WorldWideScience

Sample records for cartilage developmental genes

  1. Expression of cartilage developmental genes in Hoxc8- and Hoxd4-transgenic mice.

    Directory of Open Access Journals (Sweden)

    Claudia Kruger

    2010-02-01

    Full Text Available Hox genes encode transcription factors, which regulate skeletal patterning and chondrocyte differentiation during the development of cartilage, the precursor to mature bone. Overexpression of the homeobox transcription factors Hoxc8 and Hoxd4 causes severe cartilage defects due to delay in cartilage maturation. Matrix metalloproteinases (MMPs, bone morphogenetic proteins (BMPs and fibroblastic growth factors (FGFs are known to play important roles in skeletal development and endochondral bone formation and remodeling. In order to investigate whether these molecules are aberrantly expressed in Hoxc8- and/or Hoxd4-transgenic cartilage, we performed quantitative RT-PCR on chondrocytes from Hox-transgenic mice. Gene expression levels of Bmp4, Fgf8, Fgf10, Mmp9, Mmp13, Nos3, Timp3, Wnt3a and Wnt5a were altered in Hoxc8-transgenic chondrocytes, and Fgfr3, Ihh, Mmp8, and Wnt3a expression levels were altered in Hoxd4-transgenic chondrocytes, respectively. Notably, Wnt3a expression was elevated in Hoxc8- and reduced in Hoxd4-transgenic cartilage. These results suggest that both transcription factors affect cartilage maturation through different molecular mechanisms, and provide the basis for future studies into the role of these genes and possible interactions in pathogenesis of cartilage defects in Hoxc8- and Hoxd4-transgenic mice.

  2. Cartilage-selective genes identified in genome-scale analysis of non-cartilage and cartilage gene expression

    Directory of Open Access Journals (Sweden)

    Cohn Zachary A

    2007-06-01

    Full Text Available Abstract Background Cartilage plays a fundamental role in the development of the human skeleton. Early in embryogenesis, mesenchymal cells condense and differentiate into chondrocytes to shape the early skeleton. Subsequently, the cartilage anlagen differentiate to form the growth plates, which are responsible for linear bone growth, and the articular chondrocytes, which facilitate joint function. However, despite the multiplicity of roles of cartilage during human fetal life, surprisingly little is known about its transcriptome. To address this, a whole genome microarray expression profile was generated using RNA isolated from 18–22 week human distal femur fetal cartilage and compared with a database of control normal human tissues aggregated at UCLA, termed Celsius. Results 161 cartilage-selective genes were identified, defined as genes significantly expressed in cartilage with low expression and little variation across a panel of 34 non-cartilage tissues. Among these 161 genes were cartilage-specific genes such as cartilage collagen genes and 25 genes which have been associated with skeletal phenotypes in humans and/or mice. Many of the other cartilage-selective genes do not have established roles in cartilage or are novel, unannotated genes. Quantitative RT-PCR confirmed the unique pattern of gene expression observed by microarray analysis. Conclusion Defining the gene expression pattern for cartilage has identified new genes that may contribute to human skeletogenesis as well as provided further candidate genes for skeletal dysplasias. The data suggest that fetal cartilage is a complex and transcriptionally active tissue and demonstrate that the set of genes selectively expressed in the tissue has been greatly underestimated.

  3. Stem Cells and Gene Therapy for Cartilage Repair

    Directory of Open Access Journals (Sweden)

    Umile Giuseppe Longo

    2012-01-01

    Full Text Available Cartilage defects represent a common problem in orthopaedic practice. Predisposing factors include traumas, inflammatory conditions, and biomechanics alterations. Conservative management of cartilage defects often fails, and patients with this lesions may need surgical intervention. Several treatment strategies have been proposed, although only surgery has been proved to be predictably effective. Usually, in focal cartilage defects without a stable fibrocartilaginous repair tissue formed, surgeons try to promote a natural fibrocartilaginous response by using marrow stimulating techniques, such as microfracture, abrasion arthroplasty, and Pridie drilling, with the aim of reducing swelling and pain and improving joint function of the patients. These procedures have demonstrated to be clinically useful and are usually considered as first-line treatment for focal cartilage defects. However, fibrocartilage presents inferior mechanical and biochemical properties compared to normal hyaline articular cartilage, characterized by poor organization, significant amounts of collagen type I, and an increased susceptibility to injury, which ultimately leads to premature osteoarthritis (OA. Therefore, the aim of future therapeutic strategies for articular cartilage regeneration is to obtain a hyaline-like cartilage repair tissue by transplantation of tissues or cells. Further studies are required to clarify the role of gene therapy and mesenchimal stem cells for management of cartilage lesions.

  4. Gene therapy for cartilage and bone tissue engineering

    CERN Document Server

    Hu, Yu-Chen

    2014-01-01

    "Gene Therapy for Cartilage and Bone Tissue Engineering" outlines the tissue engineering and possible applications of gene therapy in the field of biomedical engineering as well as basic principles of gene therapy, vectors and gene delivery, specifically for cartilage and bone engineering. It is intended for tissue engineers, cell therapists, regenerative medicine scientists and engineers, gene therapist and virologists. Dr. Yu-Chen Hu is a Distinguished Professor at the Department of Chemical Engineering, National Tsing Hua University and has received the Outstanding Research Award (National Science Council), Asia Research Award (Society of Chemical Engineers, Japan) and Professor Tsai-Teh Lai Award (Taiwan Institute of Chemical Engineers). He is also a fellow of the American Institute for Medical and Biological Engineering (AIMBE) and a member of the Tissue Engineering International & Regenerative Medicine Society (TERMIS)-Asia Pacific Council.

  5. Can one generate stable hyaline cartilage from adult mesenchymal stem cells? A developmental approach.

    Science.gov (United States)

    Hellingman, Catharine A; Koevoet, Wendy; van Osch, Gerjo J V M

    2012-11-01

    Chondrogenically differentiating bone marrow-derived mesenchymal stem cells (BMSCs) display signs of chondrocyte hypertrophy, such as production of collagen type X, MMP13 and alkaline phosphatase (ALPL). For cartilage reconstructions this is undesirable, as terminally differentiated cartilage produced by BMSCs mineralizes when implanted in vivo. Terminal differentiation is not restricted to BMSCs but is also encountered in chondrogenic differentiation of adipose-derived mesenchymal stem cells (MSCs) as well as embryonic stem cells, which by definition should be able to generate all types of tissues, including stable cartilage. Therefore, we propose that the currently used culture conditions may drive the cells towards terminal differentiation. In this manuscript we aim to review the literature, supplemented by our own data to answer the question, is it possible to generate stable hyaline cartilage from adult MSCs? We demonstrate that recently published methods for inhibiting terminal differentiation (through PTHrP, MMP13 or blocking phosphorylation of Smad1/5/8) result in cartilage formation with reduction of hypertrophic markers, although this does not reach the low level of stable chondrocytes. A set of hypertrophy markers should be included in future studies to characterize the phenotype more precisely. Finally, we used what is currently known in developmental biology about the differential development of hyaline and terminally differentiated cartilage to provide thought and insights to change current culture models for creating hyaline cartilage. Inhibiting terminal differentiation may not result in stable hyaline cartilage if the right balance of signals has not been created from the start of culture onwards. Copyright © 2011 John Wiley & Sons, Ltd.

  6. Cartilage.

    Science.gov (United States)

    Caplan, Arnold I.

    1984-01-01

    Cartilage is a fundamental biological material that helps to shape the body and then helps to support it. Its fundamental properties of strength and resilience are explained in terms of the tissue's molecular structure. (JN)

  7. Stem Cells and Gene Therapy for Cartilage Repair

    OpenAIRE

    Longo, Umile Giuseppe; Petrillo, Stefano; Franceschetti, Edoardo; Berton, Alessandra; Maffulli, Nicola; Denaro, Vincenzo

    2012-01-01

    Cartilage defects represent a common problem in orthopaedic practice. Predisposing factors include traumas, inflammatory conditions, and biomechanics alterations. Conservative management of cartilage defects often fails, and patients with this lesions may need surgical intervention. Several treatment strategies have been proposed, although only surgery has been proved to be predictably effective. Usually, in focal cartilage defects without a stable fibrocartilaginous repair tissue formed, sur...

  8. Mastication markedly affects mandibular condylar cartilage growth, gene expression, and morphology.

    Science.gov (United States)

    Enomoto, Akiko; Watahiki, Junichi; Nampo, Tomoki; Irie, Tarou; Ichikawa, Yuuta; Tachikawa, Tetsuhiko; Maki, Koutaro

    2014-09-01

    Mandibular growth is believed to be strongly related to mastication. Furthermore, mandibular condylar cartilage is known to be derived from neural crest cells. We examined whether the degree of chewing affects condylar cartilage growth of the mandible. Mice were fed diets with varying hardness. Genes specific to neural crest-derived cells were measured by real-time polymerase chain reaction to compare the expression changes between the mandibular and tibia cartilages. The mandibular condylar cartilage was then evaluated histologically, and proliferation was evaluated using proliferating cell nuclear antigen. Immunostaining was conducted for osteopontin, type X collagen, and Musashi1, and real-time polymerase chain reaction was used to assess the expression levels of osteopontin and type X collagen. Markers including P75, Wnt-1, Musashi1, and Nestin were upregulated in the mandibular condylar cartilage as compared with the tibial cartilage. Histologic assessment of the mandibular cartilage showed that the hypertrophic chondrocyte zone was statistically significantly thicker in mice fed a hard diet. Chondrocyte proliferation and Musashi1 expression were lower in mice fed a hard diet. After 4 weeks, numerous osteopontin and type X collagen-positive cells were observed in mice fed a mixed diet. Mastication affects the balance between differentiation and proliferation in the mandibular condylar cartilage. This phenomenon might be attributed to the presence of neural crest-derived cells. Copyright © 2014 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  9. Co-Expression and Co-Localization of Cartilage Glycoproteins CHI3L1 and Lubricin in Osteoarthritic Cartilage: Morphological, Immunohistochemical and Gene Expression Profiles

    Directory of Open Access Journals (Sweden)

    Marta Anna Szychlinska

    2016-03-01

    Full Text Available Osteoarthritis is the most common human arthritis characterized by degeneration of articular cartilage. Several studies reported that levels of human cartilage glycoprotein chitinase 3-like-1 (CHI3L1 are known as a potential marker for the activation of chondrocytes and the progression of Osteoarthritis (OA, whereas lubricin appears to be chondroprotective. The aim of this study was to investigate the co-expression and co-localization of CHI3L1 and lubricin in normal and osteoarthritic rat articular cartilage to correlate their modified expression to a specific grade of OA. Samples of normal and osteoarthritic rat articular cartilage were analyzed by the Kellgren–Lawrence OA severity scores, the Kraus’ modified Mankin score and the Histopathology Osteoarthritis Research Society International (OARSI system for histomorphometric evaluations, and through CHI3L1 and lubricin gene expression, immunohistochemistry and double immuno-staining analysis. The immunoexpression and the mRNA levels of lubricin increased in normal cartilage and decreased in OA cartilage (normal vs. OA, p < 0.01. By contrast, the immunoexpression and the mRNA levels of CHI3L1 increased in OA cartilage and decreased in normal cartilage (normal vs. OA, p < 0.01. Our findings are consistent with reports suggesting that these two glycoproteins are functionally associated with the development of OA and in particular with grade 2/3 of OA, suggesting that in the future they could be helpful to stage the severity and progression of the disease.

  10. Gene expression profile of the cartilage tissue spontaneously regenerated in vivo by using a novel double-network gel: Comparisons with the normal articular cartilage

    Directory of Open Access Journals (Sweden)

    Kurokawa Takayuki

    2011-09-01

    Full Text Available Abstract Background We have recently found a phenomenon that spontaneous regeneration of a hyaline cartilage-like tissue can be induced in a large osteochondral defect by implanting a double-network (DN hydrogel plug, which was composed of poly-(2-Acrylamido-2-methylpropanesulfonic acid and poly-(N, N'-Dimetyl acrylamide, at the bottom of the defect. The purpose of this study was to clarify gene expression profile of the regenerated tissue in comparison with that of the normal articular cartilage. Methods We created a cylindrical osteochondral defect in the rabbit femoral grooves. Then, we implanted the DN gel plug at the bottom of the defect. At 2 and 4 weeks after surgery, the regenerated tissue was analyzed using DNA microarray and immunohistochemical examinations. Results The gene expression profiles of the regenerated tissues were macroscopically similar to the normal cartilage, but showed some minor differences. The expression degree of COL2A1, COL1A2, COL10A1, DCN, FMOD, SPARC, FLOD2, CHAD, CTGF, and COMP genes was greater in the regenerated tissue than in the normal cartilage. The top 30 genes that expressed 5 times or more in the regenerated tissue as compared with the normal cartilage included type-2 collagen, type-10 collagen, FN, vimentin, COMP, EF1alpha, TFCP2, and GAPDH genes. Conclusions The tissue regenerated by using the DN gel was genetically similar but not completely identical to articular cartilage. The genetic data shown in this study are useful for future studies to identify specific genes involved in spontaneous cartilage regeneration.

  11. Transfection of the IHH gene into rabbit BMSCs in a simulated microgravity environment promotes chondrogenic differentiation and inhibits cartilage aging.

    Science.gov (United States)

    Liu, Peng-Cheng; Liu, Kuan; Liu, Jun-Feng; Xia, Kuo; Chen, Li-Yang; Wu, Xing

    2016-09-27

    The effect of overexpressing the Indian hedgehog (IHH) gene on the chondrogenic differentiation of rabbit bone marrow-derived mesenchymal stem cells (BMSCs) was investigated in a simulated microgravity environment. An adenovirus plasmid encoding the rabbit IHH gene was constructed in vitro and transfected into rabbit BMSCs. Two large groups were used: conventional cell culture and induction model group and simulated microgravity environment group. Each large group was further divided into blank control group, GFP transfection group, and IHH transfection group. During differentiation induction, the expression levels of cartilage-related and cartilage hypertrophy-related genes and proteins in each group were determined. In the conventional model, the IHH transfection group expressed high levels of cartilage-related factors (Coll2 and ANCN) at the early stage of differentiation induction and expressed high levels of cartilage hypertrophy-related factors (Coll10, annexin 5, and ALP) at the late stage. Under the simulated microgravity environment, the IHH transfection group expressed high levels of cartilage-related factors and low levels of cartilage hypertrophy-related factors at all stages of differentiation induction. Under the simulated microgravity environment, transfection of the IHH gene into BMSCs effectively promoted the generation of cartilage and inhibited cartilage aging and osteogenesis. Therefore, this technique is suitable for cartilage tissue engineering.

  12. Priming 3D cultures of human mesenchymal stromal cells toward cartilage formation via developmental pathways.

    Science.gov (United States)

    Centola, Matteo; Tonnarelli, Beatrice; Schären, Stefan; Glaser, Nicolas; Barbero, Andrea; Martin, Ivan

    2013-11-01

    The field of regenerative medicine has increasingly recognized the importance to be inspired by developmental processes to identify signaling pathways crucial for 3D organogenesis and tissue regeneration. Here, we aimed at recapitulating the first events occurring during limb development (ie, cell condensation and expansion of an undifferentiated mesenchymal cell population) to prime 3D cultures of human bone marrow-derived mesenchymal stromal/stem cells (hBM-MSC) toward the chondrogenic route. Based on embryonic development studies, we hypothesized that Wnt3a and fibroblast growth factor 2 (FGF2) induce hBM-MSC to proliferate in 3D culture as an undifferentiated pool of progenitors (defined by clonogenic capacity and expression of typical markers), retaining chondrogenic potential upon induction by suitable morphogens. hBM-MSC were responsive to Wnt signaling in 3D pellet culture, as assessed by significant upregulation of main target genes and increase of unphosphorylated β-catenin levels. Wnt3a was able to induce a five-fold increase in the number of proliferating hBM-MSC (6.4% vs. 1.3% in the vehicle condition), although total DNA content of the 3D construct was decreasing over time. Preconditioning with Wnt3a improved transforming growth factor-β1 mediated chondrogenesis (30% more glycosaminoglycans/cell in average). In contrast to developmental and 2D MSC culture models, FGF2 antagonized the Wnt-mediated effects. Interestingly, the CD146⁺ subpopulation was found to be more responsive to Wnt3a. The presented data indicate a possible strategy to prime 3D cultures of hBM-MSC by invoking a "developmental engineering" approach. The study also identifies some opportunities and challenges to cross-fertilize skeletal development models and 3D hBM-MSC culture systems.

  13. Fetal mesenchymal stromal cells differentiating towards chondrocytes acquire a gene expression profile resembling human growth plate cartilage.

    Directory of Open Access Journals (Sweden)

    Sandy A van Gool

    Full Text Available We used human fetal bone marrow-derived mesenchymal stromal cells (hfMSCs differentiating towards chondrocytes as an alternative model for the human growth plate (GP. Our aims were to study gene expression patterns associated with chondrogenic differentiation to assess whether chondrocytes derived from hfMSCs are a suitable model for studying the development and maturation of the GP. hfMSCs efficiently formed hyaline cartilage in a pellet culture in the presence of TGFβ3 and BMP6. Microarray and principal component analysis were applied to study gene expression profiles during chondrogenic differentiation. A set of 232 genes was found to correlate with in vitro cartilage formation. Several identified genes are known to be involved in cartilage formation and validate the robustness of the differentiating hfMSC model. KEGG pathway analysis using the 232 genes revealed 9 significant signaling pathways correlated with cartilage formation. To determine the progression of growth plate cartilage formation, we compared the gene expression profile of differentiating hfMSCs with previously established expression profiles of epiphyseal GP cartilage. As differentiation towards chondrocytes proceeds, hfMSCs gradually obtain a gene expression profile resembling epiphyseal GP cartilage. We visualized the differences in gene expression profiles as protein interaction clusters and identified many protein clusters that are activated during the early chondrogenic differentiation of hfMSCs showing the potential of this system to study GP development.

  14. Regeneration of hyaline cartilage by cell-mediated gene therapy using transforming growth factor beta 1-producing fibroblasts.

    Science.gov (United States)

    Lee, K H; Song, S U; Hwang, T S; Yi, Y; Oh, I S; Lee, J Y; Choi, K B; Choi, M S; Kim, S J

    2001-09-20

    Transforming growth factor beta (TGF-beta) has been considered as a candidate for gene therapy of orthopedic diseases. The possible application of cell-mediated TGF-beta gene therapy as a new treatment regimen for degenerative arthritis was investigated. In this study, fibroblasts expressing active TGF-beta 1 were injected into the knee joints of rabbits with artificially made cartilage defects to evaluate the feasibility of this therapy for orthopedic diseases. Two to 3 weeks after the injection there was evidence of cartilage regeneration, and at 4 to 6 weeks the cartilage defect was completely filled with newly grown hyaline cartilage. Histological analyses of the regenerated cartilage suggested that it was well integrated with the adjacent normal cartilage at the sides of the defect and that the newly formed tissue was indeed hyaline cartilage. Our findings suggest that cell-mediated TGF-beta 1 gene therapy may be a novel treatment for orthopedic diseases in which hyaline cartilage damage has occurred.

  15. PEDF Is Associated with the Termination of Chondrocyte Phenotype and Catabolism of Cartilage Tissue.

    Science.gov (United States)

    Klinger, P; Lukassen, S; Ferrazzi, F; Ekici, A B; Hotfiel, T; Swoboda, B; Aigner, T; Gelse, K

    2017-01-01

    Objective. To investigate the expression and target genes of pigment epithelium-derived factor (PEDF) in cartilage and chondrocytes, respectively. Methods. We analyzed the expression pattern of PEDF in different human cartilaginous tissues including articular cartilage, osteophytic cartilage, and fetal epiphyseal and growth plate cartilage, by immunohistochemistry and quantitative real-time (qRT) PCR. Transcriptome analysis after stimulation of human articular chondrocytes with rhPEDF was performed by RNA sequencing (RNA-Seq) and confirmed by qRT-PCR. Results. Immunohistochemically, PEDF could be detected in transient cartilaginous tissue that is prone to undergo endochondral ossification, including epiphyseal cartilage, growth plate cartilage, and osteophytic cartilage. In contrast, PEDF was hardly detected in healthy articular cartilage and in the superficial zone of epiphyses, regions that are characterized by a permanent stable chondrocyte phenotype. RNA-Seq analysis and qRT-PCR demonstrated that rhPEDF significantly induced the expression of a number of matrix-degrading factors including SAA1, MMP1, MMP3, and MMP13. Simultaneously, a number of cartilage-specific genes including COL2A1, COL9A2, COMP, and LECT were among the most significantly downregulated genes. Conclusions. PEDF represents a marker for transient cartilage during all neonatal and postnatal developmental stages and promotes the termination of cartilage tissue by upregulation of matrix-degrading factors and downregulation of cartilage-specific genes. These data provide the basis for novel strategies to stabilize the phenotype of articular cartilage and prevent its degradation.

  16. Enhanced regulatory gene expressions in the blood and articular cartilage of patients with rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Elena Vasilyevna Chetina

    2012-01-01

    Full Text Available Objective: to study the expression ratio of the non-tissue specific regulatory genes mTOR, р21, ATG1, caspase 3, tumor necrosis factor-а (TNF-а, and interleukin-6 (IL-6, as well as matrix metalloproteinase 13 (MMP-13 and X type collagen (COL10A1, cartilage resorption-associated MMP13 and COL10A1 in the blood and knee articular cartilage in patients with rheumatoid arthritis (RA. Subjects and methods. Twenty-five specimens of the distal femoral articular cartilage condyles were studied in 15 RA patients (mean age 52.4+9.1 years after endoprosthetic knee joint replacement and in 10 healthy individuals (mean age 36.0+9.1 years included into the control group. Twenty-eight blood samples taken from 28 RA patients (aged 52+7.6 years prior to endoprosthetic knee joint replacement and 27 blood samples from healthy individuals (mean age 53.6+8.3 years; a control group were also analyzed. Real-time quantitative polymerase chain reaction was applied to estimate the expression of the mTOR, p21, ATG1, caspase 3, TNF-а, IL- 6, COL0A1, and MMP-13 genes. The levels of a protein equivalent in the p70-S6K(activated by mTOR, p21, and caspase 3 genes concerned was measured in the isolated lymphocyte lysates, by applying the commercially available ELISA kits. Total protein in the cell extracts was determined using the Bradford assay procedure. Results. The cartilage samples from patients with end-stage RA exhibited a significantly higher mTOR, ATG1, p21, TNFа, MMP-13, and COL10A1 gene expressions than did those from the healthy individuals. At the same time, IL6 gene expression was much lower than that in the control group. The expressions of the mTOR, ATG1, p21, TNFа, and IL 6 genes in the blood of RA patients were much greater than those in the donors. Caspase 3 expression did not differ essentially in the bloods of the patients with RA and healthy individuals. The bloods failed to show MMP-13 and COL10A1 expressions. High mTOR and p21 gene expressions were

  17. The promotion of cartilage defect repair using adenovirus mediated Sox9 gene transfer of rabbit bone marrow mesenchymal stem cells.

    Science.gov (United States)

    Cao, Lei; Yang, Fei; Liu, Guangwang; Yu, Degang; Li, Huiwu; Fan, Qiming; Gan, Yaokai; Tang, Tingting; Dai, Kerong

    2011-06-01

    Although Sox9 is essential for chondrogenic differentiation and matrix production, its application in cartilage tissue engineering has been rarely reported. In this study, the chondrogenic effect of Sox9 on bone marrow mesenchymal stem cells (BMSCs) in vitro and its application in articular cartilage repair in vivo were evaluated. Rabbit BMSCs were transduced with adenoviral vector containing Sox9. Toluidine blue, safranin O staining and real-time PCR were performed to check chondrogenic differentiation. The results showed that Sox9 could induce chondrogenesis of BMSCs both in monolayer and on PGA scaffold effectively. The rabbit model with full-thickness cartilage defects was established and then repaired by PGA scaffold and rabbit BMSCs with or without Sox9 transduction. HE, safranin O staining and immunohistochemistry were used to assess the repair of defects by the complex. Better repair, including more newly-formed cartilage tissue and hyaline cartilage-specific extracellular matrix and greater expression of several chondrogenesis marker genes were observed in PGA scaffold and BMSCs with Sox9 transduction, compared to that without transduction. Our findings defined the important role of Sox9 in the repair of cartilage defects in vivo and provided evidence that Sox9 had the potential and advantage in the application of tissue engineering. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Remodelling of human osteoarthritic cartilage by FGF-2, alone or combined with Sox9 via rAAV gene transfer.

    Science.gov (United States)

    Cucchiarini, Magali; Terwilliger, Ernest F; Kohn, Dieter; Madry, Henning

    2009-08-01

    Compensating for the loss of extracellular cartilage matrix, as well as counteracting the alterations of the chondrocyte phenotype in osteoarthritis are of key importance to develop effective therapeutic strategies against this disorder. In the present study, we analysed the benefits of applying a potent gene combination to remodel human osteoarthritic (OA) cartilage. We employed the promising recombinant adeno-associated virus (rAAV) vector to deliver the mitogenic fibroblast growth factor 2 (FGF-2) factor, alone or simultaneously with the transcription factor Sox9 as a key activator of matrix synthesis, to human normal and OA articular chondrocytes. We evaluated the effects of single (FGF-2) or combined (FGF-2/SOX9) transgene expression upon the regenerative activities of chondrocytes in three dimensional cultures in vitro and in cartilage explants in situ. Single overexpression of FGF-2 enhanced the survival and proliferation of both normal and OA chondrocytes, without stimulating the matrix synthetic processes in the increased pools of cells. The mitogenic properties of FGF-2 were maintained when SOX9 was co-overexpressed and concomitant with an increase in the production of proteoglycans and type-II collagen, suggesting that the transcription factor was capable of counterbalancing the effects of FGF-2 on matrix accumulation. Also important, expression of type-X collagen, a marker of hypertrophy strongly decreased following treatment by the candidate vectors. Most remarkably, the levels of activities achieved in co-treated human OA cartilage were similar to or higher than those observed in normal cartilage. The present findings show that combined expression of candidate factors in OA cartilage can re-establish key features of normal cartilage and prevent the pathological shift of metabolic homeostasis. These data provide further motivation to develop coupled gene transfer approaches via rAAV for the treatment of human OA.

  19. Differences in Cartilage-Forming Capacity of Expanded Human Chondrocytes From Ear and Nose and Their Gene Expression Profiles

    NARCIS (Netherlands)

    Hellingman, C.A.; Verwiel, E.T.P.; Slagt, I.; Koevoet, W.; Poublon, R.M.L.; Nolst-Trenite, G.J.; de Jong, R.J.B.; Jahr, H.; van Osch, G.J.V.M.

    2011-01-01

    The aim of this study was to evaluate the potential of culture-expanded human auricular and nasoseptal chondrocytes as cell source for regeneration of stable cartilage and to analyze the differences in gene expression profile of expanded chondrocytes from these specific locations. Auricular

  20. Differences in cartilage-forming capacity of expanded human chondrocytes from ear and nose and their gene expression profiles

    NARCIS (Netherlands)

    Hellingman, Catharine A.; Verwiel, Eugène T. P.; Slagt, Inez; Koevoet, Wendy; Poublon, René M. L.; Nolst-Trenité, Gilbert J.; Baatenburg de Jong, Robert J.; Jahr, Holger; van Osch, Gerjo J. V. M.

    2011-01-01

    The aim of this study was to evaluate the potential of culture-expanded human auricular and nasoseptal chondrocytes as cell source for regeneration of stable cartilage and to analyze the differences in gene expression profile of expanded chondrocytes from these specific locations. Auricular

  1. Mural granulosa cell gene expression associated with oocyte developmental competence

    Directory of Open Access Journals (Sweden)

    Jiang Jin-Yi

    2010-03-01

    Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

  2. Time-dependent changes in gene expression induced in vitro by interleukin-1β in equine articular cartilage.

    Science.gov (United States)

    Löfgren, Maria; Svala, Emilia; Lindahl, Anders; Skiöldebrand, Eva; Ekman, Stina

    2018-05-01

    Osteoarthritis is an inflammatory and degenerative joint disease commonly affecting horses. To identify genes of relevance for cartilage pathology in osteoarthritis we studied the time-course effects of interleukin (IL)-1β on equine articular cartilage. Articular cartilage explants from the distal third metacarpal bone were collected postmortem from three horses without evidence of joint disease. The explants were stimulated with IL-1β for 27 days and global gene expression was measured by microarray. Gene expression was compared to that of unstimulated explants at days 3, 9, 15, 21 and 27. Release of inflammatory proteins was measured using Proximity Extension Assay. Stimulation with IL-1β led to time-dependent changes in gene expression related to inflammation, the extracellular matrix (ECM), and phenotypic alterations. Gene expression and protein release of cytokines, chemokines, and matrix-degrading enzymes increased in the stimulated explants. Collagen type II was downregulated from day 15, whereas other ECM molecules were downregulated earlier. In contrast molecules involved in ECM signaling (perlecan, chondroitin sulfate proteoglycan 4, and syndecan 4) were upregulated. At the late time points, genes related to a chondrogenic phenotype were downregulated, and genes related to a hypertrophic phenotype were upregulated, suggesting a transition towards hypertrophy later in the culturing period. The data suggest that this in vitro model mimics time course events of in vivo inflammation in OA and it may be valuable as an in vitro tool to test treatments and to study disease mechanisms. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    Science.gov (United States)

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  4. Developmental gene expression profiles of the human pathogen Schistosoma japonicum

    Directory of Open Access Journals (Sweden)

    McManus Donald P

    2009-03-01

    Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.

  5. The cartilage-derived, C-type lectin (CLECSF1): structure of the gene and chromosomal location.

    Science.gov (United States)

    Neame, P J; Tapp, H; Grimm, D R

    1999-09-03

    Cartilage is a tissue that is primarily extracellular matrix, the bulk of which consists of proteoglycan aggregates constrained within a collagen framework. Candidate components that organize the extracellular assembly of the matrix consist of collagens, proteoglycans and multimeric glycoproteins. We describe the human gene structure of a potential organizing factor, a cartilage-derived member of the C-type lectin superfamily (CLECSF1; C-type lectin superfamily) related to the serum protein, tetranectin. We show by Northern analysis that this protein is restricted to cartilage and locate the gene on chromosome 16q23. We have characterized 10.9 kb of sequence upstream of the first exon. Similarly to human tetranectin, there are three exons. The residues that are conserved between CLECSF1 and tetranectin suggest that the cartilage-derived protein forms a trimeric structure similar to that of tetranectin, with three N-terminal alpha-helical domains aggregating through hydrophobic faces. The globular, C-terminal domain that has been shown to bind carbohydrate in some members of the family and plasminogen in tetranectin, is likely to have a similar overall structure to that of tetranectin.

  6. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  7. Robustness and accuracy in sea urchin developmental gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Smadar eBen-Tabou De-Leon

    2016-02-01

    Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  8. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  9. Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

    Directory of Open Access Journals (Sweden)

    Susanta K Behura

    Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

  10. Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

    Directory of Open Access Journals (Sweden)

    Michael Hadjiargyrou

    2018-01-01

    Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

  11. Non-viral gene activated matrices for mesenchymal stem cells based tissue engineering of bone and cartilage.

    Science.gov (United States)

    Raisin, Sophie; Belamie, Emmanuel; Morille, Marie

    2016-10-01

    Recent regenerative medicine and tissue engineering strategies for bone and cartilage repair have led to fascinating progress of translation from basic research to clinical applications. In this context, the use of gene therapy is increasingly being considered as an important therapeutic modality and regenerative technique. Indeed, in the last 20 years, nucleic acids (plasmid DNA, interferent RNA) have emerged as credible alternative or complement to proteins, which exhibited major issues including short half-life, loss of bioactivity in pathologic environment leading to high dose requirement and therefore high production costs. The relevance of gene therapy strategies in combination with a scaffold, following a so-called "Gene-Activated Matrix (GAM)" approach, is to achieve a direct, local and sustained delivery of nucleic acids from a scaffold to ensure efficient and durable cell transfection. Among interesting cells sources, Mesenchymal Stem Cells (MSC) are promising for a rational use in gene/cell therapy with more than 1700 clinical trials approved during the last decade. The aim of the present review article is to provide a comprehensive overview of recent and ongoing work in non-viral genetic engineering of MSC combined with scaffolds. More specifically, we will show how this inductive strategy can be applied to orient stem cells fate for bone and cartilage repair. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Characterization of human adipose-derived stem cells and expression of chondrogenic genes during induction of cartilage differentiation.

    Science.gov (United States)

    Hamid, Adila A; Idrus, Ruszymah Bt Hj; Saim, Aminuddin Bin; Sathappan, Somasumdaram; Chua, Kien-Hui

    2012-01-01

    Understanding the changes in chondrogenic gene expression that are involved in the differentiation of human adipose-derived stem cells to chondrogenic cells is important prior to using this approach for cartilage repair. The aims of the study were to characterize human adipose-derived stem cells and to examine chondrogenic gene expression after one, two, and three weeks of induction. Human adipose-derived stem cells at passage 4 were evaluated by flow cytometry to examine the expression of surface markers. These adipose-derived stem cells were tested for adipogenic and osteogenic differentiation capacity. Ribonucleic acid was extracted from the cells for quantitative polymerase chain reaction analysis to determine the expression levels of chondrogenic genes after chondrogenic induction. Human adipose-derived stem cells were strongly positive for the mesenchymal markers CD90, CD73, CD44, CD9, and histocompatibility antigen and successfully differentiated into adipogenic and osteogenic lineages. The human adipose-derived stem cells aggregated and formed a dense matrix after chondrogenic induction. The expression of chondrogenic genes (collagen type II, aggrecan core protein, collagen type XI, COMP, and ELASTIN) was significantly higher after the first week of induction. However, a significantly elevated expression of collagen type X was observed after three weeks of chondrogenic induction. Human adipose-derived stem cells retain stem cell characteristics after expansion in culture to passage 4 and serve as a feasible source of cells for cartilage regeneration. Chondrogenesis in human adipose-derived stem cells was most prominent after one week of chondrogenic induction.

  13. The concentration, gene expression, and spatial distribution of aggrecan in canine articular cartilage, meniscus, and anterior and posterior cruciate ligaments: a new molecular distinction between hyaline cartilage and fibrocartilage in the knee joint.

    Science.gov (United States)

    Valiyaveettil, Manojkumar; Mort, John S; McDevitt, Cahir A

    2005-01-01

    The concentration, spatial distribution, and gene expression of aggrecan in meniscus, articular cartilage, and the anterior and posterior cruciate ligaments (ACL and PCL) was determined in the knee joints of five mature dogs. An anti-serum against peptide sequences specific to the G1 domain of aggrecan was employed in competitive-inhibition ELISA of guanidine HCl extracts and immunofluorescence microscopy. Gene expression was determined by Taqman real-time PCR. The concentration of aggrecan in articular cartilage (240.1 +/- 32 nMol/g dry weight) was higher than that in meniscus (medial meniscus: 33.4 +/- 4.3 nMol/g) and ligaments (ACL: 6.8 +/- 0.9 nMol/g). Aggrecan was more concentrated in the inner than the outer zone of the meniscus. Aggrecan in meniscus showed an organized, spatial network, in contrast to its diffuse distribution in articular cartilage. Thus, differences in the concentration, gene expression, and spatial distribution of aggrecan constitute another molecular distinction between hyaline cartilage and fibrocartilage of the knee.

  14. Wound healing gene therapy: cartilage regeneration induced by vascular endothelial growth factor plasmid

    Czech Academy of Sciences Publication Activity Database

    Kološtová, K.; Taltynov, O.; Pintérová, D.; Boubelík, M.; Raška, O.; Hozák, Pavel; Jirkovská, M.; Bobek, V.

    2012-01-01

    Roč. 33, č. 1 (2012), s. 68-74 ISSN 0196-0709 Institutional research plan: CEZ:AV0Z50520514 Keywords : BALB/c mouse strain * significant angiogenesis * cartilage repair * phVEGF(165) injection Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.228, year: 2012

  15. On the genesis of articular cartilage. Embryonic joint development and gene expression - implications for tissue engineering

    NARCIS (Netherlands)

    Jenner, F

    2013-01-01

    Articular chondrocytes descend from a distinct cohort of progenitor cells located in the embryonic joint anlagen, termed interzones. Their unique lineage might explain some of the problems encountered using chondrocytes of different lineages for articular cartilage tissue engineering. While it is

  16. Developmental expression of the alpha-skeletal actin gene

    Directory of Open Access Journals (Sweden)

    Vonk Freek J

    2008-06-01

    Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

  17. Repair of full-thickness articular cartilage defects by cultured mesenchymal stem cells transfected with the transforming growth factor {beta}{sub 1} gene

    Energy Technology Data Exchange (ETDEWEB)

    Guo Xiaodong [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Zheng Qixin [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yang Shuhua [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shao Zengwu [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yuan Quan [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Pan Zhengqi [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Tang Shuo [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Liu Kai [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Quan Daping [Institute of Polymer Science, School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)

    2006-12-15

    Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-{beta}{sub 1}) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-{beta}{sub 1} that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-{beta}{sub 1} gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA{sub 3}-TGF-{beta}{sub 1} gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA{sub 3} gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of

  18. Repair of full-thickness articular cartilage defects by cultured mesenchymal stem cells transfected with the transforming growth factor β1 gene

    International Nuclear Information System (INIS)

    Guo Xiaodong; Zheng Qixin; Yang Shuhua; Shao Zengwu; Yuan Quan; Pan Zhengqi; Tang Shuo; Liu Kai; Quan Daping

    2006-01-01

    Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-β 1 ) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-β 1 that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-β 1 gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA 3 -TGF-β 1 gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA 3 gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of inflammatory and alloreactive immune responses. The

  19. Characterization of human adipose-derived stem cells and expression of chondrogenic genes during induction of cartilage differentiation

    Directory of Open Access Journals (Sweden)

    Adila A Hamid

    2012-01-01

    Full Text Available OBJECTIVES: Understanding the changes in chondrogenic gene expression that are involved in the differentiation of human adipose-derived stem cells to chondrogenic cells is important prior to using this approach for cartilage repair. The aims of the study were to characterize human adipose-derived stem cells and to examine chondrogenic gene expression after one, two, and three weeks of induction. MATERIALS AND METHODS: Human adipose-derived stem cells at passage 4 were evaluated by flow cytometry to examine the expression of surface markers. These adipose-derived stem cells were tested for adipogenic and osteogenic differentiation capacity. Ribonucleic acid was extracted from the cells for quantitative polymerase chain reaction analysis to determine the expression levels of chondrogenic genes after chondrogenic induction. RESULTS: Human adipose-derived stem cells were strongly positive for the mesenchymal markers CD90, CD73, CD44, CD9, and histocompatibility antigen and successfully differentiated into adipogenic and osteogenic lineages. The human adipose-derived stem cells aggregated and formed a dense matrix after chondrogenic induction. The expression of chondrogenic genes (collagen type II, aggrecan core protein, collagen type XI, COMP, and ELASTIN was significantly higher after the first week of induction. However, a significantly elevated expression of collagen type X was observed after three weeks of chondrogenic induction. CONCLUSION: Human adipose-derived stem cells retain stem cell characteristics after expansion in culture to passage 4 and serve as a feasible source of cells for cartilage regeneration. Chondrogenesis in human adiposederived stem cells was most prominent after one week of chondrogenic induction.

  20. Engineering Cartilage

    Science.gov (United States)

    ... Research Matters NIH Research Matters March 3, 2014 Engineering Cartilage Artistic rendering of human stem cells on ... situations has been a major goal in tissue engineering. Cartilage contains water, collagen, proteoglycans, and chondrocytes. Collagens ...

  1. Shark Cartilage

    Science.gov (United States)

    Shark cartilage (tough elastic tissue that provides support, much as bone does) used for medicine comes primarily from sharks ... Several types of extracts are made from shark cartilage including squalamine lactate, AE-941, and U-995. ...

  2. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    Directory of Open Access Journals (Sweden)

    Elena V. Tchetina

    2016-01-01

    Full Text Available This study reports the effects of the iron chelator deferoxamine (DFO on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM. Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA, AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  3. The effect of estrogen on the expression of cartilage-specific genes in the chondrogenesis process of adipose-derived stem cells

    Directory of Open Access Journals (Sweden)

    Farzaneh Sadeghi

    2015-01-01

    Full Text Available Background: During adolescence, sex hormones play an important role in regulating proliferation, differentiation, maturation, and the scheduled death of chondrocytes. Although some studies have reported the regulatory role of estrogen in the development and progression of cartilage, some of the mechanisms still remain unclear, including the role of estrogen in the expression of cartilage-specific genes in chondrogenesis process, which we cover in this study. Materials and Methods: In the present study, we used adipose-derived stem cells (ADSCs to differentiate into cartilage. Differentiated cartilage cells were used in the control (without estrogen E2 in the culture medium and experimental (with estrogen in the culture medium groups to evaluate the expression of type II collagen and aggrecan as chondrogenic genes markers, with -real-time polymerase chain reaction technique. Results: Our results indicated that estrogen leads to inhibition of type II collagen gene expression and reduction of aggrecan gene expression. Conclusion: Therefore, estrogen probably has negative effects on chondrogenesis process of ADSCs.

  4. Gene expression of fibrinolytic factors urokinase plasminogen activator and plasminogen activator inhibitor-1 in rabbit temporo-mandibular joint cartilage with disc displacement.

    Science.gov (United States)

    Zhan, Jing; Gu, Zhi-yuan; Wu, Li-qun; Zhang, Yin-kai; Hu, Ji-an

    2005-06-20

    The urokinase plasminogen activator system is believed to play an important role in degradation of the extracellular matrix associated with cartilage and bone destruction; however its precise roles in temporomandibular disorders have not yet been clarified. The aims of this study were to investigate the gene expression of fibrinolytic factors urokinase plasminogen activator (uPA) and plasminogen activator inhibitor-1 (PAI-1) in the articular cartilage of rabbit temporomandibular joint (TMJ) with disc displacement (DD) and to probe the relationship between fibrinolytic activity and cartilage remodeling. Disc displacement of right joints was performed in 36 of 78 rabbits under investigation. The animals were sacrificed at 4 days and 1, 2, 4, 8 and 12 weeks after surgery, respectively. The right joints of these animals were harvested and processed for the examination of mRNA expression of uPA and PAI-1 in articular cartilage using in situ hybridization techniques. The expression of uPA and PAI-1 was co-expressed weakly in the chondrocytes from transitive zone to hypertrophic zone and mineralized zone, while no hybridizing signals were shown in proliferative zone and superficial zone in control rabbits. The most striking was the up-regulation of uPA and PAI-1 mRNA in 4-day rabbits postoperatively at the onset of cartilage degeneration. The strongest hybridizing signals for uPA and PAI-1 were seen in 2-week rabbits postoperatively. After 2 weeks, the expression of uPA and PAI-1 began to decrease and reached nearly normal level at 12 weeks. The expression of the uPA/PAI-1 system coincides with the pathological changes in condylar cartilage after DD. The uPA/PAI-1 system may be one of the essential mediators in articular cartilage remodeling.

  5. Detection of genes associated with developmental competence of bovine oocytes

    Czech Academy of Sciences Publication Activity Database

    Němcová, Lucie; Jansová, Denisa; Vodičková Kepková, Kateřina; Vodička, Petr; Jeseta, M.; Machatková, M.; Kaňka, Jiří

    2016-01-01

    Roč. 166, č. 1 (2016), s. 58-71 ISSN 0378-4320 Institutional support: RVO:67985904 Keywords : oocyte * embryo * bovine * developmental competence * transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.605, year: 2016

  6. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues.

    Directory of Open Access Journals (Sweden)

    Daifeng Cheng

    Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.

  7. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    Science.gov (United States)

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  8. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

  9. Effects of phosphorylatable short peptide-conjugated chitosan-mediated IL-1Ra and igf-1 gene transfer on articular cartilage defects in rabbits.

    Directory of Open Access Journals (Sweden)

    Ronglan Zhao

    Full Text Available Previously, we reported an improvement in the transfection efficiency of the plasmid DNA-chitosan (pDNA/CS complex by the utilization of phosphorylatable short peptide-conjugated chitosan (pSP-CS. In this study, we investigated the effects of pSP-CS-mediated gene transfection of interleukin-1 receptor antagonist protein (IL-1Ra combined with insulin-like growth factor-1 (IGF-1 in rabbit chondrocytes and in a rabbit model of cartilage defects. pBudCE4.1-IL-1Ra+igf-1, pBudCE4.1-IL-1Ra and pBudCE4.1-igf-1 were constructed and combined with pSP-CS to form pDNA/pSP-CS complexes. These complexes were transfected into rabbit primary chondrocytes or injected into the joint cavity. Seven weeks after treatment, all rabbits were sacrificed and analyzed. High levels of IL-1Ra and igf-1 expression were detected both in the cell culture supernatant and in the synovial fluid. In vitro, the transgenic complexes caused significant proliferation of chondrocytes, promotion of glycosaminoglycan (GAG and collagen II synthesis, and inhibition of chondrocyte apoptosis and nitric oxide (NO synthesis. In vivo, the exogenous genes resulted in increased collagen II synthesis and reduced NO and GAG concentrations in the synovial fluid; histological studies revealed that pDNA/pSP-CS treatment resulted in varying degrees of hyaline-like cartilage repair and Mankin score decrease. The co-expression of both genes produced greater effects than each single gene alone both in vitro and in vivo. The results suggest that pSP-CS is a good candidate for use in gene therapy for the treatment of cartilage defects and that igf-1 and IL-1Ra co-expression produces promising biologic effects on cartilage defects.

  10. Prepatterning of developmental gene expression by modified histones before zygotic genome activation

    DEFF Research Database (Denmark)

    Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

    2011-01-01

    A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

  11. Towards Regeneration of Articular Cartilage

    Science.gov (United States)

    Iwamoto, Masahiro; Ohta, Yoichi; Larmour, Colleen; Enomoto-Iwamoto, Motomi

    2014-01-01

    Articular cartilage is classified into permanent hyaline cartilage and has significant differences in structure, extracelluar matrix components, gene expression profile, and mechanical property from transient hyaline cartilage found in growth plate. In the process of synovial joint development, articular cartilage is originated from the interzone, developing at the edge of the cartilaginous anlagen, it establishes zonal structure over time and supports smooth movement of the synovial joint through life. The cascade actions of key regulators such as Wnts, GDF5, Erg, and PTHLH coordinate sequential steps of articular cartilage formation. Articular chondrocytes are restrictedly controlled not to differentiate into a hypertrophic stage by autocrine and paracrine factors and extracerllular matrix microenvironment, but retain potential to undergo hypertrophy. The basal calcified zone of articular cartilage is connected with subchondral bone, but not invaded by blood vessels nor replaced by bone, which is highly contrasted with the growth plate. Articular cartilage has limited regenerative capacity, but likely possesses and potentially uses intrinsic stem cell source in the superficial layer, Ranvier’s groove, the intra-articular tissues such as synovium and fat pad, and marrow below the subchondral bone. Considering the biological views on articular cartilage, several important points are raised for regeneration of articular cartilage. We should evaluate the nature of regenerated cartilage as permanent hyaline cartilage and not just hyaline cartilage. We should study how a hypertrophic phenotype of transplanted cells can be lastingly suppressed in regenerating tissue. Further, we should develop the methods and reagents to activate recruitment of intrinsic stem/progenitor cells into the damaged site. PMID:24078496

  12. Gene expression response to EWS–FLI1 in mouse embryonic cartilage

    Directory of Open Access Journals (Sweden)

    Miwa Tanaka

    2014-12-01

    Full Text Available Ewing's sarcoma is a rare bone tumor that affects children and adolescents. We have recently succeeded to induce Ewing's sarcoma-like small round cell tumor in mice by expression of EWS–ETS fusion genes in murine embryonic osteochondrogenic progenitors. The Ewing's sarcoma precursors are enriched in embryonic superficial zone (eSZ cells of long bone. To get insights into the mechanisms of Ewing's sarcoma development, gene expression profiles between EWS–FLI1-sensitive eSZ cells and EWS–FLI1-resistant embryonic growth plate (eGP cells were compared using DNA microarrays. Gene expression of eSZ and eGP cells (total, 30 samples was evaluated with or without EWS–FLI1 expression 0, 8 or 48 h after gene transduction. Our data provide useful information for gene expression responses to fusion oncogenes in human sarcoma.

  13. Importance of globin gene order for correct developmental expression.

    NARCIS (Netherlands)

    O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

  14. P63 gene mutations and human developmental syndromes.

    NARCIS (Netherlands)

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van

    2002-01-01

    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  15. Cis-regulatory timers for developmental gene expression.

    Directory of Open Access Journals (Sweden)

    Lionel Christiaen

    2013-10-01

    Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

  16. Developmental evolution in social insects: regulatory networks from genes to societies.

    Science.gov (United States)

    Linksvayer, Timothy A; Fewell, Jennifer H; Gadau, Jürgen; Laubichler, Manfred D

    2012-05-01

    The evolution and development of complex phenotypes in social insect colonies, such as queen-worker dimorphism or division of labor, can, in our opinion, only be fully understood within an expanded mechanistic framework of Developmental Evolution. Conversely, social insects offer a fertile research area in which fundamental questions of Developmental Evolution can be addressed empirically. We review the concept of gene regulatory networks (GRNs) that aims to fully describe the battery of interacting genomic modules that are differentially expressed during the development of individual organisms. We discuss how distinct types of network models have been used to study different levels of biological organization in social insects, from GRNs to social networks. We propose that these hierarchical networks spanning different organizational levels from genes to societies should be integrated and incorporated into full GRN models to elucidate the evolutionary and developmental mechanisms underlying social insect phenotypes. Finally, we discuss prospects and approaches to achieve such an integration. © 2012 WILEY PERIODICALS, INC.

  17. Cartilage regeneration for treatment of osteoarthritis: a paradigm for nonsurgical intervention

    Science.gov (United States)

    Sabaawy, Hatem E.

    2015-01-01

    Osteoarthritis (OA) is associated with articular cartilage abnormalities and affects people of older age: preventative or therapeutic treatment measures for OA and related articular cartilage disorders remain challenging. In this perspective review, we have integrated multiple biological, morphological, developmental, stem cell and homeostasis concepts of articular cartilage to develop a paradigm for cartilage regeneration. OA is conceptually defined as an injury of cartilage that initiates chondrocyte activation, expression of proteases and growth factor release from the matrix. This regenerative process results in the local activation of inflammatory response genes in cartilage without migration of inflammatory cells or angiogenesis. The end results are catabolic and anabolic responses, and it is the balance between these two outcomes that controls remodelling of the matrix and regeneration. A tantalizing clinical clue for cartilage regrowth in OA joints has been observed in surgically created joint distraction. We hypothesize that cartilage growth in these distracted joints may have a biological connection with the size of organs and regeneration. Therefore we propose a novel, practical and nonsurgical intervention to validate the role of distraction in cartilage regeneration in OA. The approach permits normal wake-up activity while during sleep; the index knee is subjected to distraction with a pull traction device. Comparison of follow-up magnetic resonance imaging (MRI) at 3 and 6 months of therapy to those taken before therapy will provide much-needed objective evidence for the use of this mode of therapy for OA. We suggest that the paradigm presented here merits investigation for treatment of OA in knee joints. PMID:26029269

  18. Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

    Directory of Open Access Journals (Sweden)

    Xiao-Jian Sun

    Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

  19. Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

    Directory of Open Access Journals (Sweden)

    Ishida Betty K

    2003-08-01

    Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.

  20. Comparative Analysis of Cartilage Marker Gene Expression Patterns during Axolotl and Xenopus Limb Regeneration.

    Directory of Open Access Journals (Sweden)

    Kazumasa Mitogawa

    Full Text Available Axolotls (Ambystoma mexicanum can completely regenerate lost limbs, whereas Xenopus laevis frogs cannot. During limb regeneration, a blastema is first formed at the amputation plane. It is thought that this regeneration blastema forms a limb by mechanisms similar to those of a developing embryonic limb bud. Furthermore, Xenopus laevis frogs can form a blastema after amputation; however, the blastema results in a terminal cone-shaped cartilaginous structure called a "spike." The causes of this patterning defect in Xenopus frog limb regeneration were explored. We hypothesized that differences in chondrogenesis may underlie the patterning defect. Thus, we focused on chondrogenesis. Chondrogenesis marker genes, type I and type II collagen, were compared in regenerative and nonregenerative environments. There were marked differences between axolotls and Xenopus in the expression pattern of these chondrogenesis-associated genes. The relative deficit in the chondrogenic capacity of Xenopus blastema cells may account for the absence of total limb regenerative capacity.

  1. Spatiotemporal network motif reveals the biological traits of developmental gene regulatory networks in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Kim Man-Sun

    2012-05-01

    Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.

  2. DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions

    Science.gov (United States)

    Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.

    2011-01-01

    The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518

  3. Role Of Shark Cartilage In Reducing Changes In Gene Expression Of Some Enzymes Induced By N-Nitroso-N-Methyl Urea In Prostate Of Irradiated Rats

    International Nuclear Information System (INIS)

    ELMAGHRABY, T.; YACOUB, S.; IBRAHIM, N.K.

    2009-01-01

    There is overwhelming evidence to indicate that free radicals cause oxidative damage to lipids, proteins and nucleic acids and are involved in the pathogenesis of several diseases. Therefore, antioxidants, which can neutralize free radicals, may be of central importance in the prevention of these diseases. Recent studies demonstrated the role of shark cartilage in protecting cells against reactive oxygen species induced DNA damage and mutagenesis. Reactive oxygen species and other free radicals are known to be the mediators of phenotypic and genotypic changes that lead from mutation to neoplasia. There are some primary antioxidants such as glutathione peroxidase (GSHPx), glutathione-S-transferase (GST-π) and super oxide dismutase (SOD), which protects against cellular and molecular damage caused by the reactive oxygen metabolites (ROMs).In this study, the effect of shark cartilage against the N-nitroso-N-methyl urea + testosterone and/or gamma radiation-induced mutagens and carcinogens in rat prostate were investigated.The data showed significant decrease in gene expression of manganese superoxide dismutase (Mn-SOD), glutathione peroxidase 1 (GSHPx1) , enzyme activities of total superoxide dismutase (SOD) and glutathione peroxidase (GSHPx) and non-significant increase in glutathione-S-transferase (GST-π) in N-nitroso-N-methyl urea + testosterone, N-nitroso-N-methyl urea + testosterone + gamma radiation groups as compared to control group.The results revealed that shark cartilage administration afford a significant protective effect against N-nitroso-N-methyl urea + testosterone and/or gamma radiation- induced oxidative injury.

  4. Characterization of Chondrogenic Gene Expression and Cartilage Phenotype Differentiation in Human Breast Adipose-Derived Stem Cells Promoted by Ginsenoside Rg1 In Vitro

    Directory of Open Access Journals (Sweden)

    Fang-Tian Xu

    2015-11-01

    Full Text Available Background/Aims: Investigating and understanding chondrogenic gene expression during the differentiation of human breast adipose-derived stem cells (HBASCs into chondrogenic cells is a prerequisite for the application of this approach for cartilage repair and regeneration. In this study, we aim to characterize HBASCs and to examine chondrogenic gene expression in chondrogenic inductive culture medium containing ginsenoside Rg1. Methods: Human breast adipose-derived stem cells at passage 3 were evaluated based on specific cell markers and their multilineage differentiation capacity. Cultured HBASCs were treated either with basic chondrogenic inductive conditioned medium alone (group A, control or with basic chondrogenic inductive medium plus 10 µg/ml (group B, 50 µg/ml (group C, or 100µg/ml ginsenoside Rg1 (group D. Cell proliferation was assessed using the CCK-8 assay for a period of 9 days. Two weeks after induction, the expression of chondrogenic genes (collagen type II, collagen type XI, ACP, COMP and ELASTIN was determined using real-time PCR in all groups. Results: The different concentrations of ginsenoside Rg1 that were added to the basic chondrogenic inductive culture medium promoted the proliferation of HBASCs at earlier stages (groups B, C, and D but resulted in chondrogenic phenotype differentiation and higher mRNA expression of collagen type II (CO-II, collagen type XI (CO-XI, acid phosphatase (ACP, cartilage oligomeric matrix protein (COMP and ELASTIN compared with the control (group A at later stages. The results reveal an obvious positive dose-effect relationship between ginsenoside Rg1 and the proliferation and chondrogenic phenotype differentiation of HBASCs in vitro. Conclusions: Human breast adipose-derived stem cells retain stem cell characteristics after expansion in culture through passage 3 and serve as a feasible source of cells for cartilage regeneration in vitro. Chondrogenesis in HBASCs was found to be prominent

  5. Cartilage regeneration for treatment of osteoarthritis: a paradigm for nonsurgical intervention

    OpenAIRE

    Tiku, Moti L.; Sabaawy, Hatem E.

    2015-01-01

    Osteoarthritis (OA) is associated with articular cartilage abnormalities and affects people of older age: preventative or therapeutic treatment measures for OA and related articular cartilage disorders remain challenging. In this perspective review, we have integrated multiple biological, morphological, developmental, stem cell and homeostasis concepts of articular cartilage to develop a paradigm for cartilage regeneration. OA is conceptually defined as an injury of cartilage that initiates c...

  6. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes

    Science.gov (United States)

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

    2018-01-01

    Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203

  7. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.

    Science.gov (United States)

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

    2018-04-01

    The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.

  8. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    Science.gov (United States)

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

  9. A co-expression gene network associated with developmental regulation of apple fruit acidity.

    Science.gov (United States)

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

    2015-08-01

    Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

  10. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  11. Transcriptomic signatures in cartilage ageing

    Science.gov (United States)

    2013-01-01

    Introduction Age is an important factor in the development of osteoarthritis. Microarray studies provide insight into cartilage aging but do not reveal the full transcriptomic phenotype of chondrocytes such as small noncoding RNAs, pseudogenes, and microRNAs. RNA-Seq is a powerful technique for the interrogation of large numbers of transcripts including nonprotein coding RNAs. The aim of the study was to characterise molecular mechanisms associated with age-related changes in gene signatures. Methods RNA for gene expression analysis using RNA-Seq and real-time PCR analysis was isolated from macroscopically normal cartilage of the metacarpophalangeal joints of eight horses; four young donors (4 years old) and four old donors (>15 years old). RNA sequence libraries were prepared following ribosomal RNA depletion and sequencing was undertaken using the Illumina HiSeq 2000 platform. Differentially expressed genes were defined using Benjamini-Hochberg false discovery rate correction with a generalised linear model likelihood ratio test (P ageing cartilage. Conclusion There was an age-related dysregulation of matrix, anabolic and catabolic cartilage factors. This study has increased our knowledge of transcriptional networks in cartilage ageing by providing a global view of the transcriptome. PMID:23971731

  12. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    Science.gov (United States)

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

    2005-04-01

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  13. Developmental Deltamethrin Exposure Causes Persistent Changes in Dopaminergic Gene Expression, Neurochemistry, and Locomotor Activity in Zebrafish.

    Science.gov (United States)

    Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A

    2015-08-01

    Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. An oscillopathic approach to developmental dyslexia: From genes to speech processing.

    Science.gov (United States)

    Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio

    2017-06-30

    Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

    Directory of Open Access Journals (Sweden)

    Runko Suzan J

    2005-10-01

    Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

  16. Transcriptomic profiling of cartilage ageing

    Directory of Open Access Journals (Sweden)

    Mandy Jayne Peffers

    2014-12-01

    Full Text Available The musculoskeletal system is severely affected by the ageing process, with many tissues undergoing changes that lead to loss of function and frailty. Articular cartilage is susceptible to age related diseases, such as osteoarthritis. Applying RNA-Seq to young and old equine cartilage, we identified an over-representation of genes with reduced expression relating to extracellular matrix, degradative proteases, matrix synthetic enzymes, cytokines and growth factors in cartilage from older donors. Here we describe the contents and quality controls in detail for the gene expression and related results published by Peffers and colleagues in Arthritis Research and Therapy 2013 associated with the data uploaded to ArrayExpress (E-MTAB-1386.

  17. Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

    Science.gov (United States)

    Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

    2017-07-01

    In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

  18. Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.

    Science.gov (United States)

    Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R

    2018-06-01

    Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.

  19. Human sclera maintains common characteristics with cartilage throughout evolution.

    Directory of Open Access Journals (Sweden)

    Yuko Seko

    Full Text Available BACKGROUND: The sclera maintains and protects the eye ball, which receives visual inputs. Although the sclera does not contribute significantly to visual perception, scleral diseases such as refractory scleritis, scleral perforation and pathological myopia are considered incurable or difficult to cure. The aim of this study is to identify characteristics of the human sclera as one of the connective tissues derived from the neural crest and mesoderm. METHODOLOGY/PRINCIPAL FINDINGS: We have demonstrated microarray data of cultured human infant scleral cells. Hierarchical clustering was performed to group scleral cells and other mesenchymal cells into subcategories. Hierarchical clustering analysis showed similarity between scleral cells and auricular cartilage-derived cells. Cultured micromasses of scleral cells exposed to TGF-betas and BMP2 produced an abundant matrix. The expression of cartilage-associated genes, such as Indian hedge hog, type X collagen, and MMP13, was up-regulated within 3 weeks in vitro. These results suggest that human 'sclera'-derived cells can be considered chondrocytes when cultured ex vivo. CONCLUSIONS/SIGNIFICANCE: Our present study shows a chondrogenic potential of human sclera. Interestingly, the sclera of certain vertebrates, such as birds and fish, is composed of hyaline cartilage. Although the human sclera is not a cartilaginous tissue, the human sclera maintains chondrogenic potential throughout evolution. In addition, our findings directly explain an enigma that the sclera and the joint cartilage are common targets of inflammatory cells in rheumatic arthritis. The present global gene expression database will contribute to the clarification of the pathogenesis of developmental diseases such as high myopia.

  20. Autosomal dominant precocious osteoarthropathy due to a mutation of the cartilage oligomeric matrix protein (COMP) gene: further expansion of the phenotypic variations of COMP defects

    Energy Technology Data Exchange (ETDEWEB)

    Kawaji, Hiroyuki [Department of Orthopaedic Surgery, Sanyudo Hospital, 6-1-219 Chuou, Yonezawa, Yamagata 992-0045 (Japan); Nishimura, Gen [Department of Radiology, Nasu Chuou Hospital, Tochigi (Japan); Watanabe, Sobei; Sasaki, Akira; Sano, Tokuhisa [Department of Orthopaedic Surgery, Tohoku Kohsei-Nenkin Hospital, Miyagi (Japan); Mabuchi, Akihiko; Ikeda, Toshiyuki; Ikegawa, Shiro [Laboratory for Bone and Joint Diseases, SNP Research Center, Tokyo (Japan); Ohashi, Hirofumi [Division of Medical Genetics, Saitama Children' s Medical Center, Saitama (Japan)

    2002-12-01

    We report on a Japanese family of four generations with an autosomal dominant precocious osteoarthropathy. The cardinal clinical manifestations of affected individuals were painful weight-bearing large joints, which started in late childhood or adolescence. The radiological hallmarks included coxa plana, mild epiphyseal dysplasia of the knee, and round talar domes with tibiotalar slant in childhood, which evolved into degenerative joint diseases in adulthood. The disease phenotype was cosegregated with a mutation of the cartilage oligomeric matrix protein (COMP) gene in the family members, who underwent molecular evaluation. COMP mutations have been reported in a mild form of multiple epiphyseal dysplasia (MED), Ribbing type, as well as allied disorders with more severe manifestations, such as MED Fairbank type and pseudoachondroplasia. Unlike previously reported cases with the Ribbing type, the present patients did not have short stature or brachydactyly. This report expands further the phenotypic variations of COMP defects. (orig.)

  1. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Science.gov (United States)

    Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

    2013-01-01

    Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

  2. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Directory of Open Access Journals (Sweden)

    David Cohen

    Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of

  3. Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

    Science.gov (United States)

    Traeger, Stefanie; Nowrousian, Minou

    2015-04-14

    During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

  4. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Directory of Open Access Journals (Sweden)

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  5. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.

    Directory of Open Access Journals (Sweden)

    Vijee Mohan

    Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.

  6. Pyrosequencing of Haliotis diversicolor transcriptomes: insights into early developmental molluscan gene expression.

    Directory of Open Access Journals (Sweden)

    Zi-Xia Huang

    Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.

  7. Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

    Science.gov (United States)

    Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

    2017-07-03

    Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

  8. Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

    Science.gov (United States)

    Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

    2018-06-01

    Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

  9. Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

    Directory of Open Access Journals (Sweden)

    Feng Ding

    Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

  10. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  11. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  12. Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

    Science.gov (United States)

    Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

    2010-05-16

    Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

  13. Elastic cartilage reconstruction by transplantation of cultured hyaline cartilage-derived chondrocytes.

    Science.gov (United States)

    Mizuno, M; Takebe, T; Kobayashi, S; Kimura, S; Masutani, M; Lee, S; Jo, Y H; Lee, J I; Taniguchi, H

    2014-05-01

    Current surgical intervention of craniofacial defects caused by injuries or abnormalities uses reconstructive materials, such as autologous cartilage grafts. Transplantation of autologous tissues, however, places a significant invasiveness on patients, and many efforts have been made for establishing an alternative graft. Recently, we and others have shown the potential use of reconstructed elastic cartilage from ear-derived chondrocytes or progenitors with the unique elastic properties. Here, we examined the differentiation potential of canine joint cartilage-derived chondrocytes into elastic cartilage for expanding the cell sources, such as hyaline cartilage. Articular chondrocytes are isolated from canine joint, cultivated, and compared regarding characteristic differences with auricular chondrocytes, including proliferation rates, gene expression, extracellular matrix production, and cartilage reconstruction capability after transplantation. Canine articular chondrocytes proliferated less robustly than auricular chondrocytes, but there was no significant difference in the amount of sulfated glycosaminoglycan produced from redifferentiated chondrocytes. Furthermore, in vitro expanded and redifferentiated articular chondrocytes have been shown to reconstruct elastic cartilage on transplantation that has histologic characteristics distinct from hyaline cartilage. Taken together, cultured hyaline cartilage-derived chondrocytes are a possible cell source for elastic cartilage reconstruction. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  14. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

    2017-01-01

    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  15. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

    2017-01-01

    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  16. The expression of petunia strigolactone pathway genes is altered as part of the endogenous developmental program

    Directory of Open Access Journals (Sweden)

    Revel S M Drummond

    2012-01-01

    Full Text Available Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signalling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologues of the Arabidopsis MAX1 and MAX2 genes to characterise their role in petunia architecture. A single orthologue of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels increase as leaves age. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over the development series. Alterations to the expression of these genes over time, or in different regions of the plant, may influence the branching growth habit of the plant. Alterations to strigolactone production and/or sensitivity could allow both subtle and dramatic changes to branching within and between species.

  17. Scaffold-assisted cartilage tissue engineering using infant chondrocytes from human hip cartilage.

    Science.gov (United States)

    Kreuz, P C; Gentili, C; Samans, B; Martinelli, D; Krüger, J P; Mittelmeier, W; Endres, M; Cancedda, R; Kaps, C

    2013-12-01

    Studies about cartilage repair in the hip and infant chondrocytes are rare. The aim of our study was to evaluate the use of infant articular hip chondrocytes for tissue engineering of scaffold-assisted cartilage grafts. Hip cartilage was obtained from five human donors (age 1-10 years). Expanded chondrocytes were cultured in polyglycolic acid (PGA)-fibrin scaffolds. De- and re-differentiation of chondrocytes were assessed by histological staining and gene expression analysis of typical chondrocytic marker genes. In vivo, cartilage matrix formation was assessed by histology after subcutaneous transplantation of chondrocyte-seeded PGA-fibrin scaffolds in immunocompromised mice. The donor tissue was heterogenous showing differentiated articular cartilage and non-differentiated tissue and considerable expression of type I and II collagens. Gene expression analysis showed repression of typical chondrocyte and/or mesenchymal marker genes during cell expansion, while markers were re-induced when expanded cells were cultured in PGA-fibrin scaffolds. Cartilage formation after subcutaneous transplantation of chondrocyte loaded PGA-fibrin scaffolds in nude mice was variable, with grafts showing resorption and host cell infiltration or formation of hyaline cartilage rich in type II collagen. Addition of human platelet rich plasma (PRP) to cartilage grafts resulted robustly in formation of hyaline-like cartilage that showed type II collagen and regions with type X collagen. These results suggest that culture of expanded and/or de-differentiated infant hip cartilage cells in PGA-fibrin scaffolds initiates chondrocyte re-differentiation. The heterogenous donor tissue containing immature chondrocytes bears the risk of cartilage repair failure in vivo, which may be possibly overcome by the addition of PRP. Copyright © 2013 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  18. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    Science.gov (United States)

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

    2002-09-01

    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  19. Changes in gravitational force affect gene expression in developing organ systems at different developmental times

    Directory of Open Access Journals (Sweden)

    Moorman Stephen J

    2005-05-01

    Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.

  20. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    International Nuclear Information System (INIS)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.

    2008-01-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

  1. Developmental and growth temperature regulation of two different microsomal omega-6 desaturase genes in soybeans.

    Science.gov (United States)

    Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H

    1996-01-01

    The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990

  2. Imaging of articular cartilage

    Directory of Open Access Journals (Sweden)

    Bhawan K Paunipagar

    2014-01-01

    Full Text Available We tried to review the role of magnetic resonance imaging (MRI in understanding microscopic and morphologic structure of the articular cartilage. The optimal protocols and available spin-echo sequences in present day practice are reviewed in context of common pathologies of articular cartilage. The future trends of articular cartilage imaging have been discussed with their appropriateness. In diarthrodial joints of the body, articular cartilage is functionally very important. It is frequently exposed to trauma, degeneration, and repetitive wear and tear. MRI has played a vital role in evaluation of articular cartilage. With the availability of advanced repair surgeries for cartilage lesions, there has been an increased demand for improved cartilage imaging techniques. Recent advances in imaging strategies for native and postoperative articular cartilage open up an entirely new approach in management of cartilage-related pathologies.

  3. The Drosophila Perlecan gene trol regulates multiple signaling pathways in different developmental contexts

    Directory of Open Access Journals (Sweden)

    Perry Trinity L

    2007-11-01

    Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and

  4. The axon guidance receptor gene ROBO1 is a candidate gene for developmental dyslexia.

    Directory of Open Access Journals (Sweden)

    Katariina Hannula-Jouppi

    2005-10-01

    Full Text Available Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples, the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

  5. The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples, the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

  6. Developmental and genetic modulation of arsenic biotransformation: A gene by environment interaction?

    International Nuclear Information System (INIS)

    Meza, Mercedes; Gandolfi, A. Jay; Klimecki, Walter T.

    2007-01-01

    The complexity of arsenic toxicology has confounded the identification of specific pathways of disease causation. One focal point of arsenic research is aimed at fully characterizing arsenic biotransformation in humans, a process that appears to be quite variable, producing a mixture of several arsenic species with greatly differing toxic potencies. In an effort to characterize genetic determinants of variability in arsenic biotransformation, a genetic association study of 135 subjects in western Sonora, Mexico was performed by testing 23 polymorphic sites in three arsenic biotransformation candidate genes. One gene, arsenic 3 methyltransferase (AS3MT), was strongly associated with the ratio of urinary dimethylarsinic acid to monomethylarsonic acid (D/M) in children (7-11 years) but not in adults (18-79 years). Subsequent analyses revealed that the high D/M values associated with variant AS3MT alleles were primarily due to lower levels of monomethylarsonic acid as percent of total urinary arsenic (%MMA5). In light of several reports of arsenic-induced disease being associated with relatively high %MMA5 levels, these findings raise the possibility that variant AS3MT individuals may suffer less risk from arsenic exposure than non-variant individuals. These analyses also provide evidence that, in this population, regardless of AS3MT variant status, children tend to have lower %MMA5 values than adults, suggesting that the global developmental regulation of arsenic biotransformation may interact with genetic variants in metabolic genes to result in novel genetic effects such as those in this report

  7. Molecular diagnosis of patients with epilepsy and developmental delay using a customized panel of epilepsy genes.

    Directory of Open Access Journals (Sweden)

    Laura Ortega-Moreno

    Full Text Available Pediatric epilepsies are a group of disorders with a broad phenotypic spectrum that are associated with great genetic heterogeneity, thus making sequential single-gene testing an impractical basis for diagnostic strategy. The advent of next-generation sequencing has increased the success rate of epilepsy diagnosis, and targeted resequencing using genetic panels is the a most cost-effective choice. We report the results found in a group of 87 patients with epilepsy and developmental delay using targeted next generation sequencing (custom-designed Haloplex panel. Using this gene panel, we were able to identify disease-causing variants in 17 out of 87 (19.5% analyzed patients, all found in known epilepsy-associated genes (KCNQ2, CDKL5, STXBP1, SCN1A, PCDH19, POLG, SLC2A1, ARX, ALG13, CHD2, SYNGAP1, and GRIN1. Twelve of 18 variants arose de novo and 6 were novel. The highest yield was found in patients with onset in the first years of life, especially in patients classified as having early-onset epileptic encephalopathy. Knowledge of the underlying genetic cause provides essential information on prognosis and could be used to avoid unnecessary studies, which may result in a greater diagnostic cost-effectiveness.

  8. Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

    Science.gov (United States)

    Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A

    2015-01-01

    Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  9. Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

    Science.gov (United States)

    Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

    2016-01-01

    An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also

  10. Effect of a Herbal-Leucine mix on the IL-1β-induced cartilage degradation and inflammatory gene expression in human chondrocytes

    Directory of Open Access Journals (Sweden)

    Haqqi Tariq M

    2011-08-01

    Full Text Available Abstract Background Conventional treatments for the articular diseases are often effective for symptom relief, but can also cause significant side effects and do not slow the progression of the disease. Several natural substances have been shown to be effective at relieving the symptoms of osteoarthritis (OA, and preliminary evidence suggests that some of these compounds may exert a favorable influence on the course of the disease. The objective of this study was to investigate the anti-inflammatory/chondroprotective potential of a Herbal and amino acid mixture containing extract of the Uncaria tomentosa, Boswellia spp., Lepidium meyenii and L-Leucine on the IL-1β-induced production of nitric oxide (NO, glycosaminoglycan (GAG, matrix metalloproteinases (MMPs, aggrecan (ACAN and type II collagen (COL2A1 in human OA chondrocytes and OA cartilage explants. Methods Primary OA chondrocytes or OA cartilage explants were pretreated with Herbal-Leucine mixture (HLM, 1-10 μg/ml and then stimulated with IL-1β (5 ng/ml. Effect of HLM on IL-1β-induced gene expression of iNOS, MMP-9, MMP-13, ACAN and COL2A1 was verified by real time-PCR. Estimation of NO and GAG release in culture supernatant was done using commercially available kits. Results HLM tested in these in vitro studies was found to be an effective anti-inflammatory agent, as evidenced by strong inhibition of iNOS, MMP-9 and MMP-13 expression and NO production in IL-1β-stimulated OA chondrocytes (p Leucine mixture (HLM up-regulation of ACAN and COL2A1 expression in IL-1β-stimulated OA chondrocytes was also noted (p Conclusion Our data suggests that HLM could be chondroprotective and anti-inflammatory agent in arthritis, switching chondrocyte gene expression from catabolic direction towards anabolic and regenerative, and consequently this approach may be potentially useful as a new adjunct therapeutic/preventive agent for OA or injury recovery.

  11. Developmental and growth defects in mice with combined deficiency of CK2 catalytic genes.

    Science.gov (United States)

    Landesman-Bollag, Esther; Belkina, Anna; Hovey, Beth; Connors, Edward; Cox, Charles; Seldin, David C

    2011-10-01

    The CK2 α and α' catalytic gene products have overlapping biochemical activity, but in vivo, their functions are very different. Deletion of both alleles of CK2α leads to mid-gestational embryonic lethality, while deletion of both alleles of CK2α' does not interfere with viability or development of embryos; however, adult CK2α'-/-males are infertile. To further elucidate developmental roles of CK2, and analyze functional overlap between the two catalytic genes, mice with combined knockouts were bred. Mice bearing any two CK2 catalytic alleles were phenotypically normal. However, inheritance of a single CK2α allele, without either CK2α' allele, resulted in partial embryonic lethality. Such mice that survived through embryogenesis were smaller at birth than littermate controls, and weighed less throughout life. However, their cardiac function and lifespan were normal. Fibroblasts derived from CK2α+/-CK2α'-/- embryos grew poorly in culture. These experiments demonstrate that combined loss of one CK2α allele and both CK2α' alleles leads to unique abnormalities of growth and development.

  12. Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

    Science.gov (United States)

    Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

    2017-07-30

    The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Science.gov (United States)

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  14. Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms

    Science.gov (United States)

    Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F

    2017-01-01

    Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging–genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging–genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging–genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of ‘biologically at-risk’ children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach. PMID:28045463

  15. Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms.

    Science.gov (United States)

    Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F

    2017-01-03

    Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging-genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging-genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging-genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of 'biologically at-risk' children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach.

  16. Induction of mesenchymal stem cell chondrogenic differentiation and functional cartilage microtissue formation for in vivo cartilage regeneration by cartilage extracellular matrix-derived particles.

    Science.gov (United States)

    Yin, Heyong; Wang, Yu; Sun, Zhen; Sun, Xun; Xu, Yichi; Li, Pan; Meng, Haoye; Yu, Xiaoming; Xiao, Bo; Fan, Tian; Wang, Yiguo; Xu, Wenjing; Wang, Aiyuan; Guo, Quanyi; Peng, Jiang; Lu, Shibi

    2016-03-01

    We propose a method of preparing a novel cell carrier derived from natural cartilage extracellular matrix (ECM), designated cartilage ECM-derived particles (CEDPs). Through a series of processes involving pulverization, sieving, and decellularization, fresh cartilage was made into CEDPs with a median diameter of 263 ± 48 μm. Under microgravity culture conditions in a rotary cell culture system (RCCS), bone marrow stromal cells (BMSCs) can proliferate rapidly on the surface of CEDPs with high viability. Histological evaluation and gene expression analysis indicated that BMSCs were differentiated into mature chondrocytes after 21 days of culture without the use of exogenous growth factors. Functional cartilage microtissue aggregates of BMSC-laden CEDPs formed as time in culture increased. Further, the microtissue aggregates were directly implanted into trochlear cartilage defects in a rat model (CEDP+MSC group). Gait analysis and histological results indicated that the CEDP+MSC group obtained better and more rapid joint function recovery and superior cartilage repair compared to the control groups, in which defects were treated with CEDPs alone or only fibrin glue, at both 6 and 12 weeks after surgery. In conclusion, the innovative cell carrier derived from cartilage ECM could promote chondrogenic differentiation of BMSCs, and the direct use of functional cartilage microtissue facilitated cartilage regeneration. This strategy for cell culture, stem cell differentiation and one-step surgery using cartilage microtissue for cartilage repair provides novel prospects for cartilage tissue engineering and may have further broad clinical applications. We proposed a method to prepare a novel cell carrier derived from natural cartilage ECM, termed cartilage ECM-derived particles (CEDPs), which can support proliferation of MSCs and facilitate their chondrogenic differentiation. Further, the direct use of functional cartilage microtissue of MSC-laden CEDP aggregates for

  17. Secondary cartilage revealed in a non-avian dinosaur embryo.

    Directory of Open Access Journals (Sweden)

    Alida M Bailleul

    Full Text Available The skull and jaws of extant birds possess secondary cartilage, a tissue that arises after bone formation during embryonic development at articulations, ligamentous and muscular insertions. Using histological analysis, we discovered secondary cartilage in a non-avian dinosaur embryo, Hypacrosaurus stebingeri (Ornithischia, Lambeosaurinae. This finding extends our previous report of secondary cartilage in post-hatching specimens of the same dinosaur species. It provides the first information on the ontogeny of avian and dinosaurian secondary cartilages, and further stresses their developmental similarities. Secondary cartilage was found in an embryonic dentary within a tooth socket where it is hypothesized to have arisen due to mechanical stresses generated during tooth formation. Two patterns were discerned: secondary cartilage is more restricted in location in this Hypacrosaurus embryo, than it is in Hypacrosaurus post-hatchlings; secondary cartilage occurs at far more sites in bird embryos and nestlings than in Hypacrosaurus. This suggests an increase in the number of sites of secondary cartilage during the evolution of birds. We hypothesize that secondary cartilage provided advantages in the fine manipulation of food and was selected over other types of tissues/articulations during the evolution of the highly specialized avian beak from the jaws of their dinosaurian ancestors.

  18. Developmental Transcriptome Analysis and Identification of Genes Involved in Larval Metamorphosis of the Razor Clam, Sinonovacula constricta.

    Science.gov (United States)

    Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale

    2016-04-01

    The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.

  19. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2017-04-15

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA

  20. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    International Nuclear Information System (INIS)

    Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

    2017-01-01

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT

  1. Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

    Directory of Open Access Journals (Sweden)

    William P. Bewg

    2017-12-01

    Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

  2. KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

    Science.gov (United States)

    Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang

    2016-01-01

    The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

  3. Differential gene expression of the intermediate and outer interzone layers of developing articular cartilage in murine embryos

    NARCIS (Netherlands)

    Jenner, Florien; IJpma, Arne; Cleary, Mairead; Heijsman, Daphne; Narcisi, Roberto; van der Spek, Peter J; Kremer, Andreas; van Weeren, René; Brama, Pieter; van Osch, Gerjo J V M

    2014-01-01

    Nascent embryonic joints, interzones, contain a distinct cohort of progenitor cells responsible for the formation of the majority of articular tissues. However, to date the interzone has largely been studied using in situ analysis for candidate genes in the context of the embryo rather than using an

  4. Fetal Mesenchymal Stromal Cells Differentiating towards Chondrocytes Acquire a Gene Expression Profile Resembling Human Growth Plate Cartilage

    NARCIS (Netherlands)

    van Gool, S.A.; Emons, J.A.M.; Leijten, Jeroen Christianus Hermanus; Decker, E.; Sticht, C.; van Houwelingen, J.C.; Goeman, J.J.; Kleijburg, C.; Scherjon, S.; Gretz, N.; Wit, J.M.; Rappold, G.; Post, Janine Nicole; Karperien, Hermanus Bernardus Johannes

    2012-01-01

    Abstract We used human fetal bone marrow-derived mesenchymal stromal cells (hfMSCs) differentiating towards chondrocytes as an alternative model for the human growth plate (GP). Our aims were to study gene expression patterns associated with chondrogenic differentiation to assess whether

  5. Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

    Science.gov (United States)

    Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab

    2015-09-04

    A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our

  6. Degeneration of osteoarthritis cartilage

    DEFF Research Database (Denmark)

    Jørgensen, Dan Richter

    of sensitive biomarkers for monitoring disease progression. This thesis investigates how subregional measures of cartilage thickness can be used to improve upon current imaging biomarkers. The first part of this investigation aims to discover discriminative areas in the cartilage using machine......-learning techniques specifically developed to take advantage of the spatial nature of the problem. The methods were evaluated on data from a longitudinal study where detailed cartilage thickness maps were quantified from magnetic resonance images. The results showed that focal differences in cartilage thickness may...... be relevant for both OA diagnosis and for prediction of future cartilage loss. The second part of the thesis investigates spatial patterns of longitudinal cartilage thickness changes in healthy and OA knees. Based on our findings, we propose a new, conceptually simple biomarker that embraces the heterogeneous...

  7. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  8. De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

    Science.gov (United States)

    Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin

    2015-01-01

    We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Developmentally Sensitive Interaction Effects of Genes and the Social Environment on Total and Subcortical Brain Volumes.

    Science.gov (United States)

    Richards, Jennifer S; Arias Vásquez, Alejandro; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Buitelaar, Jan K; Hartman, Catharina A

    2016-01-01

    Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD). Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE) in interindividual variability of total gray matter (GM), caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312) and without ADHD (N = 437) from N = 402 families (age M = 17.00, SD = 3.60). GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation) as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.

  10. Developmentally Sensitive Interaction Effects of Genes and the Social Environment on Total and Subcortical Brain Volumes.

    Directory of Open Access Journals (Sweden)

    Jennifer S Richards

    Full Text Available Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD. Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE in interindividual variability of total gray matter (GM, caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312 and without ADHD (N = 437 from N = 402 families (age M = 17.00, SD = 3.60. GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.

  11. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    Science.gov (United States)

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  12. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    Institute of Scientific and Technical Information of China (English)

    HSU Heng; Robert L. CHURCH

    2004-01-01

    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  13. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Directory of Open Access Journals (Sweden)

    Ram Prakash Gupta

    2017-11-01

    Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

  14. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Directory of Open Access Journals (Sweden)

    Shutao Zhang

    Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  15. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Science.gov (United States)

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  16. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

    Science.gov (United States)

    Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

    2016-05-01

    The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

    Science.gov (United States)

    Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott

    2016-08-01

    Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

  18. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

    OpenAIRE

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

  19. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L.

    Science.gov (United States)

    Moreira, Viviane S; Soares, Virgínia L F; Silva, Raner J S; Sousa, Aurizangela O; Otoni, Wagner C; Costa, Marcio G C

    2018-05-01

    Bixa orellana L., popularly known as annatto, produces several secondary metabolites of pharmaceutical and industrial interest, including bixin, whose molecular basis of biosynthesis remain to be determined. Gene expression analysis by quantitative real-time PCR (qPCR) is an important tool to advance such knowledge. However, correct interpretation of qPCR data requires the use of suitable reference genes in order to reduce experimental variations. In the present study, we have selected four different candidates for reference genes in B. orellana , coding for 40S ribosomal protein S9 (RPS9), histone H4 (H4), 60S ribosomal protein L38 (RPL38) and 18S ribosomal RNA (18SrRNA). Their expression stabilities in different tissues (e.g. flower buds, flowers, leaves and seeds at different developmental stages) were analyzed using five statistical tools (NormFinder, geNorm, BestKeeper, ΔCt method and RefFinder). The results indicated that RPL38 is the most stable gene in different tissues and stages of seed development and 18SrRNA is the most unstable among the analyzed genes. In order to validate the candidate reference genes, we have analyzed the relative expression of a target gene coding for carotenoid cleavage dioxygenase 1 (CCD1) using the stable RPL38 and the least stable gene, 18SrRNA , for normalization of the qPCR data. The results demonstrated significant differences in the interpretation of the CCD1 gene expression data, depending on the reference gene used, reinforcing the importance of the correct selection of reference genes for normalization.

  20. Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

    Science.gov (United States)

    Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

    2012-03-01

    The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

  1. MRI of the cartilage

    Energy Technology Data Exchange (ETDEWEB)

    Imhof, H.; Noebauer-Huhmann, I.-M.; Krestan, C.; Gahleitner, A.; Marlovits, S.; Trattnig, S. [Department of Osteology, Universitaetklinik fuer Radiodiagnostik, AKH-Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria); Sulzbacher, I. [Universitaetsklinik fuer Pathologie Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria)

    2002-11-01

    With the introduction of fat-suppressed gradient-echo and fast spin-echo (FSE) sequences in clinical routine MR visualization of the hyaline articular cartilage is routinely possible in the larger joints. While 3D gradient-echo with fat suppression allows exact depiction of the thickness and surface of cartilage, FSE outlines the normal and abnormal internal structures of the hyaline cartilage; therefore, both sequences seem to be necessary in a standard MRI protocol for cartilage visualization. In diagnostically ambiguous cases, in which important therapeutic decisions are required, direct MR arthrography is the established imaging standard as an add-on procedure. Despite the social impact and prevalence, until recent years there was a paucity of knowledge about the pathogenesis of cartilage damage. With the introduction of high-resolution MRI with powerful surface coils and fat-suppression techniques, visualization of the articular cartilage is now routinely possible in many joints. After a short summary of the anatomy and physiology of the hyaline cartilage, the different MR imaging methods are discussed and recommended standards are suggested. (orig.)

  2. An ex vivo human cartilage repair model to evaluate the potency of a cartilage cell transplant.

    Science.gov (United States)

    Bartz, Christoph; Meixner, Miriam; Giesemann, Petra; Roël, Giulietta; Bulwin, Grit-Carsta; Smink, Jeske J

    2016-11-15

    Cell-based therapies such as autologous chondrocyte implantation are promising therapeutic approaches to treat cartilage defects to prevent further cartilage degeneration. To assure consistent quality of cell-based therapeutics, it is important to be able to predict the biological activity of such products. This requires the development of a potency assay, which assesses a characteristic of the cell transplant before implantation that can predict its cartilage regeneration capacity after implantation. In this study, an ex vivo human cartilage repair model was developed as quality assessment tool for potency and applied to co.don's chondrosphere product, a matrix-associated autologous chondrocyte implant (chondrocyte spheroids) that is in clinical use in Germany. Chondrocyte spheroids were generated from 14 donors, and implanted into a subchondral cartilage defect that was manually generated in human articular cartilage tissue. Implanted spheroids and cartilage tissue were co-cultured ex vivo for 12 weeks to allow regeneration processes to form new tissue within the cartilage defect. Before implantation, spheroid characteristics like glycosaminoglycan production and gene and protein expression of chondrogenic markers were assessed for each donor sample and compared to determine donor-dependent variation. After the co-cultivation, histological analyses showed the formation of repair tissue within the cartilage defect, which varied in amount for the different donors. In the repair tissue, aggrecan protein was expressed and extra-cellular matrix cartilage fibers were present, both indicative for a cartilage hyaline-like character of the repair tissue. The amount of formed repair tissue was used as a read-out for regeneration capacity and was correlated with the spheroid characteristics determined before implantation. A positive correlation was found between high level of aggrecan protein expression in spheroids before implantation and a higher regeneration potential

  3. An ex vivo human cartilage repair model to evaluate the potency of a cartilage cell transplant

    Directory of Open Access Journals (Sweden)

    Christoph Bartz

    2016-11-01

    Full Text Available Abstract Background Cell-based therapies such as autologous chondrocyte implantation are promising therapeutic approaches to treat cartilage defects to prevent further cartilage degeneration. To assure consistent quality of cell-based therapeutics, it is important to be able to predict the biological activity of such products. This requires the development of a potency assay, which assesses a characteristic of the cell transplant before implantation that can predict its cartilage regeneration capacity after implantation. In this study, an ex vivo human cartilage repair model was developed as quality assessment tool for potency and applied to co.don’s chondrosphere product, a matrix-associated autologous chondrocyte implant (chondrocyte spheroids that is in clinical use in Germany. Methods Chondrocyte spheroids were generated from 14 donors, and implanted into a subchondral cartilage defect that was manually generated in human articular cartilage tissue. Implanted spheroids and cartilage tissue were co-cultured ex vivo for 12 weeks to allow regeneration processes to form new tissue within the cartilage defect. Before implantation, spheroid characteristics like glycosaminoglycan production and gene and protein expression of chondrogenic markers were assessed for each donor sample and compared to determine donor-dependent variation. Results After the co-cultivation, histological analyses showed the formation of repair tissue within the cartilage defect, which varied in amount for the different donors. In the repair tissue, aggrecan protein was expressed and extra-cellular matrix cartilage fibers were present, both indicative for a cartilage hyaline-like character of the repair tissue. The amount of formed repair tissue was used as a read-out for regeneration capacity and was correlated with the spheroid characteristics determined before implantation. A positive correlation was found between high level of aggrecan protein expression in spheroids

  4. A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

    Science.gov (United States)

    Kück, Ulrich

    2005-10-01

    Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

  5. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  6. Mutations in fam20b and xylt1 reveal that cartilage matrix controls timing of endochondral ossification by inhibiting chondrocyte maturation.

    Directory of Open Access Journals (Sweden)

    B Frank Eames

    2011-08-01

    Full Text Available Differentiating cells interact with their extracellular environment over time. Chondrocytes embed themselves in a proteoglycan (PG-rich matrix, then undergo a developmental transition, termed "maturation," when they express ihh to induce bone in the overlying tissue, the perichondrium. Here, we ask whether PGs regulate interactions between chondrocytes and perichondrium, using zebrafish mutants to reveal that cartilage PGs inhibit chondrocyte maturation, which ultimately dictates the timing of perichondral bone development. In a mutagenesis screen, we isolated a class of mutants with decreased cartilage matrix and increased perichondral bone. Positional cloning identified lesions in two genes, fam20b and xylosyltransferase1 (xylt1, both of which encode PG synthesis enzymes. Mutants failed to produce wild-type levels of chondroitin sulfate PGs, which are normally abundant in cartilage matrix, and initiated perichondral bone formation earlier than their wild-type siblings. Primary chondrocyte defects might induce the bone phenotype secondarily, because mutant chondrocytes precociously initiated maturation, showing increased and early expression of such markers as runx2b, collagen type 10a1, and ihh co-orthologs, and ihha mutation suppressed early perichondral bone in PG mutants. Ultrastructural analyses demonstrated aberrant matrix organization and also early cellular features of chondrocyte hypertrophy in mutants. Refining previous in vitro reports, which demonstrated that fam20b and xylt1 were involved in PG synthesis, our in vivo analyses reveal that these genes function in cartilage matrix production and ultimately regulate the timing of skeletal development.

  7. Non-uniform distribution pattern for differentially expressed genes of transgenic rice Huahui 1 at different developmental stages and environments.

    Directory of Open Access Journals (Sweden)

    Zhi Liu

    Full Text Available DNA microarray analysis is an effective method to detect unintended effects by detecting differentially expressed genes (DEG in safety assessment of genetically modified (GM crops. With the aim to reveal the distribution of DEG of GM crops under different conditions, we performed DNA microarray analysis using transgenic rice Huahui 1 (HH1 and its non-transgenic parent Minghui 63 (MH63 at different developmental stages and environmental conditions. Considerable DEG were selected in each group of HH1 under different conditions. For each group of HH1, the number of DEG was different; however, considerable common DEG were shared between different groups of HH1. These findings suggested that both DEG and common DEG were adequate for investigation of unintended effects. Furthermore, a number of significantly changed pathways were found in all groups of HH1, indicating genetic modification caused everlasting changes to plants. To our knowledge, our study for the first time provided the non-uniformly distributed pattern for DEG of GM crops at different developmental stages and environments. Our result also suggested that DEG selected in GM plants at specific developmental stage and environment could act as useful clues for further evaluation of unintended effects of GM plants.

  8. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Directory of Open Access Journals (Sweden)

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  9. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Developmental gene regulatory networks in sea urchins and what we can learn from them [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Megan L. Martik

    2016-02-01

    Full Text Available Sea urchin embryos begin zygotic transcription shortly after the egg is fertilized.  Throughout the cleavage stages a series of transcription factors are activated and, along with signaling through a number of pathways, at least 15 different cell types are specified by the beginning of gastrulation.  Experimentally, perturbation of contributing transcription factors, signals and receptors and their molecular consequences enabled the assembly of an extensive gene regulatory network model.  That effort, pioneered and led by Eric Davidson and his laboratory, with many additional insights provided by other laboratories, provided the sea urchin community with a valuable resource.  Here we describe the approaches used to enable the assembly of an advanced gene regulatory network model describing molecular diversification during early development.  We then provide examples to show how a relatively advanced authenticated network can be used as a tool for discovery of how diverse developmental mechanisms are controlled and work.

  11. New Frontiers for Cartilage Repair and Protection.

    Science.gov (United States)

    Zaslav, Kenneth; McAdams, Timothy; Scopp, Jason; Theosadakis, Jason; Mahajan, Vivek; Gobbi, Alberto

    2012-01-01

    Articular cartilage injury is common after athletic injury and remains a difficult treatment conundrum both for the surgeon and athlete. Although recent treatments for damage to articular cartilage have been successful in alleviating symptoms, more durable and complete, long-term articular surface restoration remains the unattained goal. In this article, we look at both new ways to prevent damage to articular surfaces as well as new techniques to recreate biomechanically sound and biochemically true articular surfaces once an athlete injures this surface. This goal should include reproducing hyaline cartilage with a well-integrated and flexible subchondral base and the normal zonal variability in the articular matrix. A number of nonoperative interventions have shown early promise in mitigating cartilage symptoms and in preclinical studies have shown evidence of chondroprotection. These include the use of glucosamine, chondroitin, and other neutraceuticals, viscosupplementation with hyaluronic acid, platelet-rich plasma, and pulsed electromagnetic fields. Newer surgical techniques, some already in clinical study, and others on the horizon offer opportunities to improve the surgical restoration of the hyaline matrix often disrupted in athletic injury. These include new scaffolds, single-stage cell techniques, the use of mesenchymal stem cells, and gene therapy. Although many of these treatments are in the preclinical and early clinical study phase, they offer the promise of better options to mitigate the sequelae of athletically induced cartilage.

  12. Gene expression analysis in human osteoblasts exposed to dexamethasone identifies altered developmental pathways as putative drivers of osteoporosis

    Directory of Open Access Journals (Sweden)

    Sadlier Denise M

    2007-02-01

    Full Text Available Abstract Background Osteoporosis, a disease of decreased bone mineral density represents a significant and growing burden in the western world. Aging population structure and therapeutic use of glucocorticoids have contributed in no small way to the increase in the incidence of this disease. Despite substantial investigative efforts over the last number of years the exact molecular mechanism underpinning the initiation and progression of osteoporosis remain to be elucidated. This has meant that no significant advances in therapeutic strategies have emerged, with joint replacement surgery being the mainstay of treatment. Methods In this study we have used an integrated genomics profiling and computational biology based strategy to identify the key osteoblast genes and gene clusters whose expression is altered in response to dexamethasone exposure. Primary human osteoblasts were exposed to dexamethasone in vitro and microarray based transcriptome profiling completed. Results These studies identified approximately 500 osteoblast genes whose expression was altered. Functional characterization of the transcriptome identified developmental networks as being reactivated with 106 development associated genes found to be differentially regulated. Pathway reconstruction revealed coordinate alteration of members of the WNT signaling pathway, including frizzled-2, frizzled-7, DKK1 and WNT5B, whose differential expression in this setting was confirmed by real time PCR. Conclusion The WNT pathway is a key regulator of skeletogenesis as well as differentiation of bone cells. Reactivation of this pathway may lead to altered osteoblast activity resulting in decreased bone mineral density, the pathological hallmark of osteoporosis. The data herein lend weight to the hypothesis that alterations in developmental pathways drive the initiation and progression of osteoporosis.

  13. A tale with a Twist: a developmental gene with potential relevance for metabolic dysfunction and inflammation in adipose tissue

    Directory of Open Access Journals (Sweden)

    Anca Dana Dobrian

    2012-08-01

    Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.

  14. Magnetic resonance imaging of cartilage and cartilage repair

    International Nuclear Information System (INIS)

    Verstraete, K.L.; Almqvist, F.; Verdonk, P.; Vanderschueren, G.; Huysse, W.; Verdonk, R.; Verbrugge, G.

    2004-01-01

    Magnetic resonance (MR) imaging of articular cartilage has assumed increased importance because of the prevalence of cartilage injury and degeneration, as well as the development of new surgical and pharmacological techniques to treat damaged cartilage. This article will review relevant aspects of the structure and biochemistry of cartilage that are important for understanding MR imaging of cartilage, describe optimal MR pulse sequences for its evaluation, and review the role of experimental quantitative MR techniques. These MR aspects are applied to clinical scenarios, including traumatic chondral injury, osteoarthritis, inflammatory arthritis, and cartilage repair procedures

  15. Magnetic resonance imaging of cartilage and cartilage repair

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, K.L. E-mail: koenraad.verstraete@ugent.be; Almqvist, F.; Verdonk, P.; Vanderschueren, G.; Huysse, W.; Verdonk, R.; Verbrugge, G

    2004-08-01

    Magnetic resonance (MR) imaging of articular cartilage has assumed increased importance because of the prevalence of cartilage injury and degeneration, as well as the development of new surgical and pharmacological techniques to treat damaged cartilage. This article will review relevant aspects of the structure and biochemistry of cartilage that are important for understanding MR imaging of cartilage, describe optimal MR pulse sequences for its evaluation, and review the role of experimental quantitative MR techniques. These MR aspects are applied to clinical scenarios, including traumatic chondral injury, osteoarthritis, inflammatory arthritis, and cartilage repair procedures.

  16. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)

    2016-08-15

    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  17. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    International Nuclear Information System (INIS)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-01-01

    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  18. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  19. Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

    Science.gov (United States)

    Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

    2013-09-01

    Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Identification of conserved drought stress responsive gene-network across tissues and developmental stages in rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Pandey, Dev Mani; Chinnusamy, Viswanathan; Archak, Sunil; Bansal, Kailash Chander

    2013-01-01

    Identification of genes that are coexpressed across various tissues and environmental stresses is biologically interesting, since they may play coordinated role in similar biological processes. Genes with correlated expression patterns can be best identified by using coexpression network analysis of transcriptome data. In the present study, we analyzed the temporal-spatial coordination of gene expression in root, leaf and panicle of rice under drought stress and constructed network using WGCNA and Cytoscape. Total of 2199 differentially expressed genes (DEGs) were identified in at least three or more tissues, wherein 88 genes have coordinated expression profile among all the six tissues under drought stress. These 88 highly coordinated genes were further subjected to module identification in the coexpression network. Based on chief topological properties we identified 18 hub genes such as ABC transporter, ATP-binding protein, dehydrin, protein phosphatase 2C, LTPL153 - Protease inhibitor, phosphatidylethanolaminebinding protein, lactose permease-related, NADP-dependent malic enzyme, etc. Motif enrichment analysis showed the presence of ABRE cis-elements in the promoters of > 62% of the coordinately expressed genes. Our results suggest that drought stress mediated upregulated gene expression was coordinated through an ABA-dependent signaling pathway across tissues, at least for the subset of genes identified in this study, while down regulation appears to be regulated by tissue specific pathways in rice.

  1. Excessive activity of cathepsin K is associated with cartilage defects in a zebrafish model of mucolipidosis II

    Directory of Open Access Journals (Sweden)

    Aaron C. Petrey

    2012-03-01

    The severe pediatric disorder mucolipidosis II (ML-II; also known as I-cell disease is caused by defects in mannose 6-phosphate (Man-6-P biosynthesis. Patients with ML-II exhibit multiple developmental defects, including skeletal, craniofacial and joint abnormalities. To date, the molecular mechanisms that underlie these clinical manifestations are poorly understood. Taking advantage of a zebrafish model of ML-II, we previously showed that the cartilage morphogenesis defects in this model are associated with altered chondrocyte differentiation and excessive deposition of type II collagen, indicating that aspects of development that rely on proper extracellular matrix homeostasis are sensitive to decreases in Man-6-P biosynthesis. To further investigate the molecular bases for the cartilage phenotypes, we analyzed the transcript abundance of several genes in chondrocyte-enriched cell populations isolated from wild-type and ML-II zebrafish embryos. Increased levels of cathepsin and matrix metalloproteinase (MMP transcripts were noted in ML-II cell populations. This increase in transcript abundance corresponded with elevated and sustained activity of several cathepsins (K, L and S and MMP-13 during early development. Unlike MMP-13, for which higher levels of protein were detected, the sustained activity of cathepsin K at later stages seemed to result from its abnormal processing and activation. Inhibition of cathepsin K activity by pharmacological or genetic means not only reduced the activity of this enzyme but led to a broad reduction in additional protease activity, significant correction of the cartilage morphogenesis phenotype and reduced type II collagen staining in ML-II embryos. Our findings suggest a central role for excessive cathepsin K activity in the developmental aspects of ML-II cartilage pathogenesis and highlight the utility of the zebrafish system to address the biochemical underpinnings of metabolic disease.

  2. Transcriptional network systems in cartilage development and disease.

    Science.gov (United States)

    Nishimura, Riko; Hata, Kenji; Nakamura, Eriko; Murakami, Tomohiko; Takahata, Yoshifumi

    2018-04-01

    Transcription factors play important roles in the regulation of cartilage development by controlling the expression of chondrogenic genes. Genetic studies have revealed that Sox9/Sox5/Sox6, Runx2/Runx3 and Osterix in particular are essential for the sequential steps of cartilage development. Importantly, these transcription factors form network systems that are also required for appropriate cartilage development. Molecular cloning approaches have largely contributed to the identification of several transcriptional partners for Sox9 and Runx2 during cartilage development. Although the importance of a negative-feedback loop between Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) in chondrocyte hypertrophy has been well established, recent studies indicate that several transcription factors interact with the Ihh-PTHrP loop and demonstrated that Ihh has multiple functions in the regulation of cartilage development. The most common cartilage disorder, osteoarthritis, has been reported to result from the pathological action of several transcription factors, including Runx2, C/EBPβ and HIF-2α. On the other hand, NFAT family members appear to play roles in the protection of cartilage from osteoarthritis. It is also becoming important to understand the homeostasis and regulation of articular chondrocytes, because they have different cellular and molecular features from chondrocytes of the growth plate. This review summarizes the regulation and roles of transcriptional network systems in cartilage development and their pathological roles in osteoarthritis.

  3. Gene networks underlying convergent and pleiotropic phenotypes in a large and systematically-phenotyped cohort with heterogeneous developmental disorders.

    Science.gov (United States)

    Andrews, Tallulah; Meader, Stephen; Vulto-van Silfhout, Anneke; Taylor, Avigail; Steinberg, Julia; Hehir-Kwa, Jayne; Pfundt, Rolph; de Leeuw, Nicole; de Vries, Bert B A; Webber, Caleb

    2015-03-01

    Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51%) groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i) this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii) that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.

  4. Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin.

    Directory of Open Access Journals (Sweden)

    Charles W Higdon

    Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.

  5. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

    Science.gov (United States)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-08-01

    2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Effect of ovary induction on bread wheat anther culture: ovary genotype and developmental stage, and candidate gene association.

    Directory of Open Access Journals (Sweden)

    Ana María Castillo

    2015-06-01

    Full Text Available Ovary pre-conditioned medium and ovary co-culture increased the efficiency of green doubled haploid plant production in bread wheat anther culture. The positive effect of this medium led to a 6- and 11-fold increase in the numbers of embryos and green plants, respectively, having a greater effect on a medium-low responding cultivar. Ovary genotype and developmental stage significantly affected microspore embryogenesis. By he use of Caramba ovaries it was possible to reach a 2-fold increase in the number of embryos and green plants, and to decrease the rate of albinism. Mature ovaries from flowers containing microspores at a late binucleate stage raised the number of embryos and green plants by 25% and 46% as compared to immature ovaries (excised from flowers with microspores at a mid-late uninucleate stage. The highest numbers of embryos and green plants were produced when using mature Caramba ovaries. Ovaries from Galeón, Tigre and Kilopondio cultivars successfully induced microspore embryogenesis at the same rate as Caramba ovaries. Moreover, Tigre ovaries raised the percentage of spontaneous chromosome doubling up to 71%. Attempts were made to identify molecular mechanisms associated to the inductive effect of the ovaries on microspore embryogenesis. The genes TAA1b, FLA26 and WALI6 associated to wheat microspore embryogenesis, the CGL1 gene involved in glycan biosynthesis or degradation, and the FER gene involved in the ovary signalling process were expressed and/or induced at different rates during ovary culture. The expression pattern of FLA26 and FER could be related to the differences between genotypes and developmental stages in the inductive effect of the ovary. Our results open opportunities for new approaches to increase bread wheat doubled haploid production by anther culture, and to identify the functional components of the ovary inductive effect on microspore embryogenesis.

  7. A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.

    Science.gov (United States)

    Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis

    2014-09-01

    A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of

  8. Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

    Science.gov (United States)

    Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

  9. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    Directory of Open Access Journals (Sweden)

    Conforto Tara L

    2012-04-01

    Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

  10. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Global developmental gene expression and pathway analysis of normal brain development and mouse models of human neuronal migration defects.

    Directory of Open Access Journals (Sweden)

    Tiziano Pramparo

    2011-03-01

    Full Text Available Heterozygous LIS1 mutations are the most common cause of human lissencephaly, a human neuronal migration defect, and DCX mutations are the most common cause of X-linked lissencephaly. LIS1 is part of a protein complex including NDEL1 and 14-3-3ε that regulates dynein motor function and microtubule dynamics, while DCX stabilizes microtubules and cooperates with LIS1 during neuronal migration and neurogenesis. Targeted gene mutations of Lis1, Dcx, Ywhae (coding for 14-3-3ε, and Ndel1 lead to neuronal migration defects in mouse and provide models of human lissencephaly, as well as aid the study of related neuro-developmental diseases. Here we investigated the developing brain of these four mutants and wild-type mice using expression microarrays, bioinformatic analyses, and in vivo/in vitro experiments to address whether mutations in different members of the LIS1 neuronal migration complex lead to similar and/or distinct global gene expression alterations. Consistent with the overall successful development of the mutant brains, unsupervised clustering and co-expression analysis suggested that cell cycle and synaptogenesis genes are similarly expressed and co-regulated in WT and mutant brains in a time-dependent fashion. By contrast, focused co-expression analysis in the Lis1 and Ndel1 mutants uncovered substantial differences in the correlation among pathways. Differential expression analysis revealed that cell cycle, cell adhesion, and cytoskeleton organization pathways are commonly altered in all mutants, while synaptogenesis, cell morphology, and inflammation/immune response are specifically altered in one or more mutants. We found several commonly dysregulated genes located within pathogenic deletion/duplication regions, which represent novel candidates of human mental retardation and neurocognitive disabilities. Our analysis suggests that gene expression and pathway analysis in mouse models of a similar disorder or within a common pathway can

  12. Developmental and Functional Expression of miRNA-Stability Related Genes in the Nervous System

    OpenAIRE

    de Sousa, ?rica; Walter, Lais Takata; Higa, Guilherme Shigueto Vilar; Casado, Ot?vio Augusto Nocera; Kihara, Alexandre Hiroaki

    2013-01-01

    In the nervous system, control of gene expression by microRNAs (miRNAs) has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We fi...

  13. Matrix development in self-assembly of articular cartilage.

    Directory of Open Access Journals (Sweden)

    Gidon Ofek

    2008-07-01

    Full Text Available Articular cartilage is a highly functional tissue which covers the ends of long bones and serves to ensure proper joint movement. A tissue engineering approach that recapitulates the developmental characteristics of articular cartilage can be used to examine the maturation and degeneration of cartilage and produce fully functional neotissue replacements for diseased tissue.This study examined the development of articular cartilage neotissue within a self-assembling process in two phases. In the first phase, articular cartilage constructs were examined at 1, 4, 7, 10, 14, 28, 42, and 56 days immunohistochemically, histologically, and through biochemical analysis for total collagen and glycosaminoglycan (GAG content. Based on statistical changes in GAG and collagen levels, four time points from the first phase (7, 14, 28, and 56 days were chosen to carry into the second phase, where the constructs were studied in terms of their mechanical characteristics, relative amounts of collagen types II and VI, and specific GAG types (chondroitin 4-sulfate, chondroitin 6-sulfate, dermatan sulfate, and hyaluronan. Collagen type VI was present in initial abundance and then localized to a pericellular distribution at 4 wks. N-cadherin activity also spiked at early stages of neotissue development, suggesting that self-assembly is mediated through a minimization of free energy. The percentage of collagen type II to total collagen significantly increased over time, while the proportion of collagen type VI to total collagen decreased between 1 and 2 wks. The chondroitin 6- to 4- sulfate ratio decreased steadily during construct maturation. In addition, the compressive properties reached a plateau and tensile characteristics peaked at 4 wks.The indices of cartilage formation examined in this study suggest that tissue maturation in self-assembled articular cartilage mirrors known developmental processes for native tissue. In terms of tissue engineering, it is

  14. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Directory of Open Access Journals (Sweden)

    Shirai Leila T

    2012-02-01

    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  15. Developmental expression of “germline”- and “sex determination”-related genes in the ctenophore Mnemiopsis leidyi

    Directory of Open Access Journals (Sweden)

    Adam M. Reitzel

    2016-08-01

    Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for

  16. Degenerated human articular cartilage at autopsy represents preclinical osteoarthritic cartilage: comparison with clinically defined osteoarthritic cartilage

    NARCIS (Netherlands)

    van Valburg, A. A.; Wenting, M. J.; Beekman, B.; te Koppele, J. M.; Lafeber, F. P.; Bijlsma, J. W.

    1997-01-01

    To investigate whether macroscopically fibrillated human articular knee cartilage observed at autopsy can be considered an early, preclinical phase of osteoarthritis (OA). Histological and biochemical characteristics of 3 types of articular knee cartilage were compared: macroscopically degenerated

  17. Association of Forced Vital Capacity with the Developmental Gene NCOR2.

    Directory of Open Access Journals (Sweden)

    Cosetta Minelli

    Full Text Available Forced Vital Capacity (FVC is an important predictor of all-cause mortality in the absence of chronic respiratory conditions. Epidemiological evidence highlights the role of early life factors on adult FVC, pointing to environmental exposures and genes affecting lung development as risk factors for low FVC later in life. Although highly heritable, a small number of genes have been found associated with FVC, and we aimed at identifying further genetic variants by focusing on lung development genes.Per-allele effects of 24,728 SNPs in 403 genes involved in lung development were tested in 7,749 adults from three studies (NFBC1966, ECRHS, EGEA. The most significant SNP for the top 25 genes was followed-up in 46,103 adults (CHARGE and SpiroMeta consortia and 5,062 children (ALSPAC. Associations were considered replicated if the replication p-value survived Bonferroni correction (p<0.002; 0.05/25, with a nominal p-value considered as suggestive evidence. For SNPs with evidence of replication, effects on the expression levels of nearby genes in lung tissue were tested in 1,111 lung samples (Lung eQTL consortium, with further functional investigation performed using public epigenomic profiling data (ENCODE.NCOR2-rs12708369 showed strong replication in children (p = 0.0002, with replication unavailable in adults due to low imputation quality. This intronic variant is in a strong transcriptional enhancer element in lung fibroblasts, but its eQTL effects could not be tested due to low imputation quality in the eQTL dataset. SERPINE2-rs6754561 replicated at nominal level in both adults (p = 0.036 and children (p = 0.045, while WNT16-rs2707469 replicated at nominal level only in adults (p = 0.026. The eQTL analyses showed association of WNT16-rs2707469 with expression levels of the nearby gene CPED1. We found no statistically significant eQTL effects for SERPINE2-rs6754561.We have identified a new gene, NCOR2, in the retinoic acid signalling pathway pointing

  18. Principles of cartilage repair

    CERN Document Server

    Erggelet, Christoph; Mandelbaum, Bert R

    2008-01-01

    Cartilage defects affect patients of all age groups. Surgeons, teamdoctors, general practitioners and physiotherapists alike are expected to provide adequate care. Only individual treatment plans combining a well balanced choice of various options will be successful. Background knowledge, operative and non-operative therapies are described in concise chapters: Articular cartilage biology - Diagnostics - Surgical techniques - Symptomatic and alternative medications - Physiotherapy. Diagnostic findings and surgical procedures are generously illustrated by aquarelles and colour photographs. Recommendations for additional reading, description of important clinical scoring systems and a listing of analytic tools are added for further information.

  19. The junction between hyaline cartilage and engineered cartilage in rabbits.

    Science.gov (United States)

    Komura, Makoto; Komura, Hiroko; Otani, Yushi; Kanamori, Yutaka; Iwanaka, Tadashi; Hoshi, Kazuto; Tsuyoshi, Takato; Tabata, Yasuhiko

    2013-06-01

    Tracheoplasty using costal cartilage grafts to enlarge the tracheal lumen was performed to treat congenital tracheal stenosis. Fibrotic granulomatous tissue was observed at the edge of grafted costal cartilage. We investigated the junction between the native hyaline cartilage and the engineered cartilage plates that were generated by auricular chondrocytes for fabricating the airway. Controlled, prospecive study. In group 1, costal cartilage from New Zealand white rabbits was collected and implanted into a space created in the cervical trachea. In group 2, chondrocytes from auricular cartilages were seeded on absorbable scaffolds. These constructs were implanted in the subcutaneous space. Engineered cartilage plates were then implanted into the trachea after 3 weeks of implantation of the constructs. The grafts in group 1 and 2 were retrieved after 4 weeks. In group 1, histological studies of the junction between the native hyaline cartilage and the implanted costal cartilage demonstrated chondrogenic tissue in four anastomoses sides out of the 10 examined. In group 2, the junction between the native trachea and the engineered cartilage showed neocartilage tissue in nine anastomoses sides out of 10. Engineered cartilage may be beneficial for engineered airways, based on the findings of the junction between the native and engineered grafts. Copyright © 2012 The American Laryngological, Rhinological and Otological Society, Inc.

  20. Diversity of immunoglobulin lambda light chain gene usage over developmental stages in the horse.

    Science.gov (United States)

    Tallmadge, Rebecca L; Tseng, Chia T; Felippe, M Julia B

    2014-10-01

    To further studies of neonatal immune responses to pathogens and vaccination, we investigated the dynamics of B lymphocyte development and immunoglobulin (Ig) gene diversity. Previously we demonstrated that equine fetal Ig VDJ sequences exhibit combinatorial and junctional diversity levels comparable to those of adult Ig VDJ sequences. Herein, RACE clones from fetal, neonatal, foal, and adult lymphoid tissue were assessed for Ig lambda light chain combinatorial, junctional, and sequence diversity. Remarkably, more lambda variable genes (IGLV) were used during fetal life than later stages and IGLV gene usage differed significantly with time, in contrast to the Ig heavy chain. Junctional diversity measured by CDR3L length was constant over time. Comparison of Ig lambda transcripts to germline revealed significant increases in nucleotide diversity over time, even during fetal life. These results suggest that the Ig lambda light chain provides an additional dimension of diversity to the equine Ig repertoire. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Developmental and functional expression of miRNA-stability related genes in the nervous system.

    Science.gov (United States)

    de Sousa, Érica; Walter, Lais Takata; Higa, Guilherme Shigueto Vilar; Casado, Otávio Augusto Nocera; Kihara, Alexandre Hiroaki

    2013-01-01

    In the nervous system, control of gene expression by microRNAs (miRNAs) has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We first detected two genes in the retina that have been associated to miRNA stability, XRN2 and PAPD4. These genes are highly expressed during retinal development, however with distinct subcellular localization. We investigated whether these proteins are regulated during specific phases of the cell cycle. Combined analyses of nuclei position in neuroblastic layer and labeling using anti-cyclin D1 revealed that both proteins do not accumulate in S or M phases of the cell cycle, being poorly expressed in progenitor cells. Indeed, XRN2 and PAPD4 were observed mainly after neuronal differentiation, since low expression was also observed in astrocytes, endothelial and microglial cells. XRN2 and PAPD4 are expressed in a wide variety of neurons, including horizontal, amacrine and ganglion cells. To evaluate the functional role of both genes, we carried out experiments addressed to the retinal adaptation in response to different ambient light conditions. PAPD4 is upregulated after 3 and 24 hours of dark- adaptation, revealing that accumulation of this protein is governed by ambient light levels. Indeed, the fast and functional regulation of PAPD4 was not related to changes in gene expression, disclosing that control of protein levels occurs by post-transcriptional mechanisms. Furthermore, we were able to quantify changes in PAPD4 in specific amacrine cells after dark -adaptation, suggesting for circuitry-related roles in visual perception. In summary, in this study we first described the

  2. Early Developmental and Evolutionary Origins of Gene Body DNA Methylation Patterns in Mammalian Placentas.

    Directory of Open Access Journals (Sweden)

    Diane I Schroeder

    2015-08-01

    Full Text Available Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs and highly methylated domains (HMDs with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo.

  3. Gene networks underlying convergent and pleiotropic phenotypes in a large and systematically-phenotyped cohort with heterogeneous developmental disorders.

    Directory of Open Access Journals (Sweden)

    Tallulah Andrews

    2015-03-01

    Full Text Available Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51% groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.

  4. Identification of 2 novel genes developmentally regulated in the mouse aorta-gonad-mesonephros region

    NARCIS (Netherlands)

    C. Orelio; E.A. Dzierzak (Elaine)

    2003-01-01

    textabstractThe first adult-repopulating hematopoietic stem cells (HSCs) emerge in the mouse aorta-gonad-mesonephros (AGM) region at embryonic day 10.5 prior to their appearance in the yolk sac and fetal liver. Although several genes are implicated in the regulation of HSCs, there

  5. Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

    Science.gov (United States)

    Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

    2014-05-01

    Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

  6. Expression analysis of genes implicated in meiotic resumption in vivo and developmental competence

    NARCIS (Netherlands)

    Algriany, O.A.

    2007-01-01

    This thesis investigated the gene expression in bovine oocytes during meiotic resumption, at 6 h post LH surge, coinciding with germinal vesicle breakdown, which was supposed to give a picture of the major cell cycle regulation changes, cytoskeleton rearrangement and chromosome alignment.

  7. Advanced Strategies for Articular Cartilage Defect Repair

    Directory of Open Access Journals (Sweden)

    Fergal J. O'Brien

    2013-02-01

    Full Text Available Articular cartilage is a unique tissue owing to its ability to withstand repetitive compressive stress throughout an individual’s lifetime. However, its major limitation is the inability to heal even the most minor injuries. There still remains an inherent lack of strategies that stimulate hyaline-like articular cartilage growth with appropriate functional properties. Recent scientific advances in tissue engineering have made significant steps towards development of constructs for articular cartilage repair. In particular, research has shown the potential of biomaterial physico-chemical properties significantly influencing the proliferation, differentiation and matrix deposition by progenitor cells. Accordingly, this highlights the potential of using such properties to direct the lineage towards which such cells follow. Moreover, the use of soluble growth factors to enhance the bioactivity and regenerative capacity of biomaterials has recently been adopted by researchers in the field of tissue engineering. In addition, gene therapy is a growing area that has found noteworthy use in tissue engineering partly due to the potential to overcome some drawbacks associated with current growth factor delivery systems. In this context, such advanced strategies in biomaterial science, cell-based and growth factor-based therapies that have been employed in the restoration and repair of damaged articular cartilage will be the focus of this review article.

  8. The mechanobiology of articular cartilage development and degeneration.

    Science.gov (United States)

    Carter, Dennis R; Beaupré, Gary S; Wong, Marcy; Smith, R Lane; Andriacchi, Tom P; Schurman, David J

    2004-10-01

    The development, maintenance, and destruction of cartilage are regulated by mechanical factors throughout life. Mechanical cues in the cartilage fetal endoskeleton influence the expression of genes that guide the processes of growth, vascular invasion, and ossification. Intermittent fluid pressure maintains the cartilage phenotype whereas mild tension (or shear) promotes growth and ossification. The articular cartilage thickness is determined by the position at which the subchondral growth front stabilizes. In mature joints, cartilage is thickest and healthiest where the contact pressure and cartilage fluid pressure are greatest. The depth-dependent histomorphology reflects the local fluid pressure, tensile strain, and fluid exudation. Osteoarthritis represents the final demise and loss of cartilage in the skeletal elements. The initiation and progression of osteoarthritis can follow many pathways and can be promoted by mechanical factors including: (1) reduced loading, which activates the subchondral growth front by reducing fluid pressure; (2) blunt impact, causing microdamage and activation of the subchondral growth front by local shear stress; (3) mechanical abnormalities that increase wear at the articulating surface; and (4) other mechanically related factors. Research should be directed at integrating our mechanical understanding of osteoarthritis pathogenesis and progression within the framework of cellular and molecular events throughout ontogeny.

  9. When is cartilage repair successful?

    International Nuclear Information System (INIS)

    Raudner, M.; Roehrich, S.; Zalaudek, M.; Trattnig, S.; Schreiner, M.M.

    2017-01-01

    Focal cartilage lesions are a cause of long-term disability and morbidity. After cartilage repair, it is crucial to evaluate long-term progression or failure in a reproducible, standardized manner. This article provides an overview of the different cartilage repair procedures and important characteristics to look for in cartilage repair imaging. Specifics and pitfalls are pointed out alongside general aspects. After successful cartilage repair, a complete, but not hypertrophic filling of the defect is the primary criterion of treatment success. The repair tissue should also be completely integrated to the surrounding native cartilage. After some months, the transplants signal should be isointense compared to native cartilage. Complications like osteophytes, subchondral defects, cysts, adhesion and chronic bone marrow edema or joint effusion are common and have to be observed via follow-up. Radiological evaluation and interpretation of postoperative changes should always take the repair method into account. (orig.) [de

  10. MR imaging of articular cartilage

    International Nuclear Information System (INIS)

    Schaefer, F.K.W.; Muhle, C.; Heller, M.; Brossmann, J.

    2001-01-01

    MR imaging has evolved to the best non-invasive method for the evaluation of articular cartilage. MR imaging helps to understand the structure and physiology of cartilage, and to diagnose cartilage lesions. Numerous studies have shown high accuracy and reliability concerning detection of cartilage lesions and early changes in both structure and biochemistry. High contrast-to-noise ratio and high spatial resolution are essential for analysis of articular cartilage. Fat-suppressed 3D-T 1 weighted gradient echo and T 2 -weighted fast spin echo sequences with or without fat suppression are recommended for clinical routine. In this article the anatomy and pathology of hyaline articular cartilage and the complex imaging characteristics of hyaline cartilage will be discussed. (orig.) [de

  11. Asymmetric division and differential gene expression during a bacterial developmental program requires DivIVA.

    Directory of Open Access Journals (Sweden)

    Prahathees Eswaramoorthy

    2014-08-01

    Full Text Available Sporulation in the bacterium Bacillus subtilis is a developmental program in which a progenitor cell differentiates into two different cell types, the smaller of which eventually becomes a dormant cell called a spore. The process begins with an asymmetric cell division event, followed by the activation of a transcription factor, σF, specifically in the smaller cell. Here, we show that the structural protein DivIVA localizes to the polar septum during sporulation and is required for asymmetric division and the compartment-specific activation of σF. Both events are known to require a protein called SpoIIE, which also localizes to the polar septum. We show that DivIVA copurifies with SpoIIE and that DivIVA may anchor SpoIIE briefly to the assembling polar septum before SpoIIE is subsequently released into the forespore membrane and recaptured at the polar septum. Finally, using super-resolution microscopy, we demonstrate that DivIVA and SpoIIE ultimately display a biased localization on the side of the polar septum that faces the smaller compartment in which σF is activated.

  12. Developmental and functional expression of miRNA-stability related genes in the nervous system.

    Directory of Open Access Journals (Sweden)

    Érica de Sousa

    Full Text Available In the nervous system, control of gene expression by microRNAs (miRNAs has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We first detected two genes in the retina that have been associated to miRNA stability, XRN2 and PAPD4. These genes are highly expressed during retinal development, however with distinct subcellular localization. We investigated whether these proteins are regulated during specific phases of the cell cycle. Combined analyses of nuclei position in neuroblastic layer and labeling using anti-cyclin D1 revealed that both proteins do not accumulate in S or M phases of the cell cycle, being poorly expressed in progenitor cells. Indeed, XRN2 and PAPD4 were observed mainly after neuronal differentiation, since low expression was also observed in astrocytes, endothelial and microglial cells. XRN2 and PAPD4 are expressed in a wide variety of neurons, including horizontal, amacrine and ganglion cells. To evaluate the functional role of both genes, we carried out experiments addressed to the retinal adaptation in response to different ambient light conditions. PAPD4 is upregulated after 3 and 24 hours of dark- adaptation, revealing that accumulation of this protein is governed by ambient light levels. Indeed, the fast and functional regulation of PAPD4 was not related to changes in gene expression, disclosing that control of protein levels occurs by post-transcriptional mechanisms. Furthermore, we were able to quantify changes in PAPD4 in specific amacrine cells after dark -adaptation, suggesting for circuitry-related roles in visual perception. In summary, in this study we

  13. Lubrication and cartilage.

    Science.gov (United States)

    Wright, V; Dowson, D

    1976-02-01

    Mechanisms of lubrication of human synovial joints have been analysed in terms of the operating conditions of the joint, the synovial fluid and articular cartilage. In the hip and knee during a walking cycle the load may rise up to four times body weight. In the knee on dropping one metre the load may go up to 25 time body weight. The elastic modulus of cartilage is similar to that of the synthetic rubber of a car tyre. The cartilage surface is rough and in elderly specimens the centre line average is 2-75 mum. The friction force generated in reciprocating tests shows that both cartilage and synovial fluid are important in lubrication. The viscosity-shear rate relationships of normal synovial fluid show that it is non-Newtonian. Osteoarthrosic fluid is less so and rheumatoid fluid is more nearly Newtonian. Experiments with hip joints in a pendulum machine show that fluid film lubrication obtains at some phases of joint action. Boundary lubrication prevails under certain conditions and has been examined with a reciprocating friction machine. Digestion of hyaluronate does not alter the boundary lubrication, but trypsin digestion does. Surface active substances (lauryl sulphate and cetyl 3-ammonium bromide) give a lubricating ability similar to that of synovial fluid. The effectiveness of the two substances varies with pH.

  14. Chondroptosis in Alkaptonuric Cartilage

    Science.gov (United States)

    Millucci, Lia; Giorgetti, Giovanna; Viti, Cecilia; Ghezzi, Lorenzo; Gambassi, Silvia; Braconi, Daniela; Marzocchi, Barbara; Paffetti, Alessandro; Lupetti, Pietro; Bernardini, Giulia; Orlandini, Maurizio

    2015-01-01

    Alkaptonuria (AKU) is a rare genetic disease that affects the entire joint. Current standard of treatment is palliative and little is known about AKU physiopathology. Chondroptosis, a peculiar type of cell death in cartilage, has been so far reported to occur in osteoarthritis, a rheumatic disease that shares some features with AKU. In the present work, we wanted to assess if chondroptosis might also occur in AKU. Electron microscopy was used to detect the morphological changes of chondrocytes in damaged cartilage distinguishing apoptosis from its variant termed chondroptosis. We adopted histological observation together with Scanning Electron Microscopy and Transmission Electron Microscopy to evaluate morphological cell changes in AKU chondrocytes. Lipid peroxidation in AKU cartilage was detected by fluorescence microscopy. Using the above‐mentioned techniques, we performed a morphological analysis and assessed that AKU chondrocytes undergo phenotypic changes and lipid oxidation, resulting in a progressive loss of articular cartilage structure and function, showing typical features of chondroptosis. To the best of our knowledge, AKU is the second chronic pathology, following osteoarthritis, where chondroptosis has been documented. Our results indicate that Golgi complex plays an important role in the apoptotic process of AKU chondrocytes and suggest a contribution of chondroptosis in AKU pathogenesis. These findings also confirm a similarity between osteoarthritis and AKU. J. Cell. Physiol. 230: 1148–1157, 2015. © 2014 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc. PMID:25336110

  15. INJURED ARTICULAR CARTILAGE REPAIR

    Directory of Open Access Journals (Sweden)

    Ariana Barlič

    2008-02-01

    Surveys show that the most frequently used surgical methods are mosaicplasty and bonemarrow stimulation with microfracturing. The efficacy of the autologous chondrocyte implantationmethod should be superior to microfracturing on a long run. Especially when(regeneration of the hyaline cartilage instead of fibrous tissue (fibrocartilage is concerned.However, it has not been scientifically proved yet

  16. HPRT deficiency coordinately dysregulates canonical Wnt and presenilin-1 signaling: a neuro-developmental regulatory role for a housekeeping gene?

    Directory of Open Access Journals (Sweden)

    Tae Hyuk Kang

    2011-01-01

    Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for

  17. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    Science.gov (United States)

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  18. Gene-environment interaction and behavioral disorders: a developmental perspective based on endophenotypes.

    Science.gov (United States)

    Battaglia, Marco; Marino, Cecilia; Maziade, Michel; Molteni, Massimo; D'Amato, Francesca

    2008-01-01

    It has been observed that 'No aspect of human behavioral genetics has caused more confusion and generated more obscurantism than the analysis and interpretation of various types of non-additivity and non-independence of gene and environmental action and interaction' (Eaves LJ et al 1977 Br J Math Stat Psychol 30:1-42). On the other hand, a bulk of newly published studies appear to speak in favour of common and frequent interplay--and possibly interaction--between identified genetic polymorphisms and specified environmental variables in shaping behavior and behavioral disorders. Considerable interest has arisen from the introduction of putative functional 'endophenotypes' which would represent a more proximate biological link to genes, as well as an obligatory intermediate of behavior. While explicit criteria to identify valid endophenotypes have been offered, a number of new 'alternative phenotypes' are now being proposed as possible 'endophenotypes' for behavioral and psychiatric genetics research, sometimes with less than optimal stringency. Nonetheless, we suggest that some endophenotypes can be helpful in investigating several instances of gene-environment interactions and be employed as additional tools to reduce the risk for spurious results in this controversial area.

  19. Cartilage extracellular matrix as a biomaterial for cartilage regeneration.

    Science.gov (United States)

    Kiyotake, Emi A; Beck, Emily C; Detamore, Michael S

    2016-11-01

    The extracellular matrix (ECM) of various tissues possesses the model characteristics that biomaterials for tissue engineering strive to mimic; however, owing to the intricate hierarchical nature of the ECM, it has yet to be fully characterized and synthetically fabricated. Cartilage repair remains a challenge because the intrinsic properties that enable its durability and long-lasting function also impede regeneration. In the last decade, cartilage ECM has emerged as a promising biomaterial for regenerating cartilage, partly because of its potentially chondroinductive nature. As this research area of cartilage matrix-based biomaterials emerged, investigators facing similar challenges consequently developed convergent solutions in constructing robust and bioactive scaffolds. This review discusses the challenges, emerging trends, and future directions of cartilage ECM scaffolds, including a comparison between two different forms of cartilage matrix: decellularized cartilage (DCC) and devitalized cartilage (DVC). To overcome the low permeability of cartilage matrix, physical fragmentation greatly enhances decellularization, although the process itself may reduce the chondroinductivity of fabricated scaffolds. The less complex processing of a scaffold composed of DVC, which has not been decellularized, appears to have translational advantages and potential chondroinductive and mechanical advantages over DCC, without detrimental immunogenicity, to ultimately enhance cartilage repair in a clinically relevant way. © 2016 New York Academy of Sciences.

  20. Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

    Science.gov (United States)

    Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi

    2017-10-01

    Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. A novel in vitro bovine cartilage punch model for assessing the regeneration of focal cartilage defects with biocompatible bacterial nanocellulose

    Science.gov (United States)

    2013-01-01

    Introduction Current therapies for articular cartilage defects fail to achieve qualitatively sufficient tissue regeneration, possibly because of a mismatch between the speed of cartilage rebuilding and the resorption of degradable implant polymers. The present study focused on the self-healing capacity of resident cartilage cells in conjunction with cell-free and biocompatible (but non-resorbable) bacterial nanocellulose (BNC). This was tested in a novel in vitro bovine cartilage punch model. Methods Standardized bovine cartilage discs with a central defect filled with BNC were cultured for up to eight weeks with/without stimulation with transforming growth factor-β1 (TGF-β1. Cartilage formation and integrity were analyzed by histology, immunohistochemistry and electron microscopy. Content, release and neosynthesis of the matrix molecules proteoglycan/aggrecan, collagen II and collagen I were also quantified. Finally, gene expression of these molecules was profiled in resident chondrocytes and chondrocytes migrated onto the cartilage surface or the implant material. Results Non-stimulated and especially TGF-β1-stimulated cartilage discs displayed a preserved structural and functional integrity of the chondrocytes and surrounding matrix, remained vital in long-term culture (eight weeks) without signs of degeneration and showed substantial synthesis of cartilage-specific molecules at the protein and mRNA level. Whereas mobilization of chondrocytes from the matrix onto the surface of cartilage and implant was pivotal for successful seeding of cell-free BNC, chondrocytes did not immigrate into the central BNC area, possibly due to the relatively small diameter of its pores (2 to 5 μm). Chondrocytes on the BNC surface showed signs of successful redifferentiation over time, including increase of aggrecan/collagen type II mRNA, decrease of collagen type I mRNA and initial deposition of proteoglycan and collagen type II in long-term high-density pellet cultures

  2. Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression.

    Science.gov (United States)

    Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha

    2013-05-01

    Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.

  3. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta

    DEFF Research Database (Denmark)

    Rewitz, Kim; Rybczynski, Robert; Warren, James T.

    2006-01-01

    this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...

  4. Advances in cartilage tissue engineering : in vitro

    NARCIS (Netherlands)

    E.W. Mandl (Erik)

    2004-01-01

    textabstractWithin the body three subtypes of cartilage can be distinguished: hyaline cartilage, elastic cartilage and fibrocartilage. Hyaline cartilage is the predominant subtype and is mainly located in articular joints and in less extent in the nasal septum and cricoid. Elastic cartilage can be

  5. A novel CpG island set identifies tissue-specific methylation at developmental gene loci.

    Directory of Open Access Journals (Sweden)

    Robert Illingworth

    2008-01-01

    Full Text Available CpG islands (CGIs are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.

  6. Developmental status of bioassays in genetic toxicology: a report of Phase II of the US Environmental Protection Agency Gene-Tox program

    Energy Technology Data Exchange (ETDEWEB)

    Brusick, D; Auletta, A

    1985-01-01

    The Gene-Tox Program was structured around two phases of genetic test data evaluation. The first phase consisted of 36 Work Group reports, each evaluating the results and performance of a specific bioassay. The second phase consisted of a plan to summarize the information provided by the Work Groups. The Gene-Tox Coordinating Committee was to be responsible for Phase II, and several subgroups were assigned specific goals in implementing this analysis. This report deals with Goal I which is to identify the developmental status of the individual bioassays reviewed by the Gene-Tox Work Groups in the first phase of the Program. 5 references, 6 tables.

  7. Developmental Changes In Pain And Spinal Immune Gene Expression After Radicular Trauma In The Rat

    Directory of Open Access Journals (Sweden)

    Gordon Alfred Barr

    2016-12-01

    Full Text Available Neuropathic pain is an example of chronic pain that develops after nerve injury and is less frequent in infants and children than in adults. Likewise, in animal models of neuropathic pain, allodynia and hyperalgesia are non-existent or attenuated in the infant, with a switch during development by which acute nerve injury transitions to chronic pain. Concomitant with the delay in neuropathic pain, there is a parallel delay in the ability of nerve injury to activate the immune system. Models of neuropathic pain in the infant have used various ligation methods and find that neuropathic pain does not occur under after postnatal day 21-28 (PN21-PN28, linked to activation of immune processes and developmental regulation of anti-inflammatory cytokines. We applied a model of neuropathic pain in the adult using a transient compression of the cervical nerve or nerve root in infant rats (injured at 10, 14, 21 or 28 days of age to define transition periods during which injury results in no change in thermal and mechanical pain sensitivity or in short term changes in pain. There was little to no hyperalgesia when the injury was imposed at PN10, but significant thermal hyperalgesia and mechanical allodynia one day after compression injury when performed at PN14, 21 or 28. Thermal withdrawal latencies return to near baseline by 7 days post-surgery (PS7 when the injuries were at PN14, and lasted up to 14 days when imposed at PN28. There was mechanical allodynia following nerve injury at 7 or 14 days after injury at PN14. Measurements of mRNA from spinal cord at 1, 7 and 14 days post-injury at PN14, 21, and 28 showed that both the magnitude and duration of elevated immune markers and chemokines/cytokines were greater in the older animals, corresponding to the development of hyperalgesia. Thus we confirm the late onset of neuropathic pain but found no evidence of emergent hyperalgesia if the injury was before PN21/28. This may be due to the use of a transient

  8. NeuroD1: developmental expression and regulated genes in the rodent pineal gland

    DEFF Research Database (Denmark)

    Muñoz, Estela M; Bailey, Michael J; Rath, Martin F

    2007-01-01

    NeuroD1/BETA2, a member of the bHLH transcription factor family, is known to influence the fate of specific neuronal, endocrine and retinal cells. We report here that NeuroD1 mRNA is highly abundant in the developing and adult rat pineal gland. Pineal expression begins in the 17-day embryo at which...... time it is also detectable in other brain regions. Expression in the pineal gland increases during the embryonic period and is maintained thereafter at levels equivalent to those found in the cerebellum and retina. In contrast, NeuroD1 mRNA decreases markedly in non-cerebellar brain regions during...... development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

  9. Progenitor cells in auricular cartilage demonstrate cartilage-forming capacity in 3D hydrogel culture

    Directory of Open Access Journals (Sweden)

    IA Otto

    2018-02-01

    Full Text Available Paramount for the generation of auricular structures of clinically-relevant size is the acquisition of a large number of cells maintaining an elastic cartilage phenotype, which is the key in producing a tissue capable of withstanding forces subjected to the auricle. Current regenerative medicine strategies utilize chondrocytes from various locations or mesenchymal stromal cells (MSCs. However, the quality of neo-tissues resulting from these cell types is inadequate due to inefficient chondrogenic differentiation and endochondral ossification, respectively. Recently, a subpopulation of stem/progenitor cells has been identified within the auricular cartilage tissue, with similarities to MSCs in terms of proliferative capacity and cell surface biomarkers, but their potential for tissue engineering has not yet been explored. This study compared the in vitro cartilage-forming ability of equine auricular cartilage progenitor cells (AuCPCs, bone marrow-derived MSCs and auricular chondrocytes in gelatin methacryloyl (gelMA-based hydrogels over a period of 56 d, by assessing their ability to undergo chondrogenic differentiation. Neocartilage formation was assessed through gene expression profiling, compression testing, biochemical composition and histology. Similar to MSCs and chondrocytes, AuCPCs displayed a marked ability to generate cartilaginous matrix, although, under the applied culture conditions, MSCs outperformed both cartilage-derived cell types in terms of matrix production and mechanical properties. AuCPCs demonstrated upregulated mRNA expression of elastin, low expression of collagen type X and similar levels of proteoglycan production and mechanical properties as compared to chondrocytes. These results underscored the AuCPCs’ tissue-specific differentiation potential, making them an interesting cell source for the next generation of elastic cartilage tissue-engineered constructs.

  10. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    Science.gov (United States)

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

    2001-12-01

    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

  11. Developmental pathways from child maltreatment to adolescent marijuana dependence: Examining moderation by FK506 binding protein 5 gene (FKBP5).

    Science.gov (United States)

    Handley, Elizabeth D; Rogosch, Fred A; Cicchetti, Dante

    2015-11-01

    The current study examined the prospective association between child maltreatment and the development of substance use disorder in adolescence with the aim of investigating pathways underlying this relation, as well as genetic moderation of these developmental mechanisms. Specifically, we tested whether youth who experienced maltreatment prior to age 8 were at risk for the development of marijuana dependence in adolescence by way of a childhood externalizing pathway and a childhood internalizing pathway. Moreover, we tested whether variation in FK506 binding protein 5 gene (FKBP5) CATT haplotype moderated these pathways. The participants were 326 children (n =179 maltreated; n = 147 nonmaltreated) assessed across two waves of data collection (childhood: ages 7-9 and adolescence: ages 15-18). Results indicated that higher levels of child externalizing symptoms significantly mediated the effect of child maltreatment on adolescent marijuana dependence symptoms for individuals with one or two copies of the FKBP5 CATT haplotype only. We did not find support for an internalizing pathway from child maltreatment to adolescent marijuana dependence, nor did we find evidence of moderation of the internalizing pathway by FKBP5 haplotype variation. Findings extend previous research by demonstrating that whether a maltreated child will traverse an externalizing pathway toward substance use disorder in adolescence is dependent on FKBP5 genetic variation.

  12. Developmental and sex-specific differences in expression of neuropeptides derived from allatotropin gene in the silkmoth Bombyx mori.

    Science.gov (United States)

    Bednár, Branislav; Roller, Ladislav; Čižmár, Daniel; Mitrová, Diana; Žitňan, Dušan

    2017-05-01

    Allatotropin (AT) and related neuropeptides are widespread bioactive molecules that regulate development, food intake and muscle contractions in insects and other invertebrates. In moths, alternative splicing of the at gene generates three mRNA precursors encoding AT with different combinations of three structurally similar AT-like peptides (ATLI-III). We used in situ hybridization and immunohistochemistry to map the differential expression of these transcripts during the postembryonic development of Bombyx mori. Transcript encoding AT alone was expressed in numerous neurons of the central nervous system and frontal ganglion, whereas transcripts encoding AT with ATLs were produced by smaller specific subgroups of neurons in larval stages. Metamorphosis was associated with considerable developmental changes and sex-specific differences in the expression of all transcripts. The most notable was the appearance of AT/ATL transcripts (1) in the brain lateral neurosecretory cells producing prothoracicotropic hormone; (2) in the male-specific cluster of about 20 neurons in the posterior region of the terminal abdominal ganglion; (3) in the female-specific medial neurons in the abdominal ganglia AG2-7. Immunohistochemical staining showed that these neurons produced a mixture of various neuropeptides and innervated diverse peripheral organs. Our data suggest that AT/ATL neuropeptides are involved in multiple stage- and sex-specific functions during the development of B. mori.

  13. A peroxidase gene expressed during early developmental stages of the parasitic plant Orobanche ramosa.

    Science.gov (United States)

    González-Verdejo, Clara Isabel; Barandiaran, Xabier; Moreno, Maria Teresa; Cubero, José Ignacio; Di Pietro, Antonio

    2006-01-01

    Broomrapes (Orobanche spp.) are holoparasitic weeds that cause devastating losses in many economically important crops. The molecular mechanisms that control the early stages of host infection in Orobanche are poorly understood. In the present study, the role of peroxidase has been examined during pre-infection growth and development of O. ramosa, using an in vitro model system. Peroxidase activity was histochemically localized at the tips of actively growing radicles and nascent attachment organs. Addition of exogenous catalase resulted in a significant reduction in the apical growth rate of the radicle. The prx1 gene encoding a putative class III peroxidase was cloned from a cDNA library of O. ramosa and was found to be expressed specifically during the early stages of the parasitic life cycle. The exogenous addition of sucrose resulted in significantly reduced prx1 transcript levels and in a dramatic change in radicle development from polarized apical growth to isotropic growth and the formation of tubercle-like structures. The results indicate an important role of peroxidases during the early parasitic stages of Orobanche.

  14. Developmental pathway genes and neural plasticity underlying emotional learning and stress-related disorders.

    Science.gov (United States)

    Maheu, Marissa E; Ressler, Kerry J

    2017-09-01

    The manipulation of neural plasticity as a means of intervening in the onset and progression of stress-related disorders retains its appeal for many researchers, despite our limited success in translating such interventions from the laboratory to the clinic. Given the challenges of identifying individual genetic variants that confer increased risk for illnesses like depression and post-traumatic stress disorder, some have turned their attention instead to focusing on so-called "master regulators" of plasticity that may provide a means of controlling these potentially impaired processes in psychiatric illnesses. The mammalian homolog of Tailless (TLX), Wnt, and the homeoprotein Otx2 have all been proposed to constitute master regulators of different forms of plasticity which have, in turn, each been implicated in learning and stress-related disorders. In the present review, we provide an overview of the changing distribution of these genes and their roles both during development and in the adult brain. We further discuss how their distinct expression profiles provide clues as to their function, and may inform their suitability as candidate drug targets in the treatment of psychiatric disorders. © 2017 Maheu and Ressler; Published by Cold Spring Harbor Laboratory Press.

  15. Peculiarities in Ankle Cartilage.

    Science.gov (United States)

    Kraeutler, Matthew J; Kaenkumchorn, Tanyaporn; Pascual-Garrido, Cecilia; Wimmer, Markus A; Chubinskaya, Susanna

    2017-01-01

    Posttraumatic osteoarthritis (PTOA) is the most common form of osteoarthritis (OA) of the ankle joint. PTOA occurs as a result of several factors, including the poor regenerative capacity of hyaline articular cartilage as well as increased contact stresses following trauma. The purpose of this article is to review the epidemiology, pathogenesis, and potential targets for treatment of PTOA in the ankle joint. Previous reviews primarily addressed clinical approaches to ankle PTOA, while the focus of the current article will be specifically on the newly acquired knowledge of the cellular mechanisms that drive PTOA in the ankle joint and means for potential targeted therapeutics that might halt the progression of cartilage degeneration and/or improve the outcome of surgical interventions. Three experimental treatment strategies are discussed in this review: (1) increasing the anabolic potential of chondrocytes through treatment with growth factors such as bone morphogenetic protein-7; (2) limiting chondrocyte cell death either through the protection of cell membrane with poloxamer 188 or inhibiting activity of intracellular proteases, caspases, which are responsible for cell death by apoptosis; and (3) inhibiting catabolic/inflammatory responses of chondrocytes by treating them with anti-inflammatory agents such as tumor necrosis factor-α antagonists. Future studies should focus on identifying the appropriate timing for treatment and an appropriate combination of anti-inflammatory, chondro- and matrix-protective biologics to limit the progression of trauma-induced cartilage degeneration and prevent the development of PTOA in the ankle joint.

  16. Cartilage grafting in nasal reconstruction.

    Science.gov (United States)

    Immerman, Sara; White, W Matthew; Constantinides, Minas

    2011-02-01

    Nasal reconstruction after resection for cutaneous malignancies poses a unique challenge to facial plastic surgeons. The nose, a unique 3-D structure, not only must remain functional but also be aesthetically pleasing to patients. A complete understanding of all the layers of the nose and knowledge of available cartilage grafting material is necessary. Autogenous material, namely septal, auricular, and costal cartilage, is the most favored material in a free cartilage graft or a composite cartilage graft. All types of material have advantages and disadvantages that should guide the most appropriate selection to maximize the functional and cosmetic outcomes for patients. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Early developmental gene enhancers affect subcortical volumes in the adult human brain.

    Science.gov (United States)

    Becker, Martin; Guadalupe, Tulio; Franke, Barbara; Hibar, Derrek P; Renteria, Miguel E; Stein, Jason L; Thompson, Paul M; Francks, Clyde; Vernes, Sonja C; Fisher, Simon E

    2016-05-01

    Genome-wide association screens aim to identify common genetic variants contributing to the phenotypic variability of complex traits, such as human height or brain morphology. The identified genetic variants are mostly within noncoding genomic regions and the biology of the genotype-phenotype association typically remains unclear. In this article, we propose a complementary targeted strategy to reveal the genetic underpinnings of variability in subcortical brain volumes, by specifically selecting genomic loci that are experimentally validated forebrain enhancers, active in early embryonic development. We hypothesized that genetic variation within these enhancers may affect the development and ultimately the structure of subcortical brain regions in adults. We tested whether variants in forebrain enhancer regions showed an overall enrichment of association with volumetric variation in subcortical structures of >13,000 healthy adults. We observed significant enrichment of genomic loci that affect the volume of the hippocampus within forebrain enhancers (empirical P = 0.0015), a finding which robustly passed the adjusted threshold for testing of multiple brain phenotypes (cutoff of P < 0.0083 at an alpha of 0.05). In analyses of individual single nucleotide polymorphisms (SNPs), we identified an association upstream of the ID2 gene with rs7588305 and variation in hippocampal volume. This SNP-based association survived multiple-testing correction for the number of SNPs analyzed but not for the number of subcortical structures. Targeting known regulatory regions offers a way to understand the underlying biology that connects genotypes to phenotypes, particularly in the context of neuroimaging genetics. This biology-driven approach generates testable hypotheses regarding the functional biology of identified associations. Hum Brain Mapp 37:1788-1800, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition.

    Science.gov (United States)

    Saunders, Lindsay R; McClay, David R

    2014-04-01

    Epithelial-mesenchymal transition (EMT) is a fundamental cell state change that transforms epithelial to mesenchymal cells during embryonic development, adult tissue repair and cancer metastasis. EMT includes a complex series of intermediate cell state changes including remodeling of the basement membrane, apical constriction, epithelial de-adhesion, directed motility, loss of apical-basal polarity, and acquisition of mesenchymal adhesion and polarity. Transcriptional regulatory state changes must ultimately coordinate the timing and execution of these cell biological processes. A well-characterized gene regulatory network (GRN) in the sea urchin embryo was used to identify the transcription factors that control five distinct cell changes during EMT. Single transcription factors were perturbed and the consequences followed with in vivo time-lapse imaging or immunostaining assays. The data show that five different sub-circuits of the GRN control five distinct cell biological activities, each part of the complex EMT process. Thirteen transcription factors (TFs) expressed specifically in pre-EMT cells were required for EMT. Three TFs highest in the GRN specified and activated EMT (alx1, ets1, tbr) and the 10 TFs downstream of those (tel, erg, hex, tgif, snail, twist, foxn2/3, dri, foxb, foxo) were also required for EMT. No single TF functioned in all five sub-circuits, indicating that there is no EMT master regulator. Instead, the resulting sub-circuit topologies suggest EMT requires multiple simultaneous regulatory mechanisms: forward cascades, parallel inputs and positive-feedback lock downs. The interconnected and overlapping nature of the sub-circuits provides one explanation for the seamless orchestration by the embryo of cell state changes leading to successful EMT.

  19. Effects of Hydrostatic Loading on a Self-Aggregating, Suspension Culture–Derived Cartilage Tissue Analog

    Science.gov (United States)

    Kraft, Jeffrey J.; Jeong, Changhoon; Novotny, John E.; Seacrist, Thomas; Chan, Gilbert; Domzalski, Marcin; Turka, Christina M.; Richardson, Dean W.; Dodge, George R.

    2011-01-01

    Objective: Many approaches are being taken to generate cartilage replacement materials. The goal of this study was to use a self-aggregating suspension culture model of chondrocytes with mechanical preconditioning. Design: Our model differs from others in that it is based on a scaffold-less, self-aggregating culture model that produces a cartilage tissue analog that has been shown to share many similarities with the natural cartilage phenotype. Owing to the known loaded environment under which chondrocytes function in vivo, we hypothesized that applying force to the suspension culture–derived chondrocyte biomass would improve its cartilage-like characteristics and provide a new model for engineering cartilage tissue analogs. Results: In this study, we used a specialized hydrostatic pressure bioreactor system to apply mechanical forces during the growth phase to improve biochemical and biophysical properties of the biomaterial formed. We demonstrated that using this high-density suspension culture, a biomaterial more consistent with the hyaline cartilage phenotype was produced without any foreign material added. Unpassaged chondrocytes responded to a physiologically relevant hydrostatic load by significantly increasing gene expression of critical cartilage molecule collagen and aggrecan along with other cartilage relevant genes, CD44, perlecan, decorin, COMP, and iNOS. Conclusions: This study describes a self-aggregating bioreactor model without foreign material or scaffold in which chondrocytes form a cartilage tissue analog with many features similar to native cartilage. This study represents a promising scaffold-less, methodological advancement in cartilage tissue engineering with potential translational applications to cartilage repair. PMID:26069584

  20. Mechanical confinement regulates cartilage matrix formation by chondrocytes

    Science.gov (United States)

    Lee, Hong-Pyo; Gu, Luo; Mooney, David J.; Levenston, Marc E.; Chaudhuri, Ovijit

    2017-12-01

    Cartilage tissue equivalents formed from hydrogels containing chondrocytes could provide a solution for replacing damaged cartilage. Previous approaches have often utilized elastic hydrogels. However, elastic stresses may restrict cartilage matrix formation and alter the chondrocyte phenotype. Here we investigated the use of viscoelastic hydrogels, in which stresses are relaxed over time and which exhibit creep, for three-dimensional (3D) culture of chondrocytes. We found that faster relaxation promoted a striking increase in the volume of interconnected cartilage matrix formed by chondrocytes. In slower relaxing gels, restriction of cell volume expansion by elastic stresses led to increased secretion of IL-1β, which in turn drove strong up-regulation of genes associated with cartilage degradation and cell death. As no cell-adhesion ligands are presented by the hydrogels, these results reveal cell sensing of cell volume confinement as an adhesion-independent mechanism of mechanotransduction in 3D culture, and highlight stress relaxation as a key design parameter for cartilage tissue engineering.

  1. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  2. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    Science.gov (United States)

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

    2012-01-01

    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  3. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system

    Science.gov (United States)

    Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng

    2018-01-01

    Background Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). Results In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. Conclusion This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes. PMID:29440889

  4. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system.

    Science.gov (United States)

    Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng; Wei, Lei

    2018-01-01

    Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog ( Ihh ) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes.

  5. Regulators of articular cartilage homeostasis

    NARCIS (Netherlands)

    Leijten, Jeroen Christianus Hermanus

    2012-01-01

    Prevention of hypertrophic differentiation is essential for successful cartilage repair strategies. Although this process is essential for longitudinal growth, it also is part of degenerative cartilage diseases such as osteoarthiritis. Moreover, it limits the use of cell types prone to this process

  6. The bio in the ink: cartilage regeneration with bioprintable hydrogels and articular cartilage-derived progenitor cells.

    Science.gov (United States)

    Levato, Riccardo; Webb, William R; Otto, Iris A; Mensinga, Anneloes; Zhang, Yadan; van Rijen, Mattie; van Weeren, René; Khan, Ilyas M; Malda, Jos

    2017-10-01

    Cell-laden hydrogels are the primary building blocks for bioprinting, and, also termed bioinks, are the foundations for creating structures that can potentially recapitulate the architecture of articular cartilage. To be functional, hydrogel constructs need to unlock the regenerative capacity of encapsulated cells. The recent identification of multipotent articular cartilage-resident chondroprogenitor cells (ACPCs), which share important traits with adult stem cells, represents a new opportunity for cartilage regeneration. However, little is known about the suitability of ACPCs for tissue engineering, especially in combination with biomaterials. This study aimed to investigate the potential of ACPCs in hydrogels for cartilage regeneration and biofabrication, and to evaluate their ability for zone-specific matrix production. Gelatin methacryloyl (gelMA)-based hydrogels were used to culture ACPCs, bone marrow mesenchymal stromal cells (MSCs) and chondrocytes, and as bioinks for printing. Our data shows ACPCs outperformed chondrocytes in terms of neo-cartilage production and unlike MSCs, ACPCs had the lowest gene expression levels of hypertrophy marker collagen type X, and the highest expression of PRG4, a key factor in joint lubrication. Co-cultures of the cell types in multi-compartment hydrogels allowed generating constructs with a layered distribution of collagens and glycosaminoglycans. By combining ACPC- and MSC-laden bioinks, a bioprinted model of articular cartilage was generated, consisting of defined superficial and deep regions, each with distinct cellular and extracellular matrix composition. Taken together, these results provide important information for the use of ACPC-laden hydrogels in regenerative medicine, and pave the way to the biofabrication of 3D constructs with multiple cell types for cartilage regeneration or in vitro tissue models. Despite its limited ability to repair, articular cartilage harbors an endogenous population of progenitor cells

  7. Evolution of the bHLH genes involved in stomatal development: implications for the expansion of developmental complexity of stomata in land plants.

    Directory of Open Access Journals (Sweden)

    Jin-Hua Ran

    Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.

  8. Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

    Science.gov (United States)

    Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro

    2009-01-01

    Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

  9. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects.

    Science.gov (United States)

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive developm...

  10. Ciona intestinalis as a Marine Model System to Study Some Key Developmental Genes Targeted by the Diatom-Derived Aldehyde Decadienal

    Directory of Open Access Journals (Sweden)

    Anna Lettieri

    2015-03-01

    Full Text Available The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.

  11. Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

    Directory of Open Access Journals (Sweden)

    Heying Zhou

    Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

  12. Neonatal manipulation of oxytocin prevents lipopolysaccharide-induced decrease in gene expression of growth factors in two developmental stages of the female rat.

    Science.gov (United States)

    Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana

    2014-10-01

    Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  14. Magnetically targeted delivery through cartilage

    Science.gov (United States)

    Jafari, Sahar; Mair, Lamar O.; Chowdhury, Sagar; Nacev, Alek; Hilaman, Ryan; Stepanov, Pavel; Baker-McKee, James; Ijanaten, Said; Koudelka, Christian; English, Bradley; Malik, Pulkit; Weinberg, Irving N.

    2018-05-01

    In this study, we have invented a method of delivering drugs deep into articular cartilage with shaped dynamic magnetic fields acting on small metallic magnetic nanoparticles with polyethylene glycol coating and average diameter of 30 nm. It was shown that transport of magnetic nanoparticles through the entire thickness of bovine articular cartilage can be controlled by a combined alternating magnetic field at 100 Hz frequency and static magnetic field of 0.8 tesla (T) generated by 1" dia. x 2" thick permanent magnet. Magnetic nanoparticles transport through bovine articular cartilage samples was investigated at various settings of magnetic field and time durations. Combined application of an alternating magnetic field and the static field gradient resulted in a nearly 50 times increase in magnetic nanoparticles transport in bovine articular cartilage tissue as compared with static field conditions. This method can be applied to locally deliver therapeutic-loaded magnetic nanoparticles deep into articular cartilage to prevent cartilage degeneration and promote cartilage repair in osteoarthritis.

  15. Magnetically targeted delivery through cartilage

    Directory of Open Access Journals (Sweden)

    Sahar Jafari

    2018-05-01

    Full Text Available In this study, we have invented a method of delivering drugs deep into articular cartilage with shaped dynamic magnetic fields acting on small metallic magnetic nanoparticles with polyethylene glycol coating and average diameter of 30 nm. It was shown that transport of magnetic nanoparticles through the entire thickness of bovine articular cartilage can be controlled by a combined alternating magnetic field at 100 Hz frequency and static magnetic field of 0.8 tesla (T generated by 1" dia. x 2" thick permanent magnet. Magnetic nanoparticles transport through bovine articular cartilage samples was investigated at various settings of magnetic field and time durations. Combined application of an alternating magnetic field and the static field gradient resulted in a nearly 50 times increase in magnetic nanoparticles transport in bovine articular cartilage tissue as compared with static field conditions. This method can be applied to locally deliver therapeutic-loaded magnetic nanoparticles deep into articular cartilage to prevent cartilage degeneration and promote cartilage repair in osteoarthritis.

  16. Identification of a developmental gene expression signature, including HOX genes, for the normal human colonic crypt stem cell niche: overexpression of the signature parallels stem cell overpopulation during colon tumorigenesis.

    Science.gov (United States)

    Bhatlekar, Seema; Addya, Sankar; Salunek, Moreh; Orr, Christopher R; Surrey, Saul; McKenzie, Steven; Fields, Jeremy Z; Boman, Bruce M

    2014-01-15

    Our goal was to identify a unique gene expression signature for human colonic stem cells (SCs). Accordingly, we determined the gene expression pattern for a known SC-enriched region--the crypt bottom. Colonic crypts and isolated crypt subsections (top, middle, and bottom) were purified from fresh, normal, human, surgical specimens. We then used an innovative strategy that used two-color microarrays (∼18,500 genes) to compare gene expression in the crypt bottom with expression in the other crypt subsections (middle or top). Array results were validated by PCR and immunostaining. About 25% of genes analyzed were expressed in crypts: 88 preferentially in the bottom, 68 in the middle, and 131 in the top. Among genes upregulated in the bottom, ∼30% were classified as growth and/or developmental genes including several in the PI3 kinase pathway, a six-transmembrane protein STAMP1, and two homeobox (HOXA4, HOXD10) genes. qPCR and immunostaining validated that HOXA4 and HOXD10 are selectively expressed in the normal crypt bottom and are overexpressed in colon carcinomas (CRCs). Immunostaining showed that HOXA4 and HOXD10 are co-expressed with the SC markers CD166 and ALDH1 in cells at the normal crypt bottom, and the number of these co-expressing cells is increased in CRCs. Thus, our findings show that these two HOX genes are selectively expressed in colonic SCs and that HOX overexpression in CRCs parallels the SC overpopulation that occurs during CRC development. Our study suggests that developmental genes play key roles in the maintenance of normal SCs and crypt renewal, and contribute to the SC overpopulation that drives colon tumorigenesis.

  17. The effects of different doses of IGF-1 on cartilage and subchondral bone during the repair of full-thickness articular cartilage defects in rabbits.

    Science.gov (United States)

    Zhang, Z; Li, L; Yang, W; Cao, Y; Shi, Y; Li, X; Zhang, Q

    2017-02-01

    To investigate the effects of different doses of insulin-like growth factor 1 (IGF-1) on the cartilage layer and subchondral bone (SB) during repair of full-thickness articular cartilage (AC) defects. IGF-1-loaded collagen membrane was implanted into full-thickness AC defects in rabbits. The effects of two different doses of IGF-1 on cartilage layer and SB adjacent to the defect, the cartilage structure, formation and integration, and the new SB formation were evaluated at the 1st, 4th and 8th week postoperation. Meanwhile, after 1 week treatment, the relative mRNA expressions in tissues adjacent to the defect, including cartilage and SB were determined by quantitative real-time RT-PCR (qRT-PCR), respectively. Different doses of IGF-1 induced different gene expression profiles in tissues adjacent to the defect and resulted in different repair outcomes. Particularly, at high dose IGF-1 aided cell survival, regulated the gene expressions in cartilage layer adjacent defect and altered ECM composition more effectively, improved the formation and integrity of neo-cartilage. While, at low dose IGF-1 regulated the gene expressions in SB more efficaciously and subsequently promoted the SB remodeling and reconstruction. Different doses of IGF-1 induced different responses of cartilage or SB during the repair of full-thickness AC defects. Particularly, high dose of IGF-1 was more beneficial to the neo-cartilage formation and integration, while low dose of it was more effective for the SB formation. Copyright © 2016 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  18. Chromosome-Centric Human Proteome Project Allies with Developmental Biology: A Case Study of the Role of Y Chromosome Genes in Organ Development.

    Science.gov (United States)

    Meyfour, Anna; Pooyan, Paria; Pahlavan, Sara; Rezaei-Tavirani, Mostafa; Gourabi, Hamid; Baharvand, Hossein; Salekdeh, Ghasem Hosseini

    2017-12-01

    One of the main goals of Chromosome-Centric Human Proteome Project is to identify protein evidence for missing proteins (MPs). Here, we present a case study of the role of Y chromosome genes in organ development and how to overcome the challenges facing MPs identification by employing human pluripotent stem cell differentiation into cells of different organs yielding unprecedented biological insight into adult silenced proteins. Y chromosome is a male-specific sex chromosome which escapes meiotic recombination. From an evolutionary perspective, Y chromosome has preserved 3% of ancestral genes compared to 98% preservation of the X chromosome based on Ohno's law. Male specific region of Y chromosome (MSY) contains genes that contribute to central dogma and govern the expression of various targets throughout the genome. One of the most well-known functions of MSY genes is to decide the male-specific characteristics including sex, testis formation, and spermatogenesis, which are majorly formed by ampliconic gene families. Beyond its role in sex-specific gonad development, MSY genes in coexpression with their X counterparts, as single copy and broadly expressed genes, inhibit haplolethality and play a key role in embryogenesis. The role of X-Y related gene mutations in the development of hereditary syndromes suggests an essential contribution of sex chromosome genes to development. MSY genes, solely and independent of their X counterparts and/or in association with sex hormones, have a considerable impact on organ development. In this Review, we present major recent findings on the contribution of MSY genes to gonad formation, spermatogenesis, and the brain, heart, and kidney development and discuss how Y chromosome proteome project may exploit developmental biology to find missing proteins.

  19. Brief report: reconstruction of joint hyaline cartilage by autologous progenitor cells derived from ear elastic cartilage.

    Science.gov (United States)

    Mizuno, Mitsuru; Kobayashi, Shinji; Takebe, Takanori; Kan, Hiroomi; Yabuki, Yuichiro; Matsuzaki, Takahisa; Yoshikawa, Hiroshi Y; Nakabayashi, Seiichiro; Ik, Lee Jeong; Maegawa, Jiro; Taniguchi, Hideki

    2014-03-01

    In healthy joints, hyaline cartilage covering the joint surfaces of bones provides cushioning due to its unique mechanical properties. However, because of its limited regenerative capacity, age- and sports-related injuries to this tissue may lead to degenerative arthropathies, prompting researchers to investigate a variety of cell sources. We recently succeeded in isolating human cartilage progenitor cells from ear elastic cartilage. Human cartilage progenitor cells have high chondrogenic and proliferative potential to form elastic cartilage with long-term tissue maintenance. However, it is unknown whether ear-derived cartilage progenitor cells can be used to reconstruct hyaline cartilage, which has different mechanical and histological properties from elastic cartilage. In our efforts to develop foundational technologies for joint hyaline cartilage repair and reconstruction, we conducted this study to obtain an answer to this question. We created an experimental canine model of knee joint cartilage damage, transplanted ear-derived autologous cartilage progenitor cells. The reconstructed cartilage was rich in proteoglycans and showed unique histological characteristics similar to joint hyaline cartilage. In addition, mechanical properties of the reconstructed tissues were higher than those of ear cartilage and equal to those of joint hyaline cartilage. This study suggested that joint hyaline cartilage was reconstructed from ear-derived cartilage progenitor cells. It also demonstrated that ear-derived cartilage progenitor cells, which can be harvested by a minimally invasive method, would be useful for reconstructing joint hyaline cartilage in patients with degenerative arthropathies. © AlphaMed Press.

  20. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Science.gov (United States)

    Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

    2016-01-01

    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  1. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Directory of Open Access Journals (Sweden)

    Zhengkun Qiu

    Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  2. The Tomato Hoffman’s Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures

    Science.gov (United States)

    Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

    2016-01-01

    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362

  3. Smart and Controllable rAAV Gene Delivery Carriers in Progenitor Cells for Human Musculoskeletal Regenerative Medicine with a Focus on the Articular Cartilage.

    Science.gov (United States)

    Rey-Rico, Ana; Cucchiarini, Magali

    2017-01-01

    Cell therapy using mesenchymal stem cells (MSCs) is a powerful tool for the treatment of various diseases and injuries. Still, important limitations including the large amounts of cells required for application in vivo and the age-related decline in lifespan, proliferation, and potency may hinder the use of MSCs in patients. In this regard, gene therapy may offer strong approaches to optimize the use of MSCs for regenerative medicine. Diverse nonviral and viral gene vehicles have been manipulated to genetically modify MSCs, among which the highly effective and relatively safe recombinant adeno-associated viral (rAAV) vectors that emerged as the preferred gene delivery system to treat human disorders. Yet, clinical adaptation of such gene vehicles may be limited by several hurdles, including the possibility of dissemination to nontarget sites and the presence of immune and toxic responses in the host organism that may impair their therapeutic actions. The use of smart biomaterials acting as interfaces to enhance the temporal and spatial presentation of therapeutic agents in the target place and/or acting as scaffolding for MSC growth is an innovative, valuable approach to overcome these shortcomings that else restrain the efficacy of such potent cell populations. Here, we provide an overview on the most recent tissue engineering approaches based on the use of biomaterials acting as vehicles for rAAV vectors to target MSCs directly in the recipient (in vivo strategy) or as supportive matrices for rAAV-modified MSCs for indirect cell reimplantation (ex vivo strategy) as means to activate the reparative processes in tissues of the musculoskeletal system. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. Large scale expression changes of genes related to neuronal signaling and developmental processes found in lateral septum of postpartum outbred mice.

    Directory of Open Access Journals (Sweden)

    Brian E Eisinger

    Full Text Available Coordinated gene expression changes across the CNS are required to produce the mammalian maternal phenotype. Lateral septum (LS is a brain region critically involved with aspects of maternal care, and we recently examined gene expression of whole septum (LS and medial septum in selectively bred maternal mice. Here, we expand on the prior study by 1 conducting microarray analysis solely on LS in virgin and postpartum mice, 2 using outbred mice, and 3 evaluating the role of sensory input on gene expression changes. Large scale changes in genes related to neuronal signaling were identified, including four GABAA receptor subunits. Subunits α4 and δ were downregulated in maternal LS, likely reflecting a reduction in the extrasynaptic, neurosteroid-sensitive α4/δ containing receptor subtype. Conversely, subunits ε and θ were increased in maternal LS. Fifteen K+ channel related genes showed altered expression, as did dopamine receptors Drd1a and Drd2 (both downregulated, hypocretin receptor 1 (Hcrtr1, kappa opioid receptor 1 (Oprk1, and transient receptor potential channel 4 (Trpc4. Expression of a large number of genes linked to developmental processes or cell differentiation were also altered in postpartum LS, including chemokine (C-X-C motif ligand 12 (Cxcl12, fatty acid binding protein 7 (Fabp7, plasma membrane proteolipid (Pllp, and suppressor of cytokine signaling 2 (Socs2. Additional genes that are linked to anxiety, such as glutathione reductase (Gsr, exhibited altered expression. Pathway analysis also identified changes in genes related to cyclic nucleotide metabolism, chromatin structure, and the Ras gene family. The sensory presence of pups was found to contribute to the altered expression of a subset of genes across all categories. This study suggests that both large changes in neuronal signaling and the possible terminal differentiation of neuronal and/or glial cells play important roles in producing the maternal state.

  5. The properties of bioengineered chondrocyte sheets for cartilage regeneration

    Directory of Open Access Journals (Sweden)

    Ota Naoshi

    2009-03-01

    Full Text Available Abstract Background Although the clinical results of autologous chondrocyte implantation for articular cartilage defects have recently improved as a result of advanced techniques based on tissue engineering procedures, problems with cell handling and scaffold imperfections remain to be solved. A new cell-sheet technique has been developed, and is potentially able to overcome these obstacles. Chondrocyte sheets applicable to cartilage regeneration can be prepared with this cell-sheet technique using temperature-responsive culture dishes. However, for clinical application, it is necessary to evaluate the characteristics of the cells in these sheets and to identify their similarities to naive cartilage. Results The expression of SOX 9, collagen type 2, 27, integrin α10, and fibronectin genes in triple-layered chondrocyte sheets was significantly increased in comparison to those in conventional monolayer culture and in a single chondrocyte sheet, implying a nature similar to ordinary cartilage. In addition, immunohistochemistry demonstrated that collagen type II, fibronectin, and integrin α10 were present in the triple-layered chondrocyte sheets. Conclusion The results of this study indicate that these chondrocyte sheets with a consistent cartilaginous phenotype and adhesive properties may lead to a new strategy for cartilage regeneration.

  6. A vision on the future of articular cartilage repair

    Directory of Open Access Journals (Sweden)

    M Cucchiarini

    2014-05-01

    Full Text Available An AO Foundation (Davos, Switzerland sponsored workshop "Cell Therapy in Cartilage Repair" from the Symposium "Where Science meets Clinics" (September 5-7, 2013, Davos gathered leaders from medicine, science, industry, and regulatory organisations to debate the vision of cell therapy in articular cartilage repair and the measures that could be taken to narrow the gap between vision and current practice. Cell-based therapy is already in clinical use to enhance the repair of cartilage lesions, with procedures such as microfracture and articular chondrocyte implantation. However, even though long term follow up is good from a clinical perspective and some of the most rigorous randomised controlled trials in the regenerative medicine/orthopaedics field show beneficial effect, none of these options have proved successful in restoring the original articular cartilage structure and functionality in patients so far. With the remarkable recent advances in experimental research in cell biology (new sources for chondrocytes, stem cells, molecular biology (growth factors, genes, biomaterials, biomechanics, and translational science, a combined effort between scientists and clinicians with broad expertise may allow development of an improved cell therapy for cartilage repair. This position paper describes the current state of the art in the field to help define a procedure adapted to the clinical situation for upcoming translation in the patient.

  7. Polymer Formulations for Cartilage Repair

    Energy Technology Data Exchange (ETDEWEB)

    Gutowska, Anna; Jasionowski, Marek; Morris, J. E.; Chrisler, William B.; An, Yuehuei H.; Mironov, V.

    2001-05-15

    Regeneration of destroyed articular cartilage can be induced by transplantation of cartilage cells into a defect. The best results are obtained with the use of autologus cells. However, obtaining large amounts of autologus cartilage cells causes a problem of creating a large cartilage defect in a donor site. Techniques are currently being developed to harvest a small number of cells and propagate them in vitro. It is a challenging task, however, due to the fact that ordinarily, in a cell culture on flat surfaces, chondrocytes do not maintain their in vivo phenotype and irreversibly diminish or cease the synthesis of aggregating proteoglycans. Therefore, the research is continuing to develop culture conditions for chondrocytes with the preserved phenotype.

  8. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  9. Cartilage oligomeric matrix protein enhances matrix assembly during chondrogenesis of human mesenchymal stem cells.

    Science.gov (United States)

    Haleem-Smith, Hana; Calderon, Raul; Song, Yingjie; Tuan, Rocky S; Chen, Faye H

    2012-04-01

    Cartilage oligomeric matrix protein/thrombospondin-5 (COMP/TSP5) is an abundant cartilage extracellular matrix (ECM) protein that interacts with major cartilage ECM components, including aggrecan and collagens. To test our hypothesis that COMP/TSP5 functions in the assembly of the ECM during cartilage morphogenesis, we have employed mesenchymal stem cell (MSC) chondrogenesis in vitro as a model to examine the effects of COMP over-expression on neo-cartilage formation. Human bone marrow-derived MSCs were transfected with either full-length COMP cDNA or control plasmid, followed by chondrogenic induction in three-dimensional pellet or alginate hydrogel culture. MSC chondrogenesis and ECM production was estimated based on quantitation of sulfated glycosaminoglycan (sGAG) accumulation, immunohistochemistry of the presence and distribution of cartilage ECM proteins, and real-time RT-PCR analyis of mRNA expression of cartilage markers. Our results showed that COMP over-expression resulted in increased total sGAG content during the early phase of MSC chondrogenesis, and increased immuno-detectable levels of aggrecan and collagen type II in the ECM of COMP-transfected pellet and alginate cultures, indicating more abundant cartilaginous matrix. COMP transfection did not significantly increase the transcript levels of the early chondrogenic marker, Sox9, or aggrecan, suggesting that enhancement of MSC cartilage ECM was effected at post-transcriptional levels. These findings strongly suggest that COMP functions in mesenchymal chondrogenesis by enhancing cartilage ECM organization and assembly. The action of COMP is most likely mediated not via direct changes in cartilage matrix gene expression but via interactions of COMP with other cartilage ECM proteins, such as aggrecan and collagens, that result in enhanced assembly and retention.

  10. CARTILAGE OLIGOMERIC MATRIX PROTEIN ENHANCES MATRIX ASSEMBLY DURING CHONDROGENESIS OF HUMAN MESENCHYMAL STEM CELLS

    Science.gov (United States)

    Haleem-Smith, Hana; Calderon, Raul; Song, Yingjie; Tuan, Rocky S.; Chen, Faye H.

    2011-01-01

    Cartilage oligomeric matrix protein/thrombospondin-5 (COMP/TSP5) is an abundant cartilage extracellular matrix (ECM) protein that interacts with major cartilage ECM components, including aggrecan and collagens. To test our hypothesis that COMP/TSP5 functions in the assembly of the ECM during cartilage morphogenesis, we have employed mesenchymal stem cell (MSC) chondrogenesis in vitro as a model to examine the effects of COMP over-expression on neo-cartilage formation. Human bone marrow-derived MSCs were transfected with either full-length COMP cDNA or control plasmid, followed by chondrogenic induction in three-dimensional pellet or alginate-hydrogel culture. MSC chondrogenesis and ECM production was estimated based on quantitation of sulfated glycosaminoglycan (sGAG) accumulation, immunohistochemistry of the presence and distribution of cartilage ECM proteins, and real-time RT-PCR analyis of mRNA expression of cartilage markers. Our results showed that COMP over-expression resulted in increased total sGAG content during the early phase of MSC chondrogenesis, and increased immuno-detectable levels of aggrecan and collagen type II in the ECM of COMP-transfected pellet and alginate cultures, indicating more abundant cartilaginous matrix. COMP transfection did not significantly increase the transcript levels of the early chondrogenic marker, Sox9, or aggrecan, suggesting that enhancement of MSC cartilage ECM was effected at post-transcriptional levels. These findings strongly suggest that COMP functions in mesenchymal chondrogenesis by enhancing cartilage ECM organization and assembly. The action of COMP is most likely mediated not via direct changes in cartilage matrix gene expression but via interactions of COMP with other cartilage ECM proteins, such as aggrecan and collagens, that result in enhanced assembly and retention. PMID:22095699

  11. Prochloraz and coumaphos induce different gene expression patterns in three developmental stages of the Carniolan honey bee (Apis mellifera carnica Pollmann).

    Science.gov (United States)

    Cizelj, Ivanka; Glavan, Gordana; Božič, Janko; Oven, Irena; Mrak, Vesna; Narat, Mojca

    2016-03-01

    The Carniolan honey bee, Apis mellifera carnica, is a Slovenian autochthonous subspecies of honey bee. In recent years, the country has recorded an annual loss of bee colonies through mortality of up to 35%. One possible reason for such high mortality could be the exposure of honey bees to xenobiotic residues that have been found in honey bee and beehive products. Acaricides are applied by beekeepers to control varroosis, while the most abundant common agricultural chemicals found in honey bee and beehive products are fungicides, which may enter the system when applied to nearby flowering crops and fruit plants. Acaricides and fungicides are not intrinsically highly toxic to bees but their action in combination might lead to higher honey bee sensitivity or mortality. In the present study we investigated the molecular immune response of honey bee workers at different developmental stages (prepupa, white-eyed pupa, adult) exposed to the acaricide coumaphos and the fungicide prochloraz individually and in combination. Expression of 17 immune-related genes was examined by quantitative RT-PCR. In treated prepupae downregulation of most immune-related genes was observed in all treatments, while in adults upregulation of most of the genes was recorded. Our study shows for the first time that negative impacts of prochloraz and a combination of coumaphos and prochloraz differ among the different developmental stages of honey bees. The main effect of the xenobiotic combination was found to be upregulation of the antimicrobial peptide genes abaecin and defensin-1 in adult honey bees. Changes in immune-related gene expression could result in depressed immunity of honey bees and their increased susceptibility to various pathogens. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  13. Spatial regulation of bone morphogenetic proteins (BMPs) in postnatal articular and growth plate cartilage

    Science.gov (United States)

    Garrison, Presley; Yue, Shanna; Hanson, Jeffrey; Baron, Jeffrey; Lui, Julian C.

    2017-01-01

    Articular and growth plate cartilage both arise from condensations of mesenchymal cells, but ultimately develop important histological and functional differences. Each is composed of three layers—the superficial, mid and deep zones of articular cartilage and the resting, proliferative and hypertrophic zones of growth plate cartilage. The bone morphogenetic protein (BMP) system plays an important role in cartilage development. A gradient in expression of BMP-related genes has been observed across growth plate cartilage, likely playing a role in zonal differentiation. To investigate the presence of a similar expression gradient in articular cartilage, we used laser capture microdissection (LCM) to separate murine growth plate and articular cartilage from the proximal tibia into their six constituent zones, and used a solution hybridization assay with color-coded probes (nCounter) to quantify mRNAs for 30 different BMP-related genes in each zone. In situ hybridization and immunohistochemistry were then used to confirm spatial expression patterns. Expression gradients for Bmp2 and 6 were observed across growth plate cartilage with highest expression in hypertrophic zone. However, intracellular BMP signaling, assessed by phospho-Smad1/5/8 immunohistochemical staining, appeared to be higher in the proliferative zone and prehypertrophic area than in hypertrophic zone, possibly due to high expression of Smad7, an inhibitory Smad, in the hypertrophic zone. We also found BMP expression gradients across the articular cartilage with BMP agonists primarily expressed in the superficial zone and BMP functional antagonists primarily expressed in the deep zone. Phospho-Smad1/5/8 immunohistochemical staining showed a similar gradient. In combination with previous evidence that BMPs regulate chondrocyte proliferation and differentiation, the current findings suggest that BMP signaling gradients exist across both growth plate and articular cartilage and that these gradients may

  14. Tissue engineering of cartilages using biomatrices

    DEFF Research Database (Denmark)

    Melrose, J.; Chuang, C.; Whitelock, J.

    2008-01-01

    and age-related degenerative diseases can all lead to cartilage loss; however, the low cell density and very limited self-renewal capacity of cartilage necessitate the development of effective therapeutic repair strategies for this tissue. The ontogeny of the chondrocyte, which is the cell that provides...... the biosynthetic machinery for all the component parts of cartilage, is discussed, since an understanding of cartilage development is central to the maintenance of a chondrocytic phenotype in any strategy aiming to produce a replacement cartilage. A plethora of matrices have been developed for cartilage...

  15. Mutation update of transcription factor genes FOXE3, HSF4, MAF, and PITX3 causing cataracts and other developmental ocular defects.

    Science.gov (United States)

    Anand, Deepti; Agrawal, Smriti A; Slavotinek, Anne; Lachke, Salil A

    2018-04-01

    Mutations in the transcription factor genes FOXE3, HSF4, MAF, and PITX3 cause congenital lens defects including cataracts that may be accompanied by defects in other components of the eye or in nonocular tissues. We comprehensively describe here all the variants in FOXE3, HSF4, MAF, and PITX3 genes linked to human developmental defects. A total of 52 variants for FOXE3, 18 variants for HSF4, 20 variants for MAF, and 19 variants for PITX3 identified so far in isolated cases or within families are documented. This effort reveals FOXE3, HSF4, MAF, and PITX3 to have 33, 16, 18, and 7 unique causal mutations, respectively. Loss-of-function mutant animals for these genes have served to model the pathobiology of the associated human defects, and we discuss the currently known molecular function of these genes, particularly with emphasis on their role in ocular development. Finally, we make the detailed FOXE3, HSF4, MAF, and PITX3 variant information available in the Leiden Online Variation Database (LOVD) platform at https://www.LOVD.nl/FOXE3, https://www.LOVD.nl/HSF4, https://www.LOVD.nl/MAF, and https://www.LOVD.nl/PITX3. Thus, this article informs on key variants in transcription factor genes linked to cataract, aphakia, corneal opacity, glaucoma, microcornea, microphthalmia, anterior segment mesenchymal dysgenesis, and Ayme-Gripp syndrome, and facilitates their access through Web-based databases. © 2018 Wiley Periodicals, Inc.

  16. A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships.

    Science.gov (United States)

    Pucci, Ferdinando; Venneri, Mary Anna; Biziato, Daniela; Nonis, Alessandro; Moi, Davide; Sica, Antonio; Di Serio, Clelia; Naldini, Luigi; De Palma, Michele

    2009-07-23

    We previously showed that Tie2-expressing monocytes (TEMs) have nonredundant proangiogenic activity in tumors. Here, we compared the gene expression profile of tumor-infiltrating TEMs with that of tumor-associated macrophages (TAMs), spleen-derived Gr1(+)Cd11b(+) neutrophils/myeloid-derived suppressor cells, circulating "inflammatory" and "resident" monocytes, and tumor-derived endothelial cells (ECs) by quantitative polymerase chain reaction-based gene arrays. TEMs sharply differed from ECs and Gr1(+)Cd11b(+) cells but were highly related to TAMs. Nevertheless, several genes were differentially expressed between TEMs and TAMs, highlighting a TEM signature consistent with enhanced proangiogenic/tissue-remodeling activity and lower proinflammatory activity. We validated these findings in models of oncogenesis and transgenic mice expressing a microRNA-regulated Tie2-GFP reporter. Remarkably, resident monocytes and TEMs on one hand, and inflammatory monocytes and TAMs on the other hand, expressed coordinated gene expression profiles, suggesting that the 2 blood monocyte subsets are committed to distinct extravascular fates in the tumor microenvironment. We further showed that a prominent proportion of embryonic/fetal macrophages, which participate in tissue morphogenesis, expressed distinguishing TEM genes. It is tempting to speculate that Tie2(+) embryonic/fetal macrophages, resident blood monocytes, and tumor-infiltrating TEMs represent distinct developmental stages of a TEM lineage committed to execute physiologic proangiogenic and tissue-remodeling programs, which can be co-opted by tumors.

  17. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    Science.gov (United States)

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

    2018-05-01

    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Bone morphogenetic protein-2 functions as a negative regulator in the differentiation of myoblasts, but not as an inducer for the formations of cartilage and bone in mouse embryonic tongue

    Directory of Open Access Journals (Sweden)

    Suzuki Erika

    2011-07-01

    Full Text Available Abstract Background In vitro studies using the myogenic cell line C2C12 demonstrate that bone morphogenetic protein-2 (BMP-2 converts the developmental pathway of C2C12 from a myogenic cell lineage to an osteoblastic cell lineage. Further, in vivo studies using null mutation mice demonstrate that BMPs inhibit the specification of the developmental fate of myogenic progenitor cells. However, the roles of BMPs in the phases of differentiation and maturation in skeletal muscles have yet to be determined. The present study attempts to define the function of BMP-2 in the final stage of differentiation of mouse tongue myoblast. Results Recombinant BMP-2 inhibited the expressions of markers for the differentiation of skeletal muscle cells, such as myogenin, muscle creatine kinase (MCK, and fast myosin heavy chain (fMyHC, whereas BMP-2 siRNA stimulated such markers. Neither the recombinant BMP-2 nor BMP-2 siRNA altered the expressions of markers for the formation of cartilage and bone, such as osteocalcin, alkaline phosphatase (ALP, collagen II, and collagen X. Further, no formation of cartilage and bone was observed in the recombinant BMP-2-treated tongues based on Alizarin red and Alcian blue stainings. Neither recombinant BMP-2 nor BMP-2 siRNA affected the expression of inhibitor of DNA binding/differentiation 1 (Id1. The ratios of chondrogenic and osteogenic markers relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a house keeping gene were approximately 1000-fold lower than those of myogenic markers in the cultured tongue. Conclusions BMP-2 functions as a negative regulator for the final differentiation of tongue myoblasts, but not as an inducer for the formation of cartilage and bone in cultured tongue, probably because the genes related to myogenesis are in an activation mode, while the genes related to chondrogenesis and osteogenesis are in a silencing mode.

  19. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Directory of Open Access Journals (Sweden)

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  20. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Science.gov (United States)

    Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

    2012-01-01

    Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  1. Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.

    Science.gov (United States)

    Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A

    2016-04-01

    A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Osteoarthritic cartilage is more homogeneous than healthy cartilage

    DEFF Research Database (Denmark)

    Qazi, Arish A; Dam, Erik B; Nielsen, Mads

    2007-01-01

    it evolves as a consequence to disease and thereby can be used as a progression biomarker. MATERIALS AND METHODS: A total of 283 right and left knees from 159 subjects aged 21 to 81 years were scanned using a Turbo 3D T1 sequence on a 0.18-T MRI Esaote scanner. The medial compartment of the tibial cartilage...... sheet was segmented using a fully automatic voxel classification scheme based on supervised learning. From the segmented cartilage sheet, homogeneity was quantified by measuring entropy from the distribution of signal intensities inside the compartment. Each knee was examined by radiography...... of the region was evaluated by testing for overfitting. Three different regularization techniques were evaluated for reducing overfitting errors. RESULTS: The P values for separating the different groups based on cartilage homogeneity were 2 x 10(-5) (KL 0 versus KL 1) and 1 x 10(-7) (KL 0 versus KL >0). Using...

  3. Imaging of cartilage repair procedures

    International Nuclear Information System (INIS)

    Sanghvi, Darshana; Munshi, Mihir; Pardiwala, Dinshaw

    2014-01-01

    The rationale for cartilage repair is to prevent precocious osteoarthritis in untreated focal cartilage injuries in the young and middle-aged population. The gamut of surgical techniques, normal postoperative radiological appearances, and possible complications have been described. An objective method of recording the quality of repair tissue is with the magnetic resonance observation of cartilage repair tissue (MOCART) score. This scoring system evaluates nine parameters that include the extent of defect filling, border zone integration, signal intensity, quality of structure and surface, subchondral bone, subchondral lamina, and records presence or absence of synovitis and adhesions. The five common techniques of cartilage repair currently offered include bone marrow stimulation (microfracture or drilling), mosaicplasty, synthetic resorbable scaffold grafts, osteochondral allograft transplants, and autologous chondrocyte implantation (ACI). Complications of cartilage repair procedures that may be demonstrated on magnetic resonance imaging (MRI) include plug loosening, graft protuberance, graft depression, and collapse in mosaicplasty, graft hypertrophy in ACI, and immune response leading to graft rejection, which is more common with synthetic grafts and cadaveric allografts

  4. Unusual interleukin-1 and -6 expression in fetal cartilage is associated with placental abnormalities.

    Directory of Open Access Journals (Sweden)

    Robert Klepacz

    2010-06-01

    Full Text Available Unusual expression of interleukin-1alpha, -1beta and -6 was previously found in the epiphyseal cartilage of rat fetuses prenatally exposed to various non-steroidal anti-inflammatory drugs (NSAID, i.e., ibuprofen, piroxicam, tolmetin and selective cyclooxygenase-2 inhibitor (DFU. The aim of the present study was to evaluate the role of placenta in such phenomenon. Morphology of the organ, thickness of basal and labyrinth layer, immunoexpression of COX isoenzymes were examined, and confronted with maternal biochemical data and fetal developmental parameters. Higher maternal urea level, as well as lower placental weight and labyrinth thickness were found in the group of fetuses who revealed expression of genes coded the selected interleukins, when compared with the xenobiotic-exposed pups without the selected genes expression and untreated control. A significant correlation between placental weight and maternal total protein or urea level was revealed. Histological changes like inflammatory infiltration and calcification were observed sporadically. Location and intensity of COX-1 staining was similar in all cases. However, more intense COX-2 staining for majority of cells of the basal zone and in dispersed giant cells of the labyrinth was found in inflamed organs. It could be concluded that abnormal expression of the selected interleukins is associated with low placental weight and decrease of its thickness, especially labyrinth zone, as well as with high maternal urea level.

  5. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Directory of Open Access Journals (Sweden)

    Escalante Ricardo

    2008-01-01

    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  6. Preserved irradiated homologous cartilage for orbital reconstruction

    International Nuclear Information System (INIS)

    Linberg, J.V.; Anderson, R.L.; Edwards, J.J.; Panje, W.R.; Bardach, J.

    1980-01-01

    Human costal cartilage is an excellent implant material for orbital and periorbital reconstruction because of its light weight, strength, homogeneous consistency and the ease with which it can be carved. Its use has been limited by the necessity of a separate surgical procedure to obtain the material. Preserved irradiated homologous cartilage has been shown to have almost all the autogenous cartilage and is convenient to use. Preserved irradiated homologous cartilage transplants do not elicit rejection reactions, resist infection and rarely undergo absorption

  7. MR Imaging of Articular Hyaline Cartilage

    OpenAIRE

    Uetani, Masataka

    2005-01-01

    MR imaging is still an evolving technique for the diagnosis of joint cartilage lesions. Early morphologic changes in the degenerative cartilage are not reliably diagnosed even with use of tailored MR imaging techniques. The detection of the biochemical changes of cartilage or high-resolution MRI will serve as an important tool for the early diagnosis of cartilage degeneration in near future. Further prospective studies are needed to establish the role of MR imaging in clinical use.

  8. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Energy Technology Data Exchange (ETDEWEB)

    Lichtensteiger, W; Faass, O; Ceccatelli, R; Schlumpf, M [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology

    2004-09-15

    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  9. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Energy Technology Data Exchange (ETDEWEB)

    Lichtensteiger, W.; Faass, O.; Ceccatelli, R.; Schlumpf, M. [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology

    2004-09-15

    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  10. Effect of the microenvironment and embryo density on developmental characteristics and gene expression profile of bovine preimplantative embryos cultured in vitro.

    Science.gov (United States)

    Hoelker, Michael; Rings, Franka; Lund, Qamaruddin; Ghanem, Nasser; Phatsara, Chirawath; Griese, Josef; Schellander, Karl; Tesfaye, Dawit

    2009-03-01

    The Well of the Well (WOW) system has been developed to culture embryos in small groups or to track the development of single embryos. In the present study, we aimed to examine the effects of the microenvironment provided by the WOW system and embryo density on developmental rates, embryo quality and preimplantative gene expression profile of the resulting embryos. Embryos cultured in a group of 16 reached the blastocyst stage at a significantly lower level than zygotes cultured in a group of 50 (22.2 vs 30.3%), whereas zygotes cultured in WOW were able to compensate against low embryo densities, reaching a blastocyst rate as high as embryos cultured in a group of 50 (31.3 vs 30.3%). Moreover, embryos derived from WOW culture did not differ in terms of differential cell counts and apoptotic cell index compared with controls. The gene expression analysis revealed 62 transcripts to be upregulated and 33 transcripts to be downregulated by WOW culture. Comparing the in vivo derived blastocysts with the blastocysts derived from WOW culture, and group culture, expression of ATP5A1, PLAC8 and KRT8 was more similar to the embryos derived from WOW culture, whereas expression of S100A10 and ZP3 genes was more similar to blastocysts cultured in a group. In conclusion, microenvironment as well as embryo density significantly affected developmental rates. While subsequent blastocysts did not differ in terms of differential cell counts and apoptotic cell index, significant differences were observed in terms of the relative abundance of transcripts in the resulting embryos.

  11. Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

    Science.gov (United States)

    Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

    2003-12-01

    Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

  12. The formation of human auricular cartilage from microtic tissue: An in vivo study.

    Science.gov (United States)

    Ishak, Mohamad Fikeri bin; See, Goh Bee; Hui, Chua Kien; Abdullah, Asma bt; Saim, Lokman bin; Saim, Aminuddin bin; Idrus, Ruszymah bt Haji

    2015-10-01

    This study aimed to isolate, culture-expand and characterize the chondrocytes isolated from microtic cartilage and evaluate its potential as a cell source for ear cartilage reconstruction. Specific attention was to construct the auricular cartilage tissue by using fibrin as scaffold. Cell culture experiment with the use of microtic chondrocytes. Cell culture experiment with the use of microtic chondrocytes. After ear reconstructive surgery at the Universiti Kebangsaan Malaysia Medical Center, chondrocytes were isolated from microtic cartilage. Chondrocytes isolated from the tissue were cultured expanded until passage 4 (P4). Upon confluency at P4, chondrocytes were harvested and tissue engineered constructs were made with human plasma polymerized to fibrin. Constructs formed later is implanted at the dorsal part of nude mice for 8 weeks, followed by post-implantation evaluation with histology staining (Hematoxylin and Eosin (H&E) and Safranin O), immunohistochemistry and RT-PCR for chondrogenic associated genes expression level. Under gross assessment, the construct after 8 weeks of implantation showed similar physical characteristics that of cartilage. Histological staining showed abundant lacunae cells embedded in extracellular matrix similar to that of native cartilage. Safranin O staining showed positive staining which indicates the presence of proteoglycan-rich matrix. Immunohistochemistry analysis showed the strong positive staining for collagen type II, the specific collagen type in the cartilage. Gene expression quantification showed no significant differences in the expression of chondrogenic gene used which is collagen type I, collagen type II, aggrecan core protein (ACP), elastin and sox9 genes when compared to construct formed from normal auricular tissue. Chondrocytes isolated from microtia cartilage has the potential to be used as an alternative cell source for external ear reconstruction in future clinical application. Copyright © 2015 Elsevier

  13. Sex-Specific Protection of Osteoarthritis by Deleting Cartilage Acid Protein 1

    OpenAIRE

    Ge, Xianpeng; Ritter, Susan Y.; Tsang, Kelly; Shi, Ruirui; Takei, Kohtaro; Aliprantis, Antonios O.

    2016-01-01

    Cartilage acidic protein 1 (CRTAC1) was recently identified as an elevated protein in the synovial fluid of patients with osteoarthritis (OA) by a proteomic analysis. This gene is also upregulated in both human and mouse OA by transcriptomic analysis. The objective of this study was to characterize the expression and function of CRTAC1 in OA. Here, we first confirm the increase of CRTAC1 in cartilage biopsies from OA patients undergoing joint replacement by real-time PCR and immunohistochemis...

  14. Biomaterial and Cell Based Cartilage Repair

    NARCIS (Netherlands)

    Zhao, X

    2015-01-01

    Injuries to human native cartilage tissue are particularly troublesome because cartilage has little ability to heal or regenerate itself. The reconstruction, repair, and regeneration of cartilage tissue continue to be one of the greatest clinical challenges, especially in orthopaedic and plastic

  15. Modeling the development of tissue engineered cartilage

    NARCIS (Netherlands)

    Sengers, B.G.

    2005-01-01

    The limited healing capacity of articular cartilage forms a major clinical problem. In general, current treatments of cartilage damage temporarily reliefs symptoms, but fail in the long term. Tissue engineering (TE) has been proposed as a more permanent repair strategy. Cartilage TE aims at

  16. Insights from amphioxus into the evolution of vertebrate cartilage.

    Directory of Open Access Journals (Sweden)

    Daniel Meulemans

    2007-08-01

    Full Text Available Central to the story of vertebrate evolution is the origin of the vertebrate head, a problem difficult to approach using paleontology and comparative morphology due to a lack of unambiguous intermediate forms. Embryologically, much of the vertebrate head is derived from two ectodermal tissues, the neural crest and cranial placodes. Recent work in protochordates suggests the first chordates possessed migratory neural tube cells with some features of neural crest cells. However, it is unclear how and when these cells acquired the ability to form cellular cartilage, a cell type unique to vertebrates. It has been variously proposed that the neural crest acquired chondrogenic ability by recruiting proto-chondrogenic gene programs deployed in the neural tube, pharynx, and notochord. To test these hypotheses we examined the expression of 11 amphioxus orthologs of genes involved in neural crest chondrogenesis. Consistent with cellular cartilage as a vertebrate novelty, we find that no single amphioxus tissue co-expresses all or most of these genes. However, most are variously co-expressed in mesodermal derivatives. Our results suggest that neural crest-derived cartilage evolved by serial cooption of genes which functioned primitively in mesoderm.

  17. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system

    Directory of Open Access Journals (Sweden)

    Wang S

    2018-01-01

    Full Text Available Shaowei Wang,1 Xiaochun Wei,1 Xiaojuan Sun,1 Chongwei Chen,1 Jingming Zhou,2 Ge Zhang,3 Heng Wu,3 Baosheng Guo,3 Lei Wei1,2 1Department of Orthopaedics, The 2nd Hospital of Shanxi Medical University, Taiyuan, Shanxi, China; 2Department of Orthopaedics, Rhode Island Hospital, The Warren Alpert Medical School of Brown University, Providence, RI, USA; 3Integrated Traditional Chinese and Western Medicine, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong Background: Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose: The objective of this study was to develop and validate a novel lipid nanoparticle (LNP-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods: LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA. Results: In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative

  18. Feasibility of autologous bone marrow mesenchymal stem cell-derived extracellular matrix scaffold for cartilage tissue engineering.

    Science.gov (United States)

    Tang, Cheng; Xu, Yan; Jin, Chengzhe; Min, Byoung-Hyun; Li, Zhiyong; Pei, Xuan; Wang, Liming

    2013-12-01

    Extracellular matrix (ECM) materials are widely used in cartilage tissue engineering. However, the current ECM materials are unsatisfactory for clinical practice as most of them are derived from allogenous or xenogenous tissue. This study was designed to develop a novel autologous ECM scaffold for cartilage tissue engineering. The autologous bone marrow mesenchymal stem cell-derived ECM (aBMSC-dECM) membrane was collected and fabricated into a three-dimensional porous scaffold via cross-linking and freeze-drying techniques. Articular chondrocytes were seeded into the aBMSC-dECM scaffold and atelocollagen scaffold, respectively. An in vitro culture and an in vivo implantation in nude mice model were performed to evaluate the influence on engineered cartilage. The current results showed that the aBMSC-dECM scaffold had a good microstructure and biocompatibility. After 4 weeks in vitro culture, the engineered cartilage in the aBMSC-dECM scaffold group formed thicker cartilage tissue with more homogeneous structure and higher expressions of cartilaginous gene and protein compared with the atelocollagen scaffold group. Furthermore, the engineered cartilage based on the aBMSC-dECM scaffold showed better cartilage formation in terms of volume and homogeneity, cartilage matrix content, and compressive modulus after 3 weeks in vivo implantation. These results indicated that the aBMSC-dECM scaffold could be a successful novel candidate scaffold for cartilage tissue engineering. © 2013 Wiley Periodicals, Inc. and International Center for Artificial Organs and Transplantation.

  19. Dual DNA methylation patterns in the CNS reveal developmentally poised chromatin and monoallelic expression of critical genes.

    Directory of Open Access Journals (Sweden)

    Jinhui Wang

    Full Text Available As a first step towards discovery of genes expressed from only one allele in the CNS, we used a tiling array assay for DNA sequences that are both methylated and unmethylated (the MAUD assay. We analyzed regulatory regions of the entire mouse brain transcriptome, and found that approximately 10% of the genes assayed showed dual DNA methylation patterns. They include a large subset of genes that display marks of both active and silent, i.e., poised, chromatin during development, consistent with a link between differential DNA methylation and lineage-specific differentiation within the CNS. Sixty-five of the MAUD hits and 57 other genes whose function is of relevance to CNS development and/or disorders were tested for allele-specific expression in F(1 hybrid clonal neural stem cell (NSC lines. Eight MAUD hits and one additional gene showed such expression. They include Lgi1, which causes a subtype of inherited epilepsy that displays autosomal dominance with incomplete penetrance; Gfra2, a receptor for glial cell line-derived neurotrophic factor GDNF that has been linked to kindling epilepsy; Unc5a, a netrin-1 receptor important in neurodevelopment; and Cspg4, a membrane chondroitin sulfate proteoglycan associated with malignant melanoma and astrocytoma in human. Three of the genes, Camk2a, Kcnc4, and Unc5a, show preferential expression of the same allele in all clonal NSC lines tested. The other six genes show a stochastic pattern of monoallelic expression in some NSC lines and bi-allelic expression in others. These results support the estimate that 1-2% of genes expressed in the CNS may be subject to allelic exclusion, and demonstrate that the group includes genes implicated in major disorders of the CNS as well as neurodevelopment.

  20. Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment

    Directory of Open Access Journals (Sweden)

    Callard Gloria V

    2008-11-01

    Full Text Available Abstract Background Research using the zebrafish model has experienced a rapid growth in recent years. Although real-time reverse transcription PCR (QPCR, normalized to an internal reference ("housekeeping" gene, is a frequently used method for quantifying gene expression changes in zebrafish, many commonly used housekeeping genes are known to vary with experimental conditions. To identify housekeeping genes that are stably expressed under different experimental conditions, and thus suitable as normalizers for QPCR in zebrafish, the present study evaluated the expression of eight commonly used housekeeping genes as a function of stage and hormone/toxicant exposure during development, and by tissue type and sex in adult fish. Results QPCR analysis was used to quantify mRNA levels of bactin1, tubulin alpha 1(tuba1, glyceraldehyde-3-phosphate dehydrogenase (gapdh, glucose-6-phosphate dehydrogenase (g6pd, TATA-box binding protein (tbp, beta-2-microglobulin (b2m, elongation factor 1 alpha (elfa, and 18s ribosomal RNA (18s during development (2 – 120 hr postfertilization, hpf; in different tissue types (brain, eye, liver, heart, muscle, gonads of adult males and females; and after treatment of embryos/larvae (24 – 96 hpf with commonly used vehicles for administration and agents that represent known environmental endocrine disruptors. All genes were found to have some degree of variability under the conditions tested here. Rank ordering of expression stability using geNorm analysis identified 18s, b2m, and elfa as most stable during development and across tissue types, while gapdh, tuba1, and tpb were the most variable. Following chemical treatment, tuba1, bactin1, and elfa were the most stably expressed whereas tbp, 18s, and b2m were the least stable. Data also revealed sex differences that are gene- and tissue-specific, and treatment effects that are gene-, vehicle- and ligand-specific. When the accuracy of QPCR analysis was tested using

  1. Current status of imaging of articular cartilage

    International Nuclear Information System (INIS)

    Hodler, J.; Resnick, D.

    1996-01-01

    Various imaging methods have been applied to assessment of articular cartilage. These include standard radiography, arthrography, CT, CT arthrography, ultrasonography, and MR imaging. Radiography remains the initial musculoskeletal imaging method. However, it is insensitive to early stages of cartilage abnormalities. MR imaging has great potential in the assessment of articular cartilage, although high-quality scans are required because imaging signs of cartilage abnormalities may be subtle. The potential and limitations of various sequences and techniques are discussed, including MR arthrography. The role of the other imaging methods in assessment of articular cartilage appears to be limited. (orig.). With 8 figs., 6 tabs

  2. Repair and tissue engineering techniques for articular cartilage.

    Science.gov (United States)

    Makris, Eleftherios A; Gomoll, Andreas H; Malizos, Konstantinos N; Hu, Jerry C; Athanasiou, Kyriacos A

    2015-01-01

    Chondral and osteochondral lesions due to injury or other pathology commonly result in the development of osteoarthritis, eventually leading to progressive total joint destruction. Although current progress suggests that biologic agents can delay the advancement of deterioration, such drugs are incapable of promoting tissue restoration. The limited ability of articular cartilage to regenerate renders joint arthroplasty an unavoidable surgical intervention. This Review describes current, widely used clinical repair techniques for resurfacing articular cartilage defects; short-term and long-term clinical outcomes of these techniques are discussed. Also reviewed is a developmental pipeline of acellular and cellular regenerative products and techniques that could revolutionize joint care over the next decade by promoting the development of functional articular cartilage. Acellular products typically consist of collagen or hyaluronic-acid-based materials, whereas cellular techniques use either primary cells or stem cells, with or without scaffolds. Central to these efforts is the prominent role that tissue engineering has in translating biological technology into clinical products; therefore, concomitant regulatory processes are also discussed.

  3. Developmental switching in Physarum polycephalum : Petri net analysis of single cell trajectories of gene expression indicates responsiveness and genetic plasticity of the Waddington quasipotential landscape

    International Nuclear Information System (INIS)

    Werthmann, Britta; Marwan, Wolfgang

    2017-01-01

    The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape. (paper)

  4. Developmental switching in Physarum polycephalum: Petri net analysis of single cell trajectories of gene expression indicates responsiveness and genetic plasticity of the Waddington quasipotential landscape

    Science.gov (United States)

    Werthmann, Britta; Marwan, Wolfgang

    2017-11-01

    The developmental switch to sporulation in Physarum polycephalum is a phytochrome-mediated far-red light-induced cell fate decision that synchronously encompasses the entire multinucleate plasmodial cell and is associated with extensive reprogramming of the transcriptome. By repeatedly taking samples of single cells after delivery of a light stimulus pulse, we analysed differential gene expression in two mutant strains and in a heterokaryon of the two strains all of which display a different propensity for making the cell fate decision. Multidimensional scaling of the gene expression data revealed individually different single cell trajectories eventually leading to sporulation. Characterization of the trajectories as walks through states of gene expression discretized by hierarchical clustering allowed the reconstruction of Petri nets that model and predict the observed behavior. Structural analyses of the Petri nets indicated stimulus- and genotype-dependence of both, single cell trajectories and of the quasipotential landscape through which these trajectories are taken. The Petri net-based approach to the analysis and decomposition of complex cellular responses and of complex mutant phenotypes may provide a scaffold for the data-driven reconstruction of causal molecular mechanisms that shape the topology of the quasipotential landscape.

  5. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  6. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    Science.gov (United States)

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  7. A novel lens epithelium gene, LEP503, is highly conserved in different vertebrate species and is developmentally regulated in postnatal rat lens.

    Science.gov (United States)

    Wen, Y; Sachs, G; Athmann, C

    2000-02-01

    The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.

  8. [Current overview of cartilage regeneration procedures].

    Science.gov (United States)

    Schenker, H; Wild, M; Rath, B; Tingart, M; Driessen, A; Quack, V; Betsch, M

    2017-11-01

    Cartilage is an avascular, alymphatic and non-innervated tissue with limited intrinsic repair potential. The high prevalence of cartilage defects and their tremendous clinical importance are a challenge for all treating physicians. This article provides the reader with an overview about current cartilage treatment options and their clinical outcome. Microfracture is still considered the gold standard in the treatment of small cartilage lesions. Small osteochondral defects can be effectively treated with the autologous osteochondral transplantation system. Larger cartilage defects are successfully treated by autologous membrane-induced chondrogenesis (AMIC) or by membrane-assisted autologous chondrocyte implantation (MACI). Despite limitations of current cartilage repair strategies, such procedures can result in short- and mid-term clinical improvement of the patients. Further developments and clinical studies are necessary to improve the long-term outcome following cartilage repair.

  9. Development of artificial articular cartilage

    Indian Academy of Sciences (India)

    Mechanical strength of Poly(vinyl alcohol), PVA is improved up to 35 MPa. Manufacturing method is adopted considering colloidal stability of nano silica particle in PVA sol at specific pH = 1. An adhesive is also prepared from PVA/Si nanocomposite containing 40% TEOS for firm attachment of artificial articular cartilage on ...

  10. Postnatal development of articular cartilage

    NARCIS (Netherlands)

    Turnhout, van M.C.

    2010-01-01

    Articular cartilage (AC) is the thin layer of tissue that covers the ends of the bones in the synovial joints in mammals. Functional adult AC has depth-dependent mechanical properties that are not yet present at birth. These depth-dependent mechanical properties in adult life are the result of a

  11. Strategies for Stratified Cartilage Bioprinting

    NARCIS (Netherlands)

    Schuurman, W.|info:eu-repo/dai/nl/313939322

    2012-01-01

    Multiple materials, cells and growth factors can be combined into one construct by the use of a state–of-the-art bioprinter. This technique may in the future make the fabrication of complete tissues or organs possible. In this thesis the feasibility of the bioprinting of cartilage and the

  12. Chondroma of the cricoid cartilage

    Directory of Open Access Journals (Sweden)

    Melo, Giulianno Molina de

    2008-12-01

    Full Text Available Introduction: The larynx cartilaginous tumors are uncommon and comprise 1% of all cartilaginous tumors. The chondroma is the most common benign tumor affecting the larynx cricoid cartilage (75%, and manifests normally in the male gender with dysphonia, progressive dyspnea and dysphagy in some cases. Objective: The objective of this study is to report a case of cricoid cartilage chondroma, in a patient with the symptom of a nodular lesion in the frontal cervical region of slow and progressive growth. Case Report: The treatment was the modified partial laryngectomy with resection of the lower hemisegment of the thyroid cartilage, cricoid hemicartilage and the first tracheal ring with free margins and reconstruction with a pericondrium and muscular prethyroidean piece. The anatomopathological exam showed a chondroma of 1.1 cm, of atypical low cellularity and low figures of mitosis in the frontal region of the cricoid cartilage. Conclusion: In this report we agreed with the literature for the primarily extensive surgical treatment depending on the location and the size of the cricoid chondroma; however, other modalities of treatment may be adopted in cases where the tumor extension appoints a total laryngectomy or when this is not possible to carry out, aiming at the preservation of the larynx. For the suitable treatment of cricoid chondromas, the understanding of the disease natural evolution and more case reports are still necessary.

  13. Developmental regulation of ecdysone receptor (EcR and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Tathyana Rachel Palo Mello

    2014-12-01

    Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.

  14. A retinoblastoma orthologue is a major regulator of S-phase, mitotic, and developmental gene expression in Dictyostelium.

    Directory of Open Access Journals (Sweden)

    Kimchi Strasser

    Full Text Available The retinoblastoma tumour suppressor, Rb, has two major functions. First, it represses genes whose products are required for S-phase entry and progression thus stabilizing cells in G1. Second, Rb interacts with factors that induce cell-cycle exit and terminal differentiation. Dictyostelium lacks a G1 phase in its cell cycle but it has a retinoblastoma orthologue, rblA.Using microarray analysis and mRNA-Seq transcriptional profiling, we show that RblA strongly represses genes whose products are involved in S phase and mitosis. Both S-phase and mitotic genes are upregulated at a single point in late G2 and again in mid-development, near the time when cell cycling is reactivated. RblA also activates a set of genes unique to slime moulds that function in terminal differentiation.Like its mammalian counterpart Dictyostelium, RblA plays a dual role, regulating cell-cycle progression and transcriptional events leading to terminal differentiation. In the absence of a G1 phase, however, RblA functions in late G2 controlling the expression of both S-phase and mitotic genes.

  15. Decellularized cartilage may be a chondroinductive material for osteochondral tissue engineering.

    Directory of Open Access Journals (Sweden)

    Amanda J Sutherland

    Full Text Available Extracellular matrix (ECM-based materials are attractive for regenerative medicine in their ability to potentially aid in stem cell recruitment, infiltration, and differentiation without added biological factors. In musculoskeletal tissue engineering, demineralized bone matrix is widely used, but recently cartilage matrix has been attracting attention as a potentially chondroinductive material. The aim of this study was thus to establish a chemical decellularization method for use with articular cartilage to quantify removal of cells and analyze the cartilage biochemical content at various stages during the decellularization process, which included a physically devitalization step. To study the cellular response to the cartilage matrix, rat bone marrow-derived mesenchymal stem cells (rBMSCs were cultured in cell pellets containing cells only (control, chondrogenic differentiation medium (TGF-β, chemically decellularized cartilage particles (DCC, or physically devitalized cartilage particles (DVC. The chemical decellularization process removed the vast majority of DNA and about half of the glycosaminoglycans (GAG within the matrix, but had no significant effect on the amount of hydroxyproline. Most notably, the DCC group significantly outperformed TGF-β in chondroinduction of rBMSCs, with collagen II gene expression an order of magnitude or more higher. While DVC did not exhibit a chondrogenic response to the extent that DCC did, DVC had a greater down regulation of collagen I, collagen X and Runx2. A new protocol has been introduced for cartilage devitalization and decellularization in the current study, with evidence of chondroinductivity. Such bioactivity along with providing the 'raw material' building blocks of regenerating cartilage may suggest a promising role for DCC in biomaterials that rely on recruiting endogenous cell recruitment and differentiation for cartilage regeneration.

  16. The olive DGAT2 gene is developmentally regulated and shares overlapping but distinct expression patterns with DGAT1

    OpenAIRE

    Banilas, Georgios; Karampelias, Michael; Makariti, Ifigenia; Kourti, Anna; Hatzopoulos, Polydefkis

    2010-01-01

    Diacylglycerol acyltransferases (DGATs) catalyse the final step of the triacylglycerol (TAG) biosynthesis of the Kennedy pathway. Two major gene families have been shown to encode DGATs, DGAT1 (type-1) and DGAT2 (type-2). Both genes encode membrane-bound proteins, with no sequence homology to each other. In this study, the molecular cloning and characterization of a type-2 DGAT cDNA from olive is presented. Southern blot analysis showed that OeDGAT2 is represented by a single copy in the oliv...

  17. Deletion of exon 20 of the Familial Dysautonomia gene Ikbkap in mice causes developmental delay, cardiovascular defects, and early embryonic lethality.

    Directory of Open Access Journals (Sweden)

    Paula Dietrich

    Full Text Available Familial Dysautonomia (FD is an autosomal recessive disorder that affects 1/3,600 live births in the Ashkenazi Jewish population, and leads to death before the age of 40. The disease is characterized by abnormal development and progressive degeneration of the sensory and autonomic nervous system. A single base pair substitution in intron 20 of the Ikbkap gene accounts for 98% of FD cases, and results in the expression of low levels of the full-length mRNA with simultaneous expression of an aberrantly spliced mRNA in which exon 20 is missing. To date, there is no animal model for the disease, and the essential cellular functions of IKAP--the protein encoded by Ikbkap--remain unknown. To better understand the normal function of IKAP and in an effort to generate a mouse model for FD, we have targeted the mouse Ikbkap gene by homologous recombination. We created two distinct alleles that result in either loss of Ikbkap expression, or expression of an mRNA lacking only exon 20. Homozygosity for either mutation leads to developmental delay, cardiovascular and brain malformations, accompanied with early embryonic lethality. Our analyses indicate that IKAP is essential for expression of specific genes involved in cardiac morphogenesis, and that cardiac failure is the likely cause of abnormal vascular development and embryonic lethality. Our results also indicate that deletion of exon 20 abolishes gene function. This implies that the truncated IKAP protein expressed in FD patients does not retain any significant biological function.

  18. Characterization of a chickpea (Cicer arietinum L.) NAC family gene, CarNAC5, which is both developmentally- and stress-regulated.

    Science.gov (United States)

    Peng, Hui; Cheng, Hui-Ying; Yu, Xin-Wang; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao

    2009-01-01

    It has been documented that the plant-specific NAC (for NAM, ATAF1,2 and CUC2) transcription factors play an important role in plant development and stress responses. In this study, a chickpea NAC gene CarNAC5 (for Cicer arietinum L. NAC gene 5) was isolated from a cDNA library from chickpea leaves treated by polyethylene glycol (PEG). CarNAC5, as a single/low copy gene, contained three exons and two introns within genomic DNA sequence and encoded a polypeptide with 291 amino acids. CarNAC5 protein had a conserved NAC domain in the N-terminus and showed high similarity to other NACs, especially ATAF subgroup members. The CarNAC5:GFP fusion protein was localized in the nucleus of onion epidermal cells. Furthermore, CarNAC5 protein activated the reporter genes LacZ and HIS3 in yeast. The transactivation activity was mapped to the C-terminal region. The transcripts of CarNAC5 appeared in many chickpea tissues including seedling leaves, stems, roots, flowers, seeds and pods, but mostly accumulated in flowers. Meanwhile, CarNAC5 was strongly expressed during seed maturation and in embryos of the early germinating seeds. It was also significantly induced by drought, heat, wounding, salicylic acid (SA), and indole-3-acetic acid (IAA) treatments. Our results suggest that CarNAC5 encodes a novel NAC-domain protein and acts as a transcriptional activator involved in plant developmental regulation and various stress responses.

  19. Altered cellular redox status, sirtuin abundance and clock gene expression in a mouse model of developmentally primed NASH.

    Science.gov (United States)

    Bruce, Kimberley D; Szczepankiewicz, Dawid; Sihota, Kiran K; Ravindraanandan, Manoj; Thomas, Hugh; Lillycrop, Karen A; Burdge, Graham C; Hanson, Mark A; Byrne, Christopher D; Cagampang, Felino R

    2016-07-01

    We have previously shown that high fat (HF) feeding during pregnancy primes the development of non-alcoholic steatohepatits (NASH) in the adult offspring. However, the underlying mechanisms are unclear. Since the endogenous molecular clock can regulate hepatic lipid metabolism, we investigated whether exposure to a HF diet during development could alter hepatic clock gene expression and contribute to NASH onset in later life. Female mice were fed either a control (C, 7%kcal fat) or HF (45%kcal fat) diet. Offspring were fed either a C or HF diet resulting in four offspring groups: C/C, C/HF, HF/C and HF/HF. NAFLD progression, cellular redox status, sirtuin expression (Sirt1, Sirt3), and the expression of core clock genes (Clock, Bmal1, Per2, Cry2) and clock-controlled genes involved in lipid metabolism (Rev-Erbα, Rev-Erbβ, RORα, and Srebp1c) were measured in offspring livers. Offspring fed a HF diet developed NAFLD. However HF fed offspring of mothers fed a HF diet developed NASH, coupled with significantly reduced NAD(+)/NADH (pNASH in adulthood, involving altered cellular redox status, reduced sirtuin abundance, and desynchronized clock gene expression. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Developmental transcriptome of Aplysia californica'

    KAUST Repository

    Heyland, Andreas; Vue, Zer; Voolstra, Christian R.; Medina, Mó nica; Moroz, Leonid L.

    2010-01-01

    developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms

  1. In Vivo Tibial Cartilage Strains in Regions of Cartilage-to-Cartilage Contact and Cartilage-to-Meniscus Contact in Response to Walking.

    Science.gov (United States)

    Liu, Betty; Lad, Nimit K; Collins, Amber T; Ganapathy, Pramodh K; Utturkar, Gangadhar M; McNulty, Amy L; Spritzer, Charles E; Moorman, Claude T; Sutter, E Grant; Garrett, William E; DeFrate, Louis E

    2017-10-01

    There are currently limited human in vivo data characterizing the role of the meniscus in load distribution within the tibiofemoral joint. Purpose/Hypothesis: The purpose was to compare the strains experienced in regions of articular cartilage covered by the meniscus to regions of cartilage not covered by the meniscus. It was hypothesized that in response to walking, tibial cartilage covered by the meniscus would experience lower strains than uncovered tibial cartilage. Descriptive laboratory study. Magnetic resonance imaging (MRI) of the knees of 8 healthy volunteers was performed before and after walking on a treadmill. Using MRI-generated 3-dimensional models of the tibia, cartilage, and menisci, cartilage thickness was measured in 4 different regions based on meniscal coverage and compartment: covered medial, uncovered medial, covered lateral, and uncovered lateral. Strain was defined as the normalized change in cartilage thickness before and after activity. Within each compartment, covered cartilage before activity was significantly thinner than uncovered cartilage before activity ( P meniscus experiences lower strains than uncovered cartilage in the medial compartment. These findings provide important baseline information on the relationship between in vivo tibial compressive strain responses and meniscal coverage, which is critical to understanding normal meniscal function.

  2. Developmentally-Regulated Excision of the SPβ Prophage Reconstitutes a Gene Required for Spore Envelope Maturation in Bacillus subtilis

    Science.gov (United States)

    Abe, Kimihiro; Kawano, Yuta; Iwamoto, Keito; Arai, Kenji; Maruyama, Yuki; Eichenberger, Patrick; Sato, Tsutomu

    2014-01-01

    Temperate phages infect bacteria by injecting their DNA into bacterial cells, where it becomes incorporated into the host genome as a prophage. In the genome of Bacillus subtilis 168, an active prophage, SPβ, is inserted into a polysaccharide synthesis gene, spsM. Here, we show that a rearrangement occurs during sporulation to reconstitute a functional composite spsM gene by precise excision of SPβ from the chromosome. SPβ excision requires a putative site-specific recombinase, SprA, and an accessory protein, SprB. A minimized SPβ, where all the SPβ genes were deleted, except sprA and sprB, retained the SPβ excision activity during sporulation, demonstrating that sprA and sprB are necessary and sufficient for the excision. While expression of sprA was observed during vegetative growth, sprB was induced during sporulation and upon mitomycin C treatment, which triggers the phage lytic cycle. We also demonstrated that overexpression of sprB (but not of sprA) resulted in SPβ prophage excision without triggering the lytic cycle. These results suggest that sprB is the factor that controls the timing of phage excision. Furthermore, we provide evidence that spsM is essential for the addition of polysaccharides to the spore envelope. The presence of polysaccharides on the spore surface renders the spore hydrophilic in water. This property may be beneficial in allowing spores to disperse in natural environments via water flow. A similar rearrangement occurs in Bacillus amyloliquefaciens FZB42, where a SPβ-like element is excised during sporulation to reconstitute a polysaccharide synthesis gene, suggesting that this type of gene rearrangement is common in spore-forming bacteria because it can be spread by phage infection. PMID:25299644

  3. Sexually dimorphic gene regulation in brain as a target for endocrine disrupters: Developmental exposure of rats to 4-methylbenzylidene camphor

    International Nuclear Information System (INIS)

    Maerkel, Kirsten; Durrer, Stefan; Henseler, Manuel; Schlumpf, Margret; Lichtensteiger, Walter

    2007-01-01

    The developing neuroendocrine brain represents a potential target for endocrine active chemicals. The UV filter 4-methylbenzylidene camphor (4-MBC) exhibits estrogenic activity, but also interferes with the thyroid axis. We investigated effects of pre- and postnatal exposure to 4-MBC in the same rat offspring at brain and reproductive organ levels. 4-MBC (7, 24, 47 mg/kg/day) was administered in chow to the parent generation before mating, during gestation and lactation, and to the offspring until adulthood. mRNA of estrogen target genes involved in control of sexual behavior and gonadal functions was measured by real-time RT-PCR in ventromedial hypothalamic nucleus (VMH) and medial preoptic area (MPO) of adult offspring. 4-MBC exposure affected mRNA levels of ER alpha, progesterone receptor (PR), preproenkephalin (PPE) and insulin-like growth factor-I (IGF-I) in a sex- and region-specific manner. In order to assess possible changes in sensitivity of target genes to estrogens, offspring were gonadectomized on day 70, injected with estradiol (E2, 10 or 50 μg/kg s.c.) or vehicle on day 84, and sacrificed 6 h later. The acute induction of PR mRNA, and repression (at 6 h) of PPE mRNA by E2 was enhanced by 4-MBC in male and female VMH and female MPO, whereas male MPO exhibited reduced responsiveness of both genes. Steroid receptor coactivator SRC-1 mRNA levels were increased in female VMH and MPO. The data indicate profound sex- and region-specific alterations in the regulation of estrogen target genes at brain level. Effect patterns in baseline and E2-induced gene expression differ from those in uterus and prostate

  4. Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

    Science.gov (United States)

    Cheniany, Monireh; Ganjeali, Ali

    2016-12-01

    Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

  5. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  6. Transcription factor ERG and joint and articular cartilage formation during mouse limb and spine skeletogenesis.

    Science.gov (United States)

    Iwamoto, Masahiro; Tamamura, Yoshihiro; Koyama, Eiki; Komori, Toshihisa; Takeshita, Nobuo; Williams, Julie A; Nakamura, Takashi; Enomoto-Iwamoto, Motomi; Pacifici, Maurizio

    2007-05-01

    Articular cartilage and synovial joints are critical for skeletal function, but the mechanisms regulating their development are largely unknown. In previous studies we found that the ets transcription factor ERG and its alternatively-spliced variant C-1-1 have roles in joint formation in chick. Here, we extended our studies to mouse. We found that ERG is also expressed in developing mouse limb joints. To test regulation of ERG expression, beads coated with the joint master regulator protein GDF-5 were implanted close to incipient joints in mouse limb explants; this led to rapid and strong ectopic ERG expression. We cloned and characterized several mammalian ERG variants and expressed a human C-1-1 counterpart (hERG3Delta81) throughout the cartilaginous skeleton of transgenic mice, using Col2a1 gene promoter/enhancer sequences. The skeletal phenotype was severe and neonatal lethal, and the transgenic mice were smaller than wild type littermates and their skeletons were largely cartilaginous. Limb long bone anlagen were entirely composed of chondrocytes actively expressing collagen IX and aggrecan as well as articular markers such as tenascin-C. Typical growth plates were absent and there was very low expression of maturation and hypertrophy markers, including Indian hedgehog, collagen X and MMP-13. The results suggest that ERG is part of molecular mechanisms leading chondrocytes into a permanent developmental path and become joint forming cells, and may do so by acting downstream of GDF-5.

  7. In vivo and in vitro studies of cartilage differentiation in altered gravities

    Science.gov (United States)

    Montufar-Solis, D.; Duke, P. J.; D'Aunno, D.

    The in vivo model our laboratory uses for studies of cartilage differentiation in space is the rat growth plate. Differences between missions, and in rat age and recovery times, provided differing results from each mission. However, in all missions, proliferation and differentiation of chondrocytes in the epiphyseal plate of spaceflown rats was altered as was matrix organization. In vitro systems, necessary complements to in vivo work, provide some advantages over the in vivo situation. In vitro, centrifugation of embryonic limb buds suppressed morphogenesis due to precocious differentiation, and changes in the developmental pattern suggest the involvement of Hox genes. In space, embryonic mouse limb mesenchyme cells differentiating in vitro on IML-1 had smoother membranes and lacked matrix seen in controls. Unusual formations, possibly highly ruffled membranes, were found in flight cultures. These results, coupled with in vivo centrifugation studies, show that in vivo or in vitro, the response of chondrocytes to gravitational changes follows Hert's curve as modified by Simon, i.e. decreased loading decreases differentiation, and increased loading speeds it up, but only to a point. After that, additional increases again slow down chondrogenesis.

  8. RNA-seq analysis of clinical-grade osteochondral allografts reveals activation of early response genes

    NARCIS (Netherlands)

    Lin, Yang; Lewallen, Eric A.; Camilleri, Emily T.; Bonin, Carolina A.; Jones, Dakota L.; Dudakovic, Amel; Galeano-Garces, Catalina; Wang, Wei; Karperien, Marcel J.; Larson, Annalise N.; Dahm, Diane L.; Stuart, Michael J.; Levy, Bruce A.; Smith, Jay; Ryssman, Daniel B.; Westendorf, Jennifer J.; Im, Hee-Jeong; van Wijnen, Andre J.; Riester, Scott M.; Krych, Aaron J.

    2016-01-01

    Preservation of osteochondral allografts used for transplantation is critical to ensure favorable outcomes for patients after surgical treatment of cartilage defects. To study the biological effects of protocols currently used for cartilage storage, we investigated differences in gene expression

  9. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  10. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  11. High hydrostatic pressure induces pro-osteoarthritic changes in cartilage precursor cells: A transcriptome analysis.

    Science.gov (United States)

    Montagne, Kevin; Onuma, Yasuko; Ito, Yuzuru; Aiki, Yasuhiko; Furukawa, Katsuko S; Ushida, Takashi

    2017-01-01

    Due to the high water content of cartilage, hydrostatic pressure is likely one of the main physical stimuli sensed by chondrocytes. Whereas, in the physiological range (0 to around 10 MPa), hydrostatic pressure exerts mostly pro-chondrogenic effects in chondrocyte models, excessive pressures have been reported to induce detrimental effects on cartilage, such as increased apoptosis and inflammation, and decreased cartilage marker expression. Though some genes modulated by high pressure have been identified, the effects of high pressure on the global gene expression pattern have still not been investigated. In this study, using microarray technology and real-time PCR validation, we analyzed the transcriptome of ATDC5 chondrocyte progenitors submitted to a continuous pressure of 25 MPa for up to 24 h. Several hundreds of genes were found to be modulated by pressure, including some not previously known to be mechano-sensitive. High pressure markedly increased the expression of stress-related genes, apoptosis-related genes and decreased that of cartilage matrix genes. Furthermore, a large set of genes involved in the progression of osteoarthritis were also induced by high pressure, suggesting that hydrostatic pressure could partly mimic in vitro some of the genetic alterations occurring in osteoarthritis.

  12. Devitalisation of human cartilage by high hydrostatic pressure treatment: Subsequent cultivation of chondrocytes and mesenchymal stem cells on the devitalised tissue

    Science.gov (United States)

    Hiemer, B.; Genz, B.; Jonitz-Heincke, A.; Pasold, J.; Wree, A.; Dommerich, S.; Bader, R.

    2016-01-01

    The regeneration of cartilage lesions still represents a major challenge. Cartilage has a tissue-specific architecture, complicating recreation by synthetic biomaterials. A novel approach for reconstruction is the use of devitalised cartilage. Treatment with high hydrostatic pressure (HHP) achieves devitalisation while biomechanical properties are remained. Therefore, in the present study, cartilage was devitalised using HHP treatment and the potential for revitalisation with chondrocytes and mesenchymal stem cells (MSCs) was investigated. The devitalisation of cartilage was performed by application of 480 MPa over 10 minutes. Effective cellular inactivation was demonstrated by the trypan blue exclusion test and DNA quantification. Histology and electron microscopy examinations showed undamaged cartilage structure after HHP treatment. For revitalisation chondrocytes and MSCs were cultured on devitalised cartilage without supplementation of chondrogenic growth factors. Both chondrocytes and MSCs significantly increased expression of cartilage-specific genes. ECM stainings showed neocartilage-like structure with positive AZAN staining as well as collagen type II and aggrecan deposition after three weeks of cultivation. Our results showed that HHP treatment caused devitalisation of cartilage tissue. ECM proteins were not influenced, thus, providing a scaffold for chondrogenic differentiation of MSCs and chondrocytes. Therefore, using HHP-treated tissue might be a promising approach for cartilage repair. PMID:27671122

  13. Study on the Effect of Wing Bud Chitin Metabolism and Its Developmental Network Genes in the Brown Planthopper, Nilaparvata lugens, by Knockdown of TRE Gene

    Directory of Open Access Journals (Sweden)

    Lu Zhang

    2017-09-01

    Full Text Available The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE (dsTRE, even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF, and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs. Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP, and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens.

  14. Study on the Effect of Wing Bud Chitin Metabolism and Its Developmental Network Genes in the Brown Planthopper, Nilaparvata lugens, by Knockdown of TRE Gene.

    Science.gov (United States)

    Zhang, Lu; Qiu, Ling-Yu; Yang, Hui-Li; Wang, Hui-Juan; Zhou, Min; Wang, Shi-Gui; Tang, Bin

    2017-01-01

    The brown planthopper, Nilaparvata lugens is one of the most serious pests of rice, and there is so far no effective way to manage this pest. However, RNA interference not only can be used to study gene function, but also provide potential opportunities for novel pest management. The development of wing plays a key role in insect physiological activities and mainly involves chitin. Hence, the regulating role of trehalase (TRE) genes on wing bud formation has been studied by RNAi. In this paper, the activity levels of TRE and the contents of the two sugars trehalose and glucose were negatively correlated indicating the potential role of TRE in the molting process. In addition, NlTRE1-1 and NlTRE2 were expressed at higher levels in wing bud tissue than in other tissues, and abnormal molting and wing deformity or curling were noted 48 h after the insect was injected with any double-stranded TRE ( dsTRE ), even though different TREs have compensatory functions. The expression levels of NlCHS1b, NlCht1, NlCht2, NlCht6, NlCht7, NlCht8, NlCht10, NlIDGF , and NlENGase decreased significantly 48 h after the insect was injected with a mixture of three kinds of dsTREs . Similarly, the TRE inhibitor validamycin can inhibit NlCHS1 and NlCht gene expression. However, the wing deformity was the result of the NlIDGF, NlENGase, NlAP , and NlTSH genes being inhibited when a single dsTRE was injected. These results demonstrate that silencing of TRE gene expression can lead to wing deformities due to the down-regulation of the AP and TSH genes involved in wing development and that the TRE inhibitor validamycin can co-regulate chitin metabolism and the expression of wing development-related genes in wing bud tissue. The results provide a new approach for the prevention and management of N. lugens .

  15. One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

    Science.gov (United States)

    Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

    2009-01-01

    Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

  16. Diode laser (980nm) cartilage reshaping

    Science.gov (United States)

    El Kharbotly, A.; El Tayeb, T.; Mostafa, Y.; Hesham, I.

    2011-03-01

    Loss of facial or ear cartilage due to trauma or surgery is a major challenge to the otolaryngologists and plastic surgeons as the complicated geometric contours are difficult to be animated. Diode laser (980 nm) has been proven effective in reshaping and maintaining the new geometric shape achieved by laser. This study focused on determining the optimum laser parameters needed for cartilage reshaping with a controlled water cooling system. Harvested animal cartilages were angulated with different degrees and irradiated with different diode laser powers (980nm, 4x8mm spot size). The cartilage specimens were maintained in a deformation angle for two hours after irradiation then released for another two hours. They were serially measured and photographed. High-power Diode laser irradiation with water cooling is a cheep and effective method for reshaping the cartilage needed for reconstruction of difficult situations in otorhinolaryngologic surgery. Key words: cartilage,diode laser (980nm), reshaping.

  17. Supporting Biomaterials for Articular Cartilage Repair

    Science.gov (United States)

    Duarte Campos, Daniela Filipa; Drescher, Wolf; Rath, Björn; Tingart, Markus

    2012-01-01

    Orthopedic surgeons and researchers worldwide are continuously faced with the challenge of regenerating articular cartilage defects. However, until now, it has not been possible to completely mimic the biological and biochemical properties of articular cartilage using current research and development approaches. In this review, biomaterials previously used for articular cartilage repair research are addressed. Furthermore, a brief discussion of the state of the art of current cell printing procedures mimicking native cartilage is offered in light of their use as future alternatives for cartilage tissue engineering. Inkjet cell printing, controlled deposition cell printing tools, and laser cell printing are cutting-edge techniques in this context. The development of mimetic hydrogels with specific biological properties relevant to articular cartilage native tissue will support the development of improved, functional, and novel engineered tissue for clinical application. PMID:26069634

  18. Histone methyltransferase Setdb1 is indispensable for Meckel's cartilage development

    International Nuclear Information System (INIS)

    Yahiro, Kohei; Higashihori, Norihisa; Moriyama, Keiji

    2017-01-01

    The histone methyltransferase Setdb1 represses gene expression by catalyzing lysine 9 of histone H3 trimethylation. Given that the conventional knockout of Setdb1 is embryo-lethal at the implantation stage, its role in craniofacial development is poorly understood. Here, we investigated the role of Setdb1, using conditional knockout mice—in which Setdb1 was deleted in the Meckel's cartilage (Setdb1 CKO)—and the mouse chondrogenic cell line ATDC5—in which Setdb1 was inhibited by siRNA. Deletion of Setdb1 in Meckel's cartilage, the supportive tissue in the embryonic mandible, led to its enlargement, instead of the degeneration that normally occurs. Chondrocytes from the Meckel's cartilage of Setdb1 CKO mice showed increased size. Furthermore, at embryonic days 16.5 and 18.5, part of the perichondrium was disrupted and mineralization was observed in the Meckel's cartilage. Proliferation analysis showed that inhibition of Setdb1 caused increased proliferation in chondrocytes in the Meckel's cartilage as well as in ATDC5 cells. Quantitative RT-PCR showed decreased expression of chondrogenic genes, such as Sox9, Mmp13, Collagen II, and Aggrecan, as a result of Setdb1 inhibition in ATDC5 cells. Along with these phenomenons, SMAD-dependent BMP signaling was significantly increased by the loss of Setdb1 in both the Meckel's cartilage of Setdb1 CKO mice and ATDC5 cells. Therefore, the abnormal development of Meckel's cartilage in Setdb1 CKO mice is partly due to the enhanced SMAD-dependent BMP signaling. Overall, to our knowledge, the present study is the first to show that epigenetic regulation by Setdb1 is indispensable for the embryonic development of Meckel's cartilage. - Highlights: • Deletion of Setdb1 led to enlarged Meckel's cartilage. • Chondrocytes from the Meckel's cartilage of Setdb1 mutant showed increased in size. • Part of the perichondrium was disrupted and mineralization was observed in the Meckel

  19. Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

    Science.gov (United States)

    Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N

    2013-10-01

    Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

  20. Preclinical Studies for Cartilage Repair

    Science.gov (United States)

    Hurtig, Mark B.; Buschmann, Michael D.; Fortier, Lisa A.; Hoemann, Caroline D.; Hunziker, Ernst B.; Jurvelin, Jukka S.; Mainil-Varlet, Pierre; McIlwraith, C. Wayne; Sah, Robert L.; Whiteside, Robert A.

    2011-01-01

    Investigational devices for articular cartilage repair or replacement are considered to be significant risk devices by regulatory bodies. Therefore animal models are needed to provide proof of efficacy and safety prior to clinical testing. The financial commitment and regulatory steps needed to bring a new technology to clinical use can be major obstacles, so the implementation of highly predictive animal models is a pressing issue. Until recently, a reductionist approach using acute chondral defects in immature laboratory species, particularly the rabbit, was considered adequate; however, if successful and timely translation from animal models to regulatory approval and clinical use is the goal, a step-wise development using laboratory animals for screening and early development work followed by larger species such as the goat, sheep and horse for late development and pivotal studies is recommended. Such animals must have fully organized and mature cartilage. Both acute and chronic chondral defects can be used but the later are more like the lesions found in patients and may be more predictive. Quantitative and qualitative outcome measures such as macroscopic appearance, histology, biochemistry, functional imaging, and biomechanical testing of cartilage, provide reliable data to support investment decisions and subsequent applications to regulatory bodies for clinical trials. No one model or species can be considered ideal for pivotal studies, but the larger animal species are recommended for pivotal studies. Larger species such as the horse, goat and pig also allow arthroscopic delivery, and press-fit or sutured implant fixation in thick cartilage as well as second look arthroscopies and biopsy procedures. PMID:26069576

  1. Bioprinting Cartilage Tissue from Mesenchymal Stem Cells and PEG Hydrogel.

    Science.gov (United States)

    Gao, Guifang; Hubbell, Karen; Schilling, Arndt F; Dai, Guohao; Cui, Xiaofeng

    2017-01-01

    Bioprinting based on thermal inkjet printing is one of the most attractive enabling technologies for tissue engineering and regeneration. During the printing process, cells, scaffolds , and growth factors are rapidly deposited to the desired two-dimensional (2D) and three-dimensional (3D) locations. Ideally, the bioprinted tissues are able to mimic the native anatomic structures in order to restore the biological functions. In this study, a bioprinting platform for 3D cartilage tissue engineering was developed using a commercially available thermal inkjet printer with simultaneous photopolymerization . The engineered cartilage demonstrated native zonal organization, ideal extracellular matrix (ECM ) composition, and proper mechanical properties. Compared to the conventional tissue fabrication approach, which requires extended UV exposure, the viability of the printed cells with simultaneous photopolymerization was significantly higher. Printed neocartilage demonstrated excellent glycosaminoglycan (GAG) and collagen type II production, which was consistent with gene expression profile. Therefore, this platform is ideal for anatomic tissue engineering with accurate cell distribution and arrangement.

  2. Human osteoarthritic cartilage is synthetically more active but in culture less vital than normal cartilage

    NARCIS (Netherlands)

    Lafeber, F. P.; van Roy, H.; Wilbrink, B.; Huber-Bruning, O.; Bijlsma, J. W.

    1992-01-01

    The proteoglycan turnover of human osteoarthritic (OA) cartilage was compared to that of normal (N) cartilage. The cartilage was obtained postmortem from human femoral knee condyles. Short term cultures were compared to longterm cultures, and proteoglycan synthesis rate, content and release

  3. The Level of AdpA Directly Affects Expression of Developmental Genes in Streptomyces coelicolor ▿ †

    OpenAIRE

    Wolański, Marcin; Donczew, Rafał; Kois-Ostrowska, Agnieszka; Masiewicz, Paweł; Jakimowicz, Dagmara; Zakrzewska-Czerwińska, Jolanta

    2011-01-01

    AdpA is a key regulator of morphological differentiation in Streptomyces. In contrast to Streptomyces griseus, relatively little is known about AdpA protein functions in Streptomyces coelicolor. Here, we report for the first time the translation accumulation profile of the S. coelicolor adpA (adpASc) gene; the level of S. coelicolor AdpA (AdpASc) increased, reaching a maximum in the early stage of aerial mycelium formation (after 36 h), and remained relatively stable for the next several hour...

  4. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  5. Cellular and Acellular Approaches for Cartilage Repair

    Science.gov (United States)

    2015-01-01

    There are several choices of cells to use for cartilage repair. Cells are used as internal or external sources and sometimes in combination. In this article, an analysis of the different cell choices and their use and potential is provided. Embryonic cartilage formation is of importance when finding more about how to be able to perfect cartilage repair. Some suggestions for near future research based on up-to-date knowledge on chondrogenic cells are given to hopefully stimulate more studies on the final goal of cartilage regeneration. PMID:27340516

  6. Optical properties of nasal septum cartilage

    Science.gov (United States)

    Bagratashvili, Nodar V.; Sviridov, Alexander P.; Sobol, Emil N.; Kitai, Moishe S.

    1998-05-01

    Optical parameters (scattering coefficient s, absorption coefficient k and scattering anisotropy coefficient g) of hyaline cartilage were studied for the first time. Optical properties of human and pig nasal septum cartilage, and of bovine ear cartilage were examined using a spectrophotometer with an integrating sphere, and an Optical Multi-Channel Analyser. We measured total transmission Tt, total reflection Rt, and on-axis transmission Ta for light propagating through cartilage sample, over the visible spectral range (14000 - 28000 cm-1). It is shown that transmission and reflection spectra of human, pig and bovine cartilage are rather similar. It allows us to conclude that the pig cartilage can be used for in-vivo studies instead of human cartilage. The data obtained were treated by means of the one-dimensional diffusion approximation solution of the optical transport equation. We have found scattering coefficient s, absorption coefficient k and scattering anisotropy coefficient g by the iterative comparison of measured and calculated Tt, Rt and Ta values for human and pig cartilage. We found, in particular, that for 500 nm irradiation s equals 37,6 plus or minus 3.5 cm-1, g equals 0,56 plus or minus 0.05, k approximately equals 0,5 plus or minus 0.3 cm-1. The above data were used in Monte Carlo simulation for spatial intensity profile of light scattered by a cartilage sample. The computed profile was very similar to the profile measured using an Optical Multi-Channel Analyzer (OMA).

  7. Rabbit articular cartilage defects treated by allogenic chondrocyte transplantation

    OpenAIRE

    Boopalan, P. R. J. V. C.; Sathishkumar, Solomon; Kumar, Senthil; Chittaranjan, Samuel

    2006-01-01

    Articular cartilage defects have a poor capacity for repair. Most of the current treatment options result in the formation of fibro-cartilage, which is functionally inferior to normal hyaline articular cartilage. We studied the effectiveness of allogenic chondrocyte transplantation for focal articular cartilage defects in rabbits. Chondrocytes were cultured in vitro from cartilage harvested from the knee joints of a New Zealand White rabbit. A 3 mm defect was created in the articular cartilag...

  8. Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early developmental defects in the hematopoietic lineage.

    Science.gov (United States)

    Tulpule, Asmin; Lensch, M William; Miller, Justine D; Austin, Karyn; D'Andrea, Alan; Schlaeger, Thorsten M; Shimamura, Akiko; Daley, George Q

    2010-04-29

    Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNA interference (RNAi) strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicate that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease.

  9. Nogo-receptor gene activity: cellular localization and developmental regulation of mRNA in mice and humans.

    Science.gov (United States)

    Josephson, Anna; Trifunovski, Alexandra; Widmer, Hans Ruedi; Widenfalk, Johan; Olson, Lars; Spenger, Christian

    2002-11-18

    Nogo (reticulon-4) is a myelin-associated protein that is expressed in three different splice variants, Nogo-A, Nogo-B, and Nogo-C. Nogo-A inhibits neurite regeneration in the central nervous system. Messenger RNA encoding Nogo is expressed in oligodendrocytes and central and peripheral neurons, but not in astrocytes or Schwann cells. Nogo is a transmembraneous protein; the extracellular domain is termed Nogo-66, and a Nogo-66-receptor (Nogo-R) has been identified. We performed in situ hybridization in human and mouse nervous tissues to map the cellular distribution of Nogo-R gene activity patterns in fetal and adult human spinal cord and sensory ganglia, adult human brain, and the nervous systems of developing and adult mice. In the human fetus Nogo-R was transcribed in the ventral horn of the spinal cord and in dorsal root ganglia. In adult human tissues Nogo-R gene activity was found in neocortex, hippocampus, amygdala, and a subset of large and medium-sized neurons of the dorsal root ganglia. Nogo-R mRNA was not expressed in the adult human spinal cord at detectable levels. In the fetal mouse, Nogo-R was diffusely expressed in brain, brainstem, trigeminal ganglion, spinal cord, and dorsal root ganglia at all stages. In the adult mouse strong Nogo-R mRNA expression was found in neurons in neocortex, hippocampus, amygdala, habenula, thalamic nuclei, brainstem, the granular cell layer of cerebellum, and the mitral cell layer of the olfactory bulb. Neurons in the adult mouse striatum, the medial septal nucleus, and spinal cord did not express Nogo-R mRNA at detectable levels. In summary, Nogo-66-R mRNA expression in humans and mice was observed in neurons of the developing nervous system Expression was downregulated in the adult spinal cord of both species, and specific expression patterns were seen in the adult brain. Copyright 2002 Wiley-Liss, Inc.

  10. Cartilage regeneration by chondrogenic induced adult stem cells in osteoarthritic sheep model.

    Science.gov (United States)

    Ude, Chinedu C; Sulaiman, Shamsul B; Min-Hwei, Ng; Hui-Cheng, Chen; Ahmad, Johan; Yahaya, Norhamdan M; Saim, Aminuddin B; Idrus, Ruszymah B H

    2014-01-01

    In this study, Adipose stem cells (ADSC) and bone marrow stem cells (BMSC), multipotent adult cells with the potentials for cartilage regenerations were induced to chondrogenic lineage and used for cartilage regenerations in surgically induced osteoarthritis in sheep model. Osteoarthritis was induced at the right knee of sheep by complete resection of the anterior cruciate ligament and medial meniscus following a 3-weeks exercise regimen. Stem cells from experimental sheep were culture expanded and induced to chondrogenic lineage. Test sheep received a single dose of 2 × 10(7) autologous PKH26-labelled, chondrogenically induced ADSCs or BMSCs as 5 mls injection, while controls received 5 mls culture medium. The proliferation rate of ADSCs 34.4 ± 1.6 hr was significantly higher than that of the BMSCs 48.8 ± 5.3 hr (P = 0.008). Chondrogenic induced BMSCs had significantly higher expressions of chondrogenic specific genes (Collagen II, SOX9 and Aggrecan) compared to chondrogenic ADSCs (P = 0.031, 0.010 and 0.013). Grossly, the treated knee joints showed regenerated de novo cartilages within 6 weeks post-treatment. On the International Cartilage Repair Society grade scores, chondrogenically induced ADSCs and BMSCs groups had significantly lower scores than controls (P = 0.0001 and 0.0001). Fluorescence of the tracking dye (PKH26) in the injected cells showed that they had populated the damaged area of cartilage. Histological staining revealed loosely packed matrixes of de novo cartilages and immunostaining demonstrated the presence of cartilage specific proteins, Collagen II and SOX9. Autologous chondrogenically induced ADSCs and BMSCs could be promising cell sources for cartilage regeneration in osteoarthritis.

  11. Cartilage regeneration by chondrogenic induced adult stem cells in osteoarthritic sheep model.

    Directory of Open Access Journals (Sweden)

    Chinedu C Ude

    Full Text Available OBJECTIVES: In this study, Adipose stem cells (ADSC and bone marrow stem cells (BMSC, multipotent adult cells with the potentials for cartilage regenerations were induced to chondrogenic lineage and used for cartilage regenerations in surgically induced osteoarthritis in sheep model. METHODS: Osteoarthritis was induced at the right knee of sheep by complete resection of the anterior cruciate ligament and medial meniscus following a 3-weeks exercise regimen. Stem cells from experimental sheep were culture expanded and induced to chondrogenic lineage. Test sheep received a single dose of 2 × 10(7 autologous PKH26-labelled, chondrogenically induced ADSCs or BMSCs as 5 mls injection, while controls received 5 mls culture medium. RESULTS: The proliferation rate of ADSCs 34.4 ± 1.6 hr was significantly higher than that of the BMSCs 48.8 ± 5.3 hr (P = 0.008. Chondrogenic induced BMSCs had significantly higher expressions of chondrogenic specific genes (Collagen II, SOX9 and Aggrecan compared to chondrogenic ADSCs (P = 0.031, 0.010 and 0.013. Grossly, the treated knee joints showed regenerated de novo cartilages within 6 weeks post-treatment. On the International Cartilage Repair Society grade scores, chondrogenically induced ADSCs and BMSCs groups had significantly lower scores than controls (P = 0.0001 and 0.0001. Fluorescence of the tracking dye (PKH26 in the injected cells showed that they had populated the damaged area of cartilage. Histological staining revealed loosely packed matrixes of de novo cartilages and immunostaining demonstrated the presence of cartilage specific proteins, Collagen II and SOX9. CONCLUSION: Autologous chondrogenically induced ADSCs and BMSCs could be promising cell sources for cartilage regeneration in osteoarthritis.

  12. Role of Insulin-Transferrin-Selenium in Auricular Chondrocyte Proliferation and Engineered Cartilage Formation in Vitro

    Directory of Open Access Journals (Sweden)

    Xia Liu

    2014-01-01

    Full Text Available The goal of this study is to determine the effects of Insulin-Transferrin-Selenium (ITS on proliferation of auricular chondrocytes and formation of engineered cartilage in vitro. Pig auricular monolayer chondrocytes and chondrocyte pellets were cultured in media containing 1% ITS at different concentrations of fetal bovine serum (FBS, 10%, 6%, 2%, 0%, or 10% FBS alone as a control for four weeks. Parameters including cell proliferation in monolayer, wet weight, collagen type I/II/X (Col I, II, X and glycosaminoglycan (GAG expression, GAG content of pellets and gene expression associated with cartilage formation/dedifferentiation (lost cartilage phenotype/hypertrophy within the chondrocyte pellets were assessed. The results showed that chondrocytes proliferation rates increased when FBS concentrations increased (2%, 6%, 10% FBS in ITS supplemented groups. In addition, 1% ITS plus 10% FBS significantly promoted cell proliferation than 10% FBS alone. No chondrocytes grew in ITS alone medium. 1% ITS plus 10% FBS enhanced cartilage formation in terms of size, wet weight, cartilage specific matrices, and homogeneity, compared to 10% FBS alone group. Furthermore, ITS prevented engineered cartilage from dedifferentiation (i.e., higher index of Col II/Col I mRNA expression and expression of aggrecan and hypertrophy (i.e., lower mRNA expression of Col X and MMP13. In conclusion, our results indicated that ITS efficiently enhanced auricular chondrocytes proliferation, retained chondrogenic phenotypes, and promoted engineered cartilage formation when combined with FBS, which is potentially used as key supplementation in auricular chondrocytes and engineered cartilage culture.

  13. Predicting knee cartilage loss using adaptive partitioning of cartilage thickness maps

    DEFF Research Database (Denmark)

    Jørgensen, Dan Richter; Dam, Erik Bjørnager; Lillholm, Martin

    2013-01-01

    This study investigates whether measures of knee cartilage thickness can predict future loss of knee cartilage. A slow and a rapid progressor group was determined using longitudinal data, and anatomically aligned cartilage thickness maps were extracted from MRI at baseline. A novel machine learning...... framework was then trained using these maps. Compared to measures of mean cartilage plate thickness, group separation was increased by focusing on local cartilage differences. This result is central for clinical trials where inclusion of rapid progressors may help reduce the period needed to study effects...

  14. Which cartilage is regenerated, hyaline cartilage or fibrocartilage? Non-invasive ultrasonic evaluation of tissue-engineered cartilage.

    Science.gov (United States)

    Hattori, K; Takakura, Y; Ohgushi, H; Habata, T; Uematsu, K; Takenaka, M; Ikeuchi, K

    2004-09-01

    To investigate ultrasonic evaluation methods for detecting whether the repair tissue is hyaline cartilage or fibrocartilage in new cartilage regeneration therapy. We examined four experimental rabbit models: a spontaneous repair model (group S), a large cartilage defect model (group L), a periosteal graft model (group P) and a tissue-engineered cartilage regeneration model (group T). From the resulting ultrasonic evaluation, we used %MM (the maximum magnitude of the measurement area divided by that of the intact cartilage) as a quantitative index of cartilage regeneration. The results of the ultrasonic evaluation were compared with the histological findings and histological score. The %MM values were 61.1 +/- 16.5% in group S, 29.8 +/- 15.1% in group L, 36.3 +/- 18.3% in group P and 76.5 +/- 18.7% in group T. The results showed a strong similarity to the histological scoring. The ultrasonic examination showed that all the hyaline-like cartilage in groups S and T had a high %MM (more than 60%). Therefore, we could define the borderline between the two types of regenerated cartilage by the %MM.

  15. Developmental Immunotoxicity

    Science.gov (United States)

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  16. A NAC transcription factor gene of Chickpea (Cicer arietinum), CarNAC3, is involved in drought stress response and various developmental processes.

    Science.gov (United States)

    Peng, Hui; Cheng, Hui-Ying; Chen, Chen; Yu, Xin-Wang; Yang, Jia-Ni; Gao, Wen-Rui; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao

    2009-11-15

    NAC transcription factors have been found to play important roles in plant development and responses to environmental stresses. Based on two cDNA libraries constructed from the PEG-treated and -nontreated seedling leaves of chickpea, a NAC gene, CarNAC3, was isolated and characterized. The results indicated that CarNAC3 contained 285 amino acids and had a conserved NAC domain. It was localized in the nucleus and possessed trans-activation activity in the C-terminus. Phylogenetic analysis showed that CarNAC3 belonged to the NAP (NAC-like, activated by APETALA3/PISTILLATA) subgroup of the NAC protein family. CarNAC3 exhibited organ-specific expression and its induction was strongly dependent on leaf age. CarNAC3 showed differential expression patterns during seed development and germination, and could be significantly induced by drought stress, abscisic acid (ABA), ethephon (Et) and indole-3-acetic acid (IAA), but was inhibited by N-6-benzyl-adenine (6-BA). Our data suggest that CarNAC3 may be a transcriptional activator involved in drought stress response and various developmental processes.

  17. Dynamic Culturing of Cartilage Tissue: The Significance of Hydrostatic Pressure

    Science.gov (United States)

    Pereira, Ana L.; Duarte, Ana R.C.; Frias, Ana M.; Pedro, Adriano J.; Oliveira, João T.; Sousa, Rui A.; Reis, Rui L.

    2012-01-01

    Human articular cartilage functions under a wide range of mechanical loads in synovial joints, where hydrostatic pressure (HP) is the prevalent actuating force. We hypothesized that the formation of engineered cartilage can be augmented by applying such physiologic stimuli to chondrogenic cells or stem cells, cultured in hydrogels, using custom-designed HP bioreactors. To test this hypothesis, we investigated the effects of distinct HP regimens on cartilage formation in vitro by either human nasal chondrocytes (HNCs) or human adipose stem cells (hASCs) encapsulated in gellan gum (GG) hydrogels. To this end, we varied the frequency of low HP, by applying pulsatile hydrostatic pressure or a steady hydrostatic pressure load to HNC-GG constructs over a period of 3 weeks, and evaluated their effects on cartilage tissue-engineering outcomes. HNCs (10×106 cells/mL) were encapsulated in GG hydrogels (1.5%) and cultured in a chondrogenic medium under three regimens for 3 weeks: (1) 0.4 MPa Pulsatile HP; (2) 0.4 MPa Steady HP; and (3) Static. Subsequently, we applied the pulsatile regimen to hASC-GG constructs and varied the amplitude of loading, by generating both low (0.4 MPa) and physiologic (5 MPa) HP levels. hASCs (10×106 cells/mL) were encapsulated in GG hydrogels (1.5%) and cultured in a chondrogenic medium under three regimens for 4 weeks: (1) 0.4 MPa Pulsatile HP; (2) 5 MPa Pulsatile HP; and (3) Static. In the HNC study, the best tissue development was achieved by the pulsatile HP regimen, whereas in the hASC study, greater chondrogenic differentiation and matrix deposition were obtained for physiologic loading, as evidenced by gene expression of aggrecan, collagen type II, and sox-9; metachromatic staining of cartilage extracellular matrix; and immunolocalization of collagens. We thus propose that both HNCs and hASCs detect and respond to physical forces, thus resembling joint loading, by enhancing cartilage tissue development in a frequency- and

  18. Diverse roles of integrin receptors in articular cartilage.

    Science.gov (United States)

    Shakibaei, M; Csaki, C; Mobasheri, A

    2008-01-01

    Integrins are heterodimeric integral membrane proteins made up of alpha and beta subunits. At least eighteen alpha and eight beta subunit genes have been described in mammals. Integrin family members are plasma membrane receptors involved in cell adhesion and active as intra- and extracellular signalling molecules in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic spread of tumour cells. Integrin beta 1 (beta1-integrin), the protein encoded by the ITGB1 gene (also known as CD29 and VLAB), is a multi-functional protein involved in cell-matrix adhesion, cell signalling, cellular defense, cell adhesion, protein binding, protein heterodimerisation and receptor-mediated activity. It is highly expressed in the human body (17.4 times higher than the average gene in the last updated revision of the human genome). The extracellular matrix (ECM) of articular cartilage is a unique environment. Interactions between chondrocytes and the ECM regulate many biological processes important to homeostasis and repair of articular cartilage, including cell attachment, growth, differentiation and survival. The beta1-integrin family of cell surface receptors appears to play a major role in mediating cell-matrix interactions that are important in regulating these fundamental processes. Chondrocyte mechanoreceptors have been proposed to incorporate beta1-integrins and mechanosensitive ion channels which link with key ECM, cytoskeletal and signalling proteins to maintain the chondrocyte phenotype, prevent chondrocyte apoptosis and regulate chondrocyte-specific gene expression. This review focuses on the expression and function of beta1-integrins in articular chondrocytes, its role in the unique biology of these cells and its distribution in cartilage.

  19. Magnetic Resonance Imaging of Cartilage Repair

    Science.gov (United States)

    Trattnig, Siegfried; Winalski, Carl S.; Marlovits, Stephan; Jurvelin, Jukka S.; Welsch, Goetz H.; Potter, Hollis G.

    2011-01-01

    Articular cartilage lesions are a common pathology of the knee joint, and many patients may benefit from cartilage repair surgeries that offer the chance to avoid the development of osteoarthritis or delay its progression. Cartilage repair surgery, no matter the technique, requires a noninvasive, standardized, and high-quality longitudinal method to assess the structure of the repair tissue. This goal is best fulfilled by magnetic resonance imaging (MRI). The present article provides an overview of the current state of the art of MRI of cartilage repair. In the first 2 sections, preclinical and clinical MRI of cartilage repair tissue are described with a focus on morphological depiction of cartilage and the use of functional (biochemical) MR methodologies for the visualization of the ultrastructure of cartilage repair. In the third section, a short overview is provided on the regulatory issues of the United States Food and Drug Administration (FDA) and the European Medicines Agency (EMEA) regarding MR follow-up studies of patients after cartilage repair surgeries. PMID:26069565

  20. Hyaline cartilage degenerates after autologous osteochondral transplantation.

    Science.gov (United States)

    Tibesku, C O; Szuwart, T; Kleffner, T O; Schlegel, P M; Jahn, U R; Van Aken, H; Fuchs, S

    2004-11-01

    Autologous osteochondral grafting is a well-established clinical procedure to treat focal cartilage defects in patients, although basic research on this topic remains sparse. The aim of the current study was to evaluate (1) histological changes of transplanted hyaline cartilage of osteochondral grafts and (2) the tissue that connects the transplanted cartilage with the adjacent cartilage in a sheep model. Both knee joints of four sheep were opened surgically and osteochondral grafts were harvested and simultaneously transplanted to the contralateral femoral condyle. The animals were sacrificed after three months and the received knee joints were evaluated histologically. Histological evaluation showed a complete ingrowth of the osseous part of the osteochondral grafts. A healing or ingrowth at the level of the cartilage could not be observed. Histological evaluation of the transplanted grafts according to Mankin revealed significantly more and more severe signs of degeneration than the adjacent cartilage, such as cloning of chondrocytes and irregularities of the articular surface. We found no connecting tissue between the transplanted and the adjacent cartilage and histological signs of degeneration of the transplanted hyaline cartilage. In the light of these findings, long-term results of autologous osteochondral grafts in human beings have to be followed critically.

  1. Transcriptional profiling differences for articular cartilage and repair tissue in equine joint surface lesions

    Directory of Open Access Journals (Sweden)

    Stromberg Arnold J

    2009-09-01

    Full Text Available Abstract Background Full-thickness articular cartilage lesions that reach to the subchondral bone yet are restricted to the chondral compartment usually fill with a fibrocartilage-like repair tissue which is structurally and biomechanically compromised relative to normal articular cartilage. The objective of this study was to evaluate transcriptional differences between chondrocytes of normal articular cartilage and repair tissue cells four months post-microfracture. Methods Bilateral one-cm2 full-thickness defects were made in the articular surface of both distal femurs of four adult horses followed by subchondral microfracture. Four months postoperatively, repair tissue from the lesion site and grossly normal articular cartilage from within the same femorotibial joint were collected. Total RNA was isolated from the tissue samples, linearly amplified, and applied to a 9,413-probe set equine-specific cDNA microarray. Eight paired comparisons matched by limb and horse were made with a dye-swap experimental design with validation by histological analyses and quantitative real-time polymerase chain reaction (RT-qPCR. Results Statistical analyses revealed 3,327 (35.3% differentially expressed probe sets. Expression of biomarkers typically associated with normal articular cartilage and fibrocartilage repair tissue corroborate earlier studies. Other changes in gene expression previously unassociated with cartilage repair were also revealed and validated by RT-qPCR. Conclusion The magnitude of divergence in transcriptional profiles between normal chondrocytes and the cells that populate repair tissue reveal substantial functional differences between these two cell populations. At the four-month postoperative time point, the relative deficiency within repair tissue of gene transcripts which typically define articular cartilage indicate that while cells occupying the lesion might be of mesenchymal origin, they have not recapitulated differentiation to

  2. Developmental gene discovery in a hemimetabolous insect: de novo assembly and annotation of a transcriptome for the cricket Gryllus bimaculatus.

    Directory of Open Access Journals (Sweden)

    Victor Zeng

    Full Text Available Most genomic resources available for insects represent the Holometabola, which are insects that undergo complete metamorphosis like beetles and flies. In contrast, the Hemimetabola (direct developing insects, representing the basal branches of the insect tree, have very few genomic resources. We have therefore created a large and publicly available transcriptome for the hemimetabolous insect Gryllus bimaculatus (cricket, a well-developed laboratory model organism whose potential for functional genetic experiments is currently limited by the absence of genomic resources. cDNA was prepared using mRNA obtained from adult ovaries containing all stages of oogenesis, and from embryo samples on each day of embryogenesis. Using 454 Titanium pyrosequencing, we sequenced over four million raw reads, and assembled them into 21,512 isotigs (predicted transcripts and 120,805 singletons with an average coverage per base pair of 51.3. We annotated the transcriptome manually for over 400 conserved genes involved in embryonic patterning, gametogenesis, and signaling pathways. BLAST comparison of the transcriptome against the NCBI non-redundant protein database (nr identified significant similarity to nr sequences for 55.5% of transcriptome sequences, and suggested that the transcriptome may contain 19,874 unique transcripts. For predicted transcripts without significant similarity to known sequences, we assessed their similarity to other orthopteran sequences, and determined that these transcripts contain recognizable protein domains, largely of unknown function. We created a searchable, web-based database to allow public access to all raw, assembled and annotated data. This database is to our knowledge the largest de novo assembled and annotated transcriptome resource available for any hemimetabolous insect. We therefore anticipate that these data will contribute significantly to more effective and higher-throughput deployment of molecular analysis tools in

  3. Tribology approach to the engineering and study of articular cartilage.

    Science.gov (United States)

    Wimmer, Markus A; Grad, Sibylle; Kaup, Thomas; Hänni, Markus; Schneider, Erich; Gogolewski, Sylwester; Alini, Mauro

    2004-01-01

    This study has been based on the assumption that articular motion is an important aspect of mechanotransduction in synovial joints. For this reason a new bioreactor concept, able to reproduce joint kinematics more closely, has been designed. The prototype consists of a rotating scaffold and/or cartilage pin, which is pressed onto an orthogonally rotating ball. By oscillating pin and ball in phase difference, elliptical displacement trajectories are generated that are similar to the motion paths occurring in vivo. Simultaneously, dynamic compression may be applied with a linear actuator, while two-step-motors generate the rotation of pin and ball. The whole apparatus is placed in an incubator. The control station is located outside. Preliminary investigations at the gene expression level demonstrated promising results. Compared with free-swelling control and/or simply compression-loaded samples, chondrocyte-seeded scaffolds as well as nasal cartilage explants exposed to interface motion both showed elevated levels of cartilage oligomeric matrix protein mRNA. The final design of the bioreactor will include four individual stations in line, which will facilitate the investigation of motion-initiated effects at the contacting surfaces in more detail.

  4. Photoactivated methods for enabling cartilage-to-cartilage tissue fixation

    Science.gov (United States)

    Sitterle, Valerie B.; Roberts, David W.

    2003-06-01

    The present study investigates whether photoactivated attachment of cartilage can provide a viable method for more effective repair of damaged articular surfaces by providing an alternative to sutures, barbs, or fibrin glues for initial fixation. Unlike artificial materials, biological constructs do not possess the initial strength for press-fitting and are instead sutured or pinned in place, typically inducing even more tissue trauma. A possible alternative involves the application of a photosensitive material, which is then photoactivated with a laser source to attach the implant and host tissues together in either a photothermal or photochemical process. The photothermal version of this method shows potential, but has been almost entirely applied to vascularized tissues. Cartilage, however, exhibits several characteristics that produce appreciable differences between applying and refining these techniques when compared to previous efforts involving vascularized tissues. Preliminary investigations involving photochemical photosensitizers based on singlet oxygen and electron transfer mechanisms are discussed, and characterization of the photodynamic effects on bulk collagen gels as a simplified model system using FTIR is performed. Previous efforts using photothermal welding applied to cartilaginous tissues are reviewed.

  5. Biological aspects of tissue-engineered cartilage.

    Science.gov (United States)

    Hoshi, Kazuto; Fujihara, Yuko; Yamawaki, Takanori; Harai, Motohiro; Asawa, Yukiyo; Hikita, Atsuhiko

    2018-04-01

    Cartilage regenerative medicine has been progressed well, and it reaches the stage of clinical application. Among various techniques, tissue engineering, which incorporates elements of materials science, is investigated earnestly, driven by high clinical needs. The cartilage tissue engineering using a poly lactide scaffold has been exploratorily used in the treatment of cleft lip-nose patients, disclosing good clinical results during 3-year observation. However, to increase the reliability of this treatment, not only accumulation of clinical evidence on safety and usefulness of the tissue-engineered products, but also establishment of scientific background on biological mechanisms, are regarded essential. In this paper, we reviewed recent trends of cartilage tissue engineering in clinical practice, summarized experimental findings on cellular and matrix changes during the cartilage regeneration, and discussed the importance of further studies on biological aspects of tissue-engineered cartilage, especially by the histological and the morphological methods.

  6. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  7. RHEB: a potential regulator of chondrocyte phenotype for cartilage tissue regeneration.

    Science.gov (United States)

    Ashraf, S; Ahn, J; Cha, B-H; Kim, J-S; Han, I; Park, H; Lee, S-H

    2017-09-01

    As articular cartilage has a limited ability to self-repair, successful cartilage regeneration requires clinical-grade chondrocytes with innate characteristics. However, cartilage regeneration via chondrocyte transplantation is challenging, because chondrocytes lose their innate characteristics during in vitro expansion. Here, we investigated the mechanistic underpinning of the gene Ras homologue enriched in brain (RHEB) in the control of senescence and dedifferentiation through the modulation of oxidative stress in chondrocytes, a hallmark of osteoarthritis. Serial expansion of human chondrocytes led to senescence, dedifferentiation and oxidative stress. RHEB maintained the innate characteristics of chondrocytes by regulating senescence, dedifferentiation and oxidative stress, leading to the upregulation of COL2 expression via SOX9 and the downregulation of p27 expression via MCL1. RHEB also decreased the expression of COL10. RHEB knockdown mimics decreased the expression of SOX9, COL2 and MCL1, while abrogating the suppressive function of RHEB on p27 and COL10 in chondrocytes. RHEB-overexpressing chondrocytes successfully formed cartilage tissue in vitro as well as in vivo, with increased expression of GAG matrix and chondrogenic markers. RHEB induces a distinct gene expression signature that maintained the innate chondrogenic properties over a long period. Therefore, RHEB expression represents a potentially useful mechanism in terms of cartilage tissue regeneration from chondrocytes, by which chondrocyte phenotypic and molecular characteristics can be retained through the modulation of senescence, dedifferentiation and oxidative stress. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Cartilage repair in the degenerative ageing knee

    Science.gov (United States)

    Brittberg, Mats; Gomoll, Andreas H; Canseco, José A; Far, Jack; Lind, Martin; Hui, James

    2016-01-01

    Background and purpose Cartilage damage can develop due to trauma, resulting in focal chondral or osteochondral defects, or as more diffuse loss of cartilage in a generalized organ disease such as osteoarthritis. A loss of cartilage function and quality is also seen with increasing age. There is a spectrum of diseases ranging from focal cartilage defects with healthy surrounding cartilage to focal lesions in degenerative cartilage, to multiple and diffuse lesions in osteoarthritic cartilage. At the recent Aarhus Regenerative Orthopaedics Symposium (AROS) 2015, regenerative challenges in an ageing population were discussed by clinicians and basic scientists. A group of clinicians was given the task of discussing the role of tissue engineering in the treatment of degenerative cartilage lesions in ageing patients. We present the outcomes of our discussions on current treatment options for such lesions, with particular emphasis on different biological repair techniques and their supporting level of evidence. Results and interpretation Based on the studies on treatment of degenerative lesions and early OA, there is low-level evidence to suggest that cartilage repair is a possible treatment for such lesions, but there are conflicting results regarding the effect of advanced age on the outcome. We concluded that further improvements are needed for direct repair of focal, purely traumatic defects before we can routinely use such repair techniques for the more challenging degenerative lesions. Furthermore, we need to identify trigger mechanisms that start generalized loss of cartilage matrix, and induce subchondral bone changes and concomitant synovial pathology, to maximize our treatment methods for biological repair in degenerative ageing joints. PMID:27910738

  9. Hyaline cartilage cells outperform mandibular condylar cartilage cells in a TMJ fibrocartilage tissue engineering application.

    Science.gov (United States)

    Wang, L; Lazebnik, M; Detamore, M S

    2009-03-01

    To compare temporomandibular joint (TMJ) condylar cartilage cells in vitro to hyaline cartilage cells cultured in a three-dimensional (3D) environment for tissue engineering of mandibular condylar cartilage. Mandibular condylar cartilage and hyaline cartilage cells were harvested from pigs and cultured for 6 weeks in polyglycolic acid (PGA) scaffolds. Both types of cells were treated with glucosamine sulfate (0.4 mM), insulin-like growth factor-I (IGF-I) (100 ng/ml) and their combination. At weeks 0 and 6, cell number, glycosaminoglycan (GAG) and collagen content were determined, types I and II collagen were visualized by immunohistochemistry and GAGs were visualized by histology. Hyaline cartilage cells produced from half an order to a full order of magnitude more GAGs and collagen than mandibular condylar cartilage cells in 3D culture. IGF-I was a highly effective signal for biosynthesis with hyaline cartilage cells, while glucosamine sulfate decreased cell proliferation and biosynthesis with both types of cells. In vitro culture of TMJ condylar cartilage cells produced a fibrous tissue with predominantly type I collagen, while hyaline cartilage cells formed a fibrocartilage-like tissue with types I and II collagen. The combination of IGF and glucosamine had a synergistic effect on maintaining the phenotype of TMJ condylar cells to generate both types I and II collagen. Given the superior biosynthetic activity by hyaline cartilage cells and the practical surgical limitations of harvesting cells from the TMJ of a patient requiring TMJ reconstruction, cartilage cells from elsewhere in the body may be a potentially better alternative to cells harvested from the TMJ for TMJ tissue engineering. This finding may also apply to other fibrocartilages such as the intervertebral disc and knee meniscus in applications where a mature cartilage cell source is desired.

  10. Cysts of the semilunar cartilage

    International Nuclear Information System (INIS)

    Bruessermann, M.

    1981-01-01

    On the basis of the studies listed in the bibliography, this dissertation reports on the pathology, clinical symptoms and radiology of cysts of the semilunar cartilage. The author analyses 118 cases of his own, with special regard to the results of pneumo-arthrographic investigations carried through according to a special technique by Schaefer. In the course of this work, measurements of the meniscal base are for the first time used as radiological criteria indicating the presence of a cyst of the semilunar cartilage. Furthermore the well-known radiological signs of cysts, such as bone defects according to Albert and Keller, light central spot in the meniscal body, as well as Rauber's sign and horizontal rupture, are investigated as to the frequency of their incidence. For that purpose all the X-ray pictures were subjected to a further dose scrutiny. A list of all the 118 cases with their clinical and radiological data is found in the annex, together with the results of the operations and patho-anatomical investigations. (orig.) [de

  11. Imaging diagnosis of the articular cartilage disorders

    International Nuclear Information System (INIS)

    Liu Sirun; Zhu Tianyuan; Huang Li; Leng Xiaoming

    2003-01-01

    Objective: To evaluate the diagnosis and differential diagnosis among the chronic osteoarthritis, rheumatoid arthritis and other chronic cartilage lesions on the plain films and MR images. Methods: Eighty-nine cases, including 115 joints, underwent plain film and MRI examination, and enhanced MRI scan was performed on 32 of them, including 44 joints. MRI scan sequences consisted of T 1 WI, T 2 WI + PDWI, STIR, and 3D FS SPGR. There were 90 knee joints in this group and each of the articular cartilage was divided into four parts: patella, femoral medial condyle, femoral lateral condyle, and tibia facet on MR images. The cartilage disorders were classified according to the outerbridge method. In addition, 61 cases including 75 joints were observed as a control group on the plain films and MR images. Results: 115 cartilage lesions were found on MR images, in which thinness of the cartilage (58 cases, 50.4%), bone changes under the cartilage (22 cases, 19.7%), medullar edema (22 cases, 19.7%), and synovial hyperplasia (52 cases, 45.2%) were seen. The patella cartilage was the most likely affected part (81/90, 90%). So the patellar cartilage lesions were divided as group 1 (grade I-II) and group 2 (grade III-IV) on MR images, which were compared with the plain film signs. The narrowing of the joint space and saccules under the articular surface were statistically significant with each other, and χ 2 values were 9.349 and 9.885, respectively (P=0.002). Conclusion: No constant signs could be seen on the plain films with grade I-II cartilage disorders. While the narrowing joint space and saccules under the joint surface could be seen on them with grade III-IV cartilage disorders, which were mainly correlated with the cartilage disorders and bone changes under the articular cartilages. A combination of the plain films and MR images is the best imaging method for examining the joints and joint cartilages. Enhanced MRI scan is very helpful on the diagnosis and differential

  12. The effects of monosodium urate monohydrate crystals on chondrocyte viability and function: implications for development of cartilage damage in gout.

    Science.gov (United States)

    Chhana, Ashika; Callon, Karen E; Pool, Bregina; Naot, Dorit; Gamble, Gregory D; Dray, Michael; Pitto, Rocco; Bentley, Jarome; McQueen, Fiona M; Cornish, Jillian; Dalbeth, Nicola

    2013-12-01

    Cartilage damage is frequently observed in advanced destructive gout. The aim of our study was to investigate the effects of monosodium urate monohydrate (MSU) crystals on chondrocyte viability and function. The alamarBlue assay and flow cytometry were used to assess the viability of primary human chondrocytes and cartilage explants following culture with MSU crystals. The number of dead chondrocytes in cartilage explants cultured with MSU crystals was quantified. Real-time PCR was used to determine changes in the relative mRNA expression levels of chondrocytic genes. The histological appearance of cartilage in joints affected by gout was also examined. MSU crystals rapidly reduced primary human chondrocyte and cartilage explant viability in a dose-dependent manner (p gout, normal cartilage architecture was lost, with empty chondrocyte lacunae observed. MSU crystals have profound inhibitory effects on chondrocyte viability and function. Interactions between MSU crystals and chondrocytes may contribute to cartilage damage in gout through reduction of chondrocyte viability and promotion of a catabolic state.

  13. miR-322 stabilizes MEK1 expression to inhibit RAF/MEK/ERK pathway activation in cartilage.

    Science.gov (United States)

    Bluhm, Björn; Ehlen, Harald W A; Holzer, Tatjana; Georgieva, Veronika S; Heilig, Juliane; Pitzler, Lena; Etich, Julia; Bortecen, Toman; Frie, Christian; Probst, Kristina; Niehoff, Anja; Belluoccio, Daniele; Van den Bergen, Jocelyn; Brachvogel, Bent

    2017-10-01

    Cartilage originates from mesenchymal cell condensations that differentiate into chondrocytes of transient growth plate cartilage or permanent cartilage of the articular joint surface and trachea. MicroRNAs fine-tune the activation of entire signaling networks and thereby modulate complex cellular responses, but so far only limited data are available on miRNAs that regulate cartilage development. Here, we characterize a miRNA that promotes the biosynthesis of a key component in the RAF/MEK/ERK pathway in cartilage. Specifically, by transcriptome profiling we identified miR-322 to be upregulated during chondrocyte differentiation. Among the various miR-322 target genes in the RAF/MEK/ERK pathway, only Mek1 was identified as a regulated target in chondrocytes. Surprisingly, an increased concentration of miR-322 stabilizes Mek1 mRNA to raise protein levels and dampen ERK1/2 phosphorylation, while cartilage-specific inactivation of miR322 in mice linked the loss of miR-322 to decreased MEK1 levels and to increased RAF/MEK/ERK pathway activation. Such mice died perinatally due to tracheal growth restriction and respiratory failure. Hence, a single miRNA can stimulate the production of an inhibitory component of a central signaling pathway to impair cartilage development. © 2017. Published by The Company of Biologists Ltd.

  14. Comparison of 454-ESTs from Huperzia serrata and Phlegmariurus carinatus reveals putative genes involved in lycopodium alkaloid biosynthesis and developmental regulation

    Directory of Open Access Journals (Sweden)

    Steinmetz André

    2010-09-01

    . serrata and P. carinatus 454-ESTs and real-time PCR analysis. Four unique putative CYP450 transcripts (Hs01891, Hs04010, Hs13557 and Hs00093 which are the most likely to be involved in the biosynthesis of lycopodium alkaloids were selected based on a phylogenetic analysis. Approximately 115 H. serrata and 98 P. carinatus unique putative transcripts associated with the biosynthesis of triterpenoids, alkaloids and flavones/flavonoids were located in the 454-EST datasets. Transcripts related to phytohormone biosynthesis and signal transduction as well as transcription factors were also obtained. In addition, we discovered 2,729 and 1,573 potential SSR-motif microsatellite loci in the H. serrata and P. carinatus 454-ESTs, respectively. Conclusions The 454-EST resource allowed for the first large-scale acquisition of ESTs from H. serrata and P. carinatus, which are representative members of the Huperziaceae family. We discovered many genes likely to be involved in the biosynthesis of bioactive compounds and transcriptional regulation as well as a large number of potential microsatellite markers. These results constitute an essential resource for understanding the molecular basis of developmental regulation and secondary metabolite biosynthesis (especially that of lycopodium alkaloids in the Huperziaceae, and they provide an overview of the genetic diversity of this family.

  15. Cartilage T2 assessment: differentiation of normal hyaline cartilage and reparative tissue after arthroscopic cartilage repair in equine subjects.

    Science.gov (United States)

    White, Lawrence M; Sussman, Marshall S; Hurtig, Mark; Probyn, Linda; Tomlinson, George; Kandel, Rita

    2006-11-01

    To prospectively assess T2 mapping characteristics of normal articular cartilage and of cartilage at sites of arthroscopic repair, including comparison with histologic results and collagen organization assessed at polarized light microscopy (PLM). Study protocol was compliant with the Canadian Council on Animal Care Guidelines and approved by the institutional animal care committee. Arthroscopic osteochondral autograft transplantation (OAT) and microfracture arthroplasty (MFx) were performed in knees of 10 equine subjects (seven female, three male; age range, 3-5 years). A site of arthroscopically normal cartilage was documented in each joint as a control site. Joints were harvested at 12 (n = 5) and 24 (n = 5) weeks postoperatively and were imaged at 1.5-T magnetic resonance (MR) with a 10-echo sagittal fast spin-echo acquisition. T2 maps of each site (21 OAT harvest, 10 MFx, 12 OAT plug, and 10 control sites) were calculated with linear least-squares curve fitting. Cartilage T2 maps were qualitatively graded as "organized" (normal transition of low-to-high T2 signal from deep to superficial cartilage zones) or "disorganized." Quantitative mean T2 values were calculated for deep, middle, and superficial cartilage at each location. Results were compared with histologic and PLM assessments by using kappa analysis. T2 maps were qualitatively graded as organized at 20 of 53 sites and as disorganized at 33 sites. Perfect agreement was seen between organized T2 and histologic findings of hyaline cartilage and between disorganized T2 and histologic findings of fibrous reparative tissue (kappa = 1.0). Strong agreement was seen between organized T2 and normal PLM findings and between disorganized T2 and abnormal PLM findings (kappa = .92). Quantitative assessment of the deep, middle, and superficial cartilage, respectively, showed mean T2 values of 53.3, 58.6, and 54.9 msec at reparative fibrous tissue sites and 40.7, 53.6, and 61.6 msec at hyaline cartilage sites. A

  16. Developmental Scaffolding

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2015-01-01

    . Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

  17. Mesenchymal stem cells in cartilage regeneration.

    Science.gov (United States)

    Savkovic, Vuk; Li, Hanluo; Seon, Jong-Keun; Hacker, Michael; Franz, Sandra; Simon, Jan-Christoph

    2014-01-01

    Articular cartilage provides life-long weight-bearing and mechanical lubrication with extraordinary biomechanical performance and simple structure. However, articular cartilage is apparently vulnerable to multifactorial damage and insufficient to self-repair, isolated in articular capsule without nerves or blood vessels. Osteoarthritis (OA) is known as a degenerative articular cartilage deficiency progressively affecting large proportion of the world population, and restoration of hyaline cartilage is clinical challenge to repair articular cartilage lesion and recreate normal functionality over long period. Mesenchymal stem cells (MSC) are highly proliferative and multipotent somatic cells that are able to differentiate mesoderm-derived cells including chondrocytes and osteoblasts. Continuous endeavors in basic research and preclinical trial have achieved promising outcomes in cartilage regeneration using MSCs. This review focuses on rationale and technologies of MSC-based hyaline cartilage repair involving tissue engineering, 3D biomaterials and growth factors. By comparing conventional treatment and current research progress, we describe insights of advantage and challenge in translation and application of MSC-based chondrogenesis for OA treatment.

  18. Allogenic lyophilized cartilage grafts for craniomaxillofacial reconstruction

    International Nuclear Information System (INIS)

    Pill Hoon Choung

    1999-01-01

    Allogenic lyophilized cartilages were made in our clinic after Sailer methods and some modification. In our clinic, we have used allogenic cartilage grafts on 102 defects of craniomaxillofacial area; 1) for defects from cyst or ameloblastoma, 2) for lack of continuity of the mandible, 3) for rhinoplasty, 4) for paranasal augmentation, 5) for augmentation genioplasty, 6) for reconstruction of orbital floor, 7) for oroantral fistula, 8) for temporal augmentation, 9) for TMJ surgery 10) for condyle defect as a costochondral graft, 11) for filling of tooth socket and alveolus augmentation,12) for correction or orbital height and 13) for guided bone regeneration in peripheral implant. The types of lyophilized cartilage used were chip, sheet and block types developed by freeze-dried methods. Some grafts showed change of ossification, in which case we could perform implant on it. We have good results on reconstruction of craniomaxillofacial defects. Allogenic cartilage have advantages such as 1) it has no immune reaction clinically, 2) it is more tolerable to infection than that of autogenous cartilage, 3) it has character of less resorption which require no over correction, 4) it is easy to manipulate contouring, and 5) it has possibility of undergoing ossification. Allogenic cartilage has been considered as good substitutes for bone. The author would like to report the results on 102 allogenic cartilage have

  19. Regulatory Challenges for Cartilage Repair Technologies.

    Science.gov (United States)

    McGowan, Kevin B; Stiegman, Glenn

    2013-01-01

    In the United States, few Food and Drug Administration (FDA)-approved options exist for the treatment of focal cartilage and osteochondral lesions. Developers of products for cartilage repair face many challenges to obtain marketing approval from the FDA. The objective of this review is to discuss the necessary steps for FDA application and approval for a new cartilage repair product. FDA Guidance Documents, FDA Panel Meetings, scientific organization recommendations, and clinicaltrials.gov were reviewed to demonstrate the current thinking of FDA and the scientific community on the regulatory process for cartilage repair therapies. Cartilage repair therapies can receive market approval from FDA as medical devices, drugs, or biologics, and the specific classification of product can affect the nonclinical, clinical, and regulatory strategy to bring the product to market. Recent FDA guidance gives an outline of the required elements to bring a cartilage repair product to market, although these standards are often very general. As a result, companies have to carefully craft their study patient population, comparator group, and clinical endpoint to best showcase their product's attributes. In addition, regulatory strategy and manufacturing process validation need to be considered early in the clinical study process to allow for timely product approval following the completion of clinical study. Although the path to regulatory approval for a cartilage repair therapy is challenging and time-consuming, proper clinical trial planning and attention to the details can eventually save companies time and money by bringing a product to the market in the most expeditious process possible.

  20. Tomato UDP-Glucose Sterol Glycosyltransferases: A Family of Developmental and Stress Regulated Genes that Encode Cytosolic and Membrane-Associated Forms of the Enzyme

    Directory of Open Access Journals (Sweden)

    Karla Ramirez-Estrada

    2017-06-01

    Full Text Available Sterol glycosyltransferases (SGTs catalyze the glycosylation of the free hydroxyl group at C-3 position of sterols to produce sterol glycosides. Glycosylated sterols and free sterols are primarily located in cell membranes where in combination with other membrane-bound lipids play a key role in modulating their properties and functioning. In contrast to most plant species, those of the genus Solanum contain very high levels of glycosylated sterols, which in the case of tomato may account for more than 85% of the total sterol content. In this study, we report the identification and functional characterization of the four members of the tomato (Solanum lycopersicum cv. Micro-Tom SGT gene family. Expression of recombinant SlSGT proteins in E. coli cells and N. benthamiana leaves demonstrated the ability of the four enzymes to glycosylate different sterol species including cholesterol, brassicasterol, campesterol, stigmasterol, and β-sitosterol, which is consistent with the occurrence in their primary structure of the putative steroid-binding domain found in steroid UDP-glucuronosyltransferases and the UDP-sugar binding domain characteristic for a superfamily of nucleoside diphosphosugar glycosyltransferases. Subcellular localization studies based on fluorescence recovery after photobleaching and cell fractionation analyses revealed that the four tomato SGTs, like the Arabidopsis SGTs UGT80A2 and UGT80B1, localize into the cytosol and the PM, although there are clear differences in their relative distribution between these two cell fractions. The SlSGT genes have specialized but still largely overlapping expression patterns in different organs of tomato plants and throughout the different stages of fruit development and ripening. Moreover, they are differentially regulated in response to biotic and abiotic stress conditions. SlSGT4 expression increases markedly in response to osmotic, salt, and cold stress, as well as upon treatment with abscisic

  1. Developmental delay

    Science.gov (United States)

    Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...

  2. Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge; Kristensen, Tage Søndergaard

    2003-01-01

    Human Deveoplment and Working Life - Work for Welfare explores whether the development of human resources at company level can improve individuals' quality of life, companies' possibilities of development, and welfare and democracy in society. Chapter two discuss the concept "developmental work...

  3. Activation of Indian Hedgehog Promotes Chondrocyte Hypertrophy and Upregulation of MMP-13 in Human Osteoarthritic Cartilage

    Science.gov (United States)

    Wei, Fangyuan; Zhou, Jingming; Wei, Xiaochun; Zhang, Juntao; Fleming, Braden C.; Terek, Richard; Pei, Ming; Chen, Qian; Liu, Tao; Wei, Lei

    2012-01-01

    Objective The objectives of this study were to 1) determine the correlation between osteoarthritis (OA) and Ihh expression, and 2) establish the effects of Ihh on expression of markers of chondrocyte hypertrophy and MMP-13 in human OA cartilage. Design OA cartilage and synovial fluid samples were obtained during total knee arthroplasty. Normal cartilage samples were obtained from intra-articular tumor resections, and normal synovial fluid samples were obtained from healthy volunteers and the contralateral uninjured knee of patients undergoing anterior cruciate ligament reconstruction. OA was graded using the Mankin score. Expression of Ihh in synovial fluid was determined by western blot. Ihh, type X collagen and MMP-13 mRNA were determined by real time PCR. Protein expression of type X collagen and MMP-13 in cartilage samples were analyzed with immunohistochemistry. Chondrocyte size was measured using image analysis. Results Ihh expression was increased 2.6 fold in OA cartilage and 37% in OA synovial fluid when compared to normal control samples. Increased expression of Ihh was associated with the severity of OA and expression of markers of chondrocyte hypertrophy: type X collagen and MMP-13, and chondocyte size. Chondrocytes were more spherical with increasing severity of OA. There was a significant correlation between Mankin score and cell size (r2= 0.80) and Ihh intensity (r2 = 0.89). Exogenous Ihh induced a 6.8 fold increase of type X collagen and 2.8 fold increase of MMP-13 mRNA expression in cultured chondrocytes. Conversely, knockdown of Ihh by siRNA and Hh inhibitor Cyclopamine had the opposite effect. Conclusions Ihh expression correlates with OA progression and changes in chondrocyte morphology and gene expression consistent with chondrocyte hypertrophy and cartilage degradation seen in OA cartilage. Thus, Ihh may be a potential therapeutic target to prevent OA progression. PMID:22469853

  4. Satisfactory surgical option for cartilage graft absorption in microtia reconstruction.

    Science.gov (United States)

    Han, So-Eun; Oh, Kap Sung

    2016-04-01

    We routinely perform auricular elevation at least 6 months after implantation of framework in microtia reconstruction using costal cartilage. However, in a few cases, cartilage graft absorption has occurred, which has led to contour irregularity with unfavorable long-term results. In the present study, we recount the details of using additional rib cartilage augmentation to achieve an accentuated contour in cartilage graft absorption cases. The cartilage graft absorption was defined as contour irregularity or cartilage graft deformation as evaluated by the surgeon and patient. Depending on the extent of cartilage graft absorption, another rib cartilage framework was added to the previously implanted framework, targeting the absorption area. We used banked cartilage or harvested new cartilage based on three-dimensional rib computed tomography. Additional recontouring of framework was conducted in eight patients who were examined for cartilage graft absorption from 1.5 to 5 years after implantation of the framework. Four patients received additional rib cartilage augmentation and tissue expander insertion simultaneously prior to auricular elevation. Two patients underwent auricular elevation simultaneously. In another two patients, additional rib cartilage augmentation was performed before auricular elevation. The mean follow-up period was 18 months, and in all cases reconstructive results were acceptable. Although further follow-up evaluation is required, additional rib cartilage augmentation is an attractive surgical option for cartilage graft absorption cases. Copyright © 2016 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  5. Latent Transforming Growth Factor-beta1 Functionalised Electrospun Scaffolds Promote Human Cartilage Differentiation: Towards an Engineered Cartilage Construct

    Directory of Open Access Journals (Sweden)

    Erh-Hsuin Lim

    2013-11-01

    Full Text Available BackgroundTo overcome the potential drawbacks of a short half-life and dose-related adverse effects of using active transforming growth factor-beta 1 for cartilage engineering, a cell-mediated latent growth factor activation strategy was developed incorporating latent transforming growth factor-β1 (LTGF into an electrospun poly(L-lactide scaffold.MethodsThe electrospun scaffold was surface modified with NH3 plasma and biofunctionalised with LTGF to produce both random and orientated biofunctionalised electrospun scaffolds. Scaffold surface chemical analysis and growth factor bioavailability assays were performed. In vitro biocompatibility and human nasal chondrocyte gene expression with these biofunctionalised electrospun scaffold templates were assessed. In vivo chondrogenic activity and chondrocyte gene expression were evaluated in athymic rats.ResultsChemical analysis demonstrated that LTGF anchored to the scaffolds was available for enzymatic, chemical and cell activation. The biofunctionalised scaffolds were non-toxic. Gene expression suggested chondrocyte re-differentiation after 14 days in culture. By 6 weeks, the implanted biofunctionalised scaffolds had induced highly passaged chondrocytes to re-express Col2A1 and produce type II collagen.ConclusionsWe have demonstrated a proof of concept for cell-mediated activation of anchored growth factors using a novel biofunctionalised scaffold in cartilage engineering. This presents a platform for development of protein delivery systems and for tissue engineering.

  6. First and second order stereology of hyaline cartilage: Application on mice femoral cartilage.

    Science.gov (United States)

    Noorafshan, Ali; Niazi, Behnam; Mohamadpour, Masoomeh; Hoseini, Leila; Hoseini, Najmeh; Owji, Ali Akbar; Rafati, Ali; Sadeghi, Yasaman; Karbalay-Doust, Saied

    2016-11-01

    Stereological techniques could be considered in research on cartilage to obtain quantitative data. The present study aimed to explain application of the first- and second-order stereological methods on articular cartilage of mice and the methods applied on the mice exposed to cadmium (Cd). The distal femoral articular cartilage of BALB/c mice (control and Cd-treated) was removed. Then, volume and surface area of the cartilage and number of chondrocytes were estimated using Cavalieri and optical dissector techniques on isotropic uniform random sections. Pair-correlation function [g(r)] and cross-correlation function were calculated to express the spatial arrangement of chondrocytes-chondrocytes and chondrocytes-matrix (chondrocyte clustering/dispersing), respectively. The mean±standard deviation of the cartilage volume, surface area, and thickness were 1.4±0.1mm 3 , 26.2±5.4mm 2 , and 52.8±6.7μm, respectively. Besides, the mean number of chondrocytes was 680±200 (×10 3 ). The cartilage volume, cartilage surface area, and number of chondrocytes were respectively reduced by 25%, 27%, and 27% in the Cd-treated mice in comparison to the control animals (pcartilage components carried potential advantages for investigating the cartilage in different joint conditions. Chondrocyte clustering/dispersing and cellularity can be evaluated in cartilage assessment in normal or abnormal situations. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Chondrogenic potential of physically treated bovine cartilage matrix derived porous scaffolds on human dermal fibroblast cells.

    Science.gov (United States)

    Moradi, Ali; Ataollahi, Forough; Sayar, Katayoun; Pramanik, Sumit; Chong, Pan-Pan; Khalil, Alizan Abdul; Kamarul, Tunku; Pingguan-Murphy, Belinda

    2016-01-01

    Extracellular matrices have drawn attention in tissue engineering as potential biomaterials for scaffold fabrication because of their bioactive components. Noninvasive techniques of scaffold fabrication and cross-linking treatments are believed to maintain the integrity of bioactive molecules while providing proper architectural and mechanical properties. Cartilage matrix derived scaffolds are designed to support the maintenance of chondrocytes and provide proper signals for differentiation of chondroinducible cells. Chondroinductive potential of bovine articular cartilage matrix derived porous scaffolds on human dermal fibroblasts and the effect of scaffold shrinkage on chondrogenesis were investigated. An increase in sulfated glycosaminoglycans production along with upregulation of chondrogenic genes confirmed that physically treated cartilage matrix derived scaffolds have chondrogenic potential on human dermal fibroblasts. © 2015 Wiley Periodicals, Inc.

  8. Developmental Hypothyroidism Reduces the Expression of Activity-Dependent Plasticity Genes in Denate Gyrus of the Adult Following Long Term Potentiation

    Science.gov (United States)

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neuro...

  9. One-stage vs two-stage cartilage repair: a current review

    Directory of Open Access Journals (Sweden)

    Daniel Meyerkort

    2010-10-01

    Full Text Available Daniel Meyerkort, David Wood, Ming-Hao ZhengCenter for Orthopaedic Research, School of Surgery and Pathology, University of Western Australia, Perth, AustraliaIntroduction: Articular cartilage has a poor capacity for regeneration if damaged. Various methods have been used to restore the articular surface, improve pain, function, and slow progression to osteoarthritis.Method: A PubMed review was performed on 18 March, 2010. Search terms included “autologous chondrocyte implantation (ACI” and “microfracture” or “mosaicplasty”. The aim of this review was to determine if 1-stage or 2-stage procedures for cartilage repair produced different functional outcomes.Results: The main procedures currently used are ACI and microfracture. Both first-generation ACI and microfracture result in clinical and functional improvement with no significant differences. A significant increase in functional outcome has been observed in second-generation procedures such as Hyalograft C, matrix-induced ACI, and ChondroCelect compared with microfracture. ACI results in a higher percentage of patients with clinical improvement than mosaicplasty; however, these results may take longer to achieve.Conclusion: Clinical and functional improvements have been demonstrated with ACI, microfracture, mosaicplasty, and synthetic cartilage constructs. Heterogeneous products and lack of good-quality randomized-control trials make product comparison difficult. Future developments involve scaffolds, gene therapy, growth factors, and stem cells to create a single-stage procedure that results in hyaline articular cartilage.Keywords: autologous chondrocyte implantation, microfracture, cartilage repair

  10. Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

    Energy Technology Data Exchange (ETDEWEB)

    Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Flaws, Jodi A. [Department of Comparative Biosciences, University of Illinois Urbana-Champaign (United States); Helferich, William G. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Pan, Yuan-Xiang, E-mail: yxpan@illinois.edu [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Lezmi, Stéphane, E-mail: slezmi@illinois.edu [Department of Pathobiology, University of Illinois Urbana-Champaign (United States)

    2015-04-15

    Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

  11. Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

    International Nuclear Information System (INIS)

    Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J.; Flaws, Jodi A.; Helferich, William G.; Pan, Yuan-Xiang; Lezmi, Stéphane

    2015-01-01

    Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

  12. IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

    Science.gov (United States)

    Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

    2016-08-01

    Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

  13. Articular cartilage changes in chondromalacia patellae.

    Science.gov (United States)

    Bentley, G

    1985-11-01

    Full thickness samples of articular cartilage were removed from areas of chondromalacia on the medial and "odd" facets of the patellae of 21 adults and examined by histology, autoradiography and electron microscopy. Surface fibrillation, loss of superficial matrix staining and reduced 35SO4 labelling was seen, with little change in the deep zone. Ten cases showed "fibrous metaplasia" of the superficial cartilage with definite evidence of cell division and apparent smoothing of the surface. Scattered chondrocyte replication appeared to occur in the surrounding intact cartilage. The findings suggest that early lesions in chondromalacia patellae may heal either by cartilage or fibrous metaplasia and that this may account for the resolution of clinical symptoms.

  14. PAPAIN-INDUCED CHANGES IN RABBIT CARTILAGE

    Science.gov (United States)

    Tsaltas, Theodore T.

    1958-01-01

    Some biochemical aspects of the collapse of the rabbit ears produced by the intravenous injection of papain have been studied. A marked depletion of chondromucoprotein (M.C.S.) and a reduction of the S35 content of cartilage matrix were found to coincide with the gross and histologic changes in the cartilage. At the same time there was a marked increase in the amount of S35 in the serum and an increase of S35 and glucuronic acid excreted in the urine. Alteration in the composition of the M.C.S. remaining in the cartilage of the papain-injected animals was detected. The findings indicate that the collapse of the rabbit ears is due to loss of chondromucoprotein from cartilage and reduction of chondroitin sulfate in the chondromucoprotein that remains. All these changes were reversed in recovery. PMID:13575681

  15. The minor collagens in articular cartilage

    DEFF Research Database (Denmark)

    Luo, Yunyun; Sinkeviciute, Dovile; He, Yi

    2017-01-01

    Articular cartilage is a connective tissue consisting of a specialized extracellular matrix (ECM) that dominates the bulk of its wet and dry weight. Type II collagen and aggrecan are the main ECM proteins in cartilage. However, little attention has been paid to less abundant molecular components......, especially minor collagens, including type IV, VI, IX, X, XI, XII, XIII, and XIV, etc. Although accounting for only a small fraction of the mature matrix, these minor collagens not only play essential structural roles in the mechanical properties, organization, and shape of articular cartilage, but also...... fulfil specific biological functions. Genetic studies of these minor collagens have revealed that they are associated with multiple connective tissue diseases, especially degenerative joint disease. The progressive destruction of cartilage involves the degradation of matrix constituents including...

  16. Cartilage Repair in Football (Soccer) Athletes

    Science.gov (United States)

    Bekkers, J.E.J.; de Windt, Th.S.; Brittberg, M.

    2012-01-01

    The prevalence of focal articular cartilage lesions among athletes is higher than in the general population. Treatment goals differ considerably between the professional and recreational athlete. High financial stakes and the short duration of a professional career influence the treatment selection for the professional athlete, while such parameters weigh differently in recreational sports. This article describes our investigation of the relation between sports and a high prevalence of focal cartilage lesions. In addition, we provide a critical review of the best available evidence for cartilage surgery and treatment selection, evaluate specific patient profiles for professional and recreational athletes, and propose a treatment algorithm for the treatment of focal cartilage lesions in football (soccer) players. PMID:26069606

  17. Asporin stably expressed in the surface layer of mandibular condylar cartilage and augmented in the deeper layer with age.

    Science.gov (United States)

    Miyamoto, Yutaka; Kanzaki, Hiroyuki; Wada, Satoshi; Tsuruoka, Sari; Itohiya, Kanako; Kumagai, Kenichi; Hamada, Yoshiki; Nakamura, Yoshiki

    2017-12-01

    Mandibular condylar cartilage (MCC) exhibits dual roles both articular cartilage and growth center. Of many growth factors, TGF-β has been implicated in the growth of articular cartilage including MCC. Recently, Asporin, decoy to TGF-β, was discovered and it blocks TGF-β signaling. Asporin is expressed in a variety of tissues including osteoarthritic articular cartilage, though there was no report of Asporin expression in MCC. In the present study, we investigated the temporal and spatial expression of Asporin in MCC. Gene expression profile of MCC and epiphyseal cartilage in tibia of 5 weeks old ICR mice were firstly compared with microarray analysis using the laser capture microdissected samples. Variance of gene expression was further confirmed by real-time RT-PCR and immunohistochemical staining at 1,3,10, and 20 weeks old. TGF-β and its signaling molecule, phosphorylated Smad-2/3 (p-Smad2/3), were also examined by immunohistochemical staining. Microarray analysis revealed that Asporin was highly expressed in MCC. Real-time RT-PCR analysis confirmed that the fibrous layer of MCC exhibited stable higher Asporin expression at any time points as compared to epiphyseal cartilage. This was also observed in immunohistochemical staining. Deeper layer in MCC augmented Asporin expression with age. Whereas, TGF-β was stably highly observed in the layer. The fibrous layer of MCC exhibited weak staining of p-Smad2/3, though the proliferating layer of MCC was strongly stained as compared to epiphyseal cartilage of tibia at early time point. Consistent with the increase of Asporin expression in the deeper layer of MCC, the intensity of p-Smad-2/3 staining was decreased with age. In conclusion, we discovered that Asporin was stably expressed at the fibrous layer of MCC, which makes it possible to manage both articular cartilage and growth center at the same time.

  18. Harnessing biomechanics to develop cartilage regeneration strategies.

    Science.gov (United States)

    Athanasiou, Kyriacos A; Responte, Donald J; Brown, Wendy E; Hu, Jerry C

    2015-02-01

    As this review was prepared specifically for the American Society of Mechanical Engineers H.R. Lissner Medal, it primarily discusses work toward cartilage regeneration performed in Dr. Kyriacos A. Athanasiou's laboratory over the past 25 years. The prevalence and severity of degeneration of articular cartilage, a tissue whose main function is largely biomechanical, have motivated the development of cartilage tissue engineering approaches informed by biomechanics. This article provides a review of important steps toward regeneration of articular cartilage with suitable biomechanical properties. As a first step, biomechanical and biochemical characterization studies at the tissue level were used to provide design criteria for engineering neotissues. Extending this work to the single cell and subcellular levels has helped to develop biochemical and mechanical stimuli for tissue engineering studies. This strong mechanobiological foundation guided studies on regenerating hyaline articular cartilage, the knee meniscus, and temporomandibular joint (TMJ) fibrocartilage. Initial tissue engineering efforts centered on developing biodegradable scaffolds for cartilage regeneration. After many years of studying scaffold-based cartilage engineering, scaffoldless approaches were developed to address deficiencies of scaffold-based systems, resulting in the self-assembling process. This process was further improved by employing exogenous stimuli, such as hydrostatic pressure, growth factors, and matrix-modifying and catabolic agents, both singly and in synergistic combination to enhance neocartilage functional properties. Due to the high cell needs for tissue engineering and the limited supply of native articular chondrocytes, costochondral cells are emerging as a suitable cell source. Looking forward, additional cell sources are investigated to render these technologies more translatable. For example, dermis isolated adult stem (DIAS) cells show potential as a source of

  19. A distinct regulatory region of the Bmp5 locus activates gene expression following adult bone fracture or soft tissue injury.

    Science.gov (United States)

    Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M

    2015-08-01

    Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Characterization of the cartilage DNA methylome in knee and hip osteoarthritis.

    Science.gov (United States)

    Rushton, Michael D; Reynard, Louise N; Barter, Matt J; Refaie, Ramsay; Rankin, Kenneth S; Young, David A; Loughlin, John

    2014-09-01

    The aim of this study was to characterize the genome-wide DNA methylation profile of chondrocytes from knee and hip cartilage obtained from patients with osteoarthritis (OA) and hip cartilage obtained from patients with femoral neck fracture, providing the first comparison of DNA methylation between OA and non-OA hip cartilage, and between OA hip and OA knee cartilage. The study was performed using the Illumina Infinium HumanMethylation450 BeadChip array, which allows the annotation of ∼480,000 CpG sites. Genome-wide methylation was assessed in chondrocyte DNA extracted from 23 hip OA patients, 73 knee OA patients, and 21 healthy hip control patients with femoral neck fracture. Analysis revealed that chondrocytes from the hip cartilage of OA patients and healthy controls have unique methylation profiles, with 5,322 differentially methylated loci (DMLs) identified between the 2 groups. In addition, a comparison between hip and knee OA chondrocytes revealed 5,547 DMLs between the 2 groups, including DMLs in several genes known to be involved in the pathogenesis of OA. Hip OA samples were found to cluster into 2 groups. A total of 15,239 DMLs were identified between the 2 clusters, with an enrichment of genes involved in inflammation and immunity. Similarly, we confirmed a previous report of knee OA samples that also clustered into 2 groups. We demonstrated that global DNA methylation using a high-density array can be a powerful tool in the characterization of OA at the molecular level. Identification of pathways enriched in DMLs between OA and OA-free cartilage highlight potential etiologic mechanisms that are involved in the initiation and/or progression of the disease and that could be therapeutically targeted. © 2014 The Authors. Arthritis & Rheumatology is published by Wiley Periodicals, Inc. on behalf of the American College of Rheumatology.

  1. Materials science: Like cartilage, but simpler

    DEFF Research Database (Denmark)

    Skov, Anne Ladegaard

    2015-01-01

    The properties of articular cartilage, which lines bones in joints, depend partlyon repulsion between components of the material. A new synthetic gel that mimics this feature has rare, direction-dependent properties.......The properties of articular cartilage, which lines bones in joints, depend partlyon repulsion between components of the material. A new synthetic gel that mimics this feature has rare, direction-dependent properties....

  2. Modern cartilage imaging of the ankle

    International Nuclear Information System (INIS)

    Weber, Marc-Andre; Wuennemann, Felix; Rehnitz, Christoph; Jungmann, Pia M.; Kuni, Benita

    2017-01-01

    Talar osteochondral lesions are an important risk factor for the development of talar osteoarthritis. Furthermore, osteochondral lesions might explain persistent ankle pain. Early diagnosis of accompanying chondral defects is important to establish the optimal therapy strategy and thereby delaying or preventing the onset of osteoarthritis. The purpose of this review is to explain modern cartilage imaging with emphasis of MR imaging as well as the discussion of more sophisticated imaging studies like CT-arthrography or functional MR imaging. Pubmed literature search concerning: osteochondral lesions, cartilage damage, ankle joint, talus, 2 D MR imaging, 3 D MR imaging, cartilage MR imaging, CT-arthrography, cartilage repair, microfracture, OATS, MACT. Dedicated MR imaging protocols to delineate talar cartilage and the appearance of acute and chronic osteochondral lesions were discussed. Recent developments of MR imaging, such as isotropic 3 D imaging that has a higher signal-to noise ratio when compared to 2 D imaging, and specialized imaging methods such as CT-arthrography as well as functional MR imaging were introduced. Several classifications schemes and imaging findings of osteochondral lesions that influence the conservative or surgical therapy strategy were discussed. MRI enables after surgery the non-invasive assessment of the repair tissue and the success of implantation. Key points: Modern MRI allows for highly resolved visualization of the articular cartilage of the ankle joint and of subchondral pathologies. Recent advances in MRI include 3 D isotropic ankle joint imaging, which deliver higher signal-to-noise ratios of the cartilage and less partial volume artifacts when compared with standard 2 D sequences. In case of osteochondral lesions MRI is beneficial for assessing the stability of the osteochondral fragment and for this discontinuity of the cartilage layer is an important factor. CT-arthrography can be used in case of contraindications of MRI and

  3. New Frontiers for Cartilage Repair and Protection

    OpenAIRE

    Zaslav, Kenneth; McAdams, Timothy; Scopp, Jason; Theosadakis, Jason; Mahajan, Vivek; Gobbi, Alberto

    2012-01-01

    Objective: Articular cartilage injury is common after athletic injury and remains a difficult treatment conundrum both for the surgeon and athlete. Although recent treatments for damage to articular cartilage have been successful in alleviating symptoms, more durable and complete, long-term articular surface restoration remains the unattained goal. In this article, we look at both new ways to prevent damage to articular surfaces as well as new techniques to recreate biomechanically sound and ...

  4. Cartilage proteoglycans inhibit fibronectin-mediated adhesion

    Science.gov (United States)

    Rich, A. M.; Pearlstein, E.; Weissmann, G.; Hoffstein, S. T.

    1981-09-01

    Normal tissues and organs show, on histological examination, a pattern of cellular and acellular zones that is characteristic and unique for each organ or tissue. This pattern is maintained in health but is sometimes destroyed by disease. For example, in mobile joints, the articular surfaces consist of relatively acellular hyaline cartilage, and the joint space is enclosed by a capsule of loose connective tissue with a lining of fibroblasts and macrophages. In the normal joint these cells are confined to the synovial lining and the articular surface remains acellular. In in vitro culture, macrophages and their precursor monocytes are very adhesive, and fibroblasts can migrate and overgrow surfaces such as collagen or plastic used for tissue culture. The fibroblasts adhere to collagen by means of fibronectin, which they synthesize and secrete1. Because the collagen of cartilage is capable of binding serum fibronectin2 and fibronectin is present in cartilage during its development3, these cells should, in theory, slowly migrate from the synovial lining to the articular surface. It is their absence from the articular cartilage in normal circumstances, and then presence in such pathological states as rheumatoid arthritis, that is striking. We therefore set out to determine whether a component of cartilage could prevent fibroblast adherence in a defined adhesion assay. As normal cartilage is composed of 50% proteoglycans and 50% collagen by dry weight4, we tested the possibility that the proteoglycans in cartilage inhibit fibroblast adhesion to collagen. We present here evidence that fibroblast spreading and adhesion to collagenous substrates is inhibited by cartilage proteoglycans.

  5. Body Weight Independently Affects Articular Cartilage Catabolism

    Directory of Open Access Journals (Sweden)

    W. Matt Denning, Jason G. Winward, Michael Becker Pardo, J. Ty Hopkins, Matthew K. Seeley

    2015-06-01

    Full Text Available Although obesity is associated with osteoarthritis, it is unclear whether body weight (BW independently affects articular cartilage catabolism (i.e., independent from physiological factors that also accompany obesity. The primary purpose of this study was to evaluate the independent effect of BW on articular cartilage catabolism associated with walking. A secondary purpose was to determine how decreased BW influenced cardiovascular response due to walking. Twelve able-bodied subjects walked for 30 minutes on a lower-body positive pressure treadmill during three sessions: control (unadjusted BW, +40%BW, and -40%BW. Serum cartilage oligomeric matrix protein (COMP was measured immediately before (baseline and after, and 15 and 30 minutes after the walk. Heart rate (HR and rate of perceived exertion (RPE were measured every three minutes during the walk. Relative to baseline, average serum COMP concentration was 13% and 5% greater immediately after and 15 minutes after the walk. Immediately after the walk, serum COMP concentration was 14% greater for the +40%BW session than for the -40%BW session. HR and RPE were greater for the +40%BW session than for the other two sessions, but did not differ between the control and -40%BW sessions. BW independently influences acute articular cartilage catabolism and cardiovascular response due to walking: as BW increases, so does acute articular cartilage catabolism and cardiovascular response. These results indicate that lower-body positive pressure walking may benefit certain individuals by reducing acute articular cartilage catabolism, due to walking, while maintaining cardiovascular response.

  6. Precision of hyaline cartilage thickness measurements

    Energy Technology Data Exchange (ETDEWEB)

    Jonsson, K.; Buckwalter, K.; Helvie, M.; Niklason, L.; Martel, W. (Univ. of Michigan Hospitals, Ann Arbor, MI (United States). Dept. of Radiology)

    1992-05-01

    Measurement of cartilage thickness in vivo is an important indicator of the status of a joint as the various degenerative and inflammatory arthritides directly affect the condition of the cartilage. In order to assess the precision of thickness measurements of hyaline articular cartilage, we undertook a pilot study using MR imaging, plain radiography, and ultrasonography (US). We measured the cartilage of the hip and knee joints in 10 persons (4 healthy volunteers and 6 patients). The joints in each patient were examined on two separate occasions using each modality. In the hips a swell as the knee joints, the most precise measuring method was plain film radiography. For radiographs of the knees obtained in the standing position, the coefficient of variation was 6.5%; in the hips this figure was 6.34%. US of the knees and MR imaging of the hips were the second best modalities in the measurement of cartilage thickness. In addition, MR imaging enabled the most complete visualization of the joint cartilage. (orig.).

  7. Aquaporin-1 and aquaporin-3 expressions in the temporo-mandibular joint condylar cartilage after an experimentally induced osteoarthritis.

    Science.gov (United States)

    Meng, Juan-hong; Ma, Xu-chen; Li, Zhi-min; Wu, Deng-cheng

    2007-12-20

    Over 70% of the total tissue weight in the cartilage matrix consists of water, and the early-stage osteoarthritic cartilage is characterized by swelling. Water transport in the cartilage matrix and across the membranes of chondrocytes may be important in normal and pathological conditions of cartilage. The purpose of this study was to identify aquaporin-1 (AQP1) and aquaporin-3 (AQP3) expressions in the mandibular condylar cartilage after experimentally induced osteoarthritis (OA) in rats. An experimental temporomandibular joint OA was induced by partial discectomy in rats. The pathological characteristics of the normal, early-stage, and late-stage osteoarthritic TMJ cartilages were verified by histological techniques. The AQP1 and AQP3 gene expressions in the normal and osteoarthritic cartilages were measured using quantitative real-time reverse-transcription PCR analysis. The cartilage sections were incubated in primary polyclonal antibodies to AQP3; immunofluorescent microscopy was used to examine the AQP3 expression shown by its protein level. The mRNA expression levels of AQP1 and AQP3, analyzed using quantitative PCR, revealed that AQP3 mRNA was highly up-regulated in the OA cartilage, which was considered significant. There was no notable difference in the expression of AQP1 mRNA between OA and normal controls. With the progressing of the OA, the localization of the AQP3 protein was quite different from that of the normal cartilage. Compared to the normal cartilage, the expressions of AQP3 protein were observed mainly in the proliferative zone and the upper mid-zone chondrocytes at the early-stage of OA, and were observed to appear frequently throughout the mid- and deep zone during the late-stage of OA. The high expression of AQP3 mRNA in the OA cartilage and the different localization of the AQP3 protein suggest that it may play a particular role in OA pathogenesis. Further study of AQP3 function may provide new insight into the understanding of the

  8. Comparative proteomic analysis of normal and collagen IX null mouse cartilage reveals altered extracellular matrix composition and novel components of the collagen IX interactome.

    Science.gov (United States)

    Brachvogel, Bent; Zaucke, Frank; Dave, Keyur; Norris, Emma L; Stermann, Jacek; Dayakli, Münire; Koch, Manuel; Gorman, Jeffrey J; Bateman, John F; Wilson, Richard

    2013-05-10

    Collagen IX is an integral cartilage extracellular matrix component important in skeletal development and joint function. Proteomic analysis and validation studies revealed novel alterations in collagen IX null cartilage. Matrilin-4, collagen XII, thrombospondin-4, fibronectin, βig-h3, and epiphycan are components of the in vivo collagen IX interactome. We applied a proteomics approach to advance our understanding of collagen IX ablation in cartilage. The cartilage extracellular matrix is essential for endochondral bone development and joint function. In addition to the major aggrecan/collagen II framework, the interacting complex of collagen IX, matrilin-3, and cartilage oligomeric matrix protein (COMP) is essential for cartilage matrix stability, as mutations in Col9a1, Col9a2, Col9a3, Comp, and Matn3 genes cause multiple epiphyseal dysplasia, in which patients develop early onset osteoarthritis. In mice, collagen IX ablation results in severely disturbed growth plate organization, hypocellular regions, and abnormal chondrocyte shape. This abnormal differentiation is likely to involve altered cell-matrix interactions but the mechanism is not known. To investigate the molecular basis of the collagen IX null phenotype we analyzed global differences in protein abundance between wild-type and knock-out femoral head cartilage by capillary HPLC tandem mass spectrometry. We identified 297 proteins in 3-day cartilage and 397 proteins in 21-day cartilage. Components that were differentially abundant between wild-type and collagen IX-deficient cartilage included 15 extracellular matrix proteins. Collagen IX ablation was associated with dramatically reduced COMP and matrilin-3, consistent with known interactions. Matrilin-1, matrilin-4, epiphycan, and thrombospondin-4 levels were reduced in collagen IX null cartilage, providing the first in vivo evidence for these proteins belonging to the collagen IX interactome. Thrombospondin-4 expression was reduced at the mRNA level

  9. Pathways of load-induced cartilage damage causing cartilage degeneration in the knee after meniscectomy

    NARCIS (Netherlands)

    Wilson, W.; Rietbergen, van B.; Donkelaar, van C.C.; Huiskes, R.

    2003-01-01

    Results of both clinical and animal studies show that meniscectomy often leads to osteoarthritic degenerative changes in articular cartilage. It is generally assumed that this process of cartilage degeneration is due to changes in mechanical loading after meniscectomy. It is, however, not known why

  10. Articular cartilage explant culture; an appropriate in vitro system to compare osteoarthritic and normal human cartilage

    NARCIS (Netherlands)

    Lafeber, F. P.; Vander Kraan, P. M.; van Roy, J. L.; Huber-Bruning, O.; Bijlsma, J. W.

    1993-01-01

    Proteoglycan metabolism of normal and histologically mild to moderate osteoarthritic cartilage explants were studied. Explants were obtained from the human knee of donors aged over 40 years. Proteoglycan content, synthesis and release were very similar in normal cartilage obtained from donors with

  11. Cartilage Repair Surgery: Outcome Evaluation by Using Noninvasive Cartilage Biomarkers Based on Quantitative MRI Techniques?

    Science.gov (United States)

    Jungmann, Pia M.; Baum, Thomas; Bauer, Jan S.; Karampinos, Dimitrios C.; Link, Thomas M.; Li, Xiaojuan; Trattnig, Siegfried; Rummeny, Ernst J.; Woertler, Klaus; Welsch, Goetz H.

    2014-01-01

    Background. New quantitative magnetic resonance imaging (MRI) techniques are increasingly applied as outcome measures after cartilage repair. Objective. To review the current literature on the use of quantitative MRI biomarkers for evaluation of cartilage repair at the knee and ankle. Methods. Using PubMed literature research, studies on biochemical, quantitative MR imaging of cartilage repair were identified and reviewed. Results. Quantitative MR biomarkers detect early degeneration of articular cartilage, mainly represented by an increasing water content, collagen disruption, and proteoglycan loss. Recently, feasibility of biochemical MR imaging of cartilage repair tissue and surrounding cartilage was demonstrated. Ultrastructural properties of the tissue after different repair procedures resulted in differences in imaging characteristics. T2 mapping, T1rho mapping, delayed gadolinium-enhanced MRI of cartilage (dGEMRIC), and diffusion weighted imaging (DWI) are applicable on most clinical 1.5 T and 3 T MR scanners. Currently, a standard of reference is difficult to define and knowledge is limited concerning correlation of clinical and MR findings. The lack of histological correlations complicates the identification of the exact tissue composition. Conclusions. A multimodal approach combining several quantitative MRI techniques in addition to morphological and clinical evaluation might be promising. Further investigations are required to demonstrate the potential for outcome evaluation after cartilage repair. PMID:24877139

  12. Free Diced Cartilage: A New Application of Diced Cartilage Grafts in Primary and Secondary Rhinoplasty.

    Science.gov (United States)

    Kreutzer, Christian; Hoehne, Julius; Gubisch, Wolfgang; Rezaeian, Farid; Haack, Sebastian

    2017-09-01

    Irregularities or deformities of the nasal dorsum after hump reduction account for a significant number of revision rhinoplasties. The authors therefore developed a technique of meticulously dicing and exactly placing free diced cartilage grafts, harvested from septum, rib, or ear cartilage. The cartilage paste is used for smoothening, augmentation, or camouflaging of the nasal dorsum in primary or revision rhinoplasties. A retrospective analysis of multisurgeon consecutive open approach rhinoplasties from January to December of 2014 was conducted at a single center. The authors compared the outcome of three different techniques to augment or cover the nasal dorsum after an observation period of 7 months. In group I, 325 patients with free diced cartilage grafts as the only onlay were included. In group II, consisting of 73 patients, the dorsal onlay was either fascia alone or in combination with free diced cartilage grafts. Forty-eight patients in group III received a dorsal augmentation with the classic diced cartilage in fascia technique. Four hundred forty-six patients undergoing primary and secondary rhinoplasties in which one of the above-mentioned diced cartilage techniques was used were included in the study. The authors found revision rates for dorsal irregularities within the 7-month postoperative observation period of 5.2, 8.2, and 25 percent for groups I, II, and III, respectively. The authors' findings strongly support their clinical experience that the free diced cartilage graft technique presents an effective and easily reproducible method for camouflage and augmentation in aesthetic and reconstructive rhinoplasty.

  13. In end stage osteoarthritis, cartilage tissue pentosidine levels are inversely related to parameters of cartilage damage

    NARCIS (Netherlands)

    Vos, P.A.J.M.; Mastbergen, S.C.; Huisman, A.M.; Boer, T.N.de; Groot, J.de; Polak, A.A.; Lafeber, F.P.J.G.

    2012-01-01

    Objectives: Age is the most prominent predisposition for development of osteoarthritis (OA). Age-related changes of articular cartilage are likely to play a role. Advanced glycation endproducts (AGEs) accumulate in cartilage matrix with increasing age and adversely affect the biomechanical

  14. Osteoarthritic human cartilage is more sensitive to transforming growth factor beta than is normal cartilage

    NARCIS (Netherlands)

    Lafeber, F. P.; Vander Kraan, P. M.; Huber-Bruning, O.; Vanden Berg, W. B.; Bijlsma, J. W.

    1993-01-01

    Osteoarthritis is a degenerative joint disease, characterized by the destruction of the articular cartilage. One of the first changes in the osteoarthritic articular cartilage is a reduction in proteoglycan content. In this study we demonstrate that transforming growth factor beta (TGF beta), a

  15. Cartilage Repair Surgery: Outcome Evaluation by Using Noninvasive Cartilage Biomarkers Based on Quantitative MRI Techniques?

    Directory of Open Access Journals (Sweden)

    Pia M. Jungmann

    2014-01-01

    Full Text Available Background. New quantitative magnetic resonance imaging (MRI techniques are increasingly applied as outcome measures after cartilage repair. Objective. To review the current literature on the use of quantitative MRI biomarkers for evaluation of cartilage repair at the knee and ankle. Methods. Using PubMed literature research, studies on biochemical, quantitative MR imaging of cartilage repair were identified and reviewed. Results. Quantitative MR biomarkers detect early degeneration of articular cartilage, mainly represented by an increasing water content, collagen disruption, and proteoglycan loss. Recently, feasibility of biochemical MR imaging of cartilage repair tissue and surrounding cartilage was demonstrated. Ultrastructural properties of the tissue after different repair procedures resulted in differences in imaging characteristics. T2 mapping, T1rho mapping, delayed gadolinium-enhanced MRI of cartilage (dGEMRIC, and diffusion weighted imaging (DWI are applicable on most clinical 1.5 T and 3 T MR scanners. Currently, a standard of reference is difficult to define and knowledge is limited concerning correlation of clinical and MR findings. The lack of histological correlations complicates the identification of the exact tissue composition. Conclusions. A multimodal approach combining several quantitative MRI techniques in addition to morphological and clinical evaluation might be promising. Further investigations are required to demonstrate the potential for outcome evaluation after cartilage repair.

  16. The cranial cartilages of teleosts and their classification.

    OpenAIRE

    Benjamin, M

    1990-01-01

    The structure and distribution of cartilages has been studied in 45 species from 24 families. The resulting data have been used as a basis for establishing a new classification. A cartilage is regarded as 'cell-rich' if its cells or their lacunae occupy more than half of the tissue volume. Five classes of cell-rich cartilage are recognised (a) hyaline-cell cartilage (common in the lips of bottom-dwelling cyprinids) and its subtypes fibro/hyaline-cell cartilage, elastic/hyaline-cell cartilage ...

  17. CARTILAGE CONSTRUCTS ENGINEERED FROM CHONDROCYTES OVEREXPRESSING IGF-I IMPROVE THE REPAIR OF OSTEOCHONDRAL DEFECTS IN A RABBIT MODEL

    Science.gov (United States)

    Madry, Henning; Kaul, Gunter; Zurakowski, David; Vunjak-Novakovic, Gordana; Cucchiarini, Magali

    2015-01-01

    Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes over expressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-over expressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects. PMID:23588785

  18. Cartilage constructs engineered from chondrocytes overexpressing IGF-I improve the repair of osteochondral defects in a rabbit model

    Directory of Open Access Journals (Sweden)

    H Madry

    2013-04-01

    Full Text Available Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes overexpressing a human insulin-like growth factor I (IGF-I gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-overexpressing chondrocytes markedly improved osteochondral repair compared with control (lacZ constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects.

  19. Tamoxifen-inducible gene deletion reveals a distinct cell type associated with trabecular bone, and direct regulation of PTHrP expression and chondrocyte morphology by Ihh in growth region cartilage.

    Science.gov (United States)

    Hilton, Matthew J; Tu, Xiaolin; Long, Fanxin

    2007-08-01

    Indian hedgehog (Ihh) controls multiple aspects of endochondral skeletal development by signaling to both chondrocytes and perichondrial cells. Previous efforts to delineate direct effects of Ihh on chondrocytes by Col2-Cre-mediated ablation of Smoothened (Smo, encoding a transmembrane protein indispensable for Ihh signaling) has been only partially successful, due to the inability to discriminate between chondrocytes and perichondrial cells. Here we report a transgenic line (Col2-Cre) expressing under the control of the Colalpha1(II) promoter an inert form of Cre that is activatable by exogenous tamoxifen (TM); TM administration at proper times during embryogenesis induced Cre activity in chondrocytes but not in the perichondrium. By using this mouse line, we deleted Smo within subsets of chondrocytes without affecting the perichondrium and found that Smo removal led to localized disruption of the expression of parathyroid hormone-related protein (PTHrP) and the morphology of chondrocytes. Unexpectedly, TM invariably induced Cre activity in a subset of cells associated with the trabecular bone surface of long bones. These cells, when genetically marked and cultured in vitro, were capable of producing bone nodules. Expression of the Col2-Cre transgene in these cells likely reflected the endogenous Colalpha1(II) promoter activity as similar cells were found to express the IIA isoform of Colalpha1(II) mRNA endogenously. In summary, the present study has not only provided evidence that Ihh signaling directly controls PTHrP expression and chondrocyte morphology in the growth region cartilage, but has also uncovered a distinct cell type associated with the trabecular bone that appears to possess osteogenic potential.

  20. Mutations in THAP11 cause an inborn error of cobalamin metabolism and developmental abnormalities.

    Science.gov (United States)

    Quintana, Anita M; Yu, Hung-Chun; Brebner, Alison; Pupavac, Mihaela; Geiger, Elizabeth A; Watson, Abigail; Castro, Victoria L; Cheung, Warren; Chen, Shu-Huang; Watkins, David; Pastinen, Tomi; Skovby, Flemming; Appel, Bruce; Rosenblatt, David S; Shaikh, Tamim H

    2017-08-01

    CblX (MIM309541) is an X-linked recessive disorder characterized by defects in cobalamin (vitamin B12) metabolism and other developmental defects. Mutations in HCFC1, a transcriptional co-regulator which interacts with multiple transcription factors, have been associated with cblX. HCFC1 regulates cobalamin metabolism via the regulation of MMACHC expression through its interaction with THAP11, a THAP domain-containing transcription factor. The HCFC1/THAP11 complex potentially regulates genes involved in diverse cellular functions including cell cycle, proliferation, and transcription. Thus, it is likely that mutation of THAP11 also results in biochemical and other phenotypes similar to those observed in patients with cblX. We report a patient who presented with clinical and biochemical phenotypic features that overlap cblX, but who does not have any mutations in either MMACHC or HCFC1. We sequenced THAP11 by Sanger sequencing and discovered a potentially pathogenic, homozygous variant, c.240C > G (p.Phe80Leu). Functional analysis in the developing zebrafish embryo demonstrated that both THAP11 and HCFC1 regulate the proliferation and differentiation of neural precursors, suggesting important roles in normal brain development. The loss of THAP11 in zebrafish embryos results in craniofacial abnormalities including the complete loss of Meckel's cartilage, the ceratohyal, and all of the ceratobranchial cartilages. These data are consistent with our previous work that demonstrated a role for HCFC1 in vertebrate craniofacial development. High throughput RNA-sequencing analysis reveals several overlapping gene targets of HCFC1 and THAP11. Thus, both HCFC1 and THAP11 play important roles in the regulation of cobalamin metabolism as well as other pathways involved in early vertebrate development. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Regeneration of articular cartilage by adipose tissue derived mesenchymal stem cells: perspectives from stem cell biology and molecular medicine.

    Science.gov (United States)

    Wu, Ling; Cai, Xiaoxiao; Zhang, Shu; Karperien, Marcel; Lin, Yunfeng

    2013-05-01

    Adipose-derived stem cells (ASCs) have been discovered for more than a decade. Due to the large numbers of cells that can be harvested with relatively little donor morbidity, they are considered to be an attractive alternative to bone marrow derived mesenchymal stem cells. Consequently, isolation and differentiation of ASCs draw great attention in the research of tissue engineering and regenerative medicine. Cartilage defects cause big therapeutic problems because of their low self-repair capacity. Application of ASCs in cartilage regeneration gives hope to treat cartilage defects with autologous stem cells. In recent years, a lot of studies have been performed to test the possibility of using ASCs to re-construct damaged cartilage tissue. In this article, we have reviewed the most up-to-date articles utilizing ASCs for cartilage regeneration in basic and translational research. Our topic covers differentiation of adipose tissue derived mesenchymal stem cells into chondrocytes, increased cartilage formation by co-culture of ASCs with chondrocytes and enhancing chondrogenic differentiation of ASCs by gene manipulation. Copyright © 2012 Wiley Periodicals, Inc.

  2. Development of a Spring-Loaded Impact Device to Deliver Injurious Mechanical Impacts to the Articular Cartilage Surface

    Science.gov (United States)

    Alexander, Peter G.; Song, Yingjie; Taboas, Juan M.; Chen, Faye H.; Melvin, Gary M.; Manner, Paul A.

    2013-01-01

    Objective: Traumatic impacts on the articular joint surface in vitro are known to lead to degeneration of the cartilage. The main objective of this study was to develop a spring-loaded impact device that can be used to deliver traumatic impacts of consistent magnitude and rate and to find whether impacts cause catabolic activities in articular cartilage consistent with other previously reported impact models and correlated with the development of osteoarthritic lesions. In developing the spring-loaded impactor, the operating hypothesis is that a single supraphysiologic impact to articular cartilage in vitro can affect cartilage integrity, cell viability, sulfated glycosaminoglycan and inflammatory mediator release in a dose-dependent manner. Design: Impacts of increasing force are delivered to adult bovine articular cartilage explants in confined compression. Impact parameters are correlated with tissue damage, cell viability, matrix and inflammatory mediator release, and gene expression 24 hours postimpact. Results: Nitric oxide release is first detected after 7.7 MPa impacts, whereas cell death, glycosaminoglycan release, and prostaglandin E2 release are first detected at 17 MPa. Catabolic markers increase linearly to maximal levels after ≥36 MPa impacts. Conclusions: A single supraphysiologic impact negatively affects cartilage integrity, cell viability, and GAG release in a dose-dependent manner. Our findings showed that 7 to 17 MPa impacts can induce cell death and catabolism without compromising the articular surface, whereas a 17 MPa impact is sufficient to induce increases in most common catabolic markers of osteoarthritic degeneration. PMID:26069650

  3. Aggrecan structure in amphibian cartilage

    Directory of Open Access Journals (Sweden)

    Covizi D.Z.

    2000-01-01

    Full Text Available The structure of the large proteoglycan present in the bullfrog epiphyseal cartilage was studied by immunochemical and biochemical methods. The isolated monomer showed a polydisperse behavior on Sepharose CL2B, with a peak at Kav = 0.14. Chondroitin sulfate chains were identified by HPLC analysis of the products formed by chondroitinase digestion and mercuric acetate treatment. These chains have approximately 38 disaccharides, a Di45:Di68 ratio of 1.6 and GalNAc4S + GalNAc4,6S are the main non-reducing terminals. Keratan sulfate was identified by the use of two monoclonal antibodies in Western blots after chondroitinase ABC treatment. A keratan sulfate-rich region (~110 kDa was isolated by sequential treatment with chondroitinase ABC and proteases. We also employed antibodies in Western blotting experiments and showed that the full length deglycosylated core protein is about 300 kDa after SDS-PAGE. Domain-specific antibodies revealed the presence of immunoreactive sites corresponding to G1/G2 and G3 globular domains and the characterization of this large proteoglycan as aggrecan. The results indicate the high conservation of the aggrecan domain structure in this lower vertebrate.

  4. Release of transgenic progranulin from a living hyaline cartilage graft model: An in vitro evaluation on anti-inflammation.

    Science.gov (United States)

    Lau, Ting Ting; Zhang, Feng; Tang, Wei; Wang, Dong-An

    2016-12-01

    Osteoarthritis (OA) is a prevalent condition that compromises and even jeopardizes the life quality of millions of people. Common symptoms in OA includes joint stiffness and soreness, and they are often associated with inflammations to various extend. Due to the avascular and aneural nature of articular hyaline cartilage, it has limited self-repair capabilities; especially under inflammatory conditions, damages inflicted on cartilage are often irreversible. Hence, treatment approaches focus on anti-inflammation or articular cartilage replacement. In this study, an engineered, dual-functional living hyaline cartilage graft (LhCG), capable of releasing transgenic anti-inflammatory cytokine-progranulin (PGRN) is developed and envisioned to simultaneously fulfil both requirements. The therapeutic functionality of PGRN releasing LhCG is evaluated by co-culturing the constructs with tumor necrosis factor-alpha (TNFα) secreting THP-1 cells to simulate the inflammatory condition in arthritis. Non-transgenic LhCG constructs and non-coculture sample groups were set up as controls. Gene expression and ECM composition changes across samples were assessed to understand the effects of PGRN as well as inflammatory environment on the cartilage graft. Collectively, the results in this study suggest that in situ release of transgenic recombinant PGRN protects LhCG from induced inflammation in vitro; contrastively, in the absence of PGRN, cartilage grafts are at risk of being degraded and mineralized under exposure to TNFα signaling. This shows that cartilage graft itself can be at risk of degradation or calcification when implanted in arthritic microenvironment. Hence, the inflammatory microenvironment has to be considered in cartilage replacement therapy to increase chances of successful joint mobility restoration. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2968-2977, 2016. © 2016 Wiley Periodicals, Inc.

  5. RNA Microarray Analysis of Macroscopically Normal Articular Cartilage from Knees Undergoing Partial Medial Meniscectomy: Potential Prediction of the Risk for Developing Osteoarthritis.

    Directory of Open Access Journals (Sweden)

    Muhammad Farooq Rai

    Full Text Available (i To provide baseline knowledge of gene expression in macroscopically normal articular cartilage, (ii to test the hypothesis that age, body-mass-index (BMI, and sex are associated with cartilage RNA transcriptome, and (iii to predict individuals at potential risk for developing "pre-osteoarthritis" (OA based on screening of genetic risk-alleles associated with OA and gene transcripts differentially expressed between normal and OA cartilage.Healthy-appearing cartilage was obtained from the medial femoral notch of 12 knees with a meniscus tear undergoing arthroscopic partial meniscectomy. Cartilage had no radiographic, magnetic-resonance-imaging or arthroscopic evidence for degeneration. RNA was subjected to Affymetrix microarrays followed by validation of selected transcripts by microfluidic digital polymerase-chain-reaction. The underlying biological processes were explored computationally. Transcriptome-wide gene expression was probed for association with known OA genetic risk-alleles assembled from published literature and for comparison with gene transcripts differentially expressed between healthy and OA cartilage from other studies.We generated a list of 27,641 gene transcripts in healthy cartilage. Several gene transcripts representing numerous biological processes were correlated with age and BMI and differentially expressed by sex. Based on disease-specific Ingenuity Pathways Analysis, gene transcripts associated with aging were enriched for bone/cartilage disease while the gene expression profile associated with BMI was enriched for growth-plate calcification and OA. When segregated by genetic risk-alleles, two clusters of study patients emerged, one cluster containing transcripts predicted by risk studies. When segregated by OA-associated gene transcripts, three clusters of study patients emerged, one of which is remarkably similar to gene expression pattern in OA.Our study provides a list of gene transcripts in healthy

  6. Rho GTPase protein Cdc42 is critical for postnatal cartilage development

    International Nuclear Information System (INIS)

    Nagahama, Ryo; Yamada, Atsushi; Tanaka, Junichi; Aizawa, Ryo; Suzuki, Dai; Kassai, Hidetoshi; Yamamoto, Matsuo; Mishima, Kenji; Aiba, Atsu; Maki, Koutaro; Kamijo, Ryutaro

    2016-01-01

    Cdc42, a small Rho GTPase family member, has been shown to regulate multiple cellular functions in vitro, including actin cytoskeletal reorganization, cell migration, proliferation, and gene expression. However, its tissue-specific roles in vivo remain largely unknown, especially in postnatal cartilage development, as cartilage-specific Cdc42 inactivated mice die within a few days after birth. In this study, we investigated the physiological functions of Cdc42 during cartilage development after birth using tamoxifen-induced cartilage-specific inactivated Cdc42 conditional knockout (Cdc42 "f"l"/"f"l; Col2-CreERT) mice, which were generated by crossing Cdc42 flox mice (Cdc42 "f"l"/"f"l) with tamoxifen-induced type II collagen (Col2) Cre transgenic mice using a Cre/loxP system. The gross morphology of the Cdc42 cKO mice was shorter limbs and body, as well as reduced body weight as compared with the controls. In addition, severe defects were found in growth plate chondrocytes of the long bones, characterized by a shorter proliferating zone (PZ), wider hypertrophic zone (HZ), and loss of columnar organization of proliferating chondrocytes, resulting in delayed endochondral bone formation associated with abnormal bone growth. Our findings demonstrate the importance of Cdc42 for cartilage development during both embryonic and postnatal stages. - Highlights: • Tamoxifen-induced cartilage specific inactivated Cdc42 mutant mice were generated. • Cdc42 mutant mice were shorter limbs and body. • Severe defects were found in growth plate chondrocytes.

  7. Biomimetically Reinforced Polyvinyl Alcohol-Based Hybrid Scaffolds for Cartilage Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Hwan D. Kim

    2017-11-01

    Full Text Available Articular cartilage has a very limited regeneration capacity. Therefore, injury or degeneration of articular cartilage results in an inferior mechanical stability, load-bearing capacity, and lubrication capability. Here, we developed a biomimetic scaffold consisting of macroporous polyvinyl alcohol (PVA sponges as a platform material for the incorporation of cell-embedded photocrosslinkable poly(ethylene glycol diacrylate (PEGDA, PEGDA-methacrylated chondroitin sulfate (PEGDA-MeCS; PCS, or PEGDA-methacrylated hyaluronic acid (PEGDA-MeHA; PHA within its pores to improve in vitro chondrocyte functions and subsequent in vivo ectopic cartilage tissue formation. Our findings demonstrated that chondrocytes encapsulated in PCS or PHA and loaded into macroporous PVA hybrid scaffolds maintained their physiological phenotypes during in vitro culture, as shown by the upregulation of various chondrogenic genes. Further, the cell-secreted extracellular matrix (ECM improved the mechanical properties of the PVA-PCS and PVA-PHA hybrid scaffolds by 83.30% and 73.76%, respectively, compared to their acellular counterparts. After subcutaneous transplantation in vivo, chondrocytes on both PVA-PCS and PVA-PHA hybrid scaffolds significantly promoted ectopic cartilage tissue formation, which was confirmed by detecting cells positively stained with Safranin-O and for type II collagen. Consequently, the mechanical properties of the hybrid scaffolds were biomimetically reinforced by 80.53% and 210.74%, respectively, compared to their acellular counterparts. By enabling the recapitulation of biomimetically relevant structural and functional properties of articular cartilage and the regulation of in vivo mechanical reinforcement mediated by cell–matrix interactions, this biomimetic material offers an opportunity to control the desired mechanical properties of cell-laden scaffolds for cartilage tissue regeneration.

  8. Rho GTPase protein Cdc42 is critical for postnatal cartilage development

    Energy Technology Data Exchange (ETDEWEB)

    Nagahama, Ryo [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan); Department of Orthodontics, School of Dentistry, Showa University, Tokyo (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan); Tanaka, Junichi [Department of Oral Diagnostic Sciences, School of Dentistry, Showa University, Tokyo (Japan); Aizawa, Ryo [Department of Periodontology, School of Dentistry, Showa University, Tokyo (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan); Kassai, Hidetoshi [Laboratory of Animal Resources, Center for Disease Biology and Integrative Medicine, Faculty of Medicine, The University of Tokyo, Tokyo (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, Tokyo (Japan); Mishima, Kenji [Department of Oral Diagnostic Sciences, School of Dentistry, Showa University, Tokyo (Japan); Aiba, Atsu [Laboratory of Animal Resources, Center for Disease Biology and Integrative Medicine, Faculty of Medicine, The University of Tokyo, Tokyo (Japan); Maki, Koutaro [Department of Orthodontics, School of Dentistry, Showa University, Tokyo (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan)

    2016-02-19

    Cdc42, a small Rho GTPase family member, has been shown to regulate multiple cellular functions in vitro, including actin cytoskeletal reorganization, cell migration, proliferation, and gene expression. However, its tissue-specific roles in vivo remain largely unknown, especially in postnatal cartilage development, as cartilage-specific Cdc42 inactivated mice die within a few days after birth. In this study, we investigated the physiological functions of Cdc42 during cartilage development after birth using tamoxifen-induced cartilage-specific inactivated Cdc42 conditional knockout (Cdc42 {sup fl/fl}; Col2-CreERT) mice, which were generated by crossing Cdc42 flox mice (Cdc42 {sup fl/fl}) with tamoxifen-induced type II collagen (Col2) Cre transgenic mice using a Cre/loxP system. The gross morphology of the Cdc42 cKO mice was shorter limbs and body, as well as reduced body weight as compared with the controls. In addition, severe defects were found in growth plate chondrocytes of the long bones, characterized by a shorter proliferating zone (PZ), wider hypertrophic zone (HZ), and loss of columnar organization of proliferating chondrocytes, resulting in delayed endochondral bone formation associated with abnormal bone growth. Our findings demonstrate the importance of Cdc42 for cartilage development during both embryonic and postnatal stages. - Highlights: • Tamoxifen-induced cartilage specific inactivated Cdc42 mutant mice were generated. • Cdc42 mutant mice were shorter limbs and body. • Severe defects were found in growth plate chondrocytes.

  9. Mycobacterial antigens stimulate rheumatoid mononuclear cells to cartilage proteoglycan depletion

    NARCIS (Netherlands)

    Wilbrink, B.; Bijlsma, J. W.; Huber-Bruning, O.; van Roy, J. L.; den Otter, W.; van Eden, W.

    1990-01-01

    In a coculture with porcine articular cartilage explants unstimulated blood mononuclear cells (BMC) from patients with rheumatoid arthritis (RA), but not from healthy controls, induced proteoglycan depletion of dead cartilage. Specific stimulation of the RA BMC with Mycobacterium tuberculosis (MT),

  10. Can Glucosamine Supplements Protect My Knee Cartilage from Osteoarthritis?

    Science.gov (United States)

    ... cartilage in osteoarthritis? Can glucosamine supplements protect my knee cartilage from osteoarthritis? Answers from Brent A. Bauer, M.D. Study results on this question have been mixed, with some suggesting possible ...

  11. Repair of osteochondral defects in rabbits with ectopically produced cartilage

    NARCIS (Netherlands)

    Emans, PJ; Hulsbosch, M; Wetzels, GMR; Bulstra, SK; Kuijer, R

    2005-01-01

    Cartilage has poor regenerative capacity. Donor site morbidity and interference with joint homeostasis should be considered when applying the autologous chondrocyte transplantation technique. The use of ectopically produced cartilage, derived from periosteum, might be a novel method to heal

  12. Properties of Cartilage on Micro- and Nanolevel

    Directory of Open Access Journals (Sweden)

    Sergei A. Chizhik

    2010-01-01

    Full Text Available Results of investigation of the elastic modulus for cartilage tissue using a technique of micro- and nanoindentation performed with help of an atomic force microscope are presented. SEM and AFM methods were applied to visualize a topography of surface layers of the entire cartilage and as well as its slices and thus to reveal features of the collagen fibers orientation. The technique used for a quantitative evaluation of the elastic modulus under compression against a ball microindenter (curvature radius - 350 micron and a nanoindenter (30 nm is described. It was shown that the cartilage behavior is highly stabile under the load if the entire composite structure of cartilage tissue is engaged into the deformation process. Tribological characteristics were investigated using the ball indenter oscillated by a tuning fork. Dependence of the friction coefficient from applied loads was obtained that revealed strong influence of an interstitial fluid on friction properties. Friction coefficient of a rat cartilage tissue as 0.08 was obtained using a developed plant prototype for tribological measurements based on the AFM construction.

  13. Articular cartilage: from formation to tissue engineering.

    Science.gov (United States)

    Camarero-Espinosa, Sandra; Rothen-Rutishauser, Barbara; Foster, E Johan; Weder, Christoph

    2016-05-26

    Hyaline cartilage is the nonlinear, inhomogeneous, anisotropic, poro-viscoelastic connective tissue that serves as friction-reducing and load-bearing cushion in synovial joints and is vital for mammalian skeletal movements. Due to its avascular nature, low cell density, low proliferative activity and the tendency of chondrocytes to de-differentiate, cartilage cannot regenerate after injury, wear and tear, or degeneration through common diseases such as osteoarthritis. Therefore severe damage usually requires surgical intervention. Current clinical strategies to generate new tissue include debridement, microfracture, autologous chondrocyte transplantation, and mosaicplasty. While articular cartilage was predicted to be one of the first tissues to be successfully engineered, it proved to be challenging to reproduce the complex architecture and biomechanical properties of the native tissue. Despite significant research efforts, only a limited number of studies have evolved up to the clinical trial stage. This review article summarizes the current state of cartilage tissue engineering in the context of relevant biological aspects, such as the formation and growth of hyaline cartilage, its composition, structure and biomechanical properties. Special attention is given to materials development, scaffold designs, fabrication methods, and template-cell interactions, which are of great importance to the structure and functionality of the engineered tissue.

  14. Magneto-therapy of human joint cartilage.

    Science.gov (United States)

    Wierzcholski, Krzysztof; Miszczak, Andrzej

    2017-01-01

    The topic of the present paper concerns the human joint cartilage therapy performed by the magnetic induction field. There is proved the thesis that the applied magnetic field for concrete cartilage illness should depend on the proper relative and concrete values of applied magnetic induction, intensity as well the time of treatment duration. Additionally, very important are frequencies and amplitudes of magnetic field as well as magnetic permeability of the synovial fluid. The research methods used in this paper include: magnetic induction field produced by a new Polish and German magneto electronic devices for the therapy of human joint cartilage diseases, stationary and movable magnetic applicators, magnetic bandage, ferrofluid injections, author's experience gained in Germany research institutes and practical results after measurements and information from patients. The results of this paper concern concrete parameters of time dependent electro-magnetic field administration during the joint cartilage therapy duration and additionally concern the corollaries which are implied from reading values gained on the magnetic induction devices. The main conclusions obtained in this paper are as follows: Time dependent magnetic induction field increases the dynamic viscosity of movable synovial fluid and decreases symptoms of cartilage illness for concrete intensity of magnetic field and concrete field line architecture. The ferrofluid therapy and phospholipids bilayer simultaneously with the administrated external electromagnetic field, increases the dynamic viscosity of movable synovial fluid.

  15. Preparation and characterization of a decellularized cartilage scaffold for ear cartilage reconstruction

    International Nuclear Information System (INIS)

    Utomo, Lizette; Pleumeekers, Mieke M; Van Osch, Gerjo J V M; Nimeskern, Luc; Stok, Kathryn S; Nürnberger, Sylvia; Hildner, Florian

    2015-01-01

    Scaffolds are widely used to reconstruct cartilage. Yet, the fabrication of a scaffold with a highly organized microenvironment that closely resembles native cartilage remains a major challenge. Scaffolds derived from acellular extracellular matrices are able to provide such a microenvironment. Currently, no report specifically on decellularization of full thickness ear cartilage has been published. In this study, decellularized ear cartilage scaffolds were prepared and extensively characterized. Cartilage decellularization was optimized to remove cells and cell remnants from elastic cartilage. Following removal of nuclear material, the obtained scaffolds retained their native collagen and elastin contents as well as their architecture and shape. High magnification scanning electron microscopy showed no obvious difference in matrix density after decellularization. However, glycosaminoglycan content was significantly reduced, resulting in a loss of viscoelastic properties. Additionally, in contact with the scaffolds, human bone-marrow-derived mesenchymal stem cells remained viable and are able to differentiate toward the chondrogenic lineage when cultured in vitro. These results, including the ability to decellularize whole human ears, highlight the clinical potential of decellularization as an improved cartilage reconstruction strategy. (paper)

  16. Cartilage Integration: Evaluation of the reasons for failure of integration during cartilage repair. A review

    Directory of Open Access Journals (Sweden)

    IM Khan

    2008-09-01

    Full Text Available Articular cartilage is a challenging tissue to reconstruct or replace principally because of its avascular nature; large chondral lesions in the tissue do not spontaneously heal. Where lesions do penetrate the bony subchondral plate, formation of hematomas and the migration of mesenchymal stem cells provide an inferior and transient fibrocartilagenous replacement for hyaline cartilage. To circumvent the poor intrinsic reparative response of articular cartilage several surgical techniques based on tissue transplantation have emerged. One characteristic shared by intrinsic reparative processes and the new surgical therapies is an apparent lack of lateral integration of repair or graft tissue with the host cartilage that can lead to poor prognosis. Many factors have been cited as impeding cartilage:cartilage integration including; chondrocyte cell death, chondrocyte dedifferentiation, the nature of the collagenous and proteoglycan networks that constitute the extracellular matrix, the type of biomaterial scaffold employed in repair and the origin of the cells used to repopulate the defect or lesion. This review addresses the principal intrinsic and extrinsic factors that impede integration and describe how manipulation of these factors using a host of strategies can positively influence cartilage integration.

  17. Drosophila mutants of the autism candidate gene neurobeachin (rugose) exhibit neuro-developmental disorders, aberrant synaptic properties, altered locomotion, impaired adult social behavior and activity patterns

    OpenAIRE

    Wise, Alexandra; Tenezaca, Luis; Fernandez, Robert W.; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F.; Venkatesh, Tadmiri

    2015-01-01

    Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions and hyperactivity. ASD exhibits a strong genetic component with underlying multi-gene interactions. Candidate gene studies have shown that the neurobeachin gene is disrupted in human patients with idiopathic autism (Castermans et al., 2003). The gene for neurobeachin (NBEA) spans the common fragile site FRA 13A ...

  18. Ethanol disrupts chondrification of the neurocranial cartilages in medaka embryos without affecting aldehyde dehydrogenase 1A2 (Aldh1A2) promoter methylation

    Science.gov (United States)

    Hu, Yuhui; Willett, Kristine L.; Khan, Ikhlas A.; Scheffler, Brian E.; Dasmahapatra, Asok K.

    2009-01-01

    Medaka (Oryzias latipes) embryos at different developmental stages were exposed to ethanol for 48 h, then allowed to hatch. Teratogenic effects were evaluated in hatchlings after examining chondrocranial cartilage deformities. Ethanol disrupted cartilage development in medaka in a dose and developmental stage-specific manner. Compared to controls, the linear length of the neurocranium and other cartilages were reduced in ethanol-treated groups. Moreover, the chondrification in cartilages, specifically trabeculae and polar cartilages, were inhibited by ethanol. To understand the mechanism of ethanol teratogenesis, NAD+: NADH status during embryogenesis and the methylation pattern of Aldh1A2 promoter in whole embryos and adult tissues (brain, eye, heart and liver) were analyzed. Embryos 6 dpf had higher NAD+ than embryos 0 or 2 dpf. Ethanol (200 or 400 mM) was able to reduce NAD+ content in 2 and 6 dpf embryos. However, in both cases reductions were not significantly different from the controls. Moreover, no significant difference in either NADH content or in NAD+: NADH status of the ethanol-treated embryos, with regard to controls, was observed. The promoter of Aldh1A2 contains 31 CpG dinucleotides (-705 to +154, ATG = +1); none of which were methylated. Compared to controls, embryonic ethanol exposure (100 and 400 mM) was unable to alter Aldh1A2 promoter methylation in embryos or in the tissues of adults (breeding) developmentally exposed to ethanol (300 mM, 48 hpf). From these data we conclude that ethanol teratogenesis in medaka does not induce alteration in the methylation pattern of Aldh1A2 promoter, but does change cartilage development. PMID:19651241

  19. MRI evaluation of acute articular cartilage injury of knee

    International Nuclear Information System (INIS)

    Zhang Jun; Wu Zhenhua; Fan Guoguang; Pan Shinong; Guo Qiyong

    2003-01-01

    Objective: To study the MRI manifestation of acute articular cartilage injury of knee for evaluating the extension and degree of the injury and guiding treatment. Methods: MRI of 34 patients with acute articular cartilage injury of knee within one day to fifteen days confirmed by arthroscopy and arthrotomy was reviewed and analyzed, with emphasis on articular cartilage and subchondral lesion. And every manifestation on MRI and that of arthroscopy and operation was compared. Results: The articular cartilage injury was diagnosed on MRI in 29 of 34 cases. Cartilage signal changes were found only in 4. The changes of cartilage shape were variable. Thinning of focal cartilage was showed in 3, osteochondral impaction in 3, creases of cartilage in 3, disrupted cartilage with fissuring in 13, cracks cartilage in 2, and cracks cartilage with displaced fragment in 1. Bone bruise and occult fracture were found only on MRI. Conclusion: The assessment of MRI and arthroscopy in acute articular cartilage injury are consistent. Combined with arthroscopy, MRI can succeed in assessing the extension and degree of acute articular injury and allowing treatment planning

  20. Spectrocolorimetric evaluation of repaired articular cartilage after a microfracture

    Directory of Open Access Journals (Sweden)

    Dohi Yoshihiro

    2008-09-01

    Full Text Available Abstract Background In clinical practice, surgeons differentiate color changes in repaired cartilage compared with surrounding intact cartilage, but cannot quantify these color changes. Objective assessments are required. A spectrocolorimeter was used to evaluate whether intact and repaired cartilage can be quantified. Findings We investigated the use of a spectrocolorimeter and the application of two color models (L* a* b* colorimetric system and spectral reflectance distribution to describe and quantify articular cartilage. In this study, we measured the colors of intact and repaired cartilage after a microfracture. Histologically, the repaired cartilage was a mixture of fibrocartilage and hyaline cartilage. In the L* a* b* colorimetric system, the L* and a* values recovered to close to the values of intact cartilage, whereas the b* value decreased over time after the operation. Regarding the spectral reflectance distribution at 12 weeks after the operation, the repaired cartilage had a higher spectral reflectance ratio than intact cartilage between wavelengths of 400 to 470 nm. Conclusion This study reports the first results regarding the relationship between spectrocolorimetric evaluation and the histological findings of repair cartilage after a microfracture. Our findings demonstrate the ability of spectrocolorimetric measurement to judge the repair cartilage after treatment on the basis of objective data such as the L*, a* and b* values and the SRP as a coincidence index of the spectral reflectance curve.

  1. Joint homeostasis in tissue engineering for cartilage repair

    NARCIS (Netherlands)

    Saris, D.B.F.

    2002-01-01

    Traumatic joint damage, articular cartilage and the research into methods of restoring the articulation are not new topics of interest. For centuries, clinicians have recognized the importance of cartilage damage and sought ways of learning about the normal form and function of hyaline cartilage as

  2. [Histologic assessment of tissue healing of hyaline cartilage by use of semiquantitative evaluation scale].

    Science.gov (United States)

    Vukasović, Andreja; Ivković, Alan; Jezek, Davor; Cerovecki, Ivan; Vnuk, Drazen; Kreszinger, Mario; Hudetz, Damir; Pećina, Marko

    2011-01-01

    Articular cartilage is an avascular and aneural tissue lacking lymph drainage, hence its inability of spontaneous repair following injury. Thus, it offers an interesting model for scientific research. A number of methods have been suggested to enhance cartilage repair, but none has yet produced significant success. The possible application of the aforementioned methods has brought about the necessity to evaluate their results. The objective of this study was to analyze results of a study of the effects of the use of TGF-beta gene transduced bone marrow clot on articular cartilage defects using ICRS visual histological assessment scale. The research was conducted on 28 skeletally mature sheep that were randomly assigned to four groups and surgically inflicted femoral chondral defects. The articular surfaces were then treated with TGF-beta1 gene transduced bone marrow clot (TGF group), GFP transduced bone marrow clot (GFP group), untransduced bone marrow clot (BM group) or left untreated (NC group). The analysis was performed by visual examination of cartilage samples and results were obtained using ICRS visual histological assessment scale. The results were subsequently subjected to statistical assessment using Kruskal-Wallis and Mann-Whitney tests. Kruskal-Wallis test yielded statistically significant difference with respect to cell distribution. Mann-Whitney test showed statistically significant difference between TGF and NC groups (P = 0.002), as well as between BM and NC groups (P = 0.002 with Bonferroni correction). Twenty-six of the twenty-eight samples were subjected to histologic and subsequent statistical analysis; two were discarded due to faulty histology technique. Our results indicated a level of certainty as to the positive effect of TGF-beta1 gene transduced bone marrow clot in restoration of articular cartilage defects. However, additional research is necessary in the field. One of the significant drawbacks on histologic assessment of cartilage

  3. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them.

    Directory of Open Access Journals (Sweden)

    Sushil Kumar Mohapatra

    Full Text Available Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT has had a limited applicability due to very low (>1% live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF and Hand-made cloning (TE-HMC, and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.

  4. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them

    Science.gov (United States)

    Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat

    2015-01-01

    Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF. PMID:26053554

  5. Establishment of Trophectoderm Cell Lines from Buffalo (Bubalus bubalis) Embryos of Different Sources and Examination of In Vitro Developmental Competence, Quality, Epigenetic Status and Gene Expression in Cloned Embryos Derived from Them.

    Science.gov (United States)

    Mohapatra, Sushil Kumar; Sandhu, Anjit; Singh, Karn Pratap; Singla, Suresh Kumar; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat

    2015-01-01

    Despite being successfully used to produce live offspring in many species, somatic cell nuclear transfer (NT) has had a limited applicability due to very low (>1%) live birth rate because of a high incidence of pregnancy failure, which is mainly due to placental dysfunction. Since this may be due to abnormalities in the trophectoderm (TE) cell lineage, TE cells can be a model to understand the placental growth disorders seen after NT. We isolated and characterized buffalo TE cells from blastocysts produced by in vitro fertilization (TE-IVF) and Hand-made cloning (TE-HMC), and compared their growth characteristics and gene expression, and developed a feeder-free culture system for their long-term culture. The TE-IVF cells were then used as donor cells to produce HMC embryos following which their developmental competence, quality, epigenetic status and gene expression were compared with those of HMC embryos produced using fetal or adult fibroblasts as donor cells. We found that although TE-HMC and TE-IVF cells have a similar capability to grow in culture, significant differences exist in gene expression levels between them and between IVF and HMC embryos from which they are derived, which may have a role in the placental abnormalities associated with NT pregnancies. Although TE cells can be used as donor cells for producing HMC blastocysts, their developmental competence and quality is lower than that of blastocysts produced from fetal or adult fibroblasts. The epigenetic status and expression level of many important genes is different in HMC blastocysts produced using TE cells or fetal or adult fibroblasts or those produced by IVF.

  6. Overexpression of hsa-miR-148a promotes cartilage production and inhibits cartilage degradation by osteoarthritic chondrocytes

    NARCIS (Netherlands)

    Vonk, L A; Kragten, A H M; Dhert, W J A; Saris, D B F; Creemers, L B

    OBJECTIVE: Hsa-miR-148a expression is decreased in Osteoarthritis (OA) cartilage, but its functional role in cartilage has never been studied. Therefore, our aim was to investigate the effects of overexpressing hsa-miR-148a on cartilage metabolism of OA chondrocytes. DESIGN: OA chondrocytes were

  7. Overexpression of hsa-miR-148a promotes cartilage production and inhibits cartilage degradation by osteoarthritic chondrocytes

    NARCIS (Netherlands)

    Vonk, Lucienne A.; Kragten, Angela H.M.; Dhert, Wouter J.; Saris, Daniël B.F.; Creemers, Laura B.

    2014-01-01

    Objective Hsa-miR-148a expression is decreased in OA cartilage, but its functional role in cartilage has never been studied. Therefore, our aim was to investigate the effects of overexpressing hsa-miR-148a on cartilage metabolism of OA chondrocytes. Design OA chondrocytes were transfected with a

  8. The Lack of Correlation between the Increased Frequency of Allele IL-1RN*2 of Interleukin-1 Receptor Antagonist Gene in Czech Patients with Knee Osteoarthritis and the Markers of Cartilage Degradation

    Czech Academy of Sciences Publication Activity Database

    Růžičková, Šárka; Šenolt, L.; Gatterová, J.; Vencovský, J.; Pavelka, K.

    2008-01-01

    Roč. 54, č. 4 (2008), s. 115-120 ISSN 0015-5500 Institutional research plan: CEZ:AV0Z50520701 Keywords : knee osteoarthritis * IL-1RN gene * VNTR polymorphism Subject RIV: EC - Immunology Impact factor: 1.140, year: 2008

  9. Mesenchymal stem cells display different gene expression profiles compared to hyaline and elastic chondrocytes

    OpenAIRE

    Zhai, Li-Jie; Zhao, Ke-Qing; Wang, Zhi-Qiang; Feng, Ya; Xing, Shuang-Chun

    2011-01-01

    Cartilage has a poor intrinsic repair capacity, requiring surgical intervention to effect biological repair. Tissue engineering technologies or regenerative medicine strategies are currently being employed to address cartilage repair. Mesenchymal stem cells (MSCs) are considered to be an excellent cell source for this application. However, the different gene expression profiles between the MSCs and differentiated cartilage remain unclear. In this report, we first examined the gene expression ...

  10. Peptide-Based Materials for Cartilage Tissue Regeneration.

    Science.gov (United States)

    Hastar, Nurcan; Arslan, Elif; Guler, Mustafa O; Tekinay, Ayse B

    2017-01-01

    Cartilaginous tissue requires structural and metabolic support after traumatic or chronic injuries because of its limited capacity for regeneration. However, current techniques for cartilage regeneration are either invasive or ineffective for long-term repair. Developing alternative approaches to regenerate cartilage tissue is needed. Therefore, versatile scaffolds formed by biomaterials are promising tools for cartilage regeneration. Bioactive scaffolds further enhance the utility in a broad range of applications including the treatment of major cartilage defects. This chapter provides an overview of cartilage tissue, tissue defects, and the methods used for regeneration, with emphasis on peptide scaffold materials that can be used to supplement or replace current medical treatment options.

  11. Quantitative magnetic resonance imaging of articular cartilage in osteoarthritis

    Directory of Open Access Journals (Sweden)

    G Blumenkrantz

    2007-05-01

    Full Text Available Magnetic resonance imaging of articular cartilage has recently been recognized as a tool for the characterization of cartilage morphology, biochemistry and function. In this paper advancements in cartilage imaging, computation of cartilage volume and thickness, and measurement of relaxation times (T2 and T1Ρ are presented. In addition, the delayed uptake of Gadolinium DTPA as a marker of proteoglycan depletion is also reviewed. The cross-sectional and longitudinal studies using these imaging techniques show promise for cartilage assessment and for the study of osteoarthritis.

  12. Osteoarthritis: Control of human cartilage hypertrophic differentiation. Research highlight van: Gremlin1, frizzled-related protein, and Dkk-1 are key regulators of human articular cartilage homeostasis

    NARCIS (Netherlands)

    Buckland, J.; Leijten, Jeroen Christianus Hermanus; van Blitterswijk, Clemens; Karperien, Hermanus Bernardus Johannes

    2012-01-01

    Disruption of articular cartilage homeostasis is important in osteoarthritis (OA) pathogenesis, key to which is activation of articular chondrocyte hypertrophic differentiation. Healthy articular cartilage is resistant to hypertrophic differentiation, whereas growth-plate cartilage is destined to

  13. Papain-induced changes in rabbit cartilage; alterations in the chemical structure of the cartilage matrix.

    Science.gov (United States)

    TSALTAS, T T

    1958-10-01

    Some biochemical aspects of the collapse of the rabbit ears produced by the intravenous injection of papain have been studied. A marked depletion of chondromucoprotein (M.C.S.) and a reduction of the S(35) content of cartilage matrix were found to coincide with the gross and histologic changes in the cartilage. At the same time there was a marked increase in the amount of S(35) in the serum and an increase of S(35) and glucuronic acid excreted in the urine. Alteration in the composition of the M.C.S. remaining in the cartilage of the papain-injected animals was detected. The findings indicate that the collapse of the rabbit ears is due to loss of chondromucoprotein from cartilage and reduction of chondroitin sulfate in the chondromucoprotein that remains. All these changes were reversed in recovery.

  14. Dental mesenchymal stem cells encapsulated in alginate hydrogel co-delivery microencapsulation system for cartilage regeneration

    Science.gov (United States)

    Moshaverinia, Alireza; Xu, Xingtian; Chen, Chider; Akiyama, Kentaro; Snead, Malcolm L; Shi, Songtao

    2013-01-01

    Dental-derived MSCs are promising candidates for cartilage regeneration, with high chondrogenic differentiation capacity. This property contributes to making dental MSCs an advantageous therapeutic option compared to current treatment modalities. The MSC delivery vehicle is the principal determinant for the success of MSC-mediated cartilage regeneration therapies. The objectives of this study were to: (1) develop a novel co-delivery system based on TGF-β1 loaded RGD-coupled alginate microspheres encapsulating Periodontal Ligament Stem Cells (PDLSCs) or Gingival Mesenchymal Stem Cells (GMSCs); and (2) investigate dental MSC viability and chondrogenic differentiation in alginate microspheres. The results revealed the sustained release of TGF-β1 from the alginate microspheres. After 4 weeks of chondrogenic differentiation in vitro, PDLSCs, GMSCs as well as human bone marrow mesenchymal stem cells (hBMMSC) (as positive control) revealed chondrogenic gene expression markers (Col II and Sox-9) via qPCR, as well as matrix positively stained by toluidine blue and safranin-O. In animal studies, ectopic cartilage tissue regeneration was observed inside and around the transplanted microspheres, confirmed by histochemical and immunofluorescent staining. Interestingly, PDLSCs showed more chondrogenesis than GMSCs and hBMMSCs (Palginate microencapsulating dental MSCs make a promising candidate for cartilage regeneration. Our results highlight the vital role played by the microenvironment, as well as value of presenting inductive signals for viability and differentiation of MSCs. PMID:23891740

  15. Histology and histochemistry of the gekkotan notochord and their bearing on the development of notochordal cartilage.

    Science.gov (United States)

    Jonasson, Kristin A; Russell, Anthony P; Vickaryous, Matthew K

    2012-06-01

    The persistence of the notochord into the skeletally mature life stage is characteristic of gekkotans, but is otherwise of rare occurrence among amniotes. The taxonomic diversity of Gekkota affords the opportunity to investigate the structure and development of this phylogenetically ancestral component of the skeleton, and to determine its basic characteristics. The gekkotan notochord spans almost the entire postcranial long axis and is characterized by a moniliform morphology with regularly alternating zones of chordoid and chondroid tissue. Chordoid tissue persists in the region of intervertebral articulations and occupies the cavitations that lie between the centra of the amphicoelous vertebrae. Chondroid tissue is restricted to zones in which the diameter of the notochord is reduced, corresponding to mid-vertebral locations. In the tail, these zones of chondroid tissue are associated with the autotomic fracture planes. Chondroid tissue first manifests during late embryogenesis, appears to differentiate from pre-existing chordoid tissue, and has the histological and histochemical characteristics of cartilage. Our observations lend support to the hypothesis that cartilage can be derived directly from notochordal tissue, and suggest that the latter may be an evolutionary and developmental precursor to chordate cartilage. The persistence of chordoid tissue in the intervertebral regions of amphicoelous vertebrae is consistent with a suite of paedomorphic traits exhibited by gekkotans and suggests that the typical hydrostatic nature of notochordal tissue may play a role in mechanically governing patterns of displacement between adjacent amphicoelous vertebrae that lack extensive centrum-to-centrum contact. Copyright © 2012 Wiley Periodicals, Inc.

  16. The effect of 3D nanofibrous scaffolds on the chondrogenesis of induced pluripotent stem cells and their application in restoration of cartilage defects.

    Science.gov (United States)

    Liu, Ji; Nie, Huarong; Xu, Zhengliang; Niu, Xin; Guo, Shangchun; Yin, Junhui; Guo, Fei; Li, Gang; Wang, Yang; Zhang, Changqing

    2014-01-01

    The discovery of induced pluripotent stem cells (iPSCs) rendered the reprogramming of terminally differentiated cells to primary stem cells with pluripotency possible and provided potential for the regeneration and restoration of cartilage defect. Chondrogenic differentiation of iPSCs is crucial for their application in cartilage tissue engineering. In this study we investigated the effect of 3D nanofibrous scaffolds on the chondrogenesis of iPSCs and articular cartilage defect restoration. Super-hydrophilic and durable mechanic polycaprolactone (PCL)/gelatin scaffolds were fabricated using two separate electrospinning processes. The morphological structure and mechanical properties of the scaffolds were characterized. The chondrogenesis of the iPSCs in vitro and the restoration of the cartilage defect was investigated using scanning electron microscopy (SEM), the Cell Counting Kit-8 (CCK-8), histological observation, RT-qPCR, and western blot analysis. iPSCs on the scaffolds expressed higher levels of chondrogenic markers than the control group. In an animal model, cartilage defects implanted with the scaffold-cell complex exhibited an enhanced gross appearance and histological improvements, higher cartilage-specific gene expression and protein levels, as well as subchondral bone regeneration. Therefore, we showed scaffolds with a 3D nanofibrous structure enhanced the chondrogenesis of iPSCs and that iPSC-containing scaffolds improved the restoration of cartilage defects to a greater degree than did scaffolds alone in vivo.

  17. The effect of 3D nanofibrous scaffolds on the chondrogenesis of induced pluripotent stem cells and their application in restoration of cartilage defects.

    Directory of Open Access Journals (Sweden)

    Ji Liu

    Full Text Available The discovery of induced pluripotent stem cells (iPSCs rendered the reprogramming of terminally differentiated cells to primary stem cells with pluripotency possible and provided potential for the regeneration and restoration of cartilage defect. Chondrogenic differentiation of iPSCs is crucial for their application in cartilage tissue engineering. In this study we investigated the effect of 3D nanofibrous scaffolds on the chondrogenesis of iPSCs and articular cartilage defect restoration. Super-hydrophilic and durable mechanic polycaprolactone (PCL/gelatin scaffolds were fabricated using two separate electrospinning processes. The morphological structure and mechanical properties of the scaffolds were characterized. The chondrogenesis of the iPSCs in vitro and the restoration of the cartilage defect was investigated using scanning electron microscopy (SEM, the Cell Counting Kit-8 (CCK-8, histological observation, RT-qPCR, and western blot analysis. iPSCs on the scaffolds expressed higher levels of chondrogenic markers than the control group. In an animal model, cartilage defects implanted with the scaffold-cell complex exhibited an enhanced gross appearance and histological improvements, higher cartilage-specific gene expression and protein levels, as well as subchondral bone regeneration. Therefore, we showed scaffolds with a 3D nanofibrous structure enhanced the chondrogenesis of iPSCs and that iPSC-containing scaffolds improved the restoration of cartilage defects to a greater degree than did scaffolds alone in vivo.

  18. The effect of ultraviolet-B radiation on gene expression and pigment composition in etiolated and green pea leaf tissue: UV-B-induced changes are gene-specific and dependent upon the developmental stage

    International Nuclear Information System (INIS)

    Jordan, B.R.; James, P.E.; Strid, A.; Anthony, R.G.

    1994-01-01

    present in low or undetectable amounts in control tissues. In green leaf tissue exposed to supplementary UV-B, a transient increase was detected. The transcripts for chs reached a maximum level after approximately 8 h UV-B exposure, and then declined to lower levels over subsequent days of diurnal photoperiods. However, a constant increase in chs was found after continuous exposure to UV-B for up to 30 h. In etiolated tissue, either white-light, supplementary UV-B or UV-B alone gave small increases in chs, only 8 h of UV-B radiation alone gave any substantial increase in chs expression. Overall, these results clearly demonstrate that the response to increased levels of UV-B radiation is dependent upon the developmental stage of the tissue and involves complex changes in gene expression. (author)

  19. Role of Cartilage Forming Cells in Regenerative Medicine for Cartilage Repair

    OpenAIRE

    Sun, Lin; Reagan, Michaela R.; Kaplan, David L.

    2010-01-01

    Lin Sun1, Michaela R Reagan2, David L Kaplan1,21Department of Chemical and Biological Engineering, 2Department of Biomedical Engineering, Tufts University, Medford, MA, USAAbstract: Currently, cartilage repair remains a major challenge for researchers and physicians due to its limited healing capacity. Cartilage regeneration requires suitable cells; these must be easily obtained and expanded, able to produce hyaline matrix with proper mechanical properties, and demonstrate sustained integrati...

  20. Mechanical activation of mammalian target of rapamycin pathway is required for cartilage development

    OpenAIRE

    Guan, Yingjie; Yang, Xu; Yang, Wentian; Charbonneau, Cherie; Chen, Qian

    2014-01-01

    Mechanical stress regulates development by modulating cell signaling and gene expression. However, the cytoplasmic components mediating mechanotransduction remain unclear. In this study, elimination of muscle contraction during chicken embryonic development resulted in a reduction in the activity of mammalian target