organic acids, sugars, and sugar alcohols were identified using gas chromatography-time-of-flight mass spectrometry (GC-TOFMS). Carotenoid content was considerably higher in green cauliflower; anthocyanins were detected only in purple cauliflower. Phenolic acids were higher in both green and purple cauliflower. Results of partial least-squares discriminant, Pearson correlation, and hierarchical clustering analyses showed that green cauliflower is distinct on the basis of the high levels of amino acids and clusters derived from common or closely related biochemical pathways. These results suggest that GC-TOFMS-based metabolite profiling, combined with chemometrics, is a useful tool for determining phenotypic variation and identifying metabolic networks connecting primary and secondary metabolism.

  17. Variation in biological properties of cauliflower mosaic virus clones.

    Science.gov (United States)

    al-Kaff, N; Covey, S N

    1994-11-01

    Infectious clones were prepared from virion DNA of three cauliflower mosaic virus (CaMV) isolates, 11/3, Xinjiang (XJ), and Aust, to investigate pathogenic variation in virus populations. Of 10 infectious clones obtained for isolate 11/3, four pathotypes were identified, each producing symptoms in turnip that differed from those of the 11/3 wild-type. Virus from two clonal groups of 11/3 was transmissible by aphids whereas that from two others was not. Of the five infectious clones obtained from isolate XJ, two groups were identified, one of which differed symptomatically from the wild-type. Only one infectious clone was obtained from isolate Aust and this had properties similar to the wild-type. Restriction enzyme polymorphisms were found in some clonal groups and these correlated with symptoms. Other groups with different pathogenic properties could not be distinguished apart by restriction site polymorphisms. Further variation was observed in the nucleotide sequences of gene II (coding for aphid transmission factor) from these viruses as compared with other CaMV isolates. In the aphid non-transmissible clones of isolate 11/3, one had a Gly to Arg mutation in gene II similar to that of other non-deleted non-transmissible CaMV isolates. The second had a 322 bp deletion at the site of a small direct repeat similar to that of isolate CM4-184 although occurring in a different position. The gene II deletion of isolate 11/3 produced a frame-shift that separated genes II and III by 60 bp. Most CaMV clones studied remained biologically stable producing similar symptoms during subsequent passages. However, one clone (11/3-7) produced two new biotypes during its first passage suggesting that it was relatively unstable. Our results show that wild-type populations of CaMV contain a range of infectious genome variants with contrasting biological properties and differing stability. We suggest that a variety of significant viral phenotypic changes can occur during each

  18. Determination of Sodium, Potassium, Magnesium, and Calcium Minerals Level in Fresh and Boiled Broccoli and Cauliflower by Atomic Absorption Spectrometry

    Science.gov (United States)

    Nerdy

    2018-01-01

    Vegetables from the cabbage family vegetables consumed by many people, which is known healthful, by eaten raw, boiled, or cooked (stir fry or soup). Vegetables like broccoli and cauliflower contain vitamins, minerals, and fiber. This study aims to determine the decrease percentage of sodium, potassium, magnesium, and calcium minerals level caused by boiled broccoli and cauliflower by atomic absorption spectrometry. Boiled broccoli and cauliflower prepared by given boiled treatment in boiling water for 3 minutes. Fresh and boiled broccoli and cauliflower carried out dry destruction, followed by quantitative analysis of sodium, potassium, magnesium, and calcium minerals respectively at a wavelength of 589.0 nm; 766.5 nm; 285.2 nm; and 422.7 nm, using atomic absorption spectrometry methods. After the determination of the sodium, potassium, magnesium, and calcium minerals level followed by validation of analytical methods with accuracy, precision, linearity, range, limit of detection (LOD), and limit of quantitation (LOQ) parameters. Research results show a decrease in the sodium, potassium, magnesium, and calcium minerals level in boiled broccoli and cauliflower compared with fresh broccoli and cauliflower. Validation of analytical methods gives results that spectrometry methods used for determining sodium, potassium, magnesium, and calcium minerals level are valid. It concluded that the boiled gives the effect of decreasing the minerals level significantly in broccoli and cauliflower.

  19. The effect of nitrogen and sulphur fertilization on the yield and content of sulforaphane and nitrates in cauliflower

    Directory of Open Access Journals (Sweden)

    Nina Čekey

    2011-01-01

    Full Text Available In the field experiment with cauliflower, we investigated the effect of four different variants of nitrogen and suplhur fertilization on quantity and quality of cauliflower in the term of sulforaphane content and nitrate accumulation. The influence of fertilization was statistically significant between control variant and fertilization variants and in both experimental years within all parameters of cauliflower yield. The highest yield of cauliflower was reached at the variant 4 when it was fertilized on the level of nutrients N:S = 250:60 kg.ha−1. The increase of yield against control variant represented value 26.6%. The applied fertilization positively affected on the accumulation sulforaphane in the cauliflower. Its highest content was determined at the variant 4 (N:S = 250:60 kg.ha−1. In comparison with control variant, the sulforaphane content was increased about 18.4%. On the other side, applied nutrition resulted in increased accumulation of nitrates in the cauliflower. The most increase of nitrate content, compared to the control variant, was also ascertained at the variant 4 (about 31.4%.The gathered data point towards to the possibility and way how we could effect on the increased accumulation of sulforaphane in cauliflower florets. This sphere of fertilization effect on the sulforaphane content is not sufficiently explored well. Our aim is to continue in this research subject and to find way how to cultivate vegetables with higher content of health-promoting compounds.

  20. Rooting pattern and nitrogen uptake of three cauliflower (Brassica oleracea var. botrytis) F1-hbrids

    NARCIS (Netherlands)

    Rather, K.; Schenk, M.K.; Everaarts, A.P.; Vethman, S.

    2000-01-01

    In a two-year field trial at the sites Ruthe (Germany, loess soil, Orthic Luvisol) and Schermer (The Netherlands, marine clay soil, Eutric Fluvisol) the cauliflower F1-hybrids Marine, Lindurian and Linford were compared in their efficiency of N use from limiting and optimum supplies of N. Limiting N

  1. Response of yield and quality of cauliflower varieties (Brassica oleracea var. botrytis) to nitrogen supply

    NARCIS (Netherlands)

    Rather, K.; Schenk, M.K.; Everaarts, A.P.; Vethman, S.

    1999-01-01

    The fertilizer nitrogen (N) inputs to some vegetables such as cauliflower (Brassica oleracea var. botrytis) can be large. One approach to decreasing the input of N may be to select for cultivars efficient in the use of nitrogen. The objective of this investigation was to identify a cultivar which

  2. The purple cauliflower arises from activation of a MYB transcription factor.

    Science.gov (United States)

    Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L; Li, Li

    2010-11-01

    Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3'-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal.

  3. Effects of salt stress imposed during two growth phases on cauliflower production and quality.

    Science.gov (United States)

    Giuffrida, Francesco; Cassaniti, Carla; Malvuccio, Angelo; Leonardi, Cherubino

    2017-03-01

    Cultivation of cauliflower is diffused in Mediterranean areas where water salinity results in the need to identify alternative irrigation sources or management strategies. Using saline water during two growth phases (from transplanting to visible appearance of inflorescence or from appearance of inflorescence to head harvest), the present study aimed to identify the growth period that is more suitable for irrigation with low quality water in relation to cauliflower production and quality. Salinity affected cauliflower growth mainly when imposed in the first growth phase. The growth reduction depended mainly on ion-specific effects, although slight nutrient imbalances as a result of Na + and Cl - antagonisms were observed. The use of non-saline water in the first or second growth period reduced both the osmotic and toxic effects of salinity. When salinity was applied during inflorescence growth, yield was reduced because of a restriction of water accumulation in the head. The results of the present study demonstrate the possibility of producing marketable cauliflower heads under conditions of salinity by timing the application of the best quality water during the first growth phase to improve fruit quality and during the second phase to reduce the negative effects of salinity on yield. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  4. The Purple Cauliflower Arises from Activation of a MYB Transcription Factor1[W][OA

    Science.gov (United States)

    Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L.; Li, Li

    2010-01-01

    Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3’-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal. PMID:20855520

  5. Bioactive compounds and antioxidant activity of fresh and processed white cauliflower.

    Science.gov (United States)

    Ahmed, Fouad A; Ali, Rehab F M

    2013-01-01

    Brassica species are very rich in health-promoting phytochemicals, including phenolic compounds, vitamin C, and minerals. The objective of this study was to investigate the effect of different blanching (i.e., water and steam) and cooking (i.e., water boiling, steam boiling, microwaving, and stir-frying) methods on the nutrient components, phytochemical contents (i.e., polyphenols, carotenoids, flavonoid, and ascorbic acid), antioxidant activity measured by DPPH assay, and phenolic profiles of white cauliflower. Results showed that water boiling and water blanching processes had a great effect on the nutrient components and caused significant losses of dry matter, protein, and mineral and phytochemical contents. However, steam treatments (blanching and cooking), stir-frying, and microwaving presented the lowest reductions. Methanolic extract of fresh cauliflower had significantly the highest antioxidant activity (68.91%) followed by the extracts of steam-blanched, steam-boiled, stir-fried, and microwaved cauliflower 61.83%, 59.15%, 58.93%, and 58.24%, respectively. HPLC analysis revealed that the predominant phenolics of raw cauliflower were protocatechuic acid (192.45), quercetin (202.4), pyrogallol (18.9), vanillic acid (11.90), coumaric acid (6.94), and kaempferol (25.91) mg/100 g DW, respectively.

  6. The effect of nitrogen on phosphorus and potassium removal by cauliflower

    NARCIS (Netherlands)

    Everaarts, A.P.; Moel, de C.P.

    2009-01-01

    The effect of the amount of nitrogen applied and of the method of application on the amounts of phosphorus and potassium removed from the field with the product in cauliflower cultivation was studied in three field experiments. Band placement or split application of nitrogen did not influence

  7. The cauliflower Orange gene enhances petiole elongation by suppressing expression of eukaryotic release factor 1.

    Science.gov (United States)

    Zhou, Xiangjun; Sun, Tian-Hu; Wang, Ning; Ling, Hong-Qing; Lu, Shan; Li, Li

    2011-04-01

    The cauliflower (Brassica oleracea var. botrytis) Orange (Or) gene affects plant growth and development in addition to conferring β-carotene accumulation. This study was undertaken to investigate the molecular basis for the effects of the Or gene mutation in on plant growth. The OR protein was found to interact with cauliflower and Arabidopsis eukaryotic release factor 1-2 (eRF1-2), a member of the eRF1 family, by yeast two-hybrid analysis and by bimolecular fluorescence complementation (BiFC) assay. Concomitantly, the Or mutant showed reduced expression of the BoeRF1 family genes. Transgenic cauliflower plants with suppressed expression of BoeRF1-2 and BoeRF1-3 were generated by RNA interference. Like the Or mutant, the BoeRF1 RNAi lines showed increased elongation of the leaf petiole. This long-petiole phenotype was largely caused by enhanced cell elongation, which resulted from increased cell length and elevated expression of genes involved in cell-wall loosening. These findings demonstrate that the cauliflower Or gene controls petiole elongation by suppressing the expression of eRF1 genes, and provide new insights into the molecular mechanism of leaf petiole regulation. © 2010 The Authors. New Phytologist © 2010 New Phytologist Trust.

  8. A Kunitz-type cysteine protease inhibitor from cauliflower and Arabidopsis

    DEFF Research Database (Denmark)

    Halls, C.E.; Rogers, S. W.; Ouffattole, M.

    2006-01-01

    proaleurain maturation protease and of papain when assayed at pH 4.5 but not at pH 6.3. In a pull-down assay, the inhibitor bound tightly to papain, but only weakly to the aspartate protease pepsin. When the cauliflower protease inhibitor was transiently expressed in tobacco suspension culture protoplasts...

  9. Impact of nutrition on the quality and quantity of cauliflower florets

    Directory of Open Access Journals (Sweden)

    Anton Uher

    2017-01-01

    Full Text Available Cauliflower (Brassica oleracea var botrytis as a member of the family Brassicaceae belongs to worldwide popular vegetable with using in all kinds of cuisine. The aim of the work was to find out the effects of nutrition and fertilization (in dependence on the amount of nitrogen on the yield of florets as well as on selected qualitative characteristics - vitamin C, nitrate and sulforaphane content. Analyses were done by the help of liquid chromatograph (HPLC with UV detector for separation. The trial was led in Nitra, Slovakia, in 2014 - 2015. Cauliflower variety CHARLOT F1 was selected for testing. Four variants have been examined in the trial: control (without application of fertilizers, N150S80 (application of nitrogen and sulphur at the supply level N: S = 150:80 kg.ha-1, N200S80 and N250S80. Application of nitrogen led to significant increasing of the yields of primary cauliflower florets in case of the dose 200 and 250 kg N.ha-1 (increasing about 87% and 134% compared to control. Applied nitrogen nutrition caused significant nitrates increasing in monitored cauliflower florets in order of the variants: 1 (control <2 (N = 150 kg.ha-1 <3 (N = 200 kg.ha-1 <4 (N = 250 kg.ha-1, but the highest dosage of nitrates is still under the permissible standard according to Food codex of Slovak republic (700 mg.kg-1 of FM. The influence of differentiated nutrition on sulforaphane content was statistically confirmed in case of the 4th variant in comparison to control, where the decrease about 40% was noticed. Influence of nitrogen fertilizing according to used methodology on vitamin C (AA content was not statistically confirmed. The nutrient concentration in the curds and stalks of cauliflower varied insignificantly with levels of nitrogen applied. Normal 0 21 false false false EN-GB X-NONE X-NONE

  10. Determination of residues of fipronil and its metabolites in cauliflower by using gas chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Duhan, Anil; Kumari, Beena; Duhan, Saroj

    2015-02-01

    Fipronil is a widely used insecticide with a well-described toxicological pathway. Recently it has been widely used in India to control vegetable pests. The present study has been carried out to observe the persistence pattern of fipronil and its metabolites-fipronil sulfone, fipronil sulfide, fipronil desulfinyl in cauliflower and soil so as to know the potential risk if any to consumers and environment. Fipronil was applied @ 56 g a.i. ha(-1). Samples of cauliflower and soil were collected periodically; processed using QuEChERS method and analyzed by GCMS/MS. In cauliflower, residues of fipronil and its metabolites reached below detectable level before 30 days of application whereas in soil about 95% of total fipronil residues got degraded within same time period. Washing and washing followed by cooking or boiling was found effective in reducing residues. A safe waiting period of 15 days is therefore suggested before consuming cauliflower.

  11. One-pot solvothermal route to self-assembly of cauliflower-shaped CdS microspheres

    Energy Technology Data Exchange (ETDEWEB)

    Ge Ming [Tianjin Key Laboratory of Environmental Remediation and Pollution Control, Nankai University, Tianjin 300071 (China); Cui Yao [Institute of New Energy Material Chemistry, and Key Laboratory of Advanced Energy Materials Chemistry (Ministry of Education), Nankai University, Tianjin 300071 (China); Liu Lu, E-mail: liul@nankai.edu.cn [Tianjin Key Laboratory of Environmental Remediation and Pollution Control, Nankai University, Tianjin 300071 (China); Zhou Zhen, E-mail: zhouzhen@nankai.edu.cn [Institute of New Energy Material Chemistry, and Key Laboratory of Advanced Energy Materials Chemistry (Ministry of Education), Nankai University, Tianjin 300071 (China)

    2011-05-15

    Nearly monodispersed cauliflower-shaped CdS microspheres were prepared through a simple one-step solvothermal route on a large scale by employing sodium dodecyl sulfate (SDS) as the surfactant. Images by field emission scanning electron microscope (FESEM) and transmission electron microscope (TEM) indicate that cauliflower-shaped CdS microspheres with diameters in the range from 1.3 to 4.5 {mu}m are assembled by nanoparticles with an average diameter of approximately 30 nm. The possible formation mechanism of the cauliflower-shaped CdS microspheres was also proposed. The photovoltaic activity of cauliflower-shaped CdS architectures has been investigated, indicating that the as-obtained CdS microspheres exhibited higher photovoltaic performance in comparison with CdS nanoparticles.

  12. Self-assembly of Fe3O4 nanocrystal-clusters into cauliflower-like architectures: Synthesis and characterization

    International Nuclear Information System (INIS)

    Zhu Luping; Liao Guihong; Bing Naici; Wang Linlin; Xie Hongyong

    2011-01-01

    Large-scale cauliflower-like Fe 3 O 4 architectures consist of well-assembled magnetite nanocrystal clusters have been synthesized by a simple solvothermal process. The as-synthesized Fe 3 O 4 samples were characterized by XRD, XPS, FT-IR, SEM, TEM, etc. The results show that the samples exhibit cauliflower-like hierarchical microstructures. The influences of synthesis parameters on the morphology of the samples were experimentally investigated. Magnetic properties of the Fe 3 O 4 cauliflower-like hierarchical microstructures have been detected by VSM at room temperature, showing a relatively low saturation magnetization of 65 emu/g and an enhanced coercive force of 247 Oe. - Graphical Abstract: Cauliflower-like Fe 3 O 4 architectures consist of well-assembled magnetite nanocrystal clusters have been synthesized by a simple solvothermal process, using FeCl 3 .6H 2 O and EDA as the starting materials. Highlights: → Cauliflower-like Fe 3 O 4 architectures were successfully prepared by a simple solvothermal route. → The cauliflower-like Fe 3 O 4 architectures have a size in the range of 200-300 nm. → They show a low saturation magnetization of 65 emu/g and an enhanced coercive force of 247 Oe. → These Fe 3 O 4 architectures may have potential applications in catalysis and biological fields.

  13. Conductive surface modification of cauliflower-like WO3 and its electrochemical properties for lithium-ion batteries

    International Nuclear Information System (INIS)

    Yoon, Sukeun; Woo, Sang-Gil; Jung, Kyu-Nam; Song, Huesup

    2014-01-01

    Highlights: • Synthesis of cauliflower-like carbon-decorated WO 3 . • Superior cyclability and rate capability for cauliflower-like carbon-decorated WO 3 . • Electrochemical reaction behavior of cauliflower-like carbon-decorated WO 3 with lithium. • In-situ XRD analysis during the first discharge–charge shows a complex reaction of intercalation and conversion of WO 3 . - Abstract: Cauliflower-like WO 3 was synthesized by a hydrothermal reaction without a surfactant, followed by firing, and was investigated as an anode material for lithium-ion battery applications. The scanning electron microscope (SEM) and transmission electron microscope (TEM) characterization indicated that WO 3 nanorods had an aggregation framework and built a cauliflower morphology. With the objective of understanding the charge–discharge process within a voltage range of 0–3 V vs. Li + /Li, in situ X-ray diffraction was used and a complex reaction of intercalation and conversion of WO 3 was revealed for the first time. The cauliflower-like WO 3 after being decorated with carbon provides a high gravimetric capacity of >635 mA h/g (Li 5.5 WO 3 ) with good cycling and a high rate capability when used as an anode in lithium-ion batteries. Based on our studies, we attribute the high electrochemical performance to the nanoscopic WO 3 particles and a conductive carbon layer, which makes them a potential candidate for lithium-ion batteries

  14. Quality of dried cauliflower according to the methods and drying parameters

    Directory of Open Access Journals (Sweden)

    Łapczyńska-Kordon Bogusława

    2018-01-01

    Full Text Available The quality of food products is a complex concept. It can be defined in many ways. The common element of most of these definitions is the condition of meeting the requirements of consumers. Quality determines product compliance with the requirements set by the normalized regulations. The paper attempts to determine the optimal method and parameters of cauliflower drying. In addition, a qualitative assessment of the obtained product was made. The results show that the method and parameters of drying significantly affect the quality of the dried cauliflower. Convection drying guarantees higher drought quality with respect to the color of the sample (higher brightness, taste and odor. Of the drying parameters accepted in the experiment, the most positive effect on the tested parameters was recorded using convection drying at a flow rate of 0.2 ms-1 and the least favorable for microwave drying 170 or 210 W.

  15. Synthesis and electrochemical behavior of nanostructured cauliflower-shape Co-Ni/Co-Ni oxides composites

    International Nuclear Information System (INIS)

    Gupta, Vinay; Kawaguchi, Toshikazu; Miura, Norio

    2009-01-01

    Nanostructured Co-Ni/Co-Ni oxides were electrochemically deposited onto stainless steel electrode by electrochemical method and characterized for their structural and supercapacitive properties. The SEM images indicated that the obtained Co-Ni/Co-Ni oxides had cauliflower-type nanostructure. The X-ray diffraction pattern showed the formation of Co 3 O 4 , NiO, Co and Ni. The EDX elemental mapping images indicated that Ni, Co and O are distributed uniformly. The deposited Co-Ni/Co-Ni oxides showed good supercapacitive characteristics with a specific capacitance of 331 F/g at 1 mA/cm 2 current density in 1 M KOH electrolyte. A mechanism of the formation of cauliflower-shape Co-Ni/Co-Ni oxides was proposed. A variety of promising applications in the fields such as energy storage devices and sensors can be envisioned from Co-Ni/Co-Ni oxides

  16. Optimisation of irrigation regime for early potatoes, late cauliflower, early cabbage and celery

    International Nuclear Information System (INIS)

    Zavadil, J.

    2006-01-01

    The paper deals with optimisation of threshold suction pressure of soil water on light soils for early potatoes, early cabbage, late cauliflower and celery on the basis of results from small-plot field experiments with differentiated irrigation regimes. Threshold suction pressures of soil water were identical for all crops: 15 kPa in treatment I, 30 kPa in treatment II, 60 kPa in treatment III, and 120 kPa in treatment IV. Precipitation, air temperature and relative humidity, global solar radiation, wind speed and direction were measured by an automated meteorological station. Reference and actual evapotranspirations were determined for the experimental crops according to FAO Paper No. 56 and by means of a biological curve (BC) in 2003-2005. To compare these two methods of calculation of actual evapotranspiration the soil moisture balance was found out. The optimum threshold suction pressure was 30 kPa for early potatoes, late cauliflower and cabbage and 15 kPa for celery. The seasonal irrigation depths determined on the basis of soil moisture balance, in which the crop evapotranspiration (ETc) was calculated either according to FAO 56 or by the BC, were substantially different from the really achieved irrigation depths with optimal suction pressure. The really achieved values were near to the depths calculated by the BC for potatoes, while for cauliflower, cabbage and celery they were similar to the depths calculated by the FAO 56 methodology. The theoretical irrigation depths calculated by the BC method sometimes differed substantially from those based on FAO 56. These differences were maximal for cauliflower and celery and minimal for cabbage. They decreased with decreasing irrigation depths. (author)

  17. Mutations in cauliflower and sprout broccoli grown from seeds flown in space

    Science.gov (United States)

    Wu, Hong; Huang, Congli; Zhang, Keping; Sun, Yeqing

    2010-11-01

    Cauliflower and sprout broccoli are widely planted vegetables particularly in Fujian Province, China. To study the mutation in these two types of vegetables induced from spaceflight, we flew the seeds on the 20th Chinese recoverable satellite which orbited the Earth for 18 days. After returning to the Earth, the cauliflower seeds were planted for two generations and the sprout broccoli seeds for one generation at the Xiamen Agriculture Research Institute. Of the 12 cauliflowers planted for the first generation, two showed significant phenotypical changes in both the size of the plant and the weight of the flower head. In addition, most of the space flown plants were found to be resistant to the black rot attack in the field. Cauliflowers planted for the second generation from the seeds in one of the two plants that displayed phenotypical changes in the first generation showed similar mutations. For the first generation of sprout broccoli, the rate of emergence from the flown seeds was lower than that of the control by 30%. No significant changes in the phenotype between the sprout broccolis planted from the flown seeds and the control were observed except one of the mutated sprout broccolis showed a change in the appearance in the lesser bud of the chief flower head. Results of the study demonstrated that DNA damages in some of the genes may have occurred in the seeds flown in space, and some of the changes in the genes may have inherited from the first to the second generation. The improved resistance to the black rot attack and increased size of the flower head are apparently beneficial.

  18. Comparison of cauliflower-insect-fungus interactions and pesticides for cabbage root fly control.

    Science.gov (United States)

    Razinger, Jaka; Žerjav, Metka; Zemljič-Urbančič, Meta; Modic, Špela; Lutz, Matthias; Schroers, Hans-Josef; Grunder, Jürg; Fellous, Simon; Urek, Gregor

    2017-12-01

    Cabbage root fly (Delia radicum L.) control represents a major challenge in brassica production, therefore different management strategies for its control were tested in conventionally managed open field cauliflower production. Strategies included treatments with low-risk methods such as nitrogen lime, the insecticide spinosad and the Beauveria bassiana ATCC 74040-based biopesticide Naturalis. Their effects were compared with treatments based on nonformulated fungal species Metarhizium brunneum, B. bassiana, Clonostachys solani, Trichoderma atroviride, T. koningiopsis, and T. gamsii and commercial insecticides λ-cyhalothrin and thiamethoxam. Spinosad and thiamethoxam were pipetted to individual plants before transplanting; λ-cyhalothrin was sprayed after transplanting; nitrogen lime was applied at first hoeing. Nonformulated fungi were delivered onto cauliflower plantlets' roots as a single pretransplantation inoculation. The cabbage root fly population dynamics exhibited a strong spatiotemporal variation. The lowest number of cabbage root fly pupae recovered from cauliflower roots in the field experiments was recorded in plants treated with spinosad (significant reduction), followed by Naturalis and one of the tested M. brunneum strains (nonsignificant reduction). Significantly more pupae were counted in the nitrogen lime treatment. The field experiments showed that a single drench of cauliflower plantlets with spinosad offered consistent and enduring cabbage root fly control. Naturalis and nonformulated fungal isolates did not decrease cabbage root fly pressure significantly, apparently due to lack of statistical power. The implications of the substantial intra- and inter-annual pest pressure variation and the benefits of using single plant treatments are discussed, and recommendations for improvement of rhizosphere-competence utilizing biological control strategies provided. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  19. Biomolecular and Structural Analyses of Cauliflower-like DNAs by Ultraviolet, Circular Dichroism, and Fluorescence Spectroscopies in Comparison with Natural DNA

    OpenAIRE

    Gill, Pooria; Ranjbar, Bijan; Saber, Reza; Khajeh, Khosro; Mohammadian, Mehdi

    2011-01-01

    Cauliflower-like DNAs are stem-loop DNAs that are fabricated periodically in inverted repetitions from deoxyribonucleic acid phosphates (dNTPs) by loop-mediated isothermal amplification (LAMP). Cauliflower-like DNAs have ladder-shape behaviors on gel electrophoresis, and increasing the time of LAMP leads to multiplying the repetitions, stem-loops, and electrophoretic bands. Cauliflower-like DNAs were fabricated via LAMP using two loop primers, two bumper primers, dNTPs, a λ-phage DNA template...

  20. Genomic Prediction and Association Mapping of Curd-Related Traits in Gene Bank Accessions of Cauliflower.

    Science.gov (United States)

    Thorwarth, Patrick; Yousef, Eltohamy A A; Schmid, Karl J

    2018-02-02

    Genetic resources are an important source of genetic variation for plant breeding. Genome-wide association studies (GWAS) and genomic prediction greatly facilitate the analysis and utilization of useful genetic diversity for improving complex phenotypic traits in crop plants. We explored the potential of GWAS and genomic prediction for improving curd-related traits in cauliflower ( Brassica oleracea var. botrytis ) by combining 174 randomly selected cauliflower gene bank accessions from two different gene banks. The collection was genotyped with genotyping-by-sequencing (GBS) and phenotyped for six curd-related traits at two locations and three growing seasons. A GWAS analysis based on 120,693 single-nucleotide polymorphisms identified a total of 24 significant associations for curd-related traits. The potential for genomic prediction was assessed with a genomic best linear unbiased prediction model and BayesB. Prediction abilities ranged from 0.10 to 0.66 for different traits and did not differ between prediction methods. Imputation of missing genotypes only slightly improved prediction ability. Our results demonstrate that GWAS and genomic prediction in combination with GBS and phenotyping of highly heritable traits can be used to identify useful quantitative trait loci and genotypes among genetically diverse gene bank material for subsequent utilization as genetic resources in cauliflower breeding. Copyright © 2018 Thorwarth et al.

  1. 60Co irradiation effect on color in minimally processed cauliflower (Brassica spp)

    International Nuclear Information System (INIS)

    Nunes, Thaise C.F.; Rogovschi, Vladimir D.; Santillo, Amanda G.; Villavicencio, Anna L.C.H.; Michels, Robert; Pitombo, Ronaldo N.M.

    2009-01-01

    Irradiation is a well-established process with clearly documented safety and efficacy. Consumers require a quality product that is convenient and has fresh-like characteristics and take product appearance, like color, into consideration as a primary criterion; it is considered a key role in food choice, food preference and acceptability. The objective of the present work was to investigate color degradation of cauliflower treated with gamma radiation during 14 days. Cauliflower irradiated samples with 0 and 1.5 kGy showed significant differences for value 'L' on the 10th and 14th day, respectively for value 'b' only the 0 kGy sample showed significant difference on day 10 of storage. On day 10 of shelf-life the irradiated cauliflower with doses of 1 and 1.5 kGy became more yellow compared to the control. The authors concluded that the treatment with low gamma radiation doses keeps the quality of fresh-cut vegetables. (author)

  2. Genomic Prediction and Association Mapping of Curd-Related Traits in Gene Bank Accessions of Cauliflower

    Directory of Open Access Journals (Sweden)

    Patrick Thorwarth

    2018-02-01

    Full Text Available Genetic resources are an important source of genetic variation for plant breeding. Genome-wide association studies (GWAS and genomic prediction greatly facilitate the analysis and utilization of useful genetic diversity for improving complex phenotypic traits in crop plants. We explored the potential of GWAS and genomic prediction for improving curd-related traits in cauliflower (Brassica oleracea var. botrytis by combining 174 randomly selected cauliflower gene bank accessions from two different gene banks. The collection was genotyped with genotyping-by-sequencing (GBS and phenotyped for six curd-related traits at two locations and three growing seasons. A GWAS analysis based on 120,693 single-nucleotide polymorphisms identified a total of 24 significant associations for curd-related traits. The potential for genomic prediction was assessed with a genomic best linear unbiased prediction model and BayesB. Prediction abilities ranged from 0.10 to 0.66 for different traits and did not differ between prediction methods. Imputation of missing genotypes only slightly improved prediction ability. Our results demonstrate that GWAS and genomic prediction in combination with GBS and phenotyping of highly heritable traits can be used to identify useful quantitative trait loci and genotypes among genetically diverse gene bank material for subsequent utilization as genetic resources in cauliflower breeding.

  3. Pre-harvest methyl jasmonate treatment enhances cauliflower chemoprotective attributes without a loss in postharvest quality.

    Science.gov (United States)

    Ku, Kang Mo; Choi, Jeong-Hee; Kushad, Mosbah M; Jeffery, Elizabeth H; Juvik, John A

    2013-06-01

    Methyl jasmonate (MeJA) treatment can significantly increase glucosinolate (GS) concentrations in Brassica vegetables and potentially enhance anticancer bioactivity. Although MeJA treatment may promote ethylene biosynthesis, which can be detrimental to postharvest quality, there are no previous reports of its effect on cauliflower postharvest quality. To address this, cauliflower curds in field plots were sprayed with either 0.1 % Triton X-100 (control) or 500 μM MeJA solutions four days prior to harvest, then stored at 4 °C. Tissue subsamples were collected after 0, 10, 20, and 30 days of postharvest storage and assayed for visual color change, ethylene production, GS concentrations, and extract quinone reductase inductive activity. MeJA treatment increased curd GS concentrations of glucoraphanin, glucobrassicin, and neoglucobrassicin by 1.5, 2.4, and 4.6-fold over controls, respectively. MeJA treated cauliflower showed significantly higher quinone reductase activity, a biomarker for anticancer bioactivity, without reducing visual color and postharvest quality for 10 days at 4 °C storage.

  4. Enhanced spectral emissivity of CeO{sub 2} coating with cauliflower-like microstructure

    Energy Technology Data Exchange (ETDEWEB)

    Huang Jianping [Center for Composite Materials and Structures, Harbin Institute of Technology, 150080 Harbin (China); Li Yibin, E-mail: liyibin@hit.edu.cn [Center for Composite Materials and Structures, Harbin Institute of Technology, 150080 Harbin (China); He Xiaodong; Song Guangping [Center for Composite Materials and Structures, Harbin Institute of Technology, 150080 Harbin (China); Fan Chenglei [Key Laboratory of Advanced Welding and Joining, Harbin Institute of Technology, 150001 Harbin (China); Sun Yue [Center for Composite Materials and Structures, Harbin Institute of Technology, 150080 Harbin (China); Fei Weidong [School of Materials Science and Engineering, Harbin Institute of Technology, 150001 Harbin (China); Du Shanyi [Center for Composite Materials and Structures, Harbin Institute of Technology, 150080 Harbin (China)

    2012-10-15

    Highlights: Black-Right-Pointing-Pointer Cauliflower-like microstructured CeO{sub 2} coating is prepared on Ni based substrate. Black-Right-Pointing-Pointer The infrared emissive property at high temperature is investigated. Black-Right-Pointing-Pointer Rough CeO{sub 2} coating shows high emissivity, that is, 0.9 at 873 K and 0.87 at 1073 K. Black-Right-Pointing-Pointer The emissivity enhancement mechanisms for the rough CeO{sub 2} coating are discussed. - Abstract: Cerium dioxide is a transparent oxide with high refractive index (from 1.6 to 2.5 at 633 nm) in the visible and near-IR spectral regions. However, little attention has been paid to its optical property in mid-IR (2.5-25 {mu}m). Here we report that the cauliflower-like microstructured CeO{sub 2} coating deposited by electron beam physical vapor deposition technique shows high emissivity up to 0.9 at 873 K in the mid-IR spectral region. The high emissivity is attributed to the coupling between free propagating waves and space-variant polarizations caused by the cauliflower-like microstructure. This high emissivity coating shows a potential application in high temperature components.

  5. Enhanced spectral emissivity of CeO2 coating with cauliflower-like microstructure

    International Nuclear Information System (INIS)

    Huang Jianping; Li Yibin; He Xiaodong; Song Guangping; Fan Chenglei; Sun Yue; Fei Weidong; Du Shanyi

    2012-01-01

    Highlights: ► Cauliflower-like microstructured CeO 2 coating is prepared on Ni based substrate. ► The infrared emissive property at high temperature is investigated. ► Rough CeO 2 coating shows high emissivity, that is, 0.9 at 873 K and 0.87 at 1073 K. ► The emissivity enhancement mechanisms for the rough CeO 2 coating are discussed. - Abstract: Cerium dioxide is a transparent oxide with high refractive index (from 1.6 to 2.5 at 633 nm) in the visible and near-IR spectral regions. However, little attention has been paid to its optical property in mid-IR (2.5–25 μm). Here we report that the cauliflower-like microstructured CeO 2 coating deposited by electron beam physical vapor deposition technique shows high emissivity up to 0.9 at 873 K in the mid-IR spectral region. The high emissivity is attributed to the coupling between free propagating waves and space-variant polarizations caused by the cauliflower-like microstructure. This high emissivity coating shows a potential application in high temperature components.

  6. Evaluation of pesticide residue dynamics in Chinese cabbage, head cabbage and cauliflower.

    Science.gov (United States)

    Kocourek, František; Stará, Jitka; Holý, Kamil; Horská, Tereza; Kocourek, Vladimír; Kováčová, Jana; Kohoutková, Jana; Suchanová, Marie; Hajšlová, Jana

    2017-06-01

    Pesticide residues from the time of application until harvest were analysed for 20, 17 and 18 active insecticidal and fungicidal substances in Chinese cabbage, head cabbage and cauliflower, respectively. In total, 40 mathematical models of residue degradation were developed using a first-order kinetic equation, and from these models it was possible to forecast the action pre-harvest interval for a given action threshold for low-residue production in Brassica vegetables as a percentage of the maximum residue level. Additionally, it was possible to establish an action pre-harvest interval based on an action threshold of 0.01 mg kg ‒1 for the production of Brassica vegetables for baby food. Among the evaluated commodities, the speed of residue degradation was highest in head cabbage, medium in Chinese cabbage and lowest in cauliflower. The half-lives of pesticide in various vegetables were also determined: they ranged from 1.55 to 5.25 days in Chinese cabbage, from 0.47 to 6.54 days in head cabbage and from 1.88 to 7.22 days in cauliflower.

  7. {sup 60}Co irradiation effect on color in minimally processed cauliflower (Brassica spp)

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Thaise C.F.; Rogovschi, Vladimir D.; Santillo, Amanda G.; Villavicencio, Anna L.C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: thaisecfnunes@hotmail.com; Michels, Robert [Hydrofarm Comercio e Representacao de Produtos Agricolas Ltda., Sao Roque, SP (Brazil); Pitombo, Ronaldo N.M. [Universidade de Sao Paulo (USP), SP (Brazil). Faculdade de Ciencias Farmaceuticas. Dept. de Alimentos e Nutricao Experimental

    2009-07-01

    Irradiation is a well-established process with clearly documented safety and efficacy. Consumers require a quality product that is convenient and has fresh-like characteristics and take product appearance, like color, into consideration as a primary criterion; it is considered a key role in food choice, food preference and acceptability. The objective of the present work was to investigate color degradation of cauliflower treated with gamma radiation during 14 days. Cauliflower irradiated samples with 0 and 1.5 kGy showed significant differences for value 'L' on the 10th and 14th day, respectively for value 'b' only the 0 kGy sample showed significant difference on day 10 of storage. On day 10 of shelf-life the irradiated cauliflower with doses of 1 and 1.5 kGy became more yellow compared to the control. The authors concluded that the treatment with low gamma radiation doses keeps the quality of fresh-cut vegetables. (author)

  8. Cauliflower ear – a minimally invasive treatment method in a wrestling athlete: a case report

    Directory of Open Access Journals (Sweden)

    Haik J

    2018-01-01

    Full Text Available Josef Haik,1–4 Or Givol,2 Rachel Kornhaber,1,5 Michelle Cleary,6 Hagit Ofir,1,2 Moti Harats1–3 1Department of Plastic and Reconstructive Surgery, Sheba Medical Center, Tel Hashomer, Ramat Gan, 2Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel; 3Burn Injury Research Node, Institute for Health Research University of Notre Dame Fremantle, Fremantle WA, Australia; 4Talpiot Leadership Program, Sheba Medical Center, Tel Hashomer, Ramat Gan, Israel; 5Faculty of Health, 6School of Health Sciences, College of Health and Medicine, University of Tasmania, Sydney, NSW, Australia Abstract: Acute auricular hematoma can be caused by direct blunt trauma or other injury to the external ear. It is typically seen in those who practice full contact sports such as boxing, wrestling, and rugby. “Cauliflower ear” deformity, fibrocartilage formation during scarring, is a common complication of auricular hematomas. Therefore, acute drainage of the hematoma and postprocedural techniques for preventing recurrence are necessary for preventing the deformity. There are many techniques although no superior method of treatment has been found. In this case report, we describe a novel method using needle aspiration followed by the application of a magnet and an adapted disc to the affected area of the auricular. This minimally invasive, simple, and accessible method could potentially facilitate the treatment of cauliflower ear among full contact sports athletes. Keywords: cauliflower ear, hematoma, ear deformity, athletic injuries, wrestling, case report

  9. Interactions between cauliflower and Rhizoctonia anastomosis groups with different levels of aggressiveness

    Science.gov (United States)

    Pannecoucque, Joke; Höfte, Monica

    2009-01-01

    Background The soil borne fungus Rhizoctonia is one of the most important plant pathogenic fungi, with a wide host range and worldwide distribution. In cauliflower (Brassica oleracea var. botrytis), several anastomosis groups (AGs) including both multinucleate R. solani and binucleate Rhizoctonia species have been identified showing different levels of aggressiveness. The infection and colonization process of Rhizoctonia during pathogenic interactions is well described. In contrast, insights into processes during interactions with weak aggressive or non-pathogenic isolates are limited. In this study the interaction of cauliflower with seven R. solani AGs and one binucleate Rhizoctonia AG differing in aggressiveness, was compared. Using microscopic and histopathological techniques, the early steps of the infection process, the colonization process and several host responses were studied. Results For aggressive Rhizoctonia AGs (R. solani AG 1-1B, AG 1-1C, AG 2-1, AG 2-2 IIIb and AG 4 HGII), a higher developmental rate was detected for several steps of the infection process, including directed growth along anticlinal cell walls and formation of T-shaped branches, infection cushion formation and stomatal penetration. Weak or non-aggressive AGs (R. solani AG 5, AG 3 and binucleate Rhizoctonia AG K) required more time, notwithstanding all AGs were able to penetrate cauliflower hypocotyls. Histopathological observations indicated that Rhizoctonia AGs provoked differential host responses and pectin degradation. We demonstrated the pronounced deposition of phenolic compounds and callose against weak and non-aggressive AGs which resulted in a delay or complete block of the host colonization. Degradation of pectic compounds was observed for all pathogenic AGs, except for AG 2-2 IIIb. Ranking the AGs based on infection rate, level of induced host responses and pectin degradation revealed a strong correlation with the disease severity caused by the AGs. Conclusion The

  10. Large-scale synthesis of double cauliflower-like Sb2S3 microcrystallines by hydrothermal method

    International Nuclear Information System (INIS)

    Wu, Lei; Xu, Hanyue; Han, Qiaofeng; Wang, Xin

    2013-01-01

    Highlights: •Highly uniform double cauliflower-like Sb 2 S 3 particles were synthesized via hydrothermal method. •Influence of reaction conditions on the morphology of the products was discussed. •Double cauliflower-like Sb 2 S 3 superstructures revealed broad spectrum response. -- Abstract: The double cauliflower-like Sb 2 S 3 superstructures assembled by nanorods were prepared using SbCl 3 and Na 2 S⋅9H 2 O as raw materials, dodecyltrimethylammonium bromide (DTAB, C 15 H 31 BrN) as surfactant under acidic condition at 180 °C for 30 h. The structure, morphology and composition of the product were characterized by X-ray diffraction pattern (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and energy diffraction spectroscopy (EDS). The effect of reaction conditions including temperature, reaction time and surfactants on the sample morphology was discussed and a possible mechanism for the formation of cauliflower-like Sb 2 S 3 was proposed. The cauliflower-like Sb 2 S 3 microcrystallines revealed broad spectrum response, which may have a good application prospect in solar energy utilization and photoelectric conversion fields

  11. Effect of successive cauliflower plantings and Rhizoctonia solani AG 2-1 inoculations on disease suppressiveness of a suppressive and a conducive soil

    NARCIS (Netherlands)

    Postma, J.; Scheper, R.W.A.; Schilder, M.T.

    2010-01-01

    Disease suppressiveness against Rhizoctonia solani AG 2-1 in cauliflower was studied in two marine clay soils with a sandy loam texture. The soils had a different cropping history. One soil had a long-term (40 years) cauliflower history and was suppressive, the other soil was conducive and came from

  12. A Serving of Vegetables in Pizza? Evaluating the Nutritional Value and Likeability of Pizza Crust with the Addition of Zucchini or Cauliflower

    Science.gov (United States)

    Ghighi, Amanda; Maioriello, Gina; Piper, Darlene; Waters, Betty; Vollmer, Rachel L.

    2017-01-01

    The purpose of this experiment was to determine the effects of the meaningful addition of vegetables, using cauliflower and zucchini, to a pizza crust on the likeability of taste, texture, appearance, and overall preference of the pizza. The likeability testing revealed that the cauliflower variation produced an unacceptable product in texture,…

  13. Effect of organic manure on nitrogen mineralization, nitrogen accumulation, nitrogen use efficiency and apparent nitrogen recovery of cauliflower (Braccica oleracea L., var. Botrytis)

    NARCIS (Netherlands)

    Beah, A.A.; Norman, P.E.; Scholberg, J.M.S.; Lantinga, E.A.; Conteh, A.R.

    2015-01-01

    Aims: The main aim of the study was to assess the effects of organic manure on nitrogen mineralization, uptake, use and recovery of cauliflower.
    Methodology: Nitrogen is one of the major yield limiting nutrients in cauliflower production. However, organic manure is applied to supplement soil

  14. Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis

    Directory of Open Access Journals (Sweden)

    Zhou Xiangjun

    2011-11-01

    Full Text Available Abstract Background Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and the regulatory control of chloroplast biogenesis and development remain to be elucidated. Results Green cauliflower mutant causes ectopic development of chloroplasts in the curd tissue of the plant, turning the otherwise white curd green. To investigate the transcriptional control of chloroplast development, we compared gene expression between green and white curds using the RNA-seq approach. Deep sequencing produced over 15 million reads with lengths of 86 base pairs from each cDNA library. A total of 7,155 genes were found to exhibit at least 3-fold changes in expression between green and white curds. These included light-regulated genes, genes encoding chloroplast constituents, and genes involved in chlorophyll biosynthesis. Moreover, we discovered that the cauliflower ELONGATED HYPOCOTYL5 (BoHY5 was expressed higher in green curds than white curds and that 2616 HY5-targeted genes, including 1600 up-regulated genes and 1016 down-regulated genes, were differently expressed in green in comparison to white curd tissue. All these 1600 up-regulated genes were HY5-targeted genes in the light. Conclusions The genome-wide profiling of gene expression by RNA-seq in green curds led to the identification of large numbers of genes associated with chloroplast development, and suggested the role of regulatory genes in the high hierarchy of light signaling pathways in mediating the ectopic chloroplast development in the green curd cauliflower mutant.

  15. Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis).

    Science.gov (United States)

    Zhou, Xiangjun; Fei, Zhangjun; Thannhauser, Theodore W; Li, Li

    2011-11-23

    Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and the regulatory control of chloroplast biogenesis and development remain to be elucidated. Green cauliflower mutant causes ectopic development of chloroplasts in the curd tissue of the plant, turning the otherwise white curd green. To investigate the transcriptional control of chloroplast development, we compared gene expression between green and white curds using the RNA-seq approach. Deep sequencing produced over 15 million reads with lengths of 86 base pairs from each cDNA library. A total of 7,155 genes were found to exhibit at least 3-fold changes in expression between green and white curds. These included light-regulated genes, genes encoding chloroplast constituents, and genes involved in chlorophyll biosynthesis. Moreover, we discovered that the cauliflower ELONGATED HYPOCOTYL5 (BoHY5) was expressed higher in green curds than white curds and that 2616 HY5-targeted genes, including 1600 up-regulated genes and 1016 down-regulated genes, were differently expressed in green in comparison to white curd tissue. All these 1600 up-regulated genes were HY5-targeted genes in the light. The genome-wide profiling of gene expression by RNA-seq in green curds led to the identification of large numbers of genes associated with chloroplast development, and suggested the role of regulatory genes in the high hierarchy of light signaling pathways in mediating the ectopic chloroplast development in the green curd cauliflower mutant.

  16. The role of BoFLC2 in cauliflower (Brassica oleracea var. botrytis L.) reproductive development.

    Science.gov (United States)

    Ridge, Stephen; Brown, Philip H; Hecht, Valérie; Driessen, Ronald G; Weller, James L

    2015-01-01

    In agricultural species that are sexually propagated or whose marketable organ is a reproductive structure, management of the flowering process is critical. Inflorescence development in cauliflower is particularly complex, presenting unique challenges for those seeking to predict and manage flowering time. In this study, an integrated physiological and molecular approach was used to clarify the environmental control of cauliflower reproductive development at the molecular level. A functional allele of BoFLC2 was identified for the first time in an annual brassica, along with an allele disrupted by a frameshift mutation (boflc2). In a segregating F₂ population derived from a cross between late-flowering (BoFLC2) and early-flowering (boflc2) lines, this gene behaved in a dosage-dependent manner and accounted for up to 65% of flowering time variation. Transcription of BoFLC genes was reduced by vernalization, with the floral integrator BoFT responding inversely. Overall expression of BoFT was significantly higher in early-flowering boflc2 lines, supporting the idea that BoFLC2 plays a key role in maintaining the vegetative state. A homologue of Arabidopsis VIN3 was isolated for the first time in a brassica crop species and was up-regulated by two days of vernalization, in contrast to findings in Arabidopsis where prolonged exposure to cold was required to elicit up-regulation. The correlations observed between gene expression and flowering time in controlled-environment experiments were validated with gene expression analyses of cauliflowers grown outdoors under 'natural' vernalizing conditions, indicating potential for transcript levels of flowering genes to form the basis of predictive assays for curd initiation and flowering time. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Conductive surface modification of cauliflower-like WO{sub 3} and its electrochemical properties for lithium-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Sukeun, E-mail: skyoon@kongju.ac.kr [Division of Advanced Materials Engineering, Kongju National University, Chungnam 330-717 (Korea, Republic of); Woo, Sang-Gil [Advanced Batteries Research Center, Korea Electronics Technology Institute, Gyeonggi 463-816 (Korea, Republic of); Jung, Kyu-Nam [Energy Efficiency and Materials Research Division, Korea Institute of Energy Research, Daejeon 305-343 (Korea, Republic of); Song, Huesup, E-mail: hssong@kongju.ac.kr [Division of Advanced Materials Engineering, Kongju National University, Chungnam 330-717 (Korea, Republic of)

    2014-11-15

    Highlights: • Synthesis of cauliflower-like carbon-decorated WO{sub 3}. • Superior cyclability and rate capability for cauliflower-like carbon-decorated WO{sub 3}. • Electrochemical reaction behavior of cauliflower-like carbon-decorated WO{sub 3} with lithium. • In-situ XRD analysis during the first discharge–charge shows a complex reaction of intercalation and conversion of WO{sub 3}. - Abstract: Cauliflower-like WO{sub 3} was synthesized by a hydrothermal reaction without a surfactant, followed by firing, and was investigated as an anode material for lithium-ion battery applications. The scanning electron microscope (SEM) and transmission electron microscope (TEM) characterization indicated that WO{sub 3} nanorods had an aggregation framework and built a cauliflower morphology. With the objective of understanding the charge–discharge process within a voltage range of 0–3 V vs. Li{sup +}/Li, in situ X-ray diffraction was used and a complex reaction of intercalation and conversion of WO{sub 3} was revealed for the first time. The cauliflower-like WO{sub 3} after being decorated with carbon provides a high gravimetric capacity of >635 mA h/g (Li{sub 5.5}WO{sub 3}) with good cycling and a high rate capability when used as an anode in lithium-ion batteries. Based on our studies, we attribute the high electrochemical performance to the nanoscopic WO{sub 3} particles and a conductive carbon layer, which makes them a potential candidate for lithium-ion batteries.

  18. Natural products and biological activity of the pharmacologically active cauliflower mushroom Sparassis crispa.

    Science.gov (United States)

    Kimura, Takashi

    2013-01-01

    Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.

  19. Natural Products and Biological Activity of the Pharmacologically Active Cauliflower Mushroom Sparassis crispa

    Directory of Open Access Journals (Sweden)

    Takashi Kimura

    2013-01-01

    Full Text Available Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.

  20. Effect of Mn deficiency on uptake, transport and distribution of 32P in cauliflower and tomato

    International Nuclear Information System (INIS)

    Mehrotra, S.C.

    1988-01-01

    The pattern of 32 P uptake, transport and distribution has been recorded in cauliflower (Brassica oleracea L. var. Botrytis cv. Late Maghi) and tomato (Lycopersicon esculentum Mill cv. Marglobe) plants grown at deficient (0.00055 ppm) and optimal (0.55 ppm) levels of Mn supply in refined sand culture. Manganese deficiency enhanced the transport of 32 P from roots to tops in both the species but the uptake and distribution pattern was found to vary with the species, plant parts and in terms of concentration and total uptake. (author). 6 refs., 2 tables

  1. Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

    Science.gov (United States)

    Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

    2014-03-01

    The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

  2. Storage stability of cauliflower soup powder: The effect of lipid oxidation and protein degradation reactions.

    Science.gov (United States)

    Raitio, Riikka; Orlien, Vibeke; Skibsted, Leif H

    2011-09-15

    Soups based on cauliflower soup powders, prepared by dry mixing of ingredients and rapeseed oil, showed a decrease in quality, as evaluated by a sensory panel, during the storage of the soup powder in the dark for up to 12weeks under mildly accelerated conditions of 40°C and 75% relative humidity. Antioxidant, shown to be effective in protecting the rapeseed bulk oil, used for the powder preparation, had no effect on storage stability of the soup powder. The freshly prepared soup powder had a relatively high concentration of free radicals, as measured by electron spin resonance spectroscopy, which decreased during storage, and most remarkably during the first two weeks of storage, with only marginal increase in lipid hydroperoxides as primary lipid oxidation products, and without any increase in secondary lipid oxidation products. Analyses of volatiles by SPME-GC-MS revealed a significant increase in concentrations of 2-methyl- and 3-methyl butanals, related to Maillard reactions, together with an increase in 2-acetylpyrrole concentration. The soup powders became more brown during storage, as indicated by a decreasing Hunter L-value, in accord with non-enzymatic browning reactions. A significant increase in the concentrations of dimethyl disulfide in soup powder headspace indicated free radical-initiated protein oxidation. Protein degradation, including Maillard reactions and protein oxidation, is concluded to be more important than lipid oxidation in determining the shelf-life of dry cauliflower soup powder. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Nutritional Status of the Cauliflower Cultivar ‘Verona’ Grown with Omission of out Added Macronutrients

    Science.gov (United States)

    Bianco, Matheus Saraiva; Cecílio Filho, Arthur Bernardes; de Carvalho, Leonardo Bianco

    2015-01-01

    Knowledge of plant nutritional status allows an understanding of the physiological responses of plants to crop fertilization. A hydroponic experiment evaluated the symptoms of macronutrient deficiency in cauliflower ‘Verona’ and determined: a) the macronutrient contents of foliar tissues when visual symptoms were observed, b) macronutrients content of foliar and inflorescence tissues at harvest. The effect of nutrient deficiency on inflorescence mass was also evaluated. Nitrogen deficiency caused chlorosis followed by purple color in the old leaves, while P deficiency caused only chlorosis in old leaves. Chlorosis at the edge of old leaves progressing to the center of the leaves was observed with the omission of K, and after was observed necrosis in the chlorotic areas. Ca deficiency caused tip burn in new leaves, while Mg deficiency caused internerval chlorosis in old leaves. The omission of each macronutrient reduced inflorescence dry matter. This deleterious effect was larger for N, P, and K deficiencies, reducing inflorescence dry matter by 87, 49, and 42%, respectively. When the nutrient solutions without N, P, K, Ca, or Mg were supplied to cauliflower plants, the macronutrient contents at harvest were 8.8, 0.6, 3.5, 13.0, and 0.8 g kg-1 in the foliar tissues and 27.3, 2.2, 21.6, 1.1, and 0.7 g kg-1 in the inflorescence tissues, respectively. PMID:25856380

  4. Purification and characterization of polyphenol oxidase from cauliflower (Brassica oleracea L.).

    Science.gov (United States)

    Rahman, Andi Nur Faidah; Ohta, Mayumi; Nakatani, Kazuya; Hayashi, Nobuyuki; Fujita, Shuji

    2012-04-11

    Polyphenol oxidase (PPO) of cauliflower was purified to 282-fold with a recovery rate of 8.1%, using phloroglucinol as a substrate. The enzyme appeared as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The estimated molecular weight of the enzyme was 60 and 54 kDa by SDS-PAGE and gel filtration, respectively. The purified enzyme, called phloroglucinol oxidase (PhO), oxidized phloroglucinol (K(m) = 3.3 mM) and phloroglucinolcarboxylic acid. The enzyme also had peroxidase (POD) activity. At the final step, the activity of purified cauliflower POD was 110-fold with a recovery rate of 3.2%. The PhO and POD showed the highest activity at pH 8.0 and 4.0 and were stable in the pH range of 3.0-11.0 and 5.0-8.0 at 5 °C for 20 h, respectively. The optimum temperature was 55 °C for PhO and 20 °C for POD. The most effective inhibitor for PhO was sodium diethyldithiocarbamate at 10 mM (IC(50) = 0.64 and K(i) = 0.15 mM), and the most effective inhibitor for POD was potassium cyanide at 1.0 mM (IC(50) = 0.03 and K(i) = 29 μM).

  5. Nutritional status of the cauliflower cultivar 'verona' grown with omission of out added macronutrients.

    Science.gov (United States)

    Bianco, Matheus Saraiva; Cecílio Filho, Arthur Bernardes; de Carvalho, Leonardo Bianco

    2015-01-01

    Knowledge of plant nutritional status allows an understanding of the physiological responses of plants to crop fertilization. A hydroponic experiment evaluated the symptoms of macronutrient deficiency in cauliflower 'Verona' and determined: a) the macronutrient contents of foliar tissues when visual symptoms were observed, b) macronutrients content of foliar and inflorescence tissues at harvest. The effect of nutrient deficiency on inflorescence mass was also evaluated. Nitrogen deficiency caused chlorosis followed by purple color in the old leaves, while P deficiency caused only chlorosis in old leaves. Chlorosis at the edge of old leaves progressing to the center of the leaves was observed with the omission of K, and after was observed necrosis in the chlorotic areas. Ca deficiency caused tip burn in new leaves, while Mg deficiency caused internerval chlorosis in old leaves. The omission of each macronutrient reduced inflorescence dry matter. This deleterious effect was larger for N, P, and K deficiencies, reducing inflorescence dry matter by 87, 49, and 42%, respectively. When the nutrient solutions without N, P, K, Ca, or Mg were supplied to cauliflower plants, the macronutrient contents at harvest were 8.8, 0.6, 3.5, 13.0, and 0.8 g kg-1 in the foliar tissues and 27.3, 2.2, 21.6, 1.1, and 0.7 g kg-1 in the inflorescence tissues, respectively.

  6. Transcriptional activation of a MYB gene controls the tissue-specific anthocyanin accumulation in a purple cauliflower mutant

    Science.gov (United States)

    Flavonoids such as anthocyanins possess significant health benefits to humans and play important physiological roles in plants. An interesting Purple gene mutation in cauliflower confers an abnormal pattern of anthocyanin accumulation, giving intense purple color in very young leaves, curds, and see...

  7. Comparative analysis of genetic diversity and differentiation of cauliflower (Brassica oleracea var. botrytis) accessions from two ex situ genebanks.

    Science.gov (United States)

    Yousef, Eltohamy A A; Müller, Thomas; Börner, Andreas; Schmid, Karl J

    2018-01-01

    Cauliflower (Brassica oleracea var. botrytis) is an important vegetable crop for human nutrition. We characterized 192 cauliflower accessions from the USDA and IPK genebanks with genotyping by sequencing (GBS). They originated from 26 different countries and represent about 44% of all cauliflower accessions in both genebanks. The analysis of genetic diversity revealed that accessions formed two major groups that represented the two genebanks and were not related to the country of origin. This differentiation was robust with respect to the analysis methods that included principal component analysis, ADMIXTURE and neighbor-joining trees. Genetic diversity was higher in the USDA collection and significant phenotypic differences between the two genebanks were found in three out of six traits investigated. GBS data have a high proportion of missing data, but we observed that the exclusion of single nucleotide polymorphisms (SNPs) with missing data or the imputation of missing SNP alleles produced very similar results. The results indicate that the composition and type of accessions have a strong effect on the structure of genetic diversity of ex situ collections, although regeneration procedures and local adaptation to regeneration conditions may also contribute to a divergence. Fst-based outlier tests of genetic differentiation identified only a small proportion (cauliflower genebank material and our results suggest that it may be useful to incorporate routine genotyping into accession management and seed regeneration to monitor the diversity present in ex situ collections and to reduce the loss of genetic diversity during seed regeneration.

  8. Cauliflower is a new host of a subgroup 16SrVII-B phytoplasma associated with stunting disease

    Science.gov (United States)

    Cauliflower stunt has occurred with high levels of incidence and provoked significant yield reduction in Brazilian crops. Phytoplasmas belonging to the subgroups 16SrIII-J and 16SrXV-A were previously reported in association with the disease. In 2014, plants with typical symptoms of the disease were...

  9. Multilocus genotyping of a ‘Candidatus Phytoplasma aurantifolia’-related strain associated with cauliflower phyllody disease in China

    Science.gov (United States)

    A new cauliflower disease characterized by formation of leaf-like inflorescences and malformed flowers occurred in a seed production filed located in Yunnan, a southwest province of China. In the diseased plants, floral organs in three inner whorls (petals, carpels, and stamens) were under-develope...

  10. Sensitive radioimmunosorbent assay for the detection of plant viruses. [Cauliflower mosaic virus, lettuce mosaic virus

    Energy Technology Data Exchange (ETDEWEB)

    Ghabrial, S A; Shepherd, R J [Kentucky Univ., Lexington (USA); California Univ., Davis (USA))

    1980-06-01

    A simple and highly sensitive radioimmunosorbent assay (RISA) for the detection of plant viruses is described. The RISA procedure is a microplate method based on the principle of 'double-antibody sandwich' and follows essentially the protocol of the enzyme-linked immunosorbent assay (ELISA) (Clark and Adams, 1977), with the exception that /sup 125/I-labelled ..gamma..-globulin is substituted for the ..gamma..-globulin enzyme conjugate; the bound /sup 125/I-..gamma..-globulin is dissociated by acidification from the double-antibody sandwich. The radioactivity is proportional to virus concentration, and cauliflower mosaic virus (CaMV) and lettuce mosaic virus (LMV) could be detected at concentrations as low as 5 and 2 ng/ml, respectively. Direct evidence of the adverse effects of conjugation with enzyme on the binding abilities of antibodies is presented. The RISA procedure should prove valuable with viruses for which the ELISA values are too low to be dependable.

  11. Evaluation of the minimal replication time of Cauliflower mosaic virus in different hosts

    International Nuclear Information System (INIS)

    Khelifa, Mounia; Masse, Delphine; Blanc, Stephane; Drucker, Martin

    2010-01-01

    Though the duration of a single round of replication is an important biological parameter, it has been determined for only few viruses. Here, this parameter was determined for Cauliflower mosaic virus (CaMV) in transfected protoplasts from different hosts: the highly susceptible Arabidopsis and turnip, and Nicotiana benthamiana, where CaMV accumulates only slowly. Four methods of differing sensitivity were employed: labelling of (1) progeny DNA and (2) capsid protein, (3) immunocapture PCR,, and (4) progeny-specific PCR. The first progeny virus was detected about 21 h after transfection. This value was confirmed by all methods, indicating that our estimate was not biased by the sensitivity of the detection method, and approximated the actual time required for one round of CaMV replication. Unexpectedly, the replication kinetics were similar in the three hosts; suggesting that slow accumulation of CaMV in Nicotiana plants is determined by non-optimal interactions in other steps of the infection cycle.

  12. Quantitative trait loci controlling leaf appearance and curd initiation of cauliflower in relation to temperature.

    Science.gov (United States)

    Hasan, Yaser; Briggs, William; Matschegewski, Claudia; Ordon, Frank; Stützel, Hartmut; Zetzsche, Holger; Groen, Simon; Uptmoor, Ralf

    2016-07-01

    QTL regions on chromosomes C06 and C09 are involved in temperature dependent time to curd induction in cauliflower. Temperature is the main environmental factor influencing curding time of cauliflower (Brassica oleracea var. botrytis). Temperatures above 20-22 °C inhibit development towards curding even in many summer cultivars. To identify quantitative trait loci (QTL) controlling curding time and its related traits in a wide range of different temperature regimes from 12 to 27 °C, a doubled haploid (DH) mapping population segregating for curding time was developed and days to curd initiation (DCI), leaf appearance rate (LAR), and final leaf number (FLN) were measured. The population was genotyped with 176 single nucleotide polymorphism (SNP) markers. Composite interval mapping (CIM) revealed repeatedly detected QTL for DCI on C06 and C09. The estimated additive effect increased at high temperatures. Significant QTL × environment interactions (Q × E) for FLN and DCI on C06 and C09 suggest that these hotspot regions have major influences on temperature mediated curd induction. 25 % of the DH lines did not induce curds at temperatures higher than 22 °C. Applying a binary model revealed a QTL with LOD >15 on C06. Nearly all lines carrying the allele of the reliable early maturing parental line (PL) on that locus induced curds at high temperatures while only half of the DH lines carrying the allele of the unreliable PL reached the generative phase during the experiment. Large variation in LAR was observed. QTL for LAR were detected repeatedly in several environments on C01, C04 and C06. Negative correlations between LAR and DCI and QTL co-localizations on C04 and C06 suggest that LAR has also effects on development towards curd induction.

  13. Forced-air, vacuum, and hydro precooling of cauliflower (Brassica oleracea L. var. botrytis cv. Freemont: part I. determination of precooling parameters

    Directory of Open Access Journals (Sweden)

    Ilknur Alibas

    2014-12-01

    Full Text Available The aim of the present study was to precool cauliflower using forced-air, vacuum and high and low flow hydro cooling methods. The weight of the precooled cauliflower heads (5000±5 g was measured before they were placed in standard plastic crates. Cauliflower heads, whose initial temperature was 23.5 ± 0.5 ºC, were cooled until the temperature reached at 1 ºC. During the precooling process, time-dependent temperature and energy consumption were measured, and during vacuum precooling, the decreasing pressure values were recorded, and a curve of time-dependent pressure decrease (vacuum was built. The most suitable cooling method to precool cauliflower in terms of cooling time and energy consumption was vacuum, followed by the high and low flow hydro and forced-air precooling methods, respectively. The highest weight loss was observed in the vacuum precooling method, followed by the forced-air method. However, there was an increase in the weight of the cauliflower heads in the high and low flow hydro precooling method. The best colour and hardness values were found in the vacuum precooling method. Among all methods tested, the most suitable method to precool cauliflower in terms of cooling and quality parameters was the vacuum precooling method.

  14. Development of new apple beverages rich in isothiocyanates by using extracts obtained from ultrasound-treated cauliflower by-products

    DEFF Research Database (Denmark)

    Amofa-Diatuo, Tracy; Anang, Daniel M.; Barba Orellana, Francisco Jose

    2017-01-01

    The objective of this study was to develop a new apple juice beverage enriched with isothiocyanates (ITC) - rich extracts obtained from cauliflower by-products. Ultrasound-assisted extraction (UAE) at different amplitudes (20-100%) and extraction times (0-10. min) at a frequency of 24. kHz was em......The objective of this study was to develop a new apple juice beverage enriched with isothiocyanates (ITC) - rich extracts obtained from cauliflower by-products. Ultrasound-assisted extraction (UAE) at different amplitudes (20-100%) and extraction times (0-10. min) at a frequency of 24. k......) and UAE (20%, 3. min), respectively. Moreover, the highest recovery of total phenolic compounds (TPC) (≈105. mg gallic acid equivalent (GAE)/L) μM) was found after UAE (100% amplitude, 3. min) of TPC from stems. ITC-rich extracts obtained from caulifower by-products at the optimum UAE conditions were...

  15. Dissipation kinetics of spinosad on cauliflower (Brassica oleracea var. botrytis. L.) under subtropical conditions of Punjab, India.

    Science.gov (United States)

    Mandal, Kousik; Jyot, Gagan; Singh, Balwinder

    2009-12-01

    Residues of spinosad were estimated in cauliflower curds using high performance liquid chromatography (HPLC) and confirmed by high performance thin layer chromatography (HPTLC). Following three application of spinosad (Success 2.5 SC) at 15 and 30 g a.i. ha−1, the average initial deposits of spinosad were observed to be 0.57 and 1.34 mg kg−1, respectively. These residues dissipated below the limit of quantification (LOQ) of 0.02 mg kg−1 after 10 days at both the dosages. The half-life values (T 1/2) of spinosad were worked out to be 1.20 and 1.58 days, respectively, at recommended and double the recommended dosages. Thus, a waiting period of 6 days is suggested for the safe consumption of spinosad treated cauliflower.

  16. Cauliflower hillock formation through crystallite migration of SnO2 thin films prepared on alumina substrates by using MOCVD

    International Nuclear Information System (INIS)

    Choi, Gwangpyo; Ryu, Hyunwook; Lee, Woosun; Hong, Kwangjun; Shin, Dongcharn; Park, Jinseong; Seo, Yongjin; Akbar, Sheikh A.

    2003-01-01

    Tin-oxide thin films were deposited at 375 .deg. C on α-alumina substrates by using metalorganic chemical vapor deposition (MOCVD) process. A number of hillocks were formed on the film after annealing in air at 500 .deg. C for 30 min, but fewer hillocks were formed for annealing in N 2 . The hillocks on the film and the grains on the alumina substrate were composed of crystallites. The oxygen content and the binding energy after annealing in air came to close to values for the stoichiometric SnO 2 . There was no relationship between the film thickness and the binding energy shift, but the binding energy did change with the annealing atmosphere and the oxygen content. The cauliflower hillocks on the film seem to be formed by the continuous migration of crystallites from cauliflower grains on the substrate to release the stress due to the increased oxygen content and volume. A cauliflower hillock can be grown by continuous migration of crystallites from nearby grains to the hillock.

  17. Enzyme-assisted extraction enhancing the phenolic release from cauliflower (Brassica oleracea L. var. botrytis) outer leaves.

    Science.gov (United States)

    Huynh, Nguyen Thai; Smagghe, Guy; Gonzales, Gerard Bryan; Van Camp, John; Raes, Katleen

    2014-07-30

    Phenolic compounds are highly present in byproducts from the cauliflower (Brassica oleracea L. var. botrytis) harvest and are thus a valuable source for valorization toward phenolic-rich extracts. In this study, we aimed to optimize and characterize the release of individual phenolic compounds from outer leaves of cauliflower, using two commercially available polysaccharide-degrading enzymes, Viscozyme L and Rapidase. As major results, the optimal conditions for the enzyme treatment were: enzyme/substrate ratio of 0.2% for Viscozyme L and 0.5% for Rapidase, temperature 35 °C, and pH 4.0. Using a UPLC-HD-TOF-MS setup, the main phenolic compounds in the extracts were identified as kaempferol glycosides and their combinations with different hydroxycinnamic acids. The most abundant components were kaempferol-3-feruloyldiglucoside and kaempferol-3-glucoside (respectively, 37.8 and 58.4 mg rutin equiv/100 g dry weight). Incubation of the cauliflower outer leaves with the enzyme mixtures resulted in a significantly higher extraction yield of kaempferol-glucosides as compared to the control treatment.

  18. Diverse accumulation of several dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress.

    Science.gov (United States)

    Rurek, Michal

    2010-08-18

    Dehydrins represent hydrophilic proteins acting mainly during cell dehydration and stress response. Dehydrins are generally thermostable; however, the so-called dehydrin-like (dehydrin-related) proteins show variable thermolability. Both groups immunoreact with antibodies directed against the K-segment of dehydrins. Plant mitochondrial dehydrin-like proteins are poorly characterized. The purpose of this study was to extend previous reports on plant dehydrins by comparing the level of immunoprecipitated dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress. All the analyzed plant species showed constitutive accumulation of thermostable mitochondrial putative dehydrins ranging from 50 to 70 kDa. The mitochondrial dehydrin-like proteins observed in cauliflower and Arabidopsis ranged from 10 to 100 kDa and in lupin imbibed seeds and hypocotyls--from 20 to 90 kDa. Cold treatment increased mainly the accumulation of 10-100 kDa cauliflower and Arabidopsis dehydrin-like proteins, in the patterns different in cauliflower leaf and inflorescence mitochondria. However, in lupin mitochondria, cold affected mainly 25-50 kDa proteins and seemed to induce the appearance of some novel dehydrin-like proteins. The influence of frost stress on cauliflower leaf mitochondrial dehydrin- like proteins was less significant. The impact of heat stress was less significant in lupin and Arabidopsis than in cauliflower inflorescence mitochondria. Cauliflower mitochondrial dehydrin-like proteins are localized mostly in the mitochondrial matrix; it seems that some of them may interact with mitochondrial membranes. All the results reveal an unexpectedly broad spectrum of dehydrin-like proteins accumulated during some abiotic stress in the mitochondria of the plant species analyzed. They display only limited similarity in size to those reported previously in maize, wheat and rye

  19. Diverse mechanisms of plant resistance to cauliflower mosaic virus revealed by leaf skeleton hybridization.

    Science.gov (United States)

    Melcher, U; Brannan, C M; Gardner, C O; Essenberg, R C

    1992-01-01

    Plants not hosts for cauliflower mosaic virus (CaMV) may prevent systemic CaMV infection by interfering with dissemination of infection through the plant or by preventing viral replication and maturation. Leaf skeleton hybridization allows distinction between these two barriers. The technique assesses the spatial distribution of CaMV in an inoculated leaf by hybridization of a skeleton of the leaf with a CaMV DNA probe. Leaves or leaflets of soybean, cucumber, peanut, tomato, lettuce, spinach, pepper, onion, wheat, maize and barley, inoculated with CaMV DNA or CaMV virions were processed for leaf skeleton hybridization either immediately after inoculation or two weeks thereafter. Autoradiographic images of soybean and cucumber skeletons had many dark spots suggesting that CaMV DNA replication and local spread had occurred. Images of onion leaf skeletons prepared two weeks after inoculation with CaMV DNA had fewer spots. To test whether these spots resulted from CaMV replication, DNA was extracted from inoculated onion leaves and analyzed by electrophoresis, blotting and hybridization. Molecules recovered two weeks after inoculation resembled those inoculated, indicating absence of replication. For the other species, we found no evidence of local spread of CaMV infections. Thus, many plant species resist systemic CaMV infection by preventing replication or local spread of CaMV, while others solely prevent systemic movement of infection.

  20. The chromoplasts of Or mutants of cauliflower (Brassica oleracea L. var. botrytis).

    Science.gov (United States)

    Paolillo, D J; Garvin, D F; Parthasarathy, M V

    2004-12-01

    The Or mutation in cauliflower (Brassica oleracea L. var. botrytis) leads to abnormal accumulations of beta-carotene in orange chromoplasts, in tissues in which leucoplasts are characteristic of wild-type plants. Or chromoplasts were investigated by light microscopy of fresh materials and electron microscopy of glutaraldehyde- and potassium permanganate-fixed materials. Carotenoid inclusions in Or chromoplasts resemble those found in carrot root chromoplasts in their optical activity and angular shape. Electron microscopy revealed that the inclusions are made up of parallel, membrane-bound compartments. These stacks of membranes are variously rolled and folded into three-dimensional objects. We classify Or chromoplasts as "membranous" chromoplasts. The Or mutation also limits plastid replication so that a single chromoplast constitutes the plastidome in most of the affected cells. There are one to two chromoplasts in each cell of a shoot apex. The ability of differentiated chromoplasts to divide in the apical meristems of Or mutant plants resembles the ability of proplastids to maintain plastid continuity from cell to cell in meristems of Arabidopsis thaliana mutants in which plastid replication is drastically limited. The findings are used to discuss the number of levels of regulation involved in plastid replication.

  1. The founder-cell transcriptome in the Arabidopsis apetala1 cauliflower inflorescence meristem.

    Science.gov (United States)

    Frerichs, Anneke; Thoma, Rahere; Abdallah, Ali Taleb; Frommolt, Peter; Werr, Wolfgang; Chandler, John William

    2016-11-03

    Although the pattern of lateral organ formation from apical meristems establishes species-specific plant architecture, the positional information that confers cell fate to cells as they transit to the meristem flanks where they differentiate, remains largely unknown. We have combined fluorescence-activated cell sorting and RNA-seq to characterise the cell-type-specific transcriptome at the earliest developmental time-point of lateral organ formation using DORNRÖSCHEN-LIKE::GFP to mark founder-cell populations at the periphery of the inflorescence meristem (IM) in apetala1 cauliflower double mutants, which overproliferate IMs. Within the lateral organ founder-cell population at the inflorescence meristem, floral primordium identity genes are upregulated and stem-cell identity markers are downregulated. Additional differentially expressed transcripts are involved in polarity generation and boundary formation, and in epigenetic and post-translational changes. However, only subtle transcriptional reprogramming within the global auxin network was observed. The transcriptional network of differentially expressed genes supports the hypothesis that lateral organ founder-cell specification involves the creation of polarity from the centre to the periphery of the IM and the establishment of a boundary from surrounding cells, consistent with bract initiation. However, contrary to the established paradigm that sites of auxin response maxima pre-pattern lateral organ initiation in the IM, auxin response might play a minor role in the earliest stages of lateral floral initiation.

  2. Localization of the N-terminal domain of cauliflower mosaic virus coat protein precursor

    International Nuclear Information System (INIS)

    Champagne, Julie; Benhamou, Nicole; Leclerc, Denis

    2004-01-01

    Cauliflower mosaic virus (CaMV) open reading frame (ORF) IV encodes a coat protein precursor (pre-CP) harboring an N-terminal extension that is cleaved off by the CaMV-encoded protease. In transfected cells, pre-CP is present in the cytoplasm, while the processed form (p44) of CP is targeted to the nucleus, suggesting that the N-terminal extension might be involved in keeping the pre-CP in the cytoplasm for viral assembly. This study reports for the first time the intracellular localization of the N-terminal extension during CaMV infection in Brassica rapa. Immunogold-labeling electron microscopy using polyclonal antibodies directed to the N-terminal extension of the pre-CP revealed that this region is closely associated with viral particles present in small aggregates, which we called small bodies, adjacent to the main inclusion bodies typical of CaMV infection. Based on these results, we propose a model for viral assembly of CaMV

  3. Hydrothermal growth of photoelectrochemically active titanium dioxide cauliflower-like nanostructures

    International Nuclear Information System (INIS)

    Pawar, Sachin A.; Devan, R.S.; Patil, D.S.; Burungale, V.V.; Bhat, T.S.; Mali, S.S.; Shin, S.W.; Ae, J.E.; Hong, C.K.; Ma, Y.R.; Kim, J.H.; Patil, P.S.

    2014-01-01

    Hierarchical titanium dioxide nanostructures have been synthesized by a simple and cost-effective hydrothermal deposition method onto the conducting glass substrates. In order to study the effect of titanium tetrachloride precursor quantity on the growth of TiO 2 ; the thin films of TiO 2 have been synthesized with the variations in the TiCl 4 from 0.4 mL to 1.0 mL at the interval of 0.2 mL. These films are characterized for their optical, structural, compositional, morphological properties using UV-vis spectrophotometer, Photoluminescence, X-ray Diffraction, High resolution transmission electron microscopy, X-ray Photoelectron Spectroscopy and Field Emission Scanning Electron Microscopy techniques. The optical band gap energy is found to increase from 2.74 to 3.06 eV with the increase in TiCl 4 quantities exhibiting a blue shift. XRD patterns show the formation of polycrystalline TiO 2 with the tetragonal crystal structure possessing rutile phase. Rise in the TiCl 4 quantity leads to the decrease in the particle size. The chemical composition and valence states of the constituent elements were analysed by XPS. FESEM images showed the formation of cauliflower-like structure at the highest TiCl 4 precursor quantity. The films were photoelectrochemically active with the maximum current density of 202 μA/cm 2 for the sample prepared at 1.0 mL

  4. Effect of high carbon dioxide storage and gamma irradiation on membrane deterioration in cauliflower florets

    International Nuclear Information System (INIS)

    Voisine, R.; Hombourger, C.; Willemot, C.; Castaigne, F.; Makhlouf, J.

    1993-01-01

    Controlled atmospheres and gamma irradiation are technologies which extend storage-life of fruits and vegetables. Separate and combined effects of high CO 2 storage and gamma irradiation on cell membranes from cauliflower florets (Brassica oleracea L., Botrytis group) were investigated. Storage of the florets for 8 days at 13°C, either under 15% carbon dioxide or in air after irradiation at 2 kGy, accelerated the deterioration of microsomal membranes during storage. Both treatments caused an early loss in lipid phosphate. Irradiation enhanced the free fatty acid content of the membranes during storage and caused an extensive protein loss. When irradiation and high CO 2 storage were combined, electrolyte leakage significantly increased while protein loss was considerably reduced. The results indicate that high CO 2 and irradiation accelerate membrane degradation through different mechanisms. The combined effects of the treatments were not additive, but membrane yield was apparently reduced. CO 2 protected the membranes from protein loss induced by irradiation. The apparent increase in electrolyte leakage after irradiation may be caused by the release of ions following cell wall deterioration

  5. Immunity at Cauliflower Hydathodes Controls Systemic Infection by Xanthomonas campestris pv campestris.

    Science.gov (United States)

    Cerutti, Aude; Jauneau, Alain; Auriac, Marie-Christine; Lauber, Emmanuelle; Martinez, Yves; Chiarenza, Serge; Leonhardt, Nathalie; Berthomé, Richard; Noël, Laurent D

    2017-06-01

    Hydathodes are water pores found on leaves of a wide range of vascular plants and are the sites of guttation. We report here on the detailed anatomy of cauliflower ( Brassica oleracea ) and Arabidopsis ( Arabidopsis thaliana ) hydathodes. Hydathode surface presents pores resembling stomata giving access to large cavities. Beneath, the epithem is composed of a lacunar and highly vascularized parenchyma offering a direct connection between leaf surface and xylem vessels. Arabidopsis hydathode pores were responsive to ABA and light similar to stomata. The flg22 flagellin peptide, a well-characterized elicitor of plant basal immunity, did not induce closure of hydathode pores in contrast to stomata. Because hydathodes are natural infection routes for several pathogens, we investigated hydathode infection by the adapted vascular phytopathogenic bacterium Xanthomonas campestris pv campestris ( Xcc ), the causal agent of black rot disease of Brassicaceae. Microscopic observations of hydathodes six days postinoculation indicated a digestion of the epithem cells and a high bacterial multiplication. Postinvasive immunity was shown to limit pathogen growth in the epithem and is actively suppressed by the type III secretion system and its effector proteins. Altogether, these results give a detailed anatomic description of Brassicaceae hydathodes and highlight the efficient use of this tissue as an initial niche for subsequent vascular systemic dissemination of Xcc in distant plant tissues. © 2017 American Society of Plant Biologists. All Rights Reserved.

  6. Purification and characterization of peroxidase from cauliflower (Brassica oleracea L. var. botrytis) buds.

    Science.gov (United States)

    Köksal, Ekrem; Gülçin, Ilhami

    2008-01-01

    Peroxidases (EC 1.11.1.7; donor: hydrogen peroxide oxidoreductase) are part of a large group of enzymes. In this study, peroxidase, a primer antioxidant enzyme, was purified with 19.3 fold and 0.2% efficiency from cauliflower (Brassica oleracea L.) by ammonium sulphate precipitation, dialysis, CM-Sephadex ion-exchange chromatography and Sephadex G-25 purification steps. The substrate specificity of peroxidase was investigated using 2,2'-azino-bis(3-ethylbenz-thiazoline-6-sulphonic acid) (ABTS), 2-methoxyphenol (guaiacol), 1,2-dihydroxybenzene (catechol), 1,2,3-trihyidroxybenzene (pyrogallol) and 4-methylcatechol. Also, optimum pH, optimum temperature, optimum ionic strength, stable pH, stable temperature, thermal inactivation conditions were determined for guaiacol/H(2)O(2), pyrogallol/H(2)O(2), ABTS/H(2)O(2), catechol/H(2)O(2) and 4-methyl catechol/H(2)O(2) substrate patterns. The molecular weight (M(w)) of this enzyme was found to be 44 kDa by gel filtration chromatography method. Native polyacrylamide gel electrophoresis (PAGE) was performed for isoenzyme determination and a single band was observed. K(m) and V(max) values were calculated from Lineweaver-Burk graph for each substrate patterns.

  7. Antiviral activity of tenofovir against Cauliflower mosaic virus and its metabolism in Brassica pekinensis plants.

    Science.gov (United States)

    Spak, Josef; Votruba, Ivan; Pavingerová, Daniela; Holý, Antonín; Spaková, Vlastimila; Petrzik, Karel

    2011-11-01

    The antiviral effect of the acyclic nucleoside phosphonate tenofovir (R)-PMPA on double-stranded DNA Cauliflower mosaic virus (CaMV) in Brassica pekinensis plants grown in vitro on liquid medium was evaluated. Double antibody sandwich ELISA and PCR were used for relative quantification of viral protein and detecting nucleic acid in plants. (R)-PMPA at concentrations of 25 and 50 mg/l significantly reduced CaMV titers in plants within 6-9 weeks to levels detectable neither by ELISA nor by PCR. Virus-free plants were obtained after 3-month cultivation of meristem tips on semisolid medium containing 50 mg/l (R)-PMPA and their regeneration to whole plants in the greenhouse. Studying the metabolism of (R)-PMPA in B. pekinensis revealed that mono- and diphosphate, structural analogs of NDP and/or NTP, are the only metabolites formed. The data indicate very low substrate activity of the enzymes toward (R)-PMPA as substrate. The extent of phosphorylation in the plant's leaves represents only 4.5% of applied labeled (R)-PMPA. In roots, we detected no radioactive peaks of phosphorylated metabolites of (R)-PMPAp or (R)-PMPApp. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. A recyclable protein resource derived from cauliflower by-products: Potential biological activities of protein hydrolysates.

    Science.gov (United States)

    Xu, Yang; Li, Yuting; Bao, Tao; Zheng, Xiaodong; Chen, Wei; Wang, Jianxu

    2017-04-15

    Cauliflower by-products (CBP) are rich in leaf protein. Every year tons of CBP will lead to environmental pollution. Therefore, this study was conducted to extract leaf protein from CBP and investigate its biological activities. Our results showed that the optimal extraction parameters were: a liquid to solid ratio of 4mL/g, a pH of 11, an ultrasonic extraction lasting 15min, and at an applied power of 175W. Under these optimized conditions, 12.066g of soluble leaf protein (SLP) was obtained from 1000g of CBP and its extraction yield was 53.07%. The obtained SLP was further hydrolysed by Alcalase and the SLP hydrolysate (SLPH) showed a potent angiotensin I-converting enzyme (ACE) inhibitory activity with an IC 50 value of 138.545μg/mL in vitro. In addition, SLPH promoted the glucose consumption and enhanced the glycogen content in HepG2 cells. Overall, our results suggested that CBP may be recycled for designing future functional foods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Setting Up Shop: The Formation and Function of the Viral Factories of Cauliflower mosaic virus

    Directory of Open Access Journals (Sweden)

    James E. Schoelz

    2017-10-01

    Full Text Available Similar to cells, viruses often compartmentalize specific functions such as genome replication or particle assembly. Viral compartments may contain host organelle membranes or they may be mainly composed of viral proteins. These compartments are often termed: inclusion bodies (IBs, viroplasms or viral factories. The same virus may form more than one type of IB, each with different functions, as illustrated by the plant pararetrovirus, Cauliflower mosaic virus (CaMV. CaMV forms two distinct types of IBs in infected plant cells, those composed mainly of the viral proteins P2 (which are responsible for transmission of CaMV by insect vectors and P6 (required for viral intra-and inter-cellular infection, respectively. P6 IBs are the major focus of this review. Much of our understanding of the formation and function of P6 IBs comes from the analyses of their major protein component, P6. Over time, the interactions and functions of P6 have been gradually elucidated. Coupled with new technologies, such as fluorescence microscopy with fluorophore-tagged viral proteins, these data complement earlier work and provide a clearer picture of P6 IB formation. As the activities and interactions of the viral proteins have gradually been determined, the functions of P6 IBs have become clearer. This review integrates the current state of knowledge on the formation and function of P6 IBs to produce a coherent model for the activities mediated by these sophisticated virus-manufacturing machines.

  10. Biology and life table parameters of Brevicoryne brassicae (Hemiptera: Aphididae) on cauliflower cultivars.

    Science.gov (United States)

    Jahan, Fatemeh; Abbasipour, Habib; Askarianzadeh, Alireza; Hassanshahi, Golamhossein; Saeedizadeh, Ayatallah

    2014-01-01

    In this article, the biology and fertility life table parameters of the cabbage aphid, Brevicoryne brassicae (L.) (Hemiptera: Aphididae), were studied on cauliflower leaves, Brassica oleracea var. botrytis (Brassicales: Brassicaceae), of the cultivars Smilla, Snow mystique, White cloud, Buris, Galiblanka, Snow crown, SG, and Tokita. This study was conducted under controlled conditions: 25 ± 2°C, 65 ± 5% relative humidity (RH), and 16:8 (L:D) h photoperiods. Statistical analysis showed that there was a significant difference (P < 0.05) between the different growth stages and the mean number of laid nymphs. Further, the maximum and minimum growth periods were observed on Galiblanka and Buris cultivars, respectively. The shortest nymphal instar growth period was observed on the Smilla cultivar (6.70 d), and the longest lifespan was seen on the White cloud (8.10 d). The Smilla cultivar (39%), in an adult emergence stage, and the SG (88%) revealed the lowest and highest rates of survival, respectively. Aphids reared on the Smilla cultivar were found to have increased due to the high intrinsic (r(m)) and finite (λ) rate of increase and the low doubling time (DT). The results indicated that the application of cultivars affecting adult reproductive parameters could be a good solution to cabbage aphid control management. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  11. Immunity at Cauliflower Hydathodes Controls Systemic Infection by Xanthomonas campestris pv campestris1

    Science.gov (United States)

    Cerutti, Aude; Jauneau, Alain; Auriac, Marie-Christine; Lauber, Emmanuelle; Martinez, Yves; Chiarenza, Serge

    2017-01-01

    Hydathodes are water pores found on leaves of a wide range of vascular plants and are the sites of guttation. We report here on the detailed anatomy of cauliflower (Brassica oleracea) and Arabidopsis (Arabidopsis thaliana) hydathodes. Hydathode surface presents pores resembling stomata giving access to large cavities. Beneath, the epithem is composed of a lacunar and highly vascularized parenchyma offering a direct connection between leaf surface and xylem vessels. Arabidopsis hydathode pores were responsive to ABA and light similar to stomata. The flg22 flagellin peptide, a well-characterized elicitor of plant basal immunity, did not induce closure of hydathode pores in contrast to stomata. Because hydathodes are natural infection routes for several pathogens, we investigated hydathode infection by the adapted vascular phytopathogenic bacterium Xanthomonas campestris pv campestris (Xcc), the causal agent of black rot disease of Brassicaceae. Microscopic observations of hydathodes six days postinoculation indicated a digestion of the epithem cells and a high bacterial multiplication. Postinvasive immunity was shown to limit pathogen growth in the epithem and is actively suppressed by the type III secretion system and its effector proteins. Altogether, these results give a detailed anatomic description of Brassicaceae hydathodes and highlight the efficient use of this tissue as an initial niche for subsequent vascular systemic dissemination of Xcc in distant plant tissues. PMID:28184011

  12. A novel biochar derived from cauliflower (Brassica oleracea L.) roots could remove norfloxacin and chlortetracycline efficiently.

    Science.gov (United States)

    Qin, Tingting; Wang, Zhaowei; Xie, Xiaoyun; Xie, Chaoran; Zhu, Junmin; Li, Yan

    2017-12-01

    The biochar was prepared by pyrolyzing the roots of cauliflowers, at a temperature of 500 °C under oxygen-limited conditions. The structure and characteristics of the biochar were examined using scanning electron microscopy, an energy dispersive spectrometer, a zeta potential analyzer, and Fourier transform infrared spectroscopy. The effects of the temperature, the initial pH, antibiotic concentration, and contact time on the adsorption of norfloxacin (NOR) and chlortetracycline (CTC) onto the biochar were investigated. The adsorption kinetics of NOR and CTC onto the biochar followed the pseudo-second-order kinetic and intra-particle diffusion models. The adsorption isotherm experimental data were well fitted to the Langmuir and Freundlich isotherm models. The maximum adsorption capacities of NOR and CTC were 31.15 and 81.30 mg/g, respectively. There was little difference between the effects of initial solution pH (4.0-10.0) on the adsorption of NOR or CTC onto the biochar because of the buffering effect. The biochar could remove NOR and CTC efficiently in aqueous solutions because of its large specific surface area, abundant surface functional groups, and particular porous structure. Therefore, it could be used as an excellent adsorbent material because of its low cost and high efficiency and the extensive availability of the raw materials.

  13. Forced-air, vacuum, and hydro precooling of cauliflower (Brassica oleracea L. var. botrytis cv. Freemont: Part II. Determination of quality parameters during storage

    Directory of Open Access Journals (Sweden)

    Ilknur Alibas

    2015-03-01

    Full Text Available Cauliflower heads, which were precooled using four different methods including vacuum, forced-air, and high and low flow hydro precooling, were stored under controlled atmosphere and room conditions. Controlled atmosphere conditions (CA were as follows: 1°C temperature, 90 ± 5% relative humidity, and 0:21 [(%CO2:%O2 – (0:21 control] atmosphere composition. Room conditions (RC were: 22±1°C temperature and 55-60% humidity. Various quality parameters of the cauliflower heads were assessed during storage (days 0, 7, 14, 21, 28, and 35 under controlled atmosphere and room conditions (days 0, 5, and 10. During storage, weight loss, deterioration rate, overall sensory quality score, hardness, and colour (L, a, b, C and α were evaluated. In the present study, the strength and quality parameters of cauliflower under CA and RC conditions were obtained. Vacuum precooling was found to be most suitable method before cauliflower was submitted to cold storage and sent to market. Furthermore, the storage of cauliflower without precooling resulted in a significant decrease in quality parameters.

  14. Large-scale synthesis of double cauliflower-like Sb{sub 2}S{sub 3} microcrystallines by hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Lei [Key Laboratory for Soft Chemistry and Functional Materials, Ministry of Education (China); Xu, Hanyue [School of Electronic and Optical Engineering, Nanjing University of Science and Technology, Nanjing 210094 (China); Han, Qiaofeng, E-mail: hanqiaofeng@njust.edu.cn [Key Laboratory for Soft Chemistry and Functional Materials, Ministry of Education (China); Wang, Xin [Key Laboratory for Soft Chemistry and Functional Materials, Ministry of Education (China)

    2013-09-25

    Highlights: •Highly uniform double cauliflower-like Sb{sub 2}S{sub 3} particles were synthesized via hydrothermal method. •Influence of reaction conditions on the morphology of the products was discussed. •Double cauliflower-like Sb{sub 2}S{sub 3} superstructures revealed broad spectrum response. -- Abstract: The double cauliflower-like Sb{sub 2}S{sub 3} superstructures assembled by nanorods were prepared using SbCl{sub 3} and Na{sub 2}S⋅9H{sub 2}O as raw materials, dodecyltrimethylammonium bromide (DTAB, C{sub 15}H{sub 31}BrN) as surfactant under acidic condition at 180 °C for 30 h. The structure, morphology and composition of the product were characterized by X-ray diffraction pattern (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and energy diffraction spectroscopy (EDS). The effect of reaction conditions including temperature, reaction time and surfactants on the sample morphology was discussed and a possible mechanism for the formation of cauliflower-like Sb{sub 2}S{sub 3} was proposed. The cauliflower-like Sb{sub 2}S{sub 3} microcrystallines revealed broad spectrum response, which may have a good application prospect in solar energy utilization and photoelectric conversion fields.

  15. Physiological potential of cauliflower seeds Potencial fisiológico de sementes de couve-flor

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Pereira Kikuti

    2008-01-01

    Full Text Available The assessment of seed physiological performance is essential to provide consistent information to compose quality control programs conducted by seed companies and allow prompt decisions to reduce post-harvest and commercialization problems. This research was carried to evaluate the efficiency of different procedures to determine cauliflower seed vigor. Six lots of the cultivar Sharon were initially characterized by germination and seedling emergence, and subsequently subjected to traditional and saturated salt accelerated aging, controlled deterioration, electrical conductivity, and potassium leachate tests, in two evaluation times. The traditional accelerated aging (41ºC/48 h, the saturated salt procedure (45ºC/72 h, the controlled deterioration (moisture content adjusted to 20% or 22% and aging at 45ºC/24 h, the electrical conductivity (50 seeds/75 mL water and evaluation after 4 h and the potassium leakage (25 seeds/50 mL of water and evaluation after 30 min laboratory tests are sensitive to detect differences in the physiological potential of cauliflower seeds. However, those results did not relate to the percentage seedling emergence in greenhouse controlled conditions, as a consequence of the favorable conditions for emergence. However, the differences identified in the tests may be related to the ability of seed lots to perform in less favorable environments.A eficiência da determinação do potencial fisiológico de lotes de sementes é essencial para a obtenção de informações consistentes, permitindo a composição de programas de controle de qualidade de sementes e a obtenção de informações consistentes para a redução de problemas pós-colheita e durante a comercialização. O objetivo desta pesquisa foi comparar a eficiência de diferentes procedimentos para a determinação do vigor de sementes de couve-flor. Para tanto, foram utilizados seis lotes do cultivar Sharon, caracterizados inicialmente pelos testes de germina

  16. Large-scale cauliflower-shaped hierarchical copper nanostructures for efficient photothermal conversion

    Science.gov (United States)

    Fan, Peixun; Wu, Hui; Zhong, Minlin; Zhang, Hongjun; Bai, Benfeng; Jin, Guofan

    2016-07-01

    Efficient solar energy harvesting and photothermal conversion have essential importance for many practical applications. Here, we present a laser-induced cauliflower-shaped hierarchical surface nanostructure on a copper surface, which exhibits extremely high omnidirectional absorption efficiency over a broad electromagnetic spectral range from the UV to the near-infrared region. The measured average hemispherical absorptance is as high as 98% within the wavelength range of 200-800 nm, and the angle dependent specular reflectance stays below 0.1% within the 0-60° incident angle. Such a structured copper surface can exhibit an apparent heating up effect under the sunlight illumination. In the experiment of evaporating water, the structured surface yields an overall photothermal conversion efficiency over 60% under an illuminating solar power density of ~1 kW m-2. The presented technology provides a cost-effective, reliable, and simple way for realizing broadband omnidirectional light absorptive metal surfaces for efficient solar energy harvesting and utilization, which is highly demanded in various light harvesting, anti-reflection, and photothermal conversion applications. Since the structure is directly formed by femtosecond laser writing, it is quite suitable for mass production and can be easily extended to a large surface area.Efficient solar energy harvesting and photothermal conversion have essential importance for many practical applications. Here, we present a laser-induced cauliflower-shaped hierarchical surface nanostructure on a copper surface, which exhibits extremely high omnidirectional absorption efficiency over a broad electromagnetic spectral range from the UV to the near-infrared region. The measured average hemispherical absorptance is as high as 98% within the wavelength range of 200-800 nm, and the angle dependent specular reflectance stays below 0.1% within the 0-60° incident angle. Such a structured copper surface can exhibit an apparent

  17. Photoreactivation of DNA-containing cauliflower mosaic virus and tobacco mosaic virus RNA on Datura

    International Nuclear Information System (INIS)

    Towill, L.; Huang, C.W.; Gordon, M.P.

    1977-01-01

    Datura stramonium L. is a local lesion host for TMV-RNA and DNA-containing cauliflower mosaic virus (CAMV). Datura can photorepair UV-damaged TMV-RNA and CAMV, giving photoreactivation sectors of 0.40 and 0.33, respectively. Dose response curves for photoreactivation of TMV-RNA and CAMV showed that 45 to 60 min of cool white light (15 W.m -2 ) was required for maximum photoreactivation. Blue light and near UV were equally effective in photoreactivating UV-irradiated TMV-RNA, whereas near UV was initially more effective than blue light for the photorepair of UV-inactivated CAMV. Higher doses of near UV apparently inactivated the CAMV photorepair system. In the case of CAMV, photoreactivating light had to be applied immediately after inoculation with the virus. Two to three hours of incubation in the dark after inoculation resulted in complete loss of response to photoreactivating irradiation. In contrast, limited photoreactivation of TMV-RNA occurred even after 4 h of dark incubation after inoculation, although photoreactivating irradiation was most effective when applied immediately after inoculation. Light was required for the maintenance of photoreactivation for both TMV-RNA and CAMV. Daturas placed in the dark for six days lost their ability to photoreactivate. Recovery of the TMV-RNA photorepair system was rapid; complete recovery attained with 90 or more min of white light (15 W.m -2 ). Recovery of CAMV photorepair system was slow; 90% recovery attained after only 20 h of light. However, full recovery could be induced by as little as 6 h of light when CAMV was inoculated 24 h after the onset of illumination. These results suggest two photorepair systems are present in Datura. (author)

  18. Cauliflower-derived porous carbon without activation for electrochemical capacitor and CO2 capture applications

    Science.gov (United States)

    Du, Juan; Yu, Yifeng; Lv, Haijun; Chen, Chunlin; Zhang, Jian; Chen, Aibing

    2018-01-01

    Carbon materials have attracted great attention in CO2 capture and energy storage due to their excellent characteristics such as tunable pore structure, modulated surface properties and superior bulk conductivities, etc. Biomass, provided by nature with non-toxic, widespread, abundant, and sustainable advantages, is considered to be a very promising precursor of carbons for the view of economic, environmental, and societal issues. However, the preparation of high-performance biomass-derived carbons is still a big challenge because of the multistep process for their synthesis and subsequent activation. Herein, hierarchically porous structured carbon materials have been prepared by directly carbonizing dried cauliflowers without any addition of agents and activation process, featuring with large specific surface area, hierarchically porous structure and improved pore volume, as well as suitable nitrogen content. Being used as a solid-state CO2 adsorbent, the obtained product exhibited a high CO2 adsorption capacity of 3.1 mmol g-1 under 1 bar and 25 °C and a remarkable reusability of 96.7% retention after 20 adsorption/regeneration cycles. Our study reveals that choosing a good biomass source was significant as the unique structure of precursor endows the carbonized product with abundant pores without the need of any post-treatment. Used as an electrode material in electrochemical capacitor, the non-activated porous carbon displayed a fairly high specific capacitance of 228.9 F g-1 at 0.5 A g-1 and an outstanding stability of 99.2% retention after 5000 cycles at 5 A g-1. [Figure not available: see fulltext.

  19. Introgression of Black Rot Resistance from Brassica carinata to Cauliflower (Brassica oleracea botrytis Group) through Embryo Rescue

    Science.gov (United States)

    Sharma, Brij B.; Kalia, Pritam; Singh, Dinesh; Sharma, Tilak R.

    2017-01-01

    Black rot caused by Xanthomonas campestris pv. campestris (Xcc) is a very important disease of cauliflower (Brassica oleracea botrytis group) resulting into 10–50% yield losses every year. Since there is a dearth of availability of resistance to black rot disease in B. oleracea (C genome), therefore exploration of A and B genomes was inevitable as they have been reported to be potential reservoirs of gene(s) for resistance to black rot. To utilize these sources, interspecific hybrid and backcross progeny (B1) were generated between cauliflower “Pusa Sharad” and Ethiopian mustard “NPC-9” employing in vitro embryo rescue technique. Direct ovule culture method was better than siliqua culture under different temperature regime periods. Hybridity testing of F1 inter-specific plants was carried out using co-dominant SSR marker and Brassica B and C genome-specific (DB and DC) primers. Meiosis in the di-genomic (BCC) interspecific hybrid of B. oleracea botrytis group (2n = 18, CC) × B. carinata (2n = 4x = 34, BBCC) was higly disorganized and cytological analysis of pollen mother cells revealed chromosomes 2n = 26 at metaphase-I. Fertile giant pollen grain formation was observed frequently in interspecific F1 hybrid and BC1 plants. The F1 inter-specific plants were found to be resistant to Xcc race 1. Segregation distortion was observed in BC1 generation for black rot resistance and different morphological traits. The At1g70610 marker analysis confirmed successful introgression of black rot resistance in interspecific BC1 population. This effort will go a long way in pyramiding gene(s) for resistance against black rot in Cole crops, especially cauliflower and cabbage for developing durable resistance, thus minimize dependency on bactericides. PMID:28769959

  20. Introgression of Black Rot Resistance from Brassica carinata to Cauliflower (Brassica oleracea botrytis Group through Embryo Rescue

    Directory of Open Access Journals (Sweden)

    Brij B. Sharma

    2017-07-01

    Full Text Available Black rot caused by Xanthomonas campestris pv. campestris (Xcc is a very important disease of cauliflower (Brassica oleracea botrytis group resulting into 10–50% yield losses every year. Since there is a dearth of availability of resistance to black rot disease in B. oleracea (C genome, therefore exploration of A and B genomes was inevitable as they have been reported to be potential reservoirs of gene(s for resistance to black rot. To utilize these sources, interspecific hybrid and backcross progeny (B1 were generated between cauliflower “Pusa Sharad” and Ethiopian mustard “NPC-9” employing in vitro embryo rescue technique. Direct ovule culture method was better than siliqua culture under different temperature regime periods. Hybridity testing of F1 inter-specific plants was carried out using co-dominant SSR marker and Brassica B and C genome-specific (DB and DC primers. Meiosis in the di-genomic (BCC interspecific hybrid of B. oleracea botrytis group (2n = 18, CC × B. carinata (2n = 4x = 34, BBCC was higly disorganized and cytological analysis of pollen mother cells revealed chromosomes 2n = 26 at metaphase-I. Fertile giant pollen grain formation was observed frequently in interspecific F1 hybrid and BC1 plants. The F1 inter-specific plants were found to be resistant to Xcc race 1. Segregation distortion was observed in BC1 generation for black rot resistance and different morphological traits. The At1g70610 marker analysis confirmed successful introgression of black rot resistance in interspecific BC1 population. This effort will go a long way in pyramiding gene(s for resistance against black rot in Cole crops, especially cauliflower and cabbage for developing durable resistance, thus minimize dependency on bactericides.

  1. Introgression of Black Rot Resistance from Brassica carinata to Cauliflower (Brassica oleracea botrytis Group) through Embryo Rescue.

    Science.gov (United States)

    Sharma, Brij B; Kalia, Pritam; Singh, Dinesh; Sharma, Tilak R

    2017-01-01

    Black rot caused by Xanthomonas campestris pv. campestris ( Xcc ) is a very important disease of cauliflower ( Brassica oleracea botrytis group) resulting into 10-50% yield losses every year. Since there is a dearth of availability of resistance to black rot disease in B. oleracea (C genome), therefore exploration of A and B genomes was inevitable as they have been reported to be potential reservoirs of gene(s) for resistance to black rot. To utilize these sources, interspecific hybrid and backcross progeny (B 1 ) were generated between cauliflower "Pusa Sharad" and Ethiopian mustard "NPC-9" employing in vitro embryo rescue technique. Direct ovule culture method was better than siliqua culture under different temperature regime periods. Hybridity testing of F 1 inter-specific plants was carried out using co-dominant SSR marker and Brassica B and C genome-specific (DB and DC) primers. Meiosis in the di-genomic (BCC) interspecific hybrid of B. oleracea botrytis group (2 n = 18, CC) × B. carinata (2 n = 4x = 34, BBCC) was higly disorganized and cytological analysis of pollen mother cells revealed chromosomes 2 n = 26 at metaphase-I. Fertile giant pollen grain formation was observed frequently in interspecific F 1 hybrid and BC 1 plants. The F 1 inter-specific plants were found to be resistant to Xcc race 1. Segregation distortion was observed in BC 1 generation for black rot resistance and different morphological traits. The At1g70610 marker analysis confirmed successful introgression of black rot resistance in interspecific BC 1 population. This effort will go a long way in pyramiding gene(s) for resistance against black rot in Cole crops, especially cauliflower and cabbage for developing durable resistance, thus minimize dependency on bactericides.

  2. Characterization of the regulatory network of BoMYB2 in controlling anthocyanin biosynthesis in purple cauliflower.

    Science.gov (United States)

    Chiu, Li-Wei; Li, Li

    2012-10-01

    Purple cauliflower (Brassica oleracea L. var. botrytis) Graffiti represents a unique mutant in conferring ectopic anthocyanin biosynthesis, which is caused by the tissue-specific activation of BoMYB2, an ortholog of Arabidopsis PAP2 or MYB113. To gain a better understanding of the regulatory network of anthocyanin biosynthesis, we investigated the interaction among cauliflower MYB-bHLH-WD40 network proteins and examined the interplay of BoMYB2 with various bHLH transcription factors in planta. Yeast two-hybrid studies revealed that cauliflower BoMYBs along with the other regulators formed the MYB-bHLH-WD40 complexes and BobHLH1 acted as a bridge between BoMYB and BoWD40-1 proteins. Different BoMYBs exhibited different binding activity to BobHLH1. Examination of the BoMYB2 transgenic lines in Arabidopsis bHLH mutant backgrounds demonstrated that TT8, EGL3, and GL3 were all involved in the BoMYB2-mediated anthocyanin biosynthesis. Expression of BoMYB2 in Arabidopsis caused up-regulation of AtTT8 and AtEGL3 as well as a subset of anthocyanin structural genes encoding flavonoid 3'-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase. Taken together, our results show that MYB-bHLH-WD40 network transcription factors regulated the bHLH gene expression, which may represent a critical feature in the control of anthocyanin biosynthesis. BoMYB2 together with various BobHLHs specifically regulated the late anthocyanin biosynthetic pathway genes for anthocyanin biosynthesis. Our findings provide additional information for the complicated regulatory network of anthocyanin biosynthesis and the transcriptional regulation of transcription factors in vegetable crops.

  3. Biomolecular and structural analyses of cauliflower-like DNAs by ultraviolet, circular dichroism, and fluorescence spectroscopies in comparison with natural DNA.

    Science.gov (United States)

    Gill, Pooria; Ranjbar, Bijan; Saber, Reza; Khajeh, Khosro; Mohammadian, Mehdi

    2011-07-01

    Cauliflower-like DNAs are stem-loop DNAs that are fabricated periodically in inverted repetitions from deoxyribonucleic acid phosphates (dNTPs) by loop-mediated isothermal amplification (LAMP). Cauliflower-like DNAs have ladder-shape behaviors on gel electrophoresis, and increasing the time of LAMP leads to multiplying the repetitions, stem-loops, and electrophoretic bands. Cauliflower-like DNAs were fabricated via LAMP using two loop primers, two bumper primers, dNTPs, a λ-phage DNA template, and a Bst DNA polymerase in 75- and 90-min periods. These times led to manufacturing two types of cauliflower-like DNAs with different contents of inverted repetitions and stem-loops, which were clearly indicated by two comparable electrophoresis patterns in agarose gel. LAMP-fabricated DNAs and natural dsB-DNA (salmon genomic DNA) were dialyzed in Gomori phosphate buffer (10 mM, pH 7.4) to be isolated from salts, nucleotides, and primers. Dialyzed DNAs were studied using UV spectroscopy, circular dichroism spectropolarimetry, and fluorescence spectrophotometry. Structural analyses indicated reduction of the molecular ellipticity and extinction coefficients in comparison with B-DNA. Also, cauliflower-like DNAs demonstrated less intrinsic and more extrinsic fluorescence in comparison with natural DNA. The overwinding and lengthening of the cauliflower-like configurations of LAMP DNAs led to changes in physical parameters of this type of DNA in comparison with natural DNA. The results obtained introduced new biomolecular characteristics of DNA macromolecules fabricated within a LAMP process and show the effects of more inverted repeats and stem-loops, which are manufactured by lengthening the process.

  4. Pesticide residues in cauliflower, eggplant, endive, lettuce, pepper, potato and wheat of the slovene origin found in 2009.

    Science.gov (United States)

    Baša-Česnik, Helena; Velikonja-Bolta, Spela; Gregorčič, Ana

    2010-12-01

    In the year 2009, 170 cauliflower, eggplant, endive, lettuce, pepper, potato and wheat samples from Slovene producers were analysed for pesticide residues. The samples were analysed for the presence of 214 different active compounds using three analytical methods. MRL exceedances have not been observed, which is better than the results obtained from the monitoring of pesticide residues in the products of plant origin in the European Union, Norway, Iceland and Liechtenstein for the years 2004 to 2006. We have observed that MRL exceedances in Slovenia have been reduced in recent times. We assume that the farmers have learned how to use PPP safely in accordance with good agricultural practice.

  5. [Isolation and identification of specific sequences correlated to cytoplasmic male sterility and fertile maintenance in cauliflower (Brassica oleracea var. botrytis)].

    Science.gov (United States)

    Wang, Chun Guo; Chen, Xiao Qiang; Li, Hui; Zhao, Qian Cheng; Sun, De Ling; Song, Wen Qin

    2008-02-01

    Analysis of ISSR (Inter-Simple Sequence Repeat) and DDRT-PCR (Differential Display Reverse Transcriptase Polymerase Chain Reaction) was performed between cytoplasmic male sterility cauliflower ogura-A and its corresponding maintainer line ogura-B. Totally, 306 detectable bands were obtained by ISSR using thirty oligonucleotide primers. Commonly, six to twelve bands were produced per primer. Among all these primers only the amplification of primer ISSR3 was polymorphic, an 1100 bp specific band was only detected in maintainer line, named ISSR3(1100). Analysis of this sequence indicated that ISSR3(1100) was high homologous with the corresponding sequences of mitochondrial genome in Brassica napus and Arabidopsis thaliana,which suggested that ISSR3(1100) may derive from mitochondrial genome in cauliflower. To carry out DDRT-PCR analysis, three anchor primers and fifteen random primers were selected to combine. Totally, 1122 bands from 1 000 bp to 50 bp were detected. However, only four bands, named ogura-A 205, ogura-A383, ogura-B307 and ogura-B352, were confirmed to be different display in both lines. This result was further identified by reverse Northern dot blotting analysis. Among these four bands, ogura-A205 and ogura-A383 only express in cytoplasmic male sterility line, while ogura-B307 and ogura-B352 were only detected in maintainer line. Analysis of these sequences indicated that it was the first time that these four sequences were reported in cauliflower. Interestingly, ogura-A205 and ogura-B307 did not exhibit any similarities to other reported sequences in other species, more investigations were required to obtain further information. ogura-A383 and ogura-B352 were also two new sequences, they showed high similarities to corresponding chloroplast sequences of Arabidopsis thaliana and Brassica rapa subsp. pekinensis. So we speculated that these two sequences may derive from chloroplast genome. All these results obtained in this study offer new and

  6. Preparation of cauliflower-like CdS/ZnS/ZnO nanostructure and its photoelectric properties

    Science.gov (United States)

    Liu, Zhifeng; Guo, Keying; Wang, Yun; Zheng, Xuerong; Ya, Jing; Li, Junwei; Han, Li; Liu, Zhichao; Han, Jianhua

    2014-06-01

    Cauliflower-like CdS/ZnS/ZnO nanostructure is fabricated via a simple hydrothermal method. Factors such as concentration of reaction solution, reaction temperature, as well as reaction time in the synthetic process are investigated, and the working mechanism of the nanostructure is suggested. Hydrogen generation efficiency of 4.69 % at 0.29 V versus saturated calomel electrode is achieved using synthesized nanostructure as electrode due to the improved absorption and appropriate energy gap structure, which is confirmed by enhanced absorption spectrum. The expected products have potential application in photoelectrochemical water splitting.

  7. Comparative analysis of genetic diversity and differentiation of cauliflower (Brassica oleracea var. botrytis accessions from two ex situ genebanks.

    Directory of Open Access Journals (Sweden)

    Eltohamy A A Yousef

    Full Text Available Cauliflower (Brassica oleracea var. botrytis is an important vegetable crop for human nutrition. We characterized 192 cauliflower accessions from the USDA and IPK genebanks with genotyping by sequencing (GBS. They originated from 26 different countries and represent about 44% of all cauliflower accessions in both genebanks. The analysis of genetic diversity revealed that accessions formed two major groups that represented the two genebanks and were not related to the country of origin. This differentiation was robust with respect to the analysis methods that included principal component analysis, ADMIXTURE and neighbor-joining trees. Genetic diversity was higher in the USDA collection and significant phenotypic differences between the two genebanks were found in three out of six traits investigated. GBS data have a high proportion of missing data, but we observed that the exclusion of single nucleotide polymorphisms (SNPs with missing data or the imputation of missing SNP alleles produced very similar results. The results indicate that the composition and type of accessions have a strong effect on the structure of genetic diversity of ex situ collections, although regeneration procedures and local adaptation to regeneration conditions may also contribute to a divergence. Fst-based outlier tests of genetic differentiation identified only a small proportion (<1% of SNPs that are highly differentiated between the two genebanks, which indicates that selection during seed regeneration is not a major cause of differentiation between genebanks. Seed regeneration procedures of both genebanks do not result in different levels of genetic drift and loss of genetic variation. We therefore conclude that the composition and type of accessions mainly influence the level of genetic diversity and explain the strong genetic differentiation between the two ex situ collections. In summary, GBS is a useful method for characterizing genetic diversity in cauliflower

  8. Effect of cooking on the concentration of bioactive compounds in broccoli (Brassica oleracea var. Avenger) and cauliflower (Brassica oleracea var. Alphina F1) grown in an organic system.

    Science.gov (United States)

    Dos Reis, Luzia Caroline Ramos; de Oliveira, Viviani Ruffo; Hagen, Martine Elisabeth Kienzle; Jablonski, André; Flôres, Simone Hickmann; de Oliveira Rios, Alessandro

    2015-04-01

    Brassica vegetables have been shown to have antioxidant capacities due to the presence of carotenoids, flavonoids and vitamins. This study evaluates the influence of different processing conditions (boiling, steaming, microwaving and sous vide) on the stability of flavonoids, carotenoids and vitamin A in broccoli and cauliflower inflorescences grown in an organic system. Results indicated that sous vide processing resulted in greater antioxidant capacity and that all processes contributed in some way to an increased content of antioxidant compounds in both cauliflower and broccoli. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Cauliflower-Like Co3O4/Three-Dimensional Graphene Composite for High Performance Supercapacitor Applications

    Directory of Open Access Journals (Sweden)

    Huili Liu

    2015-01-01

    Full Text Available Cauliflower-like Co3O4/three-dimensional (3D graphene nanocomposite material was synthesized by a facile two-step synthesis route (heat reduction of graphite oxide (GO and hydrothermal synthesis of Co3O4. The phase composition, morphology, and structure of the as-obtained products were characterized by scanning electron microscopy (SEM, transmission electron microscope (TEM, and X-ray diffraction (XRD. Electrochemical properties as supercapacitor electrode materials were systematically investigated by cyclic voltammetry (CV and constant current charge-discharge tests. It was found that the Co3O4/3D graphene composite showed a maximum specific capacitance of 863 F g−1, which was obtained by means of CVs at a scan rate of 1 mV s−1 in 6 M KOH aqueous solution. Moreover, the composite exhibited improved cycling stability after 1,000 cycles. The good supercapacitor performance is ascribed to the combination of 3D graphene and cauliflower-like Co3O4, which leads to a strong synergistic effect to remarkably boost the utilization ratio of Co3O4 and graphene for high capacitance.

  10. Effect of Heavy Metal Ions and Carbohydrates on the Activity of Cauliflower (Brassica oleracea Var. botrytis Myrosinase

    Directory of Open Access Journals (Sweden)

    Prakash, Om

    2013-04-01

    Full Text Available Myrosinase is an enzyme of cruciferous vegetables, hydrolyse glucosinolates. The breakdown products are involved in plant defence against insect and also have anti-fungal property. Myrosinase has been purified to apparent homogeneity from 5 days old germinated cauliflower seedlings having a specific activity of 12.71 units/mg proteins with 54.6 % recovery, using ammonium sulfate fractionation followed by gel filtration chromatography on Sephadex G-100. Effect of some metal ions and carbohydrates on the activity of partially purified cauliflower myrosinase was studied. Sr+2 at 4 mM concentration exhibited marked activating effect on the activity up to 2.7 fold while Fe+2 significantly inhibited. However, Sn+2 and Ba+2 increased the activity to a certain extent and then suppressed. On the other hand, some metal ions [Fe+2, Fe+3, Cu+2 and Zn+2] strongly inhibited the activity even at lower concentrations. Several carbohydrates viz., glucose, fructose, sucrose, maltose and sorbitol even at comparatively higher concentrations had little detectable inhibitory effects. Activation kinetics of myrosinase in presence of Sn+2 and Sr+2 were studied between 0- 20min. The rate of reaction was almost constant till 15 min and then slight deactivation was recorded at various concentrations used.

  11. Synthesis of cauliflower-like ZnO-TiO2 composite porous film and photoelectrical properties

    International Nuclear Information System (INIS)

    Jiang Yinhua; Yan Yun; Zhang Wenli; Ni Liang; Sun Yueming; Yin Hengbo

    2011-01-01

    A series of cauliflower-like TiO 2 -ZnO composite porous films with various molar ratios of Zn/Ti were prepared by the screen printing technique on the fluorine-doped SnO 2 (FTO) conducting glasses. The composite films were characterized by field-emission scanning electron microscopy (FE-SEM), X-ray energy-dispersive spectrometry (EDS) and UV-vis transmittance spectrum. The results showed composite film electrode had a novel cauliflower-like morphology, which could effectively increase the dye absorption. The corresponding dye-sensitized solar cells (DSCs) were made by the composite film, and effects of ZnO incorporation on the photovoltaic performances of the DSCs were studied. With the Zn/Ti molar ratio not more than 3% in ZnO-TiO 2 composite film of about 5 μm-thickness, the photocurrent density (J sc ) and the solar-to-electricity conversion efficiency (η) were greatly improved compared with those of the DSC based on bare TiO 2 film of same thickness. This increases in efficiency and J sc were attributed to high electron conductivity of ZnO, the improved dye adsorption and large light transmittance of composite film.

  12. Synthesis of cauliflower-like ZnO-TiO{sub 2} composite porous film and photoelectrical properties

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Yinhua, E-mail: jyinhua@126.com [School of Chemistry and Chemical Engineering, Jiangsu University, Zhenjiang 212013 (China) and School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Yan Yun; Zhang Wenli; Ni Liang [School of Chemistry and Chemical Engineering, Jiangsu University, Zhenjiang 212013 (China); Sun Yueming [School of Chemistry and Chemical Engineering, Southeast University, Nanjing 211189 (China); Yin Hengbo [School of Chemistry and Chemical Engineering, Jiangsu University, Zhenjiang 212013 (China)

    2011-05-15

    A series of cauliflower-like TiO{sub 2}-ZnO composite porous films with various molar ratios of Zn/Ti were prepared by the screen printing technique on the fluorine-doped SnO{sub 2} (FTO) conducting glasses. The composite films were characterized by field-emission scanning electron microscopy (FE-SEM), X-ray energy-dispersive spectrometry (EDS) and UV-vis transmittance spectrum. The results showed composite film electrode had a novel cauliflower-like morphology, which could effectively increase the dye absorption. The corresponding dye-sensitized solar cells (DSCs) were made by the composite film, and effects of ZnO incorporation on the photovoltaic performances of the DSCs were studied. With the Zn/Ti molar ratio not more than 3% in ZnO-TiO{sub 2} composite film of about 5 {mu}m-thickness, the photocurrent density (J{sub sc}) and the solar-to-electricity conversion efficiency ({eta}) were greatly improved compared with those of the DSC based on bare TiO{sub 2} film of same thickness. This increases in efficiency and J{sub sc} were attributed to high electron conductivity of ZnO, the improved dye adsorption and large light transmittance of composite film.

  13. Cold and Heat Stress Diversely Alter Both Cauliflower Respiration and Distinct Mitochondrial Proteins Including OXPHOS Components and Matrix Enzymes

    Science.gov (United States)

    Rurek, Michał; Czołpińska, Magdalena; Pawłowski, Tomasz Andrzej; Krzesiński, Włodzimierz; Spiżewski, Tomasz

    2018-01-01

    Complex proteomic and physiological approaches for studying cold and heat stress responses in plant mitochondria are still limited. Variations in the mitochondrial proteome of cauliflower (Brassica oleracea var. botrytis) curds after cold and heat and after stress recovery were assayed by two-dimensional polyacrylamide gel electrophoresis (2D PAGE) in relation to mRNA abundance and respiratory parameters. Quantitative analysis of the mitochondrial proteome revealed numerous stress-affected protein spots. In cold, major downregulations in the level of photorespiratory enzymes, porine isoforms, oxidative phosphorylation (OXPHOS) and some low-abundant proteins were observed. In contrast, carbohydrate metabolism enzymes, heat-shock proteins, translation, protein import, and OXPHOS components were involved in heat response and recovery. Several transcriptomic and metabolic regulation mechanisms are also suggested. Cauliflower plants appeared less susceptible to heat; closed stomata in heat stress resulted in moderate photosynthetic, but only minor respiratory impairments, however, photosystem II performance was unaffected. Decreased photorespiration corresponded with proteomic alterations in cold. Our results show that cold and heat stress not only operate in diverse modes (exemplified by cold-specific accumulation of some heat shock proteins), but exert some associations at molecular and physiological levels. This implies a more complex model of action of investigated stresses on plant mitochondria. PMID:29547512

  14. Genetic analisys of a cross of gaillon (Brassica oleracea var. alboglabra with cauliflower (B.oleracea var. botrytis

    Directory of Open Access Journals (Sweden)

    Vanessa B.M.G. Spini

    2000-03-01

    Full Text Available The cauliflower (Brassica oleracea var. botrytis is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra, produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these crosses, in the F2 generation, 612 plants with inflorescence like gaillon and 48 plants with inflorescence like cauliflower were obtained, in a proportion similar to 15:1, implying that 2 pairs of genes entered into formation of the cauliflower inflorescence type. In order to study flower color, 339 plants were analyzed: 274 presented white flowers and 65, yellow flowers, denoting that this caracter is determined by 1 pair of genes, white being dominant over yellow; white flowers had a slighly higher adaptive value in our population. The characteristic waxy leaf showed a proportion of 3 waxy plants for 1 not waxy, indicating the action of one pair of genes.A couve-flor (Brassica oleracea var. botrytis é um vegetal anual e tem seu cultivo no Brasil limitado às regiões Sul e Sudeste, com pequena produção no Nordeste e Centro-Oeste. Uma variedade de couve da China, "kaai laan" ou "gaillon" (Brassica oleracea var. alboglabra, produz sementes em altas temperaturas e, portanto, é apta a produzir sementes no Norte e Nordeste do Brasil. Gaillon e couve-flor foram cruzados. Foram feitos 55 cruzamentos usando 10 plantas de gaillon como mãe e 4 plantas de couve-flor como doadores de pólen. Desses cruzamentos, na geração F2, 612 plantas com inflorescência tipo gaillon e 48 plantas com inflorescência tipo couve-flor foram obtidas, em proporção similar a 15:1, demonstrando que 2 pares de genes estão envolvidos na formação da inflorescência em couve

  15. Cauliflower mosaic virus protein P6 inhibits signaling responses to salicylic acid and regulates innate immunity.

    Directory of Open Access Journals (Sweden)

    Andrew J Love

    Full Text Available Cauliflower mosaic virus (CaMV encodes a multifunctional protein P6 that is required for translation of the 35S RNA and also acts as a suppressor of RNA silencing. Here we demonstrate that P6 additionally acts as a pathogenicity effector of an unique and novel type, modifying NPR1 (a key regulator of salicylic acid (SA- and jasmonic acid (JA-dependent signaling and inhibiting SA-dependent defence responses We find that that transgene-mediated expression of P6 in Arabidopsis and transient expression in Nicotiana benthamiana has profound effects on defence signaling, suppressing expression of representative SA-responsive genes and increasing expression of representative JA-responsive genes. Relative to wild-type Arabidopsis P6-expressing transgenics had greatly reduced expression of PR-1 following SA-treatment, infection by CaMV or inoculation with an avirulent bacterial pathogen Pseudomonas syringae pv tomato (Pst. Similarly transient expression in Nicotiana benthamiana of P6 (including a mutant form defective in translational transactivation activity suppressed PR-1a transcript accumulation in response to Agrobacterium infiltration and following SA-treatment. As well as suppressing the expression of representative SA-regulated genes, P6-transgenic Arabidopsis showed greatly enhanced susceptibility to both virulent and avirulent Pst (titres elevated 10 to 30-fold compared to non-transgenic controls but reduced susceptibility to the necrotrophic fungus Botrytis cinerea. Necrosis following SA-treatment or inoculation with avirulent Pst was reduced and delayed in P6-transgenics. NPR1 an important regulator of SA/JA crosstalk, was more highly expressed in the presence of P6 and introduction of the P6 transgene into a transgenic line expressing an NPR1:GFP fusion resulted in greatly increased fluorescence in nuclei even in the absence of SA. Thus in the presence of P6 an inactive form of NPR1 is mislocalized in the nucleus even in uninduced plants

  16. Filmcoating the seed of cabbage (Brassica oleracea L. convar. Capitata L.) and cauliflower (Brassica oleracea L. var. Botrytis L.) with imidacloprid and spinosad to control insect pests

    NARCIS (Netherlands)

    Ester, A.; Putter, de H.; Bilsen, van J.G.P.M.

    2003-01-01

    Four field experiments were carried out between 1999 and 2001, to assess the protection against cabbage root fly larvae (Delia radicum), flea beetle (Phyllotreta nemorum and P. undulata), cabbage aphid (Brevicoryne brassicae) and caterpillars achieved in white cabbage and cauliflower crops by

  17. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  18. Xyloglucan endotransglucosylase/hydrolases (XTHs) are inactivated by binding to glass and cellulosic surfaces, and released in active form by a heat-stable polymer from cauliflower florets.

    Science.gov (United States)

    Sharples, Sandra C; Nguyen-Phan, Tu C; Fry, Stephen C

    2017-11-01

    Xyloglucan endotransglucosylase (XET) activity, which cuts and re-joins hemicellulose chains in the plant cell wall, contributing to wall assembly and growth regulation, is the major activity of XTH proteins. During purification, XTHs often lose XET activity which, however, is restored by treatment with certain cold-water-extractable, heat-stable polymers (CHPs), e.g. from cauliflower florets. It was not known whether the XTH-activating factor (XAF) present in CHPs works by promoting (e.g. allosterically) XET activity or by re-solubilising sequestered XTH proteins. We now show that XTHs in dilute solution bind to diverse surfaces (e.g. glass and cellulose), and that CHPs can re-solubilise the bound enzyme, re-activating it. Cell walls prepared from cauliflower florets, mung bean shoots and Arabidopsis cell-suspension cultures each contained endogenous, tightly bound, inactive XTHs, which were likewise rapidly solubilised (within 0.5h) and thus activated by cauliflower XAF. We present a convenient quantitative assay for XAF acting on the native sequestered XTHs of Arabidopsis cell walls; using this assay, we show that CHPs from all plants tested possess XAF activity. The XAF activity of diverse CHPs does not correlate with their conductivity, showing that this activity is not a simple ionic effect. The XAF action of cauliflower CHPs was augmented by NaCl, although NaCl alone was much less effective than a CHP solution of similar conductivity, confirming that the cauliflower polymers did not simply exert a salt effect. We suggest that XAF is an endogenous regulator of XET action, modulating cell-wall loosening and/or assembly in vivo. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  19. Genetic variation of temperature-regulated curd induction in cauliflower: elucidation of floral transition by genome-wide association mapping and gene expression analysis

    Science.gov (United States)

    Matschegewski, Claudia; Zetzsche, Holger; Hasan, Yaser; Leibeguth, Lena; Briggs, William; Ordon, Frank; Uptmoor, Ralf

    2015-01-01

    Cauliflower (Brassica oleracea var. botrytis) is a vernalization-responsive crop. High ambient temperatures delay harvest time. The elucidation of the genetic regulation of floral transition is highly interesting for a precise harvest scheduling and to ensure stable market supply. This study aims at genetic dissection of temperature-dependent curd induction in cauliflower by genome-wide association studies and gene expression analysis. To assess temperature-dependent curd induction, two greenhouse trials under distinct temperature regimes were conducted on a diversity panel consisting of 111 cauliflower commercial parent lines, genotyped with 14,385 SNPs. Broad phenotypic variation and high heritability (0.93) were observed for temperature-related curd induction within the cauliflower population. GWA mapping identified a total of 18 QTL localized on chromosomes O1, O2, O3, O4, O6, O8, and O9 for curding time under two distinct temperature regimes. Among those, several QTL are localized within regions of promising candidate flowering genes. Inferring population structure and genetic relatedness among the diversity set assigned three main genetic clusters. Linkage disequilibrium (LD) patterns estimated global LD extent of r2 = 0.06 and a maximum physical distance of 400 kb for genetic linkage. Transcriptional profiling of flowering genes FLOWERING LOCUS C (BoFLC) and VERNALIZATION 2 (BoVRN2) was performed, showing increased expression levels of BoVRN2 in genotypes with faster curding. However, functional relevance of BoVRN2 and BoFLC2 could not consistently be supported, which probably suggests to act facultative and/or might evidence for BoVRN2/BoFLC-independent mechanisms in temperature-regulated floral transition in cauliflower. Genetic insights in temperature-regulated curd induction can underpin genetically informed phenology models and benefit molecular breeding strategies toward the development of thermo-tolerant cultivars. PMID:26442034

  20. Spherical cauliflower-like carbon dust formed by interaction between deuterium plasma and graphite target and its internal structure

    Energy Technology Data Exchange (ETDEWEB)

    Ohno, N. [Department of Energy Engineering and Science, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan)], E-mail: ohno@ees.nagoya-u.ac.jp; Yoshimi, M. [Department of Energy Engineering and Science, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Tokitani, M. [National Institute for Fusion Science, Oroshi 322-6, Toki 509-5292 (Japan); Takamura, S. [Department of Electronics, Aichi Institute of Technology, Yakusa-cho, Toyota 470-0392 (Japan); Tokunaga, K.; Yoshida, N. [Research Institute for Applied Mechanics, Kyushu University, Kasuga, Fukuoka 816-8580 (Japan)

    2009-06-15

    Simulated experiments to produce carbon dust particles with cauliflower structure have been performed in a liner plasma device, NAGDIS-II by exposing high density deuterium plasma to a graphite sample (IG-430U). Formation of carbon dust depends on the surface temperature and the incident ion energy. At a surface temperature 600-700 K, a lot of isolated spherical dust particles are observed on the graphite target. The internal structure of an isolated dust particle was observed with Focused Ion Beam (FIB) system and Transmission Electron Microscope (TEM) in detail. FIB analysis clearly shows there exist honey-combed cell structure with thin carbon walls in the dust particle and the dust particle grows from the graphite surface. TEM image also shows that the dust particle is made of amorphous carbon with crystallized grains with diameters of 10-50 nm.

  1. Lithium Sulfur Primary Battery with Super High Energy Density: Based on the Cauliflower-like Structured C/S Cathode

    Science.gov (United States)

    Ma, Yiwen; Zhang, Hongzhang; Wu, Baoshan; Wang, Meiri; Li, Xianfeng; Zhang, Huamin

    2015-10-01

    The lithium-sulfur primary batteries, as seldom reported in the previous literatures, were developed in this work. In order to maximize its practical energy density, a novel cauliflower-like hierarchical porous C/S cathode was designed, for facilitating the lithium-ions transport and sulfur accommodation. This kind of cathode could release about 1300 mAh g-1 (S) capacity at sulfur loading of 6 ~ 14 mg cm-2, and showed excellent shelf stability during a month test at room temperature. As a result, the assembled Li-S soft package battery achieved an energy density of 504 Wh kg-1 (654 Wh L-1), which was the highest value ever reported to the best of our knowledge. This work might arouse the interests on developing primary Li-S batteries, with great potential for practical application.

  2. Radiation processing for enhancing shelf life and quality characteristics of minimally processed ready-to-cook (RTC) cauliflower (Brassica oleracea)

    International Nuclear Information System (INIS)

    Vaishnav, Jasraj; Adiani, Vanshika; Variyar, Prasad S.

    2015-01-01

    Minimally processed ready-to-cook (RTC) cauliflower samples were irradiated, stored at 4℃ for 21 days. The samples were analyzed for nutritional, physiochemical and sensory quality periodically at intervals of 0, 7, 14 and 21 days. An irradiation dose of 0.5 kGy enhanced the microbial quality and extended shelf life by 7 days without significant losses in quality attributes. Non irradiated control samples showed the highest total bacterial counts (TBC) and yeast - mold count (YMC), around 5 log cfu g -1 respectively over the period of 21 days of storage, while in all irradiated samples TBC and YMC were maintained in the range of 1-2 log cfu g -1 till 21st days. Antioxidant activity and total phenolic content (TPC) were significantly increased on irradiation (0.5 kGy) while no significant effect was noted in texture, total ascorbate content and flavonoid content. (author)

  3. Genetic and Epigenetic Alterations of Brassica nigra Introgression Lines from Somatic Hybridization: A Resource for Cauliflower Improvement.

    Science.gov (United States)

    Wang, Gui-Xiang; Lv, Jing; Zhang, Jie; Han, Shuo; Zong, Mei; Guo, Ning; Zeng, Xing-Ying; Zhang, Yue-Yun; Wang, You-Ping; Liu, Fan

    2016-01-01

    Broad phenotypic variations were obtained previously in derivatives from the asymmetric somatic hybridization of cauliflower "Korso" (Brassica oleracea var. botrytis, 2n = 18, CC genome) and black mustard "G1/1" (Brassica nigra, 2n = 16, BB genome). However, the mechanisms underlying these variations were unknown. In this study, 28 putative introgression lines (ILs) were pre-selected according to a series of morphological (leaf shape and color, plant height and branching, curd features, and flower traits) and physiological (black rot/club root resistance) characters. Multi-color fluorescence in situ hybridization revealed that these plants contained 18 chromosomes derived from "Korso." Molecular marker (65 simple sequence repeats and 77 amplified fragment length polymorphisms) analysis identified the presence of "G1/1" DNA segments (average 7.5%). Additionally, DNA profiling revealed many genetic and epigenetic differences among the ILs, including sequence alterations, deletions, and variation in patterns of cytosine methylation. The frequency of fragments lost (5.1%) was higher than presence of novel bands (1.4%), and the presence of fragments specific to Brassica carinata (BBCC 2n = 34) were common (average 15.5%). Methylation-sensitive amplified polymorphism analysis indicated that methylation changes were common and that hypermethylation (12.4%) was more frequent than hypomethylation (4.8%). Our results suggested that asymmetric somatic hybridization and alien DNA introgression induced genetic and epigenetic alterations. Thus, these ILs represent an important, novel germplasm resource for cauliflower improvement that can be mined for diverse traits of interest to breeders and researchers.

  4. Genetic and epigenetic alterations of Brassica nigra introgression lines from somatic hybridization: a resource for cauliflower improvement

    Directory of Open Access Journals (Sweden)

    Guixiang Wang

    2016-08-01

    Full Text Available Broad phenotypic variations were obtained previously in derivatives from the asymmetric somatic hybridization of cauliflower ‘Korso’ (Brassica oleracea var. botrytis, 2n = 18, CC genome and black mustard ‘G1/1’ (Brassica nigra, 2n = 16, BB genome. However, the mechanisms underlying these variations were unknown. In this study, 28 putative introgression lines (ILs were pre-selected according to a series of morphological (leaf shape and color, plant height and branching, curd features, and flower traits and physiological (black rot/club root resistance characters. Multi-color fluorescence in situ hybridization revealed that these plants contained 18 chromosomes derived from ‘Korso’. Molecular marker (65 simple sequence repeats and 77 amplified fragment length polymorphisms analysis identified the presence of ‘G1/1’ DNA segments (average 7.5%. Additionally, DNA profiling revealed many genetic and epigenetic differences among the ILs, including sequence alterations, deletions, and variation in patterns of cytosine methylation. The frequency of fragments lost (5.1% was significantly higher than presence of novel bands (1.4%, and the presence of fragments specific to B. carinata (BBCC 2n = 34 were common (average 15.5%. Methylation-sensitive amplified polymorphism analysis indicated that methylation changes were common and that hypermethylation (12.4% was more frequent than hypomethylation (4.8%. Our results suggested that asymmetric somatic hybridization and alien DNA introgression induced genetic and epigenetic alterations. Thus, these ILs represent an important, novel germplasm resource for cauliflower improvement that can be mined for diverse traits of interest to breeders and researchers.

  5. Electrochemical fabrication of a cauliflower-like nanostructured Pd film from pure Pd and its applications in electrocatalysis and electroanalysis

    International Nuclear Information System (INIS)

    Xu, Shili; Zhang, Hefang; Huang, Fuli; Wang, Pengshu; Xia, Yue; Li, Zelin; Huang, Wei

    2013-01-01

    Highlights: • A cauliflower-like nanostructured Pd film was fabricated by just applying one double-potential step method. • The film fabrication involves the formation of K 2 PdCl 4 salt from pure Pd and its electroreduction to Pd atoms. • The film electrode exhibits high electrocatalytic activities toward the oxidation of ethanol and ascorbic acid. • Good analytical performances in the higher-concentration regions are obtained on the film electrode. -- Abstract: A cauliflower-like nanostructured Pd film (CNPF) has been fabricated by just applying one double-potential step on a pure Pd substrate in a KCl solution. The CNPF formation mainly involves the formation of K 2 PdCl 4 salt from pure Pd and its electroreduction to Pd atoms. The as-prepared CNPF electrode exhibits high electrocatalytic activities toward the oxidation of ethanol and ascorbic acid (AA). The CNPF electrode is also employed to detect AA by means of constant potential amperometry (CPA) and cyclic voltammetry (CV), and good analytical performances in the higher-concentration regions are obtained. In CPA studies performed at −0.4 V, the oxidation current is linearly dependent on AA concentration in the range of 0.1–7.5 mM with a detection limit of 80 μM (based on S/N = 3), a short response time of about 3 s and a high sensitivity of 589.80 μA mM −1 cm −2 . Meanwhile, the peak current responses in CVs are linear over the broad range of 0.1–35 mM with a sensitivity of 178.56 μA mM −1 cm −2 . Besides, the CNPF electrode can also be used to detect AA in medicine vitamin C tablet with satisfactory results

  6. Study of the leaf extract of cauliflower (Brassica oleracea L. var. Botrytis) in the blood elements labelling using Technetium-99m: possible consequences for the radiation dose modification

    International Nuclear Information System (INIS)

    Lima, E.A.C.; Dire, G.; Mattos, D.M.M.; Gomes, M.L.; Freitas, R.S.; Bernardo Filho, M.; Instituto Nacional do Cancer, Rio de Janeiro, RJ

    2001-01-01

    The radiation dose that a patient receives is also associated with the number of expositions to radiation sources. The labeling of blood elements with technetium-99m can be reduced by vegetable extracts and it can determine the repetition of the exam. The labeling procedure depends on a reducing agent and stannous chloride is used. We have evaluated the influence of an extract of cauliflower (leaf) on the labeling of blood elements with technetium-99m the and the results showed that this extract was not capable to alter the labeling procedure, suggesting that the studied extract does not have redox activity sufficiently to oxidize the stannous ions. Moreover, although, other natural extracts might alter this labeling, increasing the radiation dose to the patient, this fact would not occur to the cauliflower. (author)

  7. Forced-air, vacuum, and hydro precooling of cauliflower (Brassica oleracea L. var. botrytis cv. Freemont): Part II. Determination of quality parameters during storage

    OpenAIRE

    Alibas, Ilknur; Koksal, Nezihe

    2015-01-01

    Cauliflower heads, which were precooled using four different methods including vacuum, forced-air, and high and low flow hydro precooling, were stored under controlled atmosphere and room conditions. Controlled atmosphere conditions (CA) were as follows: 1°C temperature, 90 ± 5% relative humidity, and 0:21 [(%CO2:%O2) – (0:21) control] atmosphere composition. Room conditions (RC) were: 22±1°C temperature and 55-60% humidity. Various quality parameters of the cauliflo...

  8. Genome-wide identification and characterization of miRNAs in the hypocotyl and cotyledon of cauliflower (Brassica oleracea L. var. botrytis) seedlings.

    Science.gov (United States)

    Geng, Meijuan; Li, Hui; Jin, Chuan; Liu, Qian; Chen, Chengbin; Song, Wenqin; Wang, Chunguo

    2014-02-01

    MicroRNAs (miRNAs) are a class of small endogenous, non-coding RNAs that have key regulatory functions in plant growth, development, and other biological processes. Hypocotyl and cotyledon are the two major tissues of cauliflower (Brassica oleracea L. var. botrytis) seedlings. Tissue culture experiments have indicated that the regenerative abilities of these two tissues are significantly different. However, the characterization of miRNAs and their roles in regulating organ development in cauliflower remain unexplored. In the present study, two small RNA libraries were sequenced by Solexa sequencing technology. 99 known miRNAs belonging to 28 miRNA families were identified, in which 6 miRNA families were detected only in Brassicaceae. A total of 162 new miRNA sequences with single nucleotide substitutions corresponding to the known miRNAs, and 32 potentially novel miRNAs were also first discovered. Comparative analysis indicated that 42 of 99 known miRNAs and 17 of 32 novel miRNAs exhibited significantly differential expression between hypocotyl and cotyledon, and the differential expression of several miRNAs was further validated by stem-loop RT-PCR. In addition, 235 targets for 89 known miRNAs and 198 targets for 24 novel miRNAs were predicted, and their functions were further discussed. The expression patterns of several representative targets were also confirmed by qRT-PCR analysis. The results identified that the transcriptional expression patterns of miRNAs were negatively correlated with their targets. These findings gave new insights into the characteristics of miRNAs in cauliflower, and provided important clues to elucidate the roles of miRNAs in the tissue differentiation and development of cauliflower.

  9. Curd development associated gene (CDAG1) in cauliflower (Brassica oleracea L. var. botrytis) could result in enlarged organ size and increased biomass.

    Science.gov (United States)

    Li, Hui; Liu, Qian; Zhang, Qingli; Qin, Erjun; Jin, Chuan; Wang, Yu; Wu, Mei; Shen, Guangshuang; Chen, Chengbin; Song, Wenqin; Wang, Chunguo

    2017-01-01

    The curd is a specialized organ and the most important product organ of cauliflower (Brassica oleracea L. var. botrytis). However, the mechanism underlying the regulation of curd formation and development remains largely unknown. In the present study, a novel homologous gene containing the Organ Size Related (OSR) domain, namely, CDAG1 (Curd Development Associated Gene 1) was identified in cauliflower. Quantitative analysis indicated that CDAG1 showed significantly higher transcript levels in young tissues. Functional analysis demonstrated that the ectopic overexpression of CDAG1 in Arabidopsis and cauliflower could significantly promote organ growth and result in larger organ size and increased biomass. Organ enlargement was predominantly due to increased cell number. In addition, 228 genes involved in the CDAG1-mediated regulatory network were discovered by transcriptome analysis. Among these genes, CDAG1 was confirmed to inhibit the transcriptional expression of the endogenous OSR genes, ARGOS and ARL, while a series of ethylene-responsive transcription factors (ERFs) were found to increased expression in 35S:CDAG1 transgenic Arabidopsis plants. This implies that CDAG1 may function in the ethylene-mediated signal pathway. These findings provide new insight into the function of OSR genes, and suggest potential applications of CDAG1 in breeding high-yielding crops. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Combined alkaline hydrolysis and ultrasound-assisted extraction for the release of nonextractable phenolics from cauliflower (Brassica oleracea var. botrytis) waste.

    Science.gov (United States)

    Gonzales, Gerard Bryan; Smagghe, Guy; Raes, Katleen; Van Camp, John

    2014-04-16

    Cauliflower waste contains high amounts phenolic compounds, but conventional solvent extraction misses high amounts of nonextractable phenolics (NEP), which may contribute more to the valorization of these waste streams. In this study, the NEP content and composition of cauliflower waste were investigated. The ability of alkaline hydrolysis, sonication, and their combination to release NEP was assessed. Alkaline hydrolysis with sonication was found to extract the highest NEP content (7.3 ± 0.17 mg gallic acid equivalents (GAE)/g dry waste), which was higher than the extractable fraction. The highest yield was obtained after treatment of 2 M NaOH at 60 °C for 30 min of sonication. Quantification and identification were done using U(H)PLC-DAD and U(H)PLC-ESI-MS(E). Kaempferol and quercetin glucosides along with several phenolic acids were found. The results of the study show that there are higher amounts of valuable health-promoting compounds from cauliflower waste than what is currently described in the literature.

  11. Promotive role of 5-aminolevulinic acid on chromium-induced morphological, photosynthetic, and oxidative changes in cauliflower (Brassica oleracea botrytis L.).

    Science.gov (United States)

    Ahmad, Rehan; Ali, Shafaqat; Hannan, Fakhir; Rizwan, Muhammad; Iqbal, Muhammad; Hassan, Zaidul; Akram, Nudrat Aisha; Maqbool, Saliha; Abbas, Farhat

    2017-03-01

    Chromium (Cr) is among the most toxic pollutants in the environment that adversely affect the living organisms and physiological processes in different plants. The present study investigated the effect of 15 mg L -1 of 5-aminolevulinic acid (ALA) on morpho-physiological attributes of cauliflower (Brassica oleracea botrytis L.) under different Cr concentrations (0, 10, 100, and 200 μM) in the growth medium. The results showed that Cr stress decreased the growth, biomass, photosynthetic, and gas exchange parameters. Chromium stress enhanced the activities of enzymatic antioxidants, catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD) in response to oxidative stress caused by the elevated levels of malondialdehyde (MDA), hydrogen peroxide (H 2 O 2 ), and electrolyte leakage (EL) in both roots and leaves of cauliflower. Chromium concentrations and total Cr uptake were increased in leaves, stems, and roots with increasing Cr levels in the culture medium. Foliar application of ALA increased the plant growth parameters, biomass, gas exchange parameters, and photosynthetic pigments under Cr stress compared to the treatments without ALA. Foliar application ALA decreased the levels of MDA, EL, and H 2 O 2 while further improved the performance of antioxidant in both leaves and roots compared to only Cr-stressed plant. Chromium concentrations and total Cr uptake were decreased by the ALA application compared to treatments without ALA application. The results of the present study indicated that foliar application of ALA might be beneficial in minimizing Cr uptake and its toxic effects in cauliflower.

  12. A facile synthesis for cauliflower like CeO2 catalysts from Ce-BTC precursor and their catalytic performance for CO oxidation

    Science.gov (United States)

    Zhang, Xiaodong; Hou, Fulin; Yang, Yang; Wang, Yuxin; Liu, Ning; Chen, Dan; Yang, Yiqiong

    2017-11-01

    The paper presents a novel and facile method for preparing cauliflowerlike CeO2 through direct decomposition of cerium based metal-organic framework (MOF) Ce-BTC (BTC = 1,3,5-benzenetricarboxylic acid) straw in air. Several analytical tools such as Scanning electron microscopy (SEM), X-ray diffraction (XRD), Thermogravimetric (TG), N2 adsorption-desorption, Temperature programmed reduction (TPR), Raman, X-ray photoelectron spectroscopic (XPS) and Photoluminescence (PL) have been used to characterize Ce-BTC and CeO2. The Ce-BTC calcined at 500 °C (CeO2-500) maintains the morphology of its template ;Ce-BTC; and forms a special cauliflower-like structure. XRD patterns showed that the catalyst has a perfect CeO2 crystal structure and has a smaller particle size. The prepared CeO2 cauliflowers exhibit excellent catalytic activities, long-term stability, and cycling stability for CO oxidation. The improved catalytic activities could be attributed to porous nanorods of CeO2 cauliflowers, which provide more active sites and oxygen vacancy for CO oxidation.

  13. Antioxidant and anti-inflammatory effects of cauliflower leaf powder-enriched diet against LPS induced toxicity in rabbits.

    Science.gov (United States)

    Larocca, Marilena; Perna, Anna Maria; Simonetti, Amalia; Gambacorta, Emilio; Iannuzzi, Alessandra; Perucatti, Angela; Rossano, Rocco

    2017-09-20

    Brassica phytochemicals exert a broad spectrum of health-promoting activities. The aim of this study was to investigate the possible beneficial effects of a cauliflower leaf powder (CLP)-enriched diet to prevent inflammation and oxidative stress resulting from injection of lipopolysaccharide (LPS) into rabbits. Animals (24 rabbits) were randomly divided into two groups and fed with a standard diet (SD) or a standard diet supplemented with a 100 g kg -1 diet of CLP. After 60 days, six rabbits of both groups received a LPS injection (100 μg per kg body weight). Serum samples collected after 90 min of LPS injection were assessed for their content of both inflammatory biomarkers such as tumor necrosis factor-alpha (TNF-α), interleukin-6 (IL-6) and matrix-metalloproteinases (MMP-2 and MMP-9) and oxidative stress biomarkers such as thiobarbituric acid reactive substances (TBARS), glutathione (GSH), superoxide dismutase (SOD) and catalase (CAT). LPS increased the levels of TNF-α, IL-6, and TBARS as well as MMP-2 and MMP-9 activities, whereas it decreased the GSH levels and SOD and CAT activities. In conclusion, preventive supplementation with CLP can protect rabbits from the inflammation and oxidative stress induced by LPS.

  14. Morphological, structural and optical properties of ZnO thin solid films formed by nanoleafs or micron/submicron cauliflowers

    International Nuclear Information System (INIS)

    Angulo-Rocha, Jorge; Velarde-Escobar, Oscar; Yee-Rendón, Cristo; Atondo-Rubio, Gelacio; Millan-Almaraz, Roberto; Camarillo-García, Enrique

    2017-01-01

    Thin films of ZnO formed by nano and microstructures with hexagonal crystal phase were successfully synthesized by using pyrolysis technique. At first glance the films resulted divided in 7 zones that were morphologically analyzed and showed the presence of three types of particles: nano-leafs, single microparticles, and particles formed by the addition of microparticles, “clusters”. The largest and therefore the main zone was formed by nanoleafs. Studies on morphology, structure and optical properties of these nanoleafs were obtained and correlated too. The knowledge acquired from these studies allowed the synthesis of nanostructured films entirely formed by nanoleafs with a width of 25 nm and a length 200 nm long regardless of the roughness of the substrate. Energy gap of 3.26 eV was invariant to changes in synthesis parameters. The studies on optical properties of nanoleafs and micro-cauliflower give an energy diagram that account for the location of the energy states introduced by native crystalline defects into the energy band gap and their radiative electronic transitions.

  15. Or mutation leads to photo-oxidative stress responses in cauliflower (Brassica oleracea) seedlings during de-etiolation.

    Science.gov (United States)

    Men, Xiao; Dong, Kang

    2013-11-01

    The Orange (Or) gene is a gene mutation that can increase carotenoid content in plant tissues normally devoid of pigments. It affects plastid division and is involved in the differentiation of proplastids or non-colored plastids into chromoplasts. In this study, the de-etiolation process of the wild type (WT) cauliflower (Brassica oleracea L. var. botrytis) and Or mutant seedlings was investigated. We analyzed pigment content, plastid development, transcript abundance and protein levels of genes involved in the de-etiolation process. The results showed that Or can increase the carotenoid content in green tissues, although not as effectively as in non-green tissues, and this effect might be caused by the changes in biosynthetic pathway genes at both transcriptional and post-transcriptional levels. There was no significant difference in the plastid development process between the two lines. However, the increased content of antheraxanthin and anthocyanin, and higher expression levels of violaxanthin de-epoxidase gene (VDE) suggested a stress situation leading to photoinhibition and enhanced photoprotection in the Or mutant. The up-regulated expression levels of the reactive oxygen species (ROS)-induced genes, ZAT10 for salt tolerance zinc finger protein and ASCORBATE PEROXIDASE2 (APX2), suggested the existence of photo-oxidative stress in the Or mutant. In summary, abovementioned findings provide additional insight into the functions of the Or gene in different tissues and at different developmental stages.

  16. Morphological, structural and optical properties of ZnO thin solid films formed by nanoleafs or micron/submicron cauliflowers

    Energy Technology Data Exchange (ETDEWEB)

    Angulo-Rocha, Jorge [Laboratorio de Síntesis de Materiales-Facultad de Ciencias Físico-Matemáticas – Universidad Autónoma de Sinaloa, Ciudad Universitaria S/N, CP. 80000, Culiacán, Sinaloa, México (Mexico); Velarde-Escobar, Oscar; Yee-Rendón, Cristo; Atondo-Rubio, Gelacio [Laboratorio de Óptica-Facultad de Ciencias Físico-Matemáticas – Universidad Autónoma de Sinaloa, Ciudad Universitaria S/N, CP. 80000, Culiacán, Sinaloa, México (Mexico); Millan-Almaraz, Roberto [Facultad de Ciencias Físico-Matemáticas – Universidad Autónoma de Sinaloa, Ciudad Universitaria S/N, CP. 80000, Culiacán, Sinaloa, México (Mexico); Camarillo-García, Enrique [Instituto de Física, Universidad Nacional Autónoma de México, AP 20-364, Álvaro Obregón 01000, DF, México (Mexico); and others

    2017-05-15

    Thin films of ZnO formed by nano and microstructures with hexagonal crystal phase were successfully synthesized by using pyrolysis technique. At first glance the films resulted divided in 7 zones that were morphologically analyzed and showed the presence of three types of particles: nano-leafs, single microparticles, and particles formed by the addition of microparticles, “clusters”. The largest and therefore the main zone was formed by nanoleafs. Studies on morphology, structure and optical properties of these nanoleafs were obtained and correlated too. The knowledge acquired from these studies allowed the synthesis of nanostructured films entirely formed by nanoleafs with a width of 25 nm and a length 200 nm long regardless of the roughness of the substrate. Energy gap of 3.26 eV was invariant to changes in synthesis parameters. The studies on optical properties of nanoleafs and micro-cauliflower give an energy diagram that account for the location of the energy states introduced by native crystalline defects into the energy band gap and their radiative electronic transitions.

  17. Labelling with radioisotopes, release and dispersal of the rove beetle, Aleochara bilineata Gyll. (Coleoptera: Staphylinidae) in a Danish cauliflower field

    International Nuclear Information System (INIS)

    Esbjerg, P.; Bromand, B.

    1977-01-01

    In 1975 and 1976 the dispersal of Aleochara bilineata in a cauliflower field was investigated using radioactively labelled beetles from laboratory cultures. In 1975, 920 beetles were labelled with 54 MnCl 2 . 900 of these were released in two batches of 600 and 300 individuals respectively. 20 were kept for observations in the laboratory. In 1976, lO33 beetles were labelled with 65 ZnCl 2 . These beetles were released in 7 batches of 130-200 specimens each. Optimal labelling was obtained with 65 ZnCl 2 , which had a durability of 40 days. 54 MnCl 2 labelling, on the contrary, only lasted for 20 days. Also labelling with fluorescent dust and oil-soluble dye was tried, but proved to be ineffective. 100 pitfalls placed up to 30 meters from the release point were used for recapture of the labelled beetles. 143 were recaptured in 1975, and 47 were recaptured in 1976. Dispersal rates up to 6.5 metres per day were ascertained. For biological control of cabbage root flies (Hylemya brassicae) spread of few batches of several hundred beetles each is sufficient. However, a maximum distance of 20 metres between release points is recommended to ensure quick dispersal over the whole area. (author)

  18. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  19. Evaluation of various soaking agents as a novel tool for pesticide residues mitigation from cauliflower (Brassica oleracea var. botrytis).

    Science.gov (United States)

    Abdullah; Randhawa, Muhammad Atif; Asghar, Ali; Pasha, Imran; Usman, Rabia; Shamoon, Muhammad; Bhatti, Muhammad Arslan; Irshad, Muhammad Asim; Ahmad, Naveed

    2016-08-01

    The increasing use of pesticides for boosting the yield of agricultural crops also impart toxic residues which ultimately extend to numerous physiological disorders upon consumption. The present study was designed as an effort to assess the reduction potential of various chemical solutions and to minimize the pesticide residues in cauliflower ( Brassica oleracea var. botrytis ). The samples were soaked in various solutions along with tap water to mitigate pesticide residues. Afterwards, the extracted supernatant was passed through column containing anhydrous sodium sulfate trailed by activated carbon for clean-up. Eluents were first evaporated and then completely dried under gentle stream of Nitrogen. Finally, the residues were determined using gas chromatography equipped with electron capture detector (GC-ECD). Results revealed the highest reduction of endosulfan, bifenthrin and cypermethrin residues with acetic acid (10 %) was 1.133 ± 0.007 (41 %), 0.870 ± 0.022 (60 %) and 0.403 ± 0.003 (75 %), respectively among the tested solutions. However, simple tap water treatment also resulted in 0.990 ± 0.02 (12 %), 1.323 ± 0.015 (14 %) and 1.274 ± 0.002 (21 %) elimination of endosulfan, bifenthrin and cypermethrin residues, respectively. Moreover, among various solutions, acetic acid depicted maximum reduction potential followed by citric acid, hydrogen peroxide, sodium chloride and sodium carbonate solutions. The percent reduction by various solutions ranged from 12 to 41, 14 to 60 and 21 to 75 % for the elimination of endosulfan, bifenthrin and cypermethrin residues, respectively.

  20. Variability of pesticide residues in cauliflower units collected from a field trial and market places in Greece.

    Science.gov (United States)

    Prodhan, M D H; Papadakis, Emmanouil-N; Papadopoulou-Mourkidou, Euphemia

    2016-09-01

    To estimate the variability of pesticide residue levels present in cauliflower units, a total of 142 samples were collected from a field trial of a cooperative farmer, and 120 samples were collected from different market places in Thessaloniki, Greece. The collected samples were extracted using the quick, easy, cheap, effective, rugged, and safe (QuEChERS) extraction technique, and the residues were determined by liquid chromatography-tandem mass spectrometry. The developed method was validated by evaluating the accuracy, precision, linearity, limit of detection (LOD), and limit of quantification (LOQ). The average recoveries for all the analytes, derived from the data of control samples fortified at 0.01, 0.05, 0.1, and 0.2 mg/kg, ranged from 74 to 110% with a relative standard deviation of ≤8%. The correlation coefficient (R(2)) was ≥0.997 for all the analytes using matrix-matched calibration standards. The LOD values ranged from 0.001 to 0.003 mg/kg, and the LOQ was determined at 0.01 mg/kg for all the sought analytes. The matrix effect was found to be at a considerable level, especially for cypermethrin and deltamethrin, amounting to +90% and +145%, respectively. For the field samples, the unit-to-unit variability factors (VFs) calculated for cypermethrin and deltamethrin were 2.38 and 2.32, respectively, while the average VF for the market basket samples was 5.11. In the market basket samples, residues of cypermethrin, deltamethrin, chlorpyrifos, and indoxacarb were found at levels ≥LOQ and their respective VFs were 7.12, 5.67, 5.28, and 2.40.

  1. Mobilization of Ca2+ by Cyclic ADP-Ribose from the Endoplasmic Reticulum of Cauliflower Florets1

    Science.gov (United States)

    Navazio, Lorella; Mariani, Paola; Sanders, Dale

    2001-01-01

    The NAD+ metabolite cADP-Rib (cADPR) elevates cytosolic free Ca2+ in plants and thereby plays a central role in signal transduction pathways evoked by the drought and stress hormone abscisic acid. cADPR is known to mobilize Ca2+ from the large vacuole of mature cells. To determine whether additional sites for cADPR-gated Ca2+ release reside in plant cells, microsomes from cauliflower (Brassica oleracea) inflorescences were subfractionated on sucrose density gradients, and the distribution of cADPR-elicited Ca2+ release was monitored. cADPR-gated Ca2+ release was detected in the heavy-density fractions associated with rough endoplasmic reticulum (ER). cADPR-dependent Ca2+ release co-migrated with two ER markers, calnexin and antimycin A-insensitive NADH-cytochrome c reductase activity. To investigate the possibility that contaminating plasma membrane in the ER-rich fractions was responsible for the observed release, plasma membrane vesicles were purified by aqueous two-phase partitioning, everted with Brij-58, and loaded with Ca2+: These vesicles failed to respond to cADPR. Ca2+ release evoked by cADPR at the ER was fully inhibited by ruthenium red and 8-NH2-cADPR, a specific antagonist of cADPR-gated Ca2+ release in animal cells. The presence of a Ca2+ release pathway activated by cADPR at higher plant ER reinforces the notion that, alongside the vacuole, the ER participates in Ca2+ signaling. PMID:11299392

  2. An in vitro analysis of the effect of extracts of natural products (cauliflower and chayotte) on the labeling of lymphocytes with technetium-99m

    International Nuclear Information System (INIS)

    Dire, G.F.; Correia, E.A.; Machado de Mattos, D.M.; Queiroz, M.T.; Bernardo-Filho, M.

    2002-01-01

    Aim: Blood cells labeled with technetium-99m (99mTc) are used in various procedures in nuclear medicine There are evidences that natural and synthetic drugs can affect the radiolabeling of blood cells with 99mTc. Once chayotte and cauliflower are used as food and also in folk medicine, we decided to evaluated the influence of crude extracts of these medicinal plants on the labeling of lymphocytes with 99mTc. Material and Methods: Blood withdrawn from Wistar rats was treated with histopac 1077, centrifuged and white cells were isolated and a preparation of lymphocytes was obtained. After that, 0.2mL this preparation of lymphocytes was incubated with 0.1 mL of the medicinal plant extracts recently prepared. A fresh solution of stannous chloride and 99mTc, as sodium pertechnetate, were added. After centrifugation the lymphocytes and the supernatant were separated and the percentage of radioactivity (%ATI) bound to the lymphocytes was determined. Results: The analysis of the results showed that there is not alterations in %ATI in lymphocytes treated with the cauliflower and chayotte extracts. Discussion: Although some authors have described that the chayotte and cauliflower extracts extracts are capable to induce lesions in isolated plasmid deoxyribonucleic acid, showing possible redox properties, these extracts are not capable to alter the labeling of lymphocytes with 99mTc. Conclusion: The studied natural products were not capable to induce sufficiently modifications in the medium and/or in the cells to alter the labeling of lymphocytes with 99mTc

  3. [Construction of genetic linkage map and localization of NBS-LRR like resistance gene analogues in cauliflower (Brassica oleracea var. botrytis)].

    Science.gov (United States)

    Gu, Yu; Zhao, Qian-Cheng; Sun, De-Ling; Song, Wen-Qin

    2007-06-01

    Nucleotide binding site (NBS) profiling, a new method was used to map resistance gene analogues (RGAs) in cauliflower (Brassica oleracea var. botrytis). This method allows amplification and the mapping of genetic markers anchored in the conserved NBS encoding domain of plant disease resistance genes. AFLP was also performed to construct the cauliflower intervarietal genetic map. The aim of constructing genetic map was to identify potential molecular markers linked to important agronomic traits that would be particularly useful for development and improving the species. Using 17 AFLP primer combinations and two degeneration primer/enzyme combinations, a total of 234 AFLP markers and 21 NBS markers were mapped in the F2 population derived from self-pollinating a single F1 plant of the cross AD White Flower x C-8. The markers were mapped in 9 of major linkage groups spanning 668.4 cM, with an average distance of 2.9 cM between adjacent mapped markers. The AFLP markers were well distributed throughout the linkage groups. The linkage groups contained from 12 to 47 loci each and the distance between two consecutive loci ranged from 0 to 14.9 cM. NBS markers were mapped on 8 of the 9 linkage groups of the genetic map. Most of these markers were organized in clusters. This result demonstrates the feasibility of the NBS-profiling method for generating NBS markers for resistance loci in cauliflower. The clustering of the markers mapped in this study adds to the evidence that most of them could be real RGAs.

  4. PLANT PROTECTION PRODUCT RESIDUES IN APPLES, CAULIFLOWER, CEREALS, GRAPE, LETTUCE, PEAS, PEPPERS, POTATOES AND STRAWBERRIES OF THE SLOVENE ORIGIN IN 2006

    Directory of Open Access Journals (Sweden)

    Helena BAŠA ČESNIK

    2010-02-01

    Full Text Available In the year 2006, 181 apple, cauliflower, cereal, grape, lettuce, pea, pepper, potato and strawberry samples from Slovene producers were analysed for plant protection product residues. The samples were analysed for the presence of 86 different active compounds using four analytical methods. In nine samples (5.0 % exceeded maximum residue levels (MRLs were determined which is comparable with the results of the monitoring of plant protection product residues in products of plant origin in the European union, Norway, Iceland and Liechtenstein in 2005 (4.9 %.

  5. Synthesis and microwave absorption property of graphene oxide/carbon nanotubes modified with cauliflower-like Fe3O4 nanospheres

    Science.gov (United States)

    Yan, Shaojiu; Wang, Lina; Wang, Tihong; Zhang, Liqiang; Li, Yongfeng; Dai, Shenglong

    2016-03-01

    We report a simple procedure to fabricate graphene oxide/carbon nanotube hybrids coated with cauliflower-like Fe3O4 sphere. Characterizations have been carried out to investigate the morphology, crystalline structure of the composites by scanning electron microscopy, transmission electron microscopy and X-ray diffraction. Fe3O4 particles have the morphologies of multi-lacuna; moreover, some spheres are hollow. As a kind of potential microwave absorption material, the composites are lightweight and exhibit excellent microwave absorbing ability in the range of 2-16 GHz.

  6. Mitochondrial Biogenesis in Diverse Cauliflower Cultivars under Mild and Severe Drought. Impaired Coordination of Selected Transcript and Proteomic Responses, and Regulation of Various Multifunctional Proteins

    Directory of Open Access Journals (Sweden)

    Michał Rurek

    2018-04-01

    Full Text Available Mitochondrial responses under drought within Brassica genus are poorly understood. The main goal of this study was to investigate mitochondrial biogenesis of three cauliflower (Brassica oleracea var. botrytis cultivars with varying drought tolerance. Diverse quantitative changes (decreases in abundance mostly in the mitochondrial proteome were assessed by two-dimensional gel electrophoresis (2D PAGE coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS. Respiratory (e.g., complex II, IV (CII, CIV and ATP synthase subunits, transporter (including diverse porin isoforms and matrix multifunctional proteins (e.g., components of RNA editing machinery were diversely affected in their abundance under two drought levels. Western immunoassays showed additional cultivar-specific responses of selected mitochondrial proteins. Dehydrin-related tryptic peptides (found in several 2D spots immunopositive with dehydrin-specific antisera highlighted the relevance of mitochondrial dehydrin-like proteins for the drought response. The abundance of selected mRNAs participating in drought response was also determined. We conclude that mitochondrial biogenesis was strongly, but diversely affected in various cauliflower cultivars, and associated with drought tolerance at the proteomic and functional levels. However, discussed alternative oxidase (AOX regulation at the RNA and protein level were largely uncoordinated due to the altered availability of transcripts for translation, mRNA/ribosome interactions, and/or miRNA impact on transcript abundance and translation.

  7. Cauliflower-like Neoplasm of Duodenal Papilla in a Liver Transplant Recipient: What Should We Think and Do? A Case Report.

    Science.gov (United States)

    Wan, D-L; Li, M-X; Bao, L; Zhang, L-L; Zhang, L; Chen, Q-Y; Lin, S-Z

    2018-04-01

    With the continuous improvement of liver transplantation technology, the survival rate of liver transplantation has been improved, but recurrent or de novo malignancy remains one of the major factors affecting the long-term survival of liver transplant recipients. A 45-year-old Chinese man had a plastic biliary stent placed on account of biliary anastomotic stenosis after 3 years of piggyback liver transplantation. He came to our hospital because of recurrent fever and jaundice for 2 weeks, and his carcinoembryonic antigen-199 had increased. The patient's duodenal papillary was cauliflower-like at endoscopic retrograde cholangiopancreatography to replace the biliary stent. He was initially suspected of having duodenal papillary carcinoma after liver transplantation. However, the pathology from endoscopic retrograde cholangiopancreatography and endoscopic ultrasound-guided biopsy showed inflammation. While awaiting the result of biopsy, his CA-199 decreased significantly after anti-infection and symptomatic treatment. The patient was diagnosed with biliary anastomotic stenosis and duodenal papillitis. He was discharged uneventfully; to date, there is no evidence of malignant tumor. We report this case to provide helpful information to clinicians about the management of the duodenal papilla cauliflower-like neoplasm after liver transplantation, which should be considered as inflammatory first. Perhaps our view can avoid the risk of bringing an excessive medical treatment and unnecessary economic burden to patients and their families. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Facile synthesis of nano cauliflower and nano broccoli like hierarchical superhydrophobic composite coating using PVDF/carbon soot particles via gelation technique.

    Science.gov (United States)

    Sahoo, Bichitra Nanda; Balasubramanian, Kandasubramanian

    2014-12-15

    We have elucidated a cost effective fabrication technique to produce superhydrophobic polyvinylidene fluoride (PVDF/DMF/candle soot particle and PVDF/DMF/camphor soot particle composite) porous materials. The water repellent dry composite was formed by the interaction of non-solvent (methanol) into PVDF/carbon soot particles suspension in N,N-dimethylformamide (DMF). It is seen that longer quenching time effectively changes the surface morphology of dry composites. The nano broccoli like hierarchical microstructure with micro or nano scaled roughen surface was obtained for PVDF/DMF/camphor soot particle, which reveals water contact angle of 172° with roll off angle of 2°. However, composite coating of PVDF/DMF/candle soot particle shows nano cauliflower like hierarchical, which illustrates water contact angle of 169° with roll off angle of 3°. To elucidate the enhancement of water repellent property of PVDF composites, we further divulge the evolution mechanism of nano cauliflower and nano broccoli structure. In order to evaluate the water contact angle of PVDF composites, surface diffusion of water inside the pores is investigated. Furthermore, the addition of small amount of carbon soot particles in composite not only provides the crystallization of PVDF, but also leads to dramatical amendment of surface morphology which increases the surface texture and roughness for superhydrophobicity. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Cauliflower-like MnO@C/N composites with multiscale, expanded hierarchical ordered structures as electrode materials for Lithium- and Sodium-ion batteries

    International Nuclear Information System (INIS)

    Chen, Ting; Wu, Zhenguo; Xiang, Wei; Wang, Enhui; Chen, Tingru; Guo, Xiaodong; Chen, Yanxiao; Zhong, Benhe

    2017-01-01

    MnO@C/N composite with expanded cauliflower-like morphology was prepared via one-pot L-tryptophan assisted hydrothermal method following by annealing in Ar atmosphere. The cauliflower structure was assembled by porous nanowires that composed of MnO nanoparticles wrapped by continuous N-doped amorphous carbon matrix. Superior electrochemical performances were obtained in both lithium/sodium ion batteries. And the reaction kinetics of MnO@C/N in lithium/sodium ion batteries were analyzed and compared. More than 837 mAh g −1 could be retained after 300 cycles at 500 mA g −1 . And a high reversible capacity of 336 mAh g −1 at 5000 mA g −1 also demonstrate the excellent rate performance of MnO@C/N for LIBs. As to SIBs, 123 mAh g −1 could be maintained after 200 cycles at 100 mA g −1 . The superior performances could be attributed to the peculiar porous micro-nano structure and N-doped amorphous carbon coating. The reaction kinetics results revealed that the capacitive-controlled capacity would dominate of the electrochemical performance in SIBs and the diffusion-controlled capacity could play a more important role in LIBs, due to the atom weight and size of Na + is larger than Li + .

  10. Variations in the phytochemical contents and antioxidant capacity of organically and conventionally grown Italian cauliflower (Brassica oleracea L. subsp. botrytis): results from a three-year field study.

    Science.gov (United States)

    Lo Scalzo, Roberto; Picchi, Valentina; Migliori, Carmela Anna; Campanelli, Gabriele; Leteo, Fabrizio; Ferrari, Valentino; Di Cesare, Luigi Francesco

    2013-10-30

    A three-year field study (2009-2011) was performed to evaluate phytochemicals and antioxidant capacities of two genotypes (HF1 Emeraude and the local variety, Velox) of green cauliflower grown under organic and conventional management. The conventional system increased yield, but had little effect on the dry matter, whereas the organic system increased the soluble solids. Phytochemicals and antioxidant capacity showed significant year-to-year variability. During the third year, the scarce rainfall determined a significant increase of total glucosinolates and a general decrease of antioxidants in all samples. Interestingly, in the same year organic plants were less affected by the unfavorable climatic conditions, as they increased ascorbic acid, polyphenols, and carotenoids with respect to conventional ones. The overall results for the three years showed that the two genotypes responded differently. Compared to the conventional system, Velox showed 24, 21, 13, 48, and 44% higher content of ascorbic acid, polyphenols, carotenoids, volatiles, and antioxidant capacity, respectively. In contrast, no significant increase in the phytochemicals or the antioxidant potential was found in organic Emeraude, with the exception of total volatiles (+41%). These findings suggest that organic cultivation may be highly effective for particular cauliflower genotypes.

  11. Mitochondrial Biogenesis in Diverse Cauliflower Cultivars under Mild and Severe Drought. Impaired Coordination of Selected Transcript and Proteomic Responses, and Regulation of Various Multifunctional Proteins

    Science.gov (United States)

    Rurek, Michał; Czołpińska, Magdalena; Staszak, Aleksandra Maria; Nowak, Witold; Krzesiński, Włodzimierz; Spiżewski, Tomasz

    2018-01-01

    Mitochondrial responses under drought within Brassica genus are poorly understood. The main goal of this study was to investigate mitochondrial biogenesis of three cauliflower (Brassica oleracea var. botrytis) cultivars with varying drought tolerance. Diverse quantitative changes (decreases in abundance mostly) in the mitochondrial proteome were assessed by two-dimensional gel electrophoresis (2D PAGE) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). Respiratory (e.g., complex II, IV (CII, CIV) and ATP synthase subunits), transporter (including diverse porin isoforms) and matrix multifunctional proteins (e.g., components of RNA editing machinery) were diversely affected in their abundance under two drought levels. Western immunoassays showed additional cultivar-specific responses of selected mitochondrial proteins. Dehydrin-related tryptic peptides (found in several 2D spots) immunopositive with dehydrin-specific antisera highlighted the relevance of mitochondrial dehydrin-like proteins for the drought response. The abundance of selected mRNAs participating in drought response was also determined. We conclude that mitochondrial biogenesis was strongly, but diversely affected in various cauliflower cultivars, and associated with drought tolerance at the proteomic and functional levels. However, discussed alternative oxidase (AOX) regulation at the RNA and protein level were largely uncoordinated due to the altered availability of transcripts for translation, mRNA/ribosome interactions, and/or miRNA impact on transcript abundance and translation. PMID:29642585

  12. Condicionamento fisiológico de sementes de couve-flor Priming seed treatment of cauliflower seeds

    Directory of Open Access Journals (Sweden)

    Ana Lúcia P Kikuti

    2009-06-01

    conducted to define an adequate procedure for cauliflower seed priming and to verify whether the seed physiological potential affects priming results. Six seed lots, three of the cultivar Sharon and three of Teresópolis Gigante, were submitted to hydropriming between two, four and six sheets of towel paper and to osmopriming between four sheets of towel paper moistened with polietilenoglycol 6000 solutions (-0,1 and -0,2 MPa potentials. In all priming procedures, the seed water content was adjusted to 32% or 38% for cv. Sharon and 34% or 41%, for cv. Teresópolis Gigante seeds. The effects of treatments on germination and seedling emergence were compared to unprimed control. Results showed that hydropriming between four and six sheets of towel paper was efficient to favor speed of germination (VG and speed of seedling emergence (VE in both cultivars when seeds attained 38% (cultivar Sharon and 41% (cultivar Teresópolis Gigante. VG increased from 14,6 (control to 16,4 (hydroprimed seeds in cv. Sharon seed lots of higher and lower physiological potential; the same for VE that incresead from 8,9 to 11,3 and from 7,8 to 11,6 in seed lots of lower physiological potential. In seeds of cv. Teresópolis Gigante, hydropriming promoted increases in the VG and VE, independently of seed physiological potencial; VG values ranged from 16,4 to 21,4 and the VE from 9,5 to 13,5. Results showed that hydropriming between four and six sheets of towel paper, in which seeds attained moisture content close to the required for primary root protrusion is efficient to favor the speed of germination and seedling emergence of cauliflower seeds; the influence of vigor level on seed priming response is closely related to cultivar and seed lot management.

  13. Saddle-nose and bilateral cauliflower ear deformities with pyoderma gangrenosum-like ulcers, cavitary pulmonary lesions, digital gangrene and pulselessness in a young female.

    Science.gov (United States)

    Subhadarshani, Sweta; Gupta, Vishal; Chahal, Anurag; Verma, Kaushal K

    2017-06-15

    We report a young female who presented with saddle-nose and bilateral cauliflower ear deformities along with pyoderma gangrenosum-like ulcers, digital gangrene and pulselessness. Subsequently, she was found to have bilateral conductive hearing loss, a corneal opacity, mild aortic regurgitation and radiological evidence of cavitary changes in lungs and aortoarteritis. Our patient had a constellation of symptoms which posed a diagnostic challenge. Finally, a diagnosis of relapsing polychondritis with several unusual features was made. Overlap with Takayasu's arteritis and granulomatosis with polyangitis, which has been reported rarely in the literature, cannot be excluded. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. Effect of different plant spacing on the production of cauliflower (Brassica oleraceae var. Botrytis) under the agro-climatic conditions of D.I. Khan.

    Science.gov (United States)

    Mujeeb-ur-Rahman; Iqbal, Muhammad; Jilani, Muhammad Saleem; Waseem, Kashif

    2007-12-15

    A research project to evaluate the effect of different plant spacing on the production of cauliflower was conducted at Horticulture Research Area, Faculty of Agriculture, Gomal University, Dera Ismail Khan, NWFP, Pakistan. Six different plant spacing viz., 30, 35, 40, 45, 50 and 55 cm were used. The results revealed significant variations in all the parameters and amongst various plant spacing, 45 cm spacing showed the best response for all the parameters. Maximum plant height (49.33 cm), curd diameter (19.13 cm), maximum curd weight (1.23 kg plant(-1)) and yield (30.77 t ha(-1)) were recorded in the plots where the plants were spaced 45 cm apart.

  15. Cauliflower-like SnO2 hollow microspheres as anode and carbon fiber as cathode for high performance quantum dot and dye-sensitized solar cells

    Science.gov (United States)

    Ganapathy, Veerappan; Kong, Eui-Hyun; Park, Yoon-Cheol; Jang, Hyun Myung; Rhee, Shi-Woo

    2014-02-01

    Cauliflower-like tin oxide (SnO2) hollow microspheres (HMS) sensitized with multilayer quantum dots (QDs) as photoanode and alternative stable, low-cost counter electrode are employed for the first time in QD-sensitized solar cells (QDSCs). Cauliflower-like SnO2 hollow spheres mainly consist of 50 nm-sized agglomerated nanoparticles; they possess a high internal surface area and light scattering in between the microspheres and shell layers. This makes them promising photoanode material for both QDSCs and dye-sensitized solar cells (DSCs). Successive ionic layer adsorption and reaction (SILAR) method and chemical bath deposition (CBD) are used for QD-sensitizing the SnO2 microspheres. Additionally, carbon-nanofiber (CNF) with a unique structure is used as an alternative counter electrode (CE) and compared with the standard platinum (Pt) CE. Their electrocatalytic properties are measured using electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV), and Tafel-polarization. Under 1 sun illumination, solar cells made with hollow SnO2 photoanode sandwiched with the stable CNF CE showed a power conversion efficiency of 2.5% in QDSCs and 3.0% for DSCs, which is quite promising with the standard Pt CE (QDSCs: 2.1%, and DSCs: 3.6%).Cauliflower-like tin oxide (SnO2) hollow microspheres (HMS) sensitized with multilayer quantum dots (QDs) as photoanode and alternative stable, low-cost counter electrode are employed for the first time in QD-sensitized solar cells (QDSCs). Cauliflower-like SnO2 hollow spheres mainly consist of 50 nm-sized agglomerated nanoparticles; they possess a high internal surface area and light scattering in between the microspheres and shell layers. This makes them promising photoanode material for both QDSCs and dye-sensitized solar cells (DSCs). Successive ionic layer adsorption and reaction (SILAR) method and chemical bath deposition (CBD) are used for QD-sensitizing the SnO2 microspheres. Additionally, carbon-nanofiber (CNF) with a

  16. Effect of radiation processing on shelf life and antioxidant properties of minimally processed ready to cook (RTC) cauliflower and ash gourd

    International Nuclear Information System (INIS)

    Vaishnav, Jasraj; Tripathi, Jyoti; Variyar, Prasad S.

    2017-01-01

    The demand for minimally processed vegetables are increasing because consumers now spend less time for cooking every day due to their busy life style, while insisting on more hygienic premium quality products with minimal change in nutritional and sensory properties. Minimally processed cauliflower and ash gourd products were developed using radiation processing. Products were irradiated with different doses of gamma radiation (0.5-2.5kGy), and stored at different temperatures (4,10 and 15 °C). At optimum processing conditions (0.5 kGy; 4 °C) RTC cauliflower was analyzed for their microbial and nutritional qualities (DPPH radical scavenging activity, total phenolic content, total flavonoid content and total ascorbic acid content) during a storage period of 21 days. An irradiation dose of 0.5 kGy extended the shelf life by 7 days as compared to the control which has shelf life of 14 days, along with significant increase in DPPH radical scavenging activity and total phenolic content. While in case of RTC ash gourd, optimum processing condition (2kGy;10 ° C) improved the shelf life by 7 days in comparison to control samples which have shelflife of 5 days. Irradiated samples had total phenolic content of 103.3 ± 5.2 mg kg"-"1 and total antioxidant activity of 384.2 ± 9.7 mg kg"-"1 while corresponding values for control samples were 67.8 ± 5.4 and 115.5 ± 7.0 mg kg"-1 at the end of storage period. However no significant effect was observed in total ascorbic acid content in both the products due to radiation processing. (author)

  17. Biogenesis of mitochondria in cauliflower (Brassica oleracea var. botrytis) curds subjected to temperature stress and recovery involves regulation of the complexome, respiratory chain activity, organellar translation and ultrastructure.

    Science.gov (United States)

    Rurek, Michal; Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

    2015-01-01

    The biogenesis of the cauliflower curd mitochondrial proteome was investigated under cold, heat and the recovery. For the first time, two dimensional fluorescence difference gel electrophoresis was used to study the plant mitochondrial complexome in heat and heat recovery. Particularly, changes in the complex I and complex III subunits and import proteins, and the partial disintegration of matrix complexes were observed. The presence of unassembled subunits of ATP synthase was accompanied by impairment in mitochondrial translation of its subunit. In cold and heat, the transcription profiles of mitochondrial genes were uncorrelated. The in-gel activities of respiratory complexes were particularly affected after stress recovery. Despite a general stability of respiratory chain complexes in heat, functional studies showed that their activity and the ATP synthesis yield were affected. Contrary to cold stress, heat stress resulted in a reduced efficiency of oxidative phosphorylation likely due to changes in alternative oxidase (AOX) activity. Stress and stress recovery differently modulated the protein level and activity of AOX. Heat stress induced an increase in AOX activity and protein level, and AOX1a and AOX1d transcript level, while heat recovery reversed the AOX protein and activity changes. Conversely, cold stress led to a decrease in AOX activity (and protein level), which was reversed after cold recovery. Thus, cauliflower AOX is only induced by heat stress. In heat, contrary to the AOX activity, the activity of rotenone-insensitive internal NADH dehydrogenase was diminished. The relevance of various steps of plant mitochondrial biogenesis to temperature stress response and recovery is discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Genome-Wide Identification of AP2/ERF Transcription Factors in Cauliflower and Expression Profiling of the ERF Family under Salt and Drought Stresses

    Science.gov (United States)

    Li, Hui; Wang, Yu; Wu, Mei; Li, Lihong; Li, Cong; Han, Zhanpin; Yuan, Jiye; Chen, Chengbin; Song, Wenqin; Wang, Chunguo

    2017-01-01

    The AP2/ERF transcription factors (TFs) comprise one of the largest gene superfamilies in plants. These TFs perform vital roles in plant growth, development, and responses to biotic and abiotic stresses. In this study, 171 AP2/ERF TFs were identified in cauliflower (Brassica oleracea L. var. botrytis), one of the most important horticultural crops in Brassica. Among these TFs, 15, 9, and 1 TFs were classified into the AP2, RAV, and Soloist family, respectively. The other 146 TFs belong to ERF family, which were further divided into the ERF and DREB subfamilies. The ERF subfamily contained 91 TFs, while the DREB subfamily contained 55 TFs. Phylogenetic analysis results indicated that the AP2/ERF TFs can be classified into 13 groups, in which 25 conserved motifs were confirmed. Some motifs were group- or subgroup- specific, implying that they are significant to the functions of the AP2/ERF TFs of these clades. In addition, 35 AP2/ERF TFs from the 13 groups were selected randomly and then used for expression pattern analysis under salt and drought stresses. The majority of these AP2/ERF TFs exhibited positive responses to these stress conditions. In specific, Bra-botrytis-ERF054a, Bra-botrytis-ERF056, and Bra-botrytis-CRF2a demonstrated rapid responses. By contrast, six AP2/ERF TFs were showed to delay responses to both stresses. The AP2/ERF TFs exhibiting specific expression patterns under salt or drought stresses were also confirmed. Further functional analysis indicated that ectopic overexpression of Bra-botrytis-ERF056 could increase tolerance to both salt and drought treatments. These findings provide new insights into the AP2/ERF TFs present in cauliflower, and offer candidate AP2/ERF TFs for further studies on their roles in salt and drought stress tolerance. PMID:28642765

  19. The influence of NO3- and NH4+ on the sites of nitrogen assimilation of F1 hybrid cauliflower (Brassica oleracea. L. botrytis)

    International Nuclear Information System (INIS)

    Asiah Ahmad; Parsons, R.; Md Razi Ismail

    2002-01-01

    The sites of Nitrogen assimilation of Fl hybrid cauliflower (Brassica oleracea L.) grown in vermiculite: pearlite on either NO 3 or NH 4 nutrition was investigated using 15 N techniques. Labelling studies using 15 NO 3 Or 15 NH 4 alone to follow a time course of 15 NO 3 or 15 NH 4 incorporated into amino compounds in Fl hybrid cauliflower was conducted over periods of up to 24 hours. The 15 N enrichment of amino compounds in various plant parts was measured using GC-MS and isotopic abundance mass spectrometry techniques. In roots of 15 NH 4 -N fed plant, the 15 N label rapidly appears in glutamate at high enrichment within 30 minutes and increased substantially up to 6 hours after feeding. The labelled glutamate appears to decrease slowly after 6 hours. In leaves, the glutamate shows much lower labelling within 30 minutes than in the roots and became slowly enriched 6 hours after feeding. Labelled glutamate was only detected in the curd 6 hours later. This may indicate that in NH 4 -N fed plants, most NH 4 is assimilated in the roots and translocated as amino acids to the leaves and curd. In contrast to 15 NO 3 -N fed plant, both the roots and leaves showed significant label in glutamate within 30 minutes and subsequently increased in labelled enrichment over the time period of 6 hours. The leaves contained higher labelled glutamate than the roots. The labelled glutamate in the leaves decreased significantly at 24 hours after feeding. Label was incorporated in glutamate at low level in the curd after 2 hours and became highly enriched at 6 and 24 hours after feeding. Thus in NO 3 -N fed plants, NO 3 reduction and assimilation occurred both in root and leaf which mainly occur in the leaf. Therefore differences in the response of plant growth to NO3 - and NH 4 + nutrition observed in other studies could be due to the fact that NO 3 is primarily assimilated in the leaf whereas NH 4 is root based. No significant labelling was found in serine in both roots of 15 NH 4 -N

  20. Resposta de brócolis, couve-flor e repolho à adubação com boro em solo arenoso Response of boron fertilization on broccoli, cauliflower and cabbage planted in sandy soil

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Pizetta

    2005-03-01

    Full Text Available Foram avaliados em condições de campo, em solo arenoso, com baixo teor de boro, os efeitos da adubação com cinco doses de boro (0; 2; 4; 6 e 8 kg ha-1 de B na forma de bórax na produção de brócolis, couve-flor e repolho. O experimento obedeceu a um esquema fatorial com delineamento experimental de blocos ao acaso com três repetições. As adubações orgânica e química, inclusive o bórax, foram feitas no sulco antes do transplantio das mudas e a colheita foi feita entre 63 e 93 dias após o transplantio. A produtividade de brócolis variou de 16,9 a 20,5 t ha-1; a de couve-flor de 21,6 a 29,6 t ha-1 e a de repolho de 40,5 a 46,4 t ha-1. O aumento observado na produtividade de brócolis e de repolho foi linear e o efeito das doses de boro na produtividade de couve-flor foi quadrático, sendo necessários 5,1 kg ha-1 de B para atingir a produtividade máxima de 30 t ha-1. Brócolis e repolho mostraram-se menos sensíveis do que a couve-flor tanto à deficiência quanto ao excesso de boro. No caso da couve-flor, com a aplicação de 2 kg ha-1 ou de 6 kg ha-1 de B houve significativa perda de qualidade do produto.The effects of boron fertilization on yield of broccoli, cauliflower and cabbage were evaluated through a field experiment carried out on a sandy soil low in available boron. Five boron levels (0; 2; 4; 6; and 8 kg ha-1 B as borax were applied in broccoli, cauliflower and cabbage using a factorial scheme and a randomized block design with three replicates. Organic manure and chemical fertilizers, including borax, were applied in the planting furrow before seedlings transplant and plants were harvested 63 to 93 days after planting date. The yield intervals obtained with broccoli, cauliflower and cabbage varied according to the following intervals: 16.9 to 20.5 t ha-1, 21.6 to 29.6 t ha-1 and 40.5 to 46.3 t ha-1, respectively. The increase in production observed in broccoli and cabbage yield was linear with boron levels and the

  1. Preparation of cauliflower-like shaped Ba0.6Sr0.4TiO3 powders by modified oxalate co-precipitation method

    International Nuclear Information System (INIS)

    Li Mingli; Xu Mingxia

    2009-01-01

    The quantitative barium-strontium titanyl oxalate (Ba 0.6 Sr 0.4 TiO(C 2 O 4 ) 2 .4H 2 O, BSTO) precursor powders were prepared by the modified oxalate co-preparation method. It was based on the cation-exchange reaction between the stoichiometric solutions of oxalotitanic acid (H 2 TiO(C 2 O 4 ) 2 , HTO) and barium + strontium nitrate solution containing stoichiometric quantities of Ba and Sr ions. The pyrolysis of BSTO at 800 deg. C/4 h in air produced the homogeneous cauliflower-like shaped barium-strontium titanate (Ba 0.6 Sr 0.4 TiO 3 , BST) powders. The effect of polyethylene glycol (PEG) on morphology of BSTO and BST powders was also investigated. The characterization studies were carried on the as-dried BSTO and calcined BST powders by various physicochemical techniques, IR, X-ray diffraction (XRD), scanning electron microscopy (SEM), etc. The BSTO and BST powders obtained by aforementioned technique without PEG were homogeneous with spherical shape. The particles grew into spindle shape with the effect of PEG

  2. Photo and biocatalytic activities along with UV protection properties on polyester fabric through green in-situ synthesis of cauliflower-like CuO nanoparticles.

    Science.gov (United States)

    Rezaie, Ali Bashiri; Montazer, Majid; Rad, Mahnaz Mahmoudi

    2017-11-01

    In this paper, a facile environmentally friendly method is introduced for in-situ synthesis and fabrication of cauliflower-like CuO nanoparticles on the polyester fabric to produce photo and biocatalytic activities with UV protection properties on polyester fabric. The ash of burnt leaves and stems of Seidlitzia rosmarinus plant called Keliab was used as a natural and nontoxic alkaline source for simultaneous synthesis of CuO nanoparticles and surface modification of polyester without using any other compounds. The images of field-emission scanning electron microscopy, patterns of energy-dispersive spectroscopy, UV-visible spectrum and X-ray diffraction confirmed successful synthesis and loading of CuO nanoparticles on the polyester fabric. The treated fabrics showed very good antibacterial activities toward two pathogen bacteria including Staphylococcus aureus as a Gram-positive and Escherichia coli as a Gram-negative bacteria with no adverse effects on human dermal fibroblasts based on MTT test. The treated fabrics confirmed significant photocatalytic activity for degradation of methylene blue under sunlight, self-cleaning properties under UV light and also UV protection properties. Further a colorant effect along with an improvement in the wettability and mechanical properties of the treated fabrics were indicated. Overall, this method can be applied as a clean route for producing photo and bio active textiles protecting against UV irradiation. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Formation of large viroplasms and virulence of Cauliflower mosaic virus in turnip plants depend on the N-terminal EKI sequence of viral protein TAV.

    Directory of Open Access Journals (Sweden)

    Angèle Geldreich

    Full Text Available Cauliflower mosaic virus (CaMV TAV protein (TransActivator/Viroplasmin plays a pivotal role during the infection cycle since it activates translation reinitiation of viral polycistronic RNAs and suppresses RNA silencing. It is also the major component of cytoplasmic electron-dense inclusion bodies (EDIBs called viroplasms that are particularly evident in cells infected by the virulent CaMV Cabb B-JI isolate. These EDIBs are considered as virion factories, vehicles for CaMV intracellular movement and reservoirs for CaMV transmission by aphids. In this study, focused on different TAV mutants in vivo, we demonstrate that three physically separated domains collectively participate to the formation of large EDIBs: the N-terminal EKI motif, a sequence of the MAV domain involved in translation reinitiation and a C-terminal region encompassing the zinc finger. Surprisingly, EKI mutant TAVm3, corresponding to a substitution of the EKI motif at amino acids 11-13 by three alanines (AAA, which completely abolished the formation of large viroplasms, was not lethal for CaMV but highly reduced its virulence without affecting the rate of systemic infection. Expression of TAVm3 in a viral context led to formation of small irregularly shaped inclusion bodies, mild symptoms and low levels of viral DNA and particles accumulation, despite the production of significant amounts of mature capsid proteins. Unexpectedly, for CaMV-TAVm3 the formation of viral P2-containing electron-light inclusion body (ELIB, which is essential for CaMV aphid transmission, was also altered, thus suggesting an indirect role of the EKI tripeptide in CaMV plant-to-plant propagation. This important functional contribution of the EKI motif in CaMV biology can explain the strict conservation of this motif in the TAV sequences of all CaMV isolates.

  4. Optimization of modified carbon paste electrode with multiwalled carbon nanotube/ionic liquid/cauliflower-like gold nanostructures for simultaneous determination of ascorbic acid, dopamine and uric acid

    International Nuclear Information System (INIS)

    Afraz, Ahmadreza; Rafati, Amir Abbas; Najafi, Mojgan

    2014-01-01

    We describe the modification of a carbon paste electrode (CPE) with multiwalled carbon nanotubes (MWCNTs) and an ionic liquid (IL). Electrochemical studies by using a D-optimal mixture design in Design-Expert software revealed an optimized composition of 60% graphite, 14.2% paraffin, 10.8% MWCNT and 15% IL. The optimal modified CPE shows good electrochemical properties that are well matched with model prediction parameters. In the next step, the optimized CPE was modified with gold nanostructures by applying a double-pulse electrochemical technique. The resulting electrode was characterized by scanning electron microscopy, energy dispersive X-ray spectroscopy, X-ray diffraction, and electrochemical impedance spectroscopy. It gives three sharp and well-separated oxidation peaks for ascorbic acid (AA), dopamine (DA), and uric acid (UA). The sensor enables simultaneous determination of AA, DA and UA with linear responses from 0.3 to 285, 0.08 to 200, and 0.1 to 450 μM, respectively, and with 120, 30 and 30 nM detection limits (at an S/N of 3). The method was successfully applied to the determination of AA, DA, and UA in spiked samples of human serum and urine. - Highlights: • New method for simultaneous determination of AA, DA and UA was developed. • MWCNT/ionic liquid/cauliflower-like Au nanostructure was used for CPE modification. • Optimization of electrode composition was done by Design-Expert software. • The pH effect, peak separation mechanism and real samples was thoroughly studied

  5. Optimization of modified carbon paste electrode with multiwalled carbon nanotube/ionic liquid/cauliflower-like gold nanostructures for simultaneous determination of ascorbic acid, dopamine and uric acid

    Energy Technology Data Exchange (ETDEWEB)

    Afraz, Ahmadreza [Department of Physical Chemistry, Faculty of Chemistry, Bu-Ali Sina University, P.O. Box 65174, Hamedan (Iran, Islamic Republic of); Rafati, Amir Abbas, E-mail: aa_rafati@basu.ac.ir [Department of Physical Chemistry, Faculty of Chemistry, Bu-Ali Sina University, P.O. Box 65174, Hamedan (Iran, Islamic Republic of); Najafi, Mojgan [Department of Materials Engineering, Hamedan University of Technology (HUT), 65169 Hamedan (Iran, Islamic Republic of)

    2014-11-01

    We describe the modification of a carbon paste electrode (CPE) with multiwalled carbon nanotubes (MWCNTs) and an ionic liquid (IL). Electrochemical studies by using a D-optimal mixture design in Design-Expert software revealed an optimized composition of 60% graphite, 14.2% paraffin, 10.8% MWCNT and 15% IL. The optimal modified CPE shows good electrochemical properties that are well matched with model prediction parameters. In the next step, the optimized CPE was modified with gold nanostructures by applying a double-pulse electrochemical technique. The resulting electrode was characterized by scanning electron microscopy, energy dispersive X-ray spectroscopy, X-ray diffraction, and electrochemical impedance spectroscopy. It gives three sharp and well-separated oxidation peaks for ascorbic acid (AA), dopamine (DA), and uric acid (UA). The sensor enables simultaneous determination of AA, DA and UA with linear responses from 0.3 to 285, 0.08 to 200, and 0.1 to 450 μM, respectively, and with 120, 30 and 30 nM detection limits (at an S/N of 3). The method was successfully applied to the determination of AA, DA, and UA in spiked samples of human serum and urine. - Highlights: • New method for simultaneous determination of AA, DA and UA was developed. • MWCNT/ionic liquid/cauliflower-like Au nanostructure was used for CPE modification. • Optimization of electrode composition was done by Design-Expert software. • The pH effect, peak separation mechanism and real samples was thoroughly studied.

  6. Light harvesting enhancement for dye-sensitized solar cells by novel anode containing cauliflower-like TiO{sub 2} spheres

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Lei [Beijing National Laboratory for Molecular Science, Key Laboratory of Photochemistry, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100080 (China); Graduate University of the Chinese Academy of Sciences, Beijing 100049 (China); Lin, Yuan; Xiao, Xurui; Li, Xueping; Zhou, Xiaowen [Beijing National Laboratory for Molecular Science, Key Laboratory of Photochemistry, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100080 (China); Jia, Jianguang [Department of Chemistry, School of Science, Beijing University of Chemical Technology, Beijing 100029 (China)

    2008-07-15

    Cauliflower-like TiO{sub 2} rough spheres, which are about 200 nm large, have greatly enhanced light harvesting efficiency and energy conversion efficiency of dye-sensitized solar cells (DSC), due to their high light scattering effect and large BET surface area (80.7 m{sup 2} g{sup -1}) even after calcinations at 450 C for 30 min. The large size TiO{sub 2} rough and smooth spheres, produced at different initial temperatures by hydrolysis of Ti(OBu){sub 4} with P105 (EO{sub 37}PO{sub 56}EO{sub 37}) or F68 (EO{sub 78}PO{sub 30}EO{sub 78}) tri-block copolymer as structural agents, have nearly the same diameter of {proportional_to}275 nm and strong light scattering effects in the wavelength of 400-750 nm. However, rough spheres have even higher light scattering effect and larger BET surface area than smooth spheres for the roughness of the surface. By adding 25 wt.% large TiO{sub 2} spheres into the over-layer of TiO{sub 2} film composed of {proportional_to}20 nm TiO{sub 2} particles as light scattering centers, the energy conversion efficiency of the film containing rough spheres reaches 7.36%, much larger than that of smooth spheres (6.25%). From another point of view, the TiO{sub 2} rough spheres may have the satisfying ability in other fields of application such as photo-catalysis, drug carriers and so on. (author)

  7. Ultra(high)-pressure liquid chromatography-electrospray ionization-time-of-flight-ion mobility-high definition mass spectrometry for the rapid identification and structural characterization of flavonoid glycosides from cauliflower waste.

    Science.gov (United States)

    Gonzales, Gerard Bryan; Raes, Katleen; Coelus, Sofie; Struijs, Karin; Smagghe, Guy; Van Camp, John

    2014-01-03

    In this paper, a strategy for the detection and structural elucidation of flavonoid glycosides from a complex matrix in a single chromatographic run using U(H)PLC-ESI-IMS-HDMS/MS(E) is presented. This system operates using alternative low and high energy voltages that is able to perform the task of conventional MS/MS in a data-independent way without re-injection of the sample, which saves analytical time. Also, ion mobility separation (IMS) was employed as an additional separation technique for compounds that are co-eluting after U(H)PLC separation. First, the fragmentation of flavonoid standards were analyzed and criteria was set for structural elucidation of flavonoids in a plant extract. Based on retention times, UV spectra, exact mass, and MS fragment characteristics, such as abundances of daughter ions and the presence of radical ions ([Y0-H](-)), a total 19 flavonoid glycosides, of which 8 non-acylated and 11 acylated, were detected and structurally characterized in a cauliflower waste extract. Kaempferol and quercetin were the main aglycones detected while sinapic and ferulic acid were the main phenolic acids. C-glycosides were also found although their structure could not be elucidated. The proposed method can be used as a rapid screening test for flavonoid identification and for routine analysis of plant extracts, such as these derived from cauliflower waste. The study also confirms that agroindustrial wastes, such as cauliflower leaves, could be seen as a valuable source of different bioactive phenolic compounds. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Desempenho de cultivares de couve-flor de verão em Ipameri Performance of cultivars of cauliflower summer in Ipameri

    Directory of Open Access Journals (Sweden)

    Odilon Peixoto de Morais Júnior

    2012-11-01

    Full Text Available Com o propósito de avaliar o comportamento de seis cultivares de couve-flor de verão, quanto à produção e resistência à podridão negra (Xanthomonas campestris pv. campestris, instalou-se um experimento em campo, em Ipameri-GO, com o delineamento experimental em blocos completos casualizados com seis tratamentos e quatro repetições. Cada parcela experimental, de 10m², constou de 20 plantas distribuídas no espaçamento de 1,0m entre linhas e 0,5m entre plantas. Foram avaliadas as cultivares: híbridos 'Cindy', 'Sarah AF-1169', 'Sharon', 'Verona', 'Lisvera' e a variedade Piracicaba precoce. Os híbridos Verona e Sharon mostraram-se promissores para cultivo nas condições edafoclimáticas em que foram avaliados, com produtividades de 34,17 e 30,64t ha-1, respectivamente, e com moderados níveis de resistência à podridão negra. A variedade Piracicaba precoce apresentou produção inferior às dos melhores híbridos avaliados e moderada resistência à podridão negra. O híbrido Sarah não é recomendado para plantio na região de Ipameri-GO por apresentar baixa produção e baixa resistência à podridão negra.In order to evaluate the behavior of six cultivars of cauliflower summer, as production and resistance to black rot (Xanthomonas campestris pv. campestris, installed a field experiment in Ipameri-GO, with the experimental in randomized complete blocks with six treatments and four replications. Each plot of 10m², consisting of 20 plants distributed at a spacing of 1.0m between rows and 0.5m between plants. We evaluated the cultivars: hybrids 'Cindy', 'Sarah AF-1169', 'Sharon', 'Verona', 'Lisvera' and the variety Piracicaba precoce. Hybrids Verona and Sharon proved promising for cultivation in the environmental conditions that were evaluated, with yields of 34.17 and 30.64t ha-1 respectively, and moderate levels of resistance to black rot. The variety Piracicaba precoce showed lower production of the best hybrids and moderate

  9. Novas linhagens de repôlho e couve-flor para o Estado de São Paulo Improved cabbage and cauliflower types for São Paulo

    Directory of Open Access Journals (Sweden)

    Leocádio de Souza Camargo

    1956-01-01

    ça, e a colheita dura cêrca de 60 dias. Iniciou-se o melhoramento da couve-flor "Campinas" em 1944, de material adquirido em casa comercial de São Paulo, com o nome "Quatro Estações". Após alguns anos de trabalho, criaram-se na E. E. Central em Campinas e na E. E. de Monte Alegre do Sul, linhagens muito boas. A variedade "Campinas" (I.A.C. n.° 1587 é de média precocidade, tendo produzido em 1950 e 1951, em campo de cooperação, respectivamente 398 e 1244 kg de sementes, ou uma média de 30 g por planta, ou sejam, 60 g por m², Para produção de sementes a melhor época de semeadura é fevereiro. As cabeças formam-se em junho e desde 120 dias após, as sementes são colhidas, durando a colheita 16 dias em média.Investigations on the cabbage (Brassica oleracea L. var. capitata L. and cauliflower (B. oleracea var. cauliflora, Gars, D.C. plants at the Instituto Agronômico and its various experiment stations were intensified since 1941. From 1944 on, a great deal of attention has been given to the variety problem, to improvement of local and imported types, and to their seed production. Seventy four varieties of cabbage and 59 varieties of cauliflower have been tested. The majority of these grew well in the cool season, when the average monthly temperature was around 22.5°C during the vegetative period and about 16.6°C at the time when heads were formed. In order to supply the local markets with cabbage and cauliflower during the warmer months, attention was turned to types that were capable of making satisfactory growth and forming heads during those months of the year when temperature was high. The local variety of cabbage named "Louco" (I.A.C. N.° 758, as well as the cauliflower Early Benares from India, could be cultivated in summer and fall in most mparts of São Paulo. Satisfactory growth of these types was obtained at average monthly temperatures from 20.4 to 22.6°C, and good heading when the average monthly was from 18 to 22.2°C. Improvement of the

  10. Coincidence of flowering time and the productivity and quality of cauliflower hybrid seeds Coincidência de florescimento entre linhagens de couve-flor na produtividade e qualidade de sementes híbridas

    Directory of Open Access Journals (Sweden)

    Marcelo Fontanetti Verdial

    2001-09-01

    Full Text Available The missing of flowering synchronization between the self-incompatible lines in a crop field of cauliflower hybrid seeds besides making the seed production smaller can compromise the genetic purity of them. The coincidence of the flowering time between two cauliflower lines was examined to study its effect on the productivity and quality of hybrid seeds. The treatments consisted of six different sowing dates, every fifteen days, using a self-incompatible tropical line pollinated by a winter line which does not present self-incompatibility. The following characteristics were evaluated: leaf average area and number of flowers per plant, number of siliques per plant, number and weight of seeds per plant, weight of thousand seeds and average number of seeds per silique. The germination standard test and genetic seed purity were determined for each treatment. The coincident flowering season between cauliflower lines affects directly the productivity and the genetic quality of the produced hybrid seeds. The closer the flowering time coincidence between the lines, the greater the number of seeds per silique and the smaller the percentage of non-hybrid seedlings. However, the coincidence of the flowering season between lines was found to influence physiological seed quality.A falta de sincronismo de florescimento entre as linhagens auto incompatíveis em um campo de produção de sementes híbridas de couve flor pode além de reduzir a produção de sementes comprometer a pureza genética das mesmas. Com o objetivo de estudar o efeito da coincidência de florescimento entre linhagens de couve-flor na produtividade e qualidade de sementes híbridas, foi realizado o presente experimento. Os tratamentos consistiram em seis diferentes épocas de semeadura, espaçadas a cada quinze dias, de uma linhagem de verão auto-incompatível que foi polinizada por uma linhagem de inverno que não apresenta auto-incompatibilidade. Observou-se a coincidência do

  11. Study on determination of planting time for some cauliflower cultivars (Brassica oleracea var. botrytis) under Samsun ecological conditions by using plant growth and developmental models based on thermal time

    International Nuclear Information System (INIS)

    Uzun, S.; Peksen, A.

    2000-01-01

    In this study, it was aimed to determine the effects of different planting times (01 July, 15 July and 01 August) on the growth and developmental components of some cauliflower cultivars (Snow King, White Cliff, White Rock, White Latin, Me & Carillon, SG 4004 F1 and Serrano) by using plant growth and developmental models. From the results of the present study, it was revealed that thermal time elapsing from planting to curd initiation should be high (about 1200 degree centigrade days) to stimulate vegetative growth while thermal time elapsing from curd initiation to the harvest should be low (around 200 degree centigrade days) in terms of curd weight. The highest curd weight and yield were obtained from the plants of the first planting time, namely 01 July, compared to the other planting times (15 July and 01 August). Although there were no significant differences between the cultivars, the highest yield was obtained form Cv. Me & Carillon (13.25 t ha-1), SG 4004 F1 (13.14 t ha-1) and White Rock (11.51 t ha-1) respectively

  12. Preparation of cauliflower-like shaped Ba{sub 0.6}Sr{sub 0.4}TiO{sub 3} powders by modified oxalate co-precipitation method

    Energy Technology Data Exchange (ETDEWEB)

    Li Mingli [School of Materials Science and Engineering, Key Laboratory for Advanced Ceramics and Machining Technology of Ministry of Education, Tianjin University, Tianjin 300072 (China)], E-mail: lml@tju.edu.cn; Xu Mingxia [School of Materials Science and Engineering, Key Laboratory for Advanced Ceramics and Machining Technology of Ministry of Education, Tianjin University, Tianjin 300072 (China)

    2009-04-17

    The quantitative barium-strontium titanyl oxalate (Ba{sub 0.6}Sr{sub 0.4}TiO(C{sub 2}O{sub 4}){sub 2}.4H{sub 2}O, BSTO) precursor powders were prepared by the modified oxalate co-preparation method. It was based on the cation-exchange reaction between the stoichiometric solutions of oxalotitanic acid (H{sub 2}TiO(C{sub 2}O{sub 4}){sub 2}, HTO) and barium + strontium nitrate solution containing stoichiometric quantities of Ba and Sr ions. The pyrolysis of BSTO at 800 deg. C/4 h in air produced the homogeneous cauliflower-like shaped barium-strontium titanate (Ba{sub 0.6}Sr{sub 0.4}TiO{sub 3}, BST) powders. The effect of polyethylene glycol (PEG) on morphology of BSTO and BST powders was also investigated. The characterization studies were carried on the as-dried BSTO and calcined BST powders by various physicochemical techniques, IR, X-ray diffraction (XRD), scanning electron microscopy (SEM), etc. The BSTO and BST powders obtained by aforementioned technique without PEG were homogeneous with spherical shape. The particles grew into spindle shape with the effect of PEG.

  13. Produtividade da couve-flor em função da idade de transplantio das mudas e tamanhos de células na bandeja Cauliflower production depending on age of seedling and cell size of the trays

    Directory of Open Access Journals (Sweden)

    Maria Carolina Godoy

    2005-07-01

    Full Text Available O experimento foi realizado de novembro de 2000 a abril de 2001, na UNESP em São Manuel (SP. Estudou-se o efeito do tamanho da célula da bandeja de poliestireno expandido e a idade de transplantio das mudas sobre a produção de couve-flor, híbrido Shiromaru II. Usaram-se bandejas com 128 e 288 células, correspondentes a 34,6 e 9,7 cm³/célula, respectivamente, e mudas transplantadas aos 27, 34, 41 e 48 dias após a semeadura. Os tratamentos foram arranjados como fatorial 2 x 4, dispostos no delineamento de blocos casualizados, com cinco repetições. Foram avaliados, por ocasião do transplantio, o número de folhas, peso fresco, peso seco e área foliar das mudas. A parcela experimental no campo foi constituída por dez plantas. Nas colheitas, avaliaram-se a porcentagem de plantas com cabeça comercial e nestas, o número de folhas, peso fresco e diâmetro da cabeça. A produção total por parcela foi obtida com a soma do peso fresco de todas as cabeças consideradas comerciais. A produção de mudas em bandejas com 128 células proporcionou maior porcentagem de plantas comerciais (64% relativamente às bandejas com 288 células (45%, maior peso médio de cabeça (337 g na bandeja com 128 e 247 g na bandeja com 288 células e maior produção de plantas comerciais (36,9 t/ha em bandeja de 128 células e 19,9 t/ha em bandeja de 288 células. As mudas transplantadas com 32 dias apresentaram maior peso médio de cabeça (319 g. Concluiu-se ser recomendável produzir mudas de couve-flor em bandejas com 128 células.The experiment was carried out from November/2000 to April/2001, in São Manuel, São Paulo State, Brazil. The effect of cell size of two polyestyrene trays and age of seedling at transplanting date was observed, on the production of cauliflower, hybrid Shiromaru II. Trays with 128 and 288 cells, corresponding to 34.6 and 9.7 cm³/cell, respectively, were used with seedlings transplanted at 27; 34; 41 and 48 days after sowing date

  14. Efeito do cozimento sobre alguns fatores antinutricionais em folhas de brócoli, couve- flor e couve Effect of boiling on contents of antinutritional factors in leaves of broccoli, cauliflower and cabbage

    Directory of Open Access Journals (Sweden)

    Mônica Alessandra Teixeira dos Santos

    2006-04-01

    Full Text Available Os resíduos vegetais desprezados pela indústria e durante o preparo dos alimentos poderiam ser utilizados como fontes alternativas de nutrientes contribuindo para o enriquecimento da dieta das populações carentes. Por outro lado, muitos alimentos vegetais são fontes de fatores antinutricionais que interferem na digestão ou absorção de nutrientes. Determinou-se os teores de polifenóis, nitrato e ácido oxálico de folhas de brócoli, couve-flor e couve submetidas à cocção por seis diferentes tempos (0, 2, 4, 6, 8 e 10 minutos. Verificou-se queda nos teores de fatores antinutricionais com o aumento do tempo de cozimento, mostrando-se aceitáveis para o consumo. No entanto, os tratamentos utilizados não foram suficientes para reduzir os teores de polifenóis das folhas de brócoli e couve a valores considerados adequados ao consumo humano, sugerindo a utilização conjunta de outra metodologia para a redução dos polifenóis presentes nesses vegetais.The vegetable residues despised from the industry and during the food preparation might be used as an alternative nutrient source that provides poor people a richer diet. Otherwise, many vegetables are source of antinutritional factors that might influence in the digest or in the nutrients absorption. As the purpose to determining the contents of poliphenols, oxalic acid and nitrate in leaves of broccoli, cauliflower and cabbage, they were submitted to cooking in six different times (0, 2, 4, 6, 8 and 10 minutes. The results showed that the antinutritional factors dropped with the increase of the cooking time, being acceptable for the consumption. However, the treatments were not enought to decrease the contents of poliphenols in leaves of broccoli and cabbage considering values to the human consumption. Thus, it had better to use another methodology to decrease the level of polyphenols in the vegetables.

  15. Soil pH and nutrient uptake in cauliflower (Brassica oleracea L. var. botrytis) and Broccoli (Brassica oleracea L. var. italica) in Northern Sweden. Multielement studies by means of plant and soil analyses

    Energy Technology Data Exchange (ETDEWEB)

    Magnusson, Margareta [Swedish Univ. of Agricultural Sciences, Umeaa (Sweden). Dept. of Agricultural Research for Northern Sweden

    2000-07-01

    To reveal nutrient element deficiencies or imbalances limiting vegetable production in northern Sweden, multielement soil and plant analyses were performed in cauliflower and broccoli during the period 1989 to 1996. The pH range of the soils was 4.4-8. 1. The results were evaluated with the multivariate statistical methods PCA (Principal Component Analysis) and PLS (Partial Least Squares Projection to Latent Structures). The major yield-limiting elements were Mg, B, Mn, Zn, Fe and Cu. This was a result of high soil pH and large content of Ca in the soil. The reason for B deficiency was also low B content in the soil. Applications of green mulch increased yield on soils with a pH below 6.0. It also increased the uptake and concentration in the plants of B, Ba, Cl, Cu, K, Mg, Mn, N, P, Se and Zn, and decreased the uptake and concentration of Al, Cs and Tl. The mineral fertilizer applied, NPK 11-5-18 micro, decreased soil pH. This has resulted in larger uptake and higher concentrations in the plants of Co and Mn, in comparison to where cattle manure was applied. This fertilizer strongly decreased uptake of Mo, as a result of both the acidifying effect and the large S content. Repeated applications of nitrate of lime in combination with the NPK 11-5-18 strongly increased the uptake of Cs by the plants. The results in this investigation, together with the literature reviews, strongly indicate that a relatively low soil pH (5.0-5.5) is favourable when organic fertilizers are used and that harmful effects of very low soil pH (<5.0), are ameliorated by organic materials but aggravated by mineral fertilizers. The main purpose of lime is to counteract the acidity and increased leaching created by mineral fertilizers. Because of the historical context in which the lime requirements were established, the dangers of acid soils appear to have been strongly overestimated.

  16. Agrobacterium-mediated transformation of cauliflower: optimization ...

    Indian Academy of Sciences (India)

    Unknown

    significantly enhanced productivity and quality of the crop, but insect-pests, ... were tested, one at a time, in a sequential order. The op- ..... cultivation (at 22°C) was increased to 4 days. A 3-day .... of practical utility in pest management. Table 3.

  17. Formation and photoluminescence of "Cauliflower" silicon nanoparticles

    NARCIS (Netherlands)

    Tang, W.; Eilers, J.J.; Huis, van M.A.; Wang, D.; Schropp, R.E.I.; Vece, Di M.

    2015-01-01

    The technological advantages of silicon make silicon nanoparticles, which can be used as quantum dots in a tandem configuration, highly relevant for photovoltaics. However, producing a silicon quantum dot solar cell structure remains a challenge. Here we use a gas aggregation cluster source to

  18. Avaliação de larvicidas de origem microbiana no controle da traça-das-crucíferas em couve-flor Evaluation of microbiological larvicides to control diamondback moth in cauliflower

    Directory of Open Access Journals (Sweden)

    Daniel G.S. Dias

    2004-09-01

    Full Text Available Dois inseticidas biológicos à base de Bacillus thuringiensis subspécies kurstaki (Btk e aizawai (Bta e um inseticida não sistêmico de origem biológica, à base de spinosad, foram avaliados em campo contra a traça-das-crucíferas, Plutella xylostella (L.(Lep.: Plutellidae, em cultivo de couve-flor. O experimento foi realizado em Brazlândia, DF, em uma área de produção regular de hortaliças. A lavoura foi conduzida segundo manejo indicado para a região, sem qualquer intervenção que não o controle da praga. O experimento foi realizado no período de julho a setembro de 2002. O delineamento foi de blocos ao acaso, com quatro tratamentos e quatro repetições. Os produtos foram aplicados em função da média do número de furos produzidos pela praga, presentes nas quatro folhas centrais das plantas, sendo os diferentes tratamentos avaliados semanalmente. Quando a média do número de furos atingia valor igual ou superior a seis, os produtos eram aplicados. Adotando-se este procedimento, aplicou-se três vezes o inseticida spinosad e seis vezes os inseticidas Btk e Bta. Os três tratamentos com inseticidas não diferiram entre si, mas diferiram significativamente da testemunha quanto à produção. As áreas tratadas com Btk produziram 78,1% de cabeças comercializáveis, as tratadas com Bta 76,5% e as tratadas com spinosad 75,5%. No controle houve perda de 34,4% da produção. A utilização dos produtos aumentou a receita da cultura da couve-flor em relação à testemunha, nos valores de R$ 2.505,19 com o Btk, R$ 1.954,55 com o Bta e R$ 1.891,65 com spinosad.Two bioinsecticides based on Bacillus thuringiensis sub species kurstaki (Btk and aizawai (Bta and non-systemic insecticide of biological origin based on spinosad were evaluated on cauliflower crop for diamondback moth, Plutella xylostella (L. (Lep.:Plutellidae control. The experiment was conducted in a vegetable production area of Brazlândia, Brazil. The crop was conducted

  19. Effect of alcoholic extract of guaco (Mikania glomerata on the control of dark rot (Xanthomonas campestris pv. campestris in cauliflower/ Avaliação da eficácia da tintura etanólica de guaco (Mikania glomerata no controle da podridão negra (Xanthomonas campestris pv. campestris em couve-flor

    Directory of Open Access Journals (Sweden)

    Kátia Regina Freitas Schwan-Estrada

    2006-06-01

    Full Text Available With the use of irrigation and new hybrids of cauliflower, it is possible to get production during all the year with hight yield. However, the crop has been affected by diseases, as the dark rot caused by X. campestris pv. campestris. The objective of this research work was to study the potential of Mikania glomerata for the control of this disease. Alcoholic extract 50 ºGL of M. glomerata was evaluated regarding to: in vitro antimicrobial activity through bacterial growth in 100, 250, 500 and 1000 mg L-1 of the alcoholic extract; induction of local or systemic resistance in 25 days old cauliflower, with spray of alcoholic extract concomitantly and three days before the inoculation with the pathogen (water and bordeau mixture were used as control; peroxidases activity in leaves of cauliflower treated and not treated, and harvested concomitantly, 24, 48 and 72 hours after spraying the alcoholic extract and also after inoculation. The alcoholic extract of M. glomerata showed inhibition of the bacterial growth in vitro at the concentrations of 250, 500 and 1000 mg L-1. The concentrations of 500 mg L-1 and 1000 mg L-1 inhibited 24% and 38% of the bacterial growth. This inhibition could be due to antibacterial compounds in the alcoholic extract. An inhibition of the disease in vivo occurred only in the leaves treated with 100 and 500 mg L-1 of alcoholic extract when applied concomitantly with the bacteria. This result was similar to bordeau mixture, indicating a control by direct antimicrobial activity. There was no systemic resistence induction for all treatments. The peroxidases induction was due to infectious pathogen process and not to the treatments with alcoholic extract. The results indicate the potential of M. glomerata alcoholic extract for the preventive control of cauliflower dark rot disease.Com a prática da irrigação e novos híbridos de couve-flor, é possível produzir durante todo o ano e com alta produtividade. Mas, a cultura tem

  20. CONTROLE QUÍMICO DOS PULG��ES Mysus persicae E Brevicoryne brassicae NA CULTURA DA COUVE-FLOR COM INSETICIDAS APLICADOS NA FORMA DE ESGUICHO CHEMICAL CONTROL OF APHIDS Mizus persicae AND Brevicoryne brassicae ON CAULIFLOWER WITH INSECTICIDES APPLIED IN TRANSPLANT HOLES

    Directory of Open Access Journals (Sweden)

    Selby Pereira dos Santos

    2007-09-01

    style="font-family: Times New Roman,serif;">persicae and Brevicoryne brassicae, in cauliflower, through insecticide Confidor 700 GRDA and Confidor 200 SC, was evaluated in an experimental area of the Federal University of Goiás, in May 1998. Two dosages for each one of the insecticides, as standard insecticide (Tamaron and a witness were used. Confidor 700 GRDA and Confidor 200 SC were applied at only turn in the transplanted holes, with a coastal atomizer, using jet beak. The evaluation of the results of M. persicae consisted of counting the nymphs and adults in leaves chosen by chance in plants of the central line of the parcels 35 days after the treatments. The same method was employed for the evaluation of B. brassicae 48 days after the chemical control. The treatment with Tamaron Br was applied in form of weekly applications. Confidor 700 GRDA and 200 SC controlled the aphids M. persicae and B. brassicae efficiently on the cauliflower, in minor dosages, being superior to Tamaron Br, as far as the control of

  1. Antiviral activity of tenofovir against Cauliflower mosaic virus and its metabolism in Brassica pekinensis plants

    Czech Academy of Sciences Publication Activity Database

    Špak, Josef; Votruba, Ivan; Pavingerová, Daniela; Holý, Antonín; Špaková, Vlastimila; Petrzik, Karel

    2011-01-01

    Roč. 92, č. 2 (2011), s. 378-381 ISSN 0166-3542 R&D Projects: GA ČR GA522/09/0707 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z40550506 Keywords : Caulimovirus * dsDNA * Brassica Subject RIV: CE - Biochemistry Impact factor: 4.301, year: 2011

  2. Characterization of new microsatellite loci for population genetic studies in the Smooth Cauliflower Coral (Stylophora sp.)

    KAUST Repository

    Banguera-Hinestroza, E.

    2013-01-09

    A total of one hundred microsatellites loci were selected from the draft genome of Stylophora pistillata and evaluated in previously characterized samples of Stylophora cf pistillata from the Red Sea. 17 loci were amplified successfully and tested in 24 individuals from samples belonging to a single population from the central region of the Red Sea. The number of alleles ranged from 3 to 15 alleles per locus, while observed heterozygosity ranged from 0. 292 to 0. 95. Six of these loci showed significant deviations from Hardy-Weinberg equilibrium (HWE) expectations, and 4/136 paired loci comparisons suggested linkage disequilibrium after Bonferroni corrections. After excluding loci with significant HWE deviation and evidence of null alleles, average genetic diversity over loci in the population studied (N = 24, Nloci = 11) was 0. 701 ± 0. 380. This indicates that these loci can be used effectively to evaluate genetic diversity and undertake population genetics studies in Stylophora sp. populations. 2013 The Author(s).

  3. Transmission of Xanthomonas campestris pv. campestris in seed production crops of cauliflower

    NARCIS (Netherlands)

    Kastelein, P.; Krijger, M.C.; Zouwen, van der P.S.; Steen, van der J.J.M.; Stevens, L.H.; Wolf, van der J.M.; Fernandes Vieira, J.; Amaral Villela, F.

    2014-01-01

    n 2011, two polytunnel greenhouse experiments were conducted on seed production farms, one under conventional conditions in the South-West (Rilland) and the other under organic conditions in the East (Voorst) of the Netherlands, to study transmission routes of Xanthomonas campestris pv. campestris

  4. Characterization of new microsatellite loci for population genetic studies in the Smooth Cauliflower Coral (Stylophora sp.)

    KAUST Repository

    Banguera-Hinestroza, E.; Saenz-Agudelo, P.; Bayer, T.; Berumen, Michael L.; Voolstra, Christian R.

    2013-01-01

    in 24 individuals from samples belonging to a single population from the central region of the Red Sea. The number of alleles ranged from 3 to 15 alleles per locus, while observed heterozygosity ranged from 0. 292 to 0. 95. Six of these loci showed

  5. Epidemiology of dark leaf spot caused by Alternaria brassicicola and Alternaria brassicae in organic seed production of cauliflower

    NARCIS (Netherlands)

    Köhl, J.; Tongeren, van C.A.M.; Groenenboom-de Haas, B.H.; Hoof, van R.A.; Driessen, R.; Heijden, van der L.

    2010-01-01

    In organic seed production of Brassica vegetables, infections by Alternaria brassicicola and A. brassicae can cause severe losses of yield and seed quality. Four field experiments with or without artificial inoculation with A. brassicicola were conducted in organically managed seed-production crops

  6. Antiviral activity of acyclic nucleoside phosphonates PMEA, (S)-HPMPC, PMEDAP and ribavirin against Cauliflower mosaic virus in Brassica pekinensis

    Czech Academy of Sciences Publication Activity Database

    Špak, Josef; Votruba, Ivan; Pavingerová, Daniela; Holý, Antonín; Špaková, Vlastimila; Petrzik, Karel

    2012-01-01

    Roč. 10, č. 1 (2012), s. 63-68 ISSN 0167-6857 R&D Projects: GA ČR GA522/09/0707 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z40550506 Keywords : Caulimovirus * Chemotherapy * Pararetrovirus * dsDNA Subject RIV: EE - Microbiology, Virology Impact factor: 3.633, year: 2012

  7. Properties and potential applications of the culinary-medicinal cauliflower mushroom, Sparassis crispa Wulf.:Fr. (Aphyllophoromycetideae): a review.

    Science.gov (United States)

    Chandrasekaran, Gayathri; Oh, Deuk-Sil; Shin, Hyun-Jae

    2011-01-01

    Sparassis crispa is a culinary-medicinal mushroom that has recently become popular in Korea, China, Japan, Germany, and the USA. S. crispa is a good source of food and nutraceuticals, or dietary supplements, due to its rich flavor compounds and beta-glucan content. This review is a comprehensive summary of its distribution, growth, management, general constituents, functional ingredients, as well as its current and potential medicinal and other applications.

  8. Is the mind a cauliflower or an onion? British insights into cognitive organization from the study of abnormal function.

    Science.gov (United States)

    McCarthy, Rosaleen A.

    2001-02-01

    Clinical and normal psychology have had a long tradition of close interaction in British psychology. The roots of this interplay may predate the development of the British Psychological Society, but the Society has encouraged and supported this line of research since its inception. One fundamental British insight has been to consider the evidence from pathology as a potential constraint on theories of normal function. In turn, theories of normal function have been used to understand and illuminate cognitive pathology. This review discusses some of the areas in which clinical contributions to cognitive theory have been most substantial. As with other contributions to this volume, attempts are also made to read the runes and anticipate future developments.

  9. Both the constitutive Cauliflower Mosaic Virus 35S and tissue-specific AGAMOUS enhancers activate transcription autonomously in Arabidopsis thaliana

    Science.gov (United States)

    The presence of multiple enhancers and promoters within a single vector often provokes complicated mutual interaction and crosstalk, thereby, altering promoter specificity, which causes serious problems for precisely engineering gene function and agronomic traits in transgenic plants. Enhancer elem...

  10. Effect of short-term subaerial exposure on the cauliflower coral, Pocillopora damicornis, during a simulated extreme low-tide event

    KAUST Repository

    Castrilló n-Cifuentes, Ana Lucia; Lozano-Corté s, Diego; Zapata, Fernando A.

    2017-01-01

    There is increased interest in understanding how stress reduces coral resistance to disturbances and how acclimatization increases the ability of corals to resist future stress. Most extreme low tides at Gorgona Island, which expose reef flats to air, do not appear to negatively affect corals because corals usually do not undergo lethal bleaching during such events. However, coral physiology and fitness may be impacted by this phenomenon. The aim of this study was to evaluate whether corals exposed to air have modified biological functions to resist bleaching. To test this, an extreme low-tide event was simulated in the field. Colonies of Pocillopora damicornis were exposed to air for 15 or 40 min over the course of one, two, or three consecutive days. This procedure was repeated for one to three months. Colonies of P. damicornis exposed to air had reduced fecundity, decreased zooxanthellae density, and changed color from darker to lighter. However, the growth rate of exposed corals was similar to that of non-exposed colonies. We conclude that short periods of subaerial exposure during extreme low tides are not lethal to P. damicornis, but negatively affect sexual reproduction, which might have deleterious effects at the population level. The periodic occurrence of extreme low tides in the tropical eastern Pacific may be one factor responsible for the high rate of asexual reproduction (e.g., fragmentation) in pocilloporid corals of this region.

  11. Effect of short-term subaerial exposure on the cauliflower coral, Pocillopora damicornis, during a simulated extreme low-tide event

    KAUST Repository

    Castrillón-Cifuentes, Ana Lucia

    2017-02-06

    There is increased interest in understanding how stress reduces coral resistance to disturbances and how acclimatization increases the ability of corals to resist future stress. Most extreme low tides at Gorgona Island, which expose reef flats to air, do not appear to negatively affect corals because corals usually do not undergo lethal bleaching during such events. However, coral physiology and fitness may be impacted by this phenomenon. The aim of this study was to evaluate whether corals exposed to air have modified biological functions to resist bleaching. To test this, an extreme low-tide event was simulated in the field. Colonies of Pocillopora damicornis were exposed to air for 15 or 40 min over the course of one, two, or three consecutive days. This procedure was repeated for one to three months. Colonies of P. damicornis exposed to air had reduced fecundity, decreased zooxanthellae density, and changed color from darker to lighter. However, the growth rate of exposed corals was similar to that of non-exposed colonies. We conclude that short periods of subaerial exposure during extreme low tides are not lethal to P. damicornis, but negatively affect sexual reproduction, which might have deleterious effects at the population level. The periodic occurrence of extreme low tides in the tropical eastern Pacific may be one factor responsible for the high rate of asexual reproduction (e.g., fragmentation) in pocilloporid corals of this region.

  12. Blind to morphology: Genetics identifies several widespread ecologically common species and few endemics among Indo-Pacific cauliflower corals (Pocillopora, Scleractinia)

    KAUST Repository

    Pinzón, Jorge H C

    2013-04-05

    Aim: Using high-resolution genetic markers on samples gathered from across their wide distributional range, we endeavoured to delimit species diversity in reef-building Pocillopora corals. They are common, ecologically important, and widespread throughout the Indo-Pacific, but their phenotypic plasticity in response to environmental conditions and their nearly featureless microskeletal structures confound taxonomic assignments and limit an understanding of their ecology and evolution. Location: Indo-Pacific, Red Sea, Arabian/Persian Gulf. Methods: Sequence analysis of nuclear ribosomal (internal transcribed spacer 2, ITS2) and mitochondrial (open reading frame) loci were combined with population genetic data (seven microsatellite loci) for Pocillopora samples collected throughout the Indo-Pacific, Red Sea and Arabian Gulf, in order to assess the evolutionary divergence, reproductive isolation, frequency of hybridization and geographical distributions of the genus. Results: Between five and eight genetically distinct lineages comparable to species were identified with minimal or no hybridization between them. Colony morphology was generally incongruent with genetics across the full range of sampling, and the total number of species is apparently consistent with lower estimates from competing morphologically based hypotheses (about seven or eight taxa). The most commonly occurring genetic lineages were widely distributed and exhibited high dispersal and gene flow, factors that have probably minimized allopatric speciation. Uniquely among scleractinian genera, this genus contains a monophyletic group of broadcast spawners that evolved recently from an ancestral brooder. Main conclusions: The delineation of species diversity guided by genetics fundamentally advances our understanding of Pocillopora geographical distributions, ecology and evolution. Because traditional diagnostic features of colony and branch morphology are proving to be of limited utility, the identification of Pocillopora species for future ecological and experimental work should rely on genetic characters that will improve research and aid in conservation strategies for these and other reef-building corals, including the detection of real and mistaken endemic populations. © 2013 Blackwell Publishing Ltd.

  13. Reproductive fitness of outcrossed hybrids between transgenic broccoli (brassica oleracea) carrying the ipt transgene and conventional varieties of kale, broccoli and cauliflower

    International Nuclear Information System (INIS)

    Ting, P.; Tu, Y.; Lin, C.; Chang, H.; Chen, L.; Litfu, A

    2014-01-01

    Pollens are potential carriers for genetically modified crops to transfer genetic materials horizontally to other plants. For phanerogams, pollen viability and cross-compatibility are critical factors for successful outcross hybridization. To evaluate this possibility, this project investigated pollen viability and pod setting rate by comparing broccoli (Brassica oleracea L. var. italica Planck) and broccoli transformed with the isopentenyl transferase (ipt) gene. Both served as pollen donors and four other varieties as pollen receptors to determine outcross rates. For pollen viability, F1 progeny was higher (p?0.05) for the cross of transgenic ipt broccoli with Li Syue significantly by FDA (fluorescein diacetate) assay. Higher successful hybrids were observed for transgenic ipt broccoli with Fu Yue, Li Syue and Green King. As pollen properties, number and grain diameter were significantly larger (p?0.05) in hybrid combinations of transgenic ipt broccoli with Li Syue and Green King significantly (p?0.05). The pod setting rates were higher while transgenic ipt broccoli served as donor plant. These results analyzing pollen properties between transgenic crops with possible outcross candidates would serve as one of those critical strategies for evaluating environmental biosafety issues for transgenic crops. (author)

  14. Effect of short-term subaerial exposure on the cauliflower coral, Pocillopora damicornis, during a simulated extreme low-tide event

    Science.gov (United States)

    Castrillón-Cifuentes, Ana Lucia; Lozano-Cortés, Diego F.; Zapata, Fernando A.

    2017-06-01

    There is increased interest in understanding how stress reduces coral resistance to disturbances and how acclimatization increases the ability of corals to resist future stress. Most extreme low tides at Gorgona Island, which expose reef flats to air, do not appear to negatively affect corals because corals usually do not undergo lethal bleaching during such events. However, coral physiology and fitness may be impacted by this phenomenon. The aim of this study was to evaluate whether corals exposed to air have modified biological functions to resist bleaching. To test this, an extreme low-tide event was simulated in the field. Colonies of Pocillopora damicornis were exposed to air for 15 or 40 min over the course of one, two, or three consecutive days. This procedure was repeated for one to three months. Colonies of P. damicornis exposed to air had reduced fecundity, decreased zooxanthellae density, and changed color from darker to lighter. However, the growth rate of exposed corals was similar to that of non-exposed colonies. We conclude that short periods of subaerial exposure during extreme low tides are not lethal to P. damicornis, but negatively affect sexual reproduction, which might have deleterious effects at the population level. The periodic occurrence of extreme low tides in the tropical eastern Pacific may be one factor responsible for the high rate of asexual reproduction (e.g., fragmentation) in pocilloporid corals of this region.

  15. Determination of Elemental Composition of Malabar spinach, Lettuce, Spinach, Hyacinth Bean, and Cauliflower Vegetables Using Proton Induced X-Ray Emission Technique at Savar Subdistrict in Bangladesh

    Directory of Open Access Journals (Sweden)

    S. M. Fahad

    2015-01-01

    Full Text Available The concentrations of 18 different elements (K, Ca, Fe, Cl, P, Zn, S, Mn, Ti, Cr, Rb, Co, Br, Sr, Ru, Si, Ni, and Cu were analyzed in five selected vegetables through Proton Induced X-ray Emission (PIXE technique. The objective of this study was to provide updated information on concentrations of elements in vegetables available in the local markets at Savar subdistrict in Bangladesh. These elements were found in varying concentrations in the studied vegetables. The results also indicated that P, Cl, K, Ca, Mn, Fe, and Zn were found in all vegetables. Overall, K and Ca exhibited the highest concentrations. Cu and Ni exhibited the lowest concentrations in vegetables. The necessity of these elements was also evaluated, based on the established limits of regulatory standards. The findings of this study suggest that the consumption of these vegetables is not completely free of health risks.

  16. Blind to morphology: Genetics identifies several widespread ecologically common species and few endemics among Indo-Pacific cauliflower corals (Pocillopora, Scleractinia)

    KAUST Repository

    Pinzó n, Jorge H C; Sampayo, Eugenia M.; Cox, Evelyn F.; Chauka, Leonard J.; Chen, Chaolun Allen; Voolstra, Christian R.; LaJeunesse, Todd C.

    2013-01-01

    Aim: Using high-resolution genetic markers on samples gathered from across their wide distributional range, we endeavoured to delimit species diversity in reef-building Pocillopora corals. They are common, ecologically important, and widespread throughout the Indo-Pacific, but their phenotypic plasticity in response to environmental conditions and their nearly featureless microskeletal structures confound taxonomic assignments and limit an understanding of their ecology and evolution. Location: Indo-Pacific, Red Sea, Arabian/Persian Gulf. Methods: Sequence analysis of nuclear ribosomal (internal transcribed spacer 2, ITS2) and mitochondrial (open reading frame) loci were combined with population genetic data (seven microsatellite loci) for Pocillopora samples collected throughout the Indo-Pacific, Red Sea and Arabian Gulf, in order to assess the evolutionary divergence, reproductive isolation, frequency of hybridization and geographical distributions of the genus. Results: Between five and eight genetically distinct lineages comparable to species were identified with minimal or no hybridization between them. Colony morphology was generally incongruent with genetics across the full range of sampling, and the total number of species is apparently consistent with lower estimates from competing morphologically based hypotheses (about seven or eight taxa). The most commonly occurring genetic lineages were widely distributed and exhibited high dispersal and gene flow, factors that have probably minimized allopatric speciation. Uniquely among scleractinian genera, this genus contains a monophyletic group of broadcast spawners that evolved recently from an ancestral brooder. Main conclusions: The delineation of species diversity guided by genetics fundamentally advances our understanding of Pocillopora geographical distributions, ecology and evolution. Because traditional diagnostic features of colony and branch morphology are proving to be of limited utility, the identification of Pocillopora species for future ecological and experimental work should rely on genetic characters that will improve research and aid in conservation strategies for these and other reef-building corals, including the detection of real and mistaken endemic populations. © 2013 Blackwell Publishing Ltd.

  17. 78 FR 49932 - Emamectin; Pesticide Tolerance

    Science.gov (United States)

    2013-08-16

    ... existing uses as follows: Almonds, 2.5%; apples, 20%; broccoli, 20%; cabbage, 25%; cauliflower, 20%; celery..., 10%; broccoli, 5%; cabbage, 10%; cauliflower, 10%; celery, 25%; cotton, 1%; lettuce, 10%; pears, 5...

  18. Ear Injury

    Science.gov (United States)

    ... of different injuries can affect the outer ear. Cauliflower ear (subperichondrial hematoma) A blunt blow to the ... to a deformed ear. This deformity, called a cauliflower ear, is common among wrestlers, boxers, and rugby ...

  19. 76 FR 18906 - Mancozeb; Pesticide Tolerances

    Science.gov (United States)

    2011-04-06

    ..., 32%; cantaloupe, 12.5%; carrot, 2.5%; casaba, 12.5%; cauliflower, 15%; celery, 12%; chickpea, 2.5...%; cauliflower, 5%; celery, 12%; chickpea, 1%; Chinese waxgourd, 5%; chive, 10%; collards, 10%; corn, field, 1...%; cauliflower, 10%; chickpea, 1%; collards, 31%; corn, field, 1%; corn, sweet, 6%; cottonseed, oil, 11...

  20. AutoMap User’s Guide 2010

    Science.gov (United States)

    2010-06-03

    but John likes cauliflower The example sentence above contains nine concepts. Manually reviewing this sentence reveals that milk and cookies are...associated with Dave and cauliflower is associated with John. But using a direction of unidirectional and a window size of 9 results in cauliflower

  1. RETRACTED: Facile, eco-friendly and template free photosynthesis of cauliflower like ZnO nanoparticles using leaf extract of Tamarindus indica (L.) and its biological evolution of antibacterial and antifungal activities.

    Science.gov (United States)

    Elumalai, K; Velmurugan, S; Ravi, S; Kathiravan, V; Ashokkumar, S

    2015-02-05

    In the present investigation, we chose the very simple and eco-friendly chemical method for synthesis of zinc oxide nanoparticles from leaf extract of Tamarindus indica (L.) (T. indica) and developed the new green route for synthesis of nanoparticles. Formed product has been studied by UV-vis absorption spectroscopy, Photoluminescence (PL) spectroscopy, X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), Field emission scanning electron microscopy (FE-SEM) and with corresponding energy dispersive X-ray analysis (EDX). Mainly, the present results depicted that the synthesized nanoproducts are moderately stable, hexagonal phase, roughly spherical with maximum particles in size range within 19-37 nm in diameter. The antibacterial and fungal activities of aqueous extracts of T. indica were ended with corresponding disk diffusion and Minimum Inhibitory Concentration (MIC). The highest mean zones of inhibition were observed in the ZnO NPs (200 μg/mL) against Staphylococcus aureus (13.1±0.28). Finally, it can be concluded that microbial activity of ZnO NPs has more susceptible S. aureus than the other micro organisms. Further, the present investigation suggests that ZnO NPs has the potential applications for various medical and industrial fields. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. RETRACTED: Facile, eco-friendly and template free photosynthesis of cauliflower like ZnO nanoparticles using leaf extract of Tamarindus indica (L.) and its biological evolution of antibacterial and antifungal activities

    Science.gov (United States)

    Elumalai, K.; Velmurugan, S.; Ravi, S.; Kathiravan, V.; Ashokkumar, S.

    2015-02-01

    This article has been retracted at the request of the Editor. The article contains an image (Fig. 5B) which was published later again in "Green synthesis of zinc oxide nanoparticles using Moringa oleifera leaf extract and evaluation of its antimicrobial activity" by K. Elumalai et al. in Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 143 (2015) 158-164, http://dx.doi.org/10.1016/j.saa.2015.02.011 despite being attributed to different nanoparticles. Even though this represents the first publication of this image, the attribution to different sets of nanoparticles makes the dataset suspect. The scientific community takes a very strong view on this scientific misbehavior and apologies are offered to readers of the journal that this was not detected during the submission process.

  3. 40 CFR 180.34 - Tests on the amount of residue remaining.

    Science.gov (United States)

    2010-07-01

    ...) PESTICIDE PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Procedural Regulations..., cauliflower, kohlrabi. (12) Cantaloups, honeydew melons, muskmelons, pumpkins, watermelons, winter squash. (13...

  4. 7 CFR 201.56-3 - Mustard family, Brassicaceae (Cruciferae).

    Science.gov (United States)

    2010-01-01

    ..., Chinese cabbage, cauliflower, collards, garden cress, upland cress, water cress, kale, Chinese kale, Siberian kale, kohlrabi, mustard, pakchoi, radish, rape, rutabaga, and turnip. (a) General description. (1...

  5. NOAA Weather Radio

    Science.gov (United States)

    7SSNNN NUT-Cen 5SSNNN BROCCOLI-E 6SSNNN RICE-NW1/3 1SSNNN NUT-SW 7SSNNN CAULIFLOWER-N 2SSNNN RICE-SE2/3 9SSNNN PEA-NW 1SSNNN CAULIFLOWER-SW 7SSNNN BEET-NE2/3 3SSNNN PEA-Cen 5SSNNN CAULIFLOWER-SCen 8SSNNN BEET -SW1/3 7SSNNN PEA-SE 9SSNNN CAULIFLOWER-SE 9SSNNN (in 5 parts) (in 6 parts) (in 7 parts) COUNTY SAME

  6. Characterization of Heavy Metals in Vegetables Using Inductive ...

    African Journals Online (AJOL)

    Journal of Applied Sciences and Environmental Management ... Cauliflower and Onion showed high amount of Pb. On the other hand, Cucumber and Cauliflower registered maximum content of Zn. The heavy metal concentration in vegetables was within the prescribed safety limits except Fe owing to iron-rich soil of the ...

  7. Study on transformation of cowpea trypsin inhibitor gene into ...

    African Journals Online (AJOL)

    Cowpea Trypsin Inhibitor (CpTI) gene was transferred into cauliflower by agrobacterium-mediated transformation method, and 14 transgenic cauliflower plants were obtained. Cotyledons and hypocotyls were used as explants. The putative transformants were assayed by PCR and Southern blotting analysis. The results ...

  8. Fruits and vegetables (image)

    Science.gov (United States)

    A healthy diet includes adding vegetables and fruit every day. Vegetables like broccoli, green beans, leafy greens, zucchini, cauliflower, cabbage, carrots, and tomatoes are low in calories and high in fiber, vitamins, and minerals. ...

  9. 76 FR 2110 - Notice of Receipt of a Pesticide Petition Filed for Residues of Pesticide Chemicals in or on...

    Science.gov (United States)

    2011-01-12

    ... 0F7767. (EPA-HQ-OPP-2009-0996). Enviro Tech Chemical Services, Inc., 500 Winmoore Way, Modesto, CA 95358... potassium hypochlorite, in or on apple; artichoke; asparagus; brussel sprouts; carrot; cauliflower; celery...

  10. Shaking the Salt Habit

    Science.gov (United States)

    ... lean meat Almond extract: Puddings, fruits Basil: Fish, lamb, lean ground meats, stews, salads, soups, sauces, fish cocktails Bay leaves: Lean ... apples, fruit salads, carrots, cauliflower, squash, potatoes, veal, lamb Mustard ... stews, vegetables, salads, soups Paprika: Lean meats, fish, soups, ...

  11. Original Research

    African Journals Online (AJOL)

    2013-12-17

    Dec 17, 2013 ... fertilizer uses and soil fertility management in vegetable production system using descriptive statistics. ... Article History: Received : 23-09-2013 ..... sweet and water melon, carrots, cauliflower, lettuce, egg plant, cucumber ...

  12. 76 FR 38037 - Mevinphos; Data Call-in Order for Pesticide Tolerances

    Science.gov (United States)

    2011-06-29

    ..., strawberries, grapes, lettuce, melons, watermelon, peas, peppers, summer squash, cucumbers, and tomatoes (40..., spinach, summer squash, strawberries, and tomatoes); and 5. Processing Study (tomatoes) (860.1520). III..., cabbage, cauliflower, celery, grapes, lettuce, peas, peppers, spinach, summer squash, strawberries, and...

  13. Antibiosis in Ascia monuste orseis Godart (Lepidoptera: Pieridae ...

    African Journals Online (AJOL)

    Flávio Gonçalves

    (Sinapis arvensis), wild radish (Raphanus raphanistrum), cabbage (Brassica oleracea var. capitata), cauliflower. (Brassica oleracea var. botrytis) and Chinese ..... seeds: Phytochemical characterization and antioxidant potential. Food Chem. 101: 549-558. Filgueira FAR (2008). Novo manual de olericultura: Agrotecnologia.

  14. Healthy food trends - Brussels sprouts

    Science.gov (United States)

    ... belong to the cabbage family, which also includes kale, broccoli, collard greens, and cauliflower. In fact, Brussels ... Brussels sprouts rank high in antioxidants, just after kale and spinach. Antioxidants are substances that can help ...

  15. Antioxidants: What You Need to Know

    Science.gov (United States)

    ... broccoli, bell peppers, tomatoes, cauliflower, Brussels sprouts, and kale. Vitamin E is in some nuts and seeds. ... in green leafy vegetables such as spinach and kale. You also can find it in soybean, sunflower, ...

  16. Sensory determinants of stated liking for vegetable names and actual liking for canned vegetables

    DEFF Research Database (Denmark)

    Dinnella, Caterina; Morizet, David; Masi, Camilla

    2016-01-01

    tastes (sweet, umami), delicate flavour and bright appealing colour. A second group of highly disliked vegetables consists of cauliflowers and broccoli, characterized by disliked sensations such as bitter taste and objectionable flavour. Internal Preference Maps from actual liking scores indicate...

  17. Accumulation of Proline under Salinity and Heavy metal stress in ...

    African Journals Online (AJOL)

    Michael Horsfall

    Seed germination and growth parameters of seedlings of cauliflower were observed after 5, 10 and 15 ... Keywords: Abiotic stress, salinity, proline and heavy metals. The responses of ..... induced accumulation of free proline in a metal-tolerant.

  18. Transatlantic disjunction in fleshy fungi. II. The .i.Sparassis spathulata./i. – .i.S. brevipes./i. complex

    Czech Academy of Sciences Publication Activity Database

    Petersen, R. H.; Borovička, Jan; Reboredo Segovia, A.; Hughes, K. V.

    2015-01-01

    Roč. 14, č. 6 (2015) ISSN 1617-416X Institutional support: RVO:67985831 Keywords : Cauliflower mushrooms * Epitype * phylogeography * systematics * taxonomy Subject RIV: EF - Botanics Impact factor: 1.572, year: 2015

  19. MRI of cerebral alveolar echinococcosis

    International Nuclear Information System (INIS)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Ahishali, B.; Rozanes, I.

    1999-01-01

    Cerebral alveolar echinococcosis is rare. We report a case with multiple intracranial masses which show cauliflower-like contrast enhancement pattern on MRI. The lesions originated from hepatic involvement with invasion of the inferior vena cava. (orig.)

  20. Hydrothermal synthesis and sol-gel methods for CdS particle production in different morphologies and their use in wastewater applications

    OpenAIRE

    Tuncer, Cansel

    2018-01-01

    In this study, CdSnanoparticles were synthesized in different sizes and morphologies using twodifferent methods. First, the synthesis of both cauliflower-type CdS microspheresand CdS nanoflower-type microstructures by hydrothermal synthesis was carriedout in a steel reactors with teflon chamber. While polyethylene glycol andthioacetamide were used in the synthesis of cauliflower-type CdS microspheres,thiourea was used as a sulfur source in the synthesis of nanoflower CdS microstructures.Spher...

  1. Microstructural evolution of Ni40Zr60 alloy during early stage of mechanical alloying of intermetallic compounds NiZr2 and Ni11Zr9

    International Nuclear Information System (INIS)

    Lee Peeyew; Koch, C.C.

    1994-01-01

    The microstructural change of Ni 40 Zr 60 alloy during mechanical alloying of mixtures of the intermetallic compounds NiZr 2 and Ni 11 Zr 9 has been studied by transmission electron microscopy. A specific ''cauliflower'' phase was formed during early stage of mechanical alloying process. It is suggested that the solid state reaction between intermetallic compounds NiZr 2 and Ni 11 Zr 9 is not the only origin for the formation of the ''cauliflower'' phase. ((orig.))

  2. Effect of pea intercropping on biological efficiencies and economics of some non-legume winter vegetables

    International Nuclear Information System (INIS)

    Qasim, S.A.; Anjum, M.A.; Hussain, S.; Ahmad, S.

    2013-01-01

    Intercropping with legumes makes effective use of land and other resources and results in reduced cost of production. Increased agricultural production through intercropping with minimal cost is need of time to feed increasing population. The reported work evaluates the biological efficiencies and economics of pea, garlic, turnip and cauliflower grown as sole crops and when pea intercropped in garlic, turnip and cauliflower during 2010-12. All the vegetables generally yielded more when grown as single crop compared with when pea was intercropped in these vegetables. In peas in garlic intercropping, pea yield was not significantly affected; however, garlic yield was significantly reduced (65.8%). Pea intercropping in turnip or cauliflower resulted in significantly lower yields of both crops (29.1 and 28.0%, respectively) as compared with their sole cropping. All other characteristics (plant growth and yield components) of all the four crops which indicate biological efficiency generally were greater when grown as single crops and decreased in intercropping combinations. Analysis of intercropping treatments revealed that pea intercropping in turnip resulted in the highest marginal rate of return (8,875%), followed by pea intercropping in cauliflower (6,977%), due to lower input costs incurred per hectare. However, net benefit to the growers was higher (Rs. 327,925) in case of pea intercropping in cauliflower, followed by pea intercropping in garlic (Rs. 213,425). (author)

  3. Comparative Study of Elemental Nutrients in Organic and Conventional Vegetables Using Laser-Induced Breakdown Spectroscopy (LIBS).

    Science.gov (United States)

    Bhatt, Chet R; Alfarraj, Bader; Ghany, Charles T; Yueh, Fang Y; Singh, Jagdish P

    2017-04-01

    In this study, the laser-induced breakdown spectroscopy (LIBS) technique was used to identify and compare the presence of major nutrient elements in organic and conventional vegetables. Different parts of cauliflowers and broccolis were used as working samples. Laser-induced breakdown spectra from these samples were acquired at optimum values of laser energy, gate delay, and gate width. Both univariate and multivariate analyses were performed for the comparison of these organic and conventional vegetable flowers. Principal component analysis (PCA) was taken into account for multivariate analysis while for univariate analysis, the intensity of selected atomic lines of different elements and their intensity ratio with some reference lines of organic cauliflower and broccoli samples were compared with those of conventional ones. In addition, different parts of the cauliflower and broccoli were compared in terms of intensity and intensity ratio of elemental lines.

  4. The impact of spices on vegetable consumption

    DEFF Research Database (Denmark)

    Li, Zhaoping; Krak, Michael; Zerlin, Alona

    2015-01-01

    This pilot study was conducted to evaluate the impact of spices added to broccoli, cauliflower, and spinach on amount and rate of vegetable consumption. Twenty overweight subjects who routinely ate less than three daily servings of vegetables were recruited. On six occasions, subjects were assigned...... in random order to eat broccoli, cauliflower, or spinach with or without added spices. Dishes were placed on a modified Universal Eating Monitor (UEM) that recorded rate of eating (g/sec), duration of eating (min) and total amount consumed (g). Total intake and duration of eating were increased...... significantly for broccoli with spices compared to plain broccoli, but there was no significant difference for cauliflower or spinach. No significant differences were noted in any of the visual analog scale (VAS) responses. This study suggests that adding spices may increase vegetable intake, but more studies...

  5. Growth of and toxin production by nonproteolytic Clostridium botulinum in cooked puréed vegetables at refrigeration temperatures.

    Science.gov (United States)

    Carlin, F; Peck, M W

    1996-01-01

    Seven strains of nonproteolytic Clostridium botulinum (types B, E, and F) were each inoculated into a range of anaerobic cooked puréed vegetables. After incubation at 10 degrees C for 15 to 60 days, all seven strains formed toxin in mushrooms, five did so in broccoli, four did so in cauliflower, three did so in asparagus, and one did so in kale. Growth kinetics of nonproteolytic C. botulinum type B in cooked mushrooms, cauliflower, and potatoes were determined at 16, 10, 8, and 5 degrees C. Growth and toxin production occurred in cooked cauliflower and mushrooms at all temperatures and in potatoes at 16 and 8 degrees C. The C. botulinum neurotoxin was detected within 3 to 5 days at 16 degrees C, 11 to 13 days at 10 degrees C, 10 to 34 days at 8 degrees C, and 17 to 20 days at 5 degrees C. PMID:8702303

  6. Arsenate uncoupling of oxidative phosphorylation in isolated plant mitochondria

    Energy Technology Data Exchange (ETDEWEB)

    Wickes, W A; Wiskich, J T

    1976-01-01

    The uncoupling by arsenate of beetroot and cauliflower bud mitochondria showed the following characteristics: arsenate stimulation of respiration above the rate found with phosphate; inhibition of arsenate-stimulated respiration by phosphate; enhancement of arsenate-stimulated respiration by ADP; only partial prevention of this ADP-enhanced respiration by atractyloside; inhibition by oligomycin of the arsenate-stimulated respiration back to the phosphate rate; and the absence of any stimulatory effect of ADP in the presence of oligomycin. These results are qualitatively analogous to those reported for arsenate uncoupling in rat liver mitochondria. Arsenate stimulated malate oxidation, presumably by stimulating malate entry, in both beetroot and cauliflower bud mitochondria; however, high rates of oxidation, and presumably entry, were only sustained with arsenate in beetroot mitochondria. NADH was oxidized rapidly in cauliflower bud mitochondria in the presence of arsenate, showing that arsenate did not inhibit electron transfer processes.

  7. The adhesion and tribology analysis of polycrystalline diamond coated on Si3N4 substrate

    International Nuclear Information System (INIS)

    Hamzah, E.; Purniawan, A.

    2007-01-01

    Cauliflower and octahedral structure of polycrystalline diamond was deposited on silicon nitride (Si 3 N 4 ) substrate by microwave plasma assisted chemical vapor deposition (MPACVD). In our earlier work, the effects of deposition parameters namely, % Methane (CH 4 ) diluted in hydrogen (H 2 ), microwave power and chamber pressure on surface morphology were studied. In the present work the polycrystalline diamond coating adhesion and tribology behaviour were investigated. Rockwell C hardness tester and pin-on-disk tribometer were used to determine the adhesion and tribology properties on diamond coating, respectively. The morphology of the diamond before and after indentation was observed using field emission scanning electron microscopy (FESEM). Based on the adhesion analysis results, it was found that octahedral morphology has better adhesion than cauliflower structure. It was indicated by few cracks and less peel-off than cauliflower structure of polycrystalline diamond after indentation. Based on tribology analysis, polycrystalline diamond coated on substrate has better tribology properties than uncoated substrate. (author)

  8. Combined effect of heat sterilization and ionizing radiation on folacin in canned food

    International Nuclear Information System (INIS)

    Hozova, B.; Sorman, L.

    1986-01-01

    The results are reported of a study in folacin changes following heat sterilization at reduced intensity combined with irradiation of model food products, such as pickled cauliflower and beef in gravy. The folacin content in cauliflower was found to vary with the intensity of heat sterilization; no significant effect was observed of varying radiation doses. With respect to beef in gravy, the study confirmed the suitability of the combined preservation process in view of the higher folacin retention in the given food type. (author). 3 tabs., 14 refs

  9. Occurrence of Xanthomonas campestris pv. campestris (Pammel, 1895) Dowson 1939, on brassicas in Montenegro

    OpenAIRE

    Radunović Dragana; Balaž Jelica

    2012-01-01

    Brassicas form the most important group of vegetable crops in Montenegro. The cabbage (Brassica oleracea var. capitata) is most commonly grown, although other brassicas, particularly kale, Brussels sprout, cauliflower and broccoli, have been increasingly produced since recently. One of the specialties of vegetable production in Montenegro is growing of collard (Brassica oleracea var. acephala), which is the simplest variety of the Brassica oleracea species ...

  10. Overexpression of homologous phytochrome genes in tomato: exploring the limits in photoperception

    NARCIS (Netherlands)

    Husaineid, S.H.; Kok, R.A.; Schreuder, M.E.L.; Plas, van der L.H.W.; Krol, van der A.R.

    2007-01-01

    Transgenic tomato [Lycopersicon esculentum (=Solanum lycopersicum)] lines overexpressing tomato PHYA, PHYB1, or PHYB2, under control of the constitutive double-35S promoter from cauliflower mosaic virus (CaMV) have been generated to test the level of saturation in individual phytochrome-signalling

  11. Van die Redaksie/Editorial

    African Journals Online (AJOL)

    bread is a basic foodstuff, but biscuits are junk; wine comprises ... White bread is not. 'nutritious', but cauliflower is, although it consists of. 90% water, 5% starch, a minute amount of protein, and only traces of vitamins and minerals (other than potas- sium). ... The alter- native definition is therefore that junk or non-nutritious.

  12. Nitrogen accumulation profiles of selected grain and vegetable crops: A bibliography (1940-1992)

    Energy Technology Data Exchange (ETDEWEB)

    Meischen, S.J.; Byrd, K.R.

    1994-10-01

    A bibliography of nitrogen accumulation profile data for 25 vegetable and grain crops reported between 1940 and 1992 is presented. The selected crops are asparagus, broccoli, brussels sprouts, cabbage, carrots, cauliflower, celery, corn, cotton, cucumber, field bean, field pea, garlic, lettuce, onions, and peppers.

  13. thermal degradation and estimation of dietary intakes of vitamin c

    African Journals Online (AJOL)

    IBRAHIM GARBA

    ABSTRACT. Thermal degradation of vitamin C in eight different vegetables were determined. These comprised Onion,. Tomato, Red Pepper, Spinach, Okra, Green Beans, Cauliflower, and Cabbage. Maximum degradation was observed in Tomato with 83% loss while minimum loss of 37% was in Red Pepper. An estimate ...

  14. Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...

    African Journals Online (AJOL)

    Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...

  15. A review of mechanisms underlying anticarcinogenicity by brassica vegetables

    NARCIS (Netherlands)

    Verhoeven, D.T.H.; Verhagen, H.; Goldbohm, R.A.; Brandt, P.A. van den; Poppel, G. van

    1997-01-01

    The mechanisms by which brassica vegetables might decrease the risk of cancer are reviewed in this paper. Brassicas, including all types of cabbages, broccoli, cauliflower and Brussels sprouts, may be protective against cancer due to their relatively high glucosinolate content. Glucosinolates are

  16. Congenital Cutaneous Panadnexal Papillomatous Hamartomas in a Calf

    DEFF Research Database (Denmark)

    Veiga, I. B.; Welle, M.; Agerholm, J. S.

    2017-01-01

    Several cauliflower-like alopecic masses arose on the head of an otherwise healthy, full-term newborn Jersey × Belgian blue heifer, which was humanely destroyed shortly after birth due to the severity of the skin lesions. Microscopically, the masses were composed of multiple papillary projections...

  17. Radioactive contamination of foods from fallout as a source of error in some animal experiments

    Energy Technology Data Exchange (ETDEWEB)

    Clayton, C G

    1957-01-01

    Radioactivity in control animals since 1956 has increased so as to vitiate experiments. The activity of foods used was measured. The counts are given for rat cubes, milk, peas, sugar, flour, cabbage, carrot, cauliflower, salt, semolina, and water. The high count of the cabbage is probably from /sup 137/Cs present as 4 micromicrocuries/g.

  18. Glucosinolates in Brassica vegetables: The influence of the food supply chain on intake, bioavailability and human health

    NARCIS (Netherlands)

    Verkerk, R.; Schreiner, M.; Krumbein, A.; Ciska, E.; Holst, B.; Rowland, I.; Schrijver, de R.; Hansen, M.; Gerhäuser, C.; Mithen, R.; Dekker, M.

    2009-01-01

    Glucosinolates (GLSs) are found in Brassica vegetables. Examples of these sources include cabbage, Brussels sprouts, broccoli, cauliflower and various root vegetables (e.g. radish and turnip). A number of epidemiological studies have identified an inverse association between consumption of these

  19. Evaluation of glucosinolate levels throughout the production chain of Brassica vegetables towards a novel predictive modelling approach

    NARCIS (Netherlands)

    Verkerk, R.

    2002-01-01

    Glucosinolates are a group of plant secondary metabolites, that can have important implications for human health. Vegetables of the Brassica genus, including cabbage, Brussels sprouts, broccoli, cauliflower and kohlrabi contribute almost exclusively to our intake of

  20. Maize defensin ZmDEF1 is involved in plant response to fungal ...

    African Journals Online (AJOL)

    The recombinant ZmDEF1 displays an inhibitive activity against the fungal pathogen, Phytophthora parasitica var. nicotianae. Ectopic expression of the ZmDEF1 gene under the control of the cauliflower mosaic virus (CaMV) 35S promoter conferred enhanced tolerance against P. parasitica in transgenic tobacco plants.

  1. Epidemiological studies on Brassica vegetables and cancer risk

    NARCIS (Netherlands)

    Verhoeven, D.T.H.; Goldbohm, R.A.; Poppel, G. van; Verhagen, H.; Brandt, P.A. van den

    1996-01-01

    This paper gives an overview of the epidemiological data concerning the cancer-preventive effect of brassica vegetables, including cabbage, kale, broccoli, Brussels sprouts, and cauliflower. The protective effect of brassicas against cancer may be due to their relatively high content of

  2. Natural control in cabbage root fly populations and influence of chemicals

    NARCIS (Netherlands)

    Abu Yaman, I.K.

    1960-01-01

    To facilitate studies on the natural and chemical control of Hylemya (Erioischia) brassicae (Bch.) in Holland, the bionomics and abundance of the Anthomyiid were investigated in 1959-9 in fields in which cauliflower was grown. The numbers of eggs and larvae were estimated by scrutiny of

  3. Brassica oleracea: the dog of the plant world

    Science.gov (United States)

    The horticultural crop Brassica oleracea L. plays an important role in global food systems. Brassica oleracea is unique in that it has been domesticated into several morphotypes (cultivars), including broccoli, Brussels sprout, cabbage, cauliflower, kale, kohlrabi, and several lesser well known morp...

  4. Brassica oleracea; The dog of the plant world

    Science.gov (United States)

    The horticultural crop Brassica oleracea L. plays an important role in global food systems. Brassica oleracea is unique in that it has been domesticated into several morphotypes (cultivars), including broccoli, Brussels sprout, cabbage, cauliflower, kale, kohlrabi, and several lesser well known morp...

  5. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  6. Effects of NaCl stress on seed germination, early seedling growth ...

    African Journals Online (AJOL)

    Effects of salt stress on seed germination, early seedling growth and some physiological characteristics were evaluated for four cauliflower species in seven treatments of salinity including 0 (control), 34, 68, 102, 136, 170 and 204 mM NaCl in a three replicated randomized completely block design (RCBD). This result shows ...

  7. Testing for Genetically Modified Foods Using PCR

    Science.gov (United States)

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  8. Transformation of Cowpea Vigna unguiculata with a Full-Length DNA Copy of Cowpea Mosaic Virus M-RNA

    NARCIS (Netherlands)

    Hille, Jacques; Goldbach, Rob

    1987-01-01

    A full-length DNA copy of the M-RNA of cowpea mosaic virus (CPMV), supplied with either the 35S promoter from cauliflower mosaic virus (CaMV) or the nopaline synthase promoter from Agrobacterium tumefaciens, was introduced into the T-DNA region of a Ti-plasmid-derived gene vector and transferred to

  9. Detection of herbaceous-plant pararetrovirus in lichen herbarium samples

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Koloniuk, Igor; Sarkisova, Tatiana; Číhal, L.

    2016-01-01

    Roč. 60, č. 2 (2016), s. 196-200 ISSN 0001-723X R&D Projects: GA ČR GAP501/12/1747 Institutional support: RVO:60077344 Keywords : Cauliflower mosaic virus * dsDNA * pararetrovirus Subject RIV: EE - Microbiology, Virology Impact factor: 0.673, year: 2016

  10. High-Performance Liquid Chromatography–Mass Spectrometry Analysis of Plant Metabolites in Brassicaceae

    NARCIS (Netherlands)

    Vos, de C.H.; Schipper, A.; Hall, R.D.

    2012-01-01

    The Brassicaceae family comprises a variety of plant species that are of high economic importance as -vegetables or industrial crops. This includes crops such as Brassica rapa (turnip, Bok Choi), B. oleracea (cabbages, broccoli, cauliflower, etc.), and B. napus (oil seed rape), and also includes the

  11. Stem diameter and height of chrysanthemum cv Yoko ono as ...

    African Journals Online (AJOL)

    Administrator

    2011-09-26

    Sep 26, 2011 ... Booij R (1989). Effect of growth regulators on curd diameter of cauliflower. Sci. Hortic. 38: 23-32. Castro PRC (1998). Use of plant growth regulators in fruit production of vegetable crops and ornamental plants. Série produtor Rural, Ed. especial, Piracicaba: ESALQ- Divisão de Biblioteca e Documentação.

  12. Genetic characterization of glossy-leafed mutant broccoli lines

    Science.gov (United States)

    Glossy mutants of Brassica oleracea L. have reduced or altered epicuticular wax on the surface of their leaves as compared to wild-type plants, conveying a shiny green appearance. Mutations conferring glossiness are common and have been found in most B. oleracea crop varieties, including cauliflower...

  13. A 1-kb bacteriophage lambda fragment functions as an insulator to effectively block enhancer-promoter interactions in Arabidopsis thaliana

    Science.gov (United States)

    The 35S cauliflower mosaic virus (CaMV) promoter contains an enhancer element that is able to override the tissue-, organ- and developmental-stage specificity of nearby promoters. Consequently, the precise control of transgene expression in transgenic plants, which often contain the 35S CaMV promot...

  14. Transatlantic disjunction in fleshy fungi. II. The Sparassis spathulata - S. brevipes complex

    Czech Academy of Sciences Publication Activity Database

    Petersen, R. H.; Borovička, Jan; Segovia, A. R.; Hughes, K. W.

    2015-01-01

    Roč. 14, č. 6 (2015), s. 30 ISSN 1617-416X R&D Projects: GA MŠk(CZ) LM2011019 Institutional support: RVO:61389005 Keywords : Cauliflower mushrooms * epitype * systematics * taxanomy * phytogeography Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.572, year: 2015

  15. Operation Dominic, Shot Sword Fish. Project Officers Report-Project 1.2 Surface Phenomena

    Science.gov (United States)

    1985-04-01

    liuited time scale. Unfortunately, it is Intossible to recognize individually the nyr people involved. Such recognitio must be llmited to those who made...Justified in order to avoid such an occurrence. 131 APPENDIX A GLMSSARY OF S FACE -PN TNAER Ae.oeol Crovi, The cauliflower cloud from a very shallow high

  16. Characteristic findings of metrizamide CT cisternography in epidermoids

    International Nuclear Information System (INIS)

    Inoue, H.; Toya, Sh.; Ohtani, M.; Kawase, T.; Takenaka, N.; Okui, Sh.; Miyahara, Y.; Shiga, H.

    1984-01-01

    The characteristic findings of metrizamide CT cisternography in two cases of epidermoid are reported. The main finding was a 'cauliflower-like' appearance and was thought to be caused by the irregular interstices of epidermoids. Metrizamide CT cisternography may be helpful in making a diagnosis of an epidermoid. (Author)

  17. Evaluation of effectiveness of bacterial product which can degrade pesticide-dimethoate on the scale of true practice test

    International Nuclear Information System (INIS)

    Pham Thi Le Ha; Tran Thi Thuy; Le Hai; Nguyen Duy Hang; Vo Thi Thu Ha; Nguyen Tuong Ly Lan; Le Tat Mua; Tran Kim Duyen; Mai Hoang Lam

    2004-01-01

    Dimethoate, an organophosphate pesticide has been widely used in Dalat, Lamdong. It is much toxic to birds, human being and other mammals. Its widespread use has caused environmental concern on the basic of frequent detection of dimethoate in soil and water. Microorganisms are key agents in the degradation of waste, oil and a vast array of organic pesticide in terrestrial and aquatic ecosystems. In previous study, bacteria products which can degrade. Dimethoate were produced. The present study was designed to evaluate the effectiveness of bacterial product which can degrade Pesticide-Dimethoate on the scale of true practice test. The results indicated that application bacteria product to soil grown with Cauliflower and Chinese Cabbage sprayed with organic phosphorus pesticides (Dimethoate and Chloropyrifos), the pesticide residues in soil, water and vegetables were as follow: The residues of Dimethoate and Chloropyrifos in soil grown with Cauliflower, Chinese cabbages are different. They concentrated mostly in the surface litter and top soil layers with the depth from 0 to 20 cm. From the depth of 20 cm to 100 cm, the pesticide residues were ignorable. Residue of Chloropyrifos in soil was small as well. Dimethoate residues in soil grown with Cauliflower were higher than that of Chinese cabbages. On the basis of the environmental criteria of Ministry for Science, Technology and Environment (6/95), Dimethoate residues in soil grown with cauliflowers were in excess of the maximum limit. In the case of using bacteria product to soil, pesticide residues in soil were decreased. The results also indicated that Chloropyrifos residues in water (water obtained at the depth of 75 cm and 100 cm by days) were small. Residue of Dimethoate in water small. Residue of Dimethoate in water obtained from the Cauliflower bed were higher than of Chinese cabbages one. Using bacteria product to soil, pesticide residues in water decreased. On the basis of the environmental criteria of

  18. Identification and expression analysis of glucosinolate biosynthetic genes and estimation of glucosinolate contents in edible organs of Brassica oleracea subspecies.

    Science.gov (United States)

    Yi, Go-Eun; Robin, Arif Hasan Khan; Yang, Kiwoung; Park, Jong-In; Kang, Jong-Goo; Yang, Tae-Jin; Nou, Ill-Sup

    2015-07-20

    Glucosinolates are anti-carcinogenic, anti-oxidative biochemical compounds that defend plants from insect and microbial attack. Glucosinolates are abundant in all cruciferous crops, including all vegetable and oilseed Brassica species. Here, we studied the expression of glucosinolate biosynthesis genes and determined glucosinolate contents in the edible organs of a total of 12 genotypes of Brassica oleracea: three genotypes each from cabbage, kale, kohlrabi and cauliflower subspecies. Among the 81 genes analyzed by RT-PCR, 19 are transcription factor-related, two different sets of 25 genes are involved in aliphatic and indolic biosynthesis pathways and the rest are breakdown-related. The expression of glucosinolate-related genes in the stems of kohlrabi was remarkably different compared to leaves of cabbage and kale and florets of cauliflower as only eight genes out of 81 were expressed in the stem tissues of kohlrabi. In the stem tissue of kohlrabi, only one aliphatic transcription factor-related gene, Bol036286 (MYB28) and one indolic transcription factor-related gene, Bol030761 (MYB51), were expressed. The results indicated the expression of all genes is not essential for glucosinolate biosynthesis. Using HPLC analysis, a total of 16 different types of glucosinolates were identified in four subspecies, nine of them were aliphatic, four of them were indolic and one was aromatic. Cauliflower florets measured the highest number of 14 glucosinolates. Among the aliphatic glucosinolates, only gluconapin was found in the florets of cauliflower. Glucoiberverin and glucobrassicanapin contents were the highest in the stems of kohlrabi. The indolic methoxyglucobrassicin and aromatic gluconasturtiin accounted for the highest content in the florets of cauliflower. A further detailed investigation and analyses is required to discern the precise roles of each of the genes for aliphatic and indolic glucosinolate biosynthesis in the edible organs.

  19. Identification and Expression Analysis of Glucosinolate Biosynthetic Genes and Estimation of Glucosinolate Contents in Edible Organs of Brassica oleracea Subspecies

    Directory of Open Access Journals (Sweden)

    Go-Eun Yi

    2015-07-01

    Full Text Available Glucosinolates are anti-carcinogenic, anti-oxidative biochemical compounds that defend plants from insect and microbial attack. Glucosinolates are abundant in all cruciferous crops, including all vegetable and oilseed Brassica species. Here, we studied the expression of glucosinolate biosynthesis genes and determined glucosinolate contents in the edible organs of a total of 12 genotypes of Brassica oleracea: three genotypes each from cabbage, kale, kohlrabi and cauliflower subspecies. Among the 81 genes analyzed by RT-PCR, 19 are transcription factor-related, two different sets of 25 genes are involved in aliphatic and indolic biosynthesis pathways and the rest are breakdown-related. The expression of glucosinolate-related genes in the stems of kohlrabi was remarkably different compared to leaves of cabbage and kale and florets of cauliflower as only eight genes out of 81 were expressed in the stem tissues of kohlrabi. In the stem tissue of kohlrabi, only one aliphatic transcription factor-related gene, Bol036286 (MYB28 and one indolic transcription factor-related gene, Bol030761 (MYB51, were expressed. The results indicated the expression of all genes is not essential for glucosinolate biosynthesis. Using HPLC analysis, a total of 16 different types of glucosinolates were identified in four subspecies, nine of them were aliphatic, four of them were indolic and one was aromatic. Cauliflower florets measured the highest number of 14 glucosinolates. Among the aliphatic glucosinolates, only gluconapin was found in the florets of cauliflower. Glucoiberverin and glucobrassicanapin contents were the highest in the stems of kohlrabi. The indolic methoxyglucobrassicin and aromatic gluconasturtiin accounted for the highest content in the florets of cauliflower. A further detailed investigation and analyses is required to discern the precise roles of each of the genes for aliphatic and indolic glucosinolate biosynthesis in the edible organs.

  20. Key Role of Alphaproteobacteria and Cyanobacteria in the Formation of Stromatolites of Lake Dziani Dzaha (Mayotte, Western Indian Ocean

    Directory of Open Access Journals (Sweden)

    Emmanuelle Gérard

    2018-05-01

    Full Text Available Lake Dziani Dzaha is a thalassohaline tropical crater lake located on the “Petite Terre” Island of Mayotte (Comoros archipelago, Western Indian Ocean. Stromatolites are actively growing in the shallow waters of the lake shores. These stromatolites are mainly composed of aragonite with lesser proportions of hydromagnesite, calcite, dolomite, and phyllosilicates. They are morphologically and texturally diverse ranging from tabular covered by a cauliflower-like crust to columnar ones with a smooth surface. High-throughput sequencing of bacterial and archaeal 16S rRNA genes combined with confocal laser scanning microscopy (CLSM analysis revealed that the microbial composition of the mats associated with the stromatolites was clearly distinct from that of the Arthrospira-dominated lake water. Unicellular-colonial Cyanobacteria belonging to the Xenococcus genus of the Pleurocapsales order were detected in the cauliflower crust mats, whereas filamentous Cyanobacteria belonging to the Leptolyngbya genus were found in the smooth surface mats. Observations using CLSM, scanning electron microscopy (SEM and Raman spectroscopy indicated that the cauliflower texture consists of laminations of aragonite, magnesium-silicate phase and hydromagnesite. The associated microbial mat, as confirmed by laser microdissection and whole-genome amplification (WGA, is composed of Pleurocapsales coated by abundant filamentous and coccoid Alphaproteobacteria. These phototrophic Alphaproteobacteria promote the precipitation of aragonite in which they become incrusted. In contrast, the Pleurocapsales are not calcifying but instead accumulate silicon and magnesium in their sheaths, which may be responsible for the formation of the Mg-silicate phase found in the cauliflower crust. We therefore propose that Pleurocapsales and Alphaproteobacteria are involved in the formation of two distinct mineral phases present in the cauliflower texture: Mg-silicate and aragonite

  1. Effects of home-based food preparation practices on the micronutrient content of foods.

    Science.gov (United States)

    Severi, S; Bedogni, G; Zoboli, G P; Manzieri, A M; Poli, M; Gatti, G; Battistini, N

    1998-08-01

    We studied the effects of cooking on the vitamin and mineral content of vegetables (vegetable soup, cauliflower), meat (beefsteak) and fish (sole) and those of cutting (fruit salad) and squeezing (orange juice) on the vitamin content of fruits. In cooked dishes, vitamin retention ranged between 0 (folic acid, all dishes) and 94% (retinol, sole) and mineral retention between 63 (copper, cauliflower) and 96% (iron, vegetable soup). In orange juice, ascorbic acid appeared to be protected from oxidation for at least 12 h as compared with fruit salad. Our study shows that preparation of foods with techniques available at home may be responsible for losses of vitamins and minerals. Further studies are needed to ascertain the effects of these losses on nutritional status.

  2. [Examination of processed vegetable foods for the presence of common DNA sequences of genetically modified tomatoes].

    Science.gov (United States)

    Kitagawa, Mamiko; Nakamura, Kosuke; Kondo, Kazunari; Ubukata, Shoji; Akiyama, Hiroshi

    2014-01-01

    The contamination of processed vegetable foods with genetically modified tomatoes was investigated by the use of qualitative PCR methods to detect the cauliflower mosaic virus 35S promoter (P35S) and the kanamycin resistance gene (NPTII). DNA fragments of P35S and NPTII were detected in vegetable juice samples, possibly due to contamination with the genomes of cauliflower mosaic virus infecting juice ingredients of Brassica species and soil bacteria, respectively. Therefore, to detect the transformation construct sequences of GM tomatoes, primer pairs were designed for qualitative PCR to specifically detect the border region between P35S and NPTII, and the border region between nopaline synthase gene promoter and NPTII. No amplification of the targeted sequences was observed using genomic DNA purified from the juice ingredients. The developed qualitative PCR method is considered to be a reliable tool to check contamination of products with GM tomatoes.

  3. Combined effect of thermal sterilization and ionizing radiation on storage life of preserved foods

    International Nuclear Information System (INIS)

    Hozova, B.; Sorman, L.; Fazekasova, H.

    1986-01-01

    The effect was studied of the binary combination of preservation methods, i.e., of a reduced intensity of thermosterilization and diverse doses of ionizing radiation, on the content of microorganisms in single-component tinned products (tinned beef and gravy, tinned pickled cauliflower) and in tins containing two components (beef with cauliflower) over a period of 115 days of storage at a laboratory temperature of 20 degC ± 2 degC. The experimental results showed that the chosen combined process of preservation guaranteed sufficient storage stability to the products over several months of storage. An ionizing radiation dose of 5 kGy was sufficient for both types of model samples, this both from microbiological, nutritional aspects (some group B vitamins, vitamin C, -SH groups, etc.) and with regard to organoleptic properties (outlook, color, odor, flavor, consistence, juiciness). The problems will further be studied. (author) 2 tabs., 4 figs., 14 refs

  4. CT Findings of a Gastric Inflammatory Fibroid Polyp Manifesting as Unexpected Growth: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyun Cheol; Yang, Dal Mo; Jin, Wook; Nam, Deok Ho; Kim, Gou Young; Choi, Sung Il [East-west Neo Medical Center, Seoul (Korea, Republic of)

    2009-04-15

    Gastric inflammatory fibroid polyps (IFP) are rare benign entities that are usually encountered in the gastric antrum. The authors report the CT findings of a gastric IFP case experiencing marked growth over a five-month period. An initial CT revealed a polypoid wall thickening of about 3.5x2.5 cm in the gastric antrum. A follow-up CT performed five months later revealed a cauliflower-like submucosal mass of about 8x5 cm. The mass was surgically excised and confirmed as an IFP. The authors suggest that when an evolving cauliflower-like submucosal lesion of the stomach is detected, an IFP should be considered in the differential diagnoses.

  5. INFLUENCE OF DIFFERENT AGRICULTURAL CROPS UPON THE ANTIOXIDANT CAPACITY OF CRUCIFEROUS VEGETABLES. INFLUÊNCIA DE DIFERENTES TÉCNICAS DE CULTIVO SOBRE O POTENCIAL ANTIOXIDANTE DE CRUCÍFERAS

    OpenAIRE

    K. A. ARBOS; L. B. VILLAS-BOAS; C. A. M. SANTOS; A. M. WEFFORT-SANTOS

    2008-01-01

    The Cruciferae family has many important species for the regular human diet as they provide many antioxidant components. Being routinely present as part of the Brazilian folk meals, it is worthy to evaluate their antioxidant potential. In the present work, the antioxidant capability of extracts prepared from white cabbage, kale, cauliflower, broccoli, watercress, and radish, obtained from conventional, hydroponic, and organic agricultural procedures whereas possible, was investigated in vitro...

  6. 78 FR 38226 - Sulfoxaflor; Pesticide Tolerances; Technical Correction

    Science.gov (United States)

    2013-06-26

    ... Fruit, stone, group 12 3.0 Goat, fat 0.10 Goat, meat 0.15 Goat, meat byproducts 0.40 Grain, aspirated fractions 20.0 Grape, raisin 6.0 Hog, fat 0.01 Hog, meat 0.01 Hog, meat byproducts 0.01 Horse, fat 0.10..., fat 0.10 Cattle, meat 0.15 Cattle, meat byproducts 0.40 Cauliflower 0.08 Citrus, dried pulp 3.6 Cotton...

  7. 40 CFR 180.381 - Oxyfluorfen; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ..., group 11 0.05 Fruit, stone, group 12 0.05 Goat, fat 0.01 Goat, meat 0.01 Goat, meat byproducts 0.01 Grape 0.05 Hog, fat 0.01 Hog, meat 0.01 Hog, meat byproducts 0.01 Horse, fat 0.01 Horse, meat 0.01 Horse..., meat 0.01 Cattle, meat byproducts 0.01 Cauliflower 0.05 Coffee, bean, green 0.05 Corn, field, grain 0...

  8. Primary oral and nasal transmissible venereal tumor in a mix-breed dog

    OpenAIRE

    Rezaei, Mahdieh; Azizi, Shahrzad; Shahheidaripour, Shima; Rostami, Sara

    2016-01-01

    Transmissible venereal tumor (TVT) is a coitally transmitted tumor of dogs with widespread distribution. The present study describes the occurrence of the primary oral and nasal TVT in a 10-year-old, female, mix-breed dog. The case was presented with a history of anorexia, inability to swallow and dyspnea. Clinical examinations revealed the emaciation, muzzle deformity due to the presence of a friable, fleshy, cauliflower-like mass in the oral cavity and submandibular lymphadenopathy. TVT was...

  9. Molecular trees: from syntheses towards applications

    International Nuclear Information System (INIS)

    Ardoin, N.; Astruc, D.

    1995-01-01

    Molecular trees, also called dendrimers, arborols, cauliflowers, cascades or hyperbranched molecules, have been synthesized since their first observation in 1978 by divergent, convergent or combined methods, with various functions on the branches. The potential applications of these nanoscopic molecules are in the fields of biology (gene therapy, virus mimicking an vectorization) and molecular materials sciences (new polymers, adhesion, liquid crystals, etc). (authors). 236 refs., 6 figs., 2 tabs., 8 schemes

  10. Nicotine in dried boletus mushrooms - Causes for contamination must be determined

    OpenAIRE

    German Federal Institute for Risk Assessment

    2009-01-01

    Recently, nicotine has been detected in samples of dried boletus mushrooms. In large doses, nicotine is a strong neurotoxin and natural component of the tobacco plant. Yet food supply plants such as potatoes, tomatoes, aubergines and cauliflower also contain very small amounts of the substance. The cause of nicotine contamination in dried boletus mushrooms has thus far not been determined since nicotine has not been established as a naturally occurring component in mushrooms. Whether the nico...

  11. A Computer System for Menu Evaluation and Related Applications

    Science.gov (United States)

    1974-11-01

    C00500 606000 ROAST BEEF BAKED HAM CREAM «RAVY PAPRIKA BUTTERED POTATOES LYONNAISE CARROTS CAULIFLOWER AU «RATIN SIMMERED BLACKEYE PEAS BUTTERED...002930 H00230 602000 60*000 C00500 608000 608500 PEA SOUP CRACKERS PORK CHOP SUEY TURKEY POT PIE OSBRIEN POTATOES STEAMED RICE BUTTERED... potatoes ) and finally by recipe portion cost (for 100 portions) from high to low. The recipe portion costs in each major category (1-9

  12. Simulating Nutritional Awareness and Action in Military Populations

    Science.gov (United States)

    1981-04-01

    pated as well as experts from academia, (Over) FORM 1 JAM 73 EDITION OF J MOV E5 IS OBSOLETE , UNCLASSIFIED SECURITY CLASS!FICATIOW OF THIS PAGE...watching your mother skim jam or watching your father use a wood plane. This is not "knowledge" as we define it. It was our kind of knowledge Margaret...cauliflower, peaches, pears, strawberries , Brussels sprouts, spinach, carrots, rutabaga, cabbage Honey from bees obtaining sugars from mountain

  13. Proteomic analysis of chromoplasts from six crop species reveals insights into chromoplast function and development

    OpenAIRE

    Wang, Yong-Qiang; Yang, Yong; Fei, Zhangjun; Yuan, Hui; Fish, Tara; Thannhauser, Theodore W.; Mazourek, Michael; Kochian, Leon V.; Wang, Xiaowu; Li, Li

    2013-01-01

    Chromoplasts are unique plastids that accumulate massive amounts of carotenoids. To gain a general and comparative characterization of chromoplast proteins, this study performed proteomic analysis of chromoplasts from six carotenoid-rich crops: watermelon, tomato, carrot, orange cauliflower, red papaya, and red bell pepper. Stromal and membrane proteins of chromoplasts were separated by 1D gel electrophoresis and analysed using nLC-MS/MS. A total of 953?2262 proteins from chromoplasts of diff...

  14. Host Range Specificity in Verticillium dahliae.

    Science.gov (United States)

    Bhat, R G; Subbarao, K V

    1999-12-01

    ABSTRACT Verticillium dahliae isolates from artichoke, bell pepper, cabbage, cauliflower, chili pepper, cotton, eggplant, lettuce, mint, potato, strawberry, tomato, and watermelon and V. albo-atrum from alfalfa were evaluated for their pathogenicity on all 14 hosts. One-month-old seedlings were inoculated with a spore suspension of about 10(7) conidia per ml using a root-dip technique and incubated in the greenhouse. Disease incidence and severity, plant height, and root and shoot dry weights were recorded 6 weeks after inoculation. Bell pepper, cabbage, cauliflower, cotton, eggplant, and mint isolates exhibited host specificity and differential pathogenicity on other hosts, whereas isolates from artichoke, lettuce, potato, strawberry, tomato, and watermelon did not. Bell pepper was resistant to all Verticillium isolates except isolates from bell pepper and eggplant. Thus, host specificity exists in some isolates of V. dahliae. The same isolates were characterized for vegetative compatibility groups (VCGs) through complementation of nitrate nonutilizing (nit) mutants. Cabbage and cauliflower isolates did not produce nit mutants. The isolate from cotton belonged to VCG 1; isolates from bell pepper, eggplant, potato, and tomato, to VCG 4; and the remaining isolates, to VCG 2. These isolates were also analyzed using the random amplified polymorphic DNA (RAPD) method. Forty random primers were screened, and eighteen of them amplified DNA from Verticillium. Based on RAPD banding patterns, cabbage and cauliflower isolates formed a unique group, distinct from other V. dahliae and V. albo-atrum groups. Minor genetic variations were observed among V. dahliae isolates from other hosts, regardless of whether they were host specific or not. There was no correlation among pathogenicity, VCGs, and RAPD banding patterns. Even though the isolates belonged to different VCGs, they shared similar RAPD profiles. These results suggest that management of Verticillium wilt in some crops

  15. Bountiful crop with every drop: Using drip irrigation to increase yields and conserve water

    International Nuclear Information System (INIS)

    Quevenco, Rodolfo

    2015-01-01

    Cauliflower, broccoli, sweet pepper and many other nutritious vegetables used to be expensive in Mauritius. The island’s climate and traditional agricultural practices were not suitable for cultivating several high value vegetable crops, while importing them to the island state was prohibitively costly due to the long distances involved. This has all changed over the past few years, and local farms are now starting to supply the country’s growing population and burgeoning tourism industry with fresh, locally grown produce.

  16. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    Science.gov (United States)

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

  17. Genetic manipulation of gamma-linolenic acid (GLA) synthesis in a commercial variety of evening primrose (Oenothera sp.).

    Science.gov (United States)

    de Gyves, Emilio Mendoza; Sparks, Caroline A; Sayanova, Olga; Lazzeri, Paul; Napier, Johnathan A; Jones, Huw D

    2004-07-01

    A robust Agrobacterium-mediated transformation procedure was developed for Rigel, a commercial cultivar of evening primrose, and used to deliver a cDNA encoding a Delta(6)-desaturase from borage under the control of a cauliflower mosaic virus (CaMV) 35S promoter. Analysis of the transformed plants demonstrated an altered profile of polyunsaturated fatty acids, with an increase in gamma-linolenic acid and octadecatetraenoic acid in leaf tissues when compared with control lines.

  18. Efeito de Humoativo comercial na produtividade da couve-flor no Estado de Santa Catarina

    Directory of Open Access Journals (Sweden)

    José Alfredo da Fonseca

    2015-12-01

    Full Text Available O Humoativo comercial é um substrato registrado como produto orgânico, proveniente do tratamento anaeróbico dos resíduos de celulose em lagoas de decantação e posterior compostagem aeróbica, com alta concentração em nutrientes. O objetivo deste experimento foi avaliar, a campo, o efeito da aplicação de doses de Humoativo sobre a produtividade e a absorção de metais pesados por plantas de couve-flor. Foi utilizado delineamento em blocos inteiramente casualizados, com três repetições e sete tratamentos que corresponderam às doses de Humoativo de 17, 34, 51, 68, 85 e 102 t.ha-1, em base seca. O uso do produto como fertilizante para a cultura da couve-flor proporcionou aumentos crescentes das produtividades com o aumento das doses aplicadas. Não houve efeito dos tratamentos sobre os teores de macro e micronutrientes analisados nos tecidos foliares da couve-flor.Effects of Humoativo commercial in cauliflower productivity in Santa Catarina StateAbstract:  Humoativo commercial is a substrate organic derived from the anaerobic treatment of waste cellulose into settling ponds, with high concentrations of nutrients. The objective of this experiment was to evaluate, in field, the effect of doses of Humoativo on productivity and on heavy metal uptake by plants of cauliflower. Design was used randomized blocks with three replications and seven treatments that corresponded to doses of Humoativo of 17, 34, 51, 68, 85 and 102 t.ha-1 in dry basis. The use of the product as fertilizer for the cultivation of cauliflower provided increases in the yield of culture with increasing doses applied. There was no effect of treatments on the concentrations of macro and micronutrients analyzed in the leaves of cauliflower.

  19. Comparative efficiency of trickle and furrow irrigation

    International Nuclear Information System (INIS)

    Hanif, M.; Qureshi, R.H.; Sandhu, G.R.

    1976-01-01

    Comparison of furrow and trickle methods of irrigation to know their relative efficiency with respect to water applied and fertilizer used on tomatoes, cauliflower and lettuce as test crops using canal water, showed a significant saving of about 44 and 41 per cent respectively for irrigation water and fertilizer applied with trickle as compared to furrow irrigation. Trickle irrigated crops also showed a better response as regards the rate of survival, crop growth and time of maturity

  20. Heavy metals in vegetables collected from production and market sites of a tropical urban area of India.

    Science.gov (United States)

    Sharma, Rajesh Kumar; Agrawal, Madhoolika; Marshall, Fiona M

    2009-03-01

    Vegetables (Beta vulgaris L., Abelmoschus esculentus L. and Brassica oleracea L.) from the production and market sites of India were tested for Cu, Cd, Zn and Pb. At market sites, the mean concentration of Cu in cauliflower, and of Zn and Cd in both palak and cauliflower had exceeded the PFA standard. Zn at the production sites also exceeded the PFA standard in cauliflower. Cd concentration in vegetables tested from both production and market sites was many folds higher than the EU standard. In contrast, Pb in vegetables tested from both production and market sites was below the PFA limit, but was considerably higher than the current EU and WHO standards. Heavy metals accumulation in vegetables tested are higher at market sites than those at the crop production sites. The contributions of these vegetables to dietary intake of Cu, Zn, Cd and Pb were 13%, 1%, 47% and 9% of provisional tolerable daily intake, respectively. The study concludes that the transportation and marketing systems of vegetables play a significant role in elevating the contaminant levels of heavy metals which may pose a threat to the quality of the vegetables with consequences for the health of the consumers of locally produced foodstuffs.

  1. Free radical interactions between raw materials in dry soup powder.

    Science.gov (United States)

    Raitio, Riikka; Orlien, Vibeke; Skibsted, Leif H

    2011-12-01

    Interactions at the free radical level were observed between dry ingredients in cauliflower soup powder, prepared by dry mixing of ingredients and rapeseed oil, which may be of importance for quality deterioration of such dry food products. The free radical concentrations of cauliflower soup powder, obtained by electron spin resonance (ESR) spectroscopy, rapidly become smaller during storage (40°C and relative humidity of 75%) than the calculated concentrations of free radicals based on the free radical concentrations of the powder ingredients used to make the soup powder and stored separately under similar conditions. Similarly, free radical concentrations decreased faster when any combination of two powder ingredients (of the three major ingredients of the soup powder) were mixed together and stored at 50°C for 1week than when each powder component was stored separately. Furthermore, yeast extract powder was found to play a key role when free radical interactions between powder ingredients occurred. The incubation of rapeseed oil with powder ingredients at 45°C for 24h, indicated the ability of cauliflower powder to increase the concentration of hydroperoxides in rapeseed oil, while yeast extract powder was found to prevent this hydroperoxide formation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Effect of the spray application technique on the deposition of entomopathogenic nematodes in vegetables.

    Science.gov (United States)

    Brusselman, Eva; Beck, Bert; Pollet, Sabien; Temmerman, Femke; Spanoghe, Pieter; Moens, Maurice; Nuyttens, David

    2012-03-01

    The present study compared entomopathogenic nematode delivery at the base of savoy cabbage and cauliflower, at the lower side of savoy cabbage and cauliflower leaves and in leek stems and the ground deposition using a five-nozzle spray boom equipped with an ISO 08 flat fan, an air induction flat fan and Twinjet spray nozzles. Additionally, an air support system and a row application system were evaluated. Approximately 40% of the applied nematodes did not reach the foot of the cabbage plants. The use of an air support system or a row application system improved nematode deposition at the savoy cabbage base. Relative nematode deposition on the lower side of savoy cabbage leaves was 27.20%, while only 2.64% of the applied nematodes reached the lower side of cauliflower leaves. After spraying leek with a standard boom, a low relative nematode deposition (26.64%) was measured in the leek stem. Nozzle type affected the distribution of nematodes in droplet spots. Nozzle type has a minor effect on the number of entomopathogenic nematodes delivered on difficult-to-reach targets. The use of modified spray application techniques directing the spray to the target site are necessary to increase the chances of contact of entomopathogenic nematodes with their target. Copyright © 2011 Society of Chemical Industry.

  3. Synthesis of CuO nanocrystalline and their application as electrode materials for capacitors

    International Nuclear Information System (INIS)

    Zhang Hongxia; Zhang Milin

    2008-01-01

    Cauliflower-like, nanobelt-shaped and feather-like CuO nanocrystallines were synthesized by the chemical deposition method. The microstructure and morphology of CuO were characterized by X-ray diffraction (XRD), energy-dispersive spectrum (EDS) and field emission scanning electron microscopy (FESEM). Results showed that the morphology of CuO was affected by property of alkali added into system. The probable mechanisms of the formation of CuO with different morphologies were discussed. The electrochemical properties of CuO as electrode material were enhanced by the improving of morphology. Cauliflower-like CuO exhibited a higher specific capacitance (116.9 F g -1 ) than nanobelt-shaped and feather-like CuO, and also showed good reversibility. Specific capacitance of cauliflower-like CuO (115.3 F g -1 ) was 343.5% higher than CuO bought (26 F g -1 ) at 5 mA cm -2

  4. A novel nanostructure of cadmium oxide synthesized by mechanochemical method

    Energy Technology Data Exchange (ETDEWEB)

    Tadjarodi, A., E-mail: tajarodi@iust.ac.ir [Research Laboratory of Inorganic Materials Synthesis, Department of Chemistry, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of); Imani, M. [Research Laboratory of Inorganic Materials Synthesis, Department of Chemistry, Iran University of Science and Technology, 16846-13114 Tehran (Iran, Islamic Republic of)

    2011-11-15

    Highlights: {yields} A novel nanostructure of CdO was synthesized by mechanochemical reaction followed by calcination. {yields} Mechanochemical method is a simple and low-cost to synthesize nanomaterials. {yields} The obtained precursor was characterized by FT-IR, NMR techniques and elemental analysis. {yields} SEM images showed cauliflower-like shape of sample with components average diameter of 68 nm. {yields} The rods and tubes bundles with single crystalline nature were revealed by ED pattern and TEM images. -- Abstract: Cauliflower-like cadmium oxide (CdO) nanostructure was synthesized by mechanochemical reaction followed calcination procedure. Cadmium acetate dihydrate and acetamide were used as reagents and the resulting precursor was calcinated at 450 {sup o}C for 2 h in air. The structures of the precursor and resultant product of the heating treatment were characterized using Fourier transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy and elemental analysis, X-ray powder diffraction (XRD), energy-dispersive X-ray spectroscopy analysis (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction pattern (ED). SEM and TEM images revealed the cauliflower-like morphology of the sample. This structure includes the bundles of rods and tubes in nanoscale, which combine with each other and form the resulting morphology with the average diameter, 68 nm of the components. ED pattern indicated the single crystal nature of the formed bundles.

  5. A novel nanostructure of cadmium oxide synthesized by mechanochemical method

    International Nuclear Information System (INIS)

    Tadjarodi, A.; Imani, M.

    2011-01-01

    Highlights: → A novel nanostructure of CdO was synthesized by mechanochemical reaction followed by calcination. → Mechanochemical method is a simple and low-cost to synthesize nanomaterials. → The obtained precursor was characterized by FT-IR, NMR techniques and elemental analysis. → SEM images showed cauliflower-like shape of sample with components average diameter of 68 nm. → The rods and tubes bundles with single crystalline nature were revealed by ED pattern and TEM images. -- Abstract: Cauliflower-like cadmium oxide (CdO) nanostructure was synthesized by mechanochemical reaction followed calcination procedure. Cadmium acetate dihydrate and acetamide were used as reagents and the resulting precursor was calcinated at 450 o C for 2 h in air. The structures of the precursor and resultant product of the heating treatment were characterized using Fourier transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy and elemental analysis, X-ray powder diffraction (XRD), energy-dispersive X-ray spectroscopy analysis (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction pattern (ED). SEM and TEM images revealed the cauliflower-like morphology of the sample. This structure includes the bundles of rods and tubes in nanoscale, which combine with each other and form the resulting morphology with the average diameter, 68 nm of the components. ED pattern indicated the single crystal nature of the formed bundles.

  6. Facile synthesis of one dimensional ZnO nanostructures for DSSC applications

    International Nuclear Information System (INIS)

    Marimuthu, T.; Anandhan, N.

    2016-01-01

    Development of zinc oxide (ZnO) nanostructure based third generation dye sensitized solar cell is interesting compared to conventional silicon solar cells. ZnO nanostructured thin films were electrochemically deposited onto fluorine doped tin oxide (FTO) glass substrate. The effect of ethylene-diamine-tetra-acetic acid (EDTA) on structural, morphological and optical properties is investigated using X-ray diffraction (XRD) meter, field emission scanning electron microscope (FE-SEM) and micro Raman spectroscopy. XRD patterns reveal that the prepared nanostructures are hexagonal wutrzite structures with (101) plane orientation, the nanostructure prepared using EDTA exhibits better crystallinity. FE-SEM images illustrate that the morphological changes are observed from nanorod structure to cauliflower like structure as EDTA is added. Micro Raman spectra predict that cauliflower like structure possesses a higher crystalline nature with less atomic defects compared to nanorod structures. Dye sensitized solar cell (DSSC) is constructed for the optimized cauliflower structure, and open circuit voltage, short circuit density, fill factor and efficiency are estimated from the J-V curve.

  7. Effect of surface morphology and densification on the infrared emissivity of C/SiC composites

    International Nuclear Information System (INIS)

    Wang, Fuyuan; Cheng, Laifei; Zhang, Qing; Zhang, Litong

    2014-01-01

    Highlights: • The cauliflower-like microstructure improved the infrared emissivity multiply. • The infrared emissivity decreased continually with the improving surface flatness. • The densification process boosted the infrared emissivity. - Abstract: The effects of surface morphology and densification on the infrared emissivity of 2D C/SiC composites were investigated in 6–16 μm from 1000 °C to 1600 °C. As the sample surface was polished, the reflection and scattering for the electromagnetic waves of thermal radiation were reduced, causing a sustained decrease in the infrared emissivity. The space-variant polarizations caused by the cauliflower-like microstructure were enervated in the smooth surface, which enhanced the reduction trendy in the infrared emissivity. In densification process, the increasing SiC content and the growing amount of the cauliflower-like microstructure on sample surface improved the infrared emissivity of C/SiC composites, while the decreasing porosity decreased it. Due to the greater positive effects on the thermal radiation during the densification process, the infrared emissivity of C/SiC composites increased successively with density

  8. Synthesis of CuO nanocrystalline and their application as electrode materials for capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Hongxia [Department of Material Science and Chemical Engineering, Harbin Engineering University, Harbin 150001 (China)], E-mail: zhanghongxia.412@163.com; Zhang Milin [Department of Material Science and Chemical Engineering, Harbin Engineering University, Harbin 150001 (China)], E-mail: zhangmilin@hrbeu.edu.cn

    2008-04-15

    Cauliflower-like, nanobelt-shaped and feather-like CuO nanocrystallines were synthesized by the chemical deposition method. The microstructure and morphology of CuO were characterized by X-ray diffraction (XRD), energy-dispersive spectrum (EDS) and field emission scanning electron microscopy (FESEM). Results showed that the morphology of CuO was affected by property of alkali added into system. The probable mechanisms of the formation of CuO with different morphologies were discussed. The electrochemical properties of CuO as electrode material were enhanced by the improving of morphology. Cauliflower-like CuO exhibited a higher specific capacitance (116.9 F g{sup -1}) than nanobelt-shaped and feather-like CuO, and also showed good reversibility. Specific capacitance of cauliflower-like CuO (115.3 F g{sup -1}) was 343.5% higher than CuO bought (26 F g{sup -1}) at 5 mA cm{sup -2}.

  9. Effect of surface morphology and densification on the infrared emissivity of C/SiC composites

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Fuyuan, E-mail: wangfy1986@gmail.com; Cheng, Laifei; Zhang, Qing, E-mail: zhangqing@nwpu.edu.cn; Zhang, Litong

    2014-09-15

    Highlights: • The cauliflower-like microstructure improved the infrared emissivity multiply. • The infrared emissivity decreased continually with the improving surface flatness. • The densification process boosted the infrared emissivity. - Abstract: The effects of surface morphology and densification on the infrared emissivity of 2D C/SiC composites were investigated in 6–16 μm from 1000 °C to 1600 °C. As the sample surface was polished, the reflection and scattering for the electromagnetic waves of thermal radiation were reduced, causing a sustained decrease in the infrared emissivity. The space-variant polarizations caused by the cauliflower-like microstructure were enervated in the smooth surface, which enhanced the reduction trendy in the infrared emissivity. In densification process, the increasing SiC content and the growing amount of the cauliflower-like microstructure on sample surface improved the infrared emissivity of C/SiC composites, while the decreasing porosity decreased it. Due to the greater positive effects on the thermal radiation during the densification process, the infrared emissivity of C/SiC composites increased successively with density.

  10. Facile synthesis of one dimensional ZnO nanostructures for DSSC applications

    Energy Technology Data Exchange (ETDEWEB)

    Marimuthu, T.; Anandhan, N., E-mail: anandhan-kn@rediffmail.com [Advanced Materials and Thin Film Physics Lab, School of Physics, Alagappa University, Karaikudi – 630 003, India. (India)

    2016-05-06

    Development of zinc oxide (ZnO) nanostructure based third generation dye sensitized solar cell is interesting compared to conventional silicon solar cells. ZnO nanostructured thin films were electrochemically deposited onto fluorine doped tin oxide (FTO) glass substrate. The effect of ethylene-diamine-tetra-acetic acid (EDTA) on structural, morphological and optical properties is investigated using X-ray diffraction (XRD) meter, field emission scanning electron microscope (FE-SEM) and micro Raman spectroscopy. XRD patterns reveal that the prepared nanostructures are hexagonal wutrzite structures with (101) plane orientation, the nanostructure prepared using EDTA exhibits better crystallinity. FE-SEM images illustrate that the morphological changes are observed from nanorod structure to cauliflower like structure as EDTA is added. Micro Raman spectra predict that cauliflower like structure possesses a higher crystalline nature with less atomic defects compared to nanorod structures. Dye sensitized solar cell (DSSC) is constructed for the optimized cauliflower structure, and open circuit voltage, short circuit density, fill factor and efficiency are estimated from the J-V curve.

  11. Isothiocyanates, Nitriles, and Epithionitriles from Glucosinolates Are Affected by Genotype and Developmental Stage in Brassica oleracea Varieties.

    Science.gov (United States)

    Hanschen, Franziska S; Schreiner, Monika

    2017-01-01

    Vegetables of the Brassica oleracea group, such as broccoli, cauliflower, and cabbage, play an important role for glucosinolate consumption in the human diet. Upon maceration of the vegetable tissue, glucosinolates are degraded enzymatically to form volatile isothiocyanates, nitriles, and epithionitriles. However, only the uptake of isothiocyanates is linked to the cancer-preventive effects. Thus, it is of great interest to evaluate especially the isothiocyanate formation. Here, we studied the formation of glucosinolates and their respective hydrolysis products in sprouts and fully developed vegetable heads of different genotypes of the five B. oleracea varieties: broccoli, cauliflower as well as white, red, and savoy cabbages. Further, the effect of ontogeny (developmental stages) during the head development on the formation of glucosinolates and their respective hydrolysis products was evaluated at three different developmental stages (mini, fully developed, and over-mature head). Broccoli and red cabbage were mainly rich in 4-(methylsulfinyl)butyl glucosinolate (glucoraphanin), whereas cauliflower, savoy cabbage and white cabbage contained mainly 2-propenyl (sinigrin) and 3-(methylsulfinyl)propyl glucosinolate (glucoiberin). Upon hydrolysis, epithionitriles or nitriles were often observed to be the main hydrolysis products, with 1-cyano-2,3-epithiopropane being most abundant with up to 5.7 μmol/g fresh weight in white cabbage sprouts. Notably, sprouts often contained more than 10 times more glucosinolates or their hydrolysis products compared to fully developed vegetables. Moreover, during head development, both glucosinolate concentrations as well as hydrolysis product concentrations changed and mini heads contained the highest isothiocyanate concentrations. Thus, from a cancer-preventive point of view, consumption of mini heads of the B. oleracea varieties is recommended.

  12. Detection of herbaceous-plant pararetrovirus in lichen herbarium samples.

    Science.gov (United States)

    Petrzik, K; Koloniuk, I; Sarkisová, T; Číhal, L

    2016-06-01

    Cauliflower mosaic virus (CaMV) - a plant pararetrovirus that naturally causes diseases in Brassicaceae and Solanaceae plant hosts worldwide - has been detected by PCR for the first time in herbarium samples of Usnea sp. lichens. The virus's presence in these lichens did not result in any micro- or macromorphological changes, and the herbarium records were classified as representative for the distinct species. Sequence analyses classified all the detected viruses into one lineage of CaMV isolates. We have shown here that herbarium samples could be a good source for virus study, especially where a longer time span is involved.

  13. Influence of Electrolyte Composition on the Calcium-Phosphorus compound Coating on Titanium Substrate by Micro-arc Oxidation

    Institute of Scientific and Technical Information of China (English)

    ZHU Xiu-hong; WANG Cong-zeng; KOU Bin-da; SU Xue-kuan; ZHANG Wen-quan

    2004-01-01

    The compound bioceramic coating containing calcium (Ca) and phosphorus (P) on titanium alloy substrate was prepared by means of micro-arc oxidation (MAO) treatment. The results show that under the different electrolyte the coating with the color of gray or black and surface morphology of cauliflower or honeycomb, where Ca content and P contain can attain 30% and 20% respectively, can be obtained. Meanwhile, the influences of electrolyte temperature, current density and discharge time on morphology and thickness of coating are also discussed here.

  14. Electrosynthesis of cadmium selenide films from sodium citrate-selenosulphite bath

    International Nuclear Information System (INIS)

    Lokhande, C.D.; Lee, Eun-Ho; Jung, Kwang-Deog; Joo, Oh-Shim

    2005-01-01

    Electrosynthesis of cadmium selenide (CdSe) film has been carried out from deposition bath containing sodium selenosulphite, along with cadmium complexed with sodium citrate under potentiostatic deposition condition on titanium substrates. The pH of deposition bath was weakly basic (< 9.0). The CdSe films up to 3.0 μm were deposited. The X-ray diffraction (XRD) studies revealed that the CdSe films are microcrystalline with increased grain size after annealing. The scanning electron microscopy showed that the films are porous with cauliflower-like morphology. The photelectrochemical characterization showed that the CdSe films are photoactive

  15. Evaluation of charge storage ability of chrome doped Mn2O3 nanostructures derived by cathodic electrodeposition

    OpenAIRE

    Hamideh Darjazi; Saied Saeed Hosseiny Davarani; Hamid Reza Moazami; Taher Yousefi; Farideh Tabatabaei

    2016-01-01

    A facile synthetic route has been proposed to prepare cauliflower-like nanostructures of Cr doped Mn2O3. The synthesis was carried out by constant current cathodic electrodeposition from Mn2+ nitrate solutions containing minor amounts of dichromate. It was found that the presence of Cr mediates the formation of cathodic MnO2 which then reacts with the excess Mn2+ species to form Mn2O3 nanostructures. X-Ray Diffraction (XRD), Scanning Electron Microscopy (SEM) and Differential Thermal Analysis...

  16. The synthesis of [3H]-indole-3-carbinol, a natural anti-carcinogen from cruciferous vegetables

    International Nuclear Information System (INIS)

    Dashwood, R.H.; Uyetake, Lyle; Fong, A.T.; Hendricks, J.D.; Bailey, G.S.

    1989-01-01

    Indole-3-carbinol is a natural anti-carcinogen found as a glucosinolate in cruciferous vegetables such as cabbage, cauliflower and broccoli. A complete understanding of the mechanisms of anti-carcinogenesis by this dietary inhibitor requires improved insight into the disposition and metabolic fate of indole-3-carbinol in vivo. Such metabolic studies have been hampered by the lack of a commercial source of radiolabelled compound. This provided the main impetus for the work reported here, the synthesis of 5-[ 3 H]-indole-3-carbinol from 5-bromoindole. (author)

  17. Lead in some food crops and trees

    Energy Technology Data Exchange (ETDEWEB)

    Warren, H V; Delavault, R E

    1962-02-01

    An investigation has been made of the lead content of trees and some of the more common vegetables and cereals (maize, cabbage, potatoes, carrots, beets, onions, peas, hops, oats, rhubarb, lettuce, cauliflower, leeks, barley, rye, and wheat) grown in British Columbia and in Great Britain. The lead content of the lime, yew, willow, birch, oak, ash, hazel and cypress was determined. It was concluded that in areas where soils have an abnormally high lead content, food products may acquire up to ten times as much lead, or more, than those grown on normal soil.

  18. Si nanostructures grown by picosecond high repetition rate pulsed laser deposition

    International Nuclear Information System (INIS)

    Pervolaraki, M.; Komninou, Ph.; Kioseoglou, J.; Athanasopoulos, G.I.; Giapintzakis, J.

    2013-01-01

    One-step growth of n-doped Si nanostructures by picosecond ultra fast pulsed laser deposition at 1064 nm is reported for the first time. The structure and morphology of the Si nanostructures were characterized by X-ray diffraction, scanning electron microscopy and atomic force microscopy. Transmission electron microscopy studies revealed that the shape of the Si nanostructures depends on the ambient argon pressure. Fibrous networks, cauliflower formations and Si rectangular crystals grew when argon pressure of 300 Pa, 30 Pa and vacuum (10 −3 Pa) conditions were used, respectively. In addition, the electrical resistance of the vacuum made material was investigated

  19. Of chromoplasts and chaperones.

    Science.gov (United States)

    Giuliano, Giovanni; Diretto, Gianfranco

    2007-12-01

    Chromoplasts are carotenoid-accumulating plastids found in many fruits and flowers. In a new paper, Li and colleagues show that the Or gene of cauliflower induces differentiation of beta-carotene-containing chromoplasts in the (normally non-pigmented) curd tissue. This is the first time that a gene product controlling chromoplast differentiation is described. Or encodes an evolutionarily conserved DnaJ cysteine-rich domain-containing protein that can be used for metabolic engineering in crop plants, such as potato.

  20. Electrodeposition of polypyrrole films on aluminum surfaces from a p-toluene sulfonic acid medium

    Directory of Open Access Journals (Sweden)

    Andréa Santos Liu

    2009-01-01

    Full Text Available Electrodeposition of polypyrrole films on aluminum from aqueous solutions containing p-toluene sulfonic acid and pyrrole was performed by cyclic voltammetry and galvanostatic technique. The influence of applied current density on the morphology of the films was studied by Scanning Electron Microscopy. The films displayed a cauliflower-like structure consisting of micro-spherical grains. This structure is related to dopand intercalation in the polymeric chain. Films deposited at higher current density were more susceptible to the formation of pores and defects along the polymeric chain than films deposited at lower current density. These pores allow the penetration of aggressive species, thereby favoring the corrosion process.

  1. Characteristics of the Leuconostoc mesenteroides subsp. mesenteroides strains from fresh vegetables

    Directory of Open Access Journals (Sweden)

    Dimić Gordana R.

    2006-01-01

    Full Text Available Strains synthesizing extracellular polysaccharide dextran on a medium with 10% sucrose were isolated from different kind of vegetables (cabbage, cucumber, cauliflower, kohlrabi, carrot, green beans, red beet, pepper, eggplant, radish. Carbohydrate fermentation was examined using a bioMerieux API 50 CHL test system. Among micropopulations with characteristic spherical cell morphology, 94.9% belonged to Leuconostoc mesenteroides subsp. mesenteroides and 5.1% were identified as Leuconostoc mesenteroides subsp. dextranicum. According to fermentation of pentoses L. mesenteroides strains were divided into three groups with a certain number of biotypes; 10 strains were tested on acid production. .

  2. The synthesis of ( sup 3 H)-indole-3-carbinol, a natural anti-carcinogen from cruciferous vegetables

    Energy Technology Data Exchange (ETDEWEB)

    Dashwood, R H; Uyetake, Lyle; Fong, A T; Hendricks, J D; Bailey, G S [Oregon State Univ., Corvallis, OR (USA). Dept. of Food Science and Technology

    1989-08-01

    Indole-3-carbinol is a natural anti-carcinogen found as a glucosinolate in cruciferous vegetables such as cabbage, cauliflower and broccoli. A complete understanding of the mechanisms of anti-carcinogenesis by this dietary inhibitor requires improved insight into the disposition and metabolic fate of indole-3-carbinol in vivo. Such metabolic studies have been hampered by the lack of a commercial source of radiolabelled compound. This provided the main impetus for the work reported here, the synthesis of 5-({sup 3}H)-indole-3-carbinol from 5-bromoindole. (author).

  3. 35S Promoter Methylation in Kanamycin-Resistant Kalanchoe (Kalanchoe pinnata L.) Plants Expressing the Antimicrobial Peptide Cecropin P1 Transgene.

    Science.gov (United States)

    Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I

    2016-09-01

    Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases.

  4. A SIMPLE AND EFFECTIVE TREATMENT FOR PERICHONDRITIS TO PREVENT REACCUMULATION

    Directory of Open Access Journals (Sweden)

    Pampa Pathi Goud

    2015-11-01

    Full Text Available OBJECTIVE: A simple treatment for perichondritis to prevent reaccumulation by using a drain. Existing treatment for this condition is initially medical, surgical (incision and drainage and compression to prevent recurrence with accompanying medical management. However the result is often a failure, resulting in partial or complete cauliflower ear deformity. PROCEDURE: Treatment involves to drain the site of infection and placing a drain to prevent reaccumulation. RESULT: The prescribed treatment avoids reaccumulation of fluid and repeated drainage. CONCLUSION: This method can be implemented for routine minor OT practice.

  5. Chromomycosis presenting as soft-tissue mass: report of a case with MRI features

    International Nuclear Information System (INIS)

    Bahk, Won-Jong; Chang, Eun-Deok; Chun, Kyung-Ah; Lee, An-Hi; Park, Jung-Mi; Bahk, Yong-Whee

    2009-01-01

    Chromomycosis is primarily a skin disease that superficially presents as slowly growing, verrucous lesions, often warty or cauliflower-like in appearance. It may occasionally create a flat, plaque-like lesion in the skin but deep-seated tumorous presentation has not previously been reported. As the lesion is limited to the cutaneous and superficial subcutaneous tissues, hitherto reported cases have been described from the view point of dermatology and, so, without MRI study. We report a patient with pathologically proven chromomycosis that produced a subcutaneous mass in the dorsum of the hand with an emphasis on MRI features. (orig.)

  6. Chromomycosis presenting as soft-tissue mass: report of a case with MRI features

    Energy Technology Data Exchange (ETDEWEB)

    Bahk, Won-Jong [Uijongbu St. Mary' s Hospital, The Catholic University of Korea, Department of Orthopaedic Surgery, Gyunggido (Korea); Chang, Eun-Deok; Chun, Kyung-Ah; Lee, An-Hi; Park, Jung-Mi [The Catholic University of Korea School of Medicine, Musculoskeletal Oncology Group, Gyunggido (Korea); Bahk, Yong-Whee [SungAe General Hospital, PET CT Center, Seoul (Korea)

    2009-02-15

    Chromomycosis is primarily a skin disease that superficially presents as slowly growing, verrucous lesions, often warty or cauliflower-like in appearance. It may occasionally create a flat, plaque-like lesion in the skin but deep-seated tumorous presentation has not previously been reported. As the lesion is limited to the cutaneous and superficial subcutaneous tissues, hitherto reported cases have been described from the view point of dermatology and, so, without MRI study. We report a patient with pathologically proven chromomycosis that produced a subcutaneous mass in the dorsum of the hand with an emphasis on MRI features. (orig.)

  7. Radiation Induced Polymerization of Pyrrole

    International Nuclear Information System (INIS)

    Sarada Idris; Ratnam, C.T.; Ahmad Ashrif Abu Bakar

    2016-01-01

    We demonstrate the polymerization of pyrrole by gamma irradiation. The pyrrole films were exposed to gamma ray from cobalt 60 source at doses ranging from 0 to 150 kGy. The films were subjected to structural and morphological analyses by using FTIR, SEM and AFM techniques. Similar studies were also made on pristine pyrrole film which serve as control. Results revealed that pyrrole has been successfully polymerized through irradiation induced reactions. The SEM images depicted the formation of cauliflower shape upon gamma irradiation. The structural changes of pyrrole also evidenced by FTIR spectra. Surface topography and roughness of pyrrole before and after gamma irradiation found to show significant differences. (author)

  8. Si nanostructures grown by picosecond high repetition rate pulsed laser deposition

    Energy Technology Data Exchange (ETDEWEB)

    Pervolaraki, M., E-mail: pervolaraki@ucy.ac.cy [Nanotechnology Research Center and Department of Mechanical and Manufacturing Engineering, University of Cyprus, 75 Kallipoleos Av., PO Box 20537, 1678 Nicosia (Cyprus); Komninou, Ph.; Kioseoglou, J. [Department of Physics, Aristotle University of Thessaloniki, GR-54124 Thessaloniki (Greece); Athanasopoulos, G.I. [Nanotechnology Research Center and Department of Mechanical and Manufacturing Engineering, University of Cyprus, 75 Kallipoleos Av., PO Box 20537, 1678 Nicosia (Cyprus); Giapintzakis, J., E-mail: giapintz@ucy.ac.cy [Nanotechnology Research Center and Department of Mechanical and Manufacturing Engineering, University of Cyprus, 75 Kallipoleos Av., PO Box 20537, 1678 Nicosia (Cyprus)

    2013-08-01

    One-step growth of n-doped Si nanostructures by picosecond ultra fast pulsed laser deposition at 1064 nm is reported for the first time. The structure and morphology of the Si nanostructures were characterized by X-ray diffraction, scanning electron microscopy and atomic force microscopy. Transmission electron microscopy studies revealed that the shape of the Si nanostructures depends on the ambient argon pressure. Fibrous networks, cauliflower formations and Si rectangular crystals grew when argon pressure of 300 Pa, 30 Pa and vacuum (10{sup −3} Pa) conditions were used, respectively. In addition, the electrical resistance of the vacuum made material was investigated.

  9. Carbonaceous Particles Production in a Sputtering Discharge

    International Nuclear Information System (INIS)

    Dominique, Claire; Sant, Marco; Arnas, Cecile

    2005-01-01

    Spherical dust particles have been produced in argon glow discharge by sputtering of a graphite cathode. Their size varies from 40 to 200 nm depending on the distance between the two electrodes and the largest ones have a cauliflower shape. Simulations giving the evolution of the energy distribution of sputtered carbon atoms suggest a mechanism of growth by carbon vapour condensation. The chemical composition and structure of particles have been investigated by infrared spectroscopy and appear to be a complex arrangement of the carbon atoms and hetero-atoms

  10. HEMATOMA AURIKULA

    Directory of Open Access Journals (Sweden)

    Sari Indah

    2014-12-01

    Full Text Available Hematoma aurikula merupakan sekuele yang terjadi akibat trauma langsung pada daun telingayang menyebabkan penimbunan darah dalam ruang antara perikondrium dan kartilago yang biasanyaditemukan pada pegulat atau petinju. Keterlambatan diagnosis serta penanganan dapat menimbulkankomplikasi dimana salah satunya adalah telinga kembang kol atau cauliflower ear. Penatalaksanaanhematoma aurikula cukup bervariasi, namun tujuan utama pengobatan tersebut adalah mengevakuasidarah subperikondrial, mencegah kekambuhan, dan mencegah terjadinya infeksi. Dilaporkan satukasus hematoma aurikula pada seorang laki-laki dewasa berusia 68 tahun di Rumah Sakit UmumPusat ( RSUP  Sanglah-Denpasar yang telah dilakukan penanganan aspirasi serta bebat tekanmenggunakan teknik bolster yang memberikan hasil yang baik.

  11. Consumption of a diet rich in Brassica vegetables is associated with a reduced abundance of sulphate‐reducing bacteria: A randomised crossover study

    Science.gov (United States)

    Kellingray, Lee; Tapp, Henri S.; Saha, Shikha; Doleman, Joanne F.; Narbad, Arjan

    2017-01-01

    Scope We examined whether a Brassica‐rich diet was associated with an increase in the relative abundance of intestinal lactobacilli and sulphate‐reducing bacteria (SRB), or alteration to the composition of the gut microbiota, in healthy adults. Methods and results A randomised crossover study was performed with ten healthy adults who were fed a high‐ and a low‐Brassica diet for 2‐wk periods, with a 2‐wk washout phase separating the diets. The high‐Brassica diet consisted of six 84 g portions of broccoli, six 84 g portions of cauliflower and six 300 g portions of a broccoli and sweet potato soup. The low‐Brassica diet consisted of one 84 g portion of broccoli and one 84 g portion of cauliflower. Faecal microbiota composition was measured in samples collected following 2‐wk Brassica‐free periods (consumption of all Brassica prohibited), and after each diet, whereby the only Brassica consumed was that supplied by the study team. No significant changes to the relative abundance of lactobacilli were observed (p = 0.8019). The increased consumption of Brassica was associated with a reduction in the relative abundance of SRB (p = 0.0215), and members of the Rikenellaceae, Ruminococcaceae, Mogibacteriaceae, Clostridium and unclassified Clostridiales (p Brassica vegetables was linked to a reduced relative abundance of SRB, and therefore may be potentially beneficial to gastrointestinal health. PMID:28296348

  12. Impact of selenium supply on Se-methylselenocysteine and glucosinolate accumulation in selenium-biofortified Brassica sprouts.

    Science.gov (United States)

    Avila, Fabricio William; Yang, Yong; Faquin, Valdemar; Ramos, Silvio Junio; Guilherme, Luiz Roberto G; Thannhauser, Theodore W; Li, Li

    2014-12-15

    Brassica sprouts are widely marketed as functional foods. Here we examined the effects of Se treatment on the accumulation of anticancer compound Se-methylselenocysteine (SeMSCys) and glucosinolates in Brassica sprouts. Cultivars from the six most extensively consumed Brassica vegetables (broccoli, cauliflower, green cabbage, Chinese cabbage, kale, and Brussels sprouts) were used. We found that Se-biofortified Brassica sprouts all were able to synthesize significant amounts of SeMSCys. Analysis of glucosinolate profiles revealed that each Brassica crop accumulated different types and amounts of glucosinolates. Cauliflower sprouts had high total glucosinolate content. Broccoli sprouts contained high levels of glucoraphanin, a precursor for potent anticancer compound. Although studies have reported an inverse relationship between accumulation of Se and glucosinolates in mature Brassica plants, Se supply generally did not affect glucosinolate accumulation in Brassica sprouts. Thus, Brassica vegetable sprouts can be biofortified with Se for the accumulation of SeMSCys without negative effects on chemopreventive glucosinolate contents. Published by Elsevier Ltd.

  13. Optimum timing of insecticide applications against diamondback moth Plutella xylostella in cole crops using threshold catches in sex pheromone traps.

    Science.gov (United States)

    Reddy, G V; Guerrero, A

    2001-01-01

    Field trials were conducted in cabbage (Brassica oleracea var capitata), cauliflower (B oleracea var botrytis) and knol khol (B oleracea gongylodes) crops at two different locations in Karnataka State (India) to optimize the timing of insecticide applications to control the diamondback moth, Plutella xylostella, using sex pheromone traps. Our results indicate that applications of cartap hydrochloride as insecticide during a 12-24 h period after the pheromone traps had caught on average 8, 12 and 16 males per trap per night in cabbage, cauliflower and knol khol, respectively, were significantly more effective than regular insecticide sprays at 7, 9, 12 or 15 days after transplantation. This was demonstrated by estimation of the mean number of eggs and larvae per plant, the percentage of holes produced, as well as the marketable yield of the three crops at each location. A good correlation between the immature stages, infestation level, the estimated crop yield and the number of moths caught in pheromone traps was also found, indicating the usefulness of pheromone-based monitoring traps to predict population densities of the pest.

  14. Construction of phosphomannose isomerase (PMI) transformation vectors and evaluation of the effectiveness of vectors in tobacco (Nicotiana tabacum L).

    Science.gov (United States)

    Bahariah, Bohari; Parveez, Ghulam Kadir Ahmad; Masani, Mat Yunus Abdul; Khalid, Norzulaani

    2012-01-01

    Phosphomannose isomerase (pmi) gene isolated from Escherichia coli allows transgenic plants carrying it to convert mannose-6- phosphate (from mannose), a carbon source that could not be naturally utilized by plants into fructose-6-phosphate which can be utilized by plants as a carbon source. This conversion ability provides energy source to allow the transformed cells to survive on the medium containing mannose. In this study, four transformation vectors carrying the pmi gene alone or in combination with the β-glucuronidase (gusA) gene were constructed and driven by either the maize ubiquitin (Ubi1) or the cauliflower mosaic virus (CaMV35S) promoter. Restriction digestion, PCR amplification and sequencing were carried out to ensure sequence integrity and orientation. Tobacco was used as a model system to study the effectiveness of the constructs and selection system. PMI11G and pMI3G, which carry gusA gene, were used to study the gene transient expression in tobacco. PMI3 construct, which only carries the pmi gene driven by CaMV35S promoter, was stably transformed into tobacco using biolistics after selection on 30 g 1(-1) mannose without sucrose. Transgenic plants were verified using PCR analysis. PMI/pmi - Phosphomannose isomerase, Ubi1 - Maize ubiquitin promoter, CaMV35S - Cauliflower mosaic virus 35S promoter, gusA - β-glucuronidase GUS reporter gene.

  15. Development and Validation of a P-35S, T-nos, T-35S and P-FMV Tetraplex Real-time PCR Screening Method to Detect Regulatory Genes of Genetically Modified Organisms in Food.

    Science.gov (United States)

    Eugster, Albert; Murmann, Petra; Kaenzig, Andre; Breitenmoser, Alda

    2014-10-01

    In routine analysis screening methods based on real-time PCR (polymerase chain reaction) are most commonly used for the detection of genetically modified (GM) plant material in food and feed. Screening tests are based on sequences frequently used for GM development, allowing the detection of a large number of GMOs (genetically modified organisms). Here, we describe the development and validation of a tetraplex real-time PCR screening assay comprising detection systems for the regulatory genes Cauliflower Mosaic Virus 35S promoter, Agrobacterium tumefaciens nos terminator, Cauliflower Mosaic Virus 35S terminator and Figwort Mosaic Virus 34S promoter. Three of the four primer and probe combinations have already been published elsewhere, whereas primers and probe for the 35S terminator have been developed in-house. Adjustment of primer and probe concentrations revealed a high PCR sensitivity with insignificant physical cross-talk between the four detection channels. The sensitivity of each PCR-system is sufficient to detect a GMO concentration as low as 0.05% of the containing respective element. The specificity of the described tetraplex is high when tested on DNA from GM maize, soy, rapeseed and tomato. We also demonstrate the robustness of the system by inter-laboratory tests. In conclusion, this method provides a sensitive and reliable screening procedure for the detection of the most frequently used regulatory elements present in GM crops either authorised or unauthorised for food.

  16. Thermal aspects of open sun drying of various crops

    Energy Technology Data Exchange (ETDEWEB)

    Jain, D.; Tiwari, G.N. [Indian Inst. of Technology, Center for Energy Studies, New Delhi (India)

    2003-01-01

    Open sun drying (OSD) is the most common method of crop drying in developing countries. Despite several disadvantages, it is widely practiced because it is a simple way of drying. Crop temperature, temperature around the crop, solar temperature, and rate of moisture evaporation are the important parameters in OSD. The thermal behavior of OSD of green chillies, green pea, white gram (kabuli chana), onions, potatoes, and cauliflower was studied. The heat transfer analysis which is mainly dependent on the rate of moisture transfer has also been extended during drying process. A mathematical model has been developed to predict the crop temperature, rate of moisture removal, and solar temperature for a steady state condition. The rate of moisture transfer for potato slices and cauliflower was significantly higher than that in other crops. A fair agreement was observed between predicted and experimental results with coefficient of correlations ranging from 0.8936 to 0.7520, 0.9792-0.4172, and 0.9986-0.9942 for crop temperature, temperature above the crop surface, and rate of the moisture removal during drying, respectively except potato slices. (Author)

  17. Effect of Cultured Celery Juice, Temperature, and Product Composition on the Inhibition of Proteolytic Clostridium botulinum Toxin Production.

    Science.gov (United States)

    Golden, Max C; Wanless, Brandon J; David, Jairus R D; Kottapalli, Bala; Lineback, D Scott; Talley, Ryan J; Glass, Kathleen A

    2017-08-01

    Clostridium botulinum may be of concern in prepared refrigerated meals, for which strict cold chain management cannot be guaranteed. This study evaluated the effect of temperature, product composition, and cultured celery juice powder (CCJP) as a source of nitrite on the inhibition of botulinum toxin formation in two experimental (meat- and vegetable-based) prepared meals. Data obtained from the challenge study were compared with a published mathematical model to determine whether the model is fail-safe with regard to the tested meals. Treatments were inoculated with proteolytic C. botulinum, vacuum packaged, cooked at 90°C for 10 min, and assayed for botulinum toxin at appropriate intervals in samples stored at 10, 15, or 20°C for up to 8 weeks. None of the treatments stored at 10°C for 8 weeks supported toxin production by proteolytic C. botulinum. The addition of CCJP delayed toxin production by 1 and 3 weeks in cauliflower potatoes and in Dijon pork, respectively, stored at 15°C. Toxin production was delayed by 1 week at 20°C when CCJP was added to the cauliflower potatoes. This study found that the predictive model was fail-safe but was overly conservative for the experimental meals described. Finally, this study confirms that product composition, the addition of nitrite via CCJP, storage time, and temperature play important roles in the inhibition of toxin formation by proteolytic C. botulinum.

  18. Electrochemical properties of SnO2/carbon composite materials as anode material for lithium-ion batteries

    International Nuclear Information System (INIS)

    Wang Jie; Zhao Hailei; Liu Xiaotong; Wang Jing; Wang Chunmei

    2011-01-01

    Highlights: → SnO 2 /carbon powders with a cauliflower-like particle structure were synthesized. → Post-annealing can improve the electrochemical properties of SnO 2 /C composite. → The 500 deg. C-annealed SnO 2 /C shows the best electrochemical performance. → The lithium ion diffusion coefficients of the SnO 2 /C electrodes were calculated. - Abstract: SnO 2 /carbon composite anode materials were synthesized from SnCl 4 .5H 2 O and sucrose via a hydrothermal route and a post heat-treatment. The synthesized spherical SnO 2 /carbon powders show a cauliflower-like micro-sized structure. High annealing temperature results in partial reduction of SnO 2 . Metallic Sn starts to emerge at 500 deg. C. High Sn content in SnO 2 /carbon composite is favorable for the increase of initial coulombic efficiency but not for the cycling stability. The SnO 2 /carbon annealed at 500 deg. C exhibits high specific capacity (∼400 mAh g -1 ), stable cycling performance and good rate capability. The generation of Li 2 O in the first lithiation process can prevent the aggregation of active Sn, while the carbon component can buffer the big volume change caused by lithiation/delithiation of active Sn. Both of them make contribution to the better cycle stability.

  19. Effects of inoculum potential on screening for resistance to Plasmodiophora brassicae in greenhouse trials

    Directory of Open Access Journals (Sweden)

    Józef Robak

    2013-12-01

    Full Text Available Several factors, including growth medium, inoculum density, and inoculum storage affected the reaction of resistant and susceptible Brassicas to Plasmodiophora brassicae in the greenhouse. A high level of disease was achieved using Peat-litte mix R and a commercial greenhouse mix. There was litte difference in disease incidence when spore suspensions were pipeted into planting holes or when seedlings were dipped into spore suspensions. Seedlings transplanted from sand or Petri dishes gave higher levels of disease than direct seeding. Two-year frozen storage of clubs reduced the inoculum potential to a level unable to define resistance. Inoculum levels of 103-7 spores per ml from fresh clubs, or 105-7 spores per ml from clubs frozen for 2 or 4 years, produced 90% club incidence of susceptible cauliflower and Chinese cabbage, A concentration of only 106-8 spores per ml from fresh clubs was required for maximum disease expression in a cauliflower line partially resistant to clubroot.

  20. Deposition of Ni-CGO composite anodes by electrostatic assisted ultrasonic spray pyrolysis method

    International Nuclear Information System (INIS)

    Chen, J.-C.; Chang, C.-L.; Hsu, C.-S.; Hwang, B.-H.

    2007-01-01

    Deposition of composite films of Ni and Gd-doped ceria was carried out using the electrostatic assisted ultrasonic spray pyrolysis method for the first time. The composite films were highly homogeneous, as revealed by element mapping via energy-dispersive spectrometry. Scanning electron microscope examinations revealed that deposition temperature and electric field strength had profound influence on resultant microstructure, while composition of the precursor solution had little effect. A highly porous cauliflower structure ideal for solid oxide fuel cell anode performance was obtained with a deposition temperature of 450 deg. C under an electric field introduced by an applied voltage of 12 kV. Films obtained with a lower deposition temperature of 250 deg. C or a higher applied voltage of 15 kV resulted in denser films with low porosity, while lower applied voltages of 7 or 5 kV resulted in thinner or discontinuous films due to the insufficient electrostatic attraction on the aerosol droplets. As revealed by AC impedance measurement, the area specific resistances of the Ni-CGO anode with porous cauliflower structure were rather low and a value of 0.09 Ω cm 2 at 550 deg. C was obtained

  1. The chemistry and structure of nickel–tungsten coatings obtained by pulse galvanostatic electrodeposition

    International Nuclear Information System (INIS)

    Argañaraz, M.P. Quiroga; Ribotta, S.B.; Folquer, M.E.; Zelaya, E.; Llorente, C.; Ramallo-López, J.M.; Benítez, G.; Rubert, A.; Gassa, L.M.; Vela, M.E.; Salvarezza, R.C.

    2012-01-01

    A detailed characterization of electrodeposited Ni-W coatings prepared by pulse electrodeposition on steel and copper substrates is presented. The coatings were obtained at high current pulse frequency and show high microhardness and absence of brittleness. The surface of the coating consists of nanometer sized crystals forming a cauliflower-like structure protected by a mixture of nickel and tungsten oxides. The cauliflower structure is preserved into the bulk coating that exhibits an average composition ≈70 at% Ni-30 at% W. Different phases are observed in the bulk structure: a W-rich amorphous phase (≈40%) and Ni-rich crystalline phases (≈60%). The crystalline phases consist of crystalline domains ≈7 nm in size of Ni(W) (fcc) solid solution (12 at% W content) and a minor Ni 4 W component (less than 10%). The amorphous phase exhibits a less compact Ni-W structure where some amount of C could also be present. Oxidized W species cannot be detected in the bulk coating, thus discarding the presence of significant amounts of tungsten carbide, tungstates or citrate–tungsten complexes. Our results shed light on controversial points related to the chemical composition and demonstrate the complex structure of this system.

  2. A recombination point is conserved in the mitochondrial genome of higher plant species and located downstream from the cox2 pseudogene in Solanum tuberosum L.

    Directory of Open Access Journals (Sweden)

    Susely F.S. Tada

    2006-01-01

    Full Text Available The potato (Solanum tuberosum L. mitochondrial cox3/sdh4/pseudo-cox2 gene cluster has previously been identified by heterologous hybridization using a Marchantia polymorpha sdh4 probe. In our present study we used Southern blotting using sdh4 and cox2 probes to show that the sdh4 and cox2 genes are clustered in the mitochondria of potato, soybean and pea. Northern blotting revealed cotranscription of sdh4 and cox2 in potato but not in cauliflower, indicating that these genes are not clustered in cauliflower. A putative recombination point was detected downstream of the cox2 pseudogene (pseudo-cox2 in potato mitochondrial DNA (mtDNA. This sequence corresponds to a 32 bp sequence which appears to be well-conserved and is adjacent to the terminals of some mitochondrial genes in Citrullus lanatus, Beta vulgaris and Arabidopsis thaliana and is probably involved in the genic rearrangements. It is possible the potato mtDNA pseudo-cox2 gene was generated by recombination during evolution in the same way as that of several other mitochondrial genes and remains as an inactive partial copy of the functional cox2 which was also detected in potato mtDNA.

  3. Room temperature growth of nanocrystalline anatase TiO2 thin films by dc magnetron sputtering

    International Nuclear Information System (INIS)

    Singh, Preetam; Kaur, Davinder

    2010-01-01

    We report, the structural and optical properties of nanocrystalline anatase TiO 2 thin films grown on glass substrate by dc magnetron sputtering at room temperature. The influence of sputtering power and pressure over crystallinity and surface morphology of the films were investigated. It was observed that increase in sputtering power activates the TiO 2 film growth from relative lower surface free energy to higher surface free energy. XRD pattern revealed the change in preferred orientation from (1 0 1) to (0 0 4) with increase in sputtering power, which is accounted for different surface energy associated with different planes. Microstructure of the films also changes from cauliflower type to columnar type structures with increase in sputtering power. FESEM images of films grown at low pressure and low sputtering power showed typical cauliflower like structure. The optical measurement revealed the systematic variation of the optical constants with deposition parameters. The films are highly transparent with transmission higher than 90% with sharp ultraviolet cut off. The transmittance of these films was found to be influenced by the surface roughness and film thickness. The optical band gap was found to decrease with increase in the sputtering power and pressure. The refractive index of the films was found to vary in the range of 2.50-2.24 with increase in sputtering pressure or sputtering power, resulting in the possibility of producing TiO 2 films for device applications with different refractive index, by changing the deposition parameters.

  4. Differences observed in the surface morphology and microstructure of Ni-Fe-Cu ternary thin films electrochemically deposited at low and high applied current densities

    International Nuclear Information System (INIS)

    Sarac, U; Kaya, M; Baykul, M C

    2016-01-01

    In this research, nanocrystalline Ni-Fe-Cu ternary thin films using electrochemical deposition technique were produced at low and high applied current densities onto Indium Tin Oxide (ITO) coated conducting glass substrates. Change of surface morphology and microstructural properties of the films were investigated. Energy dispersive X-ray spectroscopy (EDX) measurements showed that the Ni-Fe-Cu ternary thin films exhibit anomalous codeposition behaviour during the electrochemical deposition process. From the X-ray diffraction (XRD) analyses, it was revealed that there are two segregated phases such as Cu- rich and Ni-rich within the films. The crystallographic structure of the films was face-centered cubic (FCC). It was also observed that the film has lower lattice micro-strain and higher texture degree at high applied current density. Scanning electron microscopy (SEM) studies revealed that the films have rounded shape particles on the base part and cauliflower-like structures on the upper part. The film electrodeposited at high current density had considerably smaller rounded shape particles and cauliflower-like structures. From the atomic force microscopy (AFM) analyses, it was shown that the film deposited at high current density has smaller particle size and surface roughness than the film grown at low current density. (paper)

  5. Electrochemical properties of SnO{sub 2}/carbon composite materials as anode material for lithium-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Wang Jie [School of Materials Science and Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Zhao Hailei, E-mail: hlzhao@ustb.edu.cn [School of Materials Science and Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Beijing Key Lab of New Energy Materials and Technologies, Beijing 100083 (China); Liu Xiaotong; Wang Jing; Wang Chunmei [School of Materials Science and Engineering, University of Science and Technology Beijing, Beijing 100083 (China)

    2011-07-15

    Highlights: > SnO{sub 2}/carbon powders with a cauliflower-like particle structure were synthesized. > Post-annealing can improve the electrochemical properties of SnO{sub 2}/C composite. > The 500 deg. C-annealed SnO{sub 2}/C shows the best electrochemical performance. > The lithium ion diffusion coefficients of the SnO{sub 2}/C electrodes were calculated. - Abstract: SnO{sub 2}/carbon composite anode materials were synthesized from SnCl{sub 4}.5H{sub 2}O and sucrose via a hydrothermal route and a post heat-treatment. The synthesized spherical SnO{sub 2}/carbon powders show a cauliflower-like micro-sized structure. High annealing temperature results in partial reduction of SnO{sub 2}. Metallic Sn starts to emerge at 500 deg. C. High Sn content in SnO{sub 2}/carbon composite is favorable for the increase of initial coulombic efficiency but not for the cycling stability. The SnO{sub 2}/carbon annealed at 500 deg. C exhibits high specific capacity ({approx}400 mAh g{sup -1}), stable cycling performance and good rate capability. The generation of Li{sub 2}O in the first lithiation process can prevent the aggregation of active Sn, while the carbon component can buffer the big volume change caused by lithiation/delithiation of active Sn. Both of them make contribution to the better cycle stability.

  6. Isolation of DNA methyltransferase from plants

    International Nuclear Information System (INIS)

    Ehrlich, K.; Malbroue, C.

    1987-01-01

    DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from [ 3 H]AdoMet incorporated into acid precipitable material per h at 30 0 ). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30 0

  7. Room temperature growth of nanocrystalline anatase TiO{sub 2} thin films by dc magnetron sputtering

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Preetam, E-mail: preetamphy@gmail.co [Functional Nanomaterials Research Lab, Department of Physics and Centre of Nanotechnology, Indian Institute of Technology Roorkee, Roorkee 247667 (India); Kaur, Davinder [Functional Nanomaterials Research Lab, Department of Physics and Centre of Nanotechnology, Indian Institute of Technology Roorkee, Roorkee 247667 (India)

    2010-03-01

    We report, the structural and optical properties of nanocrystalline anatase TiO{sub 2} thin films grown on glass substrate by dc magnetron sputtering at room temperature. The influence of sputtering power and pressure over crystallinity and surface morphology of the films were investigated. It was observed that increase in sputtering power activates the TiO{sub 2} film growth from relative lower surface free energy to higher surface free energy. XRD pattern revealed the change in preferred orientation from (1 0 1) to (0 0 4) with increase in sputtering power, which is accounted for different surface energy associated with different planes. Microstructure of the films also changes from cauliflower type to columnar type structures with increase in sputtering power. FESEM images of films grown at low pressure and low sputtering power showed typical cauliflower like structure. The optical measurement revealed the systematic variation of the optical constants with deposition parameters. The films are highly transparent with transmission higher than 90% with sharp ultraviolet cut off. The transmittance of these films was found to be influenced by the surface roughness and film thickness. The optical band gap was found to decrease with increase in the sputtering power and pressure. The refractive index of the films was found to vary in the range of 2.50-2.24 with increase in sputtering pressure or sputtering power, resulting in the possibility of producing TiO{sub 2} films for device applications with different refractive index, by changing the deposition parameters.

  8. Consumption of a diet rich in Brassica vegetables is associated with a reduced abundance of sulphate-reducing bacteria: A randomised crossover study.

    Science.gov (United States)

    Kellingray, Lee; Tapp, Henri S; Saha, Shikha; Doleman, Joanne F; Narbad, Arjan; Mithen, Richard F

    2017-09-01

    We examined whether a Brassica-rich diet was associated with an increase in the relative abundance of intestinal lactobacilli and sulphate-reducing bacteria (SRB), or alteration to the composition of the gut microbiota, in healthy adults. A randomised crossover study was performed with ten healthy adults who were fed a high- and a low-Brassica diet for 2-wk periods, with a 2-wk washout phase separating the diets. The high-Brassica diet consisted of six 84 g portions of broccoli, six 84 g portions of cauliflower and six 300 g portions of a broccoli and sweet potato soup. The low-Brassica diet consisted of one 84 g portion of broccoli and one 84 g portion of cauliflower. Faecal microbiota composition was measured in samples collected following 2-wk Brassica-free periods (consumption of all Brassica prohibited), and after each diet, whereby the only Brassica consumed was that supplied by the study team. No significant changes to the relative abundance of lactobacilli were observed (p = 0.8019). The increased consumption of Brassica was associated with a reduction in the relative abundance of SRB (p = 0.0215), and members of the Rikenellaceae, Ruminococcaceae, Mogibacteriaceae, Clostridium and unclassified Clostridiales (p < 0.01). The increased consumption of Brassica vegetables was linked to a reduced relative abundance of SRB, and therefore may be potentially beneficial to gastrointestinal health. © 2017 The Authors. Molecular Nutrition & Food Research published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Use of Vegetable Waste Extracts for Controlling Microstructure of CuO Nanoparticles: Green Synthesis, Characterization, and Photocatalytic Applications

    Directory of Open Access Journals (Sweden)

    Hameed Ullah

    2017-01-01

    Full Text Available Chemical syntheses involve either hazardous reactants or byproducts which adversely affect the environment. It is, therefore, desirable to develop synthesis processes which either do not involve hazardous reactants or consume all the reactants giving no byproducts. We have synthesized CuO nanoparticles (NPs adhering to some of the principles of green chemistry. The CuO NPs have been synthesized exploiting extracts of vegetable wastes, that is, Cauliflower waste and Potatoes and Peas peels. The extracts were aimed to work as capping agents to get control over the microstructure and morphology of the resulting CuO NPs. The green synthesized CuO NPs were characterized to explore the microstructure, morphology, optical bandgaps, and photocatalytic performances. XRD revealed that the CuO NPs of all the samples crystallized in a single crystal system, that is, monoclinic. However, the morphologies and the optical bandgaps energies varied as a function of the extract of vegetable waste. Similarly, the CuO NPs obtained through different extracts have shown different photocatalytic activities. The CuO NPs produced with extract of Cauliflower have shown high degradation of MB (96.28% compared to obtained with Potatoes peels (87.37% and Peas peels (79.11%.

  10. Nitrogen loss from high N-input vegetable fields - a) direct N2O emissions b) Spatiotemporal variability of N species (N2O, NH4+, NO3-) in soils

    Science.gov (United States)

    Pfab, H.; Ruser, R.; Palmer, I.; Fiedler, S.

    2009-04-01

    Nitrous oxide is a climate relevant trace gas. It contributes 7.9 % to the total anthropogenic greenhouse gas emission and it is also involved in stratospheric ozone depletion. Approximately 85 % of the anthropogenic N2O emissions result from agricultural activities, more than 50 % are produced during microbial N-turnover processes in soils. Especially soils with high N-input (N-fertilizer and high amount of N in plant residues) like vegetable cropped soils are assumed to cause high N2O losses. The aims of the study presented were (i) to quantify the N2O loss from a vegetable field (lettuce-cauliflower crop rotation), (ii) to calculate an emission factor for the study site in Southwest Germany and to compare this factor with the default value provided by the IPCC (2006) and (iii) to test the emission reduction potential (Ammonium Sulfate Nitrate fertilizer, ASN either by reduced N-fertilization) in comparison with common N doses used for good agricultural practice or by the use of a nitrification inhibitor (DMPP), a banded N-application (lettuce) or a depot fertilization measure (pseudo-CULTAN in order to suppress nitrification). N2O fluxes determined with the closed chamber method were highly variable in time with strongly increased flux rates after N-fertilization in combination with rainfall or irrigation measures and after the incorporation of cauliflower crop residues. Using the mean soil nitrate contents of the top soil of our investigated treatments (0-25 cm depth), we could explain approximately 60 % of the variability of the cumulative N2O losses during the vegetation period of lettuce and cauliflower. The cumulative N2O emissions ranged between 0,99 kg N2O-N ha-1 from the unfertilized control plots (vegetation period) and 6,81 kg N2O-N ha-1 from the plots with the highest N-dose. Based on the guidelines of the IPCC (2006), we calculated an emission factor around 0,9 % for the cropping season. This value is in good agreement with the default value of the

  11. Microstructural properties of electrochemically prepared Ni–Fe–W powders

    International Nuclear Information System (INIS)

    Ribić-Zelenović, L.; Ćirović, N.; Spasojević, M.; Mitrović, N.; Maričić, A.; Pavlović, V.

    2012-01-01

    A nanostructured Ni–Fe–W powder was obtained by electrodeposition from ammonium citrate electrolyte within the current density range of 500–1000 mA cm −2 at the electrolyte temperature of 50 °C–70 °C. XRD analysis shows that the powder contains an amorphous matrix having embedded nanocrystals of the FCC solid solution of iron and tungsten in nickel, with an average crystal grain size of 3.4 nm, a high internal microstrain value and a high density of chaotically distributed dislocations. EDS analysis exhibits that the chemical composition of the Ni–24%Fe–11%W powder does not depend upon current density and electrolyte temperature due to the diffusion control of the process of codeposition of nickel, iron and tungsten. SEM micrographs show that the electrodeposition results in the formation of two particle shapes: large cauliflower-like particles and small dendrite particles. The cauliflower-like particles contain deep cavities at hydrogen evolution sites. Cavity density increases with increasing deposition current density. Smaller powder particles are formed at higher temperatures and at higher current densities. During the first heating, relative magnetic permeability decreases reaching the Curie temperature at about 350 °C and after cooling exhibits a 12% increase due to the performed relaxation process. Following the second heating to 500 °C, the magnetic permeability of the powder is about 5% lower than that of the as-prepared powder due to crystallization of the amorphous phase of the powder and the crystal grain growth in FCC phase. - Highlights: ► Electrodeposition Ni–Fe–W powder from ammonium citrate electrolyte (500–1000 mA cm −2 ). ► Powder contains amorphous matrix and embedded nanocrystals 3.4 nm. ► Chemical composition Ni–24%Fe–11%W do not depend upon current density and electrolyte temperature. ► Two particle shapes: large cauliflower-like particles and small dendrite particles. ► Smaller powder particles are

  12. Microstructural properties of electrochemically prepared Ni-Fe-W powders

    Energy Technology Data Exchange (ETDEWEB)

    Ribic-Zelenovic, L. [Faculty of Agronomy, University of Kragujevac, Cacak (Serbia); Cirovic, N. [Joint Laboratory for Advanced Materials of SASA, Technical Faculty Cacak, University of Kragujevac, Cacak (Serbia); Spasojevic, M. [Faculty of Agronomy, University of Kragujevac, Cacak (Serbia); Mitrovic, N., E-mail: nmitrov@tfc.kg.ac.rs [Joint Laboratory for Advanced Materials of SASA, Technical Faculty Cacak, University of Kragujevac, Cacak (Serbia); Maricic, A. [Joint Laboratory for Advanced Materials of SASA, Technical Faculty Cacak, University of Kragujevac, Cacak (Serbia); Pavlovic, V. [Faculty of Agriculture, University of Belgrade, Belgrade (Serbia)

    2012-07-16

    A nanostructured Ni-Fe-W powder was obtained by electrodeposition from ammonium citrate electrolyte within the current density range of 500-1000 mA cm{sup -2} at the electrolyte temperature of 50 Degree-Sign C-70 Degree-Sign C. XRD analysis shows that the powder contains an amorphous matrix having embedded nanocrystals of the FCC solid solution of iron and tungsten in nickel, with an average crystal grain size of 3.4 nm, a high internal microstrain value and a high density of chaotically distributed dislocations. EDS analysis exhibits that the chemical composition of the Ni-24%Fe-11%W powder does not depend upon current density and electrolyte temperature due to the diffusion control of the process of codeposition of nickel, iron and tungsten. SEM micrographs show that the electrodeposition results in the formation of two particle shapes: large cauliflower-like particles and small dendrite particles. The cauliflower-like particles contain deep cavities at hydrogen evolution sites. Cavity density increases with increasing deposition current density. Smaller powder particles are formed at higher temperatures and at higher current densities. During the first heating, relative magnetic permeability decreases reaching the Curie temperature at about 350 Degree-Sign C and after cooling exhibits a 12% increase due to the performed relaxation process. Following the second heating to 500 Degree-Sign C, the magnetic permeability of the powder is about 5% lower than that of the as-prepared powder due to crystallization of the amorphous phase of the powder and the crystal grain growth in FCC phase. - Highlights: Black-Right-Pointing-Pointer Electrodeposition Ni-Fe-W powder from ammonium citrate electrolyte (500-1000 mA cm{sup -2}). Black-Right-Pointing-Pointer Powder contains amorphous matrix and embedded nanocrystals 3.4 nm. Black-Right-Pointing-Pointer Chemical composition Ni-24%Fe-11%W do not depend upon current density and electrolyte temperature. Black

  13. Determination of Cadmium, Lead and Zinc in Vegetables in Jaipur (India).

    Science.gov (United States)

    Kumar, Ashok; Verma, P S

    2014-01-01

    An atomic absorption spectroscopic method was used for the determination of Lead, Cadmium and Zinc in vegetables grown in and around Jaipur food stuffs irrigated with industrial waste water. Vegetable samples were collected after maturity, and analyzed, such as spinach (Spinacia oleracea), ladyfinger (Abelmoschus esulentus), pepper mint (Menthe pipereta), brinjal (Solanum melongena), coriander (Coriandrum sativum), cauliflower (Brassica oleracea), onion (Allium cepa), radish (Raphanus sativus), pointedgourd (Trichosanthes dioica), bottlegourd (Lagenaria siceraria), chilies (Capsicum annum), ribbedgourd (Luffa acutangula) and pumpkin (Curcurbites pepo). The concentration of Lead ranged between 1.40-71.06 ppm, Cadmium 0.61-34.48 ppm and Zinc 0.39-187.26 ppm in vegetable samples. The results reveal that urban consumers are at greater risk of purchasing fresh vegetables with high levels of heavy metal, beyond the permissible limits, as defined by the Indian Prevention of Food Adulteration Act, 1954 and WHO.

  14. Assessment of some Herbal Drugs for Prophylaxis of Peptic Ulcer.

    Science.gov (United States)

    Gohar, Ahmed A; Zaki, Ahmed A

    2014-01-01

    Aqueous (hydrophilic) and chloroform (Lipophilic) extracts of nine medicinal plants currently used in Egyptian traditional medicine to treat some gastrointestinal tract (GIT) disorders were tested for their gastro-protective effect against the incidence of peptic ulcer. Indomethacin-induced ulcer in a rat model was used for this testing. Mentha microphylla, Brassica oleracea Capitata (Cabbage), B. oleracea Botrytis (cauliflower) aqueous fraction, Portolaca oleracea polysaccharide fraction, Oreganum marjoranum, Matricaria recutita, Solanum nigrum hydrophilic and lipophilic fractions, in addition to the chloroform fraction of Portolaca oleracea and Cicorium intybus afforded high protection against the incidence of gastric ulcer (~95%). O. syriacum hydrophilic and lipophilic fractions and gum arabic afforded moderate prophylactic effect. L. sicerarea, C. intybus hydrophilic fractions and M. microphylla lipophilic fraction were inactive. Herbs represent excellent resources for cost-effective and readily available gastro-protective remedies without side effects.

  15. RETRACTED: Green synthesis of zinc oxide nanoparticles using Moringa oleifera leaf extract and evaluation of its antimicrobial activity

    Science.gov (United States)

    Elumalai, K.; Velmurugan, S.; Ravi, S.; Kathiravan, V.; Ashokkumar, S.

    2015-05-01

    This article has been retracted: please see Elsevier Policy on Article Withdrawal. This article has been retracted at the request of the Editor. The article contains the same image in two panels (Fig. 8A and B) which was previously published in "Facile, eco-friendly and template free photosynthesis of cauliflower like ZnO nanoparticles using leaf extract of Tamarindus indica (L.) and its biological evolution of antibacterial and antifungal activities" by K. Elumalai et al. in Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 136 (2015) 1052-1057, http://dx.doi.org/10.1016/j.saa.2014.09.129 despite being attributed to different nanoparticles. Furthermore, Figures 9C, D and E are the same, despite being indicated as analysis of different microorganisms. The scientific community takes a very strong view on this scientific misbehavior and apologies are offered to readers of the journal that this was not detected during the submission process.

  16. Simple screening strategy with only water bath needed for the identification of insect-resistant genetically modified rice.

    Science.gov (United States)

    Zhang, Fang; Wang, Liu; Wang, Rui; Ying, Yibin; Wu, Jian

    2015-02-03

    An informative, with simple instrument needed, rapid and easily updated strategy for the identification of insect-resistant genetically modified (GM) rice has been described. Such strategy is based on a parallel series of loop-mediated isothermal amplification (LAMP) reactions targeting the rice endogenous gene sucrose phosphate synthase (Sps), the top two most frequently used genetic elements (Agrobacterium tumefaciens nopaline synthase terminator (Nos) and Cauliflower mosaic virus 35S promoter (CaMV35S)), and an insect-resistant specific gene (Cry1Ac) and detected visually by phosphate ion (Pi)-induced coloration reaction. After a logical judgment of visible readouts has been obtained, three popular insect-resistant GM rice events in China can be successfully identified within 35 min, using either microwell strips or paper bases.

  17. Spinal Exostosis in a Boy with Multiple Hereditary Exostoses

    Directory of Open Access Journals (Sweden)

    Ali Al Kaissi

    2013-01-01

    Full Text Available We report on a 13-year-old boy who presented with multiple hereditary exostosis and had development of back pain, associated with neurological deficits, and was found to have exostoses in the spinal canal. Spine radiograph showed a cauliflower-like abnormality of multiple exostoses of the posterior arch (pedicle of the thoracic vertebrae (T3–5. Reformatted CT scanning revealed the simultaneous development of intra- and extraspinal osteochondromatosis of T3–5. The spinal cord was compressed by the intraspinal exostosis. Our patient was surgically treated for intraspinal exostoses and showed cessation of neurological deficits. We report what might be a rare association of spinal cord compression in a patient with multiple hereditary exostoses.

  18. Diagnosis of pelvic wall tumor on multislice CT

    International Nuclear Information System (INIS)

    Zhang Keyun; Deng Lequn; Lei Hongwei

    2011-01-01

    Objective: To evaluate the value of multi-slice CT (MSCT) in diagnosing pelvic wall tumors. Methods: MSCT of 21 cases of pelvic wall tumors including metastasis (10), neurogenic tumor (5), chondrosarcoma (2), chordoma (1), aneurysmal bone cyst (1), giant cell tumor (1), and osteochondroma (1) was retrospectively analyzed. Results: CT appearances of pelvic wall tumors include bony destruction and soft tissue masses. Common features were bone destruction in metastasis, expansion of the neuroforamen in neurogenic tumor, pleomorphic calcification in chondrosarcoma, lower sacral vertebral location of chordoma, iliac crest bone destruction in giant cell tumor, cauliflower-like nodules in osteochondroma. Conclusion: MSCT with three-dimensional volume rendering demonstrates well the tumor shape, size, extent, internal structure and relationship with the surrounding organs to aid diagnosis of pelvic wall tumors. (authors)

  19. Mechanical Properties of TiTaHfNbZr High-Entropy Alloy Coatings Deposited on NiTi Shape Memory Alloy Substrates

    Science.gov (United States)

    Motallebzadeh, A.; Yagci, M. B.; Bedir, E.; Aksoy, C. B.; Canadinc, D.

    2018-04-01

    TiTaHfNbZr high-entropy alloy (HEA) thin films with thicknesses of about 750 and 1500 nm were deposited on NiTi substrates by RF magnetron sputtering using TiTaHfNbZr equimolar targets. The thorough experimental analysis on microstructure and mechanical properties of deposited films revealed that the TiTaHfNbZr films exhibited amorphous and cauliflower-like structure, where grain size and surface roughness increased concomitant with film thickness. More importantly, the current findings demonstrate that the TiTaHfNbZr HEA films with mechanical properties of the same order as those of the NiTi substrate constitute promising biomedical coatings effective in preventing Ni release.

  20. Nylon-sputtered nanoparticles: fabrication and basic properties

    Science.gov (United States)

    Polonskyi, O.; Kylián, O.; Solař, P.; Artemenko, A.; Kousal, J.; Slavínská, D.; Choukourov, A.; Biederman, H.

    2012-12-01

    Nylon-sputtered nanoparticles were prepared using a simple gas aggregation cluster source based on a planar magnetron (Haberland type) and equipped with a nylon target. Plasma polymer particles originated in an aggregation chamber and travelled to a main (deposition) chamber with a gas flow through an orifice. The deposited nanoparticles were observed to have a cauliflower-like structure. The nanoparticles were found to be nitrogen-rich with N/C ratio close to 0.5. An increase in rf power from 60 to 100 W resulted in a decrease in mean particle size from 210 to 168 nm whereas an increase in their residence time in the cluster source from 0.7 to 4.6 s resulted in an increase in the size from 73 to 231 nm.

  1. Influence of atmospheric SO/sub 2/ on the formation of goitrogenic substances in plants

    Energy Technology Data Exchange (ETDEWEB)

    Spaleny, J.; Kutacek, M.

    1970-01-01

    Experiments were performed to determine whether SO/sub 2/ from the atmosphere, after having passed through the stoma into the tissue of the assimilating organs of plants, may incorporate into naturally occurring goitrogens, the thioglycosides, and so increase their content. Results of tests with cauliflower indicate that the sulfur does incorporate into the thioglycosides. From these results it is considered essential to propose a medical test of a sample of the population from polluted areas with regard to the pathology of the thyroid gland. The excessive supply of goitrogenic thioglycosides may lead to the disturbance of the activity of the thyroid gland in individual patients who consume excessive quantities of Brassica in areas that are strongly polluted by SO/sub 2/.

  2. Effects of fluorine on the germination of some species of seeds

    Energy Technology Data Exchange (ETDEWEB)

    Navara, J; Holub, Z; Bedatsova, L

    1966-01-01

    The various degrees of tolerance of the seeds of some species of plants towards fluorine and their ability to accumulate fluorine under experimental conditions are presented. The effects of fluorine on the germination of seeds manifests itself in various ways. The studied species have been divided into four groups according to their natural tolerance: (1) very sensitive: pea, soya, vetch and cabbage; (2) sensitive: radish, barley, cole; (3) less sensitive: maize, cauliflower, alfalfa, mustard, oats, clover kohlrabi; and (4) tolerant: poppy, carrot, tomato. Highly tolerant species are capable of accumulating considerable amounts of fluorine when compared with the more sensitive species. A more intensive accumulation of fluorine has been noticed in the oleaginous species, viz. mustard and poppy. A correlation was found to exist between the ash contents (especially of calcium) and the ability of a greater accumulation of fluorine. 23 references, 6 figures, 2 tables.

  3. Links, lecturing and learning: some issues for geoscience education

    Science.gov (United States)

    Castleford, John

    1998-08-01

    If the educational potential of the World Wide Web is to be realised, academics need to move beyond the flowery hype from chattering cybersages expatiating on its vast informational potential. As if you had not noticed, the Web is now a bed we share with vast numbers of anorak wearers, get-rich-quick marketers, porn barons, cauliflower-diet promoters and the like. If academics are to be able to educate students on how to use the Web it will need more than pointing them toward a list of "my favorite sites". In this essay I offer a few ideas about how Geoscientists can look past the hype surrounding the World Wide Web and develop a working perspective on its use as a resource to support and reinforce learning.

  4. Effect of Anoxia on Respiration Rate (Fermentative Index and Ethanol Production of Onion Bulbs (Allium cepa L.

    Directory of Open Access Journals (Sweden)

    N. Benkeblia

    2003-01-01

    Full Text Available The physiological behavior, including carbon dioxide production, fermentative index (FI and ethanolic production of onion bulbs kept under total anoxia (l00% N2 was investigated. During the first 24 hours, carbon dioxide production increased from 0.01 to 1.56 kPa Co2, and the average rate of the increase in CO2; production between 0 and 24 hours was 0.09 kPa/h. The Q10, of the fermentative index was l.9. Ethanol produced by onion bulbs kept under anoxia during 6 hours was temperature dependent, and was 0.563 and 0.760 pmol kg-1h-1 at 10 and 20°C respectively, while at 4°C the quantity produced was not detected. It is concluded that onion seems to be less tolerant to anoxia than other vegetables such as artichoke, cauliflower, tomato, potato and asparagus.

  5. Simulation of nitrogen leaching from a fertigated crop rotation in a Mediterranean climate using the EU-Rotate_N and Hydrus-2D models

    DEFF Research Database (Denmark)

    Doltra, Jordi; Nuñoz, P

    2010-01-01

    to a higher nitrate concentration in percolated water. Comparison of the observed and predicted yield response to N applications with EU-Rotate_N demonstrated that the best fertigation strategy could be identified and the risk of nitrate leaching quantified with this model. The results showed......Two different modeling approaches were used to simulate the N leached during an intensively fertigated crop rotation: a recently developed crop-based simulation model (EU-Rotate_N) and a widely recognized solute transport model (Hydrus-2D). Model performance was evaluated using data from...... an experiment where four N fertigation levels were applied to a bell pepper-cauliflower-Swiss chard rotation in a sandy loam soil. All the input data were obtained from measurements, transfer functions or were included in the model databases. Model runs were without specific site calibration. The use of soil...

  6. Solitary Osteochondroma of the Thoracic Spine with Compressive Myelopathy; A Rare Presentation

    International Nuclear Information System (INIS)

    Mehrian, Payam; Karimi, Mohammad Ali; Kahkuee, Shahram; Bakhshayeshkaram, Mehrdad; Ghasemikhah, Reza

    2013-01-01

    A 19-year-old man presented with a 5-year history of back pain radiating to the lower extremities and paresthesis of the toes during the last year. Plain X-ray revealed a large cauliflower shaped exophytic mass at the level of T8, T9 and T10 vertebrae. Computed tomography (CT) and magnetic resonance imaging (MRI) showed an abnormal bony mass arising from the posterior arch of T9 with protrusion to the spinal canal and marked cord compression. The cortex and medulla of the lesion had continuity with those of the T9 vertebra. Surgical en bloc resection was performed and the patient’s symptoms resolved. The histopathologic diagnosis was osteochondroma. In patients with symptoms of myelopathy, in addition to more common etiologies, one should also be aware of rare entities such as osteochondroma

  7. Mixed-solvothermal synthesis of CdS micro/nanostructures and their optical properties

    International Nuclear Information System (INIS)

    Zhong Shengliang; Zhang Linfei; Huang Zhenzhong; Wang Shangping

    2011-01-01

    Several novel cadmium sulfide (CdS) micro/nanostructures, including cauliflower-like microspheres, football-like microspheres, tower-like microrods, and dendrites were controllably prepared via an oxalic acid-assisted solvothermal route using ethylene glycol (EG) and H 2 O as pure and mixed solvents with different S sources. The as-prepared products were characterized by X-ray powder diffraction (XRD), scanning electronic microscope (SEM) and UV-vis spectrophotometer (UV). It was found that CdS micro/nanostructures can be selectively obtained by varying the composition of solvent, concentration of oxalic acid, and sulfur sources. UV-vis absorption spectra reveal that their absorption properties are shape-dependent. The possible formation process of the CdS micro/nanostructures was briefly discussed. This route provides a facile way to tune the morphologies of CdS over a wide range.

  8. Mixed-solvothermal synthesis of CdS micro/nanostructures and their optical properties

    Energy Technology Data Exchange (ETDEWEB)

    Zhong Shengliang, E-mail: zslxhx@yahoo.com.cn [College of Chemistry and Chemical Engineering, Jiangxi Normal University, Nanchang 330022 (China); Zhang Linfei; Huang Zhenzhong; Wang Shangping [College of Chemistry and Chemical Engineering, Jiangxi Normal University, Nanchang 330022 (China)

    2011-01-15

    Several novel cadmium sulfide (CdS) micro/nanostructures, including cauliflower-like microspheres, football-like microspheres, tower-like microrods, and dendrites were controllably prepared via an oxalic acid-assisted solvothermal route using ethylene glycol (EG) and H{sub 2}O as pure and mixed solvents with different S sources. The as-prepared products were characterized by X-ray powder diffraction (XRD), scanning electronic microscope (SEM) and UV-vis spectrophotometer (UV). It was found that CdS micro/nanostructures can be selectively obtained by varying the composition of solvent, concentration of oxalic acid, and sulfur sources. UV-vis absorption spectra reveal that their absorption properties are shape-dependent. The possible formation process of the CdS micro/nanostructures was briefly discussed. This route provides a facile way to tune the morphologies of CdS over a wide range.

  9. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  10. Analysis of S-methylmethionine and S-adenosylmethionine in plant tissue by a dansylation, Dual-isotope method

    Energy Technology Data Exchange (ETDEWEB)

    Macnicol, P.K.

    1986-10-01

    A method is presented for determining the levels of S-methylmethionine (MeMet) and S-adenosylmethionine (AdoMet) in the same plant tissue sample, utilizing readily available equipment. The bottom limit of sensitivity, ca. 100 pmol, can be lowered if required. A trichloracetic acid homogenate of the tissue is supplemented with (carboxyl-/sup 14/C)MeMet and (carboxyl-/sup 14/C)AdoMet. After separation of MeMet and AdoMet from each other and from endogenous homoserine on a phosphocellulose column, the two fractions are heat treated at appropriate pH values to liberate (/sup 14/C)homoserine. Quantitation is via the /sup 3/H//sup 14/C ratio of (/sup 3/H)dansyl-(/sup 14/C)homoserine isolated by thin-layer chromatography. The method is validated with pea cotyledon, corn root, and cauliflower leaf.

  11. Food-processing, packaging and irradiation/preservation

    International Nuclear Information System (INIS)

    Tripathi, Jyothi

    2017-01-01

    The present talk describes the major projects being carried out in FFACS during last few years. One of the major aims of the section is development of ready-to-cook (RTC) vegetables and ready-to-eat (RTE) fruits with improved shelf life using radiation processing. RTC vegetables and fruits (French beans, ash gourd, drumstick, pumpkin, cabbage, cauliflower and pomegranate having shelf life of 2-3 days at 10 °C) with enhanced shelf life (up to 21 days at 10°C) were developed using radiation treatment. The developed products were far superior as compared to the corresponding control samples with respect to sensory and microbial quality during the intended storage period. The findings have helped the food industry in adoption of food irradiation technology. The products developed are now being taken up by HyperCITY Retail (India) Ltd. for sale on their shelves

  12. Analysis of S-methylmethionine and S-adenosylmethionine in plant tissue by a dansylation, Dual-isotope method

    International Nuclear Information System (INIS)

    Macnicol, P.K.

    1986-01-01

    A method is presented for determining the levels of S-methylmethionine (MeMet) and S-adenosylmethionine (AdoMet) in the same plant tissue sample, utilizing readily available equipment. The bottom limit of sensitivity, ca. 100 pmol, can be lowered if required. A trichloracetic acid homogenate of the tissue is supplemented with [carboxyl- 14 C]MeMet and [carboxyl- 14 C]AdoMet. After separation of MeMet and AdoMet from each other and from endogenous homoserine on a phosphocellulose column, the two fractions are heat treated at appropriate pH values to liberate [ 14 C]homoserine. Quantitation is via the 3 H/ 14 C ratio of [ 3 H]dansyl-[ 14 C]homoserine isolated by thin-layer chromatography. The method is validated with pea cotyledon, corn root, and cauliflower leaf

  13. Nano-Crystalline Diamond Films with Pineapple-Like Morphology Grown by the DC Arcjet vapor Deposition Method

    Science.gov (United States)

    Li, Bin; Zhang, Qin-Jian; Shi, Yan-Chao; Li, Jia-Jun; Li, Hong; Lu, Fan-Xiu; Chen, Guang-Chao

    2014-08-01

    A nano-crystlline diamond film is grown by the dc arcjet chemical vapor deposition method. The film is characterized by scanning electron microscopy, high-resolution transmission electron microscopy (HRTEM), x-ray diffraction (XRD) and Raman spectra, respectively. The nanocrystalline grains are averagely with 80 nm in the size measured by XRD, and further proven by Raman and HRTEM. The observed novel morphology of the growth surface, pineapple-like morphology, is constructed by cubo-octahedral growth zones with a smooth faceted top surface and coarse side surfaces. The as-grown film possesses (100) dominant surface containing a little amorphous sp2 component, which is far different from the nano-crystalline film with the usual cauliflower-like morphology.

  14. Plant-based fertilizers for organic vegetable production

    DEFF Research Database (Denmark)

    Sørensen, Jørn Nygaard; Thorup-Kristensen, Kristian

    2011-01-01

    To ensure high yield and quality in organic vegetable production, crops often require additional fertilizer applied during the season. Due to the risk of contamination of edible plant products from slurry, plant-based fertilizers may be used as an alternative. The purpose of our work was to develop...... fertility, the term “mobile green manures” is used for green-manure crops that are harvested in one field and then moved as a whole and used as fertilizer in other fields. To further investigate mobile-green-manure crops for use as efficient fertilizers, pot and field experiments were conducted...... with cauliflower (Brassica oleracea botrytis) and kale (Brassica oleracea sabellica) supplied with organic matter consisting of a wide range of plant species with varying nutrient concentrations. Further, field experiments were conducted with leek (Allium porrum) and celery (Apium graveolens dulce) supplied...

  15. Arsenic contamination of soils and agricultural plants through irrigation water in Nepal

    International Nuclear Information System (INIS)

    Dahal, B.M.; Fuerhacker, M.; Mentler, A.; Karki, K.B.; Shrestha, R.R.; Blum, W.E.H.

    2008-01-01

    This study monitored the influence of arsenic-contaminated irrigation water on alkaline soils and arsenic uptake in agricultural plants at field level. The arsenic concentrations in irrigation water ranges from -1 where the arsenic concentrations in the soils were measured from 6.1 to 16.7 mg As kg -1 . The arsenic content in different parts of plants are found in the order of roots > shoots > leaves > edible parts. The mean arsenic content of edible plant material (dry weight) were found in the order of onion leaves (0.55 mg As kg -1 ) > onion bulb (0.45 mg As kg -1 ) > cauliflower (0.33 mg As kg -1 ) > rice (0.18 mg As kg -1 ) > brinjal (0.09 mg As kg -1 ) > potato ( -1 ). - The arsenic content in soil and plants is influenced by the degree of arsenic amount in irrigated water

  16. A Quantitative PCR-Electrochemical Genosensor Test for the Screening of Biotech Crops

    Directory of Open Access Journals (Sweden)

    Suely Moura-Melo

    2017-04-01

    Full Text Available The design of screening methods for the detection of genetically modified organisms (GMOs in food would improve the efficiency in their control. We report here a PCR amplification method combined with a sequence-specific electrochemical genosensor for the quantification of a DNA sequence characteristic of the 35S promoter derived from the cauliflower mosaic virus (CaMV. Specifically, we employ a genosensor constructed by chemisorption of a thiolated capture probe and p-aminothiophenol gold surfaces to entrap on the sensing layer the unpurified PCR amplicons, together with a signaling probe labeled with fluorescein. The proposed test allows for the determination of a transgene copy number in both hemizygous (maize MON810 trait and homozygous (soybean GTS40-3-2 transformed plants, and exhibits a limit of quantification of at least 0.25% for both kinds of GMO lines.

  17. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

    2005-01-01

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  18. DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products.

    Science.gov (United States)

    Turkec, Aydin; Kazan, Hande; Karacanli, Burçin; Lucas, Stuart J

    2015-08-01

    In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

  19. Attenuation of Carcinogenesis and the Mechanism Underlying by the Influence of Indole-3-carbinol and Its Metabolite 3,3'-Diindolylmethane: A Therapeutic Marvel.

    Science.gov (United States)

    Maruthanila, V L; Poornima, J; Mirunalini, S

    2014-01-01

    Rising evidence provides credible support towards the potential role of bioactive products derived from cruciferous vegetables such as broccoli, cauliflower, kale, cabbage, brussels sprouts, turnips, kohlrabi, bok choy, and radishes. Many epidemiological studies point out that Brassica vegetable protects humans against cancer since they are rich sources of glucosinolates in addition to possessing a high content of flavonoids, vitamins, and mineral nutrients. Indole-3-carbinol (I3C) belongs to the class of compounds called indole glucosinolate, obtained from cruciferous vegetables, and is well-known for tits anticancer properties. In particular, I3C and its dimeric product, 3,3'-diindolylmethane (DIM), have been generally investigated for their value against a number of human cancers in vitro as well as in vivo. This paper reviews an in-depth study of the anticancer activity and the miscellaneous mechanisms underlying the anticarcinogenicity thereby broadening its therapeutic marvel.

  20. Study of the electroplating mechanism and physicochemical proprieties of deposited Ni-W-Silicate composite alloy

    International Nuclear Information System (INIS)

    Sassi, W.; Dhouibi, L.; Berçot, P.; Rezrazi, M.; Triki, E.

    2014-01-01

    In this work, layers based on Nickel-Tungsten (Ni-W) were electroplated from citrate-ammonia bath with and without silicate addition. Firstly, Electrochemical Quartz Crystal Microbalance (EQCM) and Global Discharge Optical Emission Spectroscopy (GDOES) were used to investigate the electroplating mechanism of both coatings. The gain mass was 14 and 4.13 μg cm −2 for Ni-W-Sil and Ni-W coatings, respectively. Secondly, the morphology of the composite alloy shows a smooth and homogenous surface with compact cauliflower like-structure identified as silicate incorporation. Finally, after a long immersion into chloride solution, Ni-W-Sil composite film showed a good surface stability and a remarkable mechanical hardness. These proprieties enhanced the electrochemical behavior of the composite alloy

  1. Imaging diagnosis of cystitis glandula

    International Nuclear Information System (INIS)

    Tang Yonghua; Xie Ji; Zhou Jianqin; Song Qi; He Guoxiang

    2000-01-01

    Objective: To study the CT diagnostic point of cystitis glandula (CG). Methods: 24 cases of CG proved by pathology were analyzed. Results: 11 cases had hematuria. 22 cases were examined with cysto-copy, with 11 cases presenting cauliflower appearance, 8 cases edema and follicular configuration and 3 cases roughened mucosa. Ultrasound was performed in 18 cases, among with 12 diagnosed as bladder masses. 15 cases had intravenous urography, among them 10 cases were diagnosed as bladder masses and confirmed by CT. 2 had bladder cancer simultaneously. Conclusions: Cystitis glandula is easily mistaken for bladder cancer. It can be proved by pathological examination. CT and IVU examination can detect the lesions. When the bladder wall becomes diffusely thickened but without surrounding invasion, cystitis glandula should be highly suspected

  2. CLINICAL ASPECTS OF TRANSMISSIBLE VENEREAL TUMOR

    Directory of Open Access Journals (Sweden)

    A. C. Sá

    2016-07-01

    Full Text Available The transmissible venereal tumor is among the main diseases that affect domestic animals of the Canidae family. Abandoned animals are the main transmitters of the disease, which is highly contagious; most of the injuries are commonly found on animals genital organs and faces. This is a tumor without any involvement with an infectious agent, tumor cells are transferred from a sick animal to a healthy animal through natural breeding or direct contact of the lesions with other body parts. The disease has no predisposition for breeding, sex and species, therefore possibly affecting all canids although there are more reports on stray animals.The TVT lesions have cauliflower appearance and may be pedunculated, papillary or multilobulated, with hemorrhagic and crumbly aspect. The tumor can have benign or malignant potential, being the second most frequently commonly reported, wherein according to its potential raise the difficulty of the treatment or not.

  3. Quercetin: a versatile flavonoid

    Directory of Open Access Journals (Sweden)

    Dr. Deepak Kumar Rai

    2007-07-01

    Full Text Available Associative evidence from observational and intervention studies in human subjects shows that a diet including plant foods (particularly fruit and vegetables rich in antioxidants conveys health benefits. There is no evidence that any particular nutrient or class of bioactive substances makes a special contribution to these benefits. Flavonoids occur naturally in fruits, vegetables and beverages such as tea and wine. Quercetin is the major flavonoid which belongs to the class called flavonols. Quercetin is found in many common foods including apples, tea, onions, nuts, berries, cauliflower, cabbage and many other foods. Quercetin provides many health promoting benefits, including improvement of cardiovascular health, eye diseases, allergic disorders, arthritis, reducing risk for cancers and many more. The main aim of this review is to obtain a further understanding of the reported beneficial health effects of Quercetin, its pharmacological effects, clinical application and also to evaluate its safety.

  4. Attenuation of Carcinogenesis and the Mechanism Underlying by the Influence of Indole-3-carbinol and Its Metabolite 3,3′-Diindolylmethane: A Therapeutic Marvel

    Directory of Open Access Journals (Sweden)

    V. L. Maruthanila

    2014-01-01

    Full Text Available Rising evidence provides credible support towards the potential role of bioactive products derived from cruciferous vegetables such as broccoli, cauliflower, kale, cabbage, brussels sprouts, turnips, kohlrabi, bok choy, and radishes. Many epidemiological studies point out that Brassica vegetable protects humans against cancer since they are rich sources of glucosinolates in addition to possessing a high content of flavonoids, vitamins, and mineral nutrients. Indole-3-carbinol (I3C belongs to the class of compounds called indole glucosinolate, obtained from cruciferous vegetables, and is well-known for tits anticancer properties. In particular, I3C and its dimeric product, 3,3′-diindolylmethane (DIM, have been generally investigated for their value against a number of human cancers in vitro as well as in vivo. This paper reviews an in-depth study of the anticancer activity and the miscellaneous mechanisms underlying the anticarcinogenicity thereby broadening its therapeutic marvel.

  5. Recent progress in the use of 'omics technologies in brassicaceous vegetables

    Directory of Open Access Journals (Sweden)

    Katja eWitzel

    2015-04-01

    Full Text Available Continuing advances in 'omics methodologies and instrumentation is enhancing the under-standing of how plants cope with the dynamic nature of their growing environment. 'Omics platforms have been only recently extended to cover horticultural crop species. Many of the most widely cultivated vegetable crops belong to the genus Brassica: these include plants grown for their root (turnip, rutabaga/swede, their swollen stem base (kohlrabi, their leaves (cabbage, kale, pak choi and their inflorescence (cauliflower, broccoli.Characterization at the genome, transcript, protein and metabolite levels has illustrated the complexity of the cellular response to a whole series of environmental stresses, including nutrient deficiency, pathogen attack, heavy metal toxicity, cold acclimation, and excessive and sub-optimal irradiation. This review covers recent applications of 'omics technologies to the brassicaceous vegetables, and discusses future scenarios in achieving improvements in crop end-use quality.

  6. Antimicrobial Effect of Extracts of Cruciferous Vegetables

    Directory of Open Access Journals (Sweden)

    Shu-Hui Hu

    2004-12-01

    Full Text Available The cruciferous vegetables cauliflower, broccoli, cabbage, Chinese radish, Chinese kale, and Chinese kitam were used in this study to prepare water-soluble and methanol-water extracts. Crude protein extracts were also obtained by diethylaminoethyl (DEAE anion exchange chromatography. Water-soluble polysaccharides were prepared by ethanol precipitation followed by ultrafiltration. The antimicrobial effects of all these extracts were evaluated against Gram-positive bacteria, Gram-negative bacteria, and yeast. Crude protein extracts exhibited the greatest antimicrobial activity in monoculture experiments. The antimicrobial effects of cruciferous vegetables were also studied by steeping beef, carrot, and celery in chlorine (10 ppm or citric acid solution (1% containing the crude protein extract (500 ppm for different time periods. Total aerobic plate counts and coliform counts on these foods decreased significantly after 10 minutes in all steeping solutions (p < 0.05.

  7. Spectroscopic study of jet-cooled indole-3-carbinol by thermal evaporation

    International Nuclear Information System (INIS)

    Moon, Cheol Joo; Kim, Eun Bin; Min, Ahreum; Ahn, Ahreum; Seong, Yeon Guk; Choi, Myong Yong

    2016-01-01

    Cruciferous vegetables such as cabbage, kale, broccoli, and cauliflower have relatively high levels of indole-3-carbinol (I3C), which can be used as a possible cancer preventative agent particularly for breast, cervical, colorectal, and other hormone-related cancers. Thus, this naturally occurring substance, I3C, is now being used in dietary supplements. In conclusion, we have succeeded in obtaining the R2PI spectrum of a thermally unstable sample, I3C, by using a thermal buffer (herein, uracil) for the first time. Use of thermal evaporation method for thermally unstable biomolecules using thermal buffers will allow us to explore more gas phase spectroscopic studies for their intrinsic physiological properties in the near future

  8. Fractals and foods.

    Science.gov (United States)

    Peleg, M

    1993-01-01

    Fractal geometry and related concepts have had only a very minor impact on food research. The very few reported food applications deal mainly with the characterization of the contours of agglomerated instant coffee particles, the surface morphology of treated starch particles, the microstructure of casein gels viewed as a product limited diffusion aggregation, and the jagged mechanical signatures of crunchy dry foods. Fractal geometry describes objects having morphological features that are scale invariant. A demonstration of the self-similarity of fractal objects can be found in the familiar morphology of cauliflower and broccoli, both foods. Processes regulated by nonlinear dynamics can exhibit a chaotic behavior that has fractal characteristics. Examples are mixing of viscous fluids, turbulence, crystallization, agglomeration, diffusion, and possibly food spoilage.

  9. Facile Fabrication of Durable Copper-Based Superhydrophobic Surfaces via Electrodeposition.

    Science.gov (United States)

    Jain, R; Pitchumani, R

    2018-03-13

    Superhydrophobic surfaces have myriad industrial applications, yet their practical utilization has been limited by their poor mechanical durability and longevity. We present a low-cost, facile process to develop superhydrophobic copper-based coatings via an electrodeposition route, that addresses this limitation. Through electrodeposition, a stable, multiscale, cauliflower shaped fractal morphology was obtained and upon modification by stearic acid, the prepared coatings show extreme water repellency with contact angle of 162 ± 2° and roll-off angle of about 3°. Systematic studies are presented on coatings fabricated under different processing conditions to demonstrate good durability, mechanical and underwater stability, corrosion resistance, and self-cleaning effect. The study also presents an approach for rejuvenation of slippery superhydrophobic nature (roll-off angle <10°) on the surfaces after long-term water immersion. The presented process can be scaled to larger, durable coatings with controllable wettability for diverse applications.

  10. Spectroscopic study of jet-cooled indole-3-carbinol by thermal evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Cheol Joo; Kim, Eun Bin; Min, Ahreum; Ahn, Ahreum; Seong, Yeon Guk; Choi, Myong Yong [Gyeongsang National University, Jinju (Korea, Republic of)

    2016-10-15

    Cruciferous vegetables such as cabbage, kale, broccoli, and cauliflower have relatively high levels of indole-3-carbinol (I3C), which can be used as a possible cancer preventative agent particularly for breast, cervical, colorectal, and other hormone-related cancers. Thus, this naturally occurring substance, I3C, is now being used in dietary supplements. In conclusion, we have succeeded in obtaining the R2PI spectrum of a thermally unstable sample, I3C, by using a thermal buffer (herein, uracil) for the first time. Use of thermal evaporation method for thermally unstable biomolecules using thermal buffers will allow us to explore more gas phase spectroscopic studies for their intrinsic physiological properties in the near future.

  11. Generation of an Infectious Clone of a New Korean Isolate of Apple chlorotic leaf spot virus Driven by Dual 35S and T7 Promoters in a Versatile Binary Vector

    Directory of Open Access Journals (Sweden)

    Ik-Hyun Kim

    2017-12-01

    Full Text Available The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacteriophage T7 RNA promoter and the Cauliflower mosaic virus 35S promoter. Chenopodium quinoa was successfully infected using in vitro transcripts synthesized using the T7 promoter, detected at 20 days post inoculation (dpi, but did not produce obvious symptoms. Nicotiana occidentalis and C. quinoa were inoculated through agroinfiltration. At 32 dpi the infection rate was evaluated; no C. quinoa plants were infected by agroinfiltration, but infection of N. occidentalis was obtained.

  12. Primary oral and nasal transmissible venereal tumor in a mix-breed dog

    Directory of Open Access Journals (Sweden)

    Mahdieh Rezaei

    2016-05-01

    Full Text Available Transmissible venereal tumor (TVT is a coitally transmitted tumor of dogs with widespread distribution. The present study describes the occurrence of the primary oral and nasal TVT in a 10-year-old, female, mix-breed dog. The case was presented with a history of anorexia, inability to swallow and dyspnea. Clinical examinations revealed the emaciation, muzzle deformity due to the presence of a friable, fleshy, cauliflower-like mass in the oral cavity and submandibular lymphadenopathy. TVT was diagnosed based on histopathological findings. The dog was discharged with therapeutic intervention with vincristine. Unfortunately, the case died before readmission because of the progressive worsening of the general condition. Our findings highlight the need for considering TVT for the differential diagnosis of the extragenital masses in dogs.

  13. Mechanical Properties of TiTaHfNbZr High-Entropy Alloy Coatings Deposited on NiTi Shape Memory Alloy Substrates

    Science.gov (United States)

    Motallebzadeh, A.; Yagci, M. B.; Bedir, E.; Aksoy, C. B.; Canadinc, D.

    2018-06-01

    TiTaHfNbZr high-entropy alloy (HEA) thin films with thicknesses of about 750 and 1500 nm were deposited on NiTi substrates by RF magnetron sputtering using TiTaHfNbZr equimolar targets. The thorough experimental analysis on microstructure and mechanical properties of deposited films revealed that the TiTaHfNbZr films exhibited amorphous and cauliflower-like structure, where grain size and surface roughness increased concomitant with film thickness. More importantly, the current findings demonstrate that the TiTaHfNbZr HEA films with mechanical properties of the same order as those of the NiTi substrate constitute promising biomedical coatings effective in preventing Ni release.

  14. Experimental study of different carbon dust growth mechanisms

    International Nuclear Information System (INIS)

    Arnas, C.; Dominique, C.; Roubin, P.; Martin, C.; Laffon, C.; Parent, P.; Brosset, C.; Pegourie, B.

    2005-01-01

    Laboratory experiments are proposed to understand the growth mechanisms of spheroid carbon dust grains observed in Tokamaks with inside wall elements in graphite based materials. Different categories of solid grains in the nanometer size range are produced from graphite sputtering in rare gas plasmas. Dense primary particles are observed either individually or in the form of spherical agglomerates. The agglomeration process is likely to be stopped by Coulomb repulsion. Other particulates of higher size and cauliflower texture are formed by atomic-molecule accretion. Examples of these different cases are presented with specific characteristics provided by ex situ diagnostics. A comparison with dust samples collected in Tore Supra or observed in other Tokamaks is proposed

  15. New insight in magnetic saturation behavior of nickel hierarchical structures

    Science.gov (United States)

    Ma, Ji; Zhang, Jianxing; Liu, Chunting; Chen, Kezheng

    2017-09-01

    It is unanimously accepted that non-ferromagnetic inclusions in a ferromagnetic system will lower down total saturation magnetization in unit of emu/g. In this study, ;lattice strain; was found to be another key factor to have critical impact on magnetic saturation behavior of the system. The lattice strain determined assembling patterns of primary nanoparticles in hierarchical structures and was intimately related with the formation process of these architectures. Therefore, flower-necklace-like and cauliflower-like nickel hierarchical structures were used as prototype systems to evidence the relationship between assembling patterns of primary nanoparticles and magnetic saturation behaviors of these architectures. It was found that the influence of lattice strain on saturation magnetization outperformed that of non-ferromagnetic inclusions in these hierarchical structures. This will enable new insights into fundamental understanding of related magnetic effects.

  16. Effective charge separation in BiOI/Cu2O composites with enhanced photocatalytic activity

    Science.gov (United States)

    Xia, Yongmei; He, Zuming; Yang, Wei; Tang, Bin; Lu, Yalin; Hu, Kejun; Su, Jiangbin; Li, Xiaoping

    2018-02-01

    Novel BiOI/Cu2O composites were designed and synthesized for the first time by coupling reduction method at low temperature. The samples were characterized by XRD, XPS, SEM, EDS, HRTEM, UV-vis (DRS), FTIR and photo-electro-chemical (PEC) analysis. Results showed that the BiOI/Cu2O composites consisted of three-dimensional (3D), hierarchical cauliflower-like structure composed of BiOI nanosheet and Cu2O cubic submicrometer structure, the composite absorption band broadened, and the absorption intensity in the visible region strengthened. And the composites exhibited an excellent photocatalytic performance, which might be attributed to the improvement of the composite absorption and effective charge separation in BiOI/Cu2O composites. In addition, the possible photocatalytic mechanism was proposed.

  17. Stochastic clustering of material surface under high-heat plasma load

    Science.gov (United States)

    Budaev, Viacheslav P.

    2017-11-01

    The results of a study of a surface formed by high-temperature plasma loads on various materials such as tungsten, carbon and stainless steel are presented. High-temperature plasma irradiation leads to an inhomogeneous stochastic clustering of the surface with self-similar granularity - fractality on the scale from nanoscale to macroscales. Cauliflower-like structure of tungsten and carbon materials are formed under high heat plasma load in fusion devices. The statistical characteristics of hierarchical granularity and scale invariance are estimated. They differ qualitatively from the roughness of the ordinary Brownian surface, which is possibly due to the universal mechanisms of stochastic clustering of material surface under the influence of high-temperature plasma.

  18. Molecular and Biological Characterization of an Isolate of Cucumber mosaic virus from Glycine soja by Generating its Infectious Full-genome cDNA Clones

    Directory of Open Access Journals (Sweden)

    Mi Sa Vo Phan

    2014-06-01

    Full Text Available Molecular and biological characteristics of an isolate of Cucumber mosaic virus (CMV from Glycine soja (wild soybean, named as CMV-209, was examined in this study. Comparison of nucleotide sequences and phylogenetic analyses of CMV-209 with the other CMV strains revealed that CMV-209 belonged to CMV subgroup I. However, CMV-209 showed some genetic distance from the CMV strains assigned to subgroup IA or subgroup IB. Infectious full-genome cDNA clones of CMV-209 were generated under the control of the Cauliflower mosaic virus 35S promoter. Infectivity of the CMV-209 clones was evaluated in Nicotiana benthamiana and various legume species. Our assays revealed that CMV-209 could systemically infect Glycine soja (wild soybean and Pisum sativum (pea as well as N. benthamiana, but not the other legume species.

  19. Changes in lipids and in the sensoric properties of foods due to combined preservation (thermosterilization + ionizing radiation)

    International Nuclear Information System (INIS)

    Rajniakova, A.; Sorman, L.; Hozova, B.; Salkova, Z.

    1989-01-01

    Chemical changes in lipids were examined in ''Beef with Cauliflower'' model samples prepared by combined preservation, consisting in thermosterilization at 121 degC for 30 min and exposure to ionizing radiation doses of 3 to 5 kGy immediately after preparation and during storage (115 days at 20±2 degC). The acid, peroxide and carbonyl values increased with increasing radiation dose. The sensoric characteristics of the samples were examined as well, and no changes were observed in the 115 days of storage. Various preservation modes were tested, and the combination of steady sterilization at 121 degC for 30 min with subsequent exposure to a 5 kGy dose emerged as optimal; the nutrition value of the beef was higher and energy demands lower than in the application of conventional thermosterilization. (author). 6 figs., 3 tabs., 10 refs

  20. A sensitive radioimmunosorbent assay for the detection of plant viruses

    International Nuclear Information System (INIS)

    Ghabrial, S.A.; Shepherd, R.J.

    1980-01-01

    A simple and highly sensitive radioimmunosorbent assay (RISA) for the detection of plant viruses is described. The RISA procedure is a microplate method based on the principle of 'double-antibody sandwich' and follows essentially the protocol of the enzyme-linked immunosorbent assay (ELISA) (Clark and Adams, 1977), with the exception that 125 I-labelled γ-globulin is substituted for the γ-globulin enzyme conjugate; the bound 125 I-γ-globulin is dissociated by acidification from the double-antibody sandwich. The radioactivity is proportional to virus concentration, and cauliflower mosaic virus (CaMV) and lettuce mosaic virus (LMV) could be detected at concentrations as low as 5 and 2 ng/ml, respectively. Direct evidence of the adverse effects of conjugation with enzyme on the binding abilities of antibodies is presented. The RISA procedure should prove valuable with viruses for which the ELISA values are too low to be dependable. (author)

  1. Giant condyloma acuminatum of vulva

    Directory of Open Access Journals (Sweden)

    S. M. Ramiz Ahmed

    2017-09-01

    Full Text Available In this paper, A 23 year old married woman who was diagnosed as a case of giant condyloma acuminatum of vulva measuring about 15 x 8 x 3 cm, irregular surface with multiple projections, oval in shape, firm to hard in consistency, mildly tender, exophytic, cauliflower like growth involving the whole vulva (lower part of mons pubis, labia, vestibule, clitoris, around vaginal opening. Another multiple small lesions were present at perineal region but there was no inguinal lymphadenopathy. She underwent a combined electro cauterization and cryotherapy for small to moderate size multiple primary and recurrent warty lesions and wide surgical excision with fasciocutaneous advancement flaps procedure for a giant lesions in the vulva. Excisional biopsies were performed to detect potential malignancy but malignancy was not found histologically. The patient was advised to first follow-up 1 month after operation when multiple small warty lesions were developed and treated and the subsequent follow-ups for 3 months.

  2. Wear resistance of nano- and micro-crystalline diamond coatings onto WC-Co with Cr/CrN interlayers

    Energy Technology Data Exchange (ETDEWEB)

    Polini, Riccardo [Dipartimento di Scienze e Tecnologie Chimiche, Universita di Roma Tor Vergata, Via della Ricerca Scientifica, 1, Rome, 00133 (Italy); Barletta, Massimiliano, E-mail: barletta@ing.uniroma2.i [Dipartimento di Ingegneria Meccanica, Universita di Roma Tor Vergata, Via del Politecnico, 1, Rome, 00133 (Italy); Cristofanilli, Giacomo [Dipartimento di Scienze e Tecnologie Chimiche, Universita di Roma Tor Vergata, Via della Ricerca Scientifica, 1, Rome, 00133 (Italy)

    2010-12-30

    Cr/CrN bi-layers have been used recently to promote the growth of high quality Hot Filament Chemical Vapour Deposition (HFCVD) diamond coatings onto Co-cemented tungsten carbide (WC-6 wt.%Co) substrates. In the present investigation, the influence of the crystalline size of the diamond coatings on their wear endurance is looked into. Nano- (NDC) and micro-crystalline Diamond Coatings (MDC) were deposited by HFCVD onto untreated and Fluidized Bed (FB) treated Cr/CrN interlayers. NDCs, characterized by a cauliflower-like morphology, showed improved wear resistance. However, the superimposition of NDCs onto Cr/CrN interlayers micro-corrugated by FB treatment was found to be the most promising choice, leading to the formation of highly adherent and wear resistant coatings.

  3. Morphological features of electrodeposited Pt nanoparticles and its application as anode catalysts in polymer electrolyte formic acid fuel cells

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Hongrae; Joo, Jiyong; Kwon, Youngkook [Electrochemical Reaction and Technology Laboratory (ERTL), Department of Environmental Science and Engineering, GIST, Gwangju 500-712 (Korea); Uhm, Sunghyun [Ertl Center for Electrochemistry and Catalysis, GIST, Gwangju 500-712 (Korea); Lee, Jaeyoung [Electrochemical Reaction and Technology Laboratory (ERTL), Department of Environmental Science and Engineering, GIST, Gwangju 500-712 (Korea); Ertl Center for Electrochemistry and Catalysis, GIST, Gwangju 500-712 (Korea)

    2010-09-15

    Electrodeposited Pt nanoparticles on carbon substrate show various morphologies depending on the applied potentials. Dendritic, pyramidal, cauliflower-like, and hemi-spherical morphologies of Pt are formed at potential ranges between -0.2 and 0.3 V (vs. Ag/AgCl) and its particle sizes are distributed from 8 to 26 nm. Dendritic bulky particles over 20 nm are formed at an applied potential of -0.2 V, while low deposition potential of 0.2 V causes dense hemi-spherical structure of Pt less than 10 nm. The influence of different Pt shapes on an electrocatalytic oxidation of formic acid is represented. Consequently, homogeneous distribution of Pt nanoparticles with average particle of ca. 14 nm on carbon paper results in a high surface to volume ratio and the better power performance in a fuel cell application. (author)

  4. Electrochemical deposition of gold-platinum alloy nanoparticles on an indium tin oxide electrode and their electrocatalytic applications

    Energy Technology Data Exchange (ETDEWEB)

    Song Yan; Ma Yuting; Wang Yuan [Department of Chemistry, Soochow University, Suzhou, Jiangsu 215123 (China); Di Junwei, E-mail: djw@suda.edu.c [Department of Chemistry, Soochow University, Suzhou, Jiangsu 215123 (China); Tu Yifeng [Department of Chemistry, Soochow University, Suzhou, Jiangsu 215123 (China)

    2010-07-01

    Gold-platinum (Au-Pt) hybrid nanoparticles (Au-PtNPs) were successfully deposited on an indium tin oxide (ITO) surface using a direct electrochemical method. The resulting nanoparticles were characterized by scanning electron microscopy (SEM), UV-vis spectroscopy, X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDX), and electrochemical methods. It was found that the size of the Au-PtNPs depends on the number of electrodeposition cycles. Au-PtNPs obtained by 20 electrodeposition cycles had a cauliflower-shaped structure with an average diameter of about 60 nm. These Au-PtNPs exhibited alloy properties. Electrochemical measurements showed that the charge transfer resistivity was significantly decreased for the Au-PtNPs/ITO electrode. Additionally, the Au-PtNPs displayed an electrocatalytic activity for nitrite oxidation and oxygen reduction. The Au-PtNPs/ITO electrodes reported herein could possibly be used as electrocatalysts and sensors.

  5. {sup 18}F-FDG-Avid Adenocarcinoma of the Rectum Presenting as a Subtle Filling Defect on Maximum Intensity Projection Image: Report of a Case

    Energy Technology Data Exchange (ETDEWEB)

    Bahk, Yong Whee; Lee, Kwang Chan [SungAe General Hospital, Seoul (Korea, Republic of)

    2009-04-15

    {sup 18}F-FDG avid polypoid or tumefacient carcinomas of the gastrointestinal (GI) tract including the rectum are characteristically featured on PET-CT as an intraluminal tumor surrounded by completely or partially cleared background. However, the carcinomas of intramural or sessile variant may not so easily be detected especially when tumors are obliterated by feces or mucus retained in the host bowel loop. Recently, we observed a case of cauliflower-like adenocarcinoma of the rectum that was diagnosed by noting a subtle, flat filling defect created against the background of 'black' feces-mucus filled rectum. To our knowledge such a 'filling defect' produced by sessile tumor has not previously been reported as a useful diagnostic sign of GI tract carcinoma on PET-CT.

  6. Reactivation of Cutaneous Leishmaniasis after Renal Transplantation: A Case Report

    Directory of Open Access Journals (Sweden)

    Hossein Mortazavi

    2014-01-01

    Full Text Available A 45-year-old man with reactivation of previously existing and subsiding cutaneous leishmaniasis on his wrist and lower leg (shin after renal transplantation was admitted to our dermatology service on March 2008. He presented to us with two huge tumoral and cauliflower-like lesions. Skin smear and histopathology of skin showed leishman bodies and confirmed the diagnosis. After renal transplantation, he received cyclosporine plus prednisolone to induce immunosuppression and reduce the probability of transplant rejection. After immunosuppressive therapy, reactivation of cutaneous leishmaniasis with the above presentation took place. The patient responded to 800 mg/day intravenous sodium stibogluconate for 3 weeks plus local cryotherapy. Systemic plus local therapy along with reducing the doses of immunosuppressive drugs led to improvement of lesions. Reactivation of leishmaniasis after immunosuppression has been rarely reported.

  7. Nanocrystalline diamond film as cathode for gas discharge sensors

    Energy Technology Data Exchange (ETDEWEB)

    Jou, Shyankay, E-mail: sjou@mail.ntust.edu.t [Graduate Institute of Materials Science and Technology, National Taiwan University of Science and Technology, Taipei 106, Taiwan (China); Huang, Bohr-Ran [Graduate Institute of Electro-Optical Engineering and Department of Electronic Engineering, National Taiwan University of Science and Technology, Taipei 106, Taiwan (China); Wu, Meng-Chang [Department of Electronic Engineering, National Yunlin University of Science and Technology, Touliu 640, Taiwan (China)

    2010-05-31

    Nanocrystalline diamond (NCD) film was deposited on a silicon substrate utilizing microwave plasma-enhanced chemical vapor deposition in a mixed flow of methane, hydrogen and argon. The deposited film had a cauliflower-like morphology, and was composed of NCD, carbon clusters and mixed sp{sup 2}- and sp{sup 3}-bonded carbon. Electron field emission (EFE) in vacuum and electrical discharges in Ar, N{sub 2} and O{sub 2} using the NCD film as the cathode were characterized. The turn-on field for EFE and the geometric enhancement factor for the NCD film were 8.5 V/{mu}m and 668, respectively. The breakdown voltages for Ar, N{sub 2} and O{sub 2} increased with pressures from 1.33 x 10{sup 4} Pa to 1.01 x 10{sup 5} Pa, following the right side of the normal Paschen curve.

  8. Tumoral calcinosis in a dog with chronic renal failure : clinical communication

    Directory of Open Access Journals (Sweden)

    T.C. Spotswood

    2003-06-01

    Full Text Available A 2-year-old male German shepherd dog in poor bodily condition was evaluated for thoracic limb lameness due to a large, firm mass medial to the left cranial scapula. Radiography revealed several large cauliflower-like mineralized masses in the craniomedial left scapula musculature, pectoral region and bilaterally in the biceps tendon sheaths. Urinalysis, haematology and serum biochemistry showed that the dog was severely anaemic, hyperphosphataemic and in chronic renal failure. The dog was euthanased and a full post mortem performed. A diagnosis of chronic renal failure with secondary hyperparathyroidism was confirmed. The mineralized masses were grossly and histopathologically consistent with a diagnosis of tumoral calcinosis. Tumoral calcinosis associated with chronic renal failure that does not involve the foot pads is rarely seen.

  9. Chemical vapor deposition of hexagonal boron nitride films in the reduced pressure

    International Nuclear Information System (INIS)

    Choi, B.J.

    1999-01-01

    Hexagonal boron nitride (h-BN) films were deposited onto a graphite substrate in reduced pressure by reacting ammonia and boron tribromide at 800--1,200 C. The growth rate of h-BN films was dependent on the substrate temperature and the total pressures. The growth rate increased with increasing the substrate temperature at the pressure of 2 kPa, while it showed a maximum value at the pressures of 4 and 8 kPa. The temperature at which the maximum growth rate occurs decreased with increasing total pressure. With increasing the substrate temperature and total pressure, the apparent grain size increased and the surface morphology showed a rough, cauliflower-like structure

  10. Tumoral calcinosis in a dog with chronic renal failure

    International Nuclear Information System (INIS)

    Spotswood, T.C.

    2003-01-01

    A 2-year-old male German shepherd dog in poor bodily condition was evaluated for thoracic limb lameness due to a large, firm mass medial to the left cranial scapula. Radiography revealed several large cauliflower-like mineralized masses in the craniomedial left scapula musculature, pectoral region and bilaterally in the biceps tendon sheaths. Urinalysis, haematology and serum biochemistry showed that the dog was severely anaemic, hyperphosphataemic and in chronic renal failure. The dog was euthanased and a full post mortem performed. A diagnosis of chronic renal failure with secondary hyperparathyroidism was confirmed. The mineralised masses were grossly and histopathologically consistent with a diagnosis of tumoral calcinosis. Tumoral calcinosis associated with chronic renal failure that does not involve the foot pads is rarely seen

  11. Barley HvPAPhy_a as transgene provides high and stable phytase activities in mature barley straw and in grains

    DEFF Research Database (Denmark)

    Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh

    2017-01-01

    The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains......, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...... activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature...

  12. Influence of High-Pressure Processing on the Profile of Polyglutamyl 5-Methyltetrahydrofolate in Selected Vegetables

    Science.gov (United States)

    Wang, Chao; Riedl, Ken M.; Somerville, Jeremy; Balasubramaniam, V. M.; Schwartz, Steven J.

    2013-01-01

    In plants, folate occurs predominantly as 5-methyltetrahydrofolate (5MTHF) polyglutamyl forms. Differences in stability and bioavailability of food folate compared to synthetic folic acid have been attributed to the presence of the polyglutamyl chain. High-pressure processing (HPP) was tested for whether it might shorten polyglutamyl chains of 5MTHF species in fresh vegetables by enabling action of native γ-glutamylhydrolase (GGH). A validated ultrahigh-performance reversed-phase liquid chromatography–tandem mass spectrometry method using stable isotope as internal standard was applied for characterizing 5MTHF polyglutamyl profiles. HPP conditions included 300, 450, and 600 MPa at 30 °C for 0 or 5 min, and vegetables were vacuum-packed before treatment. Investigated vegetables included cauliflower (Brassica oleracea), baby carrots (Daucus carota), and carrot greens (D. carota). HPP treatment caused conversion of polyglutamyl 5MTHF species to short-chain and monoglutamyl forms. Maximal conversion of polyglutamyl folate to monoglutamyl folate occurred at the highest pressure/time combination investigated, 600 MPa/30 °C/5 min. Under this condition, cauliflower monoglutamyl folate increased nearly 4-fold, diglutamyl folate 32-fold, and triglutamyl folate 8-fold; carrot monoglutamyl increased 23-fold and diglutamyl 32-fold; and carrot greens monoglutamyl increased 2.5-fold and the diglutamyl form 19-fold. Although some folate degradation was observed at certain intermediate HPP conditions, total 5MTHF folate was largely preserved at 600 MPa/5 min. Thus, HPP of raw vegetables is a feasible strategy for enhancing vegetable monoglutamate 5MTHF. PMID:21770413

  13. Direct plantlet inoculation with soil or insect-associated fungi may control cabbage root fly maggots.

    Science.gov (United States)

    Razinger, Jaka; Lutz, Matthias; Schroers, Hans-Josef; Palmisano, Marilena; Wohler, Christian; Urek, Gregor; Grunder, Jürg

    2014-07-01

    A potential Delia radicum biological control strategy involving cauliflower plantlet inoculation with various fungi was investigated in a series of laboratory and glasshouse experiments. In addition to entomopathogenic fungi, fungi with a high rhizosphere competence and fungi with the ability to survive as saprotrophs in soil were tested. The following fungal species were evaluated in the experiments: Trichoderma atroviride, T. koningiopsis, T. gamsii, Beauveria bassiana, Metharhizium anisopliae, M. brunneum and Clonostachys solani. A commercial carbosulfan-based insecticide was used as a positive control. Additionally, two commercial products, one based on B. bassiana (Naturalis) and one on Bacillus thuringiensis (Delfin) were used as reference biocontrol agents. The aims were (i) to assess the pathogenicity of the selected fungal isolates to Delia radicum, (ii) to evaluate the fungal isolates' rhizosphere competence, with the emphasis on the persistence of the original inoculum on the growing roots, (iii) to assess possible endophytic plant tissue colonization, and (iv) to evaluate potential plant growth stimulating effects of the added inoculi. Significant pathogenicity of tested fungi against Delia radicum was confirmed in in vitro and glasshouse experiments. All tested fungi persisted on cauliflower rhizoplane. More importantly, the added fungi were found on thoroughly washed roots outside the original point of inoculation. This provided us with evidence that our tested fungi could be transferred via or grow with the elongating roots. In addition to colonizing the rhizoplane, some fungi were found inside the plant root or stem tissue, thus exhibiting endophytic characteristics. The importance of fungal ecology as a criterion in appropriate biological control agent selection is discussed. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Broccoli sprouts: An exceptionally rich source of inducers of enzymes that protect against chemical carcinogens

    Science.gov (United States)

    Fahey, Jed W.; Zhang, Yuesheng; Talalay, Paul

    1997-01-01

    Induction of phase 2 detoxication enzymes [e.g., glutathione transferases, epoxide hydrolase, NAD(P)H: quinone reductase, and glucuronosyltransferases] is a powerful strategy for achieving protection against carcinogenesis, mutagenesis, and other forms of toxicity of electrophiles and reactive forms of oxygen. Since consumption of large quantities of fruit and vegetables is associated with a striking reduction in the risk of developing a variety of malignancies, it is of interest that a number of edible plants contain substantial quantities of compounds that regulate mammalian enzymes of xenobiotic metabolism. Thus, edible plants belonging to the family Cruciferae and genus Brassica (e.g., broccoli and cauliflower) contain substantial quantities of isothiocyanates (mostly in the form of their glucosinolate precursors) some of which (e.g., sulforaphane or 4-methylsulfinylbutyl isothiocyanate) are very potent inducers of phase 2 enzymes. Unexpectedly, 3-day-old sprouts of cultivars of certain crucifers including broccoli and cauliflower contain 10–100 times higher levels of glucoraphanin (the glucosinolate of sulforaphane) than do the corresponding mature plants. Glucosinolates and isothiocyanates can be efficiently extracted from plants, without hydrolysis of glucosinolates by myrosinase, by homogenization in a mixture of equal volumes of dimethyl sulfoxide, dimethylformamide, and acetonitrile at −50°C. Extracts of 3-day-old broccoli sprouts (containing either glucoraphanin or sulforaphane as the principal enzyme inducer) were highly effective in reducing the incidence, multiplicity, and rate of development of mammary tumors in dimethylbenz(a)anthracene-treated rats. Notably, sprouts of many broccoli cultivars contain negligible quantities of indole glucosinolates, which predominate in the mature vegetable and may give rise to degradation products (e.g., indole-3-carbinol) that can enhance tumorigenesis. Hence, small quantities of crucifer sprouts may protect

  15. Production of biogas from plant materials

    Energy Technology Data Exchange (ETDEWEB)

    Zuer, J.

    1980-12-01

    Different crop residues from agriculture and horticulture were investigated for feasibility of producing biogas. The anaerobic fermentation has been performed in batch system fermentation reactors (5 liters) at mesophilic conditions (35 degrees C). Content of volatile solids (VS/TS) in raw materials varied from 78.5 percent in silage from top of sugar beet to 97.3 percent in straw of rye. The highest content of lignin was found in stalks of Jerusalem artichoke (49.6 percent), stalks of horse bean (47.6 percent) and the lowest in leaves of cauliflower (9.5 percent), top of sugar beet and leaves of cabbage (11 percent) in both. Ratio of carbon to nitrogen was the highest in the straw of rye (60) and the lowest in silage from top of sugar beet (11) and in leaves of cauliflower (11). Rate of biogas production during the first 13 days of fermentation was about 27 liters per kg TS per day, achieved from top of sugar beet. Typical mean rate of biogas production, about 9 liters per kg TS per day, was performed during the first 40 days of retention time from straw of wheat and stalks of rape. Top of sugar beet and manure slurry have had the shortest effective retention time ca 20 days. Maximum total yield of biogas (427.0 liters per kg TS) was achieved from top of sugar beet. From manure slurry 257.5 liters biogas per kg TS was obtained. Methane content in biogas produced during the final 7 days of retention time was the highest from silage from top of artichoke (72.8 percent), stalks of horse bean (71.6 percent) and straw of wheat (71.0 percent). The lowest percentage of methane (59.0 percent) was found in biogas from top of sugar beet.

  16. Proteomic analysis of chromoplasts from six crop species reveals insights into chromoplast function and development.

    Science.gov (United States)

    Wang, Yong-Qiang; Yang, Yong; Fei, Zhangjun; Yuan, Hui; Fish, Tara; Thannhauser, Theodore W; Mazourek, Michael; Kochian, Leon V; Wang, Xiaowu; Li, Li

    2013-02-01

    Chromoplasts are unique plastids that accumulate massive amounts of carotenoids. To gain a general and comparative characterization of chromoplast proteins, this study performed proteomic analysis of chromoplasts from six carotenoid-rich crops: watermelon, tomato, carrot, orange cauliflower, red papaya, and red bell pepper. Stromal and membrane proteins of chromoplasts were separated by 1D gel electrophoresis and analysed using nLC-MS/MS. A total of 953-2262 proteins from chromoplasts of different crop species were identified. Approximately 60% of the identified proteins were predicted to be plastid localized. Functional classification using MapMan bins revealed large numbers of proteins involved in protein metabolism, transport, amino acid metabolism, lipid metabolism, and redox in chromoplasts from all six species. Seventeen core carotenoid metabolic enzymes were identified. Phytoene synthase, phytoene desaturase, ζ-carotene desaturase, 9-cis-epoxycarotenoid dioxygenase, and carotenoid cleavage dioxygenase 1 were found in almost all crops, suggesting relative abundance of them among the carotenoid pathway enzymes. Chromoplasts from different crops contained abundant amounts of ATP synthase and adenine nucleotide translocator, which indicates an important role of ATP production and transport in chromoplast development. Distinctive abundant proteins were observed in chromoplast from different crops, including capsanthin/capsorubin synthase and fibrillins in pepper, superoxide dismutase in watermelon, carrot, and cauliflower, and glutathione-S-transferease in papaya. The comparative analysis of chromoplast proteins among six crop species offers new insights into the general metabolism and function of chromoplasts as well as the uniqueness of chromoplasts in specific crop species. This work provides reference datasets for future experimental study of chromoplast biogenesis, development, and regulation in plants.

  17. Facile one step synthesis of novel TiO2 nanocoral by sol-gel method using Aloe vera plant extract

    Science.gov (United States)

    Venkatesh, K. S.; Krishnamoorthi, S. R.; Palani, N. S.; Thirumal, V.; Jose, Sujin P.; Wang, Fu-Ming; Ilangovan, R.

    2015-05-01

    Titanium oxide (TiO2) nanoparticles (NPs) were synthesized by sol gel method using Aloe vera plant extract as a biological capping agent and a cauliflower-nanocoral morphology was observed in this technique. The assynthesized TiO2 nanopowder was calcined at a range of temperatures (300-600 °C) for 1 h. The influence of A. vera plant extract on the thermal, structural and morphological properties of TiO2 nanopowder was evaluated. Thermogravimetric analysis/differential thermal analysis was employed to study the thermal properties of the assynthesized TiO2 nanopowder. The crystallinity, phase transformation and the crystallite size of the calcined samples were studied by X-ray diffraction technique. XRD result confirmed the presence of TiO2 with anatase phase. FT Raman spectra showed the Raman active modes pertaining to the TiO2 anatase phase and Raman band shift was also observed with respect to particle size variation. The different functional group vibrations of as dried pure A. vera plant extract were compared with the mixture of TiO2 and A. vera plant extract by FT-IR analysis. The scanning electron microscopy images apparently showed the formation of spherical shaped NPs and also it demonstrated the effect of A. vera plant extract on the reduction of particles size. The surface area of the TiO2 NPs was measured through Brunauer-Emmett-Teller analysis. Transmission electron microscopy images ascertained that the spherical shaped TiO2 NPs were formed with cauliflower-nanocoral morphology decorated with nanopolyps with the size range between 15 and 30 nm.

  18. Effect of gamma irradiation on the microbiological and organoleptic quality of ready prepared chilled meals

    Energy Technology Data Exchange (ETDEWEB)

    Patterson, M F; Stevenson, M H; Grant, I R; McAteer, N J; Stewart, E M [Department of Food Science, Queen` s University of Belfast, Belfast (Ireland)

    1999-12-31

    The sensitivity of five food borne pathogens (Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Bacillus cereus and Clostridium perfringens) to irradiation in the components of a roast beef meal (beef, gravy, cauliflower with white sauce, roast potatoes and mashed potatoes) was compared. The D{sub 10} values ranged from 0.17 to 0.65 kGy, depending on the organism and plating medium. When irradiated in gravy, the pathogens generally had lower D{sub 10} values than in any of the other four components. In a subsequent study, the effect of irradiation (2 and 3 kGy) on the microbiological and sensory quality of the roast beef meals was assessed at intervals during 15 days of storage at 2-3 deg. C. A dose of 2 kGy was beneficial in improving the microbial quality of the meals, but sensory profiling techniques, using a trained panel of assessors, showed that there were significant differences between the non-irradiated and irradiated meal components during storage. The changes were most apparent in the cauliflower and potato components, and most often occurred in the colour, appearance and textural attributes tested. As these changes could have a limiting effect on the shelf-life of the meals, the suitability of other vegetables for inclusion in such irradiated meals was investigated. Irradiation and chilled storage of carrots and broccoli did not significantly affect the sensory quality when compared with the non-irradiated controls. A consumer trial of the roast beef meal (beef, gravy, roast potatoes, broccoli and carrots) found that irradiation (2 kGy) did not significantly affect the sensory quality. It was concluded that irradiation could be used to improve the microbiological safety and shelf-life of certain chilled meals without significantly affecting the organoleptic quality. (author) 16 refs, 2 figs, 9 tabs

  19. Chemical Composition and Antioxidant Activity in Different Tissues of Brassica Vegetables

    Directory of Open Access Journals (Sweden)

    Shiva Ram Bhandari

    2015-01-01

    Full Text Available This research was conducted to evaluate glucosinolate profiles, vitamin C, total phenol, total flavonoid, and free sugar (glucose, fructose, and sucrose content, fatty acid composition, and antioxidant activity in floret and leaf of six cauliflower and broccoli cultivars. The level of chemical constituents as well as antioxidants significantly varied among crop types, cultivars, and their different parts, in that phytochemicals such as glucosinolate were statistically higher in florets compared with leaves in both broccoli and cauliflower cultivars. In contrast, total flavonoid and free sugar were found at higher levels in the leaf parts. The Asia purple cultivar exhibited statistically higher vitamin C (649.7 mg·100 g−1, total phenol (1345.2 mg·GAE 100 g−1, and total flavonoid (632.7 mg·CE 100 g−1 contents and consequently had the highest antioxidant activity (1.12 mg·mL−1 in its florets, while Baeridom and Bridal had the highest total glucosinolate (9.66 µmol·g−1 and free sugar (318.6 mg·g−1 contents, respectively compared with other cultivars. Likewise, the major fatty acids were palmitic (23.52%–38.42%, linoleic (13.09%–18.97%, and linolenic (26.32%–51.80% acids, which comprised the highest compositional ratio (more than 50% of polyunsaturated fatty acids (PUFAs in most cultivars. Among the antioxidants, total phenol exhibited the most significant positive correlation (r = 0.698 ** with antioxidant activity, followed by vitamin C (r = 0.522 ** and total flavonoid (r = 0.494 **, indicating their significant contributions to total antioxidant activity.

  20. Effect of gamma irradiation on the microbiological and organoleptic quality of ready prepared chilled meals

    International Nuclear Information System (INIS)

    Patterson, M.F.; Stevenson, M.H.; Grant, I.R.; McAteer, N.J.; Stewart, E.M.

    1998-01-01

    The sensitivity of five food borne pathogens (Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Bacillus cereus and Clostridium perfringens) to irradiation in the components of a roast beef meal (beef, gravy, cauliflower with white sauce, roast potatoes and mashed potatoes) was compared. The D 10 values ranged from 0.17 to 0.65 kGy, depending on the organism and plating medium. When irradiated in gravy, the pathogens generally had lower D 10 values than in any of the other four components. In a subsequent study, the effect of irradiation (2 and 3 kGy) on the microbiological and sensory quality of the roast beef meals was assessed at intervals during 15 days of storage at 2-3 deg. C. A dose of 2 kGy was beneficial in improving the microbial quality of the meals, but sensory profiling techniques, using a trained panel of assessors, showed that there were significant differences between the non-irradiated and irradiated meal components during storage. The changes were most apparent in the cauliflower and potato components, and most often occurred in the colour, appearance and textural attributes tested. As these changes could have a limiting effect on the shelf-life of the meals, the suitability of other vegetables for inclusion in such irradiated meals was investigated. Irradiation and chilled storage of carrots and broccoli did not significantly affect the sensory quality when compared with the non-irradiated controls. A consumer trial of the roast beef meal (beef, gravy, roast potatoes, broccoli and carrots) found that irradiation (2 kGy) did not significantly affect the sensory quality. It was concluded that irradiation could be used to improve the microbiological safety and shelf-life of certain chilled meals without significantly affecting the organoleptic quality. (author)

  1. Effect of spray volume on the deposition, viability and infectivity of entomopathogenic nematodes in a foliar spray on vegetables.

    Science.gov (United States)

    Brusselman, Eva; Beck, Bert; Pollet, Sabien; Temmerman, Femke; Spanoghe, Pieter; Moens, Maurice; Nuyttens, David

    2012-10-01

    Spray volume can influence the amount of free water on the leaf surface and subsequently the ability of entomopathogenic nematodes (EPNs) to move. In this study, an investigation was made of the effect of spray volume (548, 730 and 1095 L ha(-1) ) on the deposition, viability and infectivity of EPNs against Galleria mellonella on savoy cabbage, cauliflower and leek. Increasing spray volume decreased nematode deposition on 7.1 cm2 leek leaf discs at a 15° angle with the spray nozzle. Although the number of living nematodes observed on leek after 240 min of exposure was not significantly different between the low-volume application (548 L ha(-1) ) and the high-volume application (1095 L ha(-1) ), a greater infectivity was obtained in the latter application. The higher number of droplets deposited on the leek discs in the high-volume application may have stimulated nematode movement. No significant effect of spray volume was observed on the relative deposition of Steinernema carpocapsae on the bottom side of cauliflower and savoy cabbage leaf discs. In spite of the low S. carpocapsae deposition on the bottom side of the savoy cabbage discs, high infectivity was obtained against G. mellonella. Using the lowest spray volume on savoy cabbage, infectivity decreased with increasing exposure time, while infectivity was not affected by exposure time when a spray volume of 730 L ha(-1) or more was used. Spray volume is an important application parameter, as it affects nematode infectivity. Future research should investigate the effect of spray volume in the field and its influence on the effect of adjuvants. Copyright © 2012 Society of Chemical Industry.

  2. Structural and optical properties of Co-doped ZnO nanocrystallites prepared by a one-step solution route

    International Nuclear Information System (INIS)

    Li Ping; Wang Sha; Li Jibiao; Wei Yu

    2012-01-01

    Zinc oxide (ZnO) nanocrystallites with different Co-doping levels were successfully synthesized by a simple one-step solution route at low temperature (95 deg. C) in this study. The structure and morphology of the samples thus obtained were characterized by XRD, EDS, XPS and FESEM. Results show that cobalt ions, in the oxidation state of Co 2+ , replace Zn 2+ ions in the ZnO lattice without changing its wurtzite structure. The dopant content varies from 0.59% to 5.39%, based on Co-doping levels. The pure ZnO particles exhibit well-defined 3D flower-like morphology with an average size of 550 nm, while the particles obtained after Co-doping are mostly cauliflower-like nanoclusters with an average size of 120 nm. Both the flower-like pure ZnO and the cauliflower-like Co:ZnO nanoclusters are composed of densely arrayed nanorods. The optical properties of the ZnO nanocrystallites following Co-doping were also investigated by UV-Visible absorption and Photoluminescence spectra. Our results indicate that Co-doping can change the energy-band structure and effectively adjust the luminescence properties of ZnO nanocrystallites. - Highlights: → Co-doped ZnO nanocrystallites were synthesized via a simple one-step solution route. → Co 2+ ions incorporated into the ZnO lattice without changing its wurtzite structure. → Co-doping changed the energy band structure of ZnO. → Co-doping effectively adjusted the luminescence properties of ZnO nanocrystallites.

  3. Structural and optical properties of Co-doped ZnO nanocrystallites prepared by a one-step solution route

    Energy Technology Data Exchange (ETDEWEB)

    Li Ping, E-mail: lipingchina@yahoo.com.cn [Provincial Key Laboratory of Inorganic Nanomaterials, School of Chemistry and Materials Science, Hebei Normal University, 113 Yuhua Road, Shijiazhuang 050016, Hebei (China); Wang Sha; Li Jibiao; Wei Yu [Provincial Key Laboratory of Inorganic Nanomaterials, School of Chemistry and Materials Science, Hebei Normal University, 113 Yuhua Road, Shijiazhuang 050016, Hebei (China)

    2012-01-15

    Zinc oxide (ZnO) nanocrystallites with different Co-doping levels were successfully synthesized by a simple one-step solution route at low temperature (95 deg. C) in this study. The structure and morphology of the samples thus obtained were characterized by XRD, EDS, XPS and FESEM. Results show that cobalt ions, in the oxidation state of Co{sup 2+}, replace Zn{sup 2+} ions in the ZnO lattice without changing its wurtzite structure. The dopant content varies from 0.59% to 5.39%, based on Co-doping levels. The pure ZnO particles exhibit well-defined 3D flower-like morphology with an average size of 550 nm, while the particles obtained after Co-doping are mostly cauliflower-like nanoclusters with an average size of 120 nm. Both the flower-like pure ZnO and the cauliflower-like Co:ZnO nanoclusters are composed of densely arrayed nanorods. The optical properties of the ZnO nanocrystallites following Co-doping were also investigated by UV-Visible absorption and Photoluminescence spectra. Our results indicate that Co-doping can change the energy-band structure and effectively adjust the luminescence properties of ZnO nanocrystallites. - Highlights: > Co-doped ZnO nanocrystallites were synthesized via a simple one-step solution route. > Co{sup 2+} ions incorporated into the ZnO lattice without changing its wurtzite structure. > Co-doping changed the energy band structure of ZnO. > Co-doping effectively adjusted the luminescence properties of ZnO nanocrystallites.

  4. Left atrial appendage morphology in patients with suspected cardiogenic stroke without known atrial fibrillation.

    Directory of Open Access Journals (Sweden)

    Miika Korhonen

    Full Text Available The left atrial appendage (LAA is the typical origin for intracardiac thrombus formation. Whether LAA morphology is associated with increased stroke/TIA risk is controversial and, if it does, which morphological type most predisposes to thrombus formation. We assessed LAA morphology in stroke patients with cryptogenic or suspected cardiogenic etiology and in age- and gender-matched healthy controls. LAA morphology and volume were analyzed by cardiac computed tomography in 111 patients (74 males; mean age 60 ± 11 years with acute ischemic stroke of cryptogenic or suspected cardiogenic etiology other than known atrial fibrillation (AF. A subgroup of 40 patients was compared to an age- and gender-matched control group of 40 healthy individuals (21 males in each; mean age 54 ± 9 years. LAA was classified into four morphology types (Cactus, ChickenWing, WindSock, CauliFlower modified with a quantitative qualifier. The proportions of LAA morphology types in the main stroke group, matched stroke subgroup, and control group were as follows: Cactus (9.0%, 5.0%, 20.0%, ChickenWing (23.4%, 37.5%, 10.0%, WindSock (47.7%, 35.0%, 67.5%, and CauliFlower (19.8%, 22.5%, 2.5%. The distribution of morphology types differed significantly (P<0.001 between the matched stroke subgroup and control group. The proportion of single-lobed LAA was significantly higher (P<0.001 in the matched stroke subgroup (55% than the control group (6%. LAA volumes were significantly larger (P<0.001 in both stroke study groups compared to controls patients. To conclude, LAA morphology differed significantly between stroke patients and controls, and single-lobed LAAs were overrepresented and LAA volume was larger in patients with acute ischemic stroke of cryptogenic or suspected cardiogenic etiology.

  5. Facile controlled synthesis different morphologies of LuBO3:Ln3+ (Ln = Eu, Tb) phosphors and tunable luminescent properties

    International Nuclear Information System (INIS)

    Leng, Zhihua; Xiong, Hailong; Li, Linlin; Zhang, Nannan; Liu, Yali; Gan, Shucai

    2015-01-01

    Sphere-like and cauliflower-like hexagonal-vaterite LuBO 3 have been successfully synthesized for the first time via a chemical conversion route using Lu(OH)CO 3 colloid spheres as sacrificial precursor and H 3 BO 3 as boron source without any additional surfactant. FTIR analysis provides an additional evidence of the formation of vaterite-type LuBO 3 in this method. It was found that, an appropriate amount ethanol in the hydrothermal process has a great effect on the products' morphology and crystallinity. Time-dependent experiments indicate that the formation of LuBO 3 crystals went through a two-stage growth process, which involves a fast nucleation of primary particles followed by a slow aggregation and crystallization of primary particles. An investigation on the photoluminescence (PL) properties of LuBO 3 :Eu 3+ phosphors with different morphologies indicates that their PL intensity are dependent on their crystallinity. The effect of Eu 3+ and Tb 3+ doping concentration on PL intensity were also investigated and the quenching concentration of LuBO 3 :Eu 3+ and LuBO 3 :Tb 3+ is 0.25 and 0.20, respectively. Moreover, for Eu 3+ /Tb 3+ doped LuBO 3 phosphors, the color tones can be tuned from green, through green–yellow and yellow, and then to red by simply adjusting the relative doping concentrations of the Tb 3+ and Eu 3+ ions. - Highlights: • Sphere-like and cauliflower-like LuBO 3 were obtained by a conversion route. • This method used Lu(OH)CO 3 and H 3 BO 3 as the precursors for the first time. • Ethanol can control the products' morphology, crystallinity and PL intensity. • The emitting color tones vary with Tb 3+ /Eu 3+ doped concentration

  6. The Emerging British Verticillium longisporum Population Consists of Aggressive Brassica Pathogens.

    Science.gov (United States)

    Depotter, Jasper R L; Rodriguez-Moreno, Luis; Thomma, Bart P H J; Wood, Thomas A

    2017-11-01

    Verticillium longisporum is an economically important fungal pathogen of brassicaceous crops that originated from at least three hybridization events between different Verticillium spp., leading to the hybrid lineages A1/D1, A1/D2, and A1/D3. Isolates of lineage A1/D1 generally cause stem striping on oilseed rape (Brassica napus), which has recently been reported for the first time to occur in the United Kingdom. Intriguingly, the emerging U.K. population is distinct from the north-central European stem striping population. Little is known about the pathogenicity of the newly emerged U.K. population; hence, pathogenicity tests were executed to compare British isolates to previously characterized reference strains. In addition to the model plant Arabidopsis thaliana, the pathogenicity of four British isolates was assessed on four cultivars of three Brassica crop species: oilseed rape (Quartz and Incentive), cauliflower (Clapton), and Chinese cabbage (Hilton). To this end, vascular discoloration of the roots, plant biomass accumulations, and fungal stem colonization upon isolate infection were evaluated. The British isolates appeared to be remarkably aggressive, because plant biomass was significantly affected and severe vascular discoloration was observed. The British isolates were successful stem colonizers and the extent of fungal colonization negatively correlated with plant biomass of cauliflower and Quartz oilseed rape. However, in Quartz, the fungal colonization of A1/D1 isolates was significantly lower than that of the virulent reference isolate from lineage A1/D3, PD589. Moreover, despite levels of stem colonization similar to those of A1/D1 strains, PD589 did not cause significant disease on Incentive. Thus, A1/D1 isolates, including British isolates, are aggressive oilseed rape pathogens despite limited colonization levels in comparison with a virulent A1/D3 isolate.

  7. Facile hydrothermal synthesis of alpha manganese sesquioxide (α-Mn2O3) nanodumb-bells: Structural, magnetic, optical and photocatalytic properties

    International Nuclear Information System (INIS)

    Gnanam, S.; Rajendran, V.

    2013-01-01

    Highlights: ► α-Mn 2 O 3 nanoparticles sizes of 35–42 nm have been prepared by hydrothermal process. ► Shapes of α-Mn 2 O 3 : Dumb-bell, Cauliflower, spherical with rod, spherical with wires. ► The strong UV emission can be attributed to high purity and perfect crystallinity. ► Photocatalytic activity of α–Mn 2 O 3 was studied by degradation of Remazol red B dye. - Abstract: Nanometer scale cubic bixbyite α-Mn 2 O 3 has been synthesized by a facile hydrothermal method, at a temperature of 450 °C in the presence of various surfactants. The X-ray diffraction (XRD) analysis shows that the average crystallite size of the sample is ∼35–42 nm. The shapes of the α-Mn 2 O 3 nanoparticles include: Dumb-bell-like (anionic surfactant), Cauliflower-like (nonionic surfactant), spherical with rods (cationic surfactant) and spherical with wires (surface modifier). The shapes of α-Mn 2 O 3 nanoparticles depend on the type of surfactant used in the synthesis. The magnetic property of the anionic surfactant assisted sample was primarily studied, using the vibrating sample magnetometer (VSM). The optical absorption spectra confirmed the effectiveness of the selected capping agents, as the anionic capped α-Mn 2 O 3 colloids absorbed at shorter wavelength than the other agents, indicating a much smaller crystallite size. The property of strong UV emissions may be attributed to the high purity and perfect crystallinity of the as-prepared α-Mn 2 O 3 . The surfactants-assisted catalyst was tested for its photocatalytic activity towards the photodegradation of the harmful organic dye Remazol Red B, using a multilamp photo reactor. Possible formation mechanisms have also been proposed for the as-synthesized anionic surfactant assisted samples.

  8. Effect of precursor solutions on ZnO film via solution precursor plasma spray and corresponding gas sensing performances

    International Nuclear Information System (INIS)

    Yu, Z.X.; Ma, Y.Z.; Zhao, Y.L.; Huang, J.B.; Wang, W.Z.; Moliere, M.; Liao, H.L.

    2017-01-01

    Highlights: • C-axis preferential oriented grown ZnO films were firstly deposited via SPPS with different solutions. • ZnO films were hydrophobic due to cauliflower and honeycomb-like surface morphologies with high surface specific area. • Gas detecting performance of (002) plane oriented ZnO was predicted and compared by “first principle calculation method”. - Abstract: Solution precursor plasma spraying (SPPS) as a novel thermal spray method was employed to deposit nano-structured ZnO thin film using different formulations of the precursor solution. This article focuses on the influence of the solution composition on the preferential orientation of crystal growth, on crystal size and surface morphology of the resulting ZnO films. The trend of preferential growth along (002) lattice plane of ZnO film was studied by slow scanning X-ray diffraction using a specific coefficient P_(_0_0_2_)_. It appears that the thermal spray process promotes the buildup of ZnO films preferentially oriented along the c-axis. The shape of single particle tends to change from round shaped beads to hexagonal plates by increasing the volume ratio of ethanol in the solvent. Both cauliflower and honeycomb-like surface morphologies featuring high specific surface area and roughness were obtained through the SPPS process by varying solution composition. These ZnO films are hydrophobic with contact angle as high as 136°, which is seemingly associated with micro reliefs developing high surface specific area. Then the gas sensing performances of ZnO films preferentially oriented along (002) face were tentatively predicted using the “first principle calculation method” and were compared with those of conventional films that are mainly oriented along the (101) face. The (002) face displays better hydrogen adsorption capability than the (101) face with much larger resulting changes in electrical resistance. In conclusion, the c-axis oriented ZnO films obtained through SSPS have

  9. Effect of precursor solutions on ZnO film via solution precursor plasma spray and corresponding gas sensing performances

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Z.X., E-mail: zexin.yu@utbm.fr [Univ Bourgogne Franche Comte, CNRS, Lab ICB, UMR 6303, Site UTBM, F-90010 Belfort (France); Ma, Y.Z., E-mail: yangzhou.ma@outlook.com [School of Materials Science and Engineering, Anhui University of Technology, Ma’anshan 243002 (China); Zhao, Y.L. [Univ Bourgogne Franche Comte, CNRS, Lab ICB, UMR 6303, Site UTBM, F-90010 Belfort (France); Huang, J.B.; Wang, W.Z. [Key Lab of Safety Science of Pressurized System, Ministry of Education, School of Mechanical and Power Engineering, East China University of Science and Technology, Shanghai 200237 (China); Moliere, M.; Liao, H.L. [Univ Bourgogne Franche Comte, CNRS, Lab ICB, UMR 6303, Site UTBM, F-90010 Belfort (France)

    2017-08-01

    Highlights: • C-axis preferential oriented grown ZnO films were firstly deposited via SPPS with different solutions. • ZnO films were hydrophobic due to cauliflower and honeycomb-like surface morphologies with high surface specific area. • Gas detecting performance of (002) plane oriented ZnO was predicted and compared by “first principle calculation method”. - Abstract: Solution precursor plasma spraying (SPPS) as a novel thermal spray method was employed to deposit nano-structured ZnO thin film using different formulations of the precursor solution. This article focuses on the influence of the solution composition on the preferential orientation of crystal growth, on crystal size and surface morphology of the resulting ZnO films. The trend of preferential growth along (002) lattice plane of ZnO film was studied by slow scanning X-ray diffraction using a specific coefficient P{sub (002).} It appears that the thermal spray process promotes the buildup of ZnO films preferentially oriented along the c-axis. The shape of single particle tends to change from round shaped beads to hexagonal plates by increasing the volume ratio of ethanol in the solvent. Both cauliflower and honeycomb-like surface morphologies featuring high specific surface area and roughness were obtained through the SPPS process by varying solution composition. These ZnO films are hydrophobic with contact angle as high as 136°, which is seemingly associated with micro reliefs developing high surface specific area. Then the gas sensing performances of ZnO films preferentially oriented along (002) face were tentatively predicted using the “first principle calculation method” and were compared with those of conventional films that are mainly oriented along the (101) face. The (002) face displays better hydrogen adsorption capability than the (101) face with much larger resulting changes in electrical resistance. In conclusion, the c-axis oriented ZnO films obtained through SSPS have

  10. Investigation of the degradation mechanism of catalytic wires during oxidation of ammonia process

    International Nuclear Information System (INIS)

    Pura, Jarosław; Wieciński, Piotr; Kwaśniak, Piotr; Zwolińska, Marta; Garbacz, Halina; Zdunek, Joanna; Laskowski, Zbigniew; Gierej, Maciej

    2016-01-01

    Highlights: • Degradation mechanisms of precious metal catalytic gauzes is proposed. • Significant change of gauzes morphology and chemical composition was observed. • Samples were analyzed using SEM, EDS and micro-XCT techniques. - Abstract: The most common catalysts for the ammonia oxidation process are 80 μm diameter platinum-rhodium wires knitted or woven into the form of a gauze. In an aggressive environment and under extreme conditions (temperature 800–900 °C, intensive gas flow, high pressure) precious elements are drained from the surface of the wires. Part of this separated material quickly decomposes on the surface in the form of characteristic “cauliflower-shape protrusions”. The rest of the platinum is captured by palladium-nickel catalytic-capture gauzes located beneath. In our investigation we focused on the effects of the degradation of gauzes from one industrial catalytic system. The aim of the study was to compare the degree and the mechanism of degradation of gauzes from a different part of the reactor. The study covered PtRh7 catalytic and PdNi5 catalytic-capture gauzes. X-ray computer microtomography investigation revealed that despite strong differences in morphology, each Pt-Rh wire has a similar specific surface area. This indicates that the oxidation process and morphological changes of the wires occur in a self-regulating balance, resulting in the value of the specific surface area of the catalyst. Microtomography analysis of Pd-Ni wires revealed strong redevelopment of the wires’ surface, which is related to the platinum capture phenomenon. Scanning electron microscope observations also revealed the nanostructure in the cauliflower-shape protrusions and large grains in the wires’ preserved cores. The high temperature in the reactor and the long-term nature of the process do not favor the occurrence of the nanostructure in this type of material. Further and detailed analysis of this phenomena will provide a better

  11. Effect of component's geometry on the plasma nitriding behavior of AISI 4340 steel

    International Nuclear Information System (INIS)

    Asadi, Z. Soltani; Mahboubi, F.

    2012-01-01

    Highlights: → The thickness of the compound layer increases with increasing in temperature and groove width. → Surface layer at the remote regions from the edge is thinner than that of closer regions. → The hardness and the case depth of the nitrided layer increase with increasing the width of the groove. → Intensity of ε phase increases with increasing the width of the groove in both methods. → The ASPN specimens are covered by hexagonal particles and for the CPN by cauliflower shape nitrides. -- Abstract: The main aim of this work was to investigate the effect of the sample geometry on properties of the conventional plasma nitrided (CPN) and active screen plasma nitrided (ASPN) steel. Sample assemblies consisting of rectangular grooved steel blocks with different groove dimensions of 2, 4, 6, 8 and 10 (W) x 40 (H) x 20 (L) mm 3 and AISI 4340 steel plates (substrates) with dimensions of 10 x 40 x 60 mm 3 , to serve as groove cover, were prepared. The sample assemblies were conventional and active screen plasma nitrided under the gas mixture of 75%N 2 + 25%H 2 , at temperatures of 500 o C and 540 o C, pressure of 4 torr, for 5 h. Properties of the nitrided substrates were investigated by evaluating compound layer thickness, case depth, phase composition and hardness profile. Results of the experiments showed that the thickness of the compound layer, hardness and nitrided case depth increased with increasing the width of the groove for both methods. Also, in each sample, nitrogen atoms penetrated more deeply in the regions of the groove closer to the edge. Hallow cathode effect occurred at the sample with 2 mm width groove, in the CPN method, leading to the overheating of the sample. In ASPN, the hardness and the nitrided case depth are lower in comparison with CPN. The surface morphology of the CPN treated samples consists of cauliflower shape surface nitrides while the surface of the AS plasma nitrided samples are covered by the hexagonal particles with

  12. Facile hydrothermal synthesis of alpha manganese sesquioxide ({alpha}-Mn{sub 2}O{sub 3}) nanodumb-bells: Structural, magnetic, optical and photocatalytic properties

    Energy Technology Data Exchange (ETDEWEB)

    Gnanam, S., E-mail: gnanam.nanoscience@gmail.com [Department of Physics, Presidency College, Chennai 600005, Tamilnadu (India); Rajendran, V. [Department of Physics, Presidency College, Chennai 600005, Tamilnadu (India)

    2013-02-15

    Highlights: Black-Right-Pointing-Pointer {alpha}-Mn{sub 2}O{sub 3} nanoparticles sizes of 35-42 nm have been prepared by hydrothermal process. Black-Right-Pointing-Pointer Shapes of {alpha}-Mn{sub 2}O{sub 3}: Dumb-bell, Cauliflower, spherical with rod, spherical with wires. Black-Right-Pointing-Pointer The strong UV emission can be attributed to high purity and perfect crystallinity. Black-Right-Pointing-Pointer Photocatalytic activity of {alpha}-Mn{sub 2}O{sub 3} was studied by degradation of Remazol red B dye. - Abstract: Nanometer scale cubic bixbyite {alpha}-Mn{sub 2}O{sub 3} has been synthesized by a facile hydrothermal method, at a temperature of 450 Degree-Sign C in the presence of various surfactants. The X-ray diffraction (XRD) analysis shows that the average crystallite size of the sample is {approx}35-42 nm. The shapes of the {alpha}-Mn{sub 2}O{sub 3} nanoparticles include: Dumb-bell-like (anionic surfactant), Cauliflower-like (nonionic surfactant), spherical with rods (cationic surfactant) and spherical with wires (surface modifier). The shapes of {alpha}-Mn{sub 2}O{sub 3} nanoparticles depend on the type of surfactant used in the synthesis. The magnetic property of the anionic surfactant assisted sample was primarily studied, using the vibrating sample magnetometer (VSM). The optical absorption spectra confirmed the effectiveness of the selected capping agents, as the anionic capped {alpha}-Mn{sub 2}O{sub 3} colloids absorbed at shorter wavelength than the other agents, indicating a much smaller crystallite size. The property of strong UV emissions may be attributed to the high purity and perfect crystallinity of the as-prepared {alpha}-Mn{sub 2}O{sub 3}. The surfactants-assisted catalyst was tested for its photocatalytic activity towards the photodegradation of the harmful organic dye Remazol Red B, using a multilamp photo reactor. Possible formation mechanisms have also been proposed for the as-synthesized anionic surfactant assisted samples.

  13. Facile controlled synthesis different morphologies of LuBO{sub 3}:Ln{sup 3+} (Ln = Eu, Tb) phosphors and tunable luminescent properties

    Energy Technology Data Exchange (ETDEWEB)

    Leng, Zhihua; Xiong, Hailong; Li, Linlin; Zhang, Nannan; Liu, Yali; Gan, Shucai, E-mail: gansc@jlu.edu.cn

    2015-10-15

    Sphere-like and cauliflower-like hexagonal-vaterite LuBO{sub 3} have been successfully synthesized for the first time via a chemical conversion route using Lu(OH)CO{sub 3} colloid spheres as sacrificial precursor and H{sub 3}BO{sub 3} as boron source without any additional surfactant. FTIR analysis provides an additional evidence of the formation of vaterite-type LuBO{sub 3} in this method. It was found that, an appropriate amount ethanol in the hydrothermal process has a great effect on the products' morphology and crystallinity. Time-dependent experiments indicate that the formation of LuBO{sub 3} crystals went through a two-stage growth process, which involves a fast nucleation of primary particles followed by a slow aggregation and crystallization of primary particles. An investigation on the photoluminescence (PL) properties of LuBO{sub 3}:Eu{sup 3+} phosphors with different morphologies indicates that their PL intensity are dependent on their crystallinity. The effect of Eu{sup 3+} and Tb{sup 3+} doping concentration on PL intensity were also investigated and the quenching concentration of LuBO{sub 3}:Eu{sup 3+} and LuBO{sub 3}:Tb{sup 3+} is 0.25 and 0.20, respectively. Moreover, for Eu{sup 3+}/Tb{sup 3+} doped LuBO{sub 3} phosphors, the color tones can be tuned from green, through green–yellow and yellow, and then to red by simply adjusting the relative doping concentrations of the Tb{sup 3+} and Eu{sup 3+} ions. - Highlights: • Sphere-like and cauliflower-like LuBO{sub 3} were obtained by a conversion route. • This method used Lu(OH)CO{sub 3} and H{sub 3}BO{sub 3} as the precursors for the first time. • Ethanol can control the products' morphology, crystallinity and PL intensity. • The emitting color tones vary with Tb{sup 3+}/Eu{sup 3+} doped concentration.

  14. Investigation of the degradation mechanism of catalytic wires during oxidation of ammonia process

    Energy Technology Data Exchange (ETDEWEB)

    Pura, Jarosław, E-mail: jaroslawpura@gmail.com [Faculty of Material Science and Engineering, Warsaw University of Technology, Wołoska 141, 02-507 Warsaw (Poland); Wieciński, Piotr; Kwaśniak, Piotr; Zwolińska, Marta; Garbacz, Halina; Zdunek, Joanna [Faculty of Material Science and Engineering, Warsaw University of Technology, Wołoska 141, 02-507 Warsaw (Poland); Laskowski, Zbigniew; Gierej, Maciej [Precious Metal Mint, Weteranów 95, 05-250 Radzymin (Poland)

    2016-12-01

    Highlights: • Degradation mechanisms of precious metal catalytic gauzes is proposed. • Significant change of gauzes morphology and chemical composition was observed. • Samples were analyzed using SEM, EDS and micro-XCT techniques. - Abstract: The most common catalysts for the ammonia oxidation process are 80 μm diameter platinum-rhodium wires knitted or woven into the form of a gauze. In an aggressive environment and under extreme conditions (temperature 800–900 °C, intensive gas flow, high pressure) precious elements are drained from the surface of the wires. Part of this separated material quickly decomposes on the surface in the form of characteristic “cauliflower-shape protrusions”. The rest of the platinum is captured by palladium-nickel catalytic-capture gauzes located beneath. In our investigation we focused on the effects of the degradation of gauzes from one industrial catalytic system. The aim of the study was to compare the degree and the mechanism of degradation of gauzes from a different part of the reactor. The study covered PtRh7 catalytic and PdNi5 catalytic-capture gauzes. X-ray computer microtomography investigation revealed that despite strong differences in morphology, each Pt-Rh wire has a similar specific surface area. This indicates that the oxidation process and morphological changes of the wires occur in a self-regulating balance, resulting in the value of the specific surface area of the catalyst. Microtomography analysis of Pd-Ni wires revealed strong redevelopment of the wires’ surface, which is related to the platinum capture phenomenon. Scanning electron microscope observations also revealed the nanostructure in the cauliflower-shape protrusions and large grains in the wires’ preserved cores. The high temperature in the reactor and the long-term nature of the process do not favor the occurrence of the nanostructure in this type of material. Further and detailed analysis of this phenomena will provide a better

  15. Sulforaphane enhances irradiation effects in terms of perturbed cell cycle progression and increased DNA damage in pancreatic cancer cells.

    Directory of Open Access Journals (Sweden)

    Patrick Naumann

    Full Text Available Sulforaphane (SFN, an herbal isothiocyanate enriched in cruciferous vegetables like broccoli and cauliflower, has gained popularity for its antitumor effects in cell lines such as pancreatic cancer. Antiproliferative as well as radiosensitizing properties were reported for head and neck cancer but little is known about its effects in pancreatic cancer cells in combination with irradiation (RT.In four established pancreatic cancer cell lines we investigated clonogenic survival, analyzed cell cycle distribution and compared DNA damage via flow cytometry and western blot after treatment with SFN and RT.Both SFN and RT show a strong and dose dependent survival reduction in clonogenic assays, an induction of a G2/M cell cycle arrest and an increase in γH2AX protein level indicating DNA damage. Effects were more pronounced in combined treatment and both cell cycle perturbation and DNA damage persisted for a longer period than after SFN or RT alone. Moreover, SFN induced a loss of DNA repair proteins Ku 70, Ku 80 and XRCC4.Our results suggest that combination of SFN and RT exerts a more distinct DNA damage and growth inhibition than each treatment alone. SFN seems to be a viable option to improve treatment efficacy of chemoradiation with hopefully higher rates of secondary resectability after neoadjuvant treatment for pancreatic cancer.

  16. Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants

    Science.gov (United States)

    Cardoza, V.; Stewart, C. N.

    2003-01-01

    An efficient protocol for the production of transgenic Brassica napus cv. Westar plants was developed by optimizing two important parameters: preconditioning time and co-cultivation time. Agrobacterium tumefaciens-mediated transformation was performed using hypocotyls as explant tissue. Two variants of a green fluorescent protein (GFP)-encoding gene--mGFP5-ER and eGFP--both under the constitutive expression of the cauliflower mosaic virus 35S promoter, were used for the experiments. Optimizing the preconditioning time to 72 h and co-cultivation time with Agrobacterium to 48 h provided the increase in the transformation efficiency from a baseline of 4% to 25%. With mGFP5-ER, the transformation rate was 17% and with eGFP it was 25%. Transgenic shoots were selected on 200 mg/l kanamycin. Rooting efficiency was 100% on half-strength Murashige and Skoog medium with 10 g/l sucrose and 0.5 mg/l indole butyric acid in the presence of kanamycin.

  17. Approaches to the indirect evaluation of germination and vigour

    Directory of Open Access Journals (Sweden)

    Matthews S.

    1998-01-01

    Full Text Available In comparisons of six seed lots of different F1 hybrid cultivars of cauliflower with similarly high laboratory germinations (above 90% separation in germination was achieved after controlled deterioration (C.D. at 24% moisture content (m.c. and 45 0C for 24 hours. This measure of vigour was related to the position of the lots on the seed survival curve and was highly predictive of the longevity of the lots when stored at 15% m.c. and 20 0C for 12 and 16 weeks. When each seed lot was deteriorated at 24% m.c. for increasing times (from 0 to 36 hours a reduction in the subsequent percentage germination was seen, which, using probit transformed percentages, was significantly and linearly related to the leakage of electrolytes into seed soak water over 24 hours. The case is made for an approach to the indirect evaluation of germination and vigour using C.D. followed by measurements of leakage that could be more discerning and rapid than the present laboratory germination test.

  18. Overexpression of PSP1 enhances growth of transgenic Arabidopsis plants under ambient air conditions.

    Science.gov (United States)

    Han, Xiaofang; Peng, Keli; Wu, Haixia; Song, Shanshan; Zhu, Yerong; Bai, Yanling; Wang, Yong

    2017-07-01

    The importance of the phosphorylated pathway (PPSB) of L-serine (Ser) biosynthesis in plant growth and development has been demonstrated, but its specific role in leaves and interaction with photorespiration, the main leaf Ser biosynthetic pathway at daytime, are still unclear. To investigate whether changes in biosynthesis of Ser by the PPSB in leaves could have an impact on photorespiration and plant growth, we overexpressed PSP1, the last enzyme of this pathway, under control of the Cauliflower Mosaic Virus 35S promoter in Arabidopsis thaliana. Overexpressor plants grown in normal air displayed larger rosette diameter and leaf area as well as higher fresh and dry weight than the wild type. By contrast, no statistically significant differences to the wild type were observed when the overexpressor seedlings were transferred to elevated CO 2 , indicating a relationship between PSP1 overexpression and photorespiration. Additionally, the transgenic plants displayed higher photorespiration, an increase in CO 2 net-uptake and stronger expression in the light of genes encoding enzymes involved in photorespiration. We further demonstrated that expression of many genes involved in nitrogen assimilation was also promoted in leaves of transgenic plants and that leaf nitrate reductase activity increased in the light, too, although not in the dark. Our results suggest a close correlation between the function of PPSB and photorespiration, and also nitrogen metabolism in leaves.

  19. A 35-year-old woman presenting with an unusual post-traumatic leiomyoma of the nipple: a case report.

    Science.gov (United States)

    Pavlidis, Leonidas; Vakirlis, Efstratios; Spyropoulou, Georgia-Alexandra; Pramateftakis, Manousos Georgios; Dionyssiou, Dimitris; Demiri, Efterpi

    2013-02-19

    Leiomyoma of the mammary papilla is one of the most uncommon nipple tumors with only 50 cases reported in the literature until now. To the best of our knowledge we present the first report of a nipple leiomyoma that originated from a traumatic abrasion caused by breastfeeding. A 35-year-old healthy Caucasian female with a cauliflower-like tender and pink nodular mass that was approximately 10mm in diameter presented to our out-patients department. The patient suggested that the mass originated from a traumatic abrasion caused by breastfeeding three years ago and it has been slowly growing ever since.An excision biopsy was performed. The histological and immunohistochemical examination confirmed the diagnosis of leiomyoma. There were no postoperative complications or any sign of local recurrence four years postoperatively. Leiomyoma of the mammary papilla is a rare benign neoplasm that usually appears as a solid tender nodule. Differential diagnosis comprises breast carcinoma, leiomyosarcoma and myoid hamartoma. The recommended treatment is complete excision of the tumor with histologically confirmed tumor-free margins otherwise recurrence is possible. A detailed history of the patient's disease can reveal the original etiology. This is an original case report that will have particular interest to plastic surgeons, dermatologists, and pathologists. The pathogenetic mechanism was trauma of the nipple. According to our review of the literature this particular information has never been reported and we think that it may advance our knowledge of this very infrequent tumor.

  20. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    International Nuclear Information System (INIS)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng

    2010-01-01

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  1. Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

    Science.gov (United States)

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-10-10

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.

  2. Phytochemicals from nine plants beneficial for pregnant women

    Directory of Open Access Journals (Sweden)

    Lakshmi. D

    2014-12-01

    Full Text Available The phytochemicals found in nine plants which are easily accessible to the women living in developing countries in particular is studied as the prevalence of diseases caused by lack of prenatal nutrients is  high in these countries. Knowledge about these plants would help the expectant women to get the maximum prenatal nutrients like Folic acid, Iron, Vitamin B6, Zinc, Calcium, Choline and Alpha linoleic acid precursors needed to synthesize Omega 3 fats which are vital for the foetal growth and development. These plants are easily available and are affordable to the majority of poor women living in slums of the city dwellers and those who live in villages. Due to lack of knowledge, money, palatability issues, improper storage and consumption irregularities the expectant mothers in this category do not consume prescribed prenatal nutrients, affecting the mother and the foetus. Though prescribed prenatal nutrients are still very essential, same from the food sources have many benefits like they are from the complex mixture of many phytochemicals which act synergistically and provide known and unknown benefits to them. Apart from this, most of the plants listed here can be easily grown in pots or plots near their homes, manuring with kitchen wastes and without using chemical fertilizers or pesticides. Plants that provide all the prenatal nutrients and easily accessible for daily consumption by the pregnant women at an affordable cost in developing countries are Cowpea, Tomatoes, Turnip greens, Garlic, Wheat, Drumstick leaves, Cauliflower, purslane and Guava fruits.

  3. Histone H3 is absent from organelle nucleoids in BY-2 cultured tobacco cells.

    Science.gov (United States)

    Takusagawa, Mari; Tamotsu, Satoshi; Sakai, Atsushi

    2013-07-01

    The core histone proteins (H2A, H2B, H3 and H4) are nuclear-localised proteins that play a central role in the formation of nucleosome structure. They have long been considered to be absent from extra-nuclear, DNA-containing organelles; that is plastids and mitochondria. Recently, however, the targeting of core histone H3 to mitochondria, and the presence of nucleosome-like structures in mitochondrial nucleoids, were proposed in cauliflower and tobacco respectively. Thus, we examined whether histone H3 was present in plant organelles and participated in the organisation of nucleoid structure, using highly purified organelles and organelle nucleoids isolated from BY-2 cultured tobacco cells. Immunofluorescence microscopic observations and Western blotting analyses demonstrated that histone H3 was absent from organelles and organelle nucleoids, consistent with the historical hypothesis. Thus, the organisation of organelle nucleoids, including putative nucleosome-like repetitive structures, should be constructed and maintained without participation of histone H3. © 2013 International Federation for Cell Biology.

  4. Top 10 plant viruses in molecular plant pathology.

    Science.gov (United States)

    Scholthof, Karen-Beth G; Adkins, Scott; Czosnek, Henryk; Palukaitis, Peter; Jacquot, Emmanuel; Hohn, Thomas; Hohn, Barbara; Saunders, Keith; Candresse, Thierry; Ahlquist, Paul; Hemenway, Cynthia; Foster, Gary D

    2011-12-01

    Many scientists, if not all, feel that their particular plant virus should appear in any list of the most important plant viruses. However, to our knowledge, no such list exists. The aim of this review was to survey all plant virologists with an association with Molecular Plant Pathology and ask them to nominate which plant viruses they would place in a 'Top 10' based on scientific/economic importance. The survey generated more than 250 votes from the international community, and allowed the generation of a Top 10 plant virus list for Molecular Plant Pathology. The Top 10 list includes, in rank order, (1) Tobacco mosaic virus, (2) Tomato spotted wilt virus, (3) Tomato yellow leaf curl virus, (4) Cucumber mosaic virus, (5) Potato virus Y, (6) Cauliflower mosaic virus, (7) African cassava mosaic virus, (8) Plum pox virus, (9) Brome mosaic virus and (10) Potato virus X, with honourable mentions for viruses just missing out on the Top 10, including Citrus tristeza virus, Barley yellow dwarf virus, Potato leafroll virus and Tomato bushy stunt virus. This review article presents a short review on each virus of the Top 10 list and its importance, with the intent of initiating discussion and debate amongst the plant virology community, as well as laying down a benchmark, as it will be interesting to see in future years how perceptions change and which viruses enter and leave the Top 10. © 2011 The Authors. Molecular Plant Pathology © 2011 BSPP and Blackwell Publishing Ltd.

  5. Geminivirus vectors for high-level expression of foreign proteins in plant cells.

    Science.gov (United States)

    Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

    2003-02-20

    Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

  6. Degradation of transgene DNA in genetically modified herbicide-tolerant rice during food processing.

    Science.gov (United States)

    Song, Shangxin; Zhou, Guanghong; Gao, Feng; Zhang, Wei; Qiu, Liangyan; Dai, Sifa; Xu, Xinglian; Xiao, Hongmei

    2011-12-01

    In order to assess the effect of food processing on the degradation of exogenous DNA components in sweet rice wine and rice crackers made from genetically modified (GM) rice (Oryza sativa L.), we developed genomic DNA extraction methods and compared the effect of different food processing procedures on DNA degradation. It was found that the purity, quantity and quality of DNA by alkaline lysis method were higher than by CTAB (cetyltrimethylammonium bromide) method. For sweet rice wine, CAMV35S (cauliflower mosaic virus 35S) promoter and NOS (nopaline synthase) terminator were degraded by the third day, whereas the exogenous gene Bar (bialaphos resistance) remained unaffected. For rice crackers, boiling, drying and microwaving contributed to the initial degradations of DNA. Baking resulted in further degradations, and frying led to the most severe changes. These results indicated that the stability of DNA in GM rice was different under different processing conditions. For sweet rice wine, Bar was most stable, followed by NOS, CAMV35S, and SPS. For rice crackers, CAMV35S was most stable, followed by SPS, NOS, and Bar. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Behavior of irradiated ATR/MOX fuel under reactivity initiated accident conditions (Joint research)

    International Nuclear Information System (INIS)

    Sasajima, Hideo; Fuketa, Toyoshi; Nakamura, Takehiko; Nakamura, Jinichi; Uetsuka, Hiroshi

    2000-03-01

    Pulse irradiation experiments with irradiated ATR/MOX fuel rods of 20 MWd/kgHM were conducted at the NSRR in JAERI to study the transient behavior of MOX fuel rod under reactivity initiated accident conditions. Four pulse irradiation experiments were performed with peak fuel enthalpy ranging from 335 J/g to 586 J/g, resulted in no failure of fuel rods. Deformation of the fuel rods due to PCMI occurred in the experiments with peak fuel enthalpy above 500 J/g. Significant fission gas release up to 20% was measured by rod puncture measurement. The generation of fine radial cracks in pellet periphery, micro-cracks and boundary separation over the entire region of pellet were observed. These microstructure changes might contribute to the swelling of fuel pellets during the pulse irradiation. This could cause the large radial deformation of fuel rod and high fission gas release when the pulse irradiation conducted at relatively high peak fuel enthalpy. In addition, fine grain structures around the plutonium spot and cauliflower structure in cavity of the plutonium spot were observed in the outer region of the fuel pellet. (author)

  8. Formation of the honeycomb-like electrodes by the regime of pulsating overpotential in the second range

    Directory of Open Access Journals (Sweden)

    NEBOJŠA D. NIKOLIĆ

    2012-03-01

    Full Text Available In this study the honeycomb-like copper structures electrodeposited by the regime of pulsating overpotential in the second range were analyzed by the technique of scanning electron microscopy. The overpotential amplitude of 1000 mV, deposition pulse of 1 s, and pause durations of 1, 5, 10 and 15 s were selected for the production of this type of structures. The size of holes which remained upon detachment of hydrogen bubbles do not depend on the length of pause duration. On the other hand, the change in morphology of electrodeposited copper around holes from cauliflower-like agglomerates of copper grains to degenerated dendrites is observed when pause duration was increased. Effects of the application of the regime of pulsating overpotential in the second range on the formation of the honeycomb-like structures were less pronounced than the effects attained by the application of the same regime in the millisecond range. However, they were more pronounced than those attained by electrodeposition in the regime of constant potential.

  9. Recombinase Polymerase Amplification (RPA of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

    Directory of Open Access Journals (Sweden)

    Chao Xu

    2014-10-01

    Full Text Available Recombinase polymerase amplification (RPA is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos terminator, which are widely incorporated in genetically modified (GM crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean. With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.

  10. Hydrothermal deposition and photochromic performances of three kinds of hierarchical structure arrays of WO3 thin films

    International Nuclear Information System (INIS)

    Ding, Defang; Shen, Yi; Ouyang, Yali; Li, Zhen

    2012-01-01

    Three kinds of tungsten oxide (WO 3 ) thin films have been fabricated by a simple hydrothermal deposition method. Scanning electron microscopy images of the products revealed that the capping agents did impact the microstructure of WO 3 films. Films prepared without capping agents were ordered nanorod arrays, while the ones obtained with ethanol and oxalic acid revealed peeled-orange-like and cauliflower-like hierarchical structure arrays, respectively. Both of the two hierarchical structures were composed of much thinner nanorods compared with the one obtained without capping agents. All the WO 3 films exhibited good photochromic properties and the two with inducers performed even better, which could be due to the changes in the microstructure that increased the amount of photogenerated electron–hole pairs and the proton diffusion rates. - Highlights: ► Ordered WO 3 nanorod arrays were prepared by hydrothermal deposition process. ► Two hierarchical WO 3 structure arrays were obtained with ethanol and oxalic acid. ► Mechanism for the improved photochromic performances of WO 3 films is proposed.

  11. Mitigation of heavy metals in different vegetables through biological washing techniques

    Directory of Open Access Journals (Sweden)

    Muhammad Umair Sattar

    2015-12-01

    Full Text Available Availability of nutritious and healthy food is the foremost challenging issue in all over the word. Vegetables are essential part in human diet and considered as natural reserves of nutrients gifted by Almighty Allah to human beings. Heavy metals are among the most toxic food pollutants and their intake through diet leads to several disorders. The sources of heavy metal contamination include waste water irrigation, industrial emissions, transportation and application of metal-based pesticides. In Pakistan this situation is more alarming as vegetables grown in peri-urban areas have shown high incidence of heavy metals accumulation. In this study effort was made to mitigate different heavy metals (Ar, Cd, Cr and Pb in cauliflower, spinach, okra and brinjal collected from peri-urban areas through washing with different biological solutions. Heavy metals contents were determined by using Atomic Absorption Spectrophotometry (AAS. Vegetable showed high load of heavy metals in unwashed form that reduced significantly by washing with different biological solutions. Among the different biological solutions, washing of vegetables with 8% ginger solution was found to be more effective.

  12. Isolation and functional characterization of JcFT, a FLOWERING LOCUS T (FT) homologous gene from the biofuel plant Jatropha curcas.

    Science.gov (United States)

    Li, Chaoqiong; Luo, Li; Fu, Qiantang; Niu, Longjian; Xu, Zeng-Fu

    2014-05-08

    Physic nut (Jatropha curcas L.) is a potential feedstock for biofuel production because Jatropha oil is highly suitable for the production of the biodiesel and bio-jet fuels. However, Jatropha exhibits low seed yield as a result of unreliable and poor flowering. FLOWERING LOCUS T (FT) -like genes are important flowering regulators in higher plants. To date, the flowering genes in Jatropha have not yet been identified or characterized. To better understand the genetic control of flowering in Jatropha, an FT homolog was isolated from Jatropha and designated as JcFT. Sequence analysis and phylogenetic relationship of JcFT revealed a high sequence similarity with the FT genes of Litchi chinensis, Populus nigra and other perennial plants. JcFT was expressed in all tissues of adult plants except young leaves, with the highest expression level in female flowers. Overexpression of JcFT in Arabidopsis and Jatropha using the constitutive promoter cauliflower mosaic virus 35S or the phloem-specific promoter Arabidopsis SUCROSE TRANSPORTER 2 promoter resulted in an extremely early flowering phenotype. Furthermore, several flowering genes downstream of JcFT were up-regulated in the JcFT-overexpression transgenic plant lines. JcFT may encode a florigen that acts as a key regulator in flowering pathway. This study is the first to functionally characterize a flowering gene, namely, JcFT, in the biofuel plant Jatropha.

  13. Development of waxy cassava with different Biological and physico-chemical characteristics of starches for industrial applications.

    Science.gov (United States)

    Zhao, Shan-Shan; Dufour, Dominique; Sánchez, Teresa; Ceballos, Hernan; Zhang, Peng

    2011-08-01

    The quality of cassava starch, an important trait in cassava breeding programs, determines its applications in various industries. For example, development of waxy (having a low level of amylose) cassava is in demand. Amylose is synthesized by granule-bound starch synthase I (GBSSI) in plants, and therefore, down-regulation of GBSSI expression in cassava might lead to reduced amylose content. We produced 63 transgenic cassava plant lines that express hair-pin dsRNAs homologous to the cassava GBSSI conserved region under the control of the vascular-specific promoter p54/1.0 from cassava (p54/1.0::GBSSI-RNAi) or cauliflower mosaic virus (CaMV) 35S (35S::GBSSI-RNAi). After the screening storage roots and starch granules from field-grown plants with iodine staining, the waxy phenotype was discovered: p54/1.0::GBSSI-RNAi line A8 and 35S::GBSSI-RNAi lines B9, B10, and B23. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis showed that there was no detectable GBSSI protein in the starch granules of plants with the waxy phenotype. Further, the amylose content of transgenic starches was significantly reduced (industrial utilization. Copyright © 2011 Wiley Periodicals, Inc.

  14. Expression of a Petunia inflata pectin methyl esterase in Solanum tuberosum L. enhances stem elongation and modifies cation distribution.

    Science.gov (United States)

    Pilling, J; Willmitzer, L; Fisahn, J

    2000-02-01

    Transgenic potato (Solanum tuberosum L.) plants were constructed with a Petunia inflata-derived cDNA encoding a pectin methyl esterase (PME; EC 3.1.1.11) in sense orientation under the control of the cauliflower mosaic virus 35S promoter. The PME activity was elevated in leaves and tubers of the transgenic lines but slightly reduced in apical segments of stems from mature plants. Stem segments from the base of juvenile PME-overexpressing plants did not differ in PME activity from the control, whereas in apical parts PME was less active than in the wild-type. During the early stages of development stems of these transgenic plants elongated more rapidly than those of the wild-type. Further evidence that overexpression of a plant-derived PME has an impact on plant development is based on modifications of tuber yield, which was reduced in the transgenic lines. Cell walls from transgenic tubers showed significant differences in their cation-binding properties in comparison with the wild-type. In particular, cell walls displayed increased affinity for sodium and calcium, while potassium binding was constant. Furthermore, the total ion content of transgenic potatoes was modified. Indications of PME-mediated differences in the distribution of ions in transgenic plants were also obtained by monitoring relaxations of the membrane potential of roots subsequent to changes in the ionic composition of the bathing solution. However, no effects on the chemical structure of pectin from tuber cell walls could be detected.

  15. Dietary factors and the risk of glioma in adults: results of a case-control study in Melbourne, Australia.

    Science.gov (United States)

    Giles, G G; McNeil, J J; Donnan, G; Webley, C; Staples, M P; Ireland, P D; Hurley, S F; Salzberg, M

    1994-11-01

    In a population-based case-control study of 416 incident gliomas in adults carried out in Melbourne, Australia, between 1987 and 1991, 409 age-sex-matched case-control pairs (243 male and 166 female) had adequate data available to examine associations between the dietary intake of N-nitroso compounds, N-nitroso precursors, other nutrients including N-nitroso inhibitors, and the risk of glioma. Dietary intakes were based on the reported frequency of consumption of 59 food items. Increased odds ratio (OR) were observed in males who consumed high levels of bacon, corned meats, apples, melons and oil. OR less than unity were observed in men consuming cabbage and cola drinks, and in women who consumed wholegrain bread, pasta, corned meat, bananas, cauliflower, brocoli, cola drinks and nuts. Generally, N-nitroso associations were greater in men and micronutrient associations were greater in women. Elevated OR in men, but not women, were associated with the intake of N-nitroso dimethylamine (NDMA), retinol and vitamin E. The intake of nitrate (largely of vegetable origin) was protective in women but not in men. When analyzed using multiple logistic regression, the association with NDMA intake in males was not modified by dietary micronutrient intakes. In females, beta carotene alone, though not directly associated with risk, modified the effect of NDMA. On balance, this study added only limited support to the N-nitroso hypothesis of glial carcinogenesis.

  16. Potensi Cendawan Asal Tanah Perakaran Bambu Sebagai Endofit dan Agen Biokontrol Penyakit Akar Gada Pada Tanaman Brokoli

    Directory of Open Access Journals (Sweden)

    . Asniah

    2014-03-01

    Full Text Available The potential of fungi from bamboo rhizosphic soils as endophytic and biocontrol agents of  clubroot disease (Plasmodiophora brassicae on Brocoli. Clubroot, caused by Plasmodiophora brassicae is a serious soilborne disease of plants worldwide, capable of severe infection on broccoli, cabbage and cauliflower. Clubroot is the most destructive diseases on cruciferae in Indonesia.  The existing control measures, including biological control do not provide satisfactory result.  The objective of the study was to explore fungi from bamboo rhizospheric soils as endophytic that can suppress clubroot disease in broccoli.  There were two steps in this study: (1 exploration and identification of fungi from bamboo rhizospheric soils. (2 Effectiveness test of the fungi in suppressing clubroot disease.  There were four species of fungi as endophytes in brocoli in this study, e.g Aspergillus sp., Mortierella sp., Paecilomyces sp., and Chaetomium globosum. They had colonized broccoli root endophytically and suppressing clubroot disease.  Paecilomyces sp. of endophytic fungi can suppress clubroot diseases incidence for 18.75%.

  17. Seleção e produção de sementes em hortaliças: com referência especial ao gênero Brassica

    Directory of Open Access Journals (Sweden)

    F. G. Brieger

    1942-01-01

    Full Text Available The preliminary work with vegetables was described and special reference was-made to the group Brassica oleracea. a Plants flowering easily in Piracicaba and probably in the whole State of São Paulo. To this group belongs the lettuce, endive, chichory, carrot, radish, kale, brocoli and cauliflower. b Plants where special treatment is necessary for flowering, as cabbage. c Plants that did not flower up to this moment, as Svisschard beet and beet. Three main factors contribute for the seedless condition in the group cabbage : lack of flowering, anormalities of the flowers and self-sterility. The preliminary experiments in controling these factors seem to indicate the possibility of seed production in this group. The systematics of the two species Brassica oleracea (Europe and Brassica juncea (Oriental Asia was discussed. The economical differences in the group Brassica oleracea are controled by Mendelian factors with complicate types of interaction. It is not necessary to look for special places in the State of São Paulo for vegetable experiments but the possibility of better results in the future, with appropriate conditions, is emphasized.

  18. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  19. Ectopic expression of a horseradish peroxidase enhances growth rate and increases oxidative stress resistance in hybrid aspen.

    Science.gov (United States)

    Kawaoka, Akiyoshi; Matsunaga, Etsuko; Endo, Saori; Kondo, Shinkichi; Yoshida, Kazuya; Shinmyo, Atsuhiko; Ebinuma, Hiroyasu

    2003-07-01

    We previously demonstrated that overexpression of the horseradish (Armoracia rusticana) peroxidase prxC1a gene stimulated the growth rate of tobacco (Nicotiana tabacum) plants. Here, the cauliflower mosaic virus 35S::prxC1a construct was introduced into hybrid aspen (Populus sieboldii x Populus grandidentata). The growth rate of these transformed hybrid aspen plants was substantially increased under greenhouse conditions. The average stem length of transformed plants was 25% greater than that of control plants. There was no other obvious phenotypic difference between the transformed and control plants. Fast-growing transformed hybrid aspen showed high levels of expression of prxC1a and had elevated peroxidase activities toward guaiacol and ascorbate. However, there was no increase of the endogenous class I ascorbate peroxidase activities in the transformed plants by separate assay and activity staining of native polyacrylamide gel electrophoresis. Furthermore, calli derived from the transformed hybrid aspen grew faster than those from control plants and were resistant to the oxidative stress imposed by hydrogen peroxide. Therefore, enhanced peroxidase activity affects plant growth rate and oxidative stress resistance.

  20. Xylitol: a review on bioproduction, application, health benefits, and related safety issues.

    Science.gov (United States)

    Ur-Rehman, Salim; Mushtaq, Zarina; Zahoor, Tahir; Jamil, Amir; Murtaza, Mian Anjum

    2015-01-01

    Xylitol is a pentahydroxy sugar-alcohol which exists in a very low quantity in fruits and vegetables (plums, strawberries, cauliflower, and pumpkin). On commercial scale, xylitol can be produced by chemical and biotechnological processes. Chemical production is costly and extensive in purification steps. However, biotechnological method utilizes agricultural and forestry wastes which offer the possibilities of economic production of xylitol by reducing required energy. The precursor xylose is produced from agricultural biomass by chemical and enzymatic hydrolysis and can be converted to xylitol primarily by yeast strain. Hydrolysis under acidic condition is the more commonly used practice influenced by various process parameters. Various fermentation process inhibitors are produced during chemical hydrolysis that reduce xylitol production, a detoxification step is, therefore, necessary. Biotechnological xylitol production is an integral process of microbial species belonging to Candida genus which is influenced by various process parameters such as pH, temperature, time, nitrogen source, and yeast extract level. Xylitol has application and potential for food and pharmaceutical industries. It is a functional sweetener as it has prebiotic effects which can reduce blood glucose, triglyceride, and cholesterol level. This review describes recent research developments related to bioproduction of xylitol from agricultural wastes, application, health, and safety issues.

  1. Glucosinolates in Brassica vegetables: the influence of the food supply chain on intake, bioavailability and human health.

    Science.gov (United States)

    Verkerk, Ruud; Schreiner, Monika; Krumbein, Angelika; Ciska, Ewa; Holst, Birgit; Rowland, Ian; De Schrijver, Remi; Hansen, Magnor; Gerhäuser, Clarissa; Mithen, Richard; Dekker, Matthijs

    2009-09-01

    Glucosinolates (GLSs) are found in Brassica vegetables. Examples of these sources include cabbage, Brussels sprouts, broccoli, cauliflower and various root vegetables (e.g. radish and turnip). A number of epidemiological studies have identified an inverse association between consumption of these vegetables and the risk of colon and rectal cancer. Animal studies have shown changes in enzyme activities and DNA damage resulting from consumption of Brassica vegetables or isothiocyanates, the breakdown products (BDP) of GLSs in the body. Mechanistic studies have begun to identify the ways in which the compounds may exert their protective action but the relevance of these studies to protective effects in the human alimentary tract is as yet unproven. In vitro studies with a number of specific isothiocyanates have suggested mechanisms that might be the basis of their chemoprotective effects. The concentration and composition of the GLSs in different plants, but also within a plant (e.g. in the seeds, roots or leaves), can vary greatly and also changes during plant development. Furthermore, the effects of various factors in the supply chain of Brassica vegetables including breeding, cultivation, storage and processing on intake and bioavailability of GLSs are extensively discussed in this paper.

  2. Potential of different crop species for nickel and cadmium phytoremediation in peri-urban areas of Varanasi district (India with more than twenty years of wastewater irrigation history

    Directory of Open Access Journals (Sweden)

    Sumita Pal

    2013-03-01

    Full Text Available Heavy metals introduced into soil by indiscriminate dumping along with irrigating with sewage effluent often lead to toxic accumulation of heavy metal ions, which not only impair soil productivity but also cause health hazards by entering into food chain via soil-plant-animal-atmosphere continuum. To evaluate the potential of different crop species for nickel (Ni and cadmium (Cd phytoremediation, fifteen crop species comprising of cereals, vegetables and flowers were collected from differentially contaminated soils (DTPA-Cd 5.7-6.75 mg kg–1, DTPA-Ni 16.50- 20.85 mg kg–1. The tissue metal concentration and relative efficiency of transfer of heavy metals from soil to plant (transfer factor for various groups of crops were worked out. The uptake of Cd and Ni increased with contents in soils and the major part of taken up Cd and Ni is translocated to the floricultural crops with maximum accumulation occurred in roots. Values of translocation factor of Cd and Ni were ranged between 0.2 to 0.8 and 0.2 to 1.0 respectively for the different crops studied. The mean total root colonization by arbuscular mycorrhiza in these soils ranged from 15% for cauliflower to 76% for marigold, suggesting a certain adaptation of these indigenous to such environmental stress. Among the different crops studied marigold with highest translocation factor, mycorrhization and Cd and Ni content in root part holds considered as a potential economic crop for phytoremediation.

  3. The Three Lineages of the Diploid Hybrid Verticillium longisporum Differ in Virulence and Pathogenicity.

    Science.gov (United States)

    Novakazi, Fluturë; Inderbitzin, Patrik; Sandoya, German; Hayes, Ryan J; von Tiedemann, Andreas; Subbarao, Krishna V

    2015-05-01

    Verticillium longisporum is an economically important vascular pathogen of Brassicaceae crops in different parts of the world. V. longisporum is a diploid hybrid that consists of three different lineages, each of which originated from a separate hybridization event between two different sets of parental species. We used 20 isolates representing the three V. longisporum lineages and the relative V. dahliae, and performed pathogenicity tests on 11 different hosts, including artichoke, cabbage, cauliflower, cotton, eggplant, horseradish, lettuce, linseed, oilseed rape (canola), tomato, and watermelon. V. longisporum was overall more virulent on the Brassicaceae crops than V. dahliae, which was more virulent than V. longisporum across the non-Brassicaceae crops. There were differences in virulence between the three V. longisporum lineages. V. longisporum lineage A1/D1 was the most virulent lineage on oilseed rape, and V. longisporum lineage A1/D2 was the most virulent lineage on cabbage and horseradish. We also found that on the non-Brassicaceae hosts eggplant, tomato, lettuce, and watermelon, V. longisporum was more or equally virulent than V. dahliae. This suggests that V. longisporum may have a wider potential host range than currently appreciated.

  4. Introgression of a Tombusvirus Resistance Locus from Nicotiana edwardsonii var. Columbia to N. clevelandii.

    Science.gov (United States)

    Schoelz, James E; Wiggins, B Elizabeth; Wintermantel, William M; Ross, Kathleen

    2006-05-01

    ABSTRACT A new variety of Nicotiana, N. edwardsonii var. Columbia, was evaluated for its capacity to serve as a new source for virus resistance genes. Columbia was developed from a hybridization between N. glutinosa and N. clevelandii, the same parents used for the formation of the original N. edwardsonii. However, in contrast to the original N. edwardsonii, crosses between Columbia and either of its parents are fertile. Thus, the inheritance of virus resistance genes present in N. glutinosa could be characterized by using Columbia as a bridge plant in crosses with the susceptible parent, N. clevelandii. To determine how virus resistance genes would segregate in interspecific crosses between Columbia and N. clevelandii, we followed the fate of the N gene, a single dominant gene that specifies resistance to Tobacco mosaic virus (TMV). Our genetic evidence indicated that the entire chromosome containing the N gene was introgressed into N. clevelandii to create an addition line, designated N. clevelandii line 19. Although line 19 was homozygous for resistance to TMV, it remained susceptible to Tomato bushy stunt virus (TBSV) and Cauliflower mosaic virus (CaMV) strain W260, indicating that resistance to these viruses must reside on other N. glutinosa chromosomes. We also developed a second addition line, N. clevelandii line 36, which was homozygous for resistance to TBSV. Line 36 was susceptible to TMV and CaMV strain W260, but was resistant to other tombusviruses, including Cucumber necrosis virus, Cymbidium ringspot virus, Lettuce necrotic stunt virus, and Carnation Italian ringspot virus.

  5. Giant condyloma acuminate due human papilloma virus type 16 in an infant successfully treated with topical imiquimod therapy

    Directory of Open Access Journals (Sweden)

    Meltem Dinleyici

    2015-12-01

    Full Text Available Anogenital warts related to human papillomavirus (HPV have been observed in children. Definition of the transmission mode, therapy, and follow-up for long term potential complications is important. A 27-month old girl was admitted with multiple pedunculated red-purple colored cauliflower-like lesions of 1.5 years duration. Clinical/histopathological and microbiological diagnosis was condyloma acuminate due to HPV type 16. After 12 weeks of imiquimod 5% cream application (pea-sized overnight three times per week, the perianal warts had completely disappeared. The mode of transmission of HPV 16 in our case was probably horizontal, related to the sharing of common personal hygiene items in the women’s shelter. We report herein the case of an infant living in a women’s shelter with giant condyloma acuminata due to HPV 16, which was successfully treated with topical imiquimod therapy. This patient should be followed up for recurrence and potential malignant lesions related to HPV type 16.

  6. Effect of Extreme Wettability on Platelet Adhesion on Metallic Implants: From Superhydrophilicity to Superhydrophobicity.

    Science.gov (United States)

    Moradi, Sona; Hadjesfandiari, Narges; Toosi, Salma Fallah; Kizhakkedathu, Jayachandran N; Hatzikiriakos, Savvas G

    2016-07-13

    In order to design antithrombotic implants, the effect of extreme wettability (superhydrophilicity to superhydrophobicity) on the biocompatibility of the metallic substrates (stainless steel and titanium) was investigated. The wettability of the surface was altered by chemical treatments and laser ablation methods. The chemical treatments generated different functionality groups and chemical composition as evident from XPS analysis. The micro/nanopatterning by laser ablation resulted in three different pattern geometry and different surface roughness and consequently wettability. The patterned surface were further modified with chemical treatments to generate a wide range of surface wettability. The influence of chemical functional groups, pattern geometry, and surface wettability on protein adsorption and platelet adhesion was studied. On chemically treated flat surfaces, the type of hydrophilic treatment was shown to be a contributing factor that determines the platelet adhesion, since the hydrophilic oxidized substrates exhibit less platelet adhesion in comparison to the control untreated or acid treated surfaces. Also, the surface morphology, surface roughness, and superhydrophobic character of the surfaces are contributing factors to platelet adhesion on the surface. Our results show that superhydrophobic cauliflower-like patterns are highly resistant to platelet adhesion possibly due to the stability of Cassie-Baxter state for this pattern compared to others. Our results also show that simple surface treatments on metals offer a novel way to improve the hemocompatibility of metallic substrates.

  7. Determination of pesticide residues in leafy vegetables at parts per billion levels by a chemometric study using GC-ECD in Cameron Highlands, Malaysia.

    Science.gov (United States)

    Farina, Yang; Abdullah, Md Pauzi; Bibi, Nusrat; Khalik, Wan Mohd Afiq Wan Mohd

    2017-06-01

    A simple and sensitive analytical method has been developed employing gas chromatography coupled with electron capture detector (GC-ECD), and validated for screening and quantification of 15 pesticide residues at trace levels in cabbage, broccoli, cauliflower, lettuce, celery, spinach, and mustard. The method consists of two steps, first, to determine the significance of each factor by Pareto chart followed by optimization of these significant factors using central composite design (CCD). Minitab statistical software was used for these multivariate experiments for the generation of 2 4-1 design and CCD matrices. The method evaluation was done by external standard calibration with linearity range between 0.5 and 3mg/kg, with correlation coefficient 0.99, limit of detection (LOD) ranges between 0.02 and 4.5ng/g, and limit of quantification (LOQ) ranges between 0.2 and 45ng/g. The average recovery was between 60% and 128%, with RSD 0.2-19.8%. The method was applied on real vegetable samples from Cameron Highlands. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods

    Science.gov (United States)

    Wu, Yuhua; Wang, Yulei; Li, Jun; Li, Wei; Zhang, Li; Li, Yunjing; Li, Xiaofei; Li, Jun; Zhu, Li; Wu, Gang

    2014-01-01

    The Cauliflower mosaic virus (CaMV) 35S promoter (P35S) is a commonly used target for detection of genetically modified organisms (GMOs). There are currently 24 reported detection methods, targeting different regions of the P35S promoter. Initial assessment revealed that due to the absence of primer binding sites in the P35S sequence, 19 of the 24 reported methods failed to detect P35S in MON88913 cotton, and the other two methods could only be applied to certain GMOs. The rest three reported methods were not suitable for measurement of P35S in some testing events, because SNPs in binding sites of the primer/probe would result in abnormal amplification plots and poor linear regression parameters. In this study, we discovered a conserved region in the P35S sequence through sequencing of P35S promoters from multiple transgenic events, and developed new qualitative and quantitative detection systems targeting this conserved region. The qualitative PCR could detect the P35S promoter in 23 unique GMO events with high specificity and sensitivity. The quantitative method was suitable for measurement of P35S promoter, exhibiting good agreement between the amount of template and Ct values for each testing event. This study provides a general P35S screening method, with greater coverage than existing methods. PMID:25483893

  9. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    Science.gov (United States)

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  10. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    Science.gov (United States)

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  11. HR-MAS NMR metabolomics of 'Swingle' citrumelo rootstock genetically modified to overproduce proline.

    Science.gov (United States)

    de Oliveira, Caroline S; Carlos, Eduardo F; Vieira, Luiz G E; Lião, Luciano M; Alcantara, Glaucia B

    2014-08-01

    The accumulation of proline is a typical physiological response to abiotic stresses in higher plants. 'Swingle' citrumelo, an important rootstock for citrus production, has been modified with a mutated Δ(1)-pyrroline-5-carboxylate synthetase gene (VaP5CSF129A) linked to the cauliflower mosaic virus 35S promoter to induce the overproduction of free proline. This paper presents a comparative metabolomic study of nontransgenic versus transgenic 'Swingle' citrumelo plants with high endogenous proline. (1)H high-resolution magic angle spinning nuclear magnetic resonance spectroscopy and multivariate analysis showed significant differences in some metabolites between the nontransgenic and transgenic leaves and roots. The overproduction of proline has reduced the sucrose content in transgenic leaves, revealing a metabolic cost for these plants. In roots, the high level of free proline acts for the adjustment of cation-anion balance, causing the reduction of acetic acid content. The same sucrose level in roots indicates that they can be considered as sucrose sink. Similar behavior may be waited for fruits produced on transgenic rootstock. Copyright © 2014 John Wiley & Sons, Ltd.

  12. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  13. Matrix metalloproteinases operate redundantly in Arabidopsis immunity against necrotrophic and biotrophic fungal pathogens.

    Directory of Open Access Journals (Sweden)

    Puyan Zhao

    Full Text Available Matrix metalloproteinases (MMPs are evolutionarily conserved and multifunctional effector molecules playing pivotal roles in development and homeostasis. In this study we explored the involvement of the five Arabidopsis thaliana At-MMPs in plant defence against microbial pathogens. Expression of At2-MMP was most responsive to inoculation with fungi and a bacterial pathogen followed by At3-MMP and At5-MMP, while At1-MMP and At4-MMP were non-responsive to these biotic stresses. Loss-of-function mutants for all tested At-MMPs displayed increased susceptibility to the necrotrophic fungus Botrytis cinerea and double mutant at2,3-mmp and triple mutant at2,3,5-mmp plants developed even stronger symptoms. Consistent with this, transgenic Arabidopsis plants that expressed At2-MMP constitutively under the Cauliflower mosaic virus 35S promoter showed enhanced resistance to the necrotrophic pathogen. Similarly, resistance to the biotrophic Arabidopsis powdery mildew fungus Golovinomyces orontii was also compromised particularly in the at2,3-mmp / at2,3,5-mmp multiplex mutants, and increased in At2-MMP overexpressor plants. The degree of disease resistance of at-mmp mutants and At2-MMP overexpressor plants also correlated positively with the degree of MAMP-triggered callose deposition in response to the bacterial flagellin peptide flg22, suggesting that matrix metalloproteinases contribute to pattern-triggered immunity (PTI in interactions of Arabidopsis with necrotrophic and biotrophic pathogens.

  14. The Grape VlWRKY3 Gene Promotes Abiotic and Biotic Stress Tolerance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Rongrong Guo

    2018-04-01

    Full Text Available WRKY transcription factors are known to play important roles in plant responses to various abiotic and biotic stresses. The grape WRKY gene, WRKY3 was previously reported to respond to salt and drought stress, as well as methyl jasmonate and ethylene treatments in Vitis labrusca × V. vinifera cv. ‘Kyoho.’ In the current study, WRKY3 from the ‘Kyoho’ grape cultivar was constitutively expressed in Arabidopsis thaliana under control of the cauliflower mosaic virus 35S promoter. The 35S::VlWRKY3 transgenic A. thaliana plants showed improved salt and drought stress tolerance during the germination, seedling and the mature plant stages. Various physiological traits related to abiotic stress responses were evaluated to gain further insight into the role of VlWRKY3, and it was found that abiotic stress caused less damage to the transgenic seedlings than to the wild-type (WT plants. VlWRKY3 over-expression also resulted in altered expression levels of abiotic stress-responsive genes. Moreover, the 35S::VlWRKY3 transgenic A. thaliana lines showed improved resistance to Golovinomyces cichoracearum, but increased susceptibility to Botrytis cinerea, compared with the WT plants. Collectively, these results indicate that VlWRKY3 plays important roles in responses to both abiotic and biotic stress, and modification of its expression may represent a strategy to enhance stress tolerance in crops.

  15. Absence of detectable transgenes in local landraces of maize in Oaxaca, Mexico (2003–2004)

    Science.gov (United States)

    Ortiz-García, S.; Ezcurra, E.; Schoel, B.; Acevedo, F.; Soberón, J.; Snow, A. A.

    2005-01-01

    In 2000, transgenes were detected in local maize varieties (landraces) in the mountains of Oaxaca, Mexico [Quist, D. & Chapela, I. H. (2001) Nature 414, 541–543]. This region is part of the Mesoamerican center of origin for maize (Zea mays L.), and the genetic diversity that is maintained in open-pollinated landraces is recognized as an important genetic resource of great cultural value. The presence of transgenes in landraces was significant because transgenic maize has never been approved for cultivation in Mexico. Here we provide a systematic survey of the frequency of transgenes in currently grown landraces. We sampled maize seeds from 870 plants in 125 fields and 18 localities in the state of Oaxaca during 2003 and 2004. We then screened 153,746 sampled seeds for the presence of two transgene elements from the 35S promoter of the cauliflower mosaic virus and the nopaline synthase gene (nopaline synthase terminator) from Agrobacterium tumefaciens. One or both of these transgene elements are present in all transgenic commercial varieties of maize. No transgenic sequences were detected with highly sensitive PCR-based markers, appropriate positive and negative controls, and duplicate samples for DNA extraction. We conclude that transgenic maize seeds were absent or extremely rare in the sampled fields. This study provides a much-needed preliminary baseline for understanding the biological, socioeconomic, and ethical implications of the inadvertent dispersal of transgenes from the United States and elsewhere to local landraces of maize in Mexico. PMID:16093316

  16. The effect of calcium on the composition and physical properties of whey protein particles prepared using emulsification.

    Science.gov (United States)

    Westerik, Nieke; Scholten, Elke; Corredig, Milena

    2015-06-15

    Protein microparticles were formed through emulsification of 25% (w/w) whey protein isolate (WPI) solutions containing various concentrations of calcium (0.0-400.0mM) in an oil phase stabilized by polyglycerol polyricinoleate (PGPR). The emulsions were heated (at 80°C) and the microparticles subsequently re-dispersed in an aqueous phase. Light microscopy and scanning electron microscopy (SEM) images revealed that control particles and those prepared with 7.4mM calcium were spherical and smooth. Particles prepared with 15.0mM calcium gained an irregular, cauliflower-like structure, and at concentrations larger than 30.0mM, shells formed and the particles were no longer spherical. These results describe, for the first time, the potential of modulating the properties of dense whey protein particles by using calcium, and may be used as structuring agents for the design of functional food matrices with increased protein and calcium content. Copyright © 2015. Published by Elsevier Ltd.

  17. Inexpensive, effective novel activated carbon fibers for sample cleanup: application to multipesticide residue analysis in food commodities using a QuEChERS method.

    Science.gov (United States)

    Singh, Shiv; Srivastava, Anshuman; Singh, Sheelendra Pratap

    2018-03-01

    Phenolic resin based activated carbon fibers (ACFs) were applied for the first time as a reversed-dispersive solid-phase extraction (r-DSPE) sorbent. A modified quick, easy, cheap, effective, rugged, and safe (QuEChERS) method was applied to determine 26 pesticides (organophosphates, organochlorines, synthetic pyrethroids, and herbicides) in different complex matrices, including cauliflower, cucumber, banana, apple, wheat, and black gram. Different physicochemical characterization techniques were used to investigate the engineering and structural properties of the r-DSPE sorbent. All the chromatographic analyses were performed with a gas chromatograph equipped with an electron capture detector. The recoveries of all 26 pesticides were acceptable (70-120%), with relative standard deviations of less than 15%. The limit of detection and the limit of quantification were 1.13-5.48 ng/g and 3.42-16.60 ng/g, respectively. In the original QuEChERS method, primary secondary amine is extensively used as the r-DSPE sorbent in the cleanup process, but it is eightfold more expensive than the ACFs used in this study. Therefore, the modified QuEChERS method using ACFs during the cleanup process is more efficient, cheaper, and more robust to determine pesticides from different types of matrices, including vegetables, grains, and fruits, and ACFs could be used as a cost-effective alternative to primary secondary amine. Graphical Abstract Sample clean-up using PSA and ACF as r-DSPE sorbent in QuEChERS method.

  18. Effects of alternative cropping systems on globe artichoke qualitative traits.

    Science.gov (United States)

    Spanu, Emanuela; Deligios, Paola A; Azara, Emanuela; Delogu, Giovanna; Ledda, Luigi

    2018-02-01

    Traditionally, globe artichoke cultivation in the Mediterranean basin is based on monoculture and on use of high amounts of nitrogen fertiliser. This raises issues regarding its compatibility with sustainable agriculture. We studied the effect of one typical conventional (CONV) and two alternative cropping systems [globe artichoke in sequence with French bean (NCV1), or in biannual rotation (NCV2) with cauliflower and with a leguminous cover crop in inter-row spaces] on yield, polyphenol and mineral content of globe artichoke heads over two consecutive growing seasons. NCV2 showed statistical differences in terms of fresh product yield with respect to the monoculture systems. In addition, the dihydroxycinnamic acids and dicaffeoylquinic acids of non-conventional samples were one-fold significantly higher than the conventional one. All the samples reported good mineral content, although NCV2 achieved a higher Fe content than conventional throughout the two seasons. After two and three dates of sampling, the CONV samples showed the highest levels of K content. In our study, an acceptable commercial yield and quality of 'Spinoso sardo' were achieved by shifting the common conventional agronomic management to more sustainable ones, by means of an accurate choice of cover crop species and rotations introduced in the systems. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  19. Characteristic analysis on the physical properties of nanostructured Mg-doped CdO thin films—Doping concentration effect

    Directory of Open Access Journals (Sweden)

    K. Usharani

    2015-06-01

    Full Text Available Highly conductive and transparent magnesium-doped cadmium oxide (CdO:Mg thin films have been deposited on suitably cleaned glass substrates maintained at 375 °C by spray pyrolysis technique using perfume atomizer. The magnesium content in the films is varied from 0 to 8 at% in steps of 2 at%. The effect of Mg doping on the structural, morphological, optical and electrical properties of the CdO thin films has been studied. All the films exhibited cubic structure with a preferential orientation along the (1 1 1 plane irrespective of the Mg doping level. SEM analysis showed that the film morphology modifies from spherical shaped grains to closely packed cauliflower shaped nanostructures with Mg doping. Except for the film coated with 2 at% Mg dopant, all the other doped films exhibited a blue shift in the optical band gap. Electrical studies revealed that the CdO:Mg film coated with 8 at% Mg dopant had a minimum resistivity of 0.0853×101 Ω-cm.

  20. Food consumption and adipose tissue DDT levels in Mexican women

    Directory of Open Access Journals (Sweden)

    Marcia Galván-Portillo

    2002-04-01

    Full Text Available This article analyzes food consumption in relation to levels of DDE (the principal metabolite of DDT in the adipose tissue of 207 Mexican women residing in States with high and low exposure to DDT. Data on the women's dietary habits and childbearing history were obtained from a personal interview. Adipose tissue DDE levels were measured by gas-liquid chromatography and compared by analysis of variance (ANOVA and multiple linear regression. Adipose tissue DDE levels increased significantly with age (p = 0.005 and residence in coastal areas (p = 0.002 and non-significantly with the consumption of onion, cauliflower, prickly pear, squash blossoms, sweet corn, broad beans, chili pepper sauce, ham, and fish. Even so, during breastfeeding there was a non-significant reduction in these levels. The findings suggest that certain foods serve as vehicles for DDE residues and confirm that breastfeeding is a mechanism for the elimination of this insecticide, which accumulates over the years in the human body.

  1. Goitrogens And Goitre— A Clinicosocial Study Of Association

    Directory of Open Access Journals (Sweden)

    M Athar Ansari

    2003-06-01

    Full Text Available Research Problem : Is there any role of goitrogens in the causation of goitre? Objectives :    (1     To describe the intake of goitrogenic substances in goitrous and non-goitrous patients. (2 To find out the types and frequency of goitrogenic subtanccs in these patients. Study Design : Hospital-based Study by Questionnaire Method. Setting : Endocrinology Out Patients Department, J.N.Medical college Hospital, A.M.U., Aligarh. Participants : Cases were patients having clinical features of iodine deficiency disorders (IDD and controls were not having goiter but they had other endocrinological disorders in the Endocrinology O.P.D. at J.N. Medical College Hospital, A.M.U., Aligarh. Study variables : Intake, type and frequency of goitrogenic substances. Outcome variables : Percentage of goitrous and nongoitrous patients consuming goitrogenic substances. Statistical Analysis : Chi-Square Test. Result : In goitrous patients, a dietary' history' of goitrogen intake was found in 93.85% patients while in nongoitrous patients, it was 76.92%, Commonly consumed vegetables having goitrogenic properties were Cabbage, Cauliflower and Lady’s finger. Intake was frequent (once a week in most of the goitrous patients while it was taken occasional (once fortnightly in most of the nongoitrous patients. Conclusion : Majority of the goitrous patients were consuming goitrogenic substances. Their role in the causation of goiter is clearly understood. However, for this further research activities should be carried out to find out the strength of association.

  2. Sporamin-mediated resistance to beet cyst nematodes (Heterodera schachtii Schm.) is dependent on trypsin inhibitory activity in sugar beet (Beta vulgaris L.) hairy roots.

    Science.gov (United States)

    Cai, Daguang; Thurau, Tim; Tian, Yanyan; Lange, Tina; Yeh, Kai-Wun; Jung, Christian

    2003-04-01

    Sporamin, a sweet potato tuberous storage protein, is a Kunitz-type trypsin inhibitor. Its capability of conferring insect-resistance on transgenic tobacco and cauliflower has been confirmed. To test its potential as an anti-feedant for the beet cyst nematode (Heterodera schachtii Schm.), the sporamin gene SpTI-1 was introduced into sugar beet (Beta vulgaris L.) by Agrobacterium rhizogenes-mediated transformation. Twelve different hairy root clones expressing sporamin were selected for studying nematode development. Of these, 8 hairy root clones were found to show significant efficiency in inhibiting the growth and development of the female nematodes whereas 4 root clones did not show any inhibitory effects even though the SpTI-1 gene was regularly expressed in all of the tested hairy roots as revealed by northern and western analyses. Inhibition of nematode development correlated with trypsin inhibitor activity but not with the amount of sporamin expressed in hairy roots. These data demonstrate that the trypsin inhibitor activity is the critical factor for inhibiting growth and development of cyst nematodes in sugar beet hairy roots expressing the sporamin gene. Hence, the sweet potato sporamin can be used as a new and effective anti-feedant for controlling cyst nematodes offering an alternative strategy for establishing nematode resistance in crops.

  3. Heavy metal contamination of vegetables from green markets in Novi Sad

    Directory of Open Access Journals (Sweden)

    Arsenov Danijela D.

    2016-01-01

    Full Text Available are valuable source of vitamins, minerals and fibers important for healthy human nutrition. However, an increased level of heavy metals in vegetables has been noticed in recent years. This study was conducted with an aim to analyze content of heavy metals, cadmium (Cd, lead (Pb, and chromium (Cr in 11 vegetable species which are the most common in human diet. Vegetables were collected from three green markets (Limanska, Futoška and Riblja pijaca in Novi Sad, during September and October, from 2009 to 2011. Heavy metal contents were analyzed in edible parts of tomato, potato, spinach, onion, beetroot, parsley, parsnip, carrot, cauliflower, pepper and broccoli using atomic absorption spectrophotometer (Varian, AAS 240FS. The results showed statistically significant differences in element concentrations among analyzed vegetables. In general, the highest metal pollution was observed in the year of 2011. Spinach was found to contain the highest metals content - 0.89 μg/g for Cd, 5.81 μg/g for Pb, and 3.67 μg/g for Cr. According to Serbian official regulations, 18.18% of all analyzed species exceeded maximum permissible level for Cd, 9.09% for Pb, while for Cr these limits are not defined. Elevated content of heavy metals in vegetables might be related to soil contamination, atmospheric depositions during transportation and marketing. Thus, a continuous monitoring of vegetables on markets should be performed in order to prevent potential health risks to consumers.

  4. Transgenic fertile Scoparia dulcis L., a folk medicinal plant, conferred with a herbicide-resistant trait using an Ri binary vector.

    Science.gov (United States)

    Yamazaki, M; Son, L; Hayashi, T; Morita, N; Asamizu, T; Mourakoshi, I; Saito, K

    1996-01-01

    Transgenic herbicide-resistant Scoparia dulcis plants were obtained by using an Ri binary vector system. The chimeric bar gene encoding phosphinothricin acetyltransferase flanked by the promoter for cauliflower mosaic virus 35S RNA and the terminal sequence for nopaline synthase was introduced in the plant genome by Agrobacterium-mediated transformation by means of scratching young plants. Hairy roots resistant to bialaphos were selected and plantlets (R0) were regenerated. Progenies (S1) were obtained by self-fertilization. The transgenic state was confirmed by DNA-blot hybridization and assaying of neomycin phosphotransferase II. Expression of the bar gene in the transgenic R0 and S1 progenies was indicated by the activity of phosphinothricin acetyltransferase. Transgenic plants accumulated scopadulcic acid B, a specific secondary metabolite of S. dulcis, in amounts of 15-60% compared with that in normal plants. The transgenic plants and progenies showed resistant trait towards bialaphos and phosphinothricin. These results suggest that an Ri binary system is one of the useful tools for the transformation of medicinal plants for which a regeneration protocol has not been established.

  5. Improving the biocontrol potential of entomopathogenic nematodes against Mamestra brassicae: effect of spray application technique, adjuvants and an attractant.

    Science.gov (United States)

    Beck, Bert; Brusselman, Eva; Nuyttens, David; Moens, Maurice; Temmerman, Femke; Pollet, Sabien; Van Weyenberg, Stephanie; Spanoghe, Pieter

    2014-01-01

    Steinernema carpocapsae Weiser, an entomopathogenic nematode (EPN), is a potential biological control agent for the cabbage moth (Mamestra brassicae L.). This research aimed to identify a suitable spray application technique, and to determine whether yeast extract added to an EPN spray has an attracting and/or a feeding stimulant effect on M. brassicae. The biological control capabilities of EPN against this pest were examined in the field. Good coverage of the underside of cauliflower leaves, the habitat of young instar larvae (L1-L4) of M. brassicae was obtained using different spray boom configurations with vertical extensions that carried underleaf spraying nozzles. One of the configurations was selected for field testing with an EPN spray. Brewer's yeast extract stimulated larval feeding on leaves, and increased the mortality of these larvae when exposed to EPN. The field trial showed that a spray application with S. carpocapsae, Addit and xanthan gum can effectively lower the numbers of cabbage heads damaged by M. brassicae. Brewer's yeast extract did not significantly increase this field performance of EPN. Steinernema carpocapsae, applied with an appropriate spray technique, can be used within biological control schemes as part of a resistance management programme for Bt. © 2013 Society of Chemical Industry.

  6. Transgenic loblolly pine (Pinus taeda L.) plants expressing a modified delta-endotoxin gene of Bacillus thuringiensis with enhanced resistance to Dendrolimus punctatus Walker and Crypyothelea formosicola Staud.

    Science.gov (United States)

    Tang, Wei; Tian, Yingchuan

    2003-02-01

    A synthetic version of the CRY1Ac gene of Bacillus thuringiensis has been used for the transformation of loblolly pine (Pinus taeda L.) using particle bombardment. Mature zygotic embryos were used to be bombarded and to generate organogenic callus and transgenic regenerated plants. Expression vector pB48.215 DNA contained a synthetic Bacillus thuringiensis (B.t.) CRY1Ac coding sequence flanked by the double cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (NOS) terminator sequences, and the neomycin phosphotransferase II (NPTII) gene controlled by the promoter of the nopaline synthase gene was introduced into loblolly pine tissues by particle bombardment. The transformed tissues were proliferated and selected on media with kanamycin. Shoot regeneration was induced from the kanamycin-resistant calli, and transgenic plantlets were then produced. More than 60 transformed plants from independent transformation events were obtained for each loblolly pine genotype tested. The integration and expression of the introduced genes in the transgenic loblolly pine plants was confirmed by polymerase chain reactions (PCR) analysis, by Southern hybridization, by Northern blot analysis, and by Western blot analysis. Effective resistance of transgenic plants against Dendrolimus punctatus Walker and Crypyothelea formosicola Staud was verified in feeding bioassays with the insects. The transgenic plants recovered could represent a good opportunity to analyse the impact of genetic engineering of pine for sustainable resistance to pests using a B. thuringiensis insecticidal protein. This protocol enabled the routine transformation of loblolly pine plants that were previously difficult to transform.

  7. Ice films follow structure zone model morphologies

    International Nuclear Information System (INIS)

    Cartwright, Julyan H.E.; Escribano, Bruno; Sainz-Diaz, C. Ignacio

    2010-01-01

    Ice films deposited at temperatures of 6-220 K and at low pressures in situ in a cryo-environmental scanning electron microscope show pronounced morphologies at the mesoscale consistent with the structure zone model of film growth. Water vapour was injected directly inside the chamber at ambient pressures ranging from 10 -4 Pa to 10 2 Pa. Several different substrates were used to exclude the influence of their morphology on the grown films. At the lowest temperatures the ice, which under these conditions is amorphous on the molecular scale, shows the mesoscale morphologies typical of the low-temperature zones of the structure zone model (SZM), including cauliflower, transition, spongelike and matchstick morphologies. Our experiments confirm that the SZM is independent of the chemical nature of the adsorbate, although the intermolecular interactions in water (hydrogen bonds) are different to those in ceramics or metals. At higher temperatures, on the other hand, where the ice is hexagonal crystalline on the molecular scale, it displays a complex palmlike morphology on the mesoscale.

  8. Heterologous Acidothermus cellulolyticus 1,4-β-Endoglucanase E1 Produced Within the Corn Biomass Converts Corn Stover Into Glucose

    Science.gov (United States)

    Ransom, Callista; Balan, Venkatesh; Biswas, Gadab; Dale, Bruce; Crockett, Elaine; Sticklen, Mariam

    Commercial conversion of lignocellulosic biomass to fermentable sugars requires inexpensive bulk production of biologically active cellulase enzymes, which might be achieved through direct production of these enzymes within the biomass crops. Transgenic corn plants containing the catalytic domain of Acidothermus cellulolyticus E1 endo-1,4-β glucanase and the bar bialaphos resistance coding sequences were generated after Biolistic® (BioRad Hercules, CA) bombardment of immature embryo-derived cells. E1 sequences were regulated under the control of the cauliflower mosaic virus 35S promoter and tobacco mosaic virus translational enhancer, and E1 protein was targeted to the apoplast using the signal peptide of tobacco pathogenesis-related protein to achieve accumulation of this enzyme. The integration, expression, and segregation of E1 and bar transgenes were demonstrated, respectively, through Southern and Western blotting, and progeny analyses. Accumulation of up to 1.13% of transgenic plant total soluble proteins was detected as biologically active E1 by enzymatic activity assay. The corn-produced, heterologous E1 could successfully convert ammonia fiber explosion-pretreated corn stover polysaccharides into glucose as a fermentable sugar for ethanol production, confirming that the E1 enzyme is produced in its active from.

  9. Radiotracer studies of fungicide residues in food plants

    International Nuclear Information System (INIS)

    1990-04-01

    Agricultural fungicides are chemicals used on seeds, crops and in soils throughout the growing season. Fungicide treatments may lead to various levels of chemical residues in food commodities. Primary emphasis has been placed on ethylenebisdithiocarbamates (EBDCs), an important group of agrofungicides used in preparations for spraying or dusting major crops such as apples, pears, broccoli, cabbages, egg plants, cauliflower, grapes, lettuce, peppers, celery, cucumbers and tomatoes. Treatments with EBDCs result in terminal residues containing ethylenthiourea (ETU). This is a toxicologically significant decomposition product which has attracted considerable attention in recent years due to indications of its potential goitrogenic and carcinogenic properties. In recognition of the need for a coordinated examination of ETU levels in food, particularly under tropical conditions, the program of radiotracer techniques as a tool for studying fungicide residue problems on food was initiated in 1984. In current studies, three EBDCs, maneb, zineb and mancozeb from different manufacturers in different countries were analysed. This report describes the model protocols (Annexes I, II and III) as they were set up for determination of residues in commodities and soil, using radiotracer and conventional chromatographic techniques . In the 16 papers presented in this report C 14 -labelled EBDCs are determined in plants, vegetables, and soils, before and after cooking, as a function of time and of other agricultural parameters. Refs, figs and tabs

  10. Vortex-Assisted Dispersive Micro-Solid Phase Extraction Using CTAB-Modified Zeolite NaY Sorbent Coupled with HPLC for the Determination of Carbamate Insecticides.

    Science.gov (United States)

    Salisaeng, Pawina; Arnnok, Prapha; Patdhanagul, Nopbhasinthu; Burakham, Rodjana

    2016-03-16

    A vortex-assisted dispersive micro-solid phase extraction (VA-D-μ-SPE) based on cetyltrimethylammonium bromide (CTAB)-modified zeolite NaY was developed for preconcentration of carbamate pesticides in fruits, vegetables, and natural surface water prior to analysis by high performance liquid chromatography with photodiode array detection. The small amounts of solid sorbent were dispersed in a sample solution, and extraction occurred by adsorption in a short time, which was accelerated by vortex agitation. Finally, the sorbents were filtered from the solution, and the analytes were subsequently desorbed using an appropriate solvent. Parameters affecting the VA-D-μ-SPE performance including sorbent amount, sample volume, desorption solvent ,and vortex time were optimized. Under the optimum condition, linear dynamic ranges were achieved between 0.004-24.000 mg kg(-1) (R(2) > 0.9946). The limits of detection (LODs) ranged from 0.004-4.000 mg kg(-1). The applicability of the developed procedure was successfully evaluated by the determination of the carbamate residues in fruits (dragon fruit, rambutan, and watermelon), vegetables (cabbage, cauliflower, and cucumber), and natural surface water.

  11. Improvement of Amperometric Sensor Used for Determination of Nitrate with Polypyrrole Nanowires Modified Electrode

    Directory of Open Access Journals (Sweden)

    Shi-chang Wang

    2005-12-01

    Full Text Available Polypyrrole(PPy nanowire modified electrodes were developed by template-freeelectrochemical method based on graphite electrode. The modified electrode wascharacterized by their amperometric response towards nitrate ions. Before reduction ofnitrate ions, electrochemical solid-phase extraction (EC-SPE of nitrate in/on modifiedelectrodes was conducted. It is found that the unusual nanowired structure of polypyrrolelayer (instead of well known cauliflower structure allows us to increase the effectivesurface area of the electrode and subsequently the sensitivity. And the effects ofelectrochemical preparation parameters of PPy nanowire modified electrodes on theircorresponding characters were evaluated. The experimental results show that theelectrochemical preparation parameters of the modified electrodes such as scan rate,polymerization potential, temperature of polymerization solution and polymerization timehave significantly effects on the morphology of PPy nanowires and subsequently effectivesurface area of the electrode and electroreduction current density of nitrate. Thedetermination sensitivity may be varied according to the modification parameters. Under acertain polymerization conditions, the corresponding sensitivity reaches 336.28 mA/M cm2 and the detection limit is 1.52×10-6 M. The proposed method was successfully applied in thedetection of nitrate in the real samples.

  12. Construction of Agrobacterium tumefaciens-mediated tomato black ring virus infectious cDNA clones.

    Science.gov (United States)

    Zarzyńska-Nowak, Aleksandra; Ferriol, Inmaculada; Falk, Bryce W; Borodynko-Filas, Natasza; Hasiów-Jaroszewska, Beata

    2017-02-15

    Tomato black ring virus (TBRV, genus Nepovirus) infects a wide range of economically important plants such as tomato, potato, tobacco and cucumber. Here, a successful construction of infectious full-length cDNA clones of the TBRV genomic RNAs (RNA1 and RNA2) is reported for the first time. The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS). The symptoms induced on plants agroinoculated with both constructs were indistinguishable from those caused by the wild-type virus. The infectivity of obtained clones was verified by reinoculation to Nicotiana tabacum cv. Xanthi, Chenopodium quinoa and Cucumis sativus. The presence of viral particles and RNA was confirmed by electron microscopy and reverse transcription polymerase chain reaction, respectively. Constructed full-length infectious cDNA clones will serve as an excellent tool to study virus-host-vector interactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Heavy metals in vegetables sold in the local market in Jordan.

    Science.gov (United States)

    Osaili, Tareq M; Al Jamali, Abbas F; Makhadmeh, Ibrahim M; Taha, Mohammad; Jarrar, Sukiena K

    2016-09-01

    Heavy metals (As, Cd, Co, Cr, Cu, Mn, Ni, Pb and Zn) in various vegetables (cabbage, green onion, lettuce, parsley, rocket, spinach, carrot, onion, potato and cauliflower) from the market in Jordan were measured using inductively coupled plasma-mass spectrometry. As, Cd, Co, Cr, Cu, Mn, Ni, Pb and Zn ranged from 0.009-0.275 mg kg(-1) wet weight, 0.004-0.060 mg kg(-1), 0.003-0.401 mg kg(-1), 0.105-3.51 mg kg(-1), 0.15-1.15 mg kg(-1), 0.93-14.39 mg kg(-1), 0.044-0.702 mg kg(-1), 0.072-0.289 mg kg(-1) and 2.23-6.65 mg kg(-1), respectively. Parsley, followed by spinach, contained the highest concentration of heavy metals. Onion contained high levels of toxic heavy metals. The content of Cu in parsley and spinach and Pb in onion exceeded the Codex limits. However, the daily intake of heavy metals from the tested vegetables was lower than the maximum limits for allowable intake.

  14. UAE-HPLC-UV: New Contribution for Fast Determination of Total Isothiocyanates in Brassicaceae Vegetables

    Directory of Open Access Journals (Sweden)

    Cecilia M. Fusari

    2015-01-01

    Full Text Available Total isothiocyanates content (ITC is considered a good indicator of bioactive compounds responsible for beneficial effects related to Brassicaceae vegetables. Analytical performance is a critical factor for routine analysis in plant tissues. The extraction technique for isolating phytochemicals from Brassicaceae vegetables is currently the bottleneck of the methodology. The aim of this work was to optimize this step in the analytical process. Fast and less expensive alternative, based on ultrasound-assisted extraction technique (UAE for direct extraction of GLS into an aqueous phase and further analysis of the hydrolysis product, was optimized. Full factorial (2k design followed by Central Composite Design (CCD was used to obtain the optimum extraction conditions. Selected conditions were homogenization time (9 min; ultrasound bath time (5 min; and sample-to-solvent ratio (1 : 5 w/v mg mL−1. The proposed analytical methodology exhibits satisfactory analytical performance in terms of linearity, precision (RSD < 2.4%, and limits of detection (26 nmol g−1 w.w.. The new analytical methodology was applied to cauliflower, cabbage, watercress, and broccoli samples with recoveries higher than 86%. The UAE extraction technique was showed to be efficient for real samples analysis leading to sensible, selective, and reproducible methodology for ITC analysis.

  15. Post-piercing perichondritis.

    Science.gov (United States)

    Fernandez, André de Paula; Castro Neto, Ivan de; Anias, Christiane Ribeiro; Pinto, Patrícia Ciminelli Linhares; Castro, Jair de Carvalho E; Carpes, Arturo Frick

    2008-01-01

    Piercing has become more and more popular among adolescents. The procedure is generally performed by unqualified professionals and carries its risk. Non-sterilized material or inappropiate hygiene increases the possibility of perichondritis and celulitis. The disease is characterized by erythema of the auricula pinna, unbearable pain and fever. Left untreated, the condition progresses with edema along the auricula and abscess formation that may result in ischemic necrosis and a cauliflower anesthetic deformation. The most common bacteria is Pseudomonas aeruginosa. In cases with abscesses, drainage is necessary along with antibiotic therapy guided by cultures and antibiogram. The aim of this case report was to review the past 10 years of published papers dealing with anatomical aspects of the auricular pinna, the history of piercing and its most common complications. A case report of perichondritis after 'high' ear piercing that required surgical treatment and that progressed with no esthetic loss. Theoretical and practical experience based on a review and a report of a case that progressed satisfactorily. The increased incidence of perichondritis in adolescents should require more elaborated primary prevention measures.

  16. A Conserved Acidic Motif in the N-Terminal Domain of Nitrate Reductase Is Necessary for the Inactivation of the Enzyme in the Dark by Phosphorylation and 14-3-3 Binding1

    Science.gov (United States)

    Pigaglio, Emmanuelle; Durand, Nathalie; Meyer, Christian

    1999-01-01

    It has previously been shown that the N-terminal domain of tobacco (Nicotiana tabacum) nitrate reductase (NR) is involved in the inactivation of the enzyme by phosphorylation, which occurs in the dark (L. Nussaume, M. Vincentz, C. Meyer, J.P. Boutin, and M. Caboche [1995] Plant Cell 7: 611–621). The activity of a mutant NR protein lacking this N-terminal domain was no longer regulated by light-dark transitions. In this study smaller deletions were performed in the N-terminal domain of tobacco NR that removed protein motifs conserved among higher plant NRs. The resulting truncated NR-coding sequences were then fused to the cauliflower mosaic virus 35S RNA promoter and introduced in NR-deficient mutants of the closely related species Nicotiana plumbaginifolia. We found that the deletion of a conserved stretch of acidic residues led to an active NR protein that was more thermosensitive than the wild-type enzyme, but it was relatively insensitive to the inactivation by phosphorylation in the dark. Therefore, the removal of this acidic stretch seems to have the same effects on NR activation state as the deletion of the N-terminal domain. A hypothetical explanation for these observations is that a specific factor that impedes inactivation remains bound to the truncated enzyme. A synthetic peptide derived from this acidic protein motif was also found to be a good substrate for casein kinase II. PMID:9880364

  17. Dietary Glucosinolates Sulforaphane, Phenethyl Isothiocyanate, Indole-3-Carbinol/3,3'-Diindolylmethane: Anti-Oxidative Stress/Inflammation, Nrf2, Epigenetics/Epigenomics and In Vivo Cancer Chemopreventive Efficacy.

    Science.gov (United States)

    Fuentes, Francisco; Paredes-Gonzalez, Ximena; Kong, Ah-Ng Tony

    2015-05-01

    Glucosinolates are a group of sulfur-containing glycosides found in many plant species, including cruciferous vegetables such as broccoli, cabbage, brussels sprouts, and cauliflower. Accumulating evidence increasingly supports the beneficial effects of dietary glucosinolates on overall health, including as potential anti-cancer agents, because of their role in the prevention of the initiation of carcinogenesis via the induction of cellular defense detoxifying/antioxidant enzymes and their epigenetic mechanisms, including modification of the CpG methylation of cancer-related genes, histone modification regulation and changes in the expression of miRNAs. In this context, the defense mechanism mediated by Nrf2-antioxidative stress and anti-inflammatory signaling pathways can contribute to cellular protection against oxidative stress and reactive metabolites of carcinogens. In this review, we summarize the cancer chemopreventive role of naturally occurring glucosinolate derivatives as inhibitors of carcinogenesis, with particular emphasis on specific molecular targets and epigenetic alterations in in vitro and in vivo human cancer animal models.

  18. Absorption of UV-B to blue light radiation by leaf cuticles of selected crop plants

    International Nuclear Information System (INIS)

    Baur, P.; Stulle, K.; Schönherr, J.; Uhlig, B.

    1998-01-01

    Plants have protective pigments absorbing destructive shortwave radiation. These pigments have been found in the epidermis and mesophyll of leaves. We studied the absorption characteristics of the leaf cuticle, the outermost part of the epidermis that is directly exposed to radiation. Adaxial leaf cuticles of apple, pear, sour cherry, strawberry, cauliflower, sugarbeet, and 13 other plant species were tested. The UV-B absorption was highest in Citrus aurantium and Citrus maxima (<3 % transmittance) and lowest in sugarbeet and peach (>64 % transmittance). The absorption maxima are at wavelenghts below 320 nm. Significant absorption was also determined at 500 nm, which correlated with cuticle thickness of the plant species (r(2)=0.72). The absorption in the range of 250 to 350 nm is caused by pigments with a high extinction coefficient. This absorption is species dependent and the patterns were designated to three different types. The highest absorption was found in evergreen species. The extraction of cuticular waxes had little effect on absorption. The specific absorption of shortwave radiation by plant cuticles is probably caused by pigments covalently bound to cut in. It is known for some plant species that cuticles can contain the phenolics p-coumaric acid, ferulic acid, and vanillic acid. Mixtures of these phenolics had spectra similar to cuticles. For most species absorption of shortwave radiation by the cuticle alone does not give complete protection

  19. Validation of a newly developed hexaplex real-time PCR assay for screening for presence of GMOs in food, feed and seed.

    Science.gov (United States)

    Bahrdt, C; Krech, A B; Wurz, A; Wulff, D

    2010-03-01

    For years, an increasing number and diversity of genetically modified plants has been grown on a commercial scale. The need for detection and identification of these genetically modified organisms (GMOs) calls for broad and at the same time flexible high throughput testing methods. Here we describe the development and validation of a hexaplex real-time polymerase chain reaction (PCR) screening assay covering more than 100 approved GMOs containing at least one of the GMO targets of the assay. The assay comprises detection systems for Cauliflower Mosaic Virus 35S promoter, Agrobacterium tumefaciens NOS terminator, Figwort Mosaic Virus 34S promoter and two construct-specific sequences present in novel genetically modified soybean and maize that lack common screening elements. Additionally a detection system for an internal positive control (IPC) indicating the presence or absence of PCR inhibiting substances was included. The six real-time PCR systems were allocated to five detection channels showing no significant crosstalk between the detection channels. As part of an extensive validation, a limit of detection (LOD(abs)) GMOs in processed and unprocessed food, feed and seed samples with high efficiency.

  20. Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

    Science.gov (United States)

    Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

    2014-07-01

    The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.