Directory of Open Access Journals (Sweden)
Cohn Zachary A
2007-06-01
Full Text Available Abstract Background Cartilage plays a fundamental role in the development of the human skeleton. Early in embryogenesis, mesenchymal cells condense and differentiate into chondrocytes to shape the early skeleton. Subsequently, the cartilage anlagen differentiate to form the growth plates, which are responsible for linear bone growth, and the articular chondrocytes, which facilitate joint function. However, despite the multiplicity of roles of cartilage during human fetal life, surprisingly little is known about its transcriptome. To address this, a whole genome microarray expression profile was generated using RNA isolated from 18–22 week human distal femur fetal cartilage and compared with a database of control normal human tissues aggregated at UCLA, termed Celsius. Results 161 cartilage-selective genes were identified, defined as genes significantly expressed in cartilage with low expression and little variation across a panel of 34 non-cartilage tissues. Among these 161 genes were cartilage-specific genes such as cartilage collagen genes and 25 genes which have been associated with skeletal phenotypes in humans and/or mice. Many of the other cartilage-selective genes do not have established roles in cartilage or are novel, unannotated genes. Quantitative RT-PCR confirmed the unique pattern of gene expression observed by microarray analysis. Conclusion Defining the gene expression pattern for cartilage has identified new genes that may contribute to human skeletogenesis as well as provided further candidate genes for skeletal dysplasias. The data suggest that fetal cartilage is a complex and transcriptionally active tissue and demonstrate that the set of genes selectively expressed in the tissue has been greatly underestimated.
Expression of cartilage developmental genes in Hoxc8- and Hoxd4-transgenic mice.
Directory of Open Access Journals (Sweden)
Claudia Kruger
2010-02-01
Full Text Available Hox genes encode transcription factors, which regulate skeletal patterning and chondrocyte differentiation during the development of cartilage, the precursor to mature bone. Overexpression of the homeobox transcription factors Hoxc8 and Hoxd4 causes severe cartilage defects due to delay in cartilage maturation. Matrix metalloproteinases (MMPs, bone morphogenetic proteins (BMPs and fibroblastic growth factors (FGFs are known to play important roles in skeletal development and endochondral bone formation and remodeling. In order to investigate whether these molecules are aberrantly expressed in Hoxc8- and/or Hoxd4-transgenic cartilage, we performed quantitative RT-PCR on chondrocytes from Hox-transgenic mice. Gene expression levels of Bmp4, Fgf8, Fgf10, Mmp9, Mmp13, Nos3, Timp3, Wnt3a and Wnt5a were altered in Hoxc8-transgenic chondrocytes, and Fgfr3, Ihh, Mmp8, and Wnt3a expression levels were altered in Hoxd4-transgenic chondrocytes, respectively. Notably, Wnt3a expression was elevated in Hoxc8- and reduced in Hoxd4-transgenic cartilage. These results suggest that both transcription factors affect cartilage maturation through different molecular mechanisms, and provide the basis for future studies into the role of these genes and possible interactions in pathogenesis of cartilage defects in Hoxc8- and Hoxd4-transgenic mice.
Gene therapy for cartilage and bone tissue engineering
Hu, Yu-Chen
2014-01-01
"Gene Therapy for Cartilage and Bone Tissue Engineering" outlines the tissue engineering and possible applications of gene therapy in the field of biomedical engineering as well as basic principles of gene therapy, vectors and gene delivery, specifically for cartilage and bone engineering. It is intended for tissue engineers, cell therapists, regenerative medicine scientists and engineers, gene therapist and virologists. Dr. Yu-Chen Hu is a Distinguished Professor at the Department of Chemical Engineering, National Tsing Hua University and has received the Outstanding Research Award (National Science Council), Asia Research Award (Society of Chemical Engineers, Japan) and Professor Tsai-Teh Lai Award (Taiwan Institute of Chemical Engineers). He is also a fellow of the American Institute for Medical and Biological Engineering (AIMBE) and a member of the Tissue Engineering International & Regenerative Medicine Society (TERMIS)-Asia Pacific Council.
Stem Cells and Gene Therapy for Cartilage Repair
Directory of Open Access Journals (Sweden)
Umile Giuseppe Longo
2012-01-01
Full Text Available Cartilage defects represent a common problem in orthopaedic practice. Predisposing factors include traumas, inflammatory conditions, and biomechanics alterations. Conservative management of cartilage defects often fails, and patients with this lesions may need surgical intervention. Several treatment strategies have been proposed, although only surgery has been proved to be predictably effective. Usually, in focal cartilage defects without a stable fibrocartilaginous repair tissue formed, surgeons try to promote a natural fibrocartilaginous response by using marrow stimulating techniques, such as microfracture, abrasion arthroplasty, and Pridie drilling, with the aim of reducing swelling and pain and improving joint function of the patients. These procedures have demonstrated to be clinically useful and are usually considered as first-line treatment for focal cartilage defects. However, fibrocartilage presents inferior mechanical and biochemical properties compared to normal hyaline articular cartilage, characterized by poor organization, significant amounts of collagen type I, and an increased susceptibility to injury, which ultimately leads to premature osteoarthritis (OA. Therefore, the aim of future therapeutic strategies for articular cartilage regeneration is to obtain a hyaline-like cartilage repair tissue by transplantation of tissues or cells. Further studies are required to clarify the role of gene therapy and mesenchimal stem cells for management of cartilage lesions.
Hellingman, Catharine A; Koevoet, Wendy; van Osch, Gerjo J V M
2012-11-01
Chondrogenically differentiating bone marrow-derived mesenchymal stem cells (BMSCs) display signs of chondrocyte hypertrophy, such as production of collagen type X, MMP13 and alkaline phosphatase (ALPL). For cartilage reconstructions this is undesirable, as terminally differentiated cartilage produced by BMSCs mineralizes when implanted in vivo. Terminal differentiation is not restricted to BMSCs but is also encountered in chondrogenic differentiation of adipose-derived mesenchymal stem cells (MSCs) as well as embryonic stem cells, which by definition should be able to generate all types of tissues, including stable cartilage. Therefore, we propose that the currently used culture conditions may drive the cells towards terminal differentiation. In this manuscript we aim to review the literature, supplemented by our own data to answer the question, is it possible to generate stable hyaline cartilage from adult MSCs? We demonstrate that recently published methods for inhibiting terminal differentiation (through PTHrP, MMP13 or blocking phosphorylation of Smad1/5/8) result in cartilage formation with reduction of hypertrophic markers, although this does not reach the low level of stable chondrocytes. A set of hypertrophy markers should be included in future studies to characterize the phenotype more precisely. Finally, we used what is currently known in developmental biology about the differential development of hyaline and terminally differentiated cartilage to provide thought and insights to change current culture models for creating hyaline cartilage. Inhibiting terminal differentiation may not result in stable hyaline cartilage if the right balance of signals has not been created from the start of culture onwards. Copyright © 2011 John Wiley & Sons, Ltd.
PEDF Is Associated with the Termination of Chondrocyte Phenotype and Catabolism of Cartilage Tissue.
Klinger, P; Lukassen, S; Ferrazzi, F; Ekici, A B; Hotfiel, T; Swoboda, B; Aigner, T; Gelse, K
2017-01-01
Objective. To investigate the expression and target genes of pigment epithelium-derived factor (PEDF) in cartilage and chondrocytes, respectively. Methods. We analyzed the expression pattern of PEDF in different human cartilaginous tissues including articular cartilage, osteophytic cartilage, and fetal epiphyseal and growth plate cartilage, by immunohistochemistry and quantitative real-time (qRT) PCR. Transcriptome analysis after stimulation of human articular chondrocytes with rhPEDF was performed by RNA sequencing (RNA-Seq) and confirmed by qRT-PCR. Results. Immunohistochemically, PEDF could be detected in transient cartilaginous tissue that is prone to undergo endochondral ossification, including epiphyseal cartilage, growth plate cartilage, and osteophytic cartilage. In contrast, PEDF was hardly detected in healthy articular cartilage and in the superficial zone of epiphyses, regions that are characterized by a permanent stable chondrocyte phenotype. RNA-Seq analysis and qRT-PCR demonstrated that rhPEDF significantly induced the expression of a number of matrix-degrading factors including SAA1, MMP1, MMP3, and MMP13. Simultaneously, a number of cartilage-specific genes including COL2A1, COL9A2, COMP, and LECT were among the most significantly downregulated genes. Conclusions. PEDF represents a marker for transient cartilage during all neonatal and postnatal developmental stages and promotes the termination of cartilage tissue by upregulation of matrix-degrading factors and downregulation of cartilage-specific genes. These data provide the basis for novel strategies to stabilize the phenotype of articular cartilage and prevent its degradation.
Directory of Open Access Journals (Sweden)
Kurokawa Takayuki
2011-09-01
Full Text Available Abstract Background We have recently found a phenomenon that spontaneous regeneration of a hyaline cartilage-like tissue can be induced in a large osteochondral defect by implanting a double-network (DN hydrogel plug, which was composed of poly-(2-Acrylamido-2-methylpropanesulfonic acid and poly-(N, N'-Dimetyl acrylamide, at the bottom of the defect. The purpose of this study was to clarify gene expression profile of the regenerated tissue in comparison with that of the normal articular cartilage. Methods We created a cylindrical osteochondral defect in the rabbit femoral grooves. Then, we implanted the DN gel plug at the bottom of the defect. At 2 and 4 weeks after surgery, the regenerated tissue was analyzed using DNA microarray and immunohistochemical examinations. Results The gene expression profiles of the regenerated tissues were macroscopically similar to the normal cartilage, but showed some minor differences. The expression degree of COL2A1, COL1A2, COL10A1, DCN, FMOD, SPARC, FLOD2, CHAD, CTGF, and COMP genes was greater in the regenerated tissue than in the normal cartilage. The top 30 genes that expressed 5 times or more in the regenerated tissue as compared with the normal cartilage included type-2 collagen, type-10 collagen, FN, vimentin, COMP, EF1alpha, TFCP2, and GAPDH genes. Conclusions The tissue regenerated by using the DN gel was genetically similar but not completely identical to articular cartilage. The genetic data shown in this study are useful for future studies to identify specific genes involved in spontaneous cartilage regeneration.
Directory of Open Access Journals (Sweden)
Sandy A van Gool
Full Text Available We used human fetal bone marrow-derived mesenchymal stromal cells (hfMSCs differentiating towards chondrocytes as an alternative model for the human growth plate (GP. Our aims were to study gene expression patterns associated with chondrogenic differentiation to assess whether chondrocytes derived from hfMSCs are a suitable model for studying the development and maturation of the GP. hfMSCs efficiently formed hyaline cartilage in a pellet culture in the presence of TGFβ3 and BMP6. Microarray and principal component analysis were applied to study gene expression profiles during chondrogenic differentiation. A set of 232 genes was found to correlate with in vitro cartilage formation. Several identified genes are known to be involved in cartilage formation and validate the robustness of the differentiating hfMSC model. KEGG pathway analysis using the 232 genes revealed 9 significant signaling pathways correlated with cartilage formation. To determine the progression of growth plate cartilage formation, we compared the gene expression profile of differentiating hfMSCs with previously established expression profiles of epiphyseal GP cartilage. As differentiation towards chondrocytes proceeds, hfMSCs gradually obtain a gene expression profile resembling epiphyseal GP cartilage. We visualized the differences in gene expression profiles as protein interaction clusters and identified many protein clusters that are activated during the early chondrogenic differentiation of hfMSCs showing the potential of this system to study GP development.
Lee, K H; Song, S U; Hwang, T S; Yi, Y; Oh, I S; Lee, J Y; Choi, K B; Choi, M S; Kim, S J
2001-09-20
Transforming growth factor beta (TGF-beta) has been considered as a candidate for gene therapy of orthopedic diseases. The possible application of cell-mediated TGF-beta gene therapy as a new treatment regimen for degenerative arthritis was investigated. In this study, fibroblasts expressing active TGF-beta 1 were injected into the knee joints of rabbits with artificially made cartilage defects to evaluate the feasibility of this therapy for orthopedic diseases. Two to 3 weeks after the injection there was evidence of cartilage regeneration, and at 4 to 6 weeks the cartilage defect was completely filled with newly grown hyaline cartilage. Histological analyses of the regenerated cartilage suggested that it was well integrated with the adjacent normal cartilage at the sides of the defect and that the newly formed tissue was indeed hyaline cartilage. Our findings suggest that cell-mediated TGF-beta 1 gene therapy may be a novel treatment for orthopedic diseases in which hyaline cartilage damage has occurred.
Scaffold-assisted cartilage tissue engineering using infant chondrocytes from human hip cartilage.
Kreuz, P C; Gentili, C; Samans, B; Martinelli, D; Krüger, J P; Mittelmeier, W; Endres, M; Cancedda, R; Kaps, C
2013-12-01
Studies about cartilage repair in the hip and infant chondrocytes are rare. The aim of our study was to evaluate the use of infant articular hip chondrocytes for tissue engineering of scaffold-assisted cartilage grafts. Hip cartilage was obtained from five human donors (age 1-10 years). Expanded chondrocytes were cultured in polyglycolic acid (PGA)-fibrin scaffolds. De- and re-differentiation of chondrocytes were assessed by histological staining and gene expression analysis of typical chondrocytic marker genes. In vivo, cartilage matrix formation was assessed by histology after subcutaneous transplantation of chondrocyte-seeded PGA-fibrin scaffolds in immunocompromised mice. The donor tissue was heterogenous showing differentiated articular cartilage and non-differentiated tissue and considerable expression of type I and II collagens. Gene expression analysis showed repression of typical chondrocyte and/or mesenchymal marker genes during cell expansion, while markers were re-induced when expanded cells were cultured in PGA-fibrin scaffolds. Cartilage formation after subcutaneous transplantation of chondrocyte loaded PGA-fibrin scaffolds in nude mice was variable, with grafts showing resorption and host cell infiltration or formation of hyaline cartilage rich in type II collagen. Addition of human platelet rich plasma (PRP) to cartilage grafts resulted robustly in formation of hyaline-like cartilage that showed type II collagen and regions with type X collagen. These results suggest that culture of expanded and/or de-differentiated infant hip cartilage cells in PGA-fibrin scaffolds initiates chondrocyte re-differentiation. The heterogenous donor tissue containing immature chondrocytes bears the risk of cartilage repair failure in vivo, which may be possibly overcome by the addition of PRP. Copyright © 2013 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Mastication markedly affects mandibular condylar cartilage growth, gene expression, and morphology.
Enomoto, Akiko; Watahiki, Junichi; Nampo, Tomoki; Irie, Tarou; Ichikawa, Yuuta; Tachikawa, Tetsuhiko; Maki, Koutaro
2014-09-01
Mandibular growth is believed to be strongly related to mastication. Furthermore, mandibular condylar cartilage is known to be derived from neural crest cells. We examined whether the degree of chewing affects condylar cartilage growth of the mandible. Mice were fed diets with varying hardness. Genes specific to neural crest-derived cells were measured by real-time polymerase chain reaction to compare the expression changes between the mandibular and tibia cartilages. The mandibular condylar cartilage was then evaluated histologically, and proliferation was evaluated using proliferating cell nuclear antigen. Immunostaining was conducted for osteopontin, type X collagen, and Musashi1, and real-time polymerase chain reaction was used to assess the expression levels of osteopontin and type X collagen. Markers including P75, Wnt-1, Musashi1, and Nestin were upregulated in the mandibular condylar cartilage as compared with the tibial cartilage. Histologic assessment of the mandibular cartilage showed that the hypertrophic chondrocyte zone was statistically significantly thicker in mice fed a hard diet. Chondrocyte proliferation and Musashi1 expression were lower in mice fed a hard diet. After 4 weeks, numerous osteopontin and type X collagen-positive cells were observed in mice fed a mixed diet. Mastication affects the balance between differentiation and proliferation in the mandibular condylar cartilage. This phenomenon might be attributed to the presence of neural crest-derived cells. Copyright © 2014 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Liu, Peng-Cheng; Liu, Kuan; Liu, Jun-Feng; Xia, Kuo; Chen, Li-Yang; Wu, Xing
2016-09-27
The effect of overexpressing the Indian hedgehog (IHH) gene on the chondrogenic differentiation of rabbit bone marrow-derived mesenchymal stem cells (BMSCs) was investigated in a simulated microgravity environment. An adenovirus plasmid encoding the rabbit IHH gene was constructed in vitro and transfected into rabbit BMSCs. Two large groups were used: conventional cell culture and induction model group and simulated microgravity environment group. Each large group was further divided into blank control group, GFP transfection group, and IHH transfection group. During differentiation induction, the expression levels of cartilage-related and cartilage hypertrophy-related genes and proteins in each group were determined. In the conventional model, the IHH transfection group expressed high levels of cartilage-related factors (Coll2 and ANCN) at the early stage of differentiation induction and expressed high levels of cartilage hypertrophy-related factors (Coll10, annexin 5, and ALP) at the late stage. Under the simulated microgravity environment, the IHH transfection group expressed high levels of cartilage-related factors and low levels of cartilage hypertrophy-related factors at all stages of differentiation induction. Under the simulated microgravity environment, transfection of the IHH gene into BMSCs effectively promoted the generation of cartilage and inhibited cartilage aging and osteogenesis. Therefore, this technique is suitable for cartilage tissue engineering.
Directory of Open Access Journals (Sweden)
Elena Vasilyevna Chetina
2012-01-01
Full Text Available Objective: to study the expression ratio of the non-tissue specific regulatory genes mTOR, р21, ATG1, caspase 3, tumor necrosis factor-а (TNF-а, and interleukin-6 (IL-6, as well as matrix metalloproteinase 13 (MMP-13 and X type collagen (COL10A1, cartilage resorption-associated MMP13 and COL10A1 in the blood and knee articular cartilage in patients with rheumatoid arthritis (RA. Subjects and methods. Twenty-five specimens of the distal femoral articular cartilage condyles were studied in 15 RA patients (mean age 52.4+9.1 years after endoprosthetic knee joint replacement and in 10 healthy individuals (mean age 36.0+9.1 years included into the control group. Twenty-eight blood samples taken from 28 RA patients (aged 52+7.6 years prior to endoprosthetic knee joint replacement and 27 blood samples from healthy individuals (mean age 53.6+8.3 years; a control group were also analyzed. Real-time quantitative polymerase chain reaction was applied to estimate the expression of the mTOR, p21, ATG1, caspase 3, TNF-а, IL- 6, COL0A1, and MMP-13 genes. The levels of a protein equivalent in the p70-S6K(activated by mTOR, p21, and caspase 3 genes concerned was measured in the isolated lymphocyte lysates, by applying the commercially available ELISA kits. Total protein in the cell extracts was determined using the Bradford assay procedure. Results. The cartilage samples from patients with end-stage RA exhibited a significantly higher mTOR, ATG1, p21, TNFа, MMP-13, and COL10A1 gene expressions than did those from the healthy individuals. At the same time, IL6 gene expression was much lower than that in the control group. The expressions of the mTOR, ATG1, p21, TNFа, and IL 6 genes in the blood of RA patients were much greater than those in the donors. Caspase 3 expression did not differ essentially in the bloods of the patients with RA and healthy individuals. The bloods failed to show MMP-13 and COL10A1 expressions. High mTOR and p21 gene expressions were
Cartilage regeneration for treatment of osteoarthritis: a paradigm for nonsurgical intervention
Tiku, Moti L.; Sabaawy, Hatem E.
2015-01-01
Osteoarthritis (OA) is associated with articular cartilage abnormalities and affects people of older age: preventative or therapeutic treatment measures for OA and related articular cartilage disorders remain challenging. In this perspective review, we have integrated multiple biological, morphological, developmental, stem cell and homeostasis concepts of articular cartilage to develop a paradigm for cartilage regeneration. OA is conceptually defined as an injury of cartilage that initiates c...
Directory of Open Access Journals (Sweden)
Marta Anna Szychlinska
2016-03-01
Full Text Available Osteoarthritis is the most common human arthritis characterized by degeneration of articular cartilage. Several studies reported that levels of human cartilage glycoprotein chitinase 3-like-1 (CHI3L1 are known as a potential marker for the activation of chondrocytes and the progression of Osteoarthritis (OA, whereas lubricin appears to be chondroprotective. The aim of this study was to investigate the co-expression and co-localization of CHI3L1 and lubricin in normal and osteoarthritic rat articular cartilage to correlate their modified expression to a specific grade of OA. Samples of normal and osteoarthritic rat articular cartilage were analyzed by the Kellgren–Lawrence OA severity scores, the Kraus’ modified Mankin score and the Histopathology Osteoarthritis Research Society International (OARSI system for histomorphometric evaluations, and through CHI3L1 and lubricin gene expression, immunohistochemistry and double immuno-staining analysis. The immunoexpression and the mRNA levels of lubricin increased in normal cartilage and decreased in OA cartilage (normal vs. OA, p < 0.01. By contrast, the immunoexpression and the mRNA levels of CHI3L1 increased in OA cartilage and decreased in normal cartilage (normal vs. OA, p < 0.01. Our findings are consistent with reports suggesting that these two glycoproteins are functionally associated with the development of OA and in particular with grade 2/3 of OA, suggesting that in the future they could be helpful to stage the severity and progression of the disease.
Cartilage regeneration for treatment of osteoarthritis: a paradigm for nonsurgical intervention
Sabaawy, Hatem E.
2015-01-01
Osteoarthritis (OA) is associated with articular cartilage abnormalities and affects people of older age: preventative or therapeutic treatment measures for OA and related articular cartilage disorders remain challenging. In this perspective review, we have integrated multiple biological, morphological, developmental, stem cell and homeostasis concepts of articular cartilage to develop a paradigm for cartilage regeneration. OA is conceptually defined as an injury of cartilage that initiates chondrocyte activation, expression of proteases and growth factor release from the matrix. This regenerative process results in the local activation of inflammatory response genes in cartilage without migration of inflammatory cells or angiogenesis. The end results are catabolic and anabolic responses, and it is the balance between these two outcomes that controls remodelling of the matrix and regeneration. A tantalizing clinical clue for cartilage regrowth in OA joints has been observed in surgically created joint distraction. We hypothesize that cartilage growth in these distracted joints may have a biological connection with the size of organs and regeneration. Therefore we propose a novel, practical and nonsurgical intervention to validate the role of distraction in cartilage regeneration in OA. The approach permits normal wake-up activity while during sleep; the index knee is subjected to distraction with a pull traction device. Comparison of follow-up magnetic resonance imaging (MRI) at 3 and 6 months of therapy to those taken before therapy will provide much-needed objective evidence for the use of this mode of therapy for OA. We suggest that the paradigm presented here merits investigation for treatment of OA in knee joints. PMID:26029269
Directory of Open Access Journals (Sweden)
Farzaneh Sadeghi
2015-01-01
Full Text Available Background: During adolescence, sex hormones play an important role in regulating proliferation, differentiation, maturation, and the scheduled death of chondrocytes. Although some studies have reported the regulatory role of estrogen in the development and progression of cartilage, some of the mechanisms still remain unclear, including the role of estrogen in the expression of cartilage-specific genes in chondrogenesis process, which we cover in this study. Materials and Methods: In the present study, we used adipose-derived stem cells (ADSCs to differentiate into cartilage. Differentiated cartilage cells were used in the control (without estrogen E2 in the culture medium and experimental (with estrogen in the culture medium groups to evaluate the expression of type II collagen and aggrecan as chondrogenic genes markers, with -real-time polymerase chain reaction technique. Results: Our results indicated that estrogen leads to inhibition of type II collagen gene expression and reduction of aggrecan gene expression. Conclusion: Therefore, estrogen probably has negative effects on chondrogenesis process of ADSCs.
Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.
Directory of Open Access Journals (Sweden)
Susanta K Behura
Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.
Human sclera maintains common characteristics with cartilage throughout evolution.
Directory of Open Access Journals (Sweden)
Yuko Seko
Full Text Available BACKGROUND: The sclera maintains and protects the eye ball, which receives visual inputs. Although the sclera does not contribute significantly to visual perception, scleral diseases such as refractory scleritis, scleral perforation and pathological myopia are considered incurable or difficult to cure. The aim of this study is to identify characteristics of the human sclera as one of the connective tissues derived from the neural crest and mesoderm. METHODOLOGY/PRINCIPAL FINDINGS: We have demonstrated microarray data of cultured human infant scleral cells. Hierarchical clustering was performed to group scleral cells and other mesenchymal cells into subcategories. Hierarchical clustering analysis showed similarity between scleral cells and auricular cartilage-derived cells. Cultured micromasses of scleral cells exposed to TGF-betas and BMP2 produced an abundant matrix. The expression of cartilage-associated genes, such as Indian hedge hog, type X collagen, and MMP13, was up-regulated within 3 weeks in vitro. These results suggest that human 'sclera'-derived cells can be considered chondrocytes when cultured ex vivo. CONCLUSIONS/SIGNIFICANCE: Our present study shows a chondrogenic potential of human sclera. Interestingly, the sclera of certain vertebrates, such as birds and fish, is composed of hyaline cartilage. Although the human sclera is not a cartilaginous tissue, the human sclera maintains chondrogenic potential throughout evolution. In addition, our findings directly explain an enigma that the sclera and the joint cartilage are common targets of inflammatory cells in rheumatic arthritis. The present global gene expression database will contribute to the clarification of the pathogenesis of developmental diseases such as high myopia.
The cartilage-derived, C-type lectin (CLECSF1): structure of the gene and chromosomal location.
Neame, P J; Tapp, H; Grimm, D R
1999-09-03
Cartilage is a tissue that is primarily extracellular matrix, the bulk of which consists of proteoglycan aggregates constrained within a collagen framework. Candidate components that organize the extracellular assembly of the matrix consist of collagens, proteoglycans and multimeric glycoproteins. We describe the human gene structure of a potential organizing factor, a cartilage-derived member of the C-type lectin superfamily (CLECSF1; C-type lectin superfamily) related to the serum protein, tetranectin. We show by Northern analysis that this protein is restricted to cartilage and locate the gene on chromosome 16q23. We have characterized 10.9 kb of sequence upstream of the first exon. Similarly to human tetranectin, there are three exons. The residues that are conserved between CLECSF1 and tetranectin suggest that the cartilage-derived protein forms a trimeric structure similar to that of tetranectin, with three N-terminal alpha-helical domains aggregating through hydrophobic faces. The globular, C-terminal domain that has been shown to bind carbohydrate in some members of the family and plasminogen in tetranectin, is likely to have a similar overall structure to that of tetranectin.
Valiyaveettil, Manojkumar; Mort, John S; McDevitt, Cahir A
2005-01-01
The concentration, spatial distribution, and gene expression of aggrecan in meniscus, articular cartilage, and the anterior and posterior cruciate ligaments (ACL and PCL) was determined in the knee joints of five mature dogs. An anti-serum against peptide sequences specific to the G1 domain of aggrecan was employed in competitive-inhibition ELISA of guanidine HCl extracts and immunofluorescence microscopy. Gene expression was determined by Taqman real-time PCR. The concentration of aggrecan in articular cartilage (240.1 +/- 32 nMol/g dry weight) was higher than that in meniscus (medial meniscus: 33.4 +/- 4.3 nMol/g) and ligaments (ACL: 6.8 +/- 0.9 nMol/g). Aggrecan was more concentrated in the inner than the outer zone of the meniscus. Aggrecan in meniscus showed an organized, spatial network, in contrast to its diffuse distribution in articular cartilage. Thus, differences in the concentration, gene expression, and spatial distribution of aggrecan constitute another molecular distinction between hyaline cartilage and fibrocartilage of the knee.
Mizuno, M; Takebe, T; Kobayashi, S; Kimura, S; Masutani, M; Lee, S; Jo, Y H; Lee, J I; Taniguchi, H
2014-05-01
Current surgical intervention of craniofacial defects caused by injuries or abnormalities uses reconstructive materials, such as autologous cartilage grafts. Transplantation of autologous tissues, however, places a significant invasiveness on patients, and many efforts have been made for establishing an alternative graft. Recently, we and others have shown the potential use of reconstructed elastic cartilage from ear-derived chondrocytes or progenitors with the unique elastic properties. Here, we examined the differentiation potential of canine joint cartilage-derived chondrocytes into elastic cartilage for expanding the cell sources, such as hyaline cartilage. Articular chondrocytes are isolated from canine joint, cultivated, and compared regarding characteristic differences with auricular chondrocytes, including proliferation rates, gene expression, extracellular matrix production, and cartilage reconstruction capability after transplantation. Canine articular chondrocytes proliferated less robustly than auricular chondrocytes, but there was no significant difference in the amount of sulfated glycosaminoglycan produced from redifferentiated chondrocytes. Furthermore, in vitro expanded and redifferentiated articular chondrocytes have been shown to reconstruct elastic cartilage on transplantation that has histologic characteristics distinct from hyaline cartilage. Taken together, cultured hyaline cartilage-derived chondrocytes are a possible cell source for elastic cartilage reconstruction. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Guo Xiaodong; Zheng Qixin; Yang Shuhua; Shao Zengwu; Yuan Quan; Pan Zhengqi; Tang Shuo; Liu Kai; Quan Daping
2006-01-01
Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-β 1 ) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-β 1 that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-β 1 gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA 3 -TGF-β 1 gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA 3 gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of inflammatory and alloreactive immune responses. The
Transcriptomic signatures in cartilage ageing
2013-01-01
Introduction Age is an important factor in the development of osteoarthritis. Microarray studies provide insight into cartilage aging but do not reveal the full transcriptomic phenotype of chondrocytes such as small noncoding RNAs, pseudogenes, and microRNAs. RNA-Seq is a powerful technique for the interrogation of large numbers of transcripts including nonprotein coding RNAs. The aim of the study was to characterise molecular mechanisms associated with age-related changes in gene signatures. Methods RNA for gene expression analysis using RNA-Seq and real-time PCR analysis was isolated from macroscopically normal cartilage of the metacarpophalangeal joints of eight horses; four young donors (4 years old) and four old donors (>15 years old). RNA sequence libraries were prepared following ribosomal RNA depletion and sequencing was undertaken using the Illumina HiSeq 2000 platform. Differentially expressed genes were defined using Benjamini-Hochberg false discovery rate correction with a generalised linear model likelihood ratio test (P ageing cartilage. Conclusion There was an age-related dysregulation of matrix, anabolic and catabolic cartilage factors. This study has increased our knowledge of transcriptional networks in cartilage ageing by providing a global view of the transcriptome. PMID:23971731
Energy Technology Data Exchange (ETDEWEB)
Guo Xiaodong [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Zheng Qixin [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yang Shuhua [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shao Zengwu [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yuan Quan [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Pan Zhengqi [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Tang Shuo [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Liu Kai [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Quan Daping [Institute of Polymer Science, School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)
2006-12-15
Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-{beta}{sub 1}) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-{beta}{sub 1} that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-{beta}{sub 1} gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA{sub 3}-TGF-{beta}{sub 1} gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA{sub 3} gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of
Stem Cells and Gene Therapy for Cartilage Repair
Longo, Umile Giuseppe; Petrillo, Stefano; Franceschetti, Edoardo; Berton, Alessandra; Maffulli, Nicola; Denaro, Vincenzo
2012-01-01
Cartilage defects represent a common problem in orthopaedic practice. Predisposing factors include traumas, inflammatory conditions, and biomechanics alterations. Conservative management of cartilage defects often fails, and patients with this lesions may need surgical intervention. Several treatment strategies have been proposed, although only surgery has been proved to be predictably effective. Usually, in focal cartilage defects without a stable fibrocartilaginous repair tissue formed, sur...
Löfgren, Maria; Svala, Emilia; Lindahl, Anders; Skiöldebrand, Eva; Ekman, Stina
2018-05-01
Osteoarthritis is an inflammatory and degenerative joint disease commonly affecting horses. To identify genes of relevance for cartilage pathology in osteoarthritis we studied the time-course effects of interleukin (IL)-1β on equine articular cartilage. Articular cartilage explants from the distal third metacarpal bone were collected postmortem from three horses without evidence of joint disease. The explants were stimulated with IL-1β for 27 days and global gene expression was measured by microarray. Gene expression was compared to that of unstimulated explants at days 3, 9, 15, 21 and 27. Release of inflammatory proteins was measured using Proximity Extension Assay. Stimulation with IL-1β led to time-dependent changes in gene expression related to inflammation, the extracellular matrix (ECM), and phenotypic alterations. Gene expression and protein release of cytokines, chemokines, and matrix-degrading enzymes increased in the stimulated explants. Collagen type II was downregulated from day 15, whereas other ECM molecules were downregulated earlier. In contrast molecules involved in ECM signaling (perlecan, chondroitin sulfate proteoglycan 4, and syndecan 4) were upregulated. At the late time points, genes related to a chondrogenic phenotype were downregulated, and genes related to a hypertrophic phenotype were upregulated, suggesting a transition towards hypertrophy later in the culturing period. The data suggest that this in vitro model mimics time course events of in vivo inflammation in OA and it may be valuable as an in vitro tool to test treatments and to study disease mechanisms. Copyright © 2018 Elsevier Ltd. All rights reserved.
Transcriptomic profiling of cartilage ageing
Directory of Open Access Journals (Sweden)
Mandy Jayne Peffers
2014-12-01
Full Text Available The musculoskeletal system is severely affected by the ageing process, with many tissues undergoing changes that lead to loss of function and frailty. Articular cartilage is susceptible to age related diseases, such as osteoarthritis. Applying RNA-Seq to young and old equine cartilage, we identified an over-representation of genes with reduced expression relating to extracellular matrix, degradative proteases, matrix synthetic enzymes, cytokines and growth factors in cartilage from older donors. Here we describe the contents and quality controls in detail for the gene expression and related results published by Peffers and colleagues in Arthritis Research and Therapy 2013 associated with the data uploaded to ArrayExpress (E-MTAB-1386.
Cucchiarini, Magali; Terwilliger, Ernest F; Kohn, Dieter; Madry, Henning
2009-08-01
Compensating for the loss of extracellular cartilage matrix, as well as counteracting the alterations of the chondrocyte phenotype in osteoarthritis are of key importance to develop effective therapeutic strategies against this disorder. In the present study, we analysed the benefits of applying a potent gene combination to remodel human osteoarthritic (OA) cartilage. We employed the promising recombinant adeno-associated virus (rAAV) vector to deliver the mitogenic fibroblast growth factor 2 (FGF-2) factor, alone or simultaneously with the transcription factor Sox9 as a key activator of matrix synthesis, to human normal and OA articular chondrocytes. We evaluated the effects of single (FGF-2) or combined (FGF-2/SOX9) transgene expression upon the regenerative activities of chondrocytes in three dimensional cultures in vitro and in cartilage explants in situ. Single overexpression of FGF-2 enhanced the survival and proliferation of both normal and OA chondrocytes, without stimulating the matrix synthetic processes in the increased pools of cells. The mitogenic properties of FGF-2 were maintained when SOX9 was co-overexpressed and concomitant with an increase in the production of proteoglycans and type-II collagen, suggesting that the transcription factor was capable of counterbalancing the effects of FGF-2 on matrix accumulation. Also important, expression of type-X collagen, a marker of hypertrophy strongly decreased following treatment by the candidate vectors. Most remarkably, the levels of activities achieved in co-treated human OA cartilage were similar to or higher than those observed in normal cartilage. The present findings show that combined expression of candidate factors in OA cartilage can re-establish key features of normal cartilage and prevent the pathological shift of metabolic homeostasis. These data provide further motivation to develop coupled gene transfer approaches via rAAV for the treatment of human OA.
Yin, Heyong; Wang, Yu; Sun, Zhen; Sun, Xun; Xu, Yichi; Li, Pan; Meng, Haoye; Yu, Xiaoming; Xiao, Bo; Fan, Tian; Wang, Yiguo; Xu, Wenjing; Wang, Aiyuan; Guo, Quanyi; Peng, Jiang; Lu, Shibi
2016-03-01
We propose a method of preparing a novel cell carrier derived from natural cartilage extracellular matrix (ECM), designated cartilage ECM-derived particles (CEDPs). Through a series of processes involving pulverization, sieving, and decellularization, fresh cartilage was made into CEDPs with a median diameter of 263 ± 48 μm. Under microgravity culture conditions in a rotary cell culture system (RCCS), bone marrow stromal cells (BMSCs) can proliferate rapidly on the surface of CEDPs with high viability. Histological evaluation and gene expression analysis indicated that BMSCs were differentiated into mature chondrocytes after 21 days of culture without the use of exogenous growth factors. Functional cartilage microtissue aggregates of BMSC-laden CEDPs formed as time in culture increased. Further, the microtissue aggregates were directly implanted into trochlear cartilage defects in a rat model (CEDP+MSC group). Gait analysis and histological results indicated that the CEDP+MSC group obtained better and more rapid joint function recovery and superior cartilage repair compared to the control groups, in which defects were treated with CEDPs alone or only fibrin glue, at both 6 and 12 weeks after surgery. In conclusion, the innovative cell carrier derived from cartilage ECM could promote chondrogenic differentiation of BMSCs, and the direct use of functional cartilage microtissue facilitated cartilage regeneration. This strategy for cell culture, stem cell differentiation and one-step surgery using cartilage microtissue for cartilage repair provides novel prospects for cartilage tissue engineering and may have further broad clinical applications. We proposed a method to prepare a novel cell carrier derived from natural cartilage ECM, termed cartilage ECM-derived particles (CEDPs), which can support proliferation of MSCs and facilitate their chondrogenic differentiation. Further, the direct use of functional cartilage microtissue of MSC-laden CEDP aggregates for
Secondary cartilage revealed in a non-avian dinosaur embryo.
Directory of Open Access Journals (Sweden)
Alida M Bailleul
Full Text Available The skull and jaws of extant birds possess secondary cartilage, a tissue that arises after bone formation during embryonic development at articulations, ligamentous and muscular insertions. Using histological analysis, we discovered secondary cartilage in a non-avian dinosaur embryo, Hypacrosaurus stebingeri (Ornithischia, Lambeosaurinae. This finding extends our previous report of secondary cartilage in post-hatching specimens of the same dinosaur species. It provides the first information on the ontogeny of avian and dinosaurian secondary cartilages, and further stresses their developmental similarities. Secondary cartilage was found in an embryonic dentary within a tooth socket where it is hypothesized to have arisen due to mechanical stresses generated during tooth formation. Two patterns were discerned: secondary cartilage is more restricted in location in this Hypacrosaurus embryo, than it is in Hypacrosaurus post-hatchlings; secondary cartilage occurs at far more sites in bird embryos and nestlings than in Hypacrosaurus. This suggests an increase in the number of sites of secondary cartilage during the evolution of birds. We hypothesize that secondary cartilage provided advantages in the fine manipulation of food and was selected over other types of tissues/articulations during the evolution of the highly specialized avian beak from the jaws of their dinosaurian ancestors.
Matrix development in self-assembly of articular cartilage.
Directory of Open Access Journals (Sweden)
Gidon Ofek
2008-07-01
Full Text Available Articular cartilage is a highly functional tissue which covers the ends of long bones and serves to ensure proper joint movement. A tissue engineering approach that recapitulates the developmental characteristics of articular cartilage can be used to examine the maturation and degeneration of cartilage and produce fully functional neotissue replacements for diseased tissue.This study examined the development of articular cartilage neotissue within a self-assembling process in two phases. In the first phase, articular cartilage constructs were examined at 1, 4, 7, 10, 14, 28, 42, and 56 days immunohistochemically, histologically, and through biochemical analysis for total collagen and glycosaminoglycan (GAG content. Based on statistical changes in GAG and collagen levels, four time points from the first phase (7, 14, 28, and 56 days were chosen to carry into the second phase, where the constructs were studied in terms of their mechanical characteristics, relative amounts of collagen types II and VI, and specific GAG types (chondroitin 4-sulfate, chondroitin 6-sulfate, dermatan sulfate, and hyaluronan. Collagen type VI was present in initial abundance and then localized to a pericellular distribution at 4 wks. N-cadherin activity also spiked at early stages of neotissue development, suggesting that self-assembly is mediated through a minimization of free energy. The percentage of collagen type II to total collagen significantly increased over time, while the proportion of collagen type VI to total collagen decreased between 1 and 2 wks. The chondroitin 6- to 4- sulfate ratio decreased steadily during construct maturation. In addition, the compressive properties reached a plateau and tensile characteristics peaked at 4 wks.The indices of cartilage formation examined in this study suggest that tissue maturation in self-assembled articular cartilage mirrors known developmental processes for native tissue. In terms of tissue engineering, it is
Directory of Open Access Journals (Sweden)
Elena V. Tchetina
2016-01-01
Full Text Available This study reports the effects of the iron chelator deferoxamine (DFO on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM. Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA, AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.
Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene
Directory of Open Access Journals (Sweden)
Michael Hadjiargyrou
2018-01-01
Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.
Towards Regeneration of Articular Cartilage
Iwamoto, Masahiro; Ohta, Yoichi; Larmour, Colleen; Enomoto-Iwamoto, Motomi
2014-01-01
Articular cartilage is classified into permanent hyaline cartilage and has significant differences in structure, extracelluar matrix components, gene expression profile, and mechanical property from transient hyaline cartilage found in growth plate. In the process of synovial joint development, articular cartilage is originated from the interzone, developing at the edge of the cartilaginous anlagen, it establishes zonal structure over time and supports smooth movement of the synovial joint through life. The cascade actions of key regulators such as Wnts, GDF5, Erg, and PTHLH coordinate sequential steps of articular cartilage formation. Articular chondrocytes are restrictedly controlled not to differentiate into a hypertrophic stage by autocrine and paracrine factors and extracerllular matrix microenvironment, but retain potential to undergo hypertrophy. The basal calcified zone of articular cartilage is connected with subchondral bone, but not invaded by blood vessels nor replaced by bone, which is highly contrasted with the growth plate. Articular cartilage has limited regenerative capacity, but likely possesses and potentially uses intrinsic stem cell source in the superficial layer, Ranvier’s groove, the intra-articular tissues such as synovium and fat pad, and marrow below the subchondral bone. Considering the biological views on articular cartilage, several important points are raised for regeneration of articular cartilage. We should evaluate the nature of regenerated cartilage as permanent hyaline cartilage and not just hyaline cartilage. We should study how a hypertrophic phenotype of transplanted cells can be lastingly suppressed in regenerating tissue. Further, we should develop the methods and reagents to activate recruitment of intrinsic stem/progenitor cells into the damaged site. PMID:24078496
Mural granulosa cell gene expression associated with oocyte developmental competence
Directory of Open Access Journals (Sweden)
Jiang Jin-Yi
2010-03-01
Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and
Zhang, Z; Li, L; Yang, W; Cao, Y; Shi, Y; Li, X; Zhang, Q
2017-02-01
To investigate the effects of different doses of insulin-like growth factor 1 (IGF-1) on the cartilage layer and subchondral bone (SB) during repair of full-thickness articular cartilage (AC) defects. IGF-1-loaded collagen membrane was implanted into full-thickness AC defects in rabbits. The effects of two different doses of IGF-1 on cartilage layer and SB adjacent to the defect, the cartilage structure, formation and integration, and the new SB formation were evaluated at the 1st, 4th and 8th week postoperation. Meanwhile, after 1 week treatment, the relative mRNA expressions in tissues adjacent to the defect, including cartilage and SB were determined by quantitative real-time RT-PCR (qRT-PCR), respectively. Different doses of IGF-1 induced different gene expression profiles in tissues adjacent to the defect and resulted in different repair outcomes. Particularly, at high dose IGF-1 aided cell survival, regulated the gene expressions in cartilage layer adjacent defect and altered ECM composition more effectively, improved the formation and integrity of neo-cartilage. While, at low dose IGF-1 regulated the gene expressions in SB more efficaciously and subsequently promoted the SB remodeling and reconstruction. Different doses of IGF-1 induced different responses of cartilage or SB during the repair of full-thickness AC defects. Particularly, high dose of IGF-1 was more beneficial to the neo-cartilage formation and integration, while low dose of it was more effective for the SB formation. Copyright © 2016 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M
2015-05-15
The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.
Raisin, Sophie; Belamie, Emmanuel; Morille, Marie
2016-10-01
Recent regenerative medicine and tissue engineering strategies for bone and cartilage repair have led to fascinating progress of translation from basic research to clinical applications. In this context, the use of gene therapy is increasingly being considered as an important therapeutic modality and regenerative technique. Indeed, in the last 20 years, nucleic acids (plasmid DNA, interferent RNA) have emerged as credible alternative or complement to proteins, which exhibited major issues including short half-life, loss of bioactivity in pathologic environment leading to high dose requirement and therefore high production costs. The relevance of gene therapy strategies in combination with a scaffold, following a so-called "Gene-Activated Matrix (GAM)" approach, is to achieve a direct, local and sustained delivery of nucleic acids from a scaffold to ensure efficient and durable cell transfection. Among interesting cells sources, Mesenchymal Stem Cells (MSC) are promising for a rational use in gene/cell therapy with more than 1700 clinical trials approved during the last decade. The aim of the present review article is to provide a comprehensive overview of recent and ongoing work in non-viral genetic engineering of MSC combined with scaffolds. More specifically, we will show how this inductive strategy can be applied to orient stem cells fate for bone and cartilage repair. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Aaron C. Petrey
2012-03-01
The severe pediatric disorder mucolipidosis II (ML-II; also known as I-cell disease is caused by defects in mannose 6-phosphate (Man-6-P biosynthesis. Patients with ML-II exhibit multiple developmental defects, including skeletal, craniofacial and joint abnormalities. To date, the molecular mechanisms that underlie these clinical manifestations are poorly understood. Taking advantage of a zebrafish model of ML-II, we previously showed that the cartilage morphogenesis defects in this model are associated with altered chondrocyte differentiation and excessive deposition of type II collagen, indicating that aspects of development that rely on proper extracellular matrix homeostasis are sensitive to decreases in Man-6-P biosynthesis. To further investigate the molecular bases for the cartilage phenotypes, we analyzed the transcript abundance of several genes in chondrocyte-enriched cell populations isolated from wild-type and ML-II zebrafish embryos. Increased levels of cathepsin and matrix metalloproteinase (MMP transcripts were noted in ML-II cell populations. This increase in transcript abundance corresponded with elevated and sustained activity of several cathepsins (K, L and S and MMP-13 during early development. Unlike MMP-13, for which higher levels of protein were detected, the sustained activity of cathepsin K at later stages seemed to result from its abnormal processing and activation. Inhibition of cathepsin K activity by pharmacological or genetic means not only reduced the activity of this enzyme but led to a broad reduction in additional protease activity, significant correction of the cartilage morphogenesis phenotype and reduced type II collagen staining in ML-II embryos. Our findings suggest a central role for excessive cathepsin K activity in the developmental aspects of ML-II cartilage pathogenesis and highlight the utility of the zebrafish system to address the biochemical underpinnings of metabolic disease.
Directory of Open Access Journals (Sweden)
Ronglan Zhao
Full Text Available Previously, we reported an improvement in the transfection efficiency of the plasmid DNA-chitosan (pDNA/CS complex by the utilization of phosphorylatable short peptide-conjugated chitosan (pSP-CS. In this study, we investigated the effects of pSP-CS-mediated gene transfection of interleukin-1 receptor antagonist protein (IL-1Ra combined with insulin-like growth factor-1 (IGF-1 in rabbit chondrocytes and in a rabbit model of cartilage defects. pBudCE4.1-IL-1Ra+igf-1, pBudCE4.1-IL-1Ra and pBudCE4.1-igf-1 were constructed and combined with pSP-CS to form pDNA/pSP-CS complexes. These complexes were transfected into rabbit primary chondrocytes or injected into the joint cavity. Seven weeks after treatment, all rabbits were sacrificed and analyzed. High levels of IL-1Ra and igf-1 expression were detected both in the cell culture supernatant and in the synovial fluid. In vitro, the transgenic complexes caused significant proliferation of chondrocytes, promotion of glycosaminoglycan (GAG and collagen II synthesis, and inhibition of chondrocyte apoptosis and nitric oxide (NO synthesis. In vivo, the exogenous genes resulted in increased collagen II synthesis and reduced NO and GAG concentrations in the synovial fluid; histological studies revealed that pDNA/pSP-CS treatment resulted in varying degrees of hyaline-like cartilage repair and Mankin score decrease. The co-expression of both genes produced greater effects than each single gene alone both in vitro and in vivo. The results suggest that pSP-CS is a good candidate for use in gene therapy for the treatment of cartilage defects and that igf-1 and IL-1Ra co-expression produces promising biologic effects on cartilage defects.
Efficient Reverse-Engineering of a Developmental Gene Regulatory Network
Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes
2012-01-01
Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to
Hellingman, C.A.; Verwiel, E.T.P.; Slagt, I.; Koevoet, W.; Poublon, R.M.L.; Nolst-Trenite, G.J.; de Jong, R.J.B.; Jahr, H.; van Osch, G.J.V.M.
2011-01-01
The aim of this study was to evaluate the potential of culture-expanded human auricular and nasoseptal chondrocytes as cell source for regeneration of stable cartilage and to analyze the differences in gene expression profile of expanded chondrocytes from these specific locations. Auricular
Hellingman, Catharine A.; Verwiel, Eugène T. P.; Slagt, Inez; Koevoet, Wendy; Poublon, René M. L.; Nolst-Trenité, Gilbert J.; Baatenburg de Jong, Robert J.; Jahr, Holger; van Osch, Gerjo J. V. M.
2011-01-01
The aim of this study was to evaluate the potential of culture-expanded human auricular and nasoseptal chondrocytes as cell source for regeneration of stable cartilage and to analyze the differences in gene expression profile of expanded chondrocytes from these specific locations. Auricular
Developmental gene expression profiles of the human pathogen Schistosoma japonicum
Directory of Open Access Journals (Sweden)
McManus Donald P
2009-03-01
Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.
Directory of Open Access Journals (Sweden)
B Frank Eames
2011-08-01
Full Text Available Differentiating cells interact with their extracellular environment over time. Chondrocytes embed themselves in a proteoglycan (PG-rich matrix, then undergo a developmental transition, termed "maturation," when they express ihh to induce bone in the overlying tissue, the perichondrium. Here, we ask whether PGs regulate interactions between chondrocytes and perichondrium, using zebrafish mutants to reveal that cartilage PGs inhibit chondrocyte maturation, which ultimately dictates the timing of perichondral bone development. In a mutagenesis screen, we isolated a class of mutants with decreased cartilage matrix and increased perichondral bone. Positional cloning identified lesions in two genes, fam20b and xylosyltransferase1 (xylt1, both of which encode PG synthesis enzymes. Mutants failed to produce wild-type levels of chondroitin sulfate PGs, which are normally abundant in cartilage matrix, and initiated perichondral bone formation earlier than their wild-type siblings. Primary chondrocyte defects might induce the bone phenotype secondarily, because mutant chondrocytes precociously initiated maturation, showing increased and early expression of such markers as runx2b, collagen type 10a1, and ihh co-orthologs, and ihha mutation suppressed early perichondral bone in PG mutants. Ultrastructural analyses demonstrated aberrant matrix organization and also early cellular features of chondrocyte hypertrophy in mutants. Refining previous in vitro reports, which demonstrated that fam20b and xylt1 were involved in PG synthesis, our in vivo analyses reveal that these genes function in cartilage matrix production and ultimately regulate the timing of skeletal development.
Cao, Lei; Yang, Fei; Liu, Guangwang; Yu, Degang; Li, Huiwu; Fan, Qiming; Gan, Yaokai; Tang, Tingting; Dai, Kerong
2011-06-01
Although Sox9 is essential for chondrogenic differentiation and matrix production, its application in cartilage tissue engineering has been rarely reported. In this study, the chondrogenic effect of Sox9 on bone marrow mesenchymal stem cells (BMSCs) in vitro and its application in articular cartilage repair in vivo were evaluated. Rabbit BMSCs were transduced with adenoviral vector containing Sox9. Toluidine blue, safranin O staining and real-time PCR were performed to check chondrogenic differentiation. The results showed that Sox9 could induce chondrogenesis of BMSCs both in monolayer and on PGA scaffold effectively. The rabbit model with full-thickness cartilage defects was established and then repaired by PGA scaffold and rabbit BMSCs with or without Sox9 transduction. HE, safranin O staining and immunohistochemistry were used to assess the repair of defects by the complex. Better repair, including more newly-formed cartilage tissue and hyaline cartilage-specific extracellular matrix and greater expression of several chondrogenesis marker genes were observed in PGA scaffold and BMSCs with Sox9 transduction, compared to that without transduction. Our findings defined the important role of Sox9 in the repair of cartilage defects in vivo and provided evidence that Sox9 had the potential and advantage in the application of tissue engineering. Copyright © 2011 Elsevier Ltd. All rights reserved.
An ex vivo human cartilage repair model to evaluate the potency of a cartilage cell transplant.
Bartz, Christoph; Meixner, Miriam; Giesemann, Petra; Roël, Giulietta; Bulwin, Grit-Carsta; Smink, Jeske J
2016-11-15
Cell-based therapies such as autologous chondrocyte implantation are promising therapeutic approaches to treat cartilage defects to prevent further cartilage degeneration. To assure consistent quality of cell-based therapeutics, it is important to be able to predict the biological activity of such products. This requires the development of a potency assay, which assesses a characteristic of the cell transplant before implantation that can predict its cartilage regeneration capacity after implantation. In this study, an ex vivo human cartilage repair model was developed as quality assessment tool for potency and applied to co.don's chondrosphere product, a matrix-associated autologous chondrocyte implant (chondrocyte spheroids) that is in clinical use in Germany. Chondrocyte spheroids were generated from 14 donors, and implanted into a subchondral cartilage defect that was manually generated in human articular cartilage tissue. Implanted spheroids and cartilage tissue were co-cultured ex vivo for 12 weeks to allow regeneration processes to form new tissue within the cartilage defect. Before implantation, spheroid characteristics like glycosaminoglycan production and gene and protein expression of chondrogenic markers were assessed for each donor sample and compared to determine donor-dependent variation. After the co-cultivation, histological analyses showed the formation of repair tissue within the cartilage defect, which varied in amount for the different donors. In the repair tissue, aggrecan protein was expressed and extra-cellular matrix cartilage fibers were present, both indicative for a cartilage hyaline-like character of the repair tissue. The amount of formed repair tissue was used as a read-out for regeneration capacity and was correlated with the spheroid characteristics determined before implantation. A positive correlation was found between high level of aggrecan protein expression in spheroids before implantation and a higher regeneration potential
An ex vivo human cartilage repair model to evaluate the potency of a cartilage cell transplant
Directory of Open Access Journals (Sweden)
Christoph Bartz
2016-11-01
Full Text Available Abstract Background Cell-based therapies such as autologous chondrocyte implantation are promising therapeutic approaches to treat cartilage defects to prevent further cartilage degeneration. To assure consistent quality of cell-based therapeutics, it is important to be able to predict the biological activity of such products. This requires the development of a potency assay, which assesses a characteristic of the cell transplant before implantation that can predict its cartilage regeneration capacity after implantation. In this study, an ex vivo human cartilage repair model was developed as quality assessment tool for potency and applied to co.don’s chondrosphere product, a matrix-associated autologous chondrocyte implant (chondrocyte spheroids that is in clinical use in Germany. Methods Chondrocyte spheroids were generated from 14 donors, and implanted into a subchondral cartilage defect that was manually generated in human articular cartilage tissue. Implanted spheroids and cartilage tissue were co-cultured ex vivo for 12 weeks to allow regeneration processes to form new tissue within the cartilage defect. Before implantation, spheroid characteristics like glycosaminoglycan production and gene and protein expression of chondrogenic markers were assessed for each donor sample and compared to determine donor-dependent variation. Results After the co-cultivation, histological analyses showed the formation of repair tissue within the cartilage defect, which varied in amount for the different donors. In the repair tissue, aggrecan protein was expressed and extra-cellular matrix cartilage fibers were present, both indicative for a cartilage hyaline-like character of the repair tissue. The amount of formed repair tissue was used as a read-out for regeneration capacity and was correlated with the spheroid characteristics determined before implantation. A positive correlation was found between high level of aggrecan protein expression in spheroids
Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas
2013-12-05
The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously
Mechanical confinement regulates cartilage matrix formation by chondrocytes
Lee, Hong-Pyo; Gu, Luo; Mooney, David J.; Levenston, Marc E.; Chaudhuri, Ovijit
2017-12-01
Cartilage tissue equivalents formed from hydrogels containing chondrocytes could provide a solution for replacing damaged cartilage. Previous approaches have often utilized elastic hydrogels. However, elastic stresses may restrict cartilage matrix formation and alter the chondrocyte phenotype. Here we investigated the use of viscoelastic hydrogels, in which stresses are relaxed over time and which exhibit creep, for three-dimensional (3D) culture of chondrocytes. We found that faster relaxation promoted a striking increase in the volume of interconnected cartilage matrix formed by chondrocytes. In slower relaxing gels, restriction of cell volume expansion by elastic stresses led to increased secretion of IL-1β, which in turn drove strong up-regulation of genes associated with cartilage degradation and cell death. As no cell-adhesion ligands are presented by the hydrogels, these results reveal cell sensing of cell volume confinement as an adhesion-independent mechanism of mechanotransduction in 3D culture, and highlight stress relaxation as a key design parameter for cartilage tissue engineering.
Prepatterning of developmental gene expression by modified histones before zygotic genome activation
DEFF Research Database (Denmark)
Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.
2011-01-01
A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...
Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng; Wei, Lei
2018-01-01
Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog ( Ihh ) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes.
Montagne, Kevin; Onuma, Yasuko; Ito, Yuzuru; Aiki, Yasuhiko; Furukawa, Katsuko S; Ushida, Takashi
2017-01-01
Due to the high water content of cartilage, hydrostatic pressure is likely one of the main physical stimuli sensed by chondrocytes. Whereas, in the physiological range (0 to around 10 MPa), hydrostatic pressure exerts mostly pro-chondrogenic effects in chondrocyte models, excessive pressures have been reported to induce detrimental effects on cartilage, such as increased apoptosis and inflammation, and decreased cartilage marker expression. Though some genes modulated by high pressure have been identified, the effects of high pressure on the global gene expression pattern have still not been investigated. In this study, using microarray technology and real-time PCR validation, we analyzed the transcriptome of ATDC5 chondrocyte progenitors submitted to a continuous pressure of 25 MPa for up to 24 h. Several hundreds of genes were found to be modulated by pressure, including some not previously known to be mechano-sensitive. High pressure markedly increased the expression of stress-related genes, apoptosis-related genes and decreased that of cartilage matrix genes. Furthermore, a large set of genes involved in the progression of osteoarthritis were also induced by high pressure, suggesting that hydrostatic pressure could partly mimic in vitro some of the genetic alterations occurring in osteoarthritis.
The formation of human auricular cartilage from microtic tissue: An in vivo study.
Ishak, Mohamad Fikeri bin; See, Goh Bee; Hui, Chua Kien; Abdullah, Asma bt; Saim, Lokman bin; Saim, Aminuddin bin; Idrus, Ruszymah bt Haji
2015-10-01
This study aimed to isolate, culture-expand and characterize the chondrocytes isolated from microtic cartilage and evaluate its potential as a cell source for ear cartilage reconstruction. Specific attention was to construct the auricular cartilage tissue by using fibrin as scaffold. Cell culture experiment with the use of microtic chondrocytes. Cell culture experiment with the use of microtic chondrocytes. After ear reconstructive surgery at the Universiti Kebangsaan Malaysia Medical Center, chondrocytes were isolated from microtic cartilage. Chondrocytes isolated from the tissue were cultured expanded until passage 4 (P4). Upon confluency at P4, chondrocytes were harvested and tissue engineered constructs were made with human plasma polymerized to fibrin. Constructs formed later is implanted at the dorsal part of nude mice for 8 weeks, followed by post-implantation evaluation with histology staining (Hematoxylin and Eosin (H&E) and Safranin O), immunohistochemistry and RT-PCR for chondrogenic associated genes expression level. Under gross assessment, the construct after 8 weeks of implantation showed similar physical characteristics that of cartilage. Histological staining showed abundant lacunae cells embedded in extracellular matrix similar to that of native cartilage. Safranin O staining showed positive staining which indicates the presence of proteoglycan-rich matrix. Immunohistochemistry analysis showed the strong positive staining for collagen type II, the specific collagen type in the cartilage. Gene expression quantification showed no significant differences in the expression of chondrogenic gene used which is collagen type I, collagen type II, aggrecan core protein (ACP), elastin and sox9 genes when compared to construct formed from normal auricular tissue. Chondrocytes isolated from microtia cartilage has the potential to be used as an alternative cell source for external ear reconstruction in future clinical application. Copyright © 2015 Elsevier
Magnetic resonance imaging of cartilage and cartilage repair
International Nuclear Information System (INIS)
Verstraete, K.L.; Almqvist, F.; Verdonk, P.; Vanderschueren, G.; Huysse, W.; Verdonk, R.; Verbrugge, G.
2004-01-01
Magnetic resonance (MR) imaging of articular cartilage has assumed increased importance because of the prevalence of cartilage injury and degeneration, as well as the development of new surgical and pharmacological techniques to treat damaged cartilage. This article will review relevant aspects of the structure and biochemistry of cartilage that are important for understanding MR imaging of cartilage, describe optimal MR pulse sequences for its evaluation, and review the role of experimental quantitative MR techniques. These MR aspects are applied to clinical scenarios, including traumatic chondral injury, osteoarthritis, inflammatory arthritis, and cartilage repair procedures
Magnetic resonance imaging of cartilage and cartilage repair
Energy Technology Data Exchange (ETDEWEB)
Verstraete, K.L. E-mail: koenraad.verstraete@ugent.be; Almqvist, F.; Verdonk, P.; Vanderschueren, G.; Huysse, W.; Verdonk, R.; Verbrugge, G
2004-08-01
Magnetic resonance (MR) imaging of articular cartilage has assumed increased importance because of the prevalence of cartilage injury and degeneration, as well as the development of new surgical and pharmacological techniques to treat damaged cartilage. This article will review relevant aspects of the structure and biochemistry of cartilage that are important for understanding MR imaging of cartilage, describe optimal MR pulse sequences for its evaluation, and review the role of experimental quantitative MR techniques. These MR aspects are applied to clinical scenarios, including traumatic chondral injury, osteoarthritis, inflammatory arthritis, and cartilage repair procedures.
Liu, Betty; Lad, Nimit K; Collins, Amber T; Ganapathy, Pramodh K; Utturkar, Gangadhar M; McNulty, Amy L; Spritzer, Charles E; Moorman, Claude T; Sutter, E Grant; Garrett, William E; DeFrate, Louis E
2017-10-01
There are currently limited human in vivo data characterizing the role of the meniscus in load distribution within the tibiofemoral joint. Purpose/Hypothesis: The purpose was to compare the strains experienced in regions of articular cartilage covered by the meniscus to regions of cartilage not covered by the meniscus. It was hypothesized that in response to walking, tibial cartilage covered by the meniscus would experience lower strains than uncovered tibial cartilage. Descriptive laboratory study. Magnetic resonance imaging (MRI) of the knees of 8 healthy volunteers was performed before and after walking on a treadmill. Using MRI-generated 3-dimensional models of the tibia, cartilage, and menisci, cartilage thickness was measured in 4 different regions based on meniscal coverage and compartment: covered medial, uncovered medial, covered lateral, and uncovered lateral. Strain was defined as the normalized change in cartilage thickness before and after activity. Within each compartment, covered cartilage before activity was significantly thinner than uncovered cartilage before activity ( P meniscus experiences lower strains than uncovered cartilage in the medial compartment. These findings provide important baseline information on the relationship between in vivo tibial compressive strain responses and meniscal coverage, which is critical to understanding normal meniscal function.
A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system
Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng
2018-01-01
Background Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). Results In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. Conclusion This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes. PMID:29440889
Insights from amphioxus into the evolution of vertebrate cartilage.
Directory of Open Access Journals (Sweden)
Daniel Meulemans
2007-08-01
Full Text Available Central to the story of vertebrate evolution is the origin of the vertebrate head, a problem difficult to approach using paleontology and comparative morphology due to a lack of unambiguous intermediate forms. Embryologically, much of the vertebrate head is derived from two ectodermal tissues, the neural crest and cranial placodes. Recent work in protochordates suggests the first chordates possessed migratory neural tube cells with some features of neural crest cells. However, it is unclear how and when these cells acquired the ability to form cellular cartilage, a cell type unique to vertebrates. It has been variously proposed that the neural crest acquired chondrogenic ability by recruiting proto-chondrogenic gene programs deployed in the neural tube, pharynx, and notochord. To test these hypotheses we examined the expression of 11 amphioxus orthologs of genes involved in neural crest chondrogenesis. Consistent with cellular cartilage as a vertebrate novelty, we find that no single amphioxus tissue co-expresses all or most of these genes. However, most are variously co-expressed in mesodermal derivatives. Our results suggest that neural crest-derived cartilage evolved by serial cooption of genes which functioned primitively in mesoderm.
Directory of Open Access Journals (Sweden)
Suzuki Erika
2011-07-01
Full Text Available Abstract Background In vitro studies using the myogenic cell line C2C12 demonstrate that bone morphogenetic protein-2 (BMP-2 converts the developmental pathway of C2C12 from a myogenic cell lineage to an osteoblastic cell lineage. Further, in vivo studies using null mutation mice demonstrate that BMPs inhibit the specification of the developmental fate of myogenic progenitor cells. However, the roles of BMPs in the phases of differentiation and maturation in skeletal muscles have yet to be determined. The present study attempts to define the function of BMP-2 in the final stage of differentiation of mouse tongue myoblast. Results Recombinant BMP-2 inhibited the expressions of markers for the differentiation of skeletal muscle cells, such as myogenin, muscle creatine kinase (MCK, and fast myosin heavy chain (fMyHC, whereas BMP-2 siRNA stimulated such markers. Neither the recombinant BMP-2 nor BMP-2 siRNA altered the expressions of markers for the formation of cartilage and bone, such as osteocalcin, alkaline phosphatase (ALP, collagen II, and collagen X. Further, no formation of cartilage and bone was observed in the recombinant BMP-2-treated tongues based on Alizarin red and Alcian blue stainings. Neither recombinant BMP-2 nor BMP-2 siRNA affected the expression of inhibitor of DNA binding/differentiation 1 (Id1. The ratios of chondrogenic and osteogenic markers relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a house keeping gene were approximately 1000-fold lower than those of myogenic markers in the cultured tongue. Conclusions BMP-2 functions as a negative regulator for the final differentiation of tongue myoblasts, but not as an inducer for the formation of cartilage and bone in cultured tongue, probably because the genes related to myogenesis are in an activation mode, while the genes related to chondrogenesis and osteogenesis are in a silencing mode.
Hamid, Adila A; Idrus, Ruszymah Bt Hj; Saim, Aminuddin Bin; Sathappan, Somasumdaram; Chua, Kien-Hui
2012-01-01
Understanding the changes in chondrogenic gene expression that are involved in the differentiation of human adipose-derived stem cells to chondrogenic cells is important prior to using this approach for cartilage repair. The aims of the study were to characterize human adipose-derived stem cells and to examine chondrogenic gene expression after one, two, and three weeks of induction. Human adipose-derived stem cells at passage 4 were evaluated by flow cytometry to examine the expression of surface markers. These adipose-derived stem cells were tested for adipogenic and osteogenic differentiation capacity. Ribonucleic acid was extracted from the cells for quantitative polymerase chain reaction analysis to determine the expression levels of chondrogenic genes after chondrogenic induction. Human adipose-derived stem cells were strongly positive for the mesenchymal markers CD90, CD73, CD44, CD9, and histocompatibility antigen and successfully differentiated into adipogenic and osteogenic lineages. The human adipose-derived stem cells aggregated and formed a dense matrix after chondrogenic induction. The expression of chondrogenic genes (collagen type II, aggrecan core protein, collagen type XI, COMP, and ELASTIN) was significantly higher after the first week of induction. However, a significantly elevated expression of collagen type X was observed after three weeks of chondrogenic induction. Human adipose-derived stem cells retain stem cell characteristics after expansion in culture to passage 4 and serve as a feasible source of cells for cartilage regeneration. Chondrogenesis in human adipose-derived stem cells was most prominent after one week of chondrogenic induction.
Directory of Open Access Journals (Sweden)
Adila A Hamid
2012-01-01
Full Text Available OBJECTIVES: Understanding the changes in chondrogenic gene expression that are involved in the differentiation of human adipose-derived stem cells to chondrogenic cells is important prior to using this approach for cartilage repair. The aims of the study were to characterize human adipose-derived stem cells and to examine chondrogenic gene expression after one, two, and three weeks of induction. MATERIALS AND METHODS: Human adipose-derived stem cells at passage 4 were evaluated by flow cytometry to examine the expression of surface markers. These adipose-derived stem cells were tested for adipogenic and osteogenic differentiation capacity. Ribonucleic acid was extracted from the cells for quantitative polymerase chain reaction analysis to determine the expression levels of chondrogenic genes after chondrogenic induction. RESULTS: Human adipose-derived stem cells were strongly positive for the mesenchymal markers CD90, CD73, CD44, CD9, and histocompatibility antigen and successfully differentiated into adipogenic and osteogenic lineages. The human adipose-derived stem cells aggregated and formed a dense matrix after chondrogenic induction. The expression of chondrogenic genes (collagen type II, aggrecan core protein, collagen type XI, COMP, and ELASTIN was significantly higher after the first week of induction. However, a significantly elevated expression of collagen type X was observed after three weeks of chondrogenic induction. CONCLUSION: Human adipose-derived stem cells retain stem cell characteristics after expansion in culture to passage 4 and serve as a feasible source of cells for cartilage regeneration. Chondrogenesis in human adiposederived stem cells was most prominent after one week of chondrogenic induction.
Repair and tissue engineering techniques for articular cartilage.
Makris, Eleftherios A; Gomoll, Andreas H; Malizos, Konstantinos N; Hu, Jerry C; Athanasiou, Kyriacos A
2015-01-01
Chondral and osteochondral lesions due to injury or other pathology commonly result in the development of osteoarthritis, eventually leading to progressive total joint destruction. Although current progress suggests that biologic agents can delay the advancement of deterioration, such drugs are incapable of promoting tissue restoration. The limited ability of articular cartilage to regenerate renders joint arthroplasty an unavoidable surgical intervention. This Review describes current, widely used clinical repair techniques for resurfacing articular cartilage defects; short-term and long-term clinical outcomes of these techniques are discussed. Also reviewed is a developmental pipeline of acellular and cellular regenerative products and techniques that could revolutionize joint care over the next decade by promoting the development of functional articular cartilage. Acellular products typically consist of collagen or hyaluronic-acid-based materials, whereas cellular techniques use either primary cells or stem cells, with or without scaffolds. Central to these efforts is the prominent role that tissue engineering has in translating biological technology into clinical products; therefore, concomitant regulatory processes are also discussed.
Directory of Open Access Journals (Sweden)
IA Otto
2018-02-01
Full Text Available Paramount for the generation of auricular structures of clinically-relevant size is the acquisition of a large number of cells maintaining an elastic cartilage phenotype, which is the key in producing a tissue capable of withstanding forces subjected to the auricle. Current regenerative medicine strategies utilize chondrocytes from various locations or mesenchymal stromal cells (MSCs. However, the quality of neo-tissues resulting from these cell types is inadequate due to inefficient chondrogenic differentiation and endochondral ossification, respectively. Recently, a subpopulation of stem/progenitor cells has been identified within the auricular cartilage tissue, with similarities to MSCs in terms of proliferative capacity and cell surface biomarkers, but their potential for tissue engineering has not yet been explored. This study compared the in vitro cartilage-forming ability of equine auricular cartilage progenitor cells (AuCPCs, bone marrow-derived MSCs and auricular chondrocytes in gelatin methacryloyl (gelMA-based hydrogels over a period of 56 d, by assessing their ability to undergo chondrogenic differentiation. Neocartilage formation was assessed through gene expression profiling, compression testing, biochemical composition and histology. Similar to MSCs and chondrocytes, AuCPCs displayed a marked ability to generate cartilaginous matrix, although, under the applied culture conditions, MSCs outperformed both cartilage-derived cell types in terms of matrix production and mechanical properties. AuCPCs demonstrated upregulated mRNA expression of elastin, low expression of collagen type X and similar levels of proteoglycan production and mechanical properties as compared to chondrocytes. These results underscored the AuCPCs’ tissue-specific differentiation potential, making them an interesting cell source for the next generation of elastic cartilage tissue-engineered constructs.
Transcriptional network systems in cartilage development and disease.
Nishimura, Riko; Hata, Kenji; Nakamura, Eriko; Murakami, Tomohiko; Takahata, Yoshifumi
2018-04-01
Transcription factors play important roles in the regulation of cartilage development by controlling the expression of chondrogenic genes. Genetic studies have revealed that Sox9/Sox5/Sox6, Runx2/Runx3 and Osterix in particular are essential for the sequential steps of cartilage development. Importantly, these transcription factors form network systems that are also required for appropriate cartilage development. Molecular cloning approaches have largely contributed to the identification of several transcriptional partners for Sox9 and Runx2 during cartilage development. Although the importance of a negative-feedback loop between Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) in chondrocyte hypertrophy has been well established, recent studies indicate that several transcription factors interact with the Ihh-PTHrP loop and demonstrated that Ihh has multiple functions in the regulation of cartilage development. The most common cartilage disorder, osteoarthritis, has been reported to result from the pathological action of several transcription factors, including Runx2, C/EBPβ and HIF-2α. On the other hand, NFAT family members appear to play roles in the protection of cartilage from osteoarthritis. It is also becoming important to understand the homeostasis and regulation of articular chondrocytes, because they have different cellular and molecular features from chondrocytes of the growth plate. This review summarizes the regulation and roles of transcriptional network systems in cartilage development and their pathological roles in osteoarthritis.
The mechanobiology of articular cartilage development and degeneration.
Carter, Dennis R; Beaupré, Gary S; Wong, Marcy; Smith, R Lane; Andriacchi, Tom P; Schurman, David J
2004-10-01
The development, maintenance, and destruction of cartilage are regulated by mechanical factors throughout life. Mechanical cues in the cartilage fetal endoskeleton influence the expression of genes that guide the processes of growth, vascular invasion, and ossification. Intermittent fluid pressure maintains the cartilage phenotype whereas mild tension (or shear) promotes growth and ossification. The articular cartilage thickness is determined by the position at which the subchondral growth front stabilizes. In mature joints, cartilage is thickest and healthiest where the contact pressure and cartilage fluid pressure are greatest. The depth-dependent histomorphology reflects the local fluid pressure, tensile strain, and fluid exudation. Osteoarthritis represents the final demise and loss of cartilage in the skeletal elements. The initiation and progression of osteoarthritis can follow many pathways and can be promoted by mechanical factors including: (1) reduced loading, which activates the subchondral growth front by reducing fluid pressure; (2) blunt impact, causing microdamage and activation of the subchondral growth front by local shear stress; (3) mechanical abnormalities that increase wear at the articulating surface; and (4) other mechanically related factors. Research should be directed at integrating our mechanical understanding of osteoarthritis pathogenesis and progression within the framework of cellular and molecular events throughout ontogeny.
Kraft, Jeffrey J.; Jeong, Changhoon; Novotny, John E.; Seacrist, Thomas; Chan, Gilbert; Domzalski, Marcin; Turka, Christina M.; Richardson, Dean W.; Dodge, George R.
2011-01-01
Objective: Many approaches are being taken to generate cartilage replacement materials. The goal of this study was to use a self-aggregating suspension culture model of chondrocytes with mechanical preconditioning. Design: Our model differs from others in that it is based on a scaffold-less, self-aggregating culture model that produces a cartilage tissue analog that has been shown to share many similarities with the natural cartilage phenotype. Owing to the known loaded environment under which chondrocytes function in vivo, we hypothesized that applying force to the suspension culture–derived chondrocyte biomass would improve its cartilage-like characteristics and provide a new model for engineering cartilage tissue analogs. Results: In this study, we used a specialized hydrostatic pressure bioreactor system to apply mechanical forces during the growth phase to improve biochemical and biophysical properties of the biomaterial formed. We demonstrated that using this high-density suspension culture, a biomaterial more consistent with the hyaline cartilage phenotype was produced without any foreign material added. Unpassaged chondrocytes responded to a physiologically relevant hydrostatic load by significantly increasing gene expression of critical cartilage molecule collagen and aggrecan along with other cartilage relevant genes, CD44, perlecan, decorin, COMP, and iNOS. Conclusions: This study describes a self-aggregating bioreactor model without foreign material or scaffold in which chondrocytes form a cartilage tissue analog with many features similar to native cartilage. This study represents a promising scaffold-less, methodological advancement in cartilage tissue engineering with potential translational applications to cartilage repair. PMID:26069584
Cartilage extracellular matrix as a biomaterial for cartilage regeneration.
Kiyotake, Emi A; Beck, Emily C; Detamore, Michael S
2016-11-01
The extracellular matrix (ECM) of various tissues possesses the model characteristics that biomaterials for tissue engineering strive to mimic; however, owing to the intricate hierarchical nature of the ECM, it has yet to be fully characterized and synthetically fabricated. Cartilage repair remains a challenge because the intrinsic properties that enable its durability and long-lasting function also impede regeneration. In the last decade, cartilage ECM has emerged as a promising biomaterial for regenerating cartilage, partly because of its potentially chondroinductive nature. As this research area of cartilage matrix-based biomaterials emerged, investigators facing similar challenges consequently developed convergent solutions in constructing robust and bioactive scaffolds. This review discusses the challenges, emerging trends, and future directions of cartilage ECM scaffolds, including a comparison between two different forms of cartilage matrix: decellularized cartilage (DCC) and devitalized cartilage (DVC). To overcome the low permeability of cartilage matrix, physical fragmentation greatly enhances decellularization, although the process itself may reduce the chondroinductivity of fabricated scaffolds. The less complex processing of a scaffold composed of DVC, which has not been decellularized, appears to have translational advantages and potential chondroinductive and mechanical advantages over DCC, without detrimental immunogenicity, to ultimately enhance cartilage repair in a clinically relevant way. © 2016 New York Academy of Sciences.
Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis
Directory of Open Access Journals (Sweden)
Ishida Betty K
2003-08-01
Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.
Developmental evolution in social insects: regulatory networks from genes to societies.
Linksvayer, Timothy A; Fewell, Jennifer H; Gadau, Jürgen; Laubichler, Manfred D
2012-05-01
The evolution and development of complex phenotypes in social insect colonies, such as queen-worker dimorphism or division of labor, can, in our opinion, only be fully understood within an expanded mechanistic framework of Developmental Evolution. Conversely, social insects offer a fertile research area in which fundamental questions of Developmental Evolution can be addressed empirically. We review the concept of gene regulatory networks (GRNs) that aims to fully describe the battery of interacting genomic modules that are differentially expressed during the development of individual organisms. We discuss how distinct types of network models have been used to study different levels of biological organization in social insects, from GRNs to social networks. We propose that these hierarchical networks spanning different organizational levels from genes to societies should be integrated and incorporated into full GRN models to elucidate the evolutionary and developmental mechanisms underlying social insect phenotypes. Finally, we discuss prospects and approaches to achieve such an integration. © 2012 WILEY PERIODICALS, INC.
A co-expression gene network associated with developmental regulation of apple fruit acidity.
Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong
2015-08-01
Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.
Directory of Open Access Journals (Sweden)
Muhammad Farooq Rai
Full Text Available (i To provide baseline knowledge of gene expression in macroscopically normal articular cartilage, (ii to test the hypothesis that age, body-mass-index (BMI, and sex are associated with cartilage RNA transcriptome, and (iii to predict individuals at potential risk for developing "pre-osteoarthritis" (OA based on screening of genetic risk-alleles associated with OA and gene transcripts differentially expressed between normal and OA cartilage.Healthy-appearing cartilage was obtained from the medial femoral notch of 12 knees with a meniscus tear undergoing arthroscopic partial meniscectomy. Cartilage had no radiographic, magnetic-resonance-imaging or arthroscopic evidence for degeneration. RNA was subjected to Affymetrix microarrays followed by validation of selected transcripts by microfluidic digital polymerase-chain-reaction. The underlying biological processes were explored computationally. Transcriptome-wide gene expression was probed for association with known OA genetic risk-alleles assembled from published literature and for comparison with gene transcripts differentially expressed between healthy and OA cartilage from other studies.We generated a list of 27,641 gene transcripts in healthy cartilage. Several gene transcripts representing numerous biological processes were correlated with age and BMI and differentially expressed by sex. Based on disease-specific Ingenuity Pathways Analysis, gene transcripts associated with aging were enriched for bone/cartilage disease while the gene expression profile associated with BMI was enriched for growth-plate calcification and OA. When segregated by genetic risk-alleles, two clusters of study patients emerged, one cluster containing transcripts predicted by risk studies. When segregated by OA-associated gene transcripts, three clusters of study patients emerged, one of which is remarkably similar to gene expression pattern in OA.Our study provides a list of gene transcripts in healthy
The junction between hyaline cartilage and engineered cartilage in rabbits.
Komura, Makoto; Komura, Hiroko; Otani, Yushi; Kanamori, Yutaka; Iwanaka, Tadashi; Hoshi, Kazuto; Tsuyoshi, Takato; Tabata, Yasuhiko
2013-06-01
Tracheoplasty using costal cartilage grafts to enlarge the tracheal lumen was performed to treat congenital tracheal stenosis. Fibrotic granulomatous tissue was observed at the edge of grafted costal cartilage. We investigated the junction between the native hyaline cartilage and the engineered cartilage plates that were generated by auricular chondrocytes for fabricating the airway. Controlled, prospecive study. In group 1, costal cartilage from New Zealand white rabbits was collected and implanted into a space created in the cervical trachea. In group 2, chondrocytes from auricular cartilages were seeded on absorbable scaffolds. These constructs were implanted in the subcutaneous space. Engineered cartilage plates were then implanted into the trachea after 3 weeks of implantation of the constructs. The grafts in group 1 and 2 were retrieved after 4 weeks. In group 1, histological studies of the junction between the native hyaline cartilage and the implanted costal cartilage demonstrated chondrogenic tissue in four anastomoses sides out of the 10 examined. In group 2, the junction between the native trachea and the engineered cartilage showed neocartilage tissue in nine anastomoses sides out of 10. Engineered cartilage may be beneficial for engineered airways, based on the findings of the junction between the native and engineered grafts. Copyright © 2012 The American Laryngological, Rhinological and Otological Society, Inc.
Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.
Directory of Open Access Journals (Sweden)
Xiao-Jian Sun
Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.
Hattori, K; Takakura, Y; Ohgushi, H; Habata, T; Uematsu, K; Takenaka, M; Ikeuchi, K
2004-09-01
To investigate ultrasonic evaluation methods for detecting whether the repair tissue is hyaline cartilage or fibrocartilage in new cartilage regeneration therapy. We examined four experimental rabbit models: a spontaneous repair model (group S), a large cartilage defect model (group L), a periosteal graft model (group P) and a tissue-engineered cartilage regeneration model (group T). From the resulting ultrasonic evaluation, we used %MM (the maximum magnitude of the measurement area divided by that of the intact cartilage) as a quantitative index of cartilage regeneration. The results of the ultrasonic evaluation were compared with the histological findings and histological score. The %MM values were 61.1 +/- 16.5% in group S, 29.8 +/- 15.1% in group L, 36.3 +/- 18.3% in group P and 76.5 +/- 18.7% in group T. The results showed a strong similarity to the histological scoring. The ultrasonic examination showed that all the hyaline-like cartilage in groups S and T had a high %MM (more than 60%). Therefore, we could define the borderline between the two types of regenerated cartilage by the %MM.
A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system
Directory of Open Access Journals (Sweden)
Wang S
2018-01-01
Full Text Available Shaowei Wang,1 Xiaochun Wei,1 Xiaojuan Sun,1 Chongwei Chen,1 Jingming Zhou,2 Ge Zhang,3 Heng Wu,3 Baosheng Guo,3 Lei Wei1,2 1Department of Orthopaedics, The 2nd Hospital of Shanxi Medical University, Taiyuan, Shanxi, China; 2Department of Orthopaedics, Rhode Island Hospital, The Warren Alpert Medical School of Brown University, Providence, RI, USA; 3Integrated Traditional Chinese and Western Medicine, School of Chinese Medicine, Hong Kong Baptist University, Hong Kong Background: Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose: The objective of this study was to develop and validate a novel lipid nanoparticle (LNP-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods: LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA. Results: In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative
Zhan, Jing; Gu, Zhi-yuan; Wu, Li-qun; Zhang, Yin-kai; Hu, Ji-an
2005-06-20
The urokinase plasminogen activator system is believed to play an important role in degradation of the extracellular matrix associated with cartilage and bone destruction; however its precise roles in temporomandibular disorders have not yet been clarified. The aims of this study were to investigate the gene expression of fibrinolytic factors urokinase plasminogen activator (uPA) and plasminogen activator inhibitor-1 (PAI-1) in the articular cartilage of rabbit temporomandibular joint (TMJ) with disc displacement (DD) and to probe the relationship between fibrinolytic activity and cartilage remodeling. Disc displacement of right joints was performed in 36 of 78 rabbits under investigation. The animals were sacrificed at 4 days and 1, 2, 4, 8 and 12 weeks after surgery, respectively. The right joints of these animals were harvested and processed for the examination of mRNA expression of uPA and PAI-1 in articular cartilage using in situ hybridization techniques. The expression of uPA and PAI-1 was co-expressed weakly in the chondrocytes from transitive zone to hypertrophic zone and mineralized zone, while no hybridizing signals were shown in proliferative zone and superficial zone in control rabbits. The most striking was the up-regulation of uPA and PAI-1 mRNA in 4-day rabbits postoperatively at the onset of cartilage degeneration. The strongest hybridizing signals for uPA and PAI-1 were seen in 2-week rabbits postoperatively. After 2 weeks, the expression of uPA and PAI-1 began to decrease and reached nearly normal level at 12 weeks. The expression of the uPA/PAI-1 system coincides with the pathological changes in condylar cartilage after DD. The uPA/PAI-1 system may be one of the essential mediators in articular cartilage remodeling.
Hu, Yuhui; Willett, Kristine L.; Khan, Ikhlas A.; Scheffler, Brian E.; Dasmahapatra, Asok K.
2009-01-01
Medaka (Oryzias latipes) embryos at different developmental stages were exposed to ethanol for 48 h, then allowed to hatch. Teratogenic effects were evaluated in hatchlings after examining chondrocranial cartilage deformities. Ethanol disrupted cartilage development in medaka in a dose and developmental stage-specific manner. Compared to controls, the linear length of the neurocranium and other cartilages were reduced in ethanol-treated groups. Moreover, the chondrification in cartilages, specifically trabeculae and polar cartilages, were inhibited by ethanol. To understand the mechanism of ethanol teratogenesis, NAD+: NADH status during embryogenesis and the methylation pattern of Aldh1A2 promoter in whole embryos and adult tissues (brain, eye, heart and liver) were analyzed. Embryos 6 dpf had higher NAD+ than embryos 0 or 2 dpf. Ethanol (200 or 400 mM) was able to reduce NAD+ content in 2 and 6 dpf embryos. However, in both cases reductions were not significantly different from the controls. Moreover, no significant difference in either NADH content or in NAD+: NADH status of the ethanol-treated embryos, with regard to controls, was observed. The promoter of Aldh1A2 contains 31 CpG dinucleotides (-705 to +154, ATG = +1); none of which were methylated. Compared to controls, embryonic ethanol exposure (100 and 400 mM) was unable to alter Aldh1A2 promoter methylation in embryos or in the tissues of adults (breeding) developmentally exposed to ethanol (300 mM, 48 hpf). From these data we conclude that ethanol teratogenesis in medaka does not induce alteration in the methylation pattern of Aldh1A2 promoter, but does change cartilage development. PMID:19651241
2013-01-01
Introduction Current therapies for articular cartilage defects fail to achieve qualitatively sufficient tissue regeneration, possibly because of a mismatch between the speed of cartilage rebuilding and the resorption of degradable implant polymers. The present study focused on the self-healing capacity of resident cartilage cells in conjunction with cell-free and biocompatible (but non-resorbable) bacterial nanocellulose (BNC). This was tested in a novel in vitro bovine cartilage punch model. Methods Standardized bovine cartilage discs with a central defect filled with BNC were cultured for up to eight weeks with/without stimulation with transforming growth factor-β1 (TGF-β1. Cartilage formation and integrity were analyzed by histology, immunohistochemistry and electron microscopy. Content, release and neosynthesis of the matrix molecules proteoglycan/aggrecan, collagen II and collagen I were also quantified. Finally, gene expression of these molecules was profiled in resident chondrocytes and chondrocytes migrated onto the cartilage surface or the implant material. Results Non-stimulated and especially TGF-β1-stimulated cartilage discs displayed a preserved structural and functional integrity of the chondrocytes and surrounding matrix, remained vital in long-term culture (eight weeks) without signs of degeneration and showed substantial synthesis of cartilage-specific molecules at the protein and mRNA level. Whereas mobilization of chondrocytes from the matrix onto the surface of cartilage and implant was pivotal for successful seeding of cell-free BNC, chondrocytes did not immigrate into the central BNC area, possibly due to the relatively small diameter of its pores (2 to 5 μm). Chondrocytes on the BNC surface showed signs of successful redifferentiation over time, including increase of aggrecan/collagen type II mRNA, decrease of collagen type I mRNA and initial deposition of proteoglycan and collagen type II in long-term high-density pellet cultures
Robustness and accuracy in sea urchin developmental gene regulatory networks
Directory of Open Access Journals (Sweden)
Smadar eBen-Tabou De-Leon
2016-02-01
Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions
Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.
2011-01-01
The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518
An oscillopathic approach to developmental dyslexia: From genes to speech processing.
Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio
2017-06-30
Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Levato, Riccardo; Webb, William R; Otto, Iris A; Mensinga, Anneloes; Zhang, Yadan; van Rijen, Mattie; van Weeren, René; Khan, Ilyas M; Malda, Jos
2017-10-01
Cell-laden hydrogels are the primary building blocks for bioprinting, and, also termed bioinks, are the foundations for creating structures that can potentially recapitulate the architecture of articular cartilage. To be functional, hydrogel constructs need to unlock the regenerative capacity of encapsulated cells. The recent identification of multipotent articular cartilage-resident chondroprogenitor cells (ACPCs), which share important traits with adult stem cells, represents a new opportunity for cartilage regeneration. However, little is known about the suitability of ACPCs for tissue engineering, especially in combination with biomaterials. This study aimed to investigate the potential of ACPCs in hydrogels for cartilage regeneration and biofabrication, and to evaluate their ability for zone-specific matrix production. Gelatin methacryloyl (gelMA)-based hydrogels were used to culture ACPCs, bone marrow mesenchymal stromal cells (MSCs) and chondrocytes, and as bioinks for printing. Our data shows ACPCs outperformed chondrocytes in terms of neo-cartilage production and unlike MSCs, ACPCs had the lowest gene expression levels of hypertrophy marker collagen type X, and the highest expression of PRG4, a key factor in joint lubrication. Co-cultures of the cell types in multi-compartment hydrogels allowed generating constructs with a layered distribution of collagens and glycosaminoglycans. By combining ACPC- and MSC-laden bioinks, a bioprinted model of articular cartilage was generated, consisting of defined superficial and deep regions, each with distinct cellular and extracellular matrix composition. Taken together, these results provide important information for the use of ACPC-laden hydrogels in regenerative medicine, and pave the way to the biofabrication of 3D constructs with multiple cell types for cartilage regeneration or in vitro tissue models. Despite its limited ability to repair, articular cartilage harbors an endogenous population of progenitor cells
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
International Nuclear Information System (INIS)
Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.
2008-01-01
The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans
Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen
2017-07-01
In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.
New Frontiers for Cartilage Repair and Protection.
Zaslav, Kenneth; McAdams, Timothy; Scopp, Jason; Theosadakis, Jason; Mahajan, Vivek; Gobbi, Alberto
2012-01-01
Articular cartilage injury is common after athletic injury and remains a difficult treatment conundrum both for the surgeon and athlete. Although recent treatments for damage to articular cartilage have been successful in alleviating symptoms, more durable and complete, long-term articular surface restoration remains the unattained goal. In this article, we look at both new ways to prevent damage to articular surfaces as well as new techniques to recreate biomechanically sound and biochemically true articular surfaces once an athlete injures this surface. This goal should include reproducing hyaline cartilage with a well-integrated and flexible subchondral base and the normal zonal variability in the articular matrix. A number of nonoperative interventions have shown early promise in mitigating cartilage symptoms and in preclinical studies have shown evidence of chondroprotection. These include the use of glucosamine, chondroitin, and other neutraceuticals, viscosupplementation with hyaluronic acid, platelet-rich plasma, and pulsed electromagnetic fields. Newer surgical techniques, some already in clinical study, and others on the horizon offer opportunities to improve the surgical restoration of the hyaline matrix often disrupted in athletic injury. These include new scaffolds, single-stage cell techniques, the use of mesenchymal stem cells, and gene therapy. Although many of these treatments are in the preclinical and early clinical study phase, they offer the promise of better options to mitigate the sequelae of athletically induced cartilage.
Garrison, Presley; Yue, Shanna; Hanson, Jeffrey; Baron, Jeffrey; Lui, Julian C.
2017-01-01
Articular and growth plate cartilage both arise from condensations of mesenchymal cells, but ultimately develop important histological and functional differences. Each is composed of three layers—the superficial, mid and deep zones of articular cartilage and the resting, proliferative and hypertrophic zones of growth plate cartilage. The bone morphogenetic protein (BMP) system plays an important role in cartilage development. A gradient in expression of BMP-related genes has been observed across growth plate cartilage, likely playing a role in zonal differentiation. To investigate the presence of a similar expression gradient in articular cartilage, we used laser capture microdissection (LCM) to separate murine growth plate and articular cartilage from the proximal tibia into their six constituent zones, and used a solution hybridization assay with color-coded probes (nCounter) to quantify mRNAs for 30 different BMP-related genes in each zone. In situ hybridization and immunohistochemistry were then used to confirm spatial expression patterns. Expression gradients for Bmp2 and 6 were observed across growth plate cartilage with highest expression in hypertrophic zone. However, intracellular BMP signaling, assessed by phospho-Smad1/5/8 immunohistochemical staining, appeared to be higher in the proliferative zone and prehypertrophic area than in hypertrophic zone, possibly due to high expression of Smad7, an inhibitory Smad, in the hypertrophic zone. We also found BMP expression gradients across the articular cartilage with BMP agonists primarily expressed in the superficial zone and BMP functional antagonists primarily expressed in the deep zone. Phospho-Smad1/5/8 immunohistochemical staining showed a similar gradient. In combination with previous evidence that BMPs regulate chondrocyte proliferation and differentiation, the current findings suggest that BMP signaling gradients exist across both growth plate and articular cartilage and that these gradients may
Imaging of articular cartilage
Directory of Open Access Journals (Sweden)
Bhawan K Paunipagar
2014-01-01
Full Text Available We tried to review the role of magnetic resonance imaging (MRI in understanding microscopic and morphologic structure of the articular cartilage. The optimal protocols and available spin-echo sequences in present day practice are reviewed in context of common pathologies of articular cartilage. The future trends of articular cartilage imaging have been discussed with their appropriateness. In diarthrodial joints of the body, articular cartilage is functionally very important. It is frequently exposed to trauma, degeneration, and repetitive wear and tear. MRI has played a vital role in evaluation of articular cartilage. With the availability of advanced repair surgeries for cartilage lesions, there has been an increased demand for improved cartilage imaging techniques. Recent advances in imaging strategies for native and postoperative articular cartilage open up an entirely new approach in management of cartilage-related pathologies.
Directory of Open Access Journals (Sweden)
Kim Man-Sun
2012-05-01
Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.
The properties of bioengineered chondrocyte sheets for cartilage regeneration
Directory of Open Access Journals (Sweden)
Ota Naoshi
2009-03-01
Full Text Available Abstract Background Although the clinical results of autologous chondrocyte implantation for articular cartilage defects have recently improved as a result of advanced techniques based on tissue engineering procedures, problems with cell handling and scaffold imperfections remain to be solved. A new cell-sheet technique has been developed, and is potentially able to overcome these obstacles. Chondrocyte sheets applicable to cartilage regeneration can be prepared with this cell-sheet technique using temperature-responsive culture dishes. However, for clinical application, it is necessary to evaluate the characteristics of the cells in these sheets and to identify their similarities to naive cartilage. Results The expression of SOX 9, collagen type 2, 27, integrin α10, and fibronectin genes in triple-layered chondrocyte sheets was significantly increased in comparison to those in conventional monolayer culture and in a single chondrocyte sheet, implying a nature similar to ordinary cartilage. In addition, immunohistochemistry demonstrated that collagen type II, fibronectin, and integrin α10 were present in the triple-layered chondrocyte sheets. Conclusion The results of this study indicate that these chondrocyte sheets with a consistent cartilaginous phenotype and adhesive properties may lead to a new strategy for cartilage regeneration.
Predicting knee cartilage loss using adaptive partitioning of cartilage thickness maps
DEFF Research Database (Denmark)
Jørgensen, Dan Richter; Dam, Erik Bjørnager; Lillholm, Martin
2013-01-01
This study investigates whether measures of knee cartilage thickness can predict future loss of knee cartilage. A slow and a rapid progressor group was determined using longitudinal data, and anatomically aligned cartilage thickness maps were extracted from MRI at baseline. A novel machine learning...... framework was then trained using these maps. Compared to measures of mean cartilage plate thickness, group separation was increased by focusing on local cartilage differences. This result is central for clinical trials where inclusion of rapid progressors may help reduce the period needed to study effects...
Diverse roles of integrin receptors in articular cartilage.
Shakibaei, M; Csaki, C; Mobasheri, A
2008-01-01
Integrins are heterodimeric integral membrane proteins made up of alpha and beta subunits. At least eighteen alpha and eight beta subunit genes have been described in mammals. Integrin family members are plasma membrane receptors involved in cell adhesion and active as intra- and extracellular signalling molecules in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic spread of tumour cells. Integrin beta 1 (beta1-integrin), the protein encoded by the ITGB1 gene (also known as CD29 and VLAB), is a multi-functional protein involved in cell-matrix adhesion, cell signalling, cellular defense, cell adhesion, protein binding, protein heterodimerisation and receptor-mediated activity. It is highly expressed in the human body (17.4 times higher than the average gene in the last updated revision of the human genome). The extracellular matrix (ECM) of articular cartilage is a unique environment. Interactions between chondrocytes and the ECM regulate many biological processes important to homeostasis and repair of articular cartilage, including cell attachment, growth, differentiation and survival. The beta1-integrin family of cell surface receptors appears to play a major role in mediating cell-matrix interactions that are important in regulating these fundamental processes. Chondrocyte mechanoreceptors have been proposed to incorporate beta1-integrins and mechanosensitive ion channels which link with key ECM, cytoskeletal and signalling proteins to maintain the chondrocyte phenotype, prevent chondrocyte apoptosis and regulate chondrocyte-specific gene expression. This review focuses on the expression and function of beta1-integrins in articular chondrocytes, its role in the unique biology of these cells and its distribution in cartilage.
RHEB: a potential regulator of chondrocyte phenotype for cartilage tissue regeneration.
Ashraf, S; Ahn, J; Cha, B-H; Kim, J-S; Han, I; Park, H; Lee, S-H
2017-09-01
As articular cartilage has a limited ability to self-repair, successful cartilage regeneration requires clinical-grade chondrocytes with innate characteristics. However, cartilage regeneration via chondrocyte transplantation is challenging, because chondrocytes lose their innate characteristics during in vitro expansion. Here, we investigated the mechanistic underpinning of the gene Ras homologue enriched in brain (RHEB) in the control of senescence and dedifferentiation through the modulation of oxidative stress in chondrocytes, a hallmark of osteoarthritis. Serial expansion of human chondrocytes led to senescence, dedifferentiation and oxidative stress. RHEB maintained the innate characteristics of chondrocytes by regulating senescence, dedifferentiation and oxidative stress, leading to the upregulation of COL2 expression via SOX9 and the downregulation of p27 expression via MCL1. RHEB also decreased the expression of COL10. RHEB knockdown mimics decreased the expression of SOX9, COL2 and MCL1, while abrogating the suppressive function of RHEB on p27 and COL10 in chondrocytes. RHEB-overexpressing chondrocytes successfully formed cartilage tissue in vitro as well as in vivo, with increased expression of GAG matrix and chondrogenic markers. RHEB induces a distinct gene expression signature that maintained the innate chondrogenic properties over a long period. Therefore, RHEB expression represents a potentially useful mechanism in terms of cartilage tissue regeneration from chondrocytes, by which chondrocyte phenotypic and molecular characteristics can be retained through the modulation of senescence, dedifferentiation and oxidative stress. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Vukasović, Andreja; Ivković, Alan; Jezek, Davor; Cerovecki, Ivan; Vnuk, Drazen; Kreszinger, Mario; Hudetz, Damir; Pećina, Marko
2011-01-01
Articular cartilage is an avascular and aneural tissue lacking lymph drainage, hence its inability of spontaneous repair following injury. Thus, it offers an interesting model for scientific research. A number of methods have been suggested to enhance cartilage repair, but none has yet produced significant success. The possible application of the aforementioned methods has brought about the necessity to evaluate their results. The objective of this study was to analyze results of a study of the effects of the use of TGF-beta gene transduced bone marrow clot on articular cartilage defects using ICRS visual histological assessment scale. The research was conducted on 28 skeletally mature sheep that were randomly assigned to four groups and surgically inflicted femoral chondral defects. The articular surfaces were then treated with TGF-beta1 gene transduced bone marrow clot (TGF group), GFP transduced bone marrow clot (GFP group), untransduced bone marrow clot (BM group) or left untreated (NC group). The analysis was performed by visual examination of cartilage samples and results were obtained using ICRS visual histological assessment scale. The results were subsequently subjected to statistical assessment using Kruskal-Wallis and Mann-Whitney tests. Kruskal-Wallis test yielded statistically significant difference with respect to cell distribution. Mann-Whitney test showed statistically significant difference between TGF and NC groups (P = 0.002), as well as between BM and NC groups (P = 0.002 with Bonferroni correction). Twenty-six of the twenty-eight samples were subjected to histologic and subsequent statistical analysis; two were discarded due to faulty histology technique. Our results indicated a level of certainty as to the positive effect of TGF-beta1 gene transduced bone marrow clot in restoration of articular cartilage defects. However, additional research is necessary in the field. One of the significant drawbacks on histologic assessment of cartilage
Advanced Strategies for Articular Cartilage Defect Repair
Directory of Open Access Journals (Sweden)
Fergal J. O'Brien
2013-02-01
Full Text Available Articular cartilage is a unique tissue owing to its ability to withstand repetitive compressive stress throughout an individual’s lifetime. However, its major limitation is the inability to heal even the most minor injuries. There still remains an inherent lack of strategies that stimulate hyaline-like articular cartilage growth with appropriate functional properties. Recent scientific advances in tissue engineering have made significant steps towards development of constructs for articular cartilage repair. In particular, research has shown the potential of biomaterial physico-chemical properties significantly influencing the proliferation, differentiation and matrix deposition by progenitor cells. Accordingly, this highlights the potential of using such properties to direct the lineage towards which such cells follow. Moreover, the use of soluble growth factors to enhance the bioactivity and regenerative capacity of biomaterials has recently been adopted by researchers in the field of tissue engineering. In addition, gene therapy is a growing area that has found noteworthy use in tissue engineering partly due to the potential to overcome some drawbacks associated with current growth factor delivery systems. In this context, such advanced strategies in biomaterial science, cell-based and growth factor-based therapies that have been employed in the restoration and repair of damaged articular cartilage will be the focus of this review article.
Histone methyltransferase Setdb1 is indispensable for Meckel's cartilage development
International Nuclear Information System (INIS)
Yahiro, Kohei; Higashihori, Norihisa; Moriyama, Keiji
2017-01-01
The histone methyltransferase Setdb1 represses gene expression by catalyzing lysine 9 of histone H3 trimethylation. Given that the conventional knockout of Setdb1 is embryo-lethal at the implantation stage, its role in craniofacial development is poorly understood. Here, we investigated the role of Setdb1, using conditional knockout mice—in which Setdb1 was deleted in the Meckel's cartilage (Setdb1 CKO)—and the mouse chondrogenic cell line ATDC5—in which Setdb1 was inhibited by siRNA. Deletion of Setdb1 in Meckel's cartilage, the supportive tissue in the embryonic mandible, led to its enlargement, instead of the degeneration that normally occurs. Chondrocytes from the Meckel's cartilage of Setdb1 CKO mice showed increased size. Furthermore, at embryonic days 16.5 and 18.5, part of the perichondrium was disrupted and mineralization was observed in the Meckel's cartilage. Proliferation analysis showed that inhibition of Setdb1 caused increased proliferation in chondrocytes in the Meckel's cartilage as well as in ATDC5 cells. Quantitative RT-PCR showed decreased expression of chondrogenic genes, such as Sox9, Mmp13, Collagen II, and Aggrecan, as a result of Setdb1 inhibition in ATDC5 cells. Along with these phenomenons, SMAD-dependent BMP signaling was significantly increased by the loss of Setdb1 in both the Meckel's cartilage of Setdb1 CKO mice and ATDC5 cells. Therefore, the abnormal development of Meckel's cartilage in Setdb1 CKO mice is partly due to the enhanced SMAD-dependent BMP signaling. Overall, to our knowledge, the present study is the first to show that epigenetic regulation by Setdb1 is indispensable for the embryonic development of Meckel's cartilage. - Highlights: • Deletion of Setdb1 led to enlarged Meckel's cartilage. • Chondrocytes from the Meckel's cartilage of Setdb1 mutant showed increased in size. • Part of the perichondrium was disrupted and mineralization was observed in the Meckel
Directory of Open Access Journals (Sweden)
Daifeng Cheng
Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.
Developmental defects in zebrafish for classification of EGF pathway inhibitors
Energy Technology Data Exchange (ETDEWEB)
Pruvot, Benoist; Curé, Yoann; Djiotsa, Joachim; Voncken, Audrey; Muller, Marc, E-mail: m.muller@ulg.ac.be
2014-01-15
One of the major challenges when testing drug candidates targeted at a specific pathway in whole animals is the discrimination between specific effects and unwanted, off-target effects. Here we used the zebrafish to define several developmental defects caused by impairment of Egf signaling, a major pathway of interest in tumor biology. We inactivated Egf signaling by genetically blocking Egf expression or using specific inhibitors of the Egf receptor function. We show that the combined occurrence of defects in cartilage formation, disturbance of blood flow in the trunk and a decrease of myelin basic protein expression represent good indicators for impairment of Egf signaling. Finally, we present a classification of known tyrosine kinase inhibitors according to their specificity for the Egf pathway. In conclusion, we show that developmental indicators can help to discriminate between specific effects on the target pathway from off-target effects in molecularly targeted drug screening experiments in whole animal systems. - Highlights: • We analyze the functions of Egf signaling on zebrafish development. • Genetic blocking of Egf expression causes cartilage, myelin and circulatory defects. • Chemical inhibition of Egf receptor function causes similar defects. • Developmental defects can reveal the specificity of Egf pathway inhibitors.
Developmental defects in zebrafish for classification of EGF pathway inhibitors
International Nuclear Information System (INIS)
Pruvot, Benoist; Curé, Yoann; Djiotsa, Joachim; Voncken, Audrey; Muller, Marc
2014-01-01
One of the major challenges when testing drug candidates targeted at a specific pathway in whole animals is the discrimination between specific effects and unwanted, off-target effects. Here we used the zebrafish to define several developmental defects caused by impairment of Egf signaling, a major pathway of interest in tumor biology. We inactivated Egf signaling by genetically blocking Egf expression or using specific inhibitors of the Egf receptor function. We show that the combined occurrence of defects in cartilage formation, disturbance of blood flow in the trunk and a decrease of myelin basic protein expression represent good indicators for impairment of Egf signaling. Finally, we present a classification of known tyrosine kinase inhibitors according to their specificity for the Egf pathway. In conclusion, we show that developmental indicators can help to discriminate between specific effects on the target pathway from off-target effects in molecularly targeted drug screening experiments in whole animal systems. - Highlights: • We analyze the functions of Egf signaling on zebrafish development. • Genetic blocking of Egf expression causes cartilage, myelin and circulatory defects. • Chemical inhibition of Egf receptor function causes similar defects. • Developmental defects can reveal the specificity of Egf pathway inhibitors
Mizuno, Mitsuru; Kobayashi, Shinji; Takebe, Takanori; Kan, Hiroomi; Yabuki, Yuichiro; Matsuzaki, Takahisa; Yoshikawa, Hiroshi Y; Nakabayashi, Seiichiro; Ik, Lee Jeong; Maegawa, Jiro; Taniguchi, Hideki
2014-03-01
In healthy joints, hyaline cartilage covering the joint surfaces of bones provides cushioning due to its unique mechanical properties. However, because of its limited regenerative capacity, age- and sports-related injuries to this tissue may lead to degenerative arthropathies, prompting researchers to investigate a variety of cell sources. We recently succeeded in isolating human cartilage progenitor cells from ear elastic cartilage. Human cartilage progenitor cells have high chondrogenic and proliferative potential to form elastic cartilage with long-term tissue maintenance. However, it is unknown whether ear-derived cartilage progenitor cells can be used to reconstruct hyaline cartilage, which has different mechanical and histological properties from elastic cartilage. In our efforts to develop foundational technologies for joint hyaline cartilage repair and reconstruction, we conducted this study to obtain an answer to this question. We created an experimental canine model of knee joint cartilage damage, transplanted ear-derived autologous cartilage progenitor cells. The reconstructed cartilage was rich in proteoglycans and showed unique histological characteristics similar to joint hyaline cartilage. In addition, mechanical properties of the reconstructed tissues were higher than those of ear cartilage and equal to those of joint hyaline cartilage. This study suggested that joint hyaline cartilage was reconstructed from ear-derived cartilage progenitor cells. It also demonstrated that ear-derived cartilage progenitor cells, which can be harvested by a minimally invasive method, would be useful for reconstructing joint hyaline cartilage in patients with degenerative arthropathies. © AlphaMed Press.
White, Lawrence M; Sussman, Marshall S; Hurtig, Mark; Probyn, Linda; Tomlinson, George; Kandel, Rita
2006-11-01
To prospectively assess T2 mapping characteristics of normal articular cartilage and of cartilage at sites of arthroscopic repair, including comparison with histologic results and collagen organization assessed at polarized light microscopy (PLM). Study protocol was compliant with the Canadian Council on Animal Care Guidelines and approved by the institutional animal care committee. Arthroscopic osteochondral autograft transplantation (OAT) and microfracture arthroplasty (MFx) were performed in knees of 10 equine subjects (seven female, three male; age range, 3-5 years). A site of arthroscopically normal cartilage was documented in each joint as a control site. Joints were harvested at 12 (n = 5) and 24 (n = 5) weeks postoperatively and were imaged at 1.5-T magnetic resonance (MR) with a 10-echo sagittal fast spin-echo acquisition. T2 maps of each site (21 OAT harvest, 10 MFx, 12 OAT plug, and 10 control sites) were calculated with linear least-squares curve fitting. Cartilage T2 maps were qualitatively graded as "organized" (normal transition of low-to-high T2 signal from deep to superficial cartilage zones) or "disorganized." Quantitative mean T2 values were calculated for deep, middle, and superficial cartilage at each location. Results were compared with histologic and PLM assessments by using kappa analysis. T2 maps were qualitatively graded as organized at 20 of 53 sites and as disorganized at 33 sites. Perfect agreement was seen between organized T2 and histologic findings of hyaline cartilage and between disorganized T2 and histologic findings of fibrous reparative tissue (kappa = 1.0). Strong agreement was seen between organized T2 and normal PLM findings and between disorganized T2 and abnormal PLM findings (kappa = .92). Quantitative assessment of the deep, middle, and superficial cartilage, respectively, showed mean T2 values of 53.3, 58.6, and 54.9 msec at reparative fibrous tissue sites and 40.7, 53.6, and 61.6 msec at hyaline cartilage sites. A
A vision on the future of articular cartilage repair
Directory of Open Access Journals (Sweden)
M Cucchiarini
2014-05-01
Full Text Available An AO Foundation (Davos, Switzerland sponsored workshop "Cell Therapy in Cartilage Repair" from the Symposium "Where Science meets Clinics" (September 5-7, 2013, Davos gathered leaders from medicine, science, industry, and regulatory organisations to debate the vision of cell therapy in articular cartilage repair and the measures that could be taken to narrow the gap between vision and current practice. Cell-based therapy is already in clinical use to enhance the repair of cartilage lesions, with procedures such as microfracture and articular chondrocyte implantation. However, even though long term follow up is good from a clinical perspective and some of the most rigorous randomised controlled trials in the regenerative medicine/orthopaedics field show beneficial effect, none of these options have proved successful in restoring the original articular cartilage structure and functionality in patients so far. With the remarkable recent advances in experimental research in cell biology (new sources for chondrocytes, stem cells, molecular biology (growth factors, genes, biomaterials, biomechanics, and translational science, a combined effort between scientists and clinicians with broad expertise may allow development of an improved cell therapy for cartilage repair. This position paper describes the current state of the art in the field to help define a procedure adapted to the clinical situation for upcoming translation in the patient.
Characterization of the cartilage DNA methylome in knee and hip osteoarthritis.
Rushton, Michael D; Reynard, Louise N; Barter, Matt J; Refaie, Ramsay; Rankin, Kenneth S; Young, David A; Loughlin, John
2014-09-01
The aim of this study was to characterize the genome-wide DNA methylation profile of chondrocytes from knee and hip cartilage obtained from patients with osteoarthritis (OA) and hip cartilage obtained from patients with femoral neck fracture, providing the first comparison of DNA methylation between OA and non-OA hip cartilage, and between OA hip and OA knee cartilage. The study was performed using the Illumina Infinium HumanMethylation450 BeadChip array, which allows the annotation of ∼480,000 CpG sites. Genome-wide methylation was assessed in chondrocyte DNA extracted from 23 hip OA patients, 73 knee OA patients, and 21 healthy hip control patients with femoral neck fracture. Analysis revealed that chondrocytes from the hip cartilage of OA patients and healthy controls have unique methylation profiles, with 5,322 differentially methylated loci (DMLs) identified between the 2 groups. In addition, a comparison between hip and knee OA chondrocytes revealed 5,547 DMLs between the 2 groups, including DMLs in several genes known to be involved in the pathogenesis of OA. Hip OA samples were found to cluster into 2 groups. A total of 15,239 DMLs were identified between the 2 clusters, with an enrichment of genes involved in inflammation and immunity. Similarly, we confirmed a previous report of knee OA samples that also clustered into 2 groups. We demonstrated that global DNA methylation using a high-density array can be a powerful tool in the characterization of OA at the molecular level. Identification of pathways enriched in DMLs between OA and OA-free cartilage highlight potential etiologic mechanisms that are involved in the initiation and/or progression of the disease and that could be therapeutically targeted. © 2014 The Authors. Arthritis & Rheumatology is published by Wiley Periodicals, Inc. on behalf of the American College of Rheumatology.
... Research Matters NIH Research Matters March 3, 2014 Engineering Cartilage Artistic rendering of human stem cells on ... situations has been a major goal in tissue engineering. Cartilage contains water, collagen, proteoglycans, and chondrocytes. Collagens ...
Madry, Henning; Kaul, Gunter; Zurakowski, David; Vunjak-Novakovic, Gordana; Cucchiarini, Magali
2015-01-01
Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes over expressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-over expressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects. PMID:23588785
Directory of Open Access Journals (Sweden)
H Madry
2013-04-01
Full Text Available Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes overexpressing a human insulin-like growth factor I (IGF-I gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-overexpressing chondrocytes markedly improved osteochondral repair compared with control (lacZ constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects.
Shark cartilage (tough elastic tissue that provides support, much as bone does) used for medicine comes primarily from sharks ... Several types of extracts are made from shark cartilage including squalamine lactate, AE-941, and U-995. ...
International Nuclear Information System (INIS)
Utomo, Lizette; Pleumeekers, Mieke M; Van Osch, Gerjo J V M; Nimeskern, Luc; Stok, Kathryn S; Nürnberger, Sylvia; Hildner, Florian
2015-01-01
Scaffolds are widely used to reconstruct cartilage. Yet, the fabrication of a scaffold with a highly organized microenvironment that closely resembles native cartilage remains a major challenge. Scaffolds derived from acellular extracellular matrices are able to provide such a microenvironment. Currently, no report specifically on decellularization of full thickness ear cartilage has been published. In this study, decellularized ear cartilage scaffolds were prepared and extensively characterized. Cartilage decellularization was optimized to remove cells and cell remnants from elastic cartilage. Following removal of nuclear material, the obtained scaffolds retained their native collagen and elastin contents as well as their architecture and shape. High magnification scanning electron microscopy showed no obvious difference in matrix density after decellularization. However, glycosaminoglycan content was significantly reduced, resulting in a loss of viscoelastic properties. Additionally, in contact with the scaffolds, human bone-marrow-derived mesenchymal stem cells remained viable and are able to differentiate toward the chondrogenic lineage when cultured in vitro. These results, including the ability to decellularize whole human ears, highlight the clinical potential of decellularization as an improved cartilage reconstruction strategy. (paper)
Decellularized cartilage may be a chondroinductive material for osteochondral tissue engineering.
Directory of Open Access Journals (Sweden)
Amanda J Sutherland
Full Text Available Extracellular matrix (ECM-based materials are attractive for regenerative medicine in their ability to potentially aid in stem cell recruitment, infiltration, and differentiation without added biological factors. In musculoskeletal tissue engineering, demineralized bone matrix is widely used, but recently cartilage matrix has been attracting attention as a potentially chondroinductive material. The aim of this study was thus to establish a chemical decellularization method for use with articular cartilage to quantify removal of cells and analyze the cartilage biochemical content at various stages during the decellularization process, which included a physically devitalization step. To study the cellular response to the cartilage matrix, rat bone marrow-derived mesenchymal stem cells (rBMSCs were cultured in cell pellets containing cells only (control, chondrogenic differentiation medium (TGF-β, chemically decellularized cartilage particles (DCC, or physically devitalized cartilage particles (DVC. The chemical decellularization process removed the vast majority of DNA and about half of the glycosaminoglycans (GAG within the matrix, but had no significant effect on the amount of hydroxyproline. Most notably, the DCC group significantly outperformed TGF-β in chondroinduction of rBMSCs, with collagen II gene expression an order of magnitude or more higher. While DVC did not exhibit a chondrogenic response to the extent that DCC did, DVC had a greater down regulation of collagen I, collagen X and Runx2. A new protocol has been introduced for cartilage devitalization and decellularization in the current study, with evidence of chondroinductivity. Such bioactivity along with providing the 'raw material' building blocks of regenerating cartilage may suggest a promising role for DCC in biomaterials that rely on recruiting endogenous cell recruitment and differentiation for cartilage regeneration.
The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes
Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas
2018-01-01
Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203
The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.
Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas
2018-04-01
The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
Sex-Specific Protection of Osteoarthritis by Deleting Cartilage Acid Protein 1
Ge, Xianpeng; Ritter, Susan Y.; Tsang, Kelly; Shi, Ruirui; Takei, Kohtaro; Aliprantis, Antonios O.
2016-01-01
Cartilage acidic protein 1 (CRTAC1) was recently identified as an elevated protein in the synovial fluid of patients with osteoarthritis (OA) by a proteomic analysis. This gene is also upregulated in both human and mouse OA by transcriptomic analysis. The objective of this study was to characterize the expression and function of CRTAC1 in OA. Here, we first confirm the increase of CRTAC1 in cartilage biopsies from OA patients undergoing joint replacement by real-time PCR and immunohistochemis...
van Valburg, A. A.; Wenting, M. J.; Beekman, B.; te Koppele, J. M.; Lafeber, F. P.; Bijlsma, J. W.
1997-01-01
To investigate whether macroscopically fibrillated human articular knee cartilage observed at autopsy can be considered an early, preclinical phase of osteoarthritis (OA). Histological and biochemical characteristics of 3 types of articular knee cartilage were compared: macroscopically degenerated
Degeneration of osteoarthritis cartilage
DEFF Research Database (Denmark)
Jørgensen, Dan Richter
of sensitive biomarkers for monitoring disease progression. This thesis investigates how subregional measures of cartilage thickness can be used to improve upon current imaging biomarkers. The first part of this investigation aims to discover discriminative areas in the cartilage using machine......-learning techniques specifically developed to take advantage of the spatial nature of the problem. The methods were evaluated on data from a longitudinal study where detailed cartilage thickness maps were quantified from magnetic resonance images. The results showed that focal differences in cartilage thickness may...... be relevant for both OA diagnosis and for prediction of future cartilage loss. The second part of the thesis investigates spatial patterns of longitudinal cartilage thickness changes in healthy and OA knees. Based on our findings, we propose a new, conceptually simple biomarker that embraces the heterogeneous...
First and second order stereology of hyaline cartilage: Application on mice femoral cartilage.
Noorafshan, Ali; Niazi, Behnam; Mohamadpour, Masoomeh; Hoseini, Leila; Hoseini, Najmeh; Owji, Ali Akbar; Rafati, Ali; Sadeghi, Yasaman; Karbalay-Doust, Saied
2016-11-01
Stereological techniques could be considered in research on cartilage to obtain quantitative data. The present study aimed to explain application of the first- and second-order stereological methods on articular cartilage of mice and the methods applied on the mice exposed to cadmium (Cd). The distal femoral articular cartilage of BALB/c mice (control and Cd-treated) was removed. Then, volume and surface area of the cartilage and number of chondrocytes were estimated using Cavalieri and optical dissector techniques on isotropic uniform random sections. Pair-correlation function [g(r)] and cross-correlation function were calculated to express the spatial arrangement of chondrocytes-chondrocytes and chondrocytes-matrix (chondrocyte clustering/dispersing), respectively. The mean±standard deviation of the cartilage volume, surface area, and thickness were 1.4±0.1mm 3 , 26.2±5.4mm 2 , and 52.8±6.7μm, respectively. Besides, the mean number of chondrocytes was 680±200 (×10 3 ). The cartilage volume, cartilage surface area, and number of chondrocytes were respectively reduced by 25%, 27%, and 27% in the Cd-treated mice in comparison to the control animals (pcartilage components carried potential advantages for investigating the cartilage in different joint conditions. Chondrocyte clustering/dispersing and cellularity can be evaluated in cartilage assessment in normal or abnormal situations. Copyright © 2016 Elsevier GmbH. All rights reserved.
Ribosomal protein gene knockdown causes developmental defects in zebrafish.
Directory of Open Access Journals (Sweden)
Tamayo Uechi
Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.
Energy Technology Data Exchange (ETDEWEB)
Imhof, H.; Noebauer-Huhmann, I.-M.; Krestan, C.; Gahleitner, A.; Marlovits, S.; Trattnig, S. [Department of Osteology, Universitaetklinik fuer Radiodiagnostik, AKH-Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria); Sulzbacher, I. [Universitaetsklinik fuer Pathologie Vienna, Waehringer Guertel 18-20, 1090 Vienna (Austria)
2002-11-01
With the introduction of fat-suppressed gradient-echo and fast spin-echo (FSE) sequences in clinical routine MR visualization of the hyaline articular cartilage is routinely possible in the larger joints. While 3D gradient-echo with fat suppression allows exact depiction of the thickness and surface of cartilage, FSE outlines the normal and abnormal internal structures of the hyaline cartilage; therefore, both sequences seem to be necessary in a standard MRI protocol for cartilage visualization. In diagnostically ambiguous cases, in which important therapeutic decisions are required, direct MR arthrography is the established imaging standard as an add-on procedure. Despite the social impact and prevalence, until recent years there was a paucity of knowledge about the pathogenesis of cartilage damage. With the introduction of high-resolution MRI with powerful surface coils and fat-suppression techniques, visualization of the articular cartilage is now routinely possible in many joints. After a short summary of the anatomy and physiology of the hyaline cartilage, the different MR imaging methods are discussed and recommended standards are suggested. (orig.)
MR imaging of articular cartilage
International Nuclear Information System (INIS)
Schaefer, F.K.W.; Muhle, C.; Heller, M.; Brossmann, J.
2001-01-01
MR imaging has evolved to the best non-invasive method for the evaluation of articular cartilage. MR imaging helps to understand the structure and physiology of cartilage, and to diagnose cartilage lesions. Numerous studies have shown high accuracy and reliability concerning detection of cartilage lesions and early changes in both structure and biochemistry. High contrast-to-noise ratio and high spatial resolution are essential for analysis of articular cartilage. Fat-suppressed 3D-T 1 weighted gradient echo and T 2 -weighted fast spin echo sequences with or without fat suppression are recommended for clinical routine. In this article the anatomy and pathology of hyaline articular cartilage and the complex imaging characteristics of hyaline cartilage will be discussed. (orig.) [de
Directory of Open Access Journals (Sweden)
Erh-Hsuin Lim
2013-11-01
Full Text Available BackgroundTo overcome the potential drawbacks of a short half-life and dose-related adverse effects of using active transforming growth factor-beta 1 for cartilage engineering, a cell-mediated latent growth factor activation strategy was developed incorporating latent transforming growth factor-β1 (LTGF into an electrospun poly(L-lactide scaffold.MethodsThe electrospun scaffold was surface modified with NH3 plasma and biofunctionalised with LTGF to produce both random and orientated biofunctionalised electrospun scaffolds. Scaffold surface chemical analysis and growth factor bioavailability assays were performed. In vitro biocompatibility and human nasal chondrocyte gene expression with these biofunctionalised electrospun scaffold templates were assessed. In vivo chondrogenic activity and chondrocyte gene expression were evaluated in athymic rats.ResultsChemical analysis demonstrated that LTGF anchored to the scaffolds was available for enzymatic, chemical and cell activation. The biofunctionalised scaffolds were non-toxic. Gene expression suggested chondrocyte re-differentiation after 14 days in culture. By 6 weeks, the implanted biofunctionalised scaffolds had induced highly passaged chondrocytes to re-express Col2A1 and produce type II collagen.ConclusionsWe have demonstrated a proof of concept for cell-mediated activation of anchored growth factors using a novel biofunctionalised scaffold in cartilage engineering. This presents a platform for development of protein delivery systems and for tissue engineering.
Directory of Open Access Journals (Sweden)
Stromberg Arnold J
2009-09-01
Full Text Available Abstract Background Full-thickness articular cartilage lesions that reach to the subchondral bone yet are restricted to the chondral compartment usually fill with a fibrocartilage-like repair tissue which is structurally and biomechanically compromised relative to normal articular cartilage. The objective of this study was to evaluate transcriptional differences between chondrocytes of normal articular cartilage and repair tissue cells four months post-microfracture. Methods Bilateral one-cm2 full-thickness defects were made in the articular surface of both distal femurs of four adult horses followed by subchondral microfracture. Four months postoperatively, repair tissue from the lesion site and grossly normal articular cartilage from within the same femorotibial joint were collected. Total RNA was isolated from the tissue samples, linearly amplified, and applied to a 9,413-probe set equine-specific cDNA microarray. Eight paired comparisons matched by limb and horse were made with a dye-swap experimental design with validation by histological analyses and quantitative real-time polymerase chain reaction (RT-qPCR. Results Statistical analyses revealed 3,327 (35.3% differentially expressed probe sets. Expression of biomarkers typically associated with normal articular cartilage and fibrocartilage repair tissue corroborate earlier studies. Other changes in gene expression previously unassociated with cartilage repair were also revealed and validated by RT-qPCR. Conclusion The magnitude of divergence in transcriptional profiles between normal chondrocytes and the cells that populate repair tissue reveal substantial functional differences between these two cell populations. At the four-month postoperative time point, the relative deficiency within repair tissue of gene transcripts which typically define articular cartilage indicate that while cells occupying the lesion might be of mesenchymal origin, they have not recapitulated differentiation to
Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab
2015-09-04
A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our
Wang, L; Lazebnik, M; Detamore, M S
2009-03-01
To compare temporomandibular joint (TMJ) condylar cartilage cells in vitro to hyaline cartilage cells cultured in a three-dimensional (3D) environment for tissue engineering of mandibular condylar cartilage. Mandibular condylar cartilage and hyaline cartilage cells were harvested from pigs and cultured for 6 weeks in polyglycolic acid (PGA) scaffolds. Both types of cells were treated with glucosamine sulfate (0.4 mM), insulin-like growth factor-I (IGF-I) (100 ng/ml) and their combination. At weeks 0 and 6, cell number, glycosaminoglycan (GAG) and collagen content were determined, types I and II collagen were visualized by immunohistochemistry and GAGs were visualized by histology. Hyaline cartilage cells produced from half an order to a full order of magnitude more GAGs and collagen than mandibular condylar cartilage cells in 3D culture. IGF-I was a highly effective signal for biosynthesis with hyaline cartilage cells, while glucosamine sulfate decreased cell proliferation and biosynthesis with both types of cells. In vitro culture of TMJ condylar cartilage cells produced a fibrous tissue with predominantly type I collagen, while hyaline cartilage cells formed a fibrocartilage-like tissue with types I and II collagen. The combination of IGF and glucosamine had a synergistic effect on maintaining the phenotype of TMJ condylar cells to generate both types I and II collagen. Given the superior biosynthetic activity by hyaline cartilage cells and the practical surgical limitations of harvesting cells from the TMJ of a patient requiring TMJ reconstruction, cartilage cells from elsewhere in the body may be a potentially better alternative to cells harvested from the TMJ for TMJ tissue engineering. This finding may also apply to other fibrocartilages such as the intervertebral disc and knee meniscus in applications where a mature cartilage cell source is desired.
Directory of Open Access Journals (Sweden)
Fang-Tian Xu
2015-11-01
Full Text Available Background/Aims: Investigating and understanding chondrogenic gene expression during the differentiation of human breast adipose-derived stem cells (HBASCs into chondrogenic cells is a prerequisite for the application of this approach for cartilage repair and regeneration. In this study, we aim to characterize HBASCs and to examine chondrogenic gene expression in chondrogenic inductive culture medium containing ginsenoside Rg1. Methods: Human breast adipose-derived stem cells at passage 3 were evaluated based on specific cell markers and their multilineage differentiation capacity. Cultured HBASCs were treated either with basic chondrogenic inductive conditioned medium alone (group A, control or with basic chondrogenic inductive medium plus 10 µg/ml (group B, 50 µg/ml (group C, or 100µg/ml ginsenoside Rg1 (group D. Cell proliferation was assessed using the CCK-8 assay for a period of 9 days. Two weeks after induction, the expression of chondrogenic genes (collagen type II, collagen type XI, ACP, COMP and ELASTIN was determined using real-time PCR in all groups. Results: The different concentrations of ginsenoside Rg1 that were added to the basic chondrogenic inductive culture medium promoted the proliferation of HBASCs at earlier stages (groups B, C, and D but resulted in chondrogenic phenotype differentiation and higher mRNA expression of collagen type II (CO-II, collagen type XI (CO-XI, acid phosphatase (ACP, cartilage oligomeric matrix protein (COMP and ELASTIN compared with the control (group A at later stages. The results reveal an obvious positive dose-effect relationship between ginsenoside Rg1 and the proliferation and chondrogenic phenotype differentiation of HBASCs in vitro. Conclusions: Human breast adipose-derived stem cells retain stem cell characteristics after expansion in culture through passage 3 and serve as a feasible source of cells for cartilage regeneration in vitro. Chondrogenesis in HBASCs was found to be prominent
Glycosylation of DMP1 Is Essential for Chondrogenesis of Condylar Cartilage.
Weng, Y; Liu, Y; Du, H; Li, L; Jing, B; Zhang, Q; Wang, X; Wang, Z; Sun, Y
2017-12-01
The mandibular condylar cartilage (MCC) shoulders force for the subchondral bone during mastication. The cartilage matrix contains various large molecules, such as type I, II, and X collagens and proteoglycans (PGs), which jointly play essential roles in maintaining cartilage characteristics. PGs play key roles in maintaining the elasticity of cartilage and providing a cushion against mastication forces. In addition to the well-known PGs, DMP1-PG, which is the PG form of dentin matrix protein 1 (DMP1), is a newly identified PG. DMP1 is proteolytically processed in vivo, and the N-terminus is glycosylated into its PG form-that is, DMP1-PG, which is highly expressed not only in tooth and bone but also in the matrix of the MCC. However, the specific functions of DMP1-PG in the MCC remain unclear. In human temporomandibular joint osteoarthritis and hyperocclusion model rat specimens, PGs are significantly downregulated, and DMP1-PG is the most prominently affected PG. To further investigate the role of DMP1-PG in condylar chondrogenesis, a glycosylation site mutant (S 89 -G 89 ) mouse model was established with knock-in methods. In the MCC of the S89G-DMP1 mice, the glycosylation level of DMP1 was significantly downregulated, and a series of abnormal developmental and pathologic changes could be observed. The morphologic changes included thinner cartilage layers, deformations of the MCC, and disordered arrangements of the chondrocytes, and an earlier onset of temporomandibular joint osteoarthritis-like changes was observed. In addition, markers of chondrogenesis were downregulated, and the matrix of the MCC displayed OA phenotypes in the S89G-DMP1 mice. Further investigations showed that the transforming growth factor β signaling molecules were affected in the MCC after the loss of DMP1-PG. In addition, the loss of DMP1-PG significantly accelerated the progression of cartilage injuries in the hyperocclusion models. Given these findings, we investigated the significant
Infrapatellar Fat Pad Stem Cells: From Developmental Biology to Cell Therapy
Directory of Open Access Journals (Sweden)
Ronaldo J. F. C. do Amaral
2017-01-01
Full Text Available The ideal cell type to be used for cartilage therapy should possess a proven chondrogenic capacity, not cause donor-site morbidity, and should be readily expandable in culture without losing their phenotype. There are several cell sources being investigated to promote cartilage regeneration: mature articular chondrocytes, chondrocyte progenitors, and various stem cells. Most recently, stem cells isolated from joint tissue, such as chondrogenic stem/progenitors from cartilage itself, synovial fluid, synovial membrane, and infrapatellar fat pad (IFP have gained great attention due to their increased chondrogenic capacity over the bone marrow and subcutaneous adipose-derived stem cells. In this review, we first describe the IFP anatomy and compare and contrast it with other adipose tissues, with a particular focus on the embryological and developmental aspects of the tissue. We then discuss the recent advances in IFP stem cells for regenerative medicine. We compare their properties with other stem cell types and discuss an ontogeny relationship with other joint cells and their role on in vivo cartilage repair. We conclude with a perspective for future clinical trials using IFP stem cells.
Infrapatellar Fat Pad Stem Cells: From Developmental Biology to Cell Therapy.
do Amaral, Ronaldo J F C; Almeida, Henrique V; Kelly, Daniel J; O'Brien, Fergal J; Kearney, Cathal J
2017-01-01
The ideal cell type to be used for cartilage therapy should possess a proven chondrogenic capacity, not cause donor-site morbidity, and should be readily expandable in culture without losing their phenotype. There are several cell sources being investigated to promote cartilage regeneration: mature articular chondrocytes, chondrocyte progenitors, and various stem cells. Most recently, stem cells isolated from joint tissue, such as chondrogenic stem/progenitors from cartilage itself, synovial fluid, synovial membrane, and infrapatellar fat pad (IFP) have gained great attention due to their increased chondrogenic capacity over the bone marrow and subcutaneous adipose-derived stem cells. In this review, we first describe the IFP anatomy and compare and contrast it with other adipose tissues, with a particular focus on the embryological and developmental aspects of the tissue. We then discuss the recent advances in IFP stem cells for regenerative medicine. We compare their properties with other stem cell types and discuss an ontogeny relationship with other joint cells and their role on in vivo cartilage repair. We conclude with a perspective for future clinical trials using IFP stem cells.
When is cartilage repair successful?
International Nuclear Information System (INIS)
Raudner, M.; Roehrich, S.; Zalaudek, M.; Trattnig, S.; Schreiner, M.M.
2017-01-01
Focal cartilage lesions are a cause of long-term disability and morbidity. After cartilage repair, it is crucial to evaluate long-term progression or failure in a reproducible, standardized manner. This article provides an overview of the different cartilage repair procedures and important characteristics to look for in cartilage repair imaging. Specifics and pitfalls are pointed out alongside general aspects. After successful cartilage repair, a complete, but not hypertrophic filling of the defect is the primary criterion of treatment success. The repair tissue should also be completely integrated to the surrounding native cartilage. After some months, the transplants signal should be isointense compared to native cartilage. Complications like osteophytes, subchondral defects, cysts, adhesion and chronic bone marrow edema or joint effusion are common and have to be observed via follow-up. Radiological evaluation and interpretation of postoperative changes should always take the repair method into account. (orig.) [de
Haleem-Smith, Hana; Calderon, Raul; Song, Yingjie; Tuan, Rocky S; Chen, Faye H
2012-04-01
Cartilage oligomeric matrix protein/thrombospondin-5 (COMP/TSP5) is an abundant cartilage extracellular matrix (ECM) protein that interacts with major cartilage ECM components, including aggrecan and collagens. To test our hypothesis that COMP/TSP5 functions in the assembly of the ECM during cartilage morphogenesis, we have employed mesenchymal stem cell (MSC) chondrogenesis in vitro as a model to examine the effects of COMP over-expression on neo-cartilage formation. Human bone marrow-derived MSCs were transfected with either full-length COMP cDNA or control plasmid, followed by chondrogenic induction in three-dimensional pellet or alginate hydrogel culture. MSC chondrogenesis and ECM production was estimated based on quantitation of sulfated glycosaminoglycan (sGAG) accumulation, immunohistochemistry of the presence and distribution of cartilage ECM proteins, and real-time RT-PCR analyis of mRNA expression of cartilage markers. Our results showed that COMP over-expression resulted in increased total sGAG content during the early phase of MSC chondrogenesis, and increased immuno-detectable levels of aggrecan and collagen type II in the ECM of COMP-transfected pellet and alginate cultures, indicating more abundant cartilaginous matrix. COMP transfection did not significantly increase the transcript levels of the early chondrogenic marker, Sox9, or aggrecan, suggesting that enhancement of MSC cartilage ECM was effected at post-transcriptional levels. These findings strongly suggest that COMP functions in mesenchymal chondrogenesis by enhancing cartilage ECM organization and assembly. The action of COMP is most likely mediated not via direct changes in cartilage matrix gene expression but via interactions of COMP with other cartilage ECM proteins, such as aggrecan and collagens, that result in enhanced assembly and retention.
Haleem-Smith, Hana; Calderon, Raul; Song, Yingjie; Tuan, Rocky S.; Chen, Faye H.
2011-01-01
Cartilage oligomeric matrix protein/thrombospondin-5 (COMP/TSP5) is an abundant cartilage extracellular matrix (ECM) protein that interacts with major cartilage ECM components, including aggrecan and collagens. To test our hypothesis that COMP/TSP5 functions in the assembly of the ECM during cartilage morphogenesis, we have employed mesenchymal stem cell (MSC) chondrogenesis in vitro as a model to examine the effects of COMP over-expression on neo-cartilage formation. Human bone marrow-derived MSCs were transfected with either full-length COMP cDNA or control plasmid, followed by chondrogenic induction in three-dimensional pellet or alginate-hydrogel culture. MSC chondrogenesis and ECM production was estimated based on quantitation of sulfated glycosaminoglycan (sGAG) accumulation, immunohistochemistry of the presence and distribution of cartilage ECM proteins, and real-time RT-PCR analyis of mRNA expression of cartilage markers. Our results showed that COMP over-expression resulted in increased total sGAG content during the early phase of MSC chondrogenesis, and increased immuno-detectable levels of aggrecan and collagen type II in the ECM of COMP-transfected pellet and alginate cultures, indicating more abundant cartilaginous matrix. COMP transfection did not significantly increase the transcript levels of the early chondrogenic marker, Sox9, or aggrecan, suggesting that enhancement of MSC cartilage ECM was effected at post-transcriptional levels. These findings strongly suggest that COMP functions in mesenchymal chondrogenesis by enhancing cartilage ECM organization and assembly. The action of COMP is most likely mediated not via direct changes in cartilage matrix gene expression but via interactions of COMP with other cartilage ECM proteins, such as aggrecan and collagens, that result in enhanced assembly and retention. PMID:22095699
Zn deposition at the bone-cartilage interface in equine articular cartilage
Energy Technology Data Exchange (ETDEWEB)
Bradley, D.A. [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom)], E-mail: D.A.Bradley@surrey.ac.uk; Moger, C.J.; Winlove, C.P. [School of Physics, University of Exeter, Exeter, EX4 4QL (United Kingdom)
2007-09-21
In articular cartilage metalloproteinases, a family of enzymes whose function relies on the presence of divalent cations such as Zn and Ca plays a central role in the normal processes of growth and remodelling and in the degenerative and inflammatory processes of arthritis. Another important enzyme, alkaline phosphatase, involved in cartilage mineralisation also relies on metallic cofactors. The local concentration of divalent cations is therefore of considerable interest in cartilage pathophysiology and several authors have used synchrotron X-ray fluorescence (XRF) to map metal ion distributions in bone and cartilage. We report use of a bench-top XRF analytical microscope, providing spatial resolution of 10 {mu}m and applicable to histological sections, facilitating correlation of the distribution with structural features. The study seeks to establish the elemental distribution in normal tissue as a precursor to investigation of changes in disease. For six samples prepared from equine metacarpophalangeal joint, we observed increased concentration of Zn and Sr ions around the tidemark between normal and mineralised cartilage. This is believed to be an active site of remodelling but its composition has hitherto lacked detailed characterization. We also report preliminary results on two of the samples using Proton-Induced X-ray Emission (PIXE). This confirms our previous observations using synchrotron-based XRF of enhanced deposition of Sr and Zn at the surface of the subchondral bone and in articular cartilage.
Magnetically targeted delivery through cartilage
Jafari, Sahar; Mair, Lamar O.; Chowdhury, Sagar; Nacev, Alek; Hilaman, Ryan; Stepanov, Pavel; Baker-McKee, James; Ijanaten, Said; Koudelka, Christian; English, Bradley; Malik, Pulkit; Weinberg, Irving N.
2018-05-01
In this study, we have invented a method of delivering drugs deep into articular cartilage with shaped dynamic magnetic fields acting on small metallic magnetic nanoparticles with polyethylene glycol coating and average diameter of 30 nm. It was shown that transport of magnetic nanoparticles through the entire thickness of bovine articular cartilage can be controlled by a combined alternating magnetic field at 100 Hz frequency and static magnetic field of 0.8 tesla (T) generated by 1" dia. x 2" thick permanent magnet. Magnetic nanoparticles transport through bovine articular cartilage samples was investigated at various settings of magnetic field and time durations. Combined application of an alternating magnetic field and the static field gradient resulted in a nearly 50 times increase in magnetic nanoparticles transport in bovine articular cartilage tissue as compared with static field conditions. This method can be applied to locally deliver therapeutic-loaded magnetic nanoparticles deep into articular cartilage to prevent cartilage degeneration and promote cartilage repair in osteoarthritis.
Magnetically targeted delivery through cartilage
Directory of Open Access Journals (Sweden)
Sahar Jafari
2018-05-01
Full Text Available In this study, we have invented a method of delivering drugs deep into articular cartilage with shaped dynamic magnetic fields acting on small metallic magnetic nanoparticles with polyethylene glycol coating and average diameter of 30 nm. It was shown that transport of magnetic nanoparticles through the entire thickness of bovine articular cartilage can be controlled by a combined alternating magnetic field at 100 Hz frequency and static magnetic field of 0.8 tesla (T generated by 1" dia. x 2" thick permanent magnet. Magnetic nanoparticles transport through bovine articular cartilage samples was investigated at various settings of magnetic field and time durations. Combined application of an alternating magnetic field and the static field gradient resulted in a nearly 50 times increase in magnetic nanoparticles transport in bovine articular cartilage tissue as compared with static field conditions. This method can be applied to locally deliver therapeutic-loaded magnetic nanoparticles deep into articular cartilage to prevent cartilage degeneration and promote cartilage repair in osteoarthritis.
Centola, Matteo; Tonnarelli, Beatrice; Schären, Stefan; Glaser, Nicolas; Barbero, Andrea; Martin, Ivan
2013-11-01
The field of regenerative medicine has increasingly recognized the importance to be inspired by developmental processes to identify signaling pathways crucial for 3D organogenesis and tissue regeneration. Here, we aimed at recapitulating the first events occurring during limb development (ie, cell condensation and expansion of an undifferentiated mesenchymal cell population) to prime 3D cultures of human bone marrow-derived mesenchymal stromal/stem cells (hBM-MSC) toward the chondrogenic route. Based on embryonic development studies, we hypothesized that Wnt3a and fibroblast growth factor 2 (FGF2) induce hBM-MSC to proliferate in 3D culture as an undifferentiated pool of progenitors (defined by clonogenic capacity and expression of typical markers), retaining chondrogenic potential upon induction by suitable morphogens. hBM-MSC were responsive to Wnt signaling in 3D pellet culture, as assessed by significant upregulation of main target genes and increase of unphosphorylated β-catenin levels. Wnt3a was able to induce a five-fold increase in the number of proliferating hBM-MSC (6.4% vs. 1.3% in the vehicle condition), although total DNA content of the 3D construct was decreasing over time. Preconditioning with Wnt3a improved transforming growth factor-β1 mediated chondrogenesis (30% more glycosaminoglycans/cell in average). In contrast to developmental and 2D MSC culture models, FGF2 antagonized the Wnt-mediated effects. Interestingly, the CD146⁺ subpopulation was found to be more responsive to Wnt3a. The presented data indicate a possible strategy to prime 3D cultures of hBM-MSC by invoking a "developmental engineering" approach. The study also identifies some opportunities and challenges to cross-fertilize skeletal development models and 3D hBM-MSC culture systems.
Rho GTPase protein Cdc42 is critical for postnatal cartilage development
Energy Technology Data Exchange (ETDEWEB)
Nagahama, Ryo [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan); Department of Orthodontics, School of Dentistry, Showa University, Tokyo (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan); Tanaka, Junichi [Department of Oral Diagnostic Sciences, School of Dentistry, Showa University, Tokyo (Japan); Aizawa, Ryo [Department of Periodontology, School of Dentistry, Showa University, Tokyo (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan); Kassai, Hidetoshi [Laboratory of Animal Resources, Center for Disease Biology and Integrative Medicine, Faculty of Medicine, The University of Tokyo, Tokyo (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, Tokyo (Japan); Mishima, Kenji [Department of Oral Diagnostic Sciences, School of Dentistry, Showa University, Tokyo (Japan); Aiba, Atsu [Laboratory of Animal Resources, Center for Disease Biology and Integrative Medicine, Faculty of Medicine, The University of Tokyo, Tokyo (Japan); Maki, Koutaro [Department of Orthodontics, School of Dentistry, Showa University, Tokyo (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, Tokyo (Japan)
2016-02-19
Cdc42, a small Rho GTPase family member, has been shown to regulate multiple cellular functions in vitro, including actin cytoskeletal reorganization, cell migration, proliferation, and gene expression. However, its tissue-specific roles in vivo remain largely unknown, especially in postnatal cartilage development, as cartilage-specific Cdc42 inactivated mice die within a few days after birth. In this study, we investigated the physiological functions of Cdc42 during cartilage development after birth using tamoxifen-induced cartilage-specific inactivated Cdc42 conditional knockout (Cdc42 {sup fl/fl}; Col2-CreERT) mice, which were generated by crossing Cdc42 flox mice (Cdc42 {sup fl/fl}) with tamoxifen-induced type II collagen (Col2) Cre transgenic mice using a Cre/loxP system. The gross morphology of the Cdc42 cKO mice was shorter limbs and body, as well as reduced body weight as compared with the controls. In addition, severe defects were found in growth plate chondrocytes of the long bones, characterized by a shorter proliferating zone (PZ), wider hypertrophic zone (HZ), and loss of columnar organization of proliferating chondrocytes, resulting in delayed endochondral bone formation associated with abnormal bone growth. Our findings demonstrate the importance of Cdc42 for cartilage development during both embryonic and postnatal stages. - Highlights: • Tamoxifen-induced cartilage specific inactivated Cdc42 mutant mice were generated. • Cdc42 mutant mice were shorter limbs and body. • Severe defects were found in growth plate chondrocytes.
Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long
2017-07-30
The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.
Cartilage regeneration by chondrogenic induced adult stem cells in osteoarthritic sheep model.
Ude, Chinedu C; Sulaiman, Shamsul B; Min-Hwei, Ng; Hui-Cheng, Chen; Ahmad, Johan; Yahaya, Norhamdan M; Saim, Aminuddin B; Idrus, Ruszymah B H
2014-01-01
In this study, Adipose stem cells (ADSC) and bone marrow stem cells (BMSC), multipotent adult cells with the potentials for cartilage regenerations were induced to chondrogenic lineage and used for cartilage regenerations in surgically induced osteoarthritis in sheep model. Osteoarthritis was induced at the right knee of sheep by complete resection of the anterior cruciate ligament and medial meniscus following a 3-weeks exercise regimen. Stem cells from experimental sheep were culture expanded and induced to chondrogenic lineage. Test sheep received a single dose of 2 × 10(7) autologous PKH26-labelled, chondrogenically induced ADSCs or BMSCs as 5 mls injection, while controls received 5 mls culture medium. The proliferation rate of ADSCs 34.4 ± 1.6 hr was significantly higher than that of the BMSCs 48.8 ± 5.3 hr (P = 0.008). Chondrogenic induced BMSCs had significantly higher expressions of chondrogenic specific genes (Collagen II, SOX9 and Aggrecan) compared to chondrogenic ADSCs (P = 0.031, 0.010 and 0.013). Grossly, the treated knee joints showed regenerated de novo cartilages within 6 weeks post-treatment. On the International Cartilage Repair Society grade scores, chondrogenically induced ADSCs and BMSCs groups had significantly lower scores than controls (P = 0.0001 and 0.0001). Fluorescence of the tracking dye (PKH26) in the injected cells showed that they had populated the damaged area of cartilage. Histological staining revealed loosely packed matrixes of de novo cartilages and immunostaining demonstrated the presence of cartilage specific proteins, Collagen II and SOX9. Autologous chondrogenically induced ADSCs and BMSCs could be promising cell sources for cartilage regeneration in osteoarthritis.
Cartilage regeneration by chondrogenic induced adult stem cells in osteoarthritic sheep model.
Directory of Open Access Journals (Sweden)
Chinedu C Ude
Full Text Available OBJECTIVES: In this study, Adipose stem cells (ADSC and bone marrow stem cells (BMSC, multipotent adult cells with the potentials for cartilage regenerations were induced to chondrogenic lineage and used for cartilage regenerations in surgically induced osteoarthritis in sheep model. METHODS: Osteoarthritis was induced at the right knee of sheep by complete resection of the anterior cruciate ligament and medial meniscus following a 3-weeks exercise regimen. Stem cells from experimental sheep were culture expanded and induced to chondrogenic lineage. Test sheep received a single dose of 2 × 10(7 autologous PKH26-labelled, chondrogenically induced ADSCs or BMSCs as 5 mls injection, while controls received 5 mls culture medium. RESULTS: The proliferation rate of ADSCs 34.4 ± 1.6 hr was significantly higher than that of the BMSCs 48.8 ± 5.3 hr (P = 0.008. Chondrogenic induced BMSCs had significantly higher expressions of chondrogenic specific genes (Collagen II, SOX9 and Aggrecan compared to chondrogenic ADSCs (P = 0.031, 0.010 and 0.013. Grossly, the treated knee joints showed regenerated de novo cartilages within 6 weeks post-treatment. On the International Cartilage Repair Society grade scores, chondrogenically induced ADSCs and BMSCs groups had significantly lower scores than controls (P = 0.0001 and 0.0001. Fluorescence of the tracking dye (PKH26 in the injected cells showed that they had populated the damaged area of cartilage. Histological staining revealed loosely packed matrixes of de novo cartilages and immunostaining demonstrated the presence of cartilage specific proteins, Collagen II and SOX9. CONCLUSION: Autologous chondrogenically induced ADSCs and BMSCs could be promising cell sources for cartilage regeneration in osteoarthritis.
Tissue engineering of cartilages using biomatrices
DEFF Research Database (Denmark)
Melrose, J.; Chuang, C.; Whitelock, J.
2008-01-01
and age-related degenerative diseases can all lead to cartilage loss; however, the low cell density and very limited self-renewal capacity of cartilage necessitate the development of effective therapeutic repair strategies for this tissue. The ontogeny of the chondrocyte, which is the cell that provides...... the biosynthetic machinery for all the component parts of cartilage, is discussed, since an understanding of cartilage development is central to the maintenance of a chondrocytic phenotype in any strategy aiming to produce a replacement cartilage. A plethora of matrices have been developed for cartilage...
Directory of Open Access Journals (Sweden)
William P. Bewg
2017-12-01
Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.
Directory of Open Access Journals (Sweden)
LS Moreira Teixeira
2012-06-01
Full Text Available Cell-based cartilage repair strategies such as matrix-induced autologous chondrocyte implantation (MACI could be improved by enhancing cell performance. We hypothesised that micro-aggregates of chondrocytes generated in high-throughput prior to implantation in a defect could stimulate cartilaginous matrix deposition and remodelling. To address this issue, we designed a micro-mould to enable controlled high-throughput formation of micro-aggregates. Morphology, stability, gene expression profiles and chondrogenic potential of micro-aggregates of human and bovine chondrocytes were evaluated and compared to single-cells cultured in micro-wells and in 3D after encapsulation in Dextran-Tyramine (Dex-TA hydrogels in vitro and in vivo. We successfully formed micro-aggregates of human and bovine chondrocytes with highly controlled size, stability and viability within 24 hours. Micro-aggregates of 100 cells presented a superior balance in Collagen type I and Collagen type II gene expression over single cells and micro-aggregates of 50 and 200 cells. Matrix metalloproteinases 1, 9 and 13 mRNA levels were decreased in micro-aggregates compared to single-cells. Histological and biochemical analysis demonstrated enhanced matrix deposition in constructs seeded with micro-aggregates cultured in vitro and in vivo, compared to single-cell seeded constructs. Whole genome microarray analysis and single gene expression profiles using human chondrocytes confirmed increased expression of cartilage-related genes when chondrocytes were cultured in micro-aggregates. In conclusion, we succeeded in controlled high-throughput formation of micro-aggregates of chondrocytes. Compared to single cell-seeded constructs, seeding of constructs with micro-aggregates greatly improved neo-cartilage formation. Therefore, micro-aggregation prior to chondrocyte implantation in current MACI procedures, may effectively accelerate hyaline cartilage formation.
Moreira Teixeira, L S; Leijten, J C H; Sobral, J; Jin, R; van Apeldoorn, A A; Feijen, J; van Blitterswijk, C; Dijkstra, P J; Karperien, M
2012-06-05
Cell-based cartilage repair strategies such as matrix-induced autologous chondrocyte implantation (MACI) could be improved by enhancing cell performance. We hypothesised that micro-aggregates of chondrocytes generated in high-throughput prior to implantation in a defect could stimulate cartilaginous matrix deposition and remodelling. To address this issue, we designed a micro-mould to enable controlled high-throughput formation of micro-aggregates. Morphology, stability, gene expression profiles and chondrogenic potential of micro-aggregates of human and bovine chondrocytes were evaluated and compared to single-cells cultured in micro-wells and in 3D after encapsulation in Dextran-Tyramine (Dex-TA) hydrogels in vitro and in vivo. We successfully formed micro-aggregates of human and bovine chondrocytes with highly controlled size, stability and viability within 24 hours. Micro-aggregates of 100 cells presented a superior balance in Collagen type I and Collagen type II gene expression over single cells and micro-aggregates of 50 and 200 cells. Matrix metalloproteinases 1, 9 and 13 mRNA levels were decreased in micro-aggregates compared to single-cells. Histological and biochemical analysis demonstrated enhanced matrix deposition in constructs seeded with micro-aggregates cultured in vitro and in vivo, compared to single-cell seeded constructs. Whole genome microarray analysis and single gene expression profiles using human chondrocytes confirmed increased expression of cartilage-related genes when chondrocytes were cultured in micro-aggregates. In conclusion, we succeeded in controlled high-throughput formation of micro-aggregates of chondrocytes. Compared to single cell-seeded constructs, seeding of constructs with micro-aggregates greatly improved neo-cartilage formation. Therefore, micro-aggregation prior to chondrocyte implantation in current MACI procedures, may effectively accelerate hyaline cartilage formation.
Chondrogenic potential of canine articular cartilage derived cells (cACCs
Directory of Open Access Journals (Sweden)
Nowak Urszula
2016-01-01
Full Text Available In the present paper, the potential of canine articular cartilage-derived cells (cACCs for chondrogenic differentiation was evaluated. The effectiveness of cACCs’ lineage commitment was analyzed after 14 days of culture in chondorgenic and non-chondrogenic conditions. Formation of proteoglycan-rich extracellular matrix was assessed using histochemical staining – Alcian Blue and Safranin-O, while elemental composition was determined by means of SEM-EDX. Additionally, ultrastructure of cACCs was evaluated using TEM. The expression of genes involved in chondrogenesis was monitored with quantitative Real Time PCR. Results obtained indicate that the potential of cACCs for cartilagous extracellular matrix formation may be maintained only in chondrogenic cultures. The formation of specific chondro-nodules was not observed in a non-chondrogenic culture environment. The analysis of cACCs’ ultrastructure, both in non-chondrogenic and chondrogenic cultures, revealed well-developed rough endoplasmatic reticulum and presence of mitochondria. The cACCs in chondrogenic medium shed an increased number of microvesicles. Furthermore, it was shown that the extracellular matrix of cACCs in chondrogenic cultures is rich in potassium and molybdenum. Additionally, it was determined that gene expression of collagen type II, aggrecan and SOX-9 was significantly increased during chondrogenic differentiation of cACCs. Results obtained indicate that the culture environment may significantly influence the cartilage phenotype of cACCs during long term culture.
Jungmann, Pia M.; Baum, Thomas; Bauer, Jan S.; Karampinos, Dimitrios C.; Link, Thomas M.; Li, Xiaojuan; Trattnig, Siegfried; Rummeny, Ernst J.; Woertler, Klaus; Welsch, Goetz H.
2014-01-01
Background. New quantitative magnetic resonance imaging (MRI) techniques are increasingly applied as outcome measures after cartilage repair. Objective. To review the current literature on the use of quantitative MRI biomarkers for evaluation of cartilage repair at the knee and ankle. Methods. Using PubMed literature research, studies on biochemical, quantitative MR imaging of cartilage repair were identified and reviewed. Results. Quantitative MR biomarkers detect early degeneration of articular cartilage, mainly represented by an increasing water content, collagen disruption, and proteoglycan loss. Recently, feasibility of biochemical MR imaging of cartilage repair tissue and surrounding cartilage was demonstrated. Ultrastructural properties of the tissue after different repair procedures resulted in differences in imaging characteristics. T2 mapping, T1rho mapping, delayed gadolinium-enhanced MRI of cartilage (dGEMRIC), and diffusion weighted imaging (DWI) are applicable on most clinical 1.5 T and 3 T MR scanners. Currently, a standard of reference is difficult to define and knowledge is limited concerning correlation of clinical and MR findings. The lack of histological correlations complicates the identification of the exact tissue composition. Conclusions. A multimodal approach combining several quantitative MRI techniques in addition to morphological and clinical evaluation might be promising. Further investigations are required to demonstrate the potential for outcome evaluation after cartilage repair. PMID:24877139
Directory of Open Access Journals (Sweden)
Pia M. Jungmann
2014-01-01
Full Text Available Background. New quantitative magnetic resonance imaging (MRI techniques are increasingly applied as outcome measures after cartilage repair. Objective. To review the current literature on the use of quantitative MRI biomarkers for evaluation of cartilage repair at the knee and ankle. Methods. Using PubMed literature research, studies on biochemical, quantitative MR imaging of cartilage repair were identified and reviewed. Results. Quantitative MR biomarkers detect early degeneration of articular cartilage, mainly represented by an increasing water content, collagen disruption, and proteoglycan loss. Recently, feasibility of biochemical MR imaging of cartilage repair tissue and surrounding cartilage was demonstrated. Ultrastructural properties of the tissue after different repair procedures resulted in differences in imaging characteristics. T2 mapping, T1rho mapping, delayed gadolinium-enhanced MRI of cartilage (dGEMRIC, and diffusion weighted imaging (DWI are applicable on most clinical 1.5 T and 3 T MR scanners. Currently, a standard of reference is difficult to define and knowledge is limited concerning correlation of clinical and MR findings. The lack of histological correlations complicates the identification of the exact tissue composition. Conclusions. A multimodal approach combining several quantitative MRI techniques in addition to morphological and clinical evaluation might be promising. Further investigations are required to demonstrate the potential for outcome evaluation after cartilage repair.
Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda
2016-02-01
Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.
Magnetic Resonance Imaging of Cartilage Repair
Trattnig, Siegfried; Winalski, Carl S.; Marlovits, Stephan; Jurvelin, Jukka S.; Welsch, Goetz H.; Potter, Hollis G.
2011-01-01
Articular cartilage lesions are a common pathology of the knee joint, and many patients may benefit from cartilage repair surgeries that offer the chance to avoid the development of osteoarthritis or delay its progression. Cartilage repair surgery, no matter the technique, requires a noninvasive, standardized, and high-quality longitudinal method to assess the structure of the repair tissue. This goal is best fulfilled by magnetic resonance imaging (MRI). The present article provides an overview of the current state of the art of MRI of cartilage repair. In the first 2 sections, preclinical and clinical MRI of cartilage repair tissue are described with a focus on morphological depiction of cartilage and the use of functional (biochemical) MR methodologies for the visualization of the ultrastructure of cartilage repair. In the third section, a short overview is provided on the regulatory issues of the United States Food and Drug Administration (FDA) and the European Medicines Agency (EMEA) regarding MR follow-up studies of patients after cartilage repair surgeries. PMID:26069565
One-stage vs two-stage cartilage repair: a current review
Directory of Open Access Journals (Sweden)
Daniel Meyerkort
2010-10-01
Full Text Available Daniel Meyerkort, David Wood, Ming-Hao ZhengCenter for Orthopaedic Research, School of Surgery and Pathology, University of Western Australia, Perth, AustraliaIntroduction: Articular cartilage has a poor capacity for regeneration if damaged. Various methods have been used to restore the articular surface, improve pain, function, and slow progression to osteoarthritis.Method: A PubMed review was performed on 18 March, 2010. Search terms included “autologous chondrocyte implantation (ACI” and “microfracture” or “mosaicplasty”. The aim of this review was to determine if 1-stage or 2-stage procedures for cartilage repair produced different functional outcomes.Results: The main procedures currently used are ACI and microfracture. Both first-generation ACI and microfracture result in clinical and functional improvement with no significant differences. A significant increase in functional outcome has been observed in second-generation procedures such as Hyalograft C, matrix-induced ACI, and ChondroCelect compared with microfracture. ACI results in a higher percentage of patients with clinical improvement than mosaicplasty; however, these results may take longer to achieve.Conclusion: Clinical and functional improvements have been demonstrated with ACI, microfracture, mosaicplasty, and synthetic cartilage constructs. Heterogeneous products and lack of good-quality randomized-control trials make product comparison difficult. Future developments involve scaffolds, gene therapy, growth factors, and stem cells to create a single-stage procedure that results in hyaline articular cartilage.Keywords: autologous chondrocyte implantation, microfracture, cartilage repair
Jing, Lizhong; Zhang, Jiying; Leng, Huijie; Guo, Qinwei; Hu, Yuelin
2015-04-01
To demonstrate that iliac crest cartilage may be used to repair articular cartilage defects in the knees of rabbits. Full-thickness cartilage defects were created in the medial femoral condyle on both knees of 36 New Zealand white rabbits. The 72 defects were randomly assigned to be repaired with ipsilateral iliac crest cartilage (Group I), osteochondral tissues removed at defect creation (Group II), or no treatment (negative control, Group III). Animals were killed at 6, 12, and 24 weeks post-operatively. The repaired tissues were harvested for magnetic resonance imaging (MRI), histological studies (haematoxylin and eosin and immunohistochemical staining), and mechanical testing. At 6 weeks, the iliac crest cartilage graft was not yet well integrated with the surrounding articular cartilage, but at 12 weeks, the graft deep zone had partial ossification. By 24 weeks, the hyaline cartilage-like tissue was completely integrated with the surrounding articular cartilage. Osteochondral autografts showed more rapid healing than Group I at 6 weeks and complete healing at 12 weeks. Untreated defects were concave or partly filled with fibrous tissue throughout the study. MRI showed that Group I had slower integration with surrounding normal cartilage compared with Group II. The mechanical properties of Group I were significantly lower than those of Group II at 12 weeks, but this difference was not significant at 24 weeks. Iliac crest cartilage autografts were able to repair knee cartilage defects with hyaline cartilage and showed comparable results with osteochondral autografts in the rabbit model.
[Current overview of cartilage regeneration procedures].
Schenker, H; Wild, M; Rath, B; Tingart, M; Driessen, A; Quack, V; Betsch, M
2017-11-01
Cartilage is an avascular, alymphatic and non-innervated tissue with limited intrinsic repair potential. The high prevalence of cartilage defects and their tremendous clinical importance are a challenge for all treating physicians. This article provides the reader with an overview about current cartilage treatment options and their clinical outcome. Microfracture is still considered the gold standard in the treatment of small cartilage lesions. Small osteochondral defects can be effectively treated with the autologous osteochondral transplantation system. Larger cartilage defects are successfully treated by autologous membrane-induced chondrogenesis (AMIC) or by membrane-assisted autologous chondrocyte implantation (MACI). Despite limitations of current cartilage repair strategies, such procedures can result in short- and mid-term clinical improvement of the patients. Further developments and clinical studies are necessary to improve the long-term outcome following cartilage repair.
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
Li, Feng; Wang, Anmin; Wang, Chengtao
2016-05-01
Many biomaterials are being used to repair damaged articular cartilage. In particular, poly vinyl alcohol hydrogel has similar mechanical properties to natural cartilage under compressive and shearing loading. Here, three-factor and two-level friction experiments and long-term tests were conducted to better evaluate its tribological properties. The friction coefficient between articular cartilage and the poly vinyl alcohol hydrogel depended primarily on the three factors of load, speed, and lubrication. When the speed increased from 10 to 20 mm/s under a load of 10 N, the friction coefficient increased from 0.12 to 0.147. When the lubricant was changed from Ringer's solution to a hyaluronic acid solution, the friction coefficient decreased to 0.084 with loads as high as 22 N. The poly vinyl alcohol hydrogel was severely damaged and lost its top surface layers, which were transferred to the articular cartilage surface. Wear was observed in the surface morphologies, which indicated the occurrence of surface adhesion of bovine cartilage. Surface fatigue and adhesive wear was the dominant wear mechanism.
Advances in cartilage tissue engineering : in vitro
E.W. Mandl (Erik)
2004-01-01
textabstractWithin the body three subtypes of cartilage can be distinguished: hyaline cartilage, elastic cartilage and fibrocartilage. Hyaline cartilage is the predominant subtype and is mainly located in articular joints and in less extent in the nasal septum and cricoid. Elastic cartilage can be
Lafeber, F. P.; van Roy, H.; Wilbrink, B.; Huber-Bruning, O.; Bijlsma, J. W.
1992-01-01
The proteoglycan turnover of human osteoarthritic (OA) cartilage was compared to that of normal (N) cartilage. The cartilage was obtained postmortem from human femoral knee condyles. Short term cultures were compared to longterm cultures, and proteoglycan synthesis rate, content and release
Rho GTPase protein Cdc42 is critical for postnatal cartilage development
International Nuclear Information System (INIS)
Nagahama, Ryo; Yamada, Atsushi; Tanaka, Junichi; Aizawa, Ryo; Suzuki, Dai; Kassai, Hidetoshi; Yamamoto, Matsuo; Mishima, Kenji; Aiba, Atsu; Maki, Koutaro; Kamijo, Ryutaro
2016-01-01
Cdc42, a small Rho GTPase family member, has been shown to regulate multiple cellular functions in vitro, including actin cytoskeletal reorganization, cell migration, proliferation, and gene expression. However, its tissue-specific roles in vivo remain largely unknown, especially in postnatal cartilage development, as cartilage-specific Cdc42 inactivated mice die within a few days after birth. In this study, we investigated the physiological functions of Cdc42 during cartilage development after birth using tamoxifen-induced cartilage-specific inactivated Cdc42 conditional knockout (Cdc42 "f"l"/"f"l; Col2-CreERT) mice, which were generated by crossing Cdc42 flox mice (Cdc42 "f"l"/"f"l) with tamoxifen-induced type II collagen (Col2) Cre transgenic mice using a Cre/loxP system. The gross morphology of the Cdc42 cKO mice was shorter limbs and body, as well as reduced body weight as compared with the controls. In addition, severe defects were found in growth plate chondrocytes of the long bones, characterized by a shorter proliferating zone (PZ), wider hypertrophic zone (HZ), and loss of columnar organization of proliferating chondrocytes, resulting in delayed endochondral bone formation associated with abnormal bone growth. Our findings demonstrate the importance of Cdc42 for cartilage development during both embryonic and postnatal stages. - Highlights: • Tamoxifen-induced cartilage specific inactivated Cdc42 mutant mice were generated. • Cdc42 mutant mice were shorter limbs and body. • Severe defects were found in growth plate chondrocytes.
Energy Technology Data Exchange (ETDEWEB)
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)
2016-08-15
Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47
International Nuclear Information System (INIS)
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong
2016-01-01
Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47
Directory of Open Access Journals (Sweden)
Conforto Tara L
2012-04-01
Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.
Occhetta, Paola; Pigeot, Sebastien; Rasponi, Marco; Dasen, Boris; Mehrkens, Arne; Ullrich, Thomas; Kramer, Ina; Guth-Gundel, Sabine; Barbero, Andrea; Martin, Ivan
2018-05-01
It is generally accepted that adult human bone marrow-derived mesenchymal stromal cells (hMSCs) are default committed toward osteogenesis. Even when induced to chondrogenesis, hMSCs typically form hypertrophic cartilage that undergoes endochondral ossification. Because embryonic mesenchyme is obviously competent to generate phenotypically stable cartilage, it is questioned whether there is a correspondence between mesenchymal progenitor compartments during development and in adulthood. Here we tested whether forcing specific early events of articular cartilage development can program hMSC fate toward stable chondrogenesis. Inspired by recent findings that spatial restriction of bone morphogenetic protein (BMP) signaling guides embryonic progenitors toward articular cartilage formation, we hypothesized that selective inhibition of BMP drives the phenotypic stability of hMSC-derived chondrocytes. Two BMP type I receptor-biased kinase inhibitors were screened in a microfluidic platform for their time- and dose-dependent effect on hMSC chondrogenesis. The different receptor selectivity profile of tested compounds allowed demonstration that transient blockade of both ALK2 and ALK3 receptors, while permissive to hMSC cartilage formation, is necessary and sufficient to maintain a stable chondrocyte phenotype. Remarkably, even upon compound removal, hMSCs were no longer competent to undergo hypertrophy in vitro and endochondral ossification in vivo, indicating the onset of a constitutive change. Our findings demonstrate that adult hMSCs effectively share properties of embryonic mesenchyme in the formation of transient but also of stable cartilage. This opens potential pharmacological strategies to articular cartilage regeneration and more broadly indicates the relevance of developmentally inspired protocols to control the fate of adult progenitor cell systems.
Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.
Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R
2018-06-01
Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.
Directory of Open Access Journals (Sweden)
IM Khan
2008-09-01
Full Text Available Articular cartilage is a challenging tissue to reconstruct or replace principally because of its avascular nature; large chondral lesions in the tissue do not spontaneously heal. Where lesions do penetrate the bony subchondral plate, formation of hematomas and the migration of mesenchymal stem cells provide an inferior and transient fibrocartilagenous replacement for hyaline cartilage. To circumvent the poor intrinsic reparative response of articular cartilage several surgical techniques based on tissue transplantation have emerged. One characteristic shared by intrinsic reparative processes and the new surgical therapies is an apparent lack of lateral integration of repair or graft tissue with the host cartilage that can lead to poor prognosis. Many factors have been cited as impeding cartilage:cartilage integration including; chondrocyte cell death, chondrocyte dedifferentiation, the nature of the collagenous and proteoglycan networks that constitute the extracellular matrix, the type of biomaterial scaffold employed in repair and the origin of the cells used to repopulate the defect or lesion. This review addresses the principal intrinsic and extrinsic factors that impede integration and describe how manipulation of these factors using a host of strategies can positively influence cartilage integration.
Osteoarthritic cartilage is more homogeneous than healthy cartilage
DEFF Research Database (Denmark)
Qazi, Arish A; Dam, Erik B; Nielsen, Mads
2007-01-01
it evolves as a consequence to disease and thereby can be used as a progression biomarker. MATERIALS AND METHODS: A total of 283 right and left knees from 159 subjects aged 21 to 81 years were scanned using a Turbo 3D T1 sequence on a 0.18-T MRI Esaote scanner. The medial compartment of the tibial cartilage...... sheet was segmented using a fully automatic voxel classification scheme based on supervised learning. From the segmented cartilage sheet, homogeneity was quantified by measuring entropy from the distribution of signal intensities inside the compartment. Each knee was examined by radiography...... of the region was evaluated by testing for overfitting. Three different regularization techniques were evaluated for reducing overfitting errors. RESULTS: The P values for separating the different groups based on cartilage homogeneity were 2 x 10(-5) (KL 0 versus KL 1) and 1 x 10(-7) (KL 0 versus KL >0). Using...
Goodrich, L R; Hidaka, C; Robbins, P D; Evans, C H; Nixon, A J
2007-05-01
Gene therapy with insulin-like growth factor-1 (IGF-1) increases matrix production and enhances chondrocyte proliferation and survival in vitro. The purpose of this study was to determine whether arthroscopically-grafted chondrocytes genetically modified by an adenovirus vector encoding equine IGF-1 (AdIGF-1) would have a beneficial effect on cartilage healing in an equine femoropatellar joint model. A total of 16 horses underwent arthroscopic repair of a single 15 mm cartilage defect in each femoropatellar joint. One joint received 2 x 10(7) AdIGF-1 modified chondrocytes and the contralateral joint received 2 x 10(7) naive (unmodified) chondrocytes. Repairs were analysed at four weeks, nine weeks and eight months after surgery. Morphological and histological appearance, IGF-1 and collagen type II gene expression (polymerase chain reaction, in situ hybridisation and immunohistochemistry), collagen type II content (cyanogen bromide and sodium dodecyl sulphate-polyacrylamide gel electrophoresis), proteoglycan content (dimethylmethylene blue assay), and gene expression for collagen type I, matrix metalloproteinase (MMP)-1, MMP-3, MMP-13, aggrecanase-1, tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) and TIMP-3 were evaluated. Genetic modification of chondrocytes significantly increased IGF-1 mRNA and ligand production in repair tissue for up to nine weeks following transplantation. The gross and histological appearance of IGF-1 modified repair tissue was improved over control defects. Gross filling of defects was significantly improved at four weeks, and a more hyaline-like tissue covered the lesions at eight months. Histological outcome at four and nine weeks post-transplantation revealed greater tissue filling of defects transplanted with genetically modified chondrocytes, whereas repair tissue in control defects was thin and irregular and more fibrous. Collagen type II expression in IGF-1 gene-transduced defects was increased 100-fold at four weeks and
Tang, Cheng; Xu, Yan; Jin, Chengzhe; Min, Byoung-Hyun; Li, Zhiyong; Pei, Xuan; Wang, Liming
2013-12-01
Extracellular matrix (ECM) materials are widely used in cartilage tissue engineering. However, the current ECM materials are unsatisfactory for clinical practice as most of them are derived from allogenous or xenogenous tissue. This study was designed to develop a novel autologous ECM scaffold for cartilage tissue engineering. The autologous bone marrow mesenchymal stem cell-derived ECM (aBMSC-dECM) membrane was collected and fabricated into a three-dimensional porous scaffold via cross-linking and freeze-drying techniques. Articular chondrocytes were seeded into the aBMSC-dECM scaffold and atelocollagen scaffold, respectively. An in vitro culture and an in vivo implantation in nude mice model were performed to evaluate the influence on engineered cartilage. The current results showed that the aBMSC-dECM scaffold had a good microstructure and biocompatibility. After 4 weeks in vitro culture, the engineered cartilage in the aBMSC-dECM scaffold group formed thicker cartilage tissue with more homogeneous structure and higher expressions of cartilaginous gene and protein compared with the atelocollagen scaffold group. Furthermore, the engineered cartilage based on the aBMSC-dECM scaffold showed better cartilage formation in terms of volume and homogeneity, cartilage matrix content, and compressive modulus after 3 weeks in vivo implantation. These results indicated that the aBMSC-dECM scaffold could be a successful novel candidate scaffold for cartilage tissue engineering. © 2013 Wiley Periodicals, Inc. and International Center for Artificial Organs and Transplantation.
Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha
2017-01-01
During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...
Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip
2017-01-01
ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...
Directory of Open Access Journals (Sweden)
Yupeng Chen
Full Text Available Matrilin-1 (Matn1, a cartilage-specific peri-cellular and extracellular matrix (ECM protein, has been hypothesized to regulate ECM interactions and transmit mechanical signals in cartilage. Since Matn1 knock-out (Matn1-/- mice exhibit a normal skeleton, its function in vivo is unclear. In this study, we found that the anabolic Acan and Col2a transcript levels were significantly higher in wildtype (Matn1+/+ mouse cartilage than that of MATN1-/- mice in vivo. However, such difference was not observed between Matn1+/+ and MATN1-/- chondrocytes cultured under stationary conditions in vitro. Cyclic loading significantly stimulated Acan and Col2a transcript levels in Matn1+/+ but not in MATN1-/- chondrocytes. This suggests that, while Matn1+/+ chondrocytes increase their anabolic gene expression in response to mechanical loading, the MATN1-/- chondrocytes fail to do so because of the deficiency in mechanotransduction. We also found that altered elastic modulus of cartilage matrix in Matn1-/- mice, suggesting the mechanotransduction has changed due to the deficiency of Matn1. To understand the impact of such deficiency on joint disease, mechanical loading was altered in vivo by destabilization of medial meniscus. While Matn1+/+ mice exhibited superficial fissures and clefts consistent with mechanical damage to the articular joint, Matn1-/- mice presented more severe cartilage lesions characterized by proteoglycan loss and disorganization of cells and ECM. This suggests that Matn1 deficiency affects pathogenesis of post-traumatic osteoarthritis by failing to up-regulate anabolic gene expression. This is the first demonstration of Matn1 function in vivo, which suggests its protective role in cartilage degeneration under altered mechanical environment.
In vivo and in vitro studies of cartilage differentiation in altered gravities
Montufar-Solis, D.; Duke, P. J.; D'Aunno, D.
The in vivo model our laboratory uses for studies of cartilage differentiation in space is the rat growth plate. Differences between missions, and in rat age and recovery times, provided differing results from each mission. However, in all missions, proliferation and differentiation of chondrocytes in the epiphyseal plate of spaceflown rats was altered as was matrix organization. In vitro systems, necessary complements to in vivo work, provide some advantages over the in vivo situation. In vitro, centrifugation of embryonic limb buds suppressed morphogenesis due to precocious differentiation, and changes in the developmental pattern suggest the involvement of Hox genes. In space, embryonic mouse limb mesenchyme cells differentiating in vitro on IML-1 had smoother membranes and lacked matrix seen in controls. Unusual formations, possibly highly ruffled membranes, were found in flight cultures. These results, coupled with in vivo centrifugation studies, show that in vivo or in vitro, the response of chondrocytes to gravitational changes follows Hert's curve as modified by Simon, i.e. decreased loading decreases differentiation, and increased loading speeds it up, but only to a point. After that, additional increases again slow down chondrogenesis.
Chhana, Ashika; Callon, Karen E; Pool, Bregina; Naot, Dorit; Gamble, Gregory D; Dray, Michael; Pitto, Rocco; Bentley, Jarome; McQueen, Fiona M; Cornish, Jillian; Dalbeth, Nicola
2013-12-01
Cartilage damage is frequently observed in advanced destructive gout. The aim of our study was to investigate the effects of monosodium urate monohydrate (MSU) crystals on chondrocyte viability and function. The alamarBlue assay and flow cytometry were used to assess the viability of primary human chondrocytes and cartilage explants following culture with MSU crystals. The number of dead chondrocytes in cartilage explants cultured with MSU crystals was quantified. Real-time PCR was used to determine changes in the relative mRNA expression levels of chondrocytic genes. The histological appearance of cartilage in joints affected by gout was also examined. MSU crystals rapidly reduced primary human chondrocyte and cartilage explant viability in a dose-dependent manner (p gout, normal cartilage architecture was lost, with empty chondrocyte lacunae observed. MSU crystals have profound inhibitory effects on chondrocyte viability and function. Interactions between MSU crystals and chondrocytes may contribute to cartilage damage in gout through reduction of chondrocyte viability and promotion of a catabolic state.
Directory of Open Access Journals (Sweden)
Shutao Zhang
Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.
miR-322 stabilizes MEK1 expression to inhibit RAF/MEK/ERK pathway activation in cartilage.
Bluhm, Björn; Ehlen, Harald W A; Holzer, Tatjana; Georgieva, Veronika S; Heilig, Juliane; Pitzler, Lena; Etich, Julia; Bortecen, Toman; Frie, Christian; Probst, Kristina; Niehoff, Anja; Belluoccio, Daniele; Van den Bergen, Jocelyn; Brachvogel, Bent
2017-10-01
Cartilage originates from mesenchymal cell condensations that differentiate into chondrocytes of transient growth plate cartilage or permanent cartilage of the articular joint surface and trachea. MicroRNAs fine-tune the activation of entire signaling networks and thereby modulate complex cellular responses, but so far only limited data are available on miRNAs that regulate cartilage development. Here, we characterize a miRNA that promotes the biosynthesis of a key component in the RAF/MEK/ERK pathway in cartilage. Specifically, by transcriptome profiling we identified miR-322 to be upregulated during chondrocyte differentiation. Among the various miR-322 target genes in the RAF/MEK/ERK pathway, only Mek1 was identified as a regulated target in chondrocytes. Surprisingly, an increased concentration of miR-322 stabilizes Mek1 mRNA to raise protein levels and dampen ERK1/2 phosphorylation, while cartilage-specific inactivation of miR322 in mice linked the loss of miR-322 to decreased MEK1 levels and to increased RAF/MEK/ERK pathway activation. Such mice died perinatally due to tracheal growth restriction and respiratory failure. Hence, a single miRNA can stimulate the production of an inhibitory component of a central signaling pathway to impair cartilage development. © 2017. Published by The Company of Biologists Ltd.
Mesenchymal stem cells in cartilage regeneration.
Savkovic, Vuk; Li, Hanluo; Seon, Jong-Keun; Hacker, Michael; Franz, Sandra; Simon, Jan-Christoph
2014-01-01
Articular cartilage provides life-long weight-bearing and mechanical lubrication with extraordinary biomechanical performance and simple structure. However, articular cartilage is apparently vulnerable to multifactorial damage and insufficient to self-repair, isolated in articular capsule without nerves or blood vessels. Osteoarthritis (OA) is known as a degenerative articular cartilage deficiency progressively affecting large proportion of the world population, and restoration of hyaline cartilage is clinical challenge to repair articular cartilage lesion and recreate normal functionality over long period. Mesenchymal stem cells (MSC) are highly proliferative and multipotent somatic cells that are able to differentiate mesoderm-derived cells including chondrocytes and osteoblasts. Continuous endeavors in basic research and preclinical trial have achieved promising outcomes in cartilage regeneration using MSCs. This review focuses on rationale and technologies of MSC-based hyaline cartilage repair involving tissue engineering, 3D biomaterials and growth factors. By comparing conventional treatment and current research progress, we describe insights of advantage and challenge in translation and application of MSC-based chondrogenesis for OA treatment.
Nanduri, Vibudha; Tattikota, Surendra Mohan; T, Avinash Raj; Sriramagiri, Vijaya Rama Rao; Kantipudi, Suma; Pande, Gopal
2014-06-01
Articular cartilage (AC) injuries and malformations are commonly noticed because of trauma or age-related degeneration. Many methods have been adopted for replacing or repairing the damaged tissue. Currently available AC repair methods, in several cases, fail to yield good-quality long-lasting results, perhaps because the reconstructed tissue lacks the cellular and matrix properties seen in hyaline cartilage (HC). To reconstruct HC tissue from 2-dimensional (2D) and 3-dimensional (3D) cultures of AC-derived human chondrocytes that would specifically exhibit the cellular and biochemical properties of the deep layer of HC. Descriptive laboratory study. Two-dimensional cultures of human AC-derived chondrocytes were established in classical medium (CM) and newly defined medium (NDM) and maintained for a period of 6 weeks. These cells were suspended in 2 mm-thick collagen I gels, placed in 24-well culture inserts, and further cultured up to 30 days. Properties of chondrocytes, grown in 2D cultures and the reconstructed 3D cartilage tissue, were studied by optical and scanning electron microscopic techniques, immunohistochemistry, and cartilage-specific gene expression profiling by reverse transcription polymerase chain reaction and were compared with those of the deep layer of native human AC. Two-dimensional chondrocyte cultures grown in NDM, in comparison with those grown in CM, showed more chondrocyte-specific gene activity and matrix properties. The NDM-grown chondrocytes in 3D cultures also showed better reproduction of deep layer properties of HC, as confirmed by microscopic and gene expression analysis. The method used in this study can yield cartilage tissue up to approximately 1.6 cm in diameter and 2 mm in thickness that satisfies the very low cell density and matrix composition properties present in the deep layer of normal HC. This study presents a novel and reproducible method for long-term culture of AC-derived chondrocytes and reconstruction of cartilage
Biomimetically Reinforced Polyvinyl Alcohol-Based Hybrid Scaffolds for Cartilage Tissue Engineering
Directory of Open Access Journals (Sweden)
Hwan D. Kim
2017-11-01
Full Text Available Articular cartilage has a very limited regeneration capacity. Therefore, injury or degeneration of articular cartilage results in an inferior mechanical stability, load-bearing capacity, and lubrication capability. Here, we developed a biomimetic scaffold consisting of macroporous polyvinyl alcohol (PVA sponges as a platform material for the incorporation of cell-embedded photocrosslinkable poly(ethylene glycol diacrylate (PEGDA, PEGDA-methacrylated chondroitin sulfate (PEGDA-MeCS; PCS, or PEGDA-methacrylated hyaluronic acid (PEGDA-MeHA; PHA within its pores to improve in vitro chondrocyte functions and subsequent in vivo ectopic cartilage tissue formation. Our findings demonstrated that chondrocytes encapsulated in PCS or PHA and loaded into macroporous PVA hybrid scaffolds maintained their physiological phenotypes during in vitro culture, as shown by the upregulation of various chondrogenic genes. Further, the cell-secreted extracellular matrix (ECM improved the mechanical properties of the PVA-PCS and PVA-PHA hybrid scaffolds by 83.30% and 73.76%, respectively, compared to their acellular counterparts. After subcutaneous transplantation in vivo, chondrocytes on both PVA-PCS and PVA-PHA hybrid scaffolds significantly promoted ectopic cartilage tissue formation, which was confirmed by detecting cells positively stained with Safranin-O and for type II collagen. Consequently, the mechanical properties of the hybrid scaffolds were biomimetically reinforced by 80.53% and 210.74%, respectively, compared to their acellular counterparts. By enabling the recapitulation of biomimetically relevant structural and functional properties of articular cartilage and the regulation of in vivo mechanical reinforcement mediated by cell–matrix interactions, this biomimetic material offers an opportunity to control the desired mechanical properties of cell-laden scaffolds for cartilage tissue regeneration.
FT-IR Microspectroscopy of Rat Ear Cartilage.
Directory of Open Access Journals (Sweden)
Benedicto de Campos Vidal
Full Text Available Rat ear cartilage was studied using Fourier transform-infrared (FT-IR microspectroscopy to expand the current knowledge which has been established for relatively more complex cartilage types. Comparison of the FT-IR spectra of the ear cartilage extracellular matrix (ECM with published data on articular cartilage, collagen II and 4-chondroitin-sulfate standards, as well as of collagen type I-containing dermal collagen bundles (CBs with collagen type II, was performed. Ear cartilage ECM glycosaminoglycans (GAGs were revealed histochemically and as a reduction in ECM FT-IR spectral band heights (1140-820 cm-1 after testicular hyaluronidase digestion. Although ear cartilage is less complex than articular cartilage, it contains ECM components with a macromolecular orientation as revealed using polarization microscopy. Collagen type II and GAGs, which play a structural role in the stereo-arrangement of the ear cartilage, contribute to its FT-IR spectrum. Similar to articular cartilage, ear cartilage showed that proteoglycans add a contribution to the collagen amide I spectral region, a finding that does not recommend this region for collagen type II quantification purposes. In contrast to articular cartilage, the symmetric stretching vibration of -SO3- groups at 1064 cm-1 appeared under-represented in the FT-IR spectral profile of ear cartilage. Because the band corresponding to the asymmetric stretching vibration of -SO3- groups (1236-1225 cm-1 overlapped with that of amide III bands, it is not recommended for evaluation of the -SO3- contribution to the FT-IR spectrum of the ear cartilage ECM. Instead, a peak (or shoulder at 1027-1016 cm-1 could be better considered for this intent. Amide I/amide II ratios as calculated here and data from the literature suggest that protein complexes of the ear cartilage ECM are arranged with a lower helical conformation compared to pure collagen II. The present results could motivate further studies on this tissue
Miyamoto, Yutaka; Kanzaki, Hiroyuki; Wada, Satoshi; Tsuruoka, Sari; Itohiya, Kanako; Kumagai, Kenichi; Hamada, Yoshiki; Nakamura, Yoshiki
2017-12-01
Mandibular condylar cartilage (MCC) exhibits dual roles both articular cartilage and growth center. Of many growth factors, TGF-β has been implicated in the growth of articular cartilage including MCC. Recently, Asporin, decoy to TGF-β, was discovered and it blocks TGF-β signaling. Asporin is expressed in a variety of tissues including osteoarthritic articular cartilage, though there was no report of Asporin expression in MCC. In the present study, we investigated the temporal and spatial expression of Asporin in MCC. Gene expression profile of MCC and epiphyseal cartilage in tibia of 5 weeks old ICR mice were firstly compared with microarray analysis using the laser capture microdissected samples. Variance of gene expression was further confirmed by real-time RT-PCR and immunohistochemical staining at 1,3,10, and 20 weeks old. TGF-β and its signaling molecule, phosphorylated Smad-2/3 (p-Smad2/3), were also examined by immunohistochemical staining. Microarray analysis revealed that Asporin was highly expressed in MCC. Real-time RT-PCR analysis confirmed that the fibrous layer of MCC exhibited stable higher Asporin expression at any time points as compared to epiphyseal cartilage. This was also observed in immunohistochemical staining. Deeper layer in MCC augmented Asporin expression with age. Whereas, TGF-β was stably highly observed in the layer. The fibrous layer of MCC exhibited weak staining of p-Smad2/3, though the proliferating layer of MCC was strongly stained as compared to epiphyseal cartilage of tibia at early time point. Consistent with the increase of Asporin expression in the deeper layer of MCC, the intensity of p-Smad-2/3 staining was decreased with age. In conclusion, we discovered that Asporin was stably expressed at the fibrous layer of MCC, which makes it possible to manage both articular cartilage and growth center at the same time.
Vanlommel, Jan; De Corte, Ronny; Luyckx, Jean Philippe; Anderson, Melissa; Labey, Luc; Bellemans, Johan
2017-01-01
Oxidized zirconium (OxZr) is produced by thermally driven oxidization creating an oxidized surface with the properties of a ceramic at the top of the Zr metal substrate. OxZr is much harder and has a lower coefficient of friction than cobalt-chrome (CoCr), both leading to better wear characteristics. We evaluated and compared damage to the cartilage of porcine patella plugs, articulating against OxZr vs CoCr. Our hypothesis was that, owing to its better wear properties, OxZr would damage cartilage less than CoCr. If this is true, OxZr might be a better material for the femoral component during total knee arthroplasty if the patella is not resurfaced. Twenty-one plugs from porcine patellae were prepared and tested in a reciprocating pin-on-disk machine while lubricated with bovine serum and under a constant load. Three different configurations were tested: cartilage-cartilage as the control group, cartilage-OxZr, and cartilage-CoCr. Macroscopic appearance, cartilage thickness, and the modified Mankin score were evaluated after 400,000 wear cycles. The control group showed statistically significant less damage than plugs articulating against both other materials. Cartilage plugs articulating against OxZr were statistically significantly less damaged than those articulating against CoCr. Although replacing cartilage by an implant always leads to deterioration of the cartilage counterface, OxZr results in less damage than CoCr. The use of OxZr might thus be preferable to CoCr in case of total knee arthroplasty without patella resurfacing. Copyright © 2016 Elsevier Inc. All rights reserved.
Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni
2015-08-01
The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable
Kreutzer, Christian; Hoehne, Julius; Gubisch, Wolfgang; Rezaeian, Farid; Haack, Sebastian
2017-09-01
Irregularities or deformities of the nasal dorsum after hump reduction account for a significant number of revision rhinoplasties. The authors therefore developed a technique of meticulously dicing and exactly placing free diced cartilage grafts, harvested from septum, rib, or ear cartilage. The cartilage paste is used for smoothening, augmentation, or camouflaging of the nasal dorsum in primary or revision rhinoplasties. A retrospective analysis of multisurgeon consecutive open approach rhinoplasties from January to December of 2014 was conducted at a single center. The authors compared the outcome of three different techniques to augment or cover the nasal dorsum after an observation period of 7 months. In group I, 325 patients with free diced cartilage grafts as the only onlay were included. In group II, consisting of 73 patients, the dorsal onlay was either fascia alone or in combination with free diced cartilage grafts. Forty-eight patients in group III received a dorsal augmentation with the classic diced cartilage in fascia technique. Four hundred forty-six patients undergoing primary and secondary rhinoplasties in which one of the above-mentioned diced cartilage techniques was used were included in the study. The authors found revision rates for dorsal irregularities within the 7-month postoperative observation period of 5.2, 8.2, and 25 percent for groups I, II, and III, respectively. The authors' findings strongly support their clinical experience that the free diced cartilage graft technique presents an effective and easily reproducible method for camouflage and augmentation in aesthetic and reconstructive rhinoplasty.
Optical properties of nasal septum cartilage
Bagratashvili, Nodar V.; Sviridov, Alexander P.; Sobol, Emil N.; Kitai, Moishe S.
1998-05-01
Optical parameters (scattering coefficient s, absorption coefficient k and scattering anisotropy coefficient g) of hyaline cartilage were studied for the first time. Optical properties of human and pig nasal septum cartilage, and of bovine ear cartilage were examined using a spectrophotometer with an integrating sphere, and an Optical Multi-Channel Analyser. We measured total transmission Tt, total reflection Rt, and on-axis transmission Ta for light propagating through cartilage sample, over the visible spectral range (14000 - 28000 cm-1). It is shown that transmission and reflection spectra of human, pig and bovine cartilage are rather similar. It allows us to conclude that the pig cartilage can be used for in-vivo studies instead of human cartilage. The data obtained were treated by means of the one-dimensional diffusion approximation solution of the optical transport equation. We have found scattering coefficient s, absorption coefficient k and scattering anisotropy coefficient g by the iterative comparison of measured and calculated Tt, Rt and Ta values for human and pig cartilage. We found, in particular, that for 500 nm irradiation s equals 37,6 plus or minus 3.5 cm-1, g equals 0,56 plus or minus 0.05, k approximately equals 0,5 plus or minus 0.3 cm-1. The above data were used in Monte Carlo simulation for spatial intensity profile of light scattered by a cartilage sample. The computed profile was very similar to the profile measured using an Optical Multi-Channel Analyzer (OMA).
Supporting Biomaterials for Articular Cartilage Repair
Duarte Campos, Daniela Filipa; Drescher, Wolf; Rath, Björn; Tingart, Markus
2012-01-01
Orthopedic surgeons and researchers worldwide are continuously faced with the challenge of regenerating articular cartilage defects. However, until now, it has not been possible to completely mimic the biological and biochemical properties of articular cartilage using current research and development approaches. In this review, biomaterials previously used for articular cartilage repair research are addressed. Furthermore, a brief discussion of the state of the art of current cell printing procedures mimicking native cartilage is offered in light of their use as future alternatives for cartilage tissue engineering. Inkjet cell printing, controlled deposition cell printing tools, and laser cell printing are cutting-edge techniques in this context. The development of mimetic hydrogels with specific biological properties relevant to articular cartilage native tissue will support the development of improved, functional, and novel engineered tissue for clinical application. PMID:26069634
Biomaterial and Cell Based Cartilage Repair
Zhao, X
2015-01-01
Injuries to human native cartilage tissue are particularly troublesome because cartilage has little ability to heal or regenerate itself. The reconstruction, repair, and regeneration of cartilage tissue continue to be one of the greatest clinical challenges, especially in orthopaedic and plastic
Directory of Open Access Journals (Sweden)
Xia Liu
2014-01-01
Full Text Available The goal of this study is to determine the effects of Insulin-Transferrin-Selenium (ITS on proliferation of auricular chondrocytes and formation of engineered cartilage in vitro. Pig auricular monolayer chondrocytes and chondrocyte pellets were cultured in media containing 1% ITS at different concentrations of fetal bovine serum (FBS, 10%, 6%, 2%, 0%, or 10% FBS alone as a control for four weeks. Parameters including cell proliferation in monolayer, wet weight, collagen type I/II/X (Col I, II, X and glycosaminoglycan (GAG expression, GAG content of pellets and gene expression associated with cartilage formation/dedifferentiation (lost cartilage phenotype/hypertrophy within the chondrocyte pellets were assessed. The results showed that chondrocytes proliferation rates increased when FBS concentrations increased (2%, 6%, 10% FBS in ITS supplemented groups. In addition, 1% ITS plus 10% FBS significantly promoted cell proliferation than 10% FBS alone. No chondrocytes grew in ITS alone medium. 1% ITS plus 10% FBS enhanced cartilage formation in terms of size, wet weight, cartilage specific matrices, and homogeneity, compared to 10% FBS alone group. Furthermore, ITS prevented engineered cartilage from dedifferentiation (i.e., higher index of Col II/Col I mRNA expression and expression of aggrecan and hypertrophy (i.e., lower mRNA expression of Col X and MMP13. In conclusion, our results indicated that ITS efficiently enhanced auricular chondrocytes proliferation, retained chondrogenic phenotypes, and promoted engineered cartilage formation when combined with FBS, which is potentially used as key supplementation in auricular chondrocytes and engineered cartilage culture.
International Nuclear Information System (INIS)
Cova, M.; Frezza, F.; Pozzi-Mucelli, R.S.; Dalla-Palma, L.; Toffanin, R.; Pozzi-Mucelli, M.; Mlynarik, V.; Vittur, F.
1998-01-01
The aims of this study were (a) to compare the MR appearance of normal articular cartilage in ex vivo MR imaging (MRI) and MR microscopy (MRM) images of disarticulated human femoral heads, (b) to evaluate by MRM the topographic variations in articular cartilage of disarticulated human femoral heads, and subsequently, (c) to compare MRM images with histology. Ten disarticulated femoral heads were examined. Magnetic resonance images were obtained using spin-echo (SE) and gradient-echo (GE) sequences. Microimages were acquired on cartilage-bone cylindrical plugs excised from four regions (superior, inferior, anterior, posterior) of one femoral head, using a modified SE sequence. Both MRI and MRM images were obtained before and after a 90 rotation of the specimen, around the axis perpendicular to the examined cartilage surface. Finally, MRM images were correlated with histology. A trilaminar appearance of articular cartilage was observed with MRI and with a greater detail with MRM. A good correlation between MRI and MRM features was demonstrated. Both MRI and MRM showed a loss of the trilaminar cartilage appearance after specimen rotation, with greater evidence on MRM images. Cartilage excised from the four regions of the femoral head showed a different thickness, being thickest in the samples excised from the superior site. The MRM technique confirms the trilaminar MRI appearance of human articular cartilage, showing good correlation with histology. The loss of the trilaminar appearance of articular cartilage induced by specimen rotation suggests that this feature is partially related to the collagen-fiber orientation within the different layers. The MRM technique also shows topographic variations in thickness of human articular cartilage. (orig.)
Cartilage grafting in nasal reconstruction.
Immerman, Sara; White, W Matthew; Constantinides, Minas
2011-02-01
Nasal reconstruction after resection for cutaneous malignancies poses a unique challenge to facial plastic surgeons. The nose, a unique 3-D structure, not only must remain functional but also be aesthetically pleasing to patients. A complete understanding of all the layers of the nose and knowledge of available cartilage grafting material is necessary. Autogenous material, namely septal, auricular, and costal cartilage, is the most favored material in a free cartilage graft or a composite cartilage graft. All types of material have advantages and disadvantages that should guide the most appropriate selection to maximize the functional and cosmetic outcomes for patients. Copyright © 2011 Elsevier Inc. All rights reserved.
The balancing act of transcription factors C-1-1 and Runx2 in articular cartilage development
International Nuclear Information System (INIS)
Iwamoto, Masahiro; Koyama, Eiki; Enomoto-Iwamoto, Motomi; Pacifici, Maurizio
2005-01-01
In previous studies we found that the ets transcription factor C-1-1 is involved in articular chondrocyte development, and we and others found that the transcription factor Runx2 is required for growth plate chondrocyte maturation and ossification. We determined here whether the two factors exert reciprocal influences on their expression and function and in so doing, steer chondrocyte developmental paths. Virally driven Runx2 over-expression in cultured chick chondrocytes did indeed lead to decreased C-1-1 expression, accompanied by decreased expression of articular cartilage marker tenascin-C, decreased proliferation, and increased expression of maturation marker collagen X. In good agreement, over-expression of a dominant-negative Runx2 form had opposite phenotypic consequences. When C-1-1 itself was over-expressed in chondrocytes already undergoing maturation, maturation was halted and the cells became small, rich in tenascin-C, and mitotically quite active. To extend these observations, we misexpressed C-1-1 in mouse cartilage and found that it caused a severe inhibition of chondrocyte maturation and widespread tenascin-C expression. In sum, C-1-1 and Runx2 do influence their respective expression patterns. The factors are powerful chondrocyte regulators and their functional interrelationships may be important for steering the cells toward alternative developmental paths
Directory of Open Access Journals (Sweden)
Robert Klepacz
2010-06-01
Full Text Available Unusual expression of interleukin-1alpha, -1beta and -6 was previously found in the epiphyseal cartilage of rat fetuses prenatally exposed to various non-steroidal anti-inflammatory drugs (NSAID, i.e., ibuprofen, piroxicam, tolmetin and selective cyclooxygenase-2 inhibitor (DFU. The aim of the present study was to evaluate the role of placenta in such phenomenon. Morphology of the organ, thickness of basal and labyrinth layer, immunoexpression of COX isoenzymes were examined, and confronted with maternal biochemical data and fetal developmental parameters. Higher maternal urea level, as well as lower placental weight and labyrinth thickness were found in the group of fetuses who revealed expression of genes coded the selected interleukins, when compared with the xenobiotic-exposed pups without the selected genes expression and untreated control. A significant correlation between placental weight and maternal total protein or urea level was revealed. Histological changes like inflammatory infiltration and calcification were observed sporadically. Location and intensity of COX-1 staining was similar in all cases. However, more intense COX-2 staining for majority of cells of the basal zone and in dispersed giant cells of the labyrinth was found in inflamed organs. It could be concluded that abnormal expression of the selected interleukins is associated with low placental weight and decrease of its thickness, especially labyrinth zone, as well as with high maternal urea level.
MR Imaging of Articular Hyaline Cartilage
Uetani, Masataka
2005-01-01
MR imaging is still an evolving technique for the diagnosis of joint cartilage lesions. Early morphologic changes in the degenerative cartilage are not reliably diagnosed even with use of tailored MR imaging techniques. The detection of the biochemical changes of cartilage or high-resolution MRI will serve as an important tool for the early diagnosis of cartilage degeneration in near future. Further prospective studies are needed to establish the role of MR imaging in clinical use.
Molecular Genetic and Gene Therapy Studies of the Musculoskeletal System
2009-09-01
enlarged fracture cartilage. Real-time RT-PCR measurements compared Bax KO mouse fracture gene expression to C57BL/6J (wild-type) mouse fracture gene...2 mM l-glutamine, 100 U/mL peni - cillin, and 100 µg/mL streptomycin (Invitrogen) in 60-mm plates, and cultured in a humidified 37°C incubator with 5...increased callus size and callus cartilage formation during the early phase of the fracture healing process, the enlarged callus and cartilage area were
POSSIBILITIES OF CURRENT CELLULAR TECHNOLOGIES FOR ARTICULAR CARTILAGE REPAIR (ANALYTICAL REVIEW
Directory of Open Access Journals (Sweden)
M. S. Bozhokin
2016-01-01
Full Text Available Despite a wide variety of surgical procedures utilized in clinical practice for treatment of articular cartilage lesions, the search for other options of articular reconstruction remains a relevant and open issue at the current stage of medicine and biotechnologies development. The recent years demonstrated a strong belief in cellular methods of hyaline cartilage repair such as implantation of autologous chondrocytes (ACI or cultures of mesenchymal stem cells (MSC including techniques for genetic modification of cells.The purpose of presented review is to summarize the published scientific data on up to date results of perspective cellular technologies for articular cartilage repair that are being developed. Autologous chondrocyte transplantation originally performed by Swedish researchers in 1987 is considered the first clinically applied technique for restoration of hyaline cartilage using cellular technologies. However, the transplanted cell culture featured low proliferative capacity and inability to form a regenerate resistant to high physical activity. Another generation of methods originated at the turn of the century utilized mesenchymal stem cells instead of autologous chondrocytes. Preparation of MSCs is a less invasive procedure compared to chondrocytes harvesting and the culture is featured by a higher proliferative ability. Researchers use various biodegradable carriers (matrices to secure cell fixation. Despite good clinical mid-term outcomes the transplanted tissue-engineering structures deteriorate with time due to cellular de-differentiation. Next generation of techniques being currently under pre-clinical studies is featured by the preliminary chondrogenic modification of transplanted cell culture. Usage of various growth factors, modified cell product and gene-activated matrices allow to gain a stable regulatory and key proteins synthesis and achieve a focused influence on regenerate's chondrogenic proliferation and in result
Steck, Eric; Bräun, Jessica; Pelttari, Karoliina; Kadel, Stephanie; Kalbacher, Hubert; Richter, Wiltrud
2007-01-01
Cartilage acidic protein 1 (CRTAC1), a novel human marker which allowed discrimination of human chondrocytes from osteoblasts and mesenchymal stem cells in culture was so far studied only on the RNA-level. We here describe its genomic organisation and detect a new brain expressed (CRTAC1-B) isoform resulting from alternate last exon usage which is highly conserved in vertebrates. In humans, we identify an exon sharing process with the neighbouring tail-to-tail orientated gene leading to CRTAC1-A. This isoform is produced by cultured human chondrocytes, localized in the extracellular matrix of articular cartilage and its secretion can be stimulated by BMP4. Of five putative O-glycosylation motifs in the last exon of CRTAC1-A, the most C-terminal one is modified according to exposure of serial C-terminal deletion mutants to the O-glycosylation inhibitor Benzyl-alpha-GalNAc. Both isoforms contain four FG-GAP repeat domains and an RGD integrin binding motif, suggesting cell-cell or cell-matrix interaction potential. In summary, CRTAC1 acquired an alternate last exon from the tail-to-tail oriented neighbouring gene in humans resulting in the glycosylated isoform CRTAC1-A which represents a new extracellular matrix molecule of articular cartilage.
Hiemer, B.; Genz, B.; Jonitz-Heincke, A.; Pasold, J.; Wree, A.; Dommerich, S.; Bader, R.
2016-01-01
The regeneration of cartilage lesions still represents a major challenge. Cartilage has a tissue-specific architecture, complicating recreation by synthetic biomaterials. A novel approach for reconstruction is the use of devitalised cartilage. Treatment with high hydrostatic pressure (HHP) achieves devitalisation while biomechanical properties are remained. Therefore, in the present study, cartilage was devitalised using HHP treatment and the potential for revitalisation with chondrocytes and mesenchymal stem cells (MSCs) was investigated. The devitalisation of cartilage was performed by application of 480 MPa over 10 minutes. Effective cellular inactivation was demonstrated by the trypan blue exclusion test and DNA quantification. Histology and electron microscopy examinations showed undamaged cartilage structure after HHP treatment. For revitalisation chondrocytes and MSCs were cultured on devitalised cartilage without supplementation of chondrogenic growth factors. Both chondrocytes and MSCs significantly increased expression of cartilage-specific genes. ECM stainings showed neocartilage-like structure with positive AZAN staining as well as collagen type II and aggrecan deposition after three weeks of cultivation. Our results showed that HHP treatment caused devitalisation of cartilage tissue. ECM proteins were not influenced, thus, providing a scaffold for chondrogenic differentiation of MSCs and chondrocytes. Therefore, using HHP-treated tissue might be a promising approach for cartilage repair. PMID:27671122
Polymer Formulations for Cartilage Repair
Energy Technology Data Exchange (ETDEWEB)
Gutowska, Anna; Jasionowski, Marek; Morris, J. E.; Chrisler, William B.; An, Yuehuei H.; Mironov, V.
2001-05-15
Regeneration of destroyed articular cartilage can be induced by transplantation of cartilage cells into a defect. The best results are obtained with the use of autologus cells. However, obtaining large amounts of autologus cartilage cells causes a problem of creating a large cartilage defect in a donor site. Techniques are currently being developed to harvest a small number of cells and propagate them in vitro. It is a challenging task, however, due to the fact that ordinarily, in a cell culture on flat surfaces, chondrocytes do not maintain their in vivo phenotype and irreversibly diminish or cease the synthesis of aggregating proteoglycans. Therefore, the research is continuing to develop culture conditions for chondrocytes with the preserved phenotype.
Diode laser (980nm) cartilage reshaping
El Kharbotly, A.; El Tayeb, T.; Mostafa, Y.; Hesham, I.
2011-03-01
Loss of facial or ear cartilage due to trauma or surgery is a major challenge to the otolaryngologists and plastic surgeons as the complicated geometric contours are difficult to be animated. Diode laser (980 nm) has been proven effective in reshaping and maintaining the new geometric shape achieved by laser. This study focused on determining the optimum laser parameters needed for cartilage reshaping with a controlled water cooling system. Harvested animal cartilages were angulated with different degrees and irradiated with different diode laser powers (980nm, 4x8mm spot size). The cartilage specimens were maintained in a deformation angle for two hours after irradiation then released for another two hours. They were serially measured and photographed. High-power Diode laser irradiation with water cooling is a cheep and effective method for reshaping the cartilage needed for reconstruction of difficult situations in otorhinolaryngologic surgery. Key words: cartilage,diode laser (980nm), reshaping.
Precision of hyaline cartilage thickness measurements
Energy Technology Data Exchange (ETDEWEB)
Jonsson, K.; Buckwalter, K.; Helvie, M.; Niklason, L.; Martel, W. (Univ. of Michigan Hospitals, Ann Arbor, MI (United States). Dept. of Radiology)
1992-05-01
Measurement of cartilage thickness in vivo is an important indicator of the status of a joint as the various degenerative and inflammatory arthritides directly affect the condition of the cartilage. In order to assess the precision of thickness measurements of hyaline articular cartilage, we undertook a pilot study using MR imaging, plain radiography, and ultrasonography (US). We measured the cartilage of the hip and knee joints in 10 persons (4 healthy volunteers and 6 patients). The joints in each patient were examined on two separate occasions using each modality. In the hips a swell as the knee joints, the most precise measuring method was plain film radiography. For radiographs of the knees obtained in the standing position, the coefficient of variation was 6.5%; in the hips this figure was 6.34%. US of the knees and MR imaging of the hips were the second best modalities in the measurement of cartilage thickness. In addition, MR imaging enabled the most complete visualization of the joint cartilage. (orig.).
Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula
2014-01-20
Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus
Imaging diagnosis of the articular cartilage disorders
International Nuclear Information System (INIS)
Liu Sirun; Zhu Tianyuan; Huang Li; Leng Xiaoming
2003-01-01
Objective: To evaluate the diagnosis and differential diagnosis among the chronic osteoarthritis, rheumatoid arthritis and other chronic cartilage lesions on the plain films and MR images. Methods: Eighty-nine cases, including 115 joints, underwent plain film and MRI examination, and enhanced MRI scan was performed on 32 of them, including 44 joints. MRI scan sequences consisted of T 1 WI, T 2 WI + PDWI, STIR, and 3D FS SPGR. There were 90 knee joints in this group and each of the articular cartilage was divided into four parts: patella, femoral medial condyle, femoral lateral condyle, and tibia facet on MR images. The cartilage disorders were classified according to the outerbridge method. In addition, 61 cases including 75 joints were observed as a control group on the plain films and MR images. Results: 115 cartilage lesions were found on MR images, in which thinness of the cartilage (58 cases, 50.4%), bone changes under the cartilage (22 cases, 19.7%), medullar edema (22 cases, 19.7%), and synovial hyperplasia (52 cases, 45.2%) were seen. The patella cartilage was the most likely affected part (81/90, 90%). So the patellar cartilage lesions were divided as group 1 (grade I-II) and group 2 (grade III-IV) on MR images, which were compared with the plain film signs. The narrowing of the joint space and saccules under the articular surface were statistically significant with each other, and χ 2 values were 9.349 and 9.885, respectively (P=0.002). Conclusion: No constant signs could be seen on the plain films with grade I-II cartilage disorders. While the narrowing joint space and saccules under the joint surface could be seen on them with grade III-IV cartilage disorders, which were mainly correlated with the cartilage disorders and bone changes under the articular cartilages. A combination of the plain films and MR images is the best imaging method for examining the joints and joint cartilages. Enhanced MRI scan is very helpful on the diagnosis and differential
Martinez-Carranza, Nicolas; Hultenby, Kjell; Lagerstedt, Anne Sofie; Schupbach, Peter; Berg, Hans E
2017-07-01
Background Full-depth cartilage lesions do not heal and the long-term clinical outcome is uncertain. In the symptomatic middle-aged (35-60 years) patient, treatment with metal implants has been proposed. However, the cartilage health surrounding these implants has not been thoroughly studied. Our objective was to evaluate the health of cartilage opposing and adjacent to metal resurfacing implants. Methods The medial femoral condyle was operated in 9 sheep bilaterally. A metallic resurfacing metallic implant was immediately inserted into an artificially created 7.5 mm defect while on the contralateral knee the defect was left untreated. Euthanasia was performed at 6 months. Six animals, of similar age and study duration, from a previous study were used for comparison in the evaluation of cartilage health adjacent to the implant. Cartilage damage to joint surfaces within the knee, cartilage repair of the defect, and cartilage adjacent to the implant was evaluated macroscopically and microscopically. Results Six animals available for evaluation of cartilage health within the knee showed a varying degree of cartilage damage with no statistical difference between defects treated with implants or left untreated ( P = 0.51; 95% CI -3.7 to 6.5). The cartilage adjacent to the implant (score 0-14; where 14 indicates no damage) remained healthy in these 6 animals showing promising results (averaged 10.5; range 9-11.5, SD 0.95). Cartilage defects did not heal in any case. Conclusion Treatment of a critical size focal lesion with a metal implant is a viable alternative treatment.
Directory of Open Access Journals (Sweden)
Kai Jiao
Full Text Available BACKGROUND: Cartilage degradation is a typical characteristic of arthritis. This study examined whether there was a subset of phagocytic chondrocytes that expressed the specific macrophage marker, CD163, and investigated their role in cartilage degradation. METHODS: Cartilage from the knee and temporomandibular joints of Sprague-Dawley rats was harvested. Cartilage degradation was experimentally-induced in rat temporomandibular joints, using published biomechanical dental methods. The expression levels of CD163 and inflammatory factors within cartilage, and the ability of CD163(+ chondrocytes to conduct phagocytosis were investigated. Cartilage from the knees of patients with osteoarthritis and normal cartilage from knee amputations was also investigated. RESULTS: In the experimentally-induced degrading cartilage from temporomandibular joints, phagocytes were capable of engulfing neighboring apoptotic and necrotic cells, and the levels of CD163, TNF-α and MMPs were all increased (P0.05. CD163(+ chondrocytes were found in the cartilage mid-zone of temporomandibular joints and knee from healthy, three-week old rats. Furthermore, an increased number of CD163(+ chondrocytes with enhanced phagocytic activity were present in Col-II(+ chondrocytes isolated from the degraded cartilage of temporomandibular joints in the eight-week experimental group compared with their age-matched controls. Increased number with enhanced phagocytic activity of CD163(+ chondrocytes were also found in isolated Col-II(+ chondrocytes stimulated with TNF-α (P<0.05. Mid-zone distribution of CD163(+ cells accompanied with increased expression of CD163 and TNF-α were further confirmed in the isolated Col-II(+ chondrocytes from the knee cartilage of human patients with osteoarthritis, in contrast to the controls (both P<0.05. CONCLUSIONS: An increased number of CD163(+ chondrocytes with enhanced phagocytic activity were discovered within degraded joint cartilage, indicating a
The cranial cartilages of teleosts and their classification.
Benjamin, M
1990-01-01
The structure and distribution of cartilages has been studied in 45 species from 24 families. The resulting data have been used as a basis for establishing a new classification. A cartilage is regarded as 'cell-rich' if its cells or their lacunae occupy more than half of the tissue volume. Five classes of cell-rich cartilage are recognised (a) hyaline-cell cartilage (common in the lips of bottom-dwelling cyprinids) and its subtypes fibro/hyaline-cell cartilage, elastic/hyaline-cell cartilage ...
Bekkers, J.E.J.; Lambertus, W.B.; Benink, R.J.; Tsuchida, A.I.; Vincken, K.L.; Dhert, W.J.A.; Creemers, L.B.; Saris, Daniël B.F.
2013-01-01
Objective Delayed gadolinium enhanced MRI of cartilage (dGEMRIC) facilitates non-invasive evaluation of the glycosaminoglycan content in articular cartilage. The primary aim of this study was to show that the dGEMRIC technique is able to monitor cartilage repair following regenerative cartilage
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong
2016-08-01
2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.
Interplay of Inflammatory Mediators with Epigenetics and Cartilage Modifications in Osteoarthritis
Directory of Open Access Journals (Sweden)
Swarna Raman
2018-03-01
Full Text Available Osteoarthritis (OA, a degenerative disease of diarthrodial joints, is influenced by mechanical and inflammatory factors with aging, obesity, chronic injuries, and secondary diseases thought to be major factors driving the process of articular cartilage degeneration. Chondrocytes, the cellular component of cartilage, reside in an avascular environment and normally have limited potential to replicate. However, extrinsic factors such as injury to the joint or intrinsic alterations to the chondrocytes themselves can lead to an altered phenotype and development of OA. Synovial inflammation is also a pivotal element of the osteoarthritic, degenerative process: influx of pro-inflammatory cytokines and production of matrix metalloproteinases accelerate advanced cellular processes such as synovitis and cartilage damage. As well as a genetic input, recent data have highlighted epigenetic factors as contributing to disease. Studies conducted over the last decade have focused on three key aspects in OA; inflammation and the immune response, genome-wide association studies that have identified important genes undergoing epigenetic modifications, and finally how chondrocytes transform in their function during development and disease. Data highlighted here have identified critical inflammatory genes involved in OA and how these factors impact chondrocyte hypertrophy in the disease. This review also addresses key inflammatory factors in synovial inflammation, epigenetics, and chondrocyte fate, and how agents that inhibit epigenetic mechanisms like DNA methylation and histone modifications could aid in development of long-term treatment strategies for the disease.
Czech Academy of Sciences Publication Activity Database
Kološtová, K.; Taltynov, O.; Pintérová, D.; Boubelík, M.; Raška, O.; Hozák, Pavel; Jirkovská, M.; Bobek, V.
2012-01-01
Roč. 33, č. 1 (2012), s. 68-74 ISSN 0196-0709 Institutional research plan: CEZ:AV0Z50520514 Keywords : BALB/c mouse strain * significant angiogenesis * cartilage repair * phVEGF(165) injection Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.228, year: 2012
Vonk, L A; Kragten, A H M; Dhert, W J A; Saris, D B F; Creemers, L B
OBJECTIVE: Hsa-miR-148a expression is decreased in Osteoarthritis (OA) cartilage, but its functional role in cartilage has never been studied. Therefore, our aim was to investigate the effects of overexpressing hsa-miR-148a on cartilage metabolism of OA chondrocytes. DESIGN: OA chondrocytes were
Dynamic Culturing of Cartilage Tissue: The Significance of Hydrostatic Pressure
Pereira, Ana L.; Duarte, Ana R.C.; Frias, Ana M.; Pedro, Adriano J.; Oliveira, João T.; Sousa, Rui A.; Reis, Rui L.
2012-01-01
Human articular cartilage functions under a wide range of mechanical loads in synovial joints, where hydrostatic pressure (HP) is the prevalent actuating force. We hypothesized that the formation of engineered cartilage can be augmented by applying such physiologic stimuli to chondrogenic cells or stem cells, cultured in hydrogels, using custom-designed HP bioreactors. To test this hypothesis, we investigated the effects of distinct HP regimens on cartilage formation in vitro by either human nasal chondrocytes (HNCs) or human adipose stem cells (hASCs) encapsulated in gellan gum (GG) hydrogels. To this end, we varied the frequency of low HP, by applying pulsatile hydrostatic pressure or a steady hydrostatic pressure load to HNC-GG constructs over a period of 3 weeks, and evaluated their effects on cartilage tissue-engineering outcomes. HNCs (10×106 cells/mL) were encapsulated in GG hydrogels (1.5%) and cultured in a chondrogenic medium under three regimens for 3 weeks: (1) 0.4 MPa Pulsatile HP; (2) 0.4 MPa Steady HP; and (3) Static. Subsequently, we applied the pulsatile regimen to hASC-GG constructs and varied the amplitude of loading, by generating both low (0.4 MPa) and physiologic (5 MPa) HP levels. hASCs (10×106 cells/mL) were encapsulated in GG hydrogels (1.5%) and cultured in a chondrogenic medium under three regimens for 4 weeks: (1) 0.4 MPa Pulsatile HP; (2) 5 MPa Pulsatile HP; and (3) Static. In the HNC study, the best tissue development was achieved by the pulsatile HP regimen, whereas in the hASC study, greater chondrogenic differentiation and matrix deposition were obtained for physiologic loading, as evidenced by gene expression of aggrecan, collagen type II, and sox-9; metachromatic staining of cartilage extracellular matrix; and immunolocalization of collagens. We thus propose that both HNCs and hASCs detect and respond to physical forces, thus resembling joint loading, by enhancing cartilage tissue development in a frequency- and
Wu, Ling; Cai, Xiaoxiao; Zhang, Shu; Karperien, Marcel; Lin, Yunfeng
2013-05-01
Adipose-derived stem cells (ASCs) have been discovered for more than a decade. Due to the large numbers of cells that can be harvested with relatively little donor morbidity, they are considered to be an attractive alternative to bone marrow derived mesenchymal stem cells. Consequently, isolation and differentiation of ASCs draw great attention in the research of tissue engineering and regenerative medicine. Cartilage defects cause big therapeutic problems because of their low self-repair capacity. Application of ASCs in cartilage regeneration gives hope to treat cartilage defects with autologous stem cells. In recent years, a lot of studies have been performed to test the possibility of using ASCs to re-construct damaged cartilage tissue. In this article, we have reviewed the most up-to-date articles utilizing ASCs for cartilage regeneration in basic and translational research. Our topic covers differentiation of adipose tissue derived mesenchymal stem cells into chondrocytes, increased cartilage formation by co-culture of ASCs with chondrocytes and enhancing chondrogenic differentiation of ASCs by gene manipulation. Copyright © 2012 Wiley Periodicals, Inc.
MRI evaluation of acute articular cartilage injury of knee
International Nuclear Information System (INIS)
Zhang Jun; Wu Zhenhua; Fan Guoguang; Pan Shinong; Guo Qiyong
2003-01-01
Objective: To study the MRI manifestation of acute articular cartilage injury of knee for evaluating the extension and degree of the injury and guiding treatment. Methods: MRI of 34 patients with acute articular cartilage injury of knee within one day to fifteen days confirmed by arthroscopy and arthrotomy was reviewed and analyzed, with emphasis on articular cartilage and subchondral lesion. And every manifestation on MRI and that of arthroscopy and operation was compared. Results: The articular cartilage injury was diagnosed on MRI in 29 of 34 cases. Cartilage signal changes were found only in 4. The changes of cartilage shape were variable. Thinning of focal cartilage was showed in 3, osteochondral impaction in 3, creases of cartilage in 3, disrupted cartilage with fissuring in 13, cracks cartilage in 2, and cracks cartilage with displaced fragment in 1. Bone bruise and occult fracture were found only on MRI. Conclusion: The assessment of MRI and arthroscopy in acute articular cartilage injury are consistent. Combined with arthroscopy, MRI can succeed in assessing the extension and degree of acute articular injury and allowing treatment planning
Vonk, Lucienne A.; Kragten, Angela H.M.; Dhert, Wouter J.; Saris, Daniël B.F.; Creemers, Laura B.
2014-01-01
Objective Hsa-miR-148a expression is decreased in OA cartilage, but its functional role in cartilage has never been studied. Therefore, our aim was to investigate the effects of overexpressing hsa-miR-148a on cartilage metabolism of OA chondrocytes. Design OA chondrocytes were transfected with a
Tribology approach to the engineering and study of articular cartilage.
Wimmer, Markus A; Grad, Sibylle; Kaup, Thomas; Hänni, Markus; Schneider, Erich; Gogolewski, Sylwester; Alini, Mauro
2004-01-01
This study has been based on the assumption that articular motion is an important aspect of mechanotransduction in synovial joints. For this reason a new bioreactor concept, able to reproduce joint kinematics more closely, has been designed. The prototype consists of a rotating scaffold and/or cartilage pin, which is pressed onto an orthogonally rotating ball. By oscillating pin and ball in phase difference, elliptical displacement trajectories are generated that are similar to the motion paths occurring in vivo. Simultaneously, dynamic compression may be applied with a linear actuator, while two-step-motors generate the rotation of pin and ball. The whole apparatus is placed in an incubator. The control station is located outside. Preliminary investigations at the gene expression level demonstrated promising results. Compared with free-swelling control and/or simply compression-loaded samples, chondrocyte-seeded scaffolds as well as nasal cartilage explants exposed to interface motion both showed elevated levels of cartilage oligomeric matrix protein mRNA. The final design of the bioreactor will include four individual stations in line, which will facilitate the investigation of motion-initiated effects at the contacting surfaces in more detail.
Cartilage repair in the degenerative ageing knee
Brittberg, Mats; Gomoll, Andreas H; Canseco, José A; Far, Jack; Lind, Martin; Hui, James
2016-01-01
Background and purpose Cartilage damage can develop due to trauma, resulting in focal chondral or osteochondral defects, or as more diffuse loss of cartilage in a generalized organ disease such as osteoarthritis. A loss of cartilage function and quality is also seen with increasing age. There is a spectrum of diseases ranging from focal cartilage defects with healthy surrounding cartilage to focal lesions in degenerative cartilage, to multiple and diffuse lesions in osteoarthritic cartilage. At the recent Aarhus Regenerative Orthopaedics Symposium (AROS) 2015, regenerative challenges in an ageing population were discussed by clinicians and basic scientists. A group of clinicians was given the task of discussing the role of tissue engineering in the treatment of degenerative cartilage lesions in ageing patients. We present the outcomes of our discussions on current treatment options for such lesions, with particular emphasis on different biological repair techniques and their supporting level of evidence. Results and interpretation Based on the studies on treatment of degenerative lesions and early OA, there is low-level evidence to suggest that cartilage repair is a possible treatment for such lesions, but there are conflicting results regarding the effect of advanced age on the outcome. We concluded that further improvements are needed for direct repair of focal, purely traumatic defects before we can routinely use such repair techniques for the more challenging degenerative lesions. Furthermore, we need to identify trigger mechanisms that start generalized loss of cartilage matrix, and induce subchondral bone changes and concomitant synovial pathology, to maximize our treatment methods for biological repair in degenerative ageing joints. PMID:27910738
Role of Cartilage Forming Cells in Regenerative Medicine for Cartilage Repair
Sun, Lin; Reagan, Michaela R.; Kaplan, David L.
2010-01-01
Lin Sun1, Michaela R Reagan2, David L Kaplan1,21Department of Chemical and Biological Engineering, 2Department of Biomedical Engineering, Tufts University, Medford, MA, USAAbstract: Currently, cartilage repair remains a major challenge for researchers and physicians due to its limited healing capacity. Cartilage regeneration requires suitable cells; these must be easily obtained and expanded, able to produce hyaline matrix with proper mechanical properties, and demonstrate sustained integrati...
Imaging of cartilage repair procedures
International Nuclear Information System (INIS)
Sanghvi, Darshana; Munshi, Mihir; Pardiwala, Dinshaw
2014-01-01
The rationale for cartilage repair is to prevent precocious osteoarthritis in untreated focal cartilage injuries in the young and middle-aged population. The gamut of surgical techniques, normal postoperative radiological appearances, and possible complications have been described. An objective method of recording the quality of repair tissue is with the magnetic resonance observation of cartilage repair tissue (MOCART) score. This scoring system evaluates nine parameters that include the extent of defect filling, border zone integration, signal intensity, quality of structure and surface, subchondral bone, subchondral lamina, and records presence or absence of synovitis and adhesions. The five common techniques of cartilage repair currently offered include bone marrow stimulation (microfracture or drilling), mosaicplasty, synthetic resorbable scaffold grafts, osteochondral allograft transplants, and autologous chondrocyte implantation (ACI). Complications of cartilage repair procedures that may be demonstrated on magnetic resonance imaging (MRI) include plug loosening, graft protuberance, graft depression, and collapse in mosaicplasty, graft hypertrophy in ACI, and immune response leading to graft rejection, which is more common with synthetic grafts and cadaveric allografts
Goldberg-Bockhorn, Eva; Schwarz, Silke; Subedi, Rachana; Elsässer, Alexander; Riepl, Ricarda; Walther, Paul; Körber, Ludwig; Breiter, Roman; Stock, Karl; Rotter, Nicole
2018-02-01
The implantation of autologous cartilage as the gold standard operative procedure for the reconstruction of cartilage defects in the head and neck region unfortunately implicates a variety of negative effects at the donor site. Tissue-engineered cartilage appears to be a promising alternative. However, due to the complex requirements, the optimal material is yet to be determined. As demonstrated previously, decellularized porcine cartilage (DECM) might be a good option to engineer vital cartilage. As the dense structure of DECM limits cellular infiltration, we investigated surface modifications of the scaffolds by carbon dioxide (CO 2 ) and Er:YAG laser application to facilitate the migration of chondrocytes inside the scaffold. After laser treatment, the scaffolds were seeded with human nasal septal chondrocytes and analyzed with respect to cell migration and formation of new extracellular matrix proteins. Histology, immunohistochemistry, SEM, and TEM examination revealed an increase of the scaffolds' surface area with proliferation of cell numbers on the scaffolds for both laser types. The lack of cytotoxic effects was demonstrated by standard cytotoxicity testing. However, a thermal denaturation area seemed to hinder the migration of the chondrocytes inside the scaffolds, even more so after CO 2 laser treatment. Therefore, the Er:YAG laser seemed to be better suitable. Further modifications of the laser adjustments or the use of alternative laser systems might be advantageous for surface enlargement and to facilitate migration of chondrocytes into the scaffold in one step.
Fujimori, Motoshi; Nakamura, Satoko; Hasegawa, Kiminori; Ikeno, Kunihiro; Ichikawa, Shota; Sutherland, Kenneth; Kamishima, Tamotsu
2017-08-01
To quantify wrist cartilage using contrast MRI and compare with the extent of adjacent synovitis and bone marrow edema (BME) in patients with rheumatoid arthritis (RA). 18 patients with RA underwent post-contrast fat-suppressed T 1 weighted coronal imaging. Cartilage area at the centre of the scaphoid-capitate and radius-scaphoid joints was measured by in-house developed software. We defined cartilage as the pixels with signal intensity between two thresholds (lower: 0.4, 0.5 and 0.6 times the muscle signal, upper: 0.9, 1.0, 1.1, 1.2 and 1.3 times the muscle signal). We investigated the association of cartilage loss with synovitis and BME score derived from RA MRI scoring system. Cartilage area was correlated with BME score when thresholds were adequately set with lower threshold at 0.6 times the muscle signal and upper threshold at 1.2 times the muscle signal for both SC (r s =-0.469, p cartilage in the wrist and BME associated with cartilage loss in patients with RA. Advances in knowledge: Our software can quantify cartilage using conventional MR images of the wrist. BME is associated with cartilage loss in RA patients.
Directory of Open Access Journals (Sweden)
Ram Prakash Gupta
2017-11-01
Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.
Directory of Open Access Journals (Sweden)
Runko Suzan J
2005-10-01
Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and
Current status of imaging of articular cartilage
International Nuclear Information System (INIS)
Hodler, J.; Resnick, D.
1996-01-01
Various imaging methods have been applied to assessment of articular cartilage. These include standard radiography, arthrography, CT, CT arthrography, ultrasonography, and MR imaging. Radiography remains the initial musculoskeletal imaging method. However, it is insensitive to early stages of cartilage abnormalities. MR imaging has great potential in the assessment of articular cartilage, although high-quality scans are required because imaging signs of cartilage abnormalities may be subtle. The potential and limitations of various sequences and techniques are discussed, including MR arthrography. The role of the other imaging methods in assessment of articular cartilage appears to be limited. (orig.). With 8 figs., 6 tabs
Developmental expression of the alpha-skeletal actin gene
Directory of Open Access Journals (Sweden)
Vonk Freek J
2008-06-01
Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.
Moradi, Ali; Ataollahi, Forough; Sayar, Katayoun; Pramanik, Sumit; Chong, Pan-Pan; Khalil, Alizan Abdul; Kamarul, Tunku; Pingguan-Murphy, Belinda
2016-01-01
Extracellular matrices have drawn attention in tissue engineering as potential biomaterials for scaffold fabrication because of their bioactive components. Noninvasive techniques of scaffold fabrication and cross-linking treatments are believed to maintain the integrity of bioactive molecules while providing proper architectural and mechanical properties. Cartilage matrix derived scaffolds are designed to support the maintenance of chondrocytes and provide proper signals for differentiation of chondroinducible cells. Chondroinductive potential of bovine articular cartilage matrix derived porous scaffolds on human dermal fibroblasts and the effect of scaffold shrinkage on chondrogenesis were investigated. An increase in sulfated glycosaminoglycans production along with upregulation of chondrogenic genes confirmed that physically treated cartilage matrix derived scaffolds have chondrogenic potential on human dermal fibroblasts. © 2015 Wiley Periodicals, Inc.
Zhai, Li-Jie; Zhao, Ke-Qing; Wang, Zhi-Qiang; Feng, Ya; Xing, Shuang-Chun
2011-01-01
Cartilage has a poor intrinsic repair capacity, requiring surgical intervention to effect biological repair. Tissue engineering technologies or regenerative medicine strategies are currently being employed to address cartilage repair. Mesenchymal stem cells (MSCs) are considered to be an excellent cell source for this application. However, the different gene expression profiles between the MSCs and differentiated cartilage remain unclear. In this report, we first examined the gene expression ...
Cartilage proteoglycans inhibit fibronectin-mediated adhesion
Rich, A. M.; Pearlstein, E.; Weissmann, G.; Hoffstein, S. T.
1981-09-01
Normal tissues and organs show, on histological examination, a pattern of cellular and acellular zones that is characteristic and unique for each organ or tissue. This pattern is maintained in health but is sometimes destroyed by disease. For example, in mobile joints, the articular surfaces consist of relatively acellular hyaline cartilage, and the joint space is enclosed by a capsule of loose connective tissue with a lining of fibroblasts and macrophages. In the normal joint these cells are confined to the synovial lining and the articular surface remains acellular. In in vitro culture, macrophages and their precursor monocytes are very adhesive, and fibroblasts can migrate and overgrow surfaces such as collagen or plastic used for tissue culture. The fibroblasts adhere to collagen by means of fibronectin, which they synthesize and secrete1. Because the collagen of cartilage is capable of binding serum fibronectin2 and fibronectin is present in cartilage during its development3, these cells should, in theory, slowly migrate from the synovial lining to the articular surface. It is their absence from the articular cartilage in normal circumstances, and then presence in such pathological states as rheumatoid arthritis, that is striking. We therefore set out to determine whether a component of cartilage could prevent fibroblast adherence in a defined adhesion assay. As normal cartilage is composed of 50% proteoglycans and 50% collagen by dry weight4, we tested the possibility that the proteoglycans in cartilage inhibit fibroblast adhesion to collagen. We present here evidence that fibroblast spreading and adhesion to collagenous substrates is inhibited by cartilage proteoglycans.
Hilz, Florian M; Ahrens, Philipp; Grad, Sibylle; Stoddart, Martin J; Dahmani, Chiheb; Wilken, Frauke L; Sauerschnig, Martin; Niemeyer, Philipp; Zwingmann, Jörn; Burgkart, Rainer; von Eisenhart-Rothe, Rüdiger; Südkamp, Norbert P; Weyh, Thomas; Imhoff, Andreas B; Alini, Mauro; Salzmann, Gian M
2014-02-01
Articular cartilage, once damaged, has very low regenerative potential. Various experimental approaches have been conducted to enhance chondrogenesis and cartilage maturation. Among those, non-invasive electromagnetic fields have shown their beneficial influence for cartilage regeneration and are widely used for the treatment of non-unions, fractures, avascular necrosis and osteoarthritis. One very well accepted way to promote cartilage maturation is physical stimulation through bioreactors. The aim of this study was the investigation of combined mechanical and electromagnetic stress affecting cartilage cells in vitro. Primary articular chondrocytes from bovine fetlock joints were seeded into three-dimensional (3-D) polyurethane scaffolds and distributed into seven stimulated experimental groups. They either underwent mechanical or electromagnetic stimulation (sinusoidal electromagnetic field of 1 mT, 2 mT, or 3 mT; 60 Hz) or both within a joint-specific bioreactor and a coil system. The scaffold-cell constructs were analyzed for glycosaminoglycan (GAG) and DNA content, histology, and gene expression of collagen-1, collagen-2, aggrecan, cartilage oligomeric matrix protein (COMP), Sox9, proteoglycan-4 (PRG-4), and matrix metalloproteinases (MMP-3 and -13). There were statistically significant differences in GAG/DNA content between the stimulated versus the control group with highest levels in the combined stimulation group. Gene expression was significantly higher for combined stimulation groups versus static control for collagen 2/collagen 1 ratio and lower for MMP-13. Amongst other genes, a more chondrogenic phenotype was noticed in expression patterns for the stimulated groups. To conclude, there is an effect of electromagnetic and mechanical stimulation on chondrocytes seeded in a 3-D scaffold, resulting in improved extracellular matrix production. © 2013 Wiley Periodicals, Inc.
Caplan, Arnold I.
1984-01-01
Cartilage is a fundamental biological material that helps to shape the body and then helps to support it. Its fundamental properties of strength and resilience are explained in terms of the tissue's molecular structure. (JN)
Hyaline cartilage degenerates after autologous osteochondral transplantation.
Tibesku, C O; Szuwart, T; Kleffner, T O; Schlegel, P M; Jahn, U R; Van Aken, H; Fuchs, S
2004-11-01
Autologous osteochondral grafting is a well-established clinical procedure to treat focal cartilage defects in patients, although basic research on this topic remains sparse. The aim of the current study was to evaluate (1) histological changes of transplanted hyaline cartilage of osteochondral grafts and (2) the tissue that connects the transplanted cartilage with the adjacent cartilage in a sheep model. Both knee joints of four sheep were opened surgically and osteochondral grafts were harvested and simultaneously transplanted to the contralateral femoral condyle. The animals were sacrificed after three months and the received knee joints were evaluated histologically. Histological evaluation showed a complete ingrowth of the osseous part of the osteochondral grafts. A healing or ingrowth at the level of the cartilage could not be observed. Histological evaluation of the transplanted grafts according to Mankin revealed significantly more and more severe signs of degeneration than the adjacent cartilage, such as cloning of chondrocytes and irregularities of the articular surface. We found no connecting tissue between the transplanted and the adjacent cartilage and histological signs of degeneration of the transplanted hyaline cartilage. In the light of these findings, long-term results of autologous osteochondral grafts in human beings have to be followed critically.
Årøen, Asbjørn; Brøgger, Helga; Røtterud, Jan Harald; Sivertsen, Einar Andreas; Engebretsen, Lars; Risberg, May Arna
2016-02-11
Assessment of degenerative changes of the cartilage is important in knee cartilage repair surgery. Magnetic Resonance Imaging (MRI) T2 mapping and delayed Gadolinium Enhanced MRI of Cartilage (dGEMRIC) are able to detect early degenerative changes. The hypothesis of the study was that cartilage surrounding a focal cartilage lesion in the knee does not possess degenerative changes. Twenty-eight consecutive patients included in a randomized controlled trial on cartilage repair were evaluated using MRI T2 mapping and dGEMRIC before cartilage treatment was initiated. Inclusion was based on disabling knee problems (Lysholm score of ≤ 75) due to an arthroscopically verified focal femoral condyle cartilage lesion. Furthermore, no major malalignments or knee ligament injuries were accepted. Mean patient age was 33 ± 9.6 years, and the mean duration of knee symptoms was 49 ± 60 months. The MRI T2 mapping and the dGEMRIC measurements were performed at three standardized regions of interest (ROIs) at the medial and lateral femoral condyle, avoiding the cartilage lesion The MRI T2 mapping of the cartilage did not demonstrate significant differences between condyles with or without cartilage lesions. The dGEMRIC results did not show significantly lower values of the affected condyle compared with the opposite condyle and the contra-lateral knee in any of the ROIs. The intraclass correlation coefficient (ICC) of the dGEMRIC readings was 0.882. The MRI T2 mapping and the dGEMRIC confirmed the arthroscopic findings that normal articular cartilage surrounded the cartilage lesion, reflecting normal variation in articular cartilage quality. NCT00885729 , registered April 17 2009.
Peptide-Based Materials for Cartilage Tissue Regeneration.
Hastar, Nurcan; Arslan, Elif; Guler, Mustafa O; Tekinay, Ayse B
2017-01-01
Cartilaginous tissue requires structural and metabolic support after traumatic or chronic injuries because of its limited capacity for regeneration. However, current techniques for cartilage regeneration are either invasive or ineffective for long-term repair. Developing alternative approaches to regenerate cartilage tissue is needed. Therefore, versatile scaffolds formed by biomaterials are promising tools for cartilage regeneration. Bioactive scaffolds further enhance the utility in a broad range of applications including the treatment of major cartilage defects. This chapter provides an overview of cartilage tissue, tissue defects, and the methods used for regeneration, with emphasis on peptide scaffold materials that can be used to supplement or replace current medical treatment options.
Islamoglu, Kemal; Dikici, Mustafa Bahadir; Ozgentas, Halil Ege
2006-09-01
Bone dust and diced cartilage are used for contour restoration because their minimal donor site morbidity. The purpose of this study is to investigate permanence of bone dust, diced cartilage and bone dust/diced cartilage mixture in rabbits over 12 weeks. New Zealand white rabbits were used for this study. There were three groups in the study: Group I: 1 mL bone dust. Group II: 1 mL diced cartilage. Group III: 0.5 mL bone dust + 0.5 mL diced cartilage mixture. They were placed into subcutaneous tissue of rabbits and removed 12 weeks later. The mean volumes of groups were 0.23 +/- 0.08 mL in group I, 0.60 +/- 0.12 mL in group II and 0.36 +/- 0.10 mL in group III. The differences between groups were found statistically significant. In conclusion, diced cartilage was found more reliable than bone dust aspect of preserving its volume for a long period in this study.
Energy Technology Data Exchange (ETDEWEB)
Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)
2017-04-15
Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA
International Nuclear Information System (INIS)
Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei
2017-01-01
Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT
Wilson, W.; Rietbergen, van B.; Donkelaar, van C.C.; Huiskes, R.
2003-01-01
Results of both clinical and animal studies show that meniscectomy often leads to osteoarthritic degenerative changes in articular cartilage. It is generally assumed that this process of cartilage degeneration is due to changes in mechanical loading after meniscectomy. It is, however, not known why
Rabbit articular cartilage defects treated by allogenic chondrocyte transplantation
Boopalan, P. R. J. V. C.; Sathishkumar, Solomon; Kumar, Senthil; Chittaranjan, Samuel
2006-01-01
Articular cartilage defects have a poor capacity for repair. Most of the current treatment options result in the formation of fibro-cartilage, which is functionally inferior to normal hyaline articular cartilage. We studied the effectiveness of allogenic chondrocyte transplantation for focal articular cartilage defects in rabbits. Chondrocytes were cultured in vitro from cartilage harvested from the knee joints of a New Zealand White rabbit. A 3 mm defect was created in the articular cartilag...
Wright, V; Dowson, D
1976-02-01
Mechanisms of lubrication of human synovial joints have been analysed in terms of the operating conditions of the joint, the synovial fluid and articular cartilage. In the hip and knee during a walking cycle the load may rise up to four times body weight. In the knee on dropping one metre the load may go up to 25 time body weight. The elastic modulus of cartilage is similar to that of the synthetic rubber of a car tyre. The cartilage surface is rough and in elderly specimens the centre line average is 2-75 mum. The friction force generated in reciprocating tests shows that both cartilage and synovial fluid are important in lubrication. The viscosity-shear rate relationships of normal synovial fluid show that it is non-Newtonian. Osteoarthrosic fluid is less so and rheumatoid fluid is more nearly Newtonian. Experiments with hip joints in a pendulum machine show that fluid film lubrication obtains at some phases of joint action. Boundary lubrication prevails under certain conditions and has been examined with a reciprocating friction machine. Digestion of hyaluronate does not alter the boundary lubrication, but trypsin digestion does. Surface active substances (lauryl sulphate and cetyl 3-ammonium bromide) give a lubricating ability similar to that of synovial fluid. The effectiveness of the two substances varies with pH.
Biological aspects of tissue-engineered cartilage.
Hoshi, Kazuto; Fujihara, Yuko; Yamawaki, Takanori; Harai, Motohiro; Asawa, Yukiyo; Hikita, Atsuhiko
2018-04-01
Cartilage regenerative medicine has been progressed well, and it reaches the stage of clinical application. Among various techniques, tissue engineering, which incorporates elements of materials science, is investigated earnestly, driven by high clinical needs. The cartilage tissue engineering using a poly lactide scaffold has been exploratorily used in the treatment of cleft lip-nose patients, disclosing good clinical results during 3-year observation. However, to increase the reliability of this treatment, not only accumulation of clinical evidence on safety and usefulness of the tissue-engineered products, but also establishment of scientific background on biological mechanisms, are regarded essential. In this paper, we reviewed recent trends of cartilage tissue engineering in clinical practice, summarized experimental findings on cellular and matrix changes during the cartilage regeneration, and discussed the importance of further studies on biological aspects of tissue-engineered cartilage, especially by the histological and the morphological methods.
Wang, Z J; An, R Z; Zhao, J Y; Zhang, Q; Yang, J; Wang, J B; Wen, G Y; Yuan, X H; Qi, X W; Li, S J; Ye, X C
2014-06-18
After injury, inflammation, or degeneration, articular cartilage has limited self-repair ability. We aimed to explore the feasibility of repair of articular cartilage defects with tissue-engineered cartilage constructed by acellular cartilage matrices (ACMs) seeded with adipose-derived stem cells (ADSCs). The ADSCs were isolated from 3-month-old New Zealand albino rabbit by using collagenase and cultured and amplified in vitro. Fresh cartilage isolated from adult New Zealand albino rabbit were freeze-dried for 12 h and treated with Triton X-100, DNase, and RNase to obtain ACMs. ADSCs were seeded in the acellular cartilaginous matrix at 2x10(7)/mL, and cultured in chondrogenic differentiation medium for 2 weeks to construct tissue-engineered cartilage. Twenty-four New Zealand white rabbits were randomly divided into A, B, and C groups. Engineered cartilage was transplanted into cartilage defect position of rabbits in group A, group B obtained ACMs, and group C did not receive any transplants. The rabbits were sacrificed in week 12. The restored tissue was evaluated using macroscopy, histology, immunohistochemistry, and transmission electron microscopy (TEM). In the tissue-engineered cartilage group (group A), articular cartilage defects of the rabbits were filled with chondrocyte-like tissue with smooth surface. Immunohistochemistry showed type II-collagen expression and Alcian blue staining was positive. TEM showed chondrocytes in the recesses, with plenty of secretary matrix particles. In the scaffold group (group B), the defect was filled with fibrous tissue. No repaired tissue was found in the blank group (group C). Tissue-engineered cartilage using ACM seeded with ADSCs can help repair articular cartilage defects in rabbits.
Horbert, Victoria; Xin, Long; Foehr, Peter; Brinkmann, Olaf; Bungartz, Matthias; Burgkart, Rainer H; Graeve, T; Kinne, Raimund W
2018-02-01
Objective Limitations of matrix-assisted autologous chondrocyte implantation to regenerate functional hyaline cartilage demand a better understanding of the underlying cellular/molecular processes. Thus, the regenerative capacity of a clinically approved hydrogel collagen type I implant was tested in a standardized bovine cartilage punch model. Methods Cartilage rings (outer diameter 6 mm; inner defect diameter 2 mm) were prepared from the bovine trochlear groove. Collagen implants (± bovine chondrocytes) were placed inside the cartilage rings and cultured up to 12 weeks. Cartilage-implant constructs were analyzed by histology (hematoxylin/eosin; safranin O), immunohistology (aggrecan, collagens 1 and 2), and for protein content, RNA expression, and implant push-out force. Results Cartilage-implant constructs revealed vital morphology, preserved matrix integrity throughout culture, progressive, but slight proteoglycan loss from the "host" cartilage or its surface and decreasing proteoglycan release into the culture supernatant. In contrast, collagen 2 and 1 content of cartilage and cartilage-implant interface was approximately constant over time. Cell-free and cell-loaded implants showed (1) cell migration onto/into the implant, (2) progressive deposition of aggrecan and constant levels of collagens 1 and 2, (3) progressively increased mRNA levels for aggrecan and collagen 2, and (4) significantly augmented push-out forces over time. Cell-loaded implants displayed a significantly earlier and more long-lasting deposition of aggrecan, as well as tendentially higher push-out forces. Conclusion Preserved tissue integrity and progressively increasing cartilage differentiation and push-out forces for up to 12 weeks of cultivation suggest initial cartilage regeneration and lateral bonding of the implant in this in vitro model for cartilage replacement materials.
Bonadio, Marcelo B; Friedman, James M; Sennett, Mackenzie L; Mauck, Robert L; Dodge, George R; Madry, Henning
2017-12-01
This study compares a traditional parapatellar retinaculum-sacrificing arthrotomy to a retinaculum-sparing arthrotomy in a porcine stifle joint as a cartilage repair model. Surgical exposure of the femoral trochlea of ten Yucatan pigs stifle joint was performed using either a traditional medial parapatellar approach with retinaculum incision and luxation of the patella (n = 5) or a minimally invasive (MIS) approach which spared the patellar retinaculum (n = 5). Both classical and MIS approaches provided adequate access to the trochlea, enabling the creation of cartilage defects without difficulties. Four full thickness, 4 mm circular full-thickness cartilage defects were created in each trochlea. There were no intraoperative complications observed in either surgical approach. All pigs were allowed full weight-bearing and full range of motion immediately postoperatively and were euthanized between 2 and 3 weeks. The traditional approach was associated with increased cartilage wear compared to the MIS approach. Two blinded raters performed gross evaluation of the trochlea cartilage surrounding the defects according to the modified ICRS cartilage injury classification. The traditional approach cartilage received a significantly worse score than the MIS approach group from both scorers (3.2 vs 0.8, p = 0.01 and 2.8 vs 0, p = 0.005 respectively). The MIS approach results in less damage to the trochlear cartilage and faster return to load bearing activities. As an arthrotomy approach in the porcine model, MIS is superior to the traditional approach.
International Nuclear Information System (INIS)
ELMAGHRABY, T.; YACOUB, S.; IBRAHIM, N.K.
2009-01-01
There is overwhelming evidence to indicate that free radicals cause oxidative damage to lipids, proteins and nucleic acids and are involved in the pathogenesis of several diseases. Therefore, antioxidants, which can neutralize free radicals, may be of central importance in the prevention of these diseases. Recent studies demonstrated the role of shark cartilage in protecting cells against reactive oxygen species induced DNA damage and mutagenesis. Reactive oxygen species and other free radicals are known to be the mediators of phenotypic and genotypic changes that lead from mutation to neoplasia. There are some primary antioxidants such as glutathione peroxidase (GSHPx), glutathione-S-transferase (GST-π) and super oxide dismutase (SOD), which protects against cellular and molecular damage caused by the reactive oxygen metabolites (ROMs).In this study, the effect of shark cartilage against the N-nitroso-N-methyl urea + testosterone and/or gamma radiation-induced mutagens and carcinogens in rat prostate were investigated.The data showed significant decrease in gene expression of manganese superoxide dismutase (Mn-SOD), glutathione peroxidase 1 (GSHPx1) , enzyme activities of total superoxide dismutase (SOD) and glutathione peroxidase (GSHPx) and non-significant increase in glutathione-S-transferase (GST-π) in N-nitroso-N-methyl urea + testosterone, N-nitroso-N-methyl urea + testosterone + gamma radiation groups as compared to control group.The results revealed that shark cartilage administration afford a significant protective effect against N-nitroso-N-methyl urea + testosterone and/or gamma radiation- induced oxidative injury.
Modeling the development of tissue engineered cartilage
Sengers, B.G.
2005-01-01
The limited healing capacity of articular cartilage forms a major clinical problem. In general, current treatments of cartilage damage temporarily reliefs symptoms, but fail in the long term. Tissue engineering (TE) has been proposed as a more permanent repair strategy. Cartilage TE aims at
Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.
Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar
2016-02-01
Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.
Gaugler, Mario; Wirz, Dieter; Ronken, Sarah; Hafner, Mirjam; Göpfert, Beat; Friederich, Niklaus F; Elke, Reinhard
2015-04-01
To test meniscal mechanical properties such as the dynamic modulus of elasticity E* and the loss angle δ at two loading frequencies ω at different locations of the menisci and compare it to E* and δ of hyaline cartilage in indentation mode with spherical indenters. On nine pairs of human menisci, the dynamic E*-modulus and loss angle δ (as a measure of the energy dissipation) were determined. The measurements were performed at two different strain rates (slow sinusoidal and fast single impact) to show the strain rate dependence of the material. The measurements were compared to previous similar measurements with the same equipment on human hyaline cartilage. The resultant E* at fast indentation (median 1.16 MPa) was significantly higher, and the loss angle was significantly lower (median 10.2°) compared to slow-loading mode's E* and δ (median 0.18 MPa and 16.9°, respectively). Further, significant differences for different locations are shown. On the medial meniscus, the anterior horn shows the highest resultant dynamic modulus. In dynamic measurements with a spherical indenter, the menisci are much softer and less energy-dissipating than hyaline cartilage. Further, the menisci are stiffer and less energy-dissipating in the middle, intermediate part compared to the meniscal base. In compression, the energy dissipation of meniscus cartilage plays a minor role compared to hyaline cartilage. At high impacts, energy dissipation is less than on low impacts, similar to cartilage.
Wang, Limin; Detamore, Michael S
2009-01-01
Temporomandibular joint (TMJ) condylar cartilage is a distinct cartilage that has both fibrocartilaginous and hyaline-like character, with a thin proliferative zone that separates the fibrocartilaginous fibrous zone at the surface from the hyaline-like mature and hypertrophic zones below. In this study, we compared the effects of insulin-like growth factor-I (IGF-I), basic fibroblast growth factor (bFGF), transforming growth factor beta1 (TGF-beta1), and glucosamine sulphate on porcine TMJ condylar cartilage and ankle cartilage cells in monolayer culture. In general, TMJ condylar cartilage cells proliferated faster than ankle cartilage cells, while ankle cells produced significantly greater amounts of glycosaminoglycans (GAGs) and collagen than TMJ condylar cartilage cells. IGF-I and bFGF were potent stimulators of TMJ cell proliferation, while no signals statistically outperformed controls for ankle cell proliferation. IGF-I was the most effective signal for GAG production with ankle cells, and the most potent upregulator of collagen synthesis for both cell types. Glucosamine sulphate promoted cell proliferation and biosynthesis at specific concentrations and outperformed growth factors in certain instances. In conclusion, hyaline cartilage cells had lower cell numbers and superior biosynthesis compared to TMJ condylar cartilage cells, and we have found IGF-I at 100 ng/mL and glucosamine sulphate at 100 microg/mL to be the most effective signals for these cells under the prescribed conditions.
Endogenous Cartilage Repair by Recruitment of Stem Cells.
Im, Gun-Il
2016-04-01
Articular cartilage has a very limited capacity for repair after injury. The adult body has a pool of stem cells that are mobilized during injury or disease. These cells exist inside niches in bone marrow, muscle, adipose tissue, synovium, and other connective tissues. A method that mobilizes this endogenous pool of stem cells will provide a less costly and less invasive alternative if these cells successfully regenerate defective cartilage. Traditional microfracture procedures employ the concept of bone marrow stimulation to regenerate cartilage. However, the regenerated tissue usually is fibrous cartilage, which has very poor mechanical properties compared to those of normal hyaline cartilage. A method that directs the migration of a large number of autologous mesenchymal stem cells toward injury sites, retains these cells around the defects, and induces chondrogenic differentiation that would enhance success of endogenous cartilage repair. This review briefly summarizes chemokines and growth factors that induce recruitment, proliferation, and differentiation of endogenous progenitor cells, endogenous cell sources for regenerating cartilage, scaffolds for delivery of bioactive factors, and bioadhesive materials that are necessary to bring about endogenous cartilage repair.
Spectrocolorimetric evaluation of repaired articular cartilage after a microfracture
Directory of Open Access Journals (Sweden)
Dohi Yoshihiro
2008-09-01
Full Text Available Abstract Background In clinical practice, surgeons differentiate color changes in repaired cartilage compared with surrounding intact cartilage, but cannot quantify these color changes. Objective assessments are required. A spectrocolorimeter was used to evaluate whether intact and repaired cartilage can be quantified. Findings We investigated the use of a spectrocolorimeter and the application of two color models (L* a* b* colorimetric system and spectral reflectance distribution to describe and quantify articular cartilage. In this study, we measured the colors of intact and repaired cartilage after a microfracture. Histologically, the repaired cartilage was a mixture of fibrocartilage and hyaline cartilage. In the L* a* b* colorimetric system, the L* and a* values recovered to close to the values of intact cartilage, whereas the b* value decreased over time after the operation. Regarding the spectral reflectance distribution at 12 weeks after the operation, the repaired cartilage had a higher spectral reflectance ratio than intact cartilage between wavelengths of 400 to 470 nm. Conclusion This study reports the first results regarding the relationship between spectrocolorimetric evaluation and the histological findings of repair cartilage after a microfracture. Our findings demonstrate the ability of spectrocolorimetric measurement to judge the repair cartilage after treatment on the basis of objective data such as the L*, a* and b* values and the SRP as a coincidence index of the spectral reflectance curve.
Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M
2015-08-01
Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.
TSALTAS, T T
1958-10-01
Some biochemical aspects of the collapse of the rabbit ears produced by the intravenous injection of papain have been studied. A marked depletion of chondromucoprotein (M.C.S.) and a reduction of the S(35) content of cartilage matrix were found to coincide with the gross and histologic changes in the cartilage. At the same time there was a marked increase in the amount of S(35) in the serum and an increase of S(35) and glucuronic acid excreted in the urine. Alteration in the composition of the M.C.S. remaining in the cartilage of the papain-injected animals was detected. The findings indicate that the collapse of the rabbit ears is due to loss of chondromucoprotein from cartilage and reduction of chondroitin sulfate in the chondromucoprotein that remains. All these changes were reversed in recovery.
Preserved irradiated homologous cartilage for orbital reconstruction
International Nuclear Information System (INIS)
Linberg, J.V.; Anderson, R.L.; Edwards, J.J.; Panje, W.R.; Bardach, J.
1980-01-01
Human costal cartilage is an excellent implant material for orbital and periorbital reconstruction because of its light weight, strength, homogeneous consistency and the ease with which it can be carved. Its use has been limited by the necessity of a separate surgical procedure to obtain the material. Preserved irradiated homologous cartilage has been shown to have almost all the autogenous cartilage and is convenient to use. Preserved irradiated homologous cartilage transplants do not elicit rejection reactions, resist infection and rarely undergo absorption
Blumbach, K.; Bastiaansen-Jenniskens, Y.M.; Groot, J. de; Paulsson, M.; Osch, G.J.V.M. van; Zaucke, F.
2009-01-01
Objective. Defects in the assembly and composition of cartilage extracellular matrix are likely to result in impaired matrix integrity and increased susceptibility to cartilage degeneration. The aim of this study was to determine the functional interaction of the collagen fibril-associated proteins
Directory of Open Access Journals (Sweden)
H Paetzold
2012-04-01
Full Text Available For long term durability of tissue-engineered cartilage implanted in vivo, the development of the collagen fibre network orientation is essential as well as the distribution of collagen, since expanded chondrocytes are known to synthesise collagen type I. Typically, these properties differ strongly between native and tissue-engineered cartilage. Nonetheless, the clinical results of a pilot study with implanted tissue-engineered cartilage in pigs were surprisingly good. The purpose of this study was therefore to analyse if the structure and composition of the artificial cartilage tissue changes in the first 52 weeks after implantation. Thus, collagen network orientation and collagen type distribution in tissue-engineered cartilage-carrier-constructs implanted in the knee joints of Göttinger minipigs for 2, 26 or 52 weeks have been further investigated by processing digitised microscopy images of histological sections. The comparison to native cartilage demonstrated that fibre orientation over the cartilage depth has a clear tendency towards native cartilage with increasing time of implantation. After 2 weeks, the collagen fibres of the superficial zone were oriented parallel to the articular surface with little anisotropy present in the middle and deep zones. Overall, fibre orientation and collagen distribution within the implants were less homogenous than in native cartilage tissue. Despite a relatively low number of specimens, the consistent observation of a continuous approximation to native tissue is very promising and suggests that it may not be necessary to engineer the perfect tissue for implantation but rather to provide an intermediate solution to help the body to heal itself.
[Tissue engineering with mesenchymal stem cells for cartilage and bone regeneration].
Schaefer, D J; Klemt, C; Zhang, X H; Stark, G B
2000-09-01
Tissue engineering offers the possibility to fabricate living substitutes for tissues and organs by combining histogenic cells and biocompatible carrier materials. Pluripotent mesenchymal stem cells are isolated and subcultured ex vivo and then their histogenic differentiation is induced by external factors. The fabrication of bone and cartilage constructs, their combinations and gene therapeutic approaches are demonstrated. Advantages and disadvantages of these methods are described by in vitro and in vitro testing. The proof of histotypical function after implantation in vivo is essential. The use of autologous cells and tissue engineering methods offers the possibility to overcome the disadvantages of classical tissue reconstruction--donor site morbidity of autologous grafts, immunogenicity of allogenic grafts and loosening of alloplastic implants. Furthermore, tissue engineering widens the spectrum of surgical indications in bone and cartilage reconstruction.
Modern cartilage imaging of the ankle
International Nuclear Information System (INIS)
Weber, Marc-Andre; Wuennemann, Felix; Rehnitz, Christoph; Jungmann, Pia M.; Kuni, Benita
2017-01-01
Talar osteochondral lesions are an important risk factor for the development of talar osteoarthritis. Furthermore, osteochondral lesions might explain persistent ankle pain. Early diagnosis of accompanying chondral defects is important to establish the optimal therapy strategy and thereby delaying or preventing the onset of osteoarthritis. The purpose of this review is to explain modern cartilage imaging with emphasis of MR imaging as well as the discussion of more sophisticated imaging studies like CT-arthrography or functional MR imaging. Pubmed literature search concerning: osteochondral lesions, cartilage damage, ankle joint, talus, 2 D MR imaging, 3 D MR imaging, cartilage MR imaging, CT-arthrography, cartilage repair, microfracture, OATS, MACT. Dedicated MR imaging protocols to delineate talar cartilage and the appearance of acute and chronic osteochondral lesions were discussed. Recent developments of MR imaging, such as isotropic 3 D imaging that has a higher signal-to noise ratio when compared to 2 D imaging, and specialized imaging methods such as CT-arthrography as well as functional MR imaging were introduced. Several classifications schemes and imaging findings of osteochondral lesions that influence the conservative or surgical therapy strategy were discussed. MRI enables after surgery the non-invasive assessment of the repair tissue and the success of implantation. Key points: Modern MRI allows for highly resolved visualization of the articular cartilage of the ankle joint and of subchondral pathologies. Recent advances in MRI include 3 D isotropic ankle joint imaging, which deliver higher signal-to-noise ratios of the cartilage and less partial volume artifacts when compared with standard 2 D sequences. In case of osteochondral lesions MRI is beneficial for assessing the stability of the osteochondral fragment and for this discontinuity of the cartilage layer is an important factor. CT-arthrography can be used in case of contraindications of MRI and
Metal deposition at the bone-cartilage interface in articular cartilage
Energy Technology Data Exchange (ETDEWEB)
Kaabar, W. [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom)], E-mail: w.kaabar@surrey.ac.uk; Daar, E.; Gundogdu, O.; Jenneson, P.M. [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Farquharson, M.J. [Department of Radiography, School of Allied Health Sciences, City University, London EC1V 0HB (United Kingdom); Webb, M.; Jeynes, C. [Surrey Ion Beam Centre, University of Surrey, Guildford GU2 7XH (United Kingdom); Bradley, D.A. [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom)
2009-03-15
There is a growing interest being shown in the changes occurring in elemental distribution at the bone-cartilage interface, the changes either being a result of mechanical damage or disease. In particular, such investigations have tended to concern the elemental alterations associated with the osteoarthritic wear and tear damage occurring to the cartilage and subchondral bone of synovial joints or that associated with disease processes such as rheumatic arthritis. Present studies examine sections of femoral head obtained from total hip replacement surgery, use being made of micro-proton-induced X-ray emission ({mu}-PIXE) and the Rutherford back scattering (RBS) techniques. Enhancements of Zn, Ca and P have been observed at the bone-cartilage interface. Further, the concentration of Zn in spongy bone underlying the subchondral surface of a section of the femoral head has been measured, obtaining 136 {mu}g g{sup -1} bone, the presence of Ca and P at the same position being 0.235 and 0.0451 g g{sup -1} bone, respectively. These values are slightly different to figures recently published by other authors using similar techniques.
Regulators of articular cartilage homeostasis
Leijten, Jeroen Christianus Hermanus
2012-01-01
Prevention of hypertrophic differentiation is essential for successful cartilage repair strategies. Although this process is essential for longitudinal growth, it also is part of degenerative cartilage diseases such as osteoarthiritis. Moreover, it limits the use of cell types prone to this process
Meng, Juan-hong; Ma, Xu-chen; Li, Zhi-min; Wu, Deng-cheng
2007-12-20
Over 70% of the total tissue weight in the cartilage matrix consists of water, and the early-stage osteoarthritic cartilage is characterized by swelling. Water transport in the cartilage matrix and across the membranes of chondrocytes may be important in normal and pathological conditions of cartilage. The purpose of this study was to identify aquaporin-1 (AQP1) and aquaporin-3 (AQP3) expressions in the mandibular condylar cartilage after experimentally induced osteoarthritis (OA) in rats. An experimental temporomandibular joint OA was induced by partial discectomy in rats. The pathological characteristics of the normal, early-stage, and late-stage osteoarthritic TMJ cartilages were verified by histological techniques. The AQP1 and AQP3 gene expressions in the normal and osteoarthritic cartilages were measured using quantitative real-time reverse-transcription PCR analysis. The cartilage sections were incubated in primary polyclonal antibodies to AQP3; immunofluorescent microscopy was used to examine the AQP3 expression shown by its protein level. The mRNA expression levels of AQP1 and AQP3, analyzed using quantitative PCR, revealed that AQP3 mRNA was highly up-regulated in the OA cartilage, which was considered significant. There was no notable difference in the expression of AQP1 mRNA between OA and normal controls. With the progressing of the OA, the localization of the AQP3 protein was quite different from that of the normal cartilage. Compared to the normal cartilage, the expressions of AQP3 protein were observed mainly in the proliferative zone and the upper mid-zone chondrocytes at the early-stage of OA, and were observed to appear frequently throughout the mid- and deep zone during the late-stage of OA. The high expression of AQP3 mRNA in the OA cartilage and the different localization of the AQP3 protein suggest that it may play a particular role in OA pathogenesis. Further study of AQP3 function may provide new insight into the understanding of the
Articular cartilage changes in chondromalacia patellae.
Bentley, G
1985-11-01
Full thickness samples of articular cartilage were removed from areas of chondromalacia on the medial and "odd" facets of the patellae of 21 adults and examined by histology, autoradiography and electron microscopy. Surface fibrillation, loss of superficial matrix staining and reduced 35SO4 labelling was seen, with little change in the deep zone. Ten cases showed "fibrous metaplasia" of the superficial cartilage with definite evidence of cell division and apparent smoothing of the surface. Scattered chondrocyte replication appeared to occur in the surrounding intact cartilage. The findings suggest that early lesions in chondromalacia patellae may heal either by cartilage or fibrous metaplasia and that this may account for the resolution of clinical symptoms.
Cartilage Repair in Football (Soccer) Athletes
Bekkers, J.E.J.; de Windt, Th.S.; Brittberg, M.
2012-01-01
The prevalence of focal articular cartilage lesions among athletes is higher than in the general population. Treatment goals differ considerably between the professional and recreational athlete. High financial stakes and the short duration of a professional career influence the treatment selection for the professional athlete, while such parameters weigh differently in recreational sports. This article describes our investigation of the relation between sports and a high prevalence of focal cartilage lesions. In addition, we provide a critical review of the best available evidence for cartilage surgery and treatment selection, evaluate specific patient profiles for professional and recreational athletes, and propose a treatment algorithm for the treatment of focal cartilage lesions in football (soccer) players. PMID:26069606
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Directory of Open Access Journals (Sweden)
Heying Zhou
Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.
Sex-Specific Protection of Osteoarthritis by Deleting Cartilage Acid Protein 1.
Ge, Xianpeng; Ritter, Susan Y; Tsang, Kelly; Shi, Ruirui; Takei, Kohtaro; Aliprantis, Antonios O
2016-01-01
Cartilage acidic protein 1 (CRTAC1) was recently identified as an elevated protein in the synovial fluid of patients with osteoarthritis (OA) by a proteomic analysis. This gene is also upregulated in both human and mouse OA by transcriptomic analysis. The objective of this study was to characterize the expression and function of CRTAC1 in OA. Here, we first confirm the increase of CRTAC1 in cartilage biopsies from OA patients undergoing joint replacement by real-time PCR and immunohistochemistry. Furthermore, we report that proinflammatory cytokines interleukin-1beta and tumor necrosis factor alpha upregulate CRTAC1 expression in primary human articular chondrocytes and synovial fibroblasts. Genetic deletion of Crtac1 in mice significantly inhibited cartilage degradation, osteophyte formation and gait abnormalities of post-traumatic OA in female, but not male, animals undergoing the destabilization of medial meniscus (DMM) surgery. Taken together, CRTAC1 is upregulated in the osteoarthritic joint and directly induced in chondrocytes and synovial fibroblasts by pro-inflammatory cytokines. This molecule is necessary for the progression of OA in female mice after DMM surgery and thus represents a potential therapy for this prevalent disease, especially for women who demonstrate higher rates and more severe OA.
Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin
2015-01-01
We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Gabner, Simone; Häusler, Gabriele; Böck, Peter
2017-06-01
Core areas in voluminous pieces of permanent cartilage are metabolically supplied via vascular canals (VCs). We studied cartilage corrosion and removal of matrix degradation products during the development of VCs in nose and rib cartilage of piglets. Conventional staining methods were used for glycosaminoglycans, immunohistochemistry was performed to demonstrate collagens types I and II, laminin, Ki-67, von Willebrand factor, VEGF, macrophage marker MAC387, S-100 protein, MMPs -2,-9,-13,-14, and their inhibitors TIMP1 and TIMP2. VCs derived from connective tissue buds that bulged into cartilage matrix ("perichondrial papillae", PPs). Matrix was corroded at the tips of PPs or resulting VCs. Connective tissue stromata in PPs and VCs comprised an axial afferent blood vessel, peripherally located wide capillaries, fibroblasts, newly synthesized matrix, and residues of corroded cartilage matrix (collagen type II, acidic proteoglycans). Multinucleated chondroclasts were absent, and monocytes/macrophages were not seen outside the blood vessels. Vanishing acidity characterized areas of extracellular matrix degradation ("preresorptive layers"), from where the dismantled matrix components diffused out. Leached-out material stained in an identical manner to intact cartilage matrix. It was detected in the stroma and inside capillaries and associated downstream veins. We conclude that the delicate VCs are excavated by endothelial sprouts and fibroblasts, whilst chondroclasts are specialized to remove high volumes of mineralized cartilage. VCs leading into permanent cartilage can be formed by corrosion or inclusion, but most VCs comprise segments that have developed in either of these ways. Anat Rec, 300:1067-1082, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Satisfactory surgical option for cartilage graft absorption in microtia reconstruction.
Han, So-Eun; Oh, Kap Sung
2016-04-01
We routinely perform auricular elevation at least 6 months after implantation of framework in microtia reconstruction using costal cartilage. However, in a few cases, cartilage graft absorption has occurred, which has led to contour irregularity with unfavorable long-term results. In the present study, we recount the details of using additional rib cartilage augmentation to achieve an accentuated contour in cartilage graft absorption cases. The cartilage graft absorption was defined as contour irregularity or cartilage graft deformation as evaluated by the surgeon and patient. Depending on the extent of cartilage graft absorption, another rib cartilage framework was added to the previously implanted framework, targeting the absorption area. We used banked cartilage or harvested new cartilage based on three-dimensional rib computed tomography. Additional recontouring of framework was conducted in eight patients who were examined for cartilage graft absorption from 1.5 to 5 years after implantation of the framework. Four patients received additional rib cartilage augmentation and tissue expander insertion simultaneously prior to auricular elevation. Two patients underwent auricular elevation simultaneously. In another two patients, additional rib cartilage augmentation was performed before auricular elevation. The mean follow-up period was 18 months, and in all cases reconstructive results were acceptable. Although further follow-up evaluation is required, additional rib cartilage augmentation is an attractive surgical option for cartilage graft absorption cases. Copyright © 2016 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Lafeber, F. P.; Vander Kraan, P. M.; Huber-Bruning, O.; Vanden Berg, W. B.; Bijlsma, J. W.
1993-01-01
Osteoarthritis is a degenerative joint disease, characterized by the destruction of the articular cartilage. One of the first changes in the osteoarthritic articular cartilage is a reduction in proteoglycan content. In this study we demonstrate that transforming growth factor beta (TGF beta), a
Harnessing biomechanics to develop cartilage regeneration strategies.
Athanasiou, Kyriacos A; Responte, Donald J; Brown, Wendy E; Hu, Jerry C
2015-02-01
As this review was prepared specifically for the American Society of Mechanical Engineers H.R. Lissner Medal, it primarily discusses work toward cartilage regeneration performed in Dr. Kyriacos A. Athanasiou's laboratory over the past 25 years. The prevalence and severity of degeneration of articular cartilage, a tissue whose main function is largely biomechanical, have motivated the development of cartilage tissue engineering approaches informed by biomechanics. This article provides a review of important steps toward regeneration of articular cartilage with suitable biomechanical properties. As a first step, biomechanical and biochemical characterization studies at the tissue level were used to provide design criteria for engineering neotissues. Extending this work to the single cell and subcellular levels has helped to develop biochemical and mechanical stimuli for tissue engineering studies. This strong mechanobiological foundation guided studies on regenerating hyaline articular cartilage, the knee meniscus, and temporomandibular joint (TMJ) fibrocartilage. Initial tissue engineering efforts centered on developing biodegradable scaffolds for cartilage regeneration. After many years of studying scaffold-based cartilage engineering, scaffoldless approaches were developed to address deficiencies of scaffold-based systems, resulting in the self-assembling process. This process was further improved by employing exogenous stimuli, such as hydrostatic pressure, growth factors, and matrix-modifying and catabolic agents, both singly and in synergistic combination to enhance neocartilage functional properties. Due to the high cell needs for tissue engineering and the limited supply of native articular chondrocytes, costochondral cells are emerging as a suitable cell source. Looking forward, additional cell sources are investigated to render these technologies more translatable. For example, dermis isolated adult stem (DIAS) cells show potential as a source of
Mutations in THAP11 cause an inborn error of cobalamin metabolism and developmental abnormalities.
Quintana, Anita M; Yu, Hung-Chun; Brebner, Alison; Pupavac, Mihaela; Geiger, Elizabeth A; Watson, Abigail; Castro, Victoria L; Cheung, Warren; Chen, Shu-Huang; Watkins, David; Pastinen, Tomi; Skovby, Flemming; Appel, Bruce; Rosenblatt, David S; Shaikh, Tamim H
2017-08-01
CblX (MIM309541) is an X-linked recessive disorder characterized by defects in cobalamin (vitamin B12) metabolism and other developmental defects. Mutations in HCFC1, a transcriptional co-regulator which interacts with multiple transcription factors, have been associated with cblX. HCFC1 regulates cobalamin metabolism via the regulation of MMACHC expression through its interaction with THAP11, a THAP domain-containing transcription factor. The HCFC1/THAP11 complex potentially regulates genes involved in diverse cellular functions including cell cycle, proliferation, and transcription. Thus, it is likely that mutation of THAP11 also results in biochemical and other phenotypes similar to those observed in patients with cblX. We report a patient who presented with clinical and biochemical phenotypic features that overlap cblX, but who does not have any mutations in either MMACHC or HCFC1. We sequenced THAP11 by Sanger sequencing and discovered a potentially pathogenic, homozygous variant, c.240C > G (p.Phe80Leu). Functional analysis in the developing zebrafish embryo demonstrated that both THAP11 and HCFC1 regulate the proliferation and differentiation of neural precursors, suggesting important roles in normal brain development. The loss of THAP11 in zebrafish embryos results in craniofacial abnormalities including the complete loss of Meckel's cartilage, the ceratohyal, and all of the ceratobranchial cartilages. These data are consistent with our previous work that demonstrated a role for HCFC1 in vertebrate craniofacial development. High throughput RNA-sequencing analysis reveals several overlapping gene targets of HCFC1 and THAP11. Thus, both HCFC1 and THAP11 play important roles in the regulation of cobalamin metabolism as well as other pathways involved in early vertebrate development. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Regulatory Challenges for Cartilage Repair Technologies.
McGowan, Kevin B; Stiegman, Glenn
2013-01-01
In the United States, few Food and Drug Administration (FDA)-approved options exist for the treatment of focal cartilage and osteochondral lesions. Developers of products for cartilage repair face many challenges to obtain marketing approval from the FDA. The objective of this review is to discuss the necessary steps for FDA application and approval for a new cartilage repair product. FDA Guidance Documents, FDA Panel Meetings, scientific organization recommendations, and clinicaltrials.gov were reviewed to demonstrate the current thinking of FDA and the scientific community on the regulatory process for cartilage repair therapies. Cartilage repair therapies can receive market approval from FDA as medical devices, drugs, or biologics, and the specific classification of product can affect the nonclinical, clinical, and regulatory strategy to bring the product to market. Recent FDA guidance gives an outline of the required elements to bring a cartilage repair product to market, although these standards are often very general. As a result, companies have to carefully craft their study patient population, comparator group, and clinical endpoint to best showcase their product's attributes. In addition, regulatory strategy and manufacturing process validation need to be considered early in the clinical study process to allow for timely product approval following the completion of clinical study. Although the path to regulatory approval for a cartilage repair therapy is challenging and time-consuming, proper clinical trial planning and attention to the details can eventually save companies time and money by bringing a product to the market in the most expeditious process possible.
Cellular and Acellular Approaches for Cartilage Repair
2015-01-01
There are several choices of cells to use for cartilage repair. Cells are used as internal or external sources and sometimes in combination. In this article, an analysis of the different cell choices and their use and potential is provided. Embryonic cartilage formation is of importance when finding more about how to be able to perfect cartilage repair. Some suggestions for near future research based on up-to-date knowledge on chondrogenic cells are given to hopefully stimulate more studies on the final goal of cartilage regeneration. PMID:27340516
Evaluation of laryngeal cartilage calcification in computed tomography
International Nuclear Information System (INIS)
Laskowska, K.; Serafin, Z.; Lasek, W.; Maciejewski, M.; Wieczor, W.; Wisniewski, S.
2008-01-01
Computed tomography (CT) is one of the basic methods used for laryngeal carcinoma diagnostics. Osteosclerotic and osteolytic changes of the cartilages are considered as a common radiologic symptom of laryngeal neoplasms. The aim of this paper was to evaluate the prevalence of both osteosclerotic changes and focal calcification defects, which may be suggestive of osteolysis. Calcification was assessed in the thyroid, the cricoid and the arytenoids cartilages on CT images of the neck. We have retrospectively analyzed neck CT examinations of 50 patients without any laryngeal pathology in anamnesis. The grade and symmetry of calcifications was assessed in the thyroid, the cricoid and the arytenoids cartilages. Calcification of the laryngeal cartilages was present in 83% of the patients. Osteosclerotic lesions of the thyroid cartilage were seen in 70% of the patients (asymmetric in 60% of them), of the cricoid catrilage in 50% (asymmetric in 60%), and of the arytenoid cartilages in 24% (asymmetric in 67%). Focal calcification defects were present in the thyroid cartilage in 56% of the patients (asymmetric in 67% of them), in the cricoid catrilage in 8% (asymmetric in all cases), and in the arytenoid cartilages in 20% (asymmetric in 90%). Osteosclerotic changes and focal calcification defects, which may suggest osteolysis, were found in most of the patients. Therefore, they cannot be used as crucial radiological criteria of neoplastic invasion of laryngeal cartilages. (authors)
Heger, Michal; Mordon, Serge R.; Leroy, Gérard; Fleurisse, Laurence; Creusy, Collette
2006-03-01
Laser-assisted cartilage reshaping (LACR) is a relatively novel technique designed to noninvasively and permanently restructure cartilaginous tissue. It is believed that heat-induced stress relaxation, in which a temperature-mediated disruption of H2O binding is associated with conformational alterations in the proteoglycan and collagen-rich matrix, constitutes the underlying mechanism of LACR. Several reports have suggested that laser-mediated cartilage mineralization may contribute to the permanent shape change of laser-reshaped cartilage. In an effort to validate these results in the context of Er:glass LACR, we performed a preliminary Raman microspectrometric study to characterize the crystal deposits in laser-irradiated chondrocytes and extracellular matrix. For the first time, we identified intracellular calcium sulfate deposits and extracellular calcium phosphate (apatite) crystals in laser-reshaped rabbit auricular cartilage. Calcium carbonate deposits are localized in both irradiated and nonirradiated samples, suggesting that this mineral plays no role in conformational retention. In our discussion, we elaborate on the possible molecular and cellular mechanisms responsible for intra- and extracellular crystallization, and propose a novel hypothesis on the formation of apatite, inasmuch as the biological function of this mineral (providing structure and rigidity in bones and dental enamel) may be extrapolated to the permanent shape change of laser-irradiated cartilage.
St-Pierre, Jean-Philippe
The development of bioengineered cartilage for replacement of damaged articular cartilage has gained momentum in recent years. One such approach has been developed in the Kandel lab, whereby cartilage is formed by seeding primary articular chondrocytes on the top surface of a porous biodegradable calcium polyphosphate (CPP) bone substitute, permitting anchorage of the tissue within the pores of the substrate; however, the interfacial shear properties of the tissue-substrate interface of these biphasic constructs are 1 to 2 orders of magnitude lower than the native cartilage-subchondral bone interface. To overcome this limitation, a strategy was devised to generate a zone of calcified cartilage (ZCC), thereby mimicking the native architecture of the osteochondral junction; however, the ZCC was located slightly above the cartilage-CPP interface. Thus, it was hypothesized that polyphosphate released from the CPP substrate and accumulating in the tissue inhibits the formation of the ZCC at the tissue-substrate interface. Based on this information, a strategy was devised to generate biphasic constructs incorporating a properly located ZCC. This approach involved the application of a thin calcium phosphate film to the surfaces of porous CPP via a sol-gel procedure, thereby limiting the accumulation of polyphosphate in the cartilaginous tissue. This modification to the substrate surface did not negatively impact the quality of the in vitro-formed cartilage tissue or the ZCC. Interfacial shear testing of biphasic constructs demonstrated significantly improved interfacial shear properties in the presence of a properly located ZCC. These studies also led to the observation that chondrocytes produce endogenous polyphosphate and that its levels in deep zone cartilage appear inversely related to mineral deposition within the tissue. Using an in vitro model of cartilage calcification, it was demonstrated that polyphosphate levels are modulated in part by the inhibitory effects
Directory of Open Access Journals (Sweden)
Junjun Shi
2012-01-01
Full Text Available The clinical application of viral vectors for gene therapy is limited for biosafety consideration. In this study, to promote articular cartilage repair, poly (lactic-co glycolic acid (PLGA nanopolymers were used as non-viral vectors to transfect rabbit mesenchymal stem cells (MSCs with the pDC316-BMP4-EGFP plasmid. The cytotoxicity and transfection efficiency in vitro were acceptable measuring by CCK-8 and flow cytometry. After transfection, Chondrogenic markers (mRNA of Col2a1, Sox9, Bmp4, and Agg of experimental cells (MSCs being transfected with BMP-4 plasmid by PLGA nanopolymers were increased more than those of control cells (MSCs being transfected with naked BMP-4 plasmid alone. In vivo study, twelve rabbits (24 knees with large full thickness articular cartilage defects were randomly divided into the experimental group (MSCs being transfected with BMP-4 plasmid by PLGA nanopolymers and the control group (MSCs being transfected with naked BMP-4 plasmid. The experimental group showed better regeneration than the control group 6 and 12 weeks postoperatively. Hyaline-like cartilage formed at week 12 in the experimental group, indicating the local delivery of BMP-4 plasmid to MSCs by PLGA nanopolymers improved articular cartilage repair significantly. PLGA nanopolymers could be a promising and effective non-viral vector for gene therapy in cartilage repair.
Go, Ju Young; Kang, Bo Young; Hwang, Jin Hee; Oh, Kap Sung
2017-01-01
Efforts to prevent chest wall deformity after costal cartilage graft are ongoing. In this study, we introduce a new method to prevent donor site deformation using irradiated cadaver cartilage (ICC) and compare this method to the autogenous diced cartilage (ADC) technique. Forty-two pediatric patients comprised the ADC group (n = 24) and the ICC group (n = 18). After harvesting costal cartilage, the empty perichondrial space was filled with autologous diced cartilage in the ADC group and cadaver cartilage in the ICC group. Digital photographs and rib cartilage three-dimensional computed tomography (CT) data were analyzed to compare the preventive effect of donor site deformity. We compared the pre- and postoperative costal cartilage volumes using 3D-CT and graded the volumes (grade I: 0%-25%, grade II: 25%-50%, grade III: 50%-75%, and grade IV: 75%-100%). The average follow-up period was 20 and 24 months in the ADC and ICC groups, respectively. Grade IV maintenance of previous costal cartilage volume was evident postoperatively in 22% of patients in the ADC group and 82% of patients in the ICC group. Intercostal space narrowing and chest wall depression were less in the ICC group. There were no complications or severe resorption of cadaver cartilage. ICC support transected costal ring and prevented stability loss by acting as a spacer. The ICC technique is more effective in preventing intercostal space narrowing and chest wall depression than the ADC technique. Samsung Medical Center Institution Review Board, Unique protocol ID: 2009-10-006-008. This study is also registered on PRS (ClinicalTrials.gov Record 2009-10-006). Copyright © 2016 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Schwarz, M L R; Schneider-Wald, B; Krase, A; Richter, W; Reisig, G; Kreinest, M; Heute, S; Pott, P P; Brade, J; Schütte, A
2012-10-01
Values for the friction coefficient of articular cartilage are given in ranges of percentage and lower and are calculated as a quotient of the friction force and the perpendicular loading force acting on it. Thus, a sophisticated system has to be provided for analysing the friction coefficient under different conditions in particular when cartilage should be coupled as friction partner. It is possible to deep-freeze articular cartilage before measuring the friction coefficient as the procedure has no influence on the results. The presented tribological system was able to distinguish between altered and native cartilage. Furthermore, tissue engineered constructs for cartilage repair were differentiated from native cartilage probes by their friction coefficient. In conclusion a tribological equipment is presented to analyze the friction coefficient of articular cartilage, in vivo generated cartilage regenerates and in vitro tissue engineered constructs regarding their biomechanical properties for quality assessment.
Ding, Jinping; Chen, Bo; Lv, Tao; Liu, Xia; Fu, Xin; Wang, Qian; Yan, Li; Kang, Ning; Cao, Yilin; Xiao, Ran
2016-08-01
: The regeneration of tissue-engineered cartilage in an immunocompetent environment usually fails due to severe inflammation induced by the scaffold and their degradation products. In the present study, we compared the tissue remodeling and the inflammatory responses of engineered cartilage constructed with bone marrow mesenchymal stem cells (BMSCs), chondrocytes, or both and scaffold group in pigs. The cartilage-forming capacity of the constructs in vitro and in vivo was evaluated by histological, biochemical, and biomechanical analyses, and the inflammatory response was investigated by quantitative analysis of foreign body giant cells and macrophages. Our data revealed that BMSC-based engineered cartilage suppressed in vivo inflammation through the alteration of macrophage phenotype, resulting in better tissue survival compared with those regenerated with chondrocytes alone or in combination with BMSCs. To further confirm the macrophage phenotype, an in vitro coculture system established by engineered cartilage and macrophages was studied using immunofluorescence, enzyme-linked immunosorbent assay, and gene expression analysis. The results demonstrated that BMSC-based engineered cartilage promoted M2 polarization of macrophages with anti-inflammatory phenotypes including the upregulation of CD206, increased IL-10 synthesis, decreased IL-1β secretion, and alterations in gene expression indicative of M1 to M2 transition. It was suggested that BMSC-seeded constructs have the potential to ameliorate scaffold-induced inflammation and improve cartilaginous tissue regeneration through M2 polarization of macrophages. Finding a strategy that can prevent scaffold-induced inflammation is of utmost importance for the regeneration of tissue-engineered cartilage in an immunocompetent environment. This study demonstrated that bone marrow mesenchymal stem cell (BMSC)-based engineered cartilage could suppress inflammation by increasing M2 polarization of macrophages, resulting
Biomarkers of adult and developmental neurotoxicity
International Nuclear Information System (INIS)
Slikker, William; Bowyer, John F.
2005-01-01
Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations
Guan, Yingjie; Yang, Xu; Yang, Wentian; Charbonneau, Cherie; Chen, Qian
2014-10-01
Mechanical stress regulates development by modulating cell signaling and gene expression. However, the cytoplasmic components mediating mechanotransduction remain unclear. In this study, elimination of muscle contraction during chicken embryonic development resulted in a reduction in the activity of mammalian target of rapamycin (mTOR) in the cartilaginous growth plate. Inhibition of mTOR activity led to significant inhibition of chondrocyte proliferation, cartilage tissue growth, and expression of chondrogenic genes, including Indian hedgehog (Ihh), a critical mediator of mechanotransduction. Conversely, cyclic loading (1 Hz, 5% matrix deformation) of embryonic chicken growth plate chondrocytes in 3-dimensional (3D) collagen scaffolding induced sustained activation of mTOR. Mechanical activation of mTOR occurred in serum-free medium, indicating that it is independent of growth factor or nutrients. Treatment of chondrocytes with Rapa abolished mechanical activation of cell proliferation and Ihh gene expression. Cyclic loading of chondroprogenitor cells deficient in SH2-containing protein tyrosine phosphatase 2 (Shp2) further enhanced mechanical activation of mTOR, cell proliferation, and chondrogenic gene expression. This result suggests that Shp2 is an antagonist of mechanotransduction through inhibition of mTOR activity. Our data demonstrate that mechanical activation of mTOR is necessary for cell proliferation, chondrogenesis, and cartilage growth during bone development, and that mTOR is an essential mechanotransduction component modulated by Shp2 in the cytoplasm. © FASEB.
Schneider, E; Nevitt, M; McCulloch, C; Cicuttini, FM; Duryea, J; Eckstein, F; Tamez-Pena, J
2012-01-01
Objective To compare precision and evaluate equivalence of femorotibial cartilage volume (VC) and mean cartilage thickness (ThCtAB.Me) from independent segmentation teams using identical MR images from three series: sagittal 3D Dual Echo in the Steady State (DESS), coronal multi-planar reformat (DESS-MPR) of DESS and coronal 3D Fast Low Angle SHot (FLASH). Design 19 subjects underwent test-retest MR imaging at 3 Tesla. Four teams segmented the cartilage using prospectively defined plate regions and rules. Mixed models analysis of the pooled data were used to evaluate the effect of acquisition, team and plate on precision and Pearson correlations and mixed models to evaluate equivalence. Results Segmentation team differences dominated measurement variability in most cartilage regions for all image series. Precision of VC and ThCtAB.Me differed significantly by team and cartilage plate, but not between FLASH and DESS. Mean values of VC and ThCtAB.Me differed by team (P<0.05) for DESS, FLASH and DESS-MPR, FLASH VC was 4–6% larger than DESS in the medial tibia and lateral central femur, and FLASH ThCtAB.Me was 5–6% larger in the medial tibia, but 4–8% smaller in the medial central femur. Correlations betweenDESS and FLASH for VC and ThCtAB.Me were high (r=0.90–0.97), except for DESS versus FLASH medial central femur ThCtAB.Me (r=0.81–0.83). Conclusions Cartilage morphology metrics from different image contrasts had similar precision, were generally equivalent, and may be combined for cross-sectional analyses if potential systematic offsets are accounted for. Data from different teams should not be pooled unless equivalence is demonstrated for cartilage metrics of interest. PMID:22521758
IL-1ß and BMPs - Interactive players of cartilage matrix degradation and regeneration
Directory of Open Access Journals (Sweden)
T Aigner
2006-10-01
Full Text Available Intact human adult articular cartilage is central for the functioning of the articulating joints. This largely depends on the integrity of its extracellular matrix, given the high loading forces during movements in particular in the weight-bearing joints. Unlike the first impression of a more or less static tissue, articular cartilage shows - albeit in the adult organism a slow - tissue turnover. Thus, one of the most important questions in osteoarthritis research is to understand the balance of catabolic and anabolic factors in articular cartilage as this is the key to understand the biology of cartilage maintenance and degeneration. Anabolic and catabolic pathways are very much intermingled in articular cartilage. The balance between anabolism and catabolism is titrated on numerous levels, starting from the mediator-synthesizing cells which express either catabolic or anabolic factors. Also, on the level of the effector cells (i.e. chondrocytes anabolic and catabolic gene expression compete for a balance of matrix homeostasis, namely the synthesis of matrix components and the expression and activation of matrix-degrading proteases. Also, there are multiple layers of intracellular cross-talks in between the anabolic and catabolic signalling pathways. Maybe the most important lesson from this overview is the notion that the anabolic-catabolic balance as such counts and not so much sufficient net anabolism or limited catabolism alone. Thus, it might be neither the aim of osteoarthritis therapy to foster anabolism nor to knock down catabolism, but the balance of anabolic-catabolic activities as a total might need proper titration and balancing.
Fate of Meckel's cartilage chondrocytes in ocular culture
International Nuclear Information System (INIS)
Richman, J.M.; Diewert, V.M.
1988-01-01
Modulation of the chondrocyte phenotype was observed in an organ culture system using Meckel's cartilage. First branchial arch cartilage was dissected from fetal rats of 16- and 17-day gestation. Perichondrium was mechanically removed, cartilage was split at the rostral process, and each half was grafted into the anterior chamber of an adult rat eye. The observed pattern of development in nonirradiated specimens was the following: hypertrophy of the rostral process and endochondral-type ossification, fibrous atrophy in the midsection, and mineralization of the malleus and incus. A change in matrix composition of the implanted cartilage was demonstrated with immunofluorescence staining for cartilage-specific proteoglycan (CSPG). After 15 days of culture, CSPG was found in the auricular process but not in the midsection or rostral process. In order to mark the implanted cells and follow their fate, cartilage was labeled in vitro with [3H]thymidine [3H]TdR). Immediately after labeling 20% of the chondrocytes contained [3H]TdR. After culturing for 5 days, 20% of the chondrocytes were still labeled and 10% of the osteogenic cells also contained radioactive label. The labeling index decreased in both cell types with increased duration of culture. Multinucleated clast-type cells did not contain label. Additional cartilages not labeled with [3H]TdR were exposed to between 20000 and 6000 rad of gamma irradiation before ocular implantation. Irradiated cartilage did not hypertrophy or form bone but a fibrous region developed in the midsection. Cells of the host animal were not induced to form bone around the irradiated cartilage. Our studies suggest that fully differentiated chondrocytes of Meckel's cartilage have the capacity to become osteocytes, osteoblasts, and fibroblasts
Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi
2016-05-01
The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
He, Hanliang; Wang, Chunqing; Tang, Qifeng; Yang, Fan; Xu, Youjia
2018-06-01
Estrogen can affect the cartilage development of zebrafish; however, the mechanism underlying its effects is not completely understood. Four-day-old zebrafish larvae were treated with 0.8 μM estrogen, the 5 days post fertilization (dpf) zebrafish larvae did not demonstrate obvious abnormalities during development; however, the 6 dpf and 7 dpf larvae exhibited abnormal craniofacial bone development along with craniofacial bone degradation. RNA deep sequencing was performed to elucidate the mechanism involved. Gene Ontology functional and KEGG pathway enrichment analysis of differentially expressed genes (DEGs) showed that the extracellular matrix (ECM), extracellular region, ECM-interaction receptor, focal adhesion, cell cycle, apoptosis, and bone-related signaling pathways were disrupted. In these signaling pathways, the expressions of key genes, such as collagen encoded (col19a1a, col7a1, col7al, col18a1, and col9a3), MAPK signaling pathway (fgf19, fgf6a), TGF-beta signaling pathway (tgfbr1), and cell cycle (cdnk1a) genes were altered. The qRT-PCR results showed that after treatment with 0.8 μM 17-β estradiol (E2), col19a1a, col7a1, col7al, col18a1, col9a3, fgf6a, cdkn1a were downregulated, and fgf19, tgfr1 were upregulated, which were consistent with deep sequencing analysis. Therefore, the effect of estrogen on cartilage development might occur via multiple mechanisms. The study results demonstrate the mechanism underlying the effect of estrogen on cartilage development. Copyright © 2018 Elsevier B.V. All rights reserved.
Sonographic evaluation of femoral articular cartilage in the knee
International Nuclear Information System (INIS)
Hong, Sung Hwan; Kong Keun Young; Chung, Hye Won; Choi, Young Ho; Song, Yeong Wook; Kang, Heung Sik
2000-01-01
To investigate the usefulness of sonography for the evaluation of osteoarthritic articular cartilage. Ten asymptomatic volunteers and 20 patients with osteoarthritis of the knee underwent sonographic evaluation. For this, the knee was maintained of full flexion in order to expose the deep portion of femoral condylar cartilage. Both transverse and longitudinal scans were obtained in standardized planes. Sonographic images of the articular cartilages were analyzed in terms of surface sharpness, echogenicity and thickness, along with associated bone changes. Normal cartilages showed a clearly-defined surface, homogeneously low echogenicity and regular thickness. Among 20 patients, the findings for medial and lateral condyles, respectively, were as follows: poorly defined cartilage surface, 16 (80%) and ten (50%); increased echogenicity of cartilage, 17 (85%) and 16 (80%); cartilage thinning, 16 (80%) and 14 (70%) (two medial condyles demonstrated obvious cartilage thickening); the presence of thick subchondral hyperechoic bands, five (25%) and four (20%); the presence of osteophytes, 13 (65%) and 12 (60%). Sonography is a convenient and accurate modality for the evaluation of femoral articular cartilage. In particular, it can be useful for detecting early degenerative cartilaginous change and for studying such change during clinical follow-up. (author)
Benthien, Jan P; Behrens, Peter
2013-11-01
The potential of subchondral mesenchymal stem cell stimulation (MSS) for cartilage repair has led to the widespread use of microfracture as a first line treatment for full thickness articular cartilage defects. Recent focus on the effects of subchondral bone during cartilage injury and repair has expanded the understanding of the strengths and limitations in MSS and opened new pathways for potential improvement. Comparative studies have shown that bone marrow access has positive implications for pluripotential cell recruitment, repair quality and quantity, i.e. deeper channels elicited better cartilage fill, more hyaline cartilage character with higher type II collagen content and lower type I collagen content compared to shallow marrow access. A subchondral needling procedure using standardised and thin subchondral perforations deep into the subarticular bone marrow making the MSS more consistent with the latest developments in subchondral cartilage remodelling is proposed. As this is a novel method clinical studies have been initiated to evaluate the procedure especially compared to microfracturing. However, the first case studies and follow-ups indicate that specific drills facilitate reaching the subchondral bone marrow while the needle size makes perforation of the subchondral bone easier and more predictable. Clinical results of the first group of patients seem to compare well to microfracturing. The authors suggest a new method for a standardised procedure using a new perforating device. Advances in MSS by subchondral bone marrow perforation are discussed. It remains to be determined by clinical studies how this method compares to microfracturing. The subchondral needling offers the surgeon and the investigator a method that facilitates comparison studies because of its defined depth of subchondral penetration and needle size.
Vos, P.A.J.M.; Mastbergen, S.C.; Huisman, A.M.; Boer, T.N.de; Groot, J.de; Polak, A.A.; Lafeber, F.P.J.G.
2012-01-01
Objectives: Age is the most prominent predisposition for development of osteoarthritis (OA). Age-related changes of articular cartilage are likely to play a role. Advanced glycation endproducts (AGEs) accumulate in cartilage matrix with increasing age and adversely affect the biomechanical
Allogenic lyophilized cartilage grafts for craniomaxillofacial reconstruction
International Nuclear Information System (INIS)
Pill Hoon Choung
1999-01-01
Allogenic lyophilized cartilages were made in our clinic after Sailer methods and some modification. In our clinic, we have used allogenic cartilage grafts on 102 defects of craniomaxillofacial area; 1) for defects from cyst or ameloblastoma, 2) for lack of continuity of the mandible, 3) for rhinoplasty, 4) for paranasal augmentation, 5) for augmentation genioplasty, 6) for reconstruction of orbital floor, 7) for oroantral fistula, 8) for temporal augmentation, 9) for TMJ surgery 10) for condyle defect as a costochondral graft, 11) for filling of tooth socket and alveolus augmentation,12) for correction or orbital height and 13) for guided bone regeneration in peripheral implant. The types of lyophilized cartilage used were chip, sheet and block types developed by freeze-dried methods. Some grafts showed change of ossification, in which case we could perform implant on it. We have good results on reconstruction of craniomaxillofacial defects. Allogenic cartilage have advantages such as 1) it has no immune reaction clinically, 2) it is more tolerable to infection than that of autogenous cartilage, 3) it has character of less resorption which require no over correction, 4) it is easy to manipulate contouring, and 5) it has possibility of undergoing ossification. Allogenic cartilage has been considered as good substitutes for bone. The author would like to report the results on 102 allogenic cartilage have
The minor collagens in articular cartilage
DEFF Research Database (Denmark)
Luo, Yunyun; Sinkeviciute, Dovile; He, Yi
2017-01-01
Articular cartilage is a connective tissue consisting of a specialized extracellular matrix (ECM) that dominates the bulk of its wet and dry weight. Type II collagen and aggrecan are the main ECM proteins in cartilage. However, little attention has been paid to less abundant molecular components......, especially minor collagens, including type IV, VI, IX, X, XI, XII, XIII, and XIV, etc. Although accounting for only a small fraction of the mature matrix, these minor collagens not only play essential structural roles in the mechanical properties, organization, and shape of articular cartilage, but also...... fulfil specific biological functions. Genetic studies of these minor collagens have revealed that they are associated with multiple connective tissue diseases, especially degenerative joint disease. The progressive destruction of cartilage involves the degradation of matrix constituents including...
DEFF Research Database (Denmark)
Qazi, Arish Asif; Dam, Erik B.; Nielsen, Mads
2007-01-01
Rationale and Objectives Cartilage loss as determined by magnetic resonance imaging (MRI) or joint space narrowing as determined by x-ray is the result of cartilage erosion. However, metabolic processes within the cartilage that later result in cartilage loss may be a more sensitive assessment...... method for early changes. Recently, it was shown that cartilage homogeneity visualized by MRI representing the biochemical changes undergoing in the cartilage is a potential marker for early detection of knee osteoarthritis (OA) and is also able to significantly separate groups of healthy subjects from...... those with OA. The purpose of this study was twofold. First, we wished to evaluate whether the results on cartilage homogeneity from the previous study can be reproduced using an independent population. Second, based on the homogeneity framework, we present an automatic technique that partitions...
NONLINEAR SPECTRAL IMAGING OF ELASTIC CARTILAGE IN RABBIT EARS
Directory of Open Access Journals (Sweden)
JING CHEN
2013-07-01
Full Text Available Elastic cartilage in the rabbit external ear is an important animal model with attractive potential value for researching the physiological and pathological states of cartilages especially during wound healing. In this work, nonlinear optical microscopy based on two-photon excited fluorescence and second harmonic generation were employed for imaging and quantifying the intact elastic cartilage. The morphology and distribution of main components in elastic cartilage including cartilage cells, collagen and elastic fibers were clearly observed from the high-resolution two-dimensional nonlinear optical images. The areas of cell nuclei, a parameter related to the pathological changes of normal or abnormal elastic cartilage, can be easily quantified. Moreover, the three-dimensional structure of chondrocytes and matrix were displayed by constructing three-dimensional image of cartilage tissue. At last, the emission spectra from cartilage were obtained and analyzed. We found that the different ratio of collagen over elastic fibers can be used to locate the observed position in the elastic cartilage. The redox ratio based on the ratio of nicotinamide adenine dinucleotide (NADH over flavin adenine dinucleotide (FAD fluorescence can also be calculated to analyze the metabolic state of chondrocytes in different regions. Our results demonstrated that this technique has the potential to provide more accurate and comprehensive information for the physiological states of elastic cartilage.
Directory of Open Access Journals (Sweden)
Seong Hwan Park
2013-01-01
Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.
Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon
2013-01-01
Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044
M.R. Baghban Eslaminezhad, Ph.D.; L. Taghiyar, M.Sc; A. Piryaee, M.Sc
2007-01-01
Background and purpose: Vitro cartilage differentiation of mesenchymal stem cells (MSCs) has been noticed in several investigations. In this regard, almost always molecular differentiation of the cells has been examined, while structural and morphological differentiation of them has been ignored. Therefore, the present study examines the structure and ultrastructure of the cartilage differentiated from murine MSCs compared with that of costal cartilage.Materials and Methods: 2× 105 MSCs isola...
Directory of Open Access Journals (Sweden)
Zi-Xia Huang
Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.
Adipose stem cells can secrete angiogenic factors that inhibit hyaline cartilage regeneration.
Lee, Christopher Sd; Burnsed, Olivia A; Raghuram, Vineeth; Kalisvaart, Jonathan; Boyan, Barbara D; Schwartz, Zvi
2012-08-24
Adipose stem cells (ASCs) secrete many trophic factors that can stimulate tissue repair, including angiogenic factors, but little is known about how ASCs and their secreted factors influence cartilage regeneration. Therefore, the aim of this study was to determine the effects ASC-secreted factors have in repairing chondral defects. ASCs isolated from male Sprague Dawley rats were cultured in monolayer or alginate microbeads supplemented with growth (GM) or chondrogenic medium (CM). Subsequent co-culture, conditioned media, and in vivo cartilage defect studies were performed. ASC monolayers and microbeads cultured in CM had decreased FGF-2 gene expression and VEGF-A secretion compared to ASCs cultured in GM. Chondrocytes co-cultured with GM-cultured ASCs for 7 days had decreased mRNAs for col2, comp, and runx2. Chondrocytes treated for 12 or 24 hours with conditioned medium from GM-cultured ASCs had reduced sox9, acan, and col2 mRNAs; reduced proliferation and proteoglycan synthesis; and increased apoptosis. ASC-conditioned medium also increased endothelial cell tube lengthening whereas conditioned medium from CM-cultured ASCs had no effect. Treating ASCs with CM reduced or abolished these deleterious effects while adding a neutralizing antibody for VEGF-A eliminated ASC-conditioned medium induced chondrocyte apoptosis and restored proteoglycan synthesis. FGF-2 also mitigated the deleterious effects VEGF-A had on chondrocyte apoptosis and phenotype. When GM-grown ASC pellets were implanted in 1 mm non-critical hyaline cartilage defects in vivo, cartilage regeneration was inhibited as evaluated by radiographic and equilibrium partitioning of an ionic contrast agent via microCT imaging. Histology revealed that defects with GM-cultured ASCs had no tissue ingrowth from the edges of the defect whereas empty defects and defects with CM-grown ASCs had similar amounts of neocartilage formation. ASCs must be treated to reduce the secretion of VEGF-A and other factors that
Lafeber, F. P.; Vander Kraan, P. M.; van Roy, J. L.; Huber-Bruning, O.; Bijlsma, J. W.
1993-01-01
Proteoglycan metabolism of normal and histologically mild to moderate osteoarthritic cartilage explants were studied. Explants were obtained from the human knee of donors aged over 40 years. Proteoglycan content, synthesis and release were very similar in normal cartilage obtained from donors with
International Nuclear Information System (INIS)
Freemont, Anthony J.; Hoyland, Judith
2006-01-01
Cartilage repair is a major goal of modern tissue engineering. To produce novel engineered implants requires a knowledge of the basic biology of the tissues that are to be replaced or reproduced. Hyaline articular cartilage and meniscal fibrocartilage are two tissues that have excited attention because of the frequency with which they are damaged. A basic strategy is to re-engineer these tissues ex vivo by stimulating stem cells to differentiate into the cells of the mature tissue capable of producing an intact functional matrix. In this brief review, the sources of cells for tissue engineering cartilage and the culture conditions that have promoted differentiation are discussed within the context of natural cartilage repair. In particular, the role of cell density, cytokines, load, matrices and oxygen tension are discussed
Energy Technology Data Exchange (ETDEWEB)
Freemont, Anthony J. [Regenerative Medicine Research Group, University of Manchester, England (United Kingdom)]. E-mail: Tony.freemont@man.ac.uk; Hoyland, Judith [Regenerative Medicine Research Group, University of Manchester, England (United Kingdom)
2006-01-15
Cartilage repair is a major goal of modern tissue engineering. To produce novel engineered implants requires a knowledge of the basic biology of the tissues that are to be replaced or reproduced. Hyaline articular cartilage and meniscal fibrocartilage are two tissues that have excited attention because of the frequency with which they are damaged. A basic strategy is to re-engineer these tissues ex vivo by stimulating stem cells to differentiate into the cells of the mature tissue capable of producing an intact functional matrix. In this brief review, the sources of cells for tissue engineering cartilage and the culture conditions that have promoted differentiation are discussed within the context of natural cartilage repair. In particular, the role of cell density, cytokines, load, matrices and oxygen tension are discussed.
Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale
2016-04-01
The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.
Benjamin, M
1989-01-01
The development of hyaline-cell cartilage attached to membrane (dentary, maxilla, nasal, lacrimal and cleithrum) and cartilage (basioccipital) bones has been studied in the viviparous black molly, Poecilia sphenops. Intramembranous ossification commences before the first appearance of hyaline cells. As hyaline-cell cartilage is densely cellular and as that attached to the dentary, maxilla and cleithrum develops from the periosteum of these membrane bones, it must be regarded as secondary cartilage according to current concepts. It is also argued that the hyaline-cell cartilage attached to the perichondral bone of the basioccipital (a cartilage bone), could also be viewed as secondary. The status of the cartilage on the nasal and lacrimal bones is less clear, for it develops, at least in part, from mucochondroid (mucous connective) tissue. This is the first definitive report of secondary cartilage in any lower vertebrate. The tissue is therefore not restricted to birds and mammals as hitherto believed, and a multipotential periosteum must have arisen early in vertebrate evolution. Images Fig. 1 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 Fig. 13 Fig. 14 PMID:2481666
International Nuclear Information System (INIS)
Huang, Hongjie; Zhang, Xin; Hu, Xiaoqing; Dai, Linghui; Zhu, Jingxian; Man, Zhentao; Ao, Yingfang; Chen, Haifeng; Zhou, Chunyan
2014-01-01
Hydrogels are attractive for cartilage tissue engineering because of their high plasticity and similarity with the native cartilage matrix. However, one critical drawback of hydrogels for osteochondral repair is their inadequate mechanical strength. To address this limitation, we constructed a solid-supported thermogel comprising a chitosan hydrogel system and demineralized bone matrix. Scanning electron microscopy, the equilibrium scanning ratio, the biodegradation rate, biomechanical tests, biochemical assays, metabolic activity tests, immunostaining and cartilage-specific gene expression analysis were used to evaluate the solid-supported thermogel. Compared with pure hydrogel or demineralized matrix, the hybrid biomaterial showed superior porosity, equilibrium swelling and degradation rate. The hybrid scaffolds exhibited an increased mechanical strength: 75% and 30% higher compared with pure hydrogels and demineralized matrix, respectively. After three days culture, bone-derived mesenchymal stem cells (BMSCs) maintained viability above 90% in all three materials; however, the cell retention of the hybrid scaffolds was more efficient and uniform than the other materials. Matrix production and chondrogenic differentiation of BMSCs in the hybrid scaffolds were superior to its precursors, based on glycosaminoglycan quantification and hyaline cartilage marker expression after three weeks in culture. Its easy preparation, favourable biophysical properties and chondrogenic capacity indicated that this solid-supported thermogel could be an attractive biomaterial framework for cartilage tissue engineering. (paper)
Joint homeostasis in tissue engineering for cartilage repair
Saris, D.B.F.
2002-01-01
Traumatic joint damage, articular cartilage and the research into methods of restoring the articulation are not new topics of interest. For centuries, clinicians have recognized the importance of cartilage damage and sought ways of learning about the normal form and function of hyaline cartilage as
Recent advances in hydrogels for cartilage tissue engineering
Directory of Open Access Journals (Sweden)
SL Vega
2017-01-01
Full Text Available Articular cartilage is a load-bearing tissue that lines the surface of bones in diarthrodial joints. Unfortunately, this avascular tissue has a limited capacity for intrinsic repair. Treatment options for articular cartilage defects include microfracture and arthroplasty; however, these strategies fail to generate tissue that adequately restores damaged cartilage. Limitations of current treatments for cartilage defects have prompted the field of cartilage tissue engineering, which seeks to integrate engineering and biological principles to promote the growth of new cartilage to replace damaged tissue. To date, a wide range of scaffolds and cell sources have emerged with a focus on recapitulating the microenvironments present during development or in adult tissue, in order to induce the formation of cartilaginous constructs with biochemical and mechanical properties of native tissue. Hydrogels have emerged as a promising scaffold due to the wide range of possible properties and the ability to entrap cells within the material. Towards improving cartilage repair, hydrogel design has advanced in recent years to improve their utility. Some of these advances include the development of improved network crosslinking (e.g. double-networks, new techniques to process hydrogels (e.g. 3D printing and better incorporation of biological signals (e.g. controlled release. This review summarises these innovative approaches to engineer hydrogels towards cartilage repair, with an eye towards eventual clinical translation.
Recent advances in hydrogels for cartilage tissue engineering.
Vega, S L; Kwon, M Y; Burdick, J A
2017-01-30
Articular cartilage is a load-bearing tissue that lines the surface of bones in diarthrodial joints. Unfortunately, this avascular tissue has a limited capacity for intrinsic repair. Treatment options for articular cartilage defects include microfracture and arthroplasty; however, these strategies fail to generate tissue that adequately restores damaged cartilage. Limitations of current treatments for cartilage defects have prompted the field of cartilage tissue engineering, which seeks to integrate engineering and biological principles to promote the growth of new cartilage to replace damaged tissue. To date, a wide range of scaffolds and cell sources have emerged with a focus on recapitulating the microenvironments present during development or in adult tissue, in order to induce the formation of cartilaginous constructs with biochemical and mechanical properties of native tissue. Hydrogels have emerged as a promising scaffold due to the wide range of possible properties and the ability to entrap cells within the material. Towards improving cartilage repair, hydrogel design has advanced in recent years to improve their utility. Some of these advances include the development of improved network crosslinking (e.g. double-networks), new techniques to process hydrogels (e.g. 3D printing) and better incorporation of biological signals (e.g. controlled release). This review summarises these innovative approaches to engineer hydrogels towards cartilage repair, with an eye towards eventual clinical translation.
Tissue engineering in the treatment of cartilage lesions
Directory of Open Access Journals (Sweden)
Jakob Naranđa
2013-11-01
Full Text Available Background: Articular cartilage lesions with the inherent limited healing potential are difficult to treat and thus remain a challenging problem for orthopaedic surgeons. Regenerative treatment techniques, such as autologous chondrocyte implantation (ACI, are promising as a treatment option to restore hyaline-like cartilage tissue in damaged articular surfaces, as opposed to the traditional reparative procedures (e.g. bone marrow stimulation – microfracture, which promote a fibrocartilage formation with lower tissue biomechanical properties and poorer clinical results. ACI technique has undergone several advances and is constantly improving. The new concept of cartilage tissue preservation uses tissue-engineering technologies, combining new biomaterials as a scaffold, application of growth factors, use of stem cells, and mechanical stimulation. The recent development of new generations of ACI uses a cartilage-like tissue in a 3-dimensional culture system that is based on the use of biodegradable material which serves as a temporary scaffold for the in vitro growth and subsequent implantation into the cartilage defect. For clinical practice, single stage procedures appear attractive to reduce cost and patient morbidity. Finally, modern concept of tissue engineering facilitates hyaline-like cartilage formation and a permanent treatment of cartilage lesions.Conclusion: The review focuses on innovations in the treatment of cartilage lesions and covers modern concepts of tissue engineering with the use of biomaterials, growth factors, stem cells and bioreactors, and presents options for clinical use.
From gristle to chondrocyte transplantation: treatment of cartilage injuries.
Lindahl, Anders
2015-10-19
This review addresses the progress in cartilage repair technology over the decades with an emphasis on cartilage regeneration with cell therapy. The most abundant cartilage is the hyaline cartilage that covers the surface of our joints and, due to avascularity, this tissue is unable to repair itself. The cartilage degeneration seen in osteoarthritis causes patient suffering and is a huge burden to society. The surgical approach to cartilage repair was non-existing until the 1950s when new surgical techniques emerged. The use of cultured cells for cell therapy started as experimental studies in the 1970s that developed over the years to a clinical application in 1994 with the introduction of the autologous chondrocyte transplantation technique (ACT). The technology is now spread worldwide and has been further refined by combining arthroscopic techniques with cells cultured on matrix (MACI technology). The non-regenerating hypothesis of cartilage has been revisited and we are now able to demonstrate cell divisions and presence of stem-cell niches in the joint. Furthermore, cartilage derived from human embryonic stem cells and induced pluripotent stem cells could be the base for new broader cell treatments for cartilage injuries and the future technology base for prevention and cure of osteoarthritis. © 2015 The Author(s).
From gristle to chondrocyte transplantation: treatment of cartilage injuries
Lindahl, Anders
2015-01-01
This review addresses the progress in cartilage repair technology over the decades with an emphasis on cartilage regeneration with cell therapy. The most abundant cartilage is the hyaline cartilage that covers the surface of our joints and, due to avascularity, this tissue is unable to repair itself. The cartilage degeneration seen in osteoarthritis causes patient suffering and is a huge burden to society. The surgical approach to cartilage repair was non-existing until the 1950s when new surgical techniques emerged. The use of cultured cells for cell therapy started as experimental studies in the 1970s that developed over the years to a clinical application in 1994 with the introduction of the autologous chondrocyte transplantation technique (ACT). The technology is now spread worldwide and has been further refined by combining arthroscopic techniques with cells cultured on matrix (MACI technology). The non-regenerating hypothesis of cartilage has been revisited and we are now able to demonstrate cell divisions and presence of stem-cell niches in the joint. Furthermore, cartilage derived from human embryonic stem cells and induced pluripotent stem cells could be the base for new broader cell treatments for cartilage injuries and the future technology base for prevention and cure of osteoarthritis. PMID:26416680
PAPAIN-INDUCED CHANGES IN RABBIT CARTILAGE
Tsaltas, Theodore T.
1958-01-01
Some biochemical aspects of the collapse of the rabbit ears produced by the intravenous injection of papain have been studied. A marked depletion of chondromucoprotein (M.C.S.) and a reduction of the S35 content of cartilage matrix were found to coincide with the gross and histologic changes in the cartilage. At the same time there was a marked increase in the amount of S35 in the serum and an increase of S35 and glucuronic acid excreted in the urine. Alteration in the composition of the M.C.S. remaining in the cartilage of the papain-injected animals was detected. The findings indicate that the collapse of the rabbit ears is due to loss of chondromucoprotein from cartilage and reduction of chondroitin sulfate in the chondromucoprotein that remains. All these changes were reversed in recovery. PMID:13575681
Reduce, reuse, and recycle: developmental evolution of trait diversification.
Preston, Jill C; Hileman, Lena C; Cubas, Pilar
2011-03-01
A major focus of evolutionary developmental (evo-devo) studies is to determine the genetic basis of variation in organismal form and function, both of which are fundamental to biological diversification. Pioneering work on metazoan and flowering plant systems has revealed conserved sets of genes that underlie the bauplan of organisms derived from a common ancestor. However, the extent to which variation in the developmental genetic toolkit mirrors variation at the phenotypic level is an active area of research. Here we explore evidence from the angiosperm evo-devo literature supporting the frugal use of genes and genetic pathways in the evolution of developmental patterning. In particular, these examples highlight the importance of genetic pleiotropy in different developmental modules, thus reducing the number of genes required in growth and development, and the reuse of particular genes in the parallel evolution of ecologically important traits.
Alexander, Peter G.; Song, Yingjie; Taboas, Juan M.; Chen, Faye H.; Melvin, Gary M.; Manner, Paul A.
2013-01-01
Objective: Traumatic impacts on the articular joint surface in vitro are known to lead to degeneration of the cartilage. The main objective of this study was to develop a spring-loaded impact device that can be used to deliver traumatic impacts of consistent magnitude and rate and to find whether impacts cause catabolic activities in articular cartilage consistent with other previously reported impact models and correlated with the development of osteoarthritic lesions. In developing the spring-loaded impactor, the operating hypothesis is that a single supraphysiologic impact to articular cartilage in vitro can affect cartilage integrity, cell viability, sulfated glycosaminoglycan and inflammatory mediator release in a dose-dependent manner. Design: Impacts of increasing force are delivered to adult bovine articular cartilage explants in confined compression. Impact parameters are correlated with tissue damage, cell viability, matrix and inflammatory mediator release, and gene expression 24 hours postimpact. Results: Nitric oxide release is first detected after 7.7 MPa impacts, whereas cell death, glycosaminoglycan release, and prostaglandin E2 release are first detected at 17 MPa. Catabolic markers increase linearly to maximal levels after ≥36 MPa impacts. Conclusions: A single supraphysiologic impact negatively affects cartilage integrity, cell viability, and GAG release in a dose-dependent manner. Our findings showed that 7 to 17 MPa impacts can induce cell death and catabolism without compromising the articular surface, whereas a 17 MPa impact is sufficient to induce increases in most common catabolic markers of osteoarthritic degeneration. PMID:26069650
Bioprinting Cartilage Tissue from Mesenchymal Stem Cells and PEG Hydrogel.
Gao, Guifang; Hubbell, Karen; Schilling, Arndt F; Dai, Guohao; Cui, Xiaofeng
2017-01-01
Bioprinting based on thermal inkjet printing is one of the most attractive enabling technologies for tissue engineering and regeneration. During the printing process, cells, scaffolds , and growth factors are rapidly deposited to the desired two-dimensional (2D) and three-dimensional (3D) locations. Ideally, the bioprinted tissues are able to mimic the native anatomic structures in order to restore the biological functions. In this study, a bioprinting platform for 3D cartilage tissue engineering was developed using a commercially available thermal inkjet printer with simultaneous photopolymerization . The engineered cartilage demonstrated native zonal organization, ideal extracellular matrix (ECM ) composition, and proper mechanical properties. Compared to the conventional tissue fabrication approach, which requires extended UV exposure, the viability of the printed cells with simultaneous photopolymerization was significantly higher. Printed neocartilage demonstrated excellent glycosaminoglycan (GAG) and collagen type II production, which was consistent with gene expression profile. Therefore, this platform is ideal for anatomic tissue engineering with accurate cell distribution and arrangement.
Sex-Specific Protection of Osteoarthritis by Deleting Cartilage Acid Protein 1.
Directory of Open Access Journals (Sweden)
Xianpeng Ge
Full Text Available Cartilage acidic protein 1 (CRTAC1 was recently identified as an elevated protein in the synovial fluid of patients with osteoarthritis (OA by a proteomic analysis. This gene is also upregulated in both human and mouse OA by transcriptomic analysis. The objective of this study was to characterize the expression and function of CRTAC1 in OA. Here, we first confirm the increase of CRTAC1 in cartilage biopsies from OA patients undergoing joint replacement by real-time PCR and immunohistochemistry. Furthermore, we report that proinflammatory cytokines interleukin-1beta and tumor necrosis factor alpha upregulate CRTAC1 expression in primary human articular chondrocytes and synovial fibroblasts. Genetic deletion of Crtac1 in mice significantly inhibited cartilage degradation, osteophyte formation and gait abnormalities of post-traumatic OA in female, but not male, animals undergoing the destabilization of medial meniscus (DMM surgery. Taken together, CRTAC1 is upregulated in the osteoarthritic joint and directly induced in chondrocytes and synovial fibroblasts by pro-inflammatory cytokines. This molecule is necessary for the progression of OA in female mice after DMM surgery and thus represents a potential therapy for this prevalent disease, especially for women who demonstrate higher rates and more severe OA.
Magnetization transfer analysis of cartilage repair tissue: a preliminary study
International Nuclear Information System (INIS)
Palmieri, F.; Keyzer, F. de; Maes, F.; Breuseghem, I. van
2006-01-01
To evaluate the magnetization transfer ratio (MTR) after two different cartilage repair procedures, and to compare these data with the MTR of normal cartilage. Twenty-seven patients with a proven cartilage defect were recruited: 13 were treated with autologous chondrocyte implantation (ACI) and 14 were treated with the microfracture technique (MFR). All patients underwent MRI examinations with MT-sequences before the surgical treatment, after 12 months (26 patients) and after 24 months (11 patients). Eleven patients received a complete follow-up study at all three time points (five of the ACI group and six of the MFR group). All images were transferred to a workstation to calculate MTR images. For every MT image set, different ROIs were delineated by two radiologists. Means were calculated per ROI type in the different time frames and in both groups of cartilage repair. The data were analyzed with unpaired t- and ANOVA tests, and by calculating Pearson's correlation coefficient. No significant differences were found in the MTR of fatty bone marrow, muscle and normal cartilage in the different time frames. There was a significant but small difference between the MTR of normal cartilage and the cartilage repair area after 12 months for both procedures. After 24 months, the MTR of ACI repaired cartilage (0.31±0.07) was not significantly different from normal cartilage MTR (0.34±0.05). The MTR of MFR repaired cartilage (0.28±0.02), still showed a significant difference from normal cartilage. The differences between damaged and repaired cartilage MTR are too small to enable MT-imaging to be a useful tool for postoperative follow-up of cartilage repair procedures. There is, however, an evolution towards normal MTR-values in the cartilage repair tissue (especially after ACI repair). (orig.)
Microscopic and histochemical manifestations of hyaline cartilage dynamics.
Malinin, G I; Malinin, T I
1999-01-01
Structure and function of hyaline cartilages has been the focus of many correlative studies for over a hundred years. Much of what is known regarding dynamics and function of cartilage constituents has been derived or inferred from biochemical and electron microscopic investigations. Here we show that in conjunction with ultrastructural, and high-magnification transmission light and polarization microscopy, the well-developed histochemical methods are indispensable for the analysis of cartilage dynamics. Microscopically demonstrable aspects of cartilage dynamics include, but are not limited to, formation of the intracellular liquid crystals, phase transitions of the extracellular matrix and tubular connections between chondrocytes. The role of the interchondrocytic liquid crystals is considered in terms of the tensegrity hypothesis and non-apoptotic cell death. Phase transitions of the extracellular matrix are discussed in terms of self-alignment of chondrons, matrix guidance pathways and cartilage growth in the absence of mitosis. The possible role of nonenzymatic glycation reactions in cartilage dynamics is also reviewed.
Quantitative magnetic resonance imaging of articular cartilage in osteoarthritis
Directory of Open Access Journals (Sweden)
G Blumenkrantz
2007-05-01
Full Text Available Magnetic resonance imaging of articular cartilage has recently been recognized as a tool for the characterization of cartilage morphology, biochemistry and function. In this paper advancements in cartilage imaging, computation of cartilage volume and thickness, and measurement of relaxation times (T2 and T1Ρ are presented. In addition, the delayed uptake of Gadolinium DTPA as a marker of proteoglycan depletion is also reviewed. The cross-sectional and longitudinal studies using these imaging techniques show promise for cartilage assessment and for the study of osteoarthritis.
Mirza, Eraj Humayun; Pan-Pan, Chong; Wan Ibrahim, Wan Mohd Azhar Bin; Djordjevic, Ivan; Pingguan-Murphy, Belinda
2015-11-01
Articular cartilage is a tissue specifically adapted to a specific niche with a low oxygen tension (hypoxia), and the presence of such conditions is a key factor in regulating growth and survival of chondrocytes. Zinc deficiency has been linked to cartilage-related disease, and presence of Zinc is known to provide antibacterial benefits, which makes its inclusion attractive in an in vitro system to reduce infection. Inclusion of 1% zinc oxide nanoparticles (ZnONP) in poly octanediol citrate (POC) polymer cultured in hypoxia has not been well determined. In this study we investigated the effects of ZnONP on chondrocyte proliferation and matrix synthesis cultured under normoxia (21% O2 ) and hypoxia (5% O2 ). We report an upregulation of chondrocyte proliferation and sulfated glycosaminoglycan (S-GAG) in hypoxic culture. Results demonstrate a synergistic effect of oxygen concentration and 1% ZnONP in up-regulation of anabolic gene expression (Type II collagen and aggrecan), and a down regulation of catabolic (MMP-13) gene expression. Furthermore, production of transcription factor hypoxia-inducible factor 1A (HIF-1A) in response to hypoxic condition to regulate chondrocyte survival under hypoxia is not affected by the presence of 1% ZnONP. Presence of 1% ZnONP appears to act to preserve homeostasis of cartilage in its hypoxic environment. © 2015 Wiley Periodicals, Inc.
Co-culture systems-based strategies for articular cartilage tissue engineering.
Zhang, Yu; Guo, Weimin; Wang, Mingjie; Hao, Chunxiang; Lu, Liang; Gao, Shuang; Zhang, Xueliang; Li, Xu; Chen, Mingxue; Li, Penghao; Jiang, Peng; Lu, Shibi; Liu, Shuyun; Guo, Quanyi
2018-03-01
Cartilage engineering facilitates repair and regeneration of damaged cartilage using engineered tissue that restores the functional properties of the impaired joint. The seed cells used most frequently in tissue engineering, are chondrocytes and mesenchymal stem cells. Seed cells activity plays a key role in the regeneration of functional cartilage tissue. However, seed cells undergo undesirable changes after in vitro processing procedures, such as degeneration of cartilage cells and induced hypertrophy of mesenchymal stem cells, which hinder cartilage tissue engineering. Compared to monoculture, which does not mimic the in vivo cellular environment, co-culture technology provides a more realistic microenvironment in terms of various physical, chemical, and biological factors. Co-culture technology is used in cartilage tissue engineering to overcome obstacles related to the degeneration of seed cells, and shows promise for cartilage regeneration and repair. In this review, we focus first on existing co-culture systems for cartilage tissue engineering and related fields, and discuss the conditions and mechanisms thereof. This is followed by methods for optimizing seed cell co-culture conditions to generate functional neo-cartilage tissue, which will lead to a new era in cartilage tissue engineering. © 2017 Wiley Periodicals, Inc.
Proteinase-activated receptor 2 modulates OA-related pain, cartilage and bone pathology.
Huesa, Carmen; Ortiz, Ana C; Dunning, Lynette; McGavin, Laura; Bennett, Louise; McIntosh, Kathryn; Crilly, Anne; Kurowska-Stolarska, Mariola; Plevin, Robin; van 't Hof, Rob J; Rowan, Andrew D; McInnes, Iain B; Goodyear, Carl S; Lockhart, John C; Ferrell, William R
2016-11-01
Proteinase-activated receptor 2 (PAR2) deficiency protects against cartilage degradation in experimental osteoarthritis (OA). The wider impact of this pathway upon OA-associated pathologies such as osteophyte formation and pain is unknown. Herein, we investigated early temporal bone and cartilage changes in experimental OA in order to further elucidate the role of PAR2 in OA pathogenesis. OA was induced in wild-type (WT) and PAR2-deficient (PAR2 -/- ) mice by destabilisation of the medial meniscus (DMM). Inflammation, cartilage degradation and bone changes were monitored using histology and microCT. In gene rescue experiments, PAR2 -/- mice were intra-articularly injected with human PAR2 (hPAR2)-expressing adenovirus. Dynamic weight bearing was used as a surrogate of OA-related pain. Osteophytes formed within 7 days post-DMM in WT mice but osteosclerosis was only evident from 14 days post induction. Importantly, PAR2 was expressed in the proliferative/hypertrophic chondrocytes present within osteophytes. In PAR2 -/- mice, osteophytes developed significantly less frequently but, when present, were smaller and of greater density; no osteosclerosis was observed in these mice up to day 28. The pattern of weight bearing was altered in PAR2 -/- mice, suggesting reduced pain perception. The expression of hPAR2 in PAR2 -/- mice recapitulated osteophyte formation and cartilage damage similar to that observed in WT mice. However, osteosclerosis was absent, consistent with lack of hPAR2 expression in subchondral bone. This study clearly demonstrates PAR2 plays a critical role, via chondrocytes, in osteophyte development and subchondral bone changes, which occur prior to PAR2-mediated cartilage damage. The latter likely occurs independently of OA-related bone changes. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Proteinase-activated receptor 2 modulates OA-related pain, cartilage and bone pathology
Huesa, Carmen; Ortiz, Ana C; Dunning, Lynette; McGavin, Laura; Bennett, Louise; McIntosh, Kathryn; Crilly, Anne; Kurowska-Stolarska, Mariola; Plevin, Robin; van ‘t Hof, Rob J; Rowan, Andrew D; McInnes, Iain B; Goodyear, Carl S; Lockhart, John C; Ferrell, William R
2016-01-01
Objective Proteinase-activated receptor 2 (PAR2) deficiency protects against cartilage degradation in experimental osteoarthritis (OA). The wider impact of this pathway upon OA-associated pathologies such as osteophyte formation and pain is unknown. Herein, we investigated early temporal bone and cartilage changes in experimental OA in order to further elucidate the role of PAR2 in OA pathogenesis. Methods OA was induced in wild-type (WT) and PAR2-deficient (PAR2−/−) mice by destabilisation of the medial meniscus (DMM). Inflammation, cartilage degradation and bone changes were monitored using histology and microCT. In gene rescue experiments, PAR2−/− mice were intra-articularly injected with human PAR2 (hPAR2)-expressing adenovirus. Dynamic weight bearing was used as a surrogate of OA-related pain. Results Osteophytes formed within 7 days post-DMM in WT mice but osteosclerosis was only evident from 14 days post induction. Importantly, PAR2 was expressed in the proliferative/hypertrophic chondrocytes present within osteophytes. In PAR2−/− mice, osteophytes developed significantly less frequently but, when present, were smaller and of greater density; no osteosclerosis was observed in these mice up to day 28. The pattern of weight bearing was altered in PAR2−/− mice, suggesting reduced pain perception. The expression of hPAR2 in PAR2−/− mice recapitulated osteophyte formation and cartilage damage similar to that observed in WT mice. However, osteosclerosis was absent, consistent with lack of hPAR2 expression in subchondral bone. Conclusions This study clearly demonstrates PAR2 plays a critical role, via chondrocytes, in osteophyte development and subchondral bone changes, which occur prior to PAR2-mediated cartilage damage. The latter likely occurs independently of OA-related bone changes. PMID:26698846
Wei, Wenbo; Lambach, Becky; Jia, Guang; Flanigan, David; Chaudhari, Ajit M W; Wei, Lai; Rogers, Alan; Payne, Jason; Siston, Robert A; Knopp, Michael V
2017-06-01
The prevalence of cartilage lesions is much higher in football athletes than in the general population. Delayed gadolinium-enhanced MRI of cartilage (dGEMRIC) has been shown to quantify regional variations of glycosaminoglycan (GAG) concentrations which is an indicator of early cartilage degeneration. The goal of this study is to determine whether dGEMRIC can be used to assess the influence in cartilage GAG concentration due to college level football play. Thirteen collegiate football players with one to four years of collegiate football play experience were recruited and both knee joints were scanned using a dedicated 8-channel phased array knee coil on a 3T MRI system. The contrast concentrations within cartilage were calculated based on the T 1 values from dGEMRIC scans. No substantial differences were found in the contrast concentrations between the pre- and post-season across all the cartilage compartments. One year collegiate football players presented an average contrast concentration at the pre-season of 0.116±0.011mM and post-season of 0.116±0.011mM. In players with multiple years of football play, contrast uptake was elevated to 0.141±0.012mM at the pre-season and 0.139±0.012mM at the post-season. The pre-season 0.023±0.016mM and post-season 0.025±0.016mM increase in contrast concentration within the group with multiple years of experience presented with a >20% increase in contrast uptake. This may indicate the gradual, cumulative damage of football play to the articular cartilage over years, even though the effect may not be noticeable after a season of play. Playing collegiate football for a longer period of time may lead to cartilage microstructural alterations, which may be linked to early knee cartilage degeneration. Copyright © 2017 Elsevier Inc. All rights reserved.
High-resolution MR imaging of wrist cartilage
International Nuclear Information System (INIS)
Rominger, M.B.; Bernreuter, W.K.; Listinsky, J.J.; Lee, D.H.; Kenney, P.J.; Colgin, S.L.
1991-01-01
This paper reports that cartilage is an important prognostic factor in arthritis. MR imaging can demonstrate both articular cartilage and subchondral bone. Our purpose was to compare various sequences, for wrist cartilage imaging and determine how extensive damage must be before it is detectable with MR imaging. Six cadaver wrists were imaged before and after arthroscopic cartilage injury (coronal and axial T1- and T2-weighted SE sequences, 3-mm sections; SPGR 45 degrees flip angle volume images with fat saturation. 1.2-mm sections; plus T1-weighted coronal images with fat saturation after injury; General Electric Signa, 1.5 T, with transmit-receive extremity coil). Twenty-two defects were created arthroscopically. Five normal volunteers were imaged for comparison. The greatest contrast among bone, cartilage, and synovial fluid was achieved with T1-weighted fat-suppressed SE image and SPGR. Gradient-recalled volume sequences generated very thin sections but were susceptible to artifact
International Nuclear Information System (INIS)
Westhoff, J.; Eckstein, F.; Sittek, H.; Faber, S.; Reiser, M.; Loesch, A.; Englmeier, K.H.; Kolem, H.
1997-01-01
Objective: To determine the reproductibility of three-dimensional volume and thickness measurements of the knee joint cartilage with MRI in volunteers. Methods: The knees of 7 healthy individuals (ages 23 to 58 yrs.) were sagitally imaged with a resolution of 2x0.31x0.31 mm 3 , using a fat-suppressed FLASH-3 D sequence. The knee was repositioned in between replicate acquisitions, 6 data sets being obtained in each case. After semiautomatic segmentation and three-dimensional reconstruction of the cartilage, the thickness was determined independent of the original section orientation. The coefficient of variation for repeated volume measurements and the deviations of the maximal cartilage thickness values were calculated subsequently. Results: The mean variation of the cartilage volumes of the replicate measurements was 1.4% (±0.8%) in the patella, 1.7% (±1.5%) in the femur, 3.0% (±1.2%) in the medial tibial plateau and 3.5% (±2.0%) in the lateral tibial plateau. The comparison of the distribution patterns of cartilage thickness yielded a high degree of agreement. Only in rare cases deviations of more than 0.5 mm were observed. Conclusions: The results show that the presented method for determining the quantitative distribution of articular cartilage yields a high degree of precision. It offers new possibilities in screening risk groups, monitoring the course of degenerative joint disease and the investigation of functional adaptation of the cartilage to mechanical loading. (orig.) [de
Radhakrishnan, Janani; Subramanian, Anuradha; Sethuraman, Swaminathan
2017-11-01
Articular hyaline cartilage regeneration remains challenging due to its less intrinsic reparability. The study develops injectable biphasic semi-interpenetrating polymer networks (SIPN) hydrogel impregnated with chondroitin sulfate (ChS) nanoparticles for functional cartilage restoration. ChS loaded zein nanoparticles (∼150nm) prepared by polyelectrolyte-protein complexation were interspersed into injectable SIPNs developed by blending alginate with poly(vinyl alcohol) and calcium crosslinking. The hydrogel exhibited interconnected porous microstructure (39.9±5.8μm pore diameter, 57.7±5.9% porosity), 92% swellability and >350Pa elastic modulus. Primary chondrocytes compatibility, chondrocyte-matrix interaction with cell-cell clustering and spheroidal morphology was demonstrated in ChS loaded hydrogel and long-term (42days) proliferation was also determined. Higher fold expression of cartilage-specific genes sox9, aggrecan and collagen-II was observed in ChS loaded hydrogel while exhibiting poor expression of collagen-I. Immunoblotting of aggregan and collagen II demonstrate favorable positive influence of ChS on chondrocytes. Thus, the injectable biphasic SIPNs could be promising composition-mimetic substitute for cartilage restoration at irregular defects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wei, Fangyuan; Zhou, Jingming; Wei, Xiaochun; Zhang, Juntao; Fleming, Braden C.; Terek, Richard; Pei, Ming; Chen, Qian; Liu, Tao; Wei, Lei
2012-01-01
Objective The objectives of this study were to 1) determine the correlation between osteoarthritis (OA) and Ihh expression, and 2) establish the effects of Ihh on expression of markers of chondrocyte hypertrophy and MMP-13 in human OA cartilage. Design OA cartilage and synovial fluid samples were obtained during total knee arthroplasty. Normal cartilage samples were obtained from intra-articular tumor resections, and normal synovial fluid samples were obtained from healthy volunteers and the contralateral uninjured knee of patients undergoing anterior cruciate ligament reconstruction. OA was graded using the Mankin score. Expression of Ihh in synovial fluid was determined by western blot. Ihh, type X collagen and MMP-13 mRNA were determined by real time PCR. Protein expression of type X collagen and MMP-13 in cartilage samples were analyzed with immunohistochemistry. Chondrocyte size was measured using image analysis. Results Ihh expression was increased 2.6 fold in OA cartilage and 37% in OA synovial fluid when compared to normal control samples. Increased expression of Ihh was associated with the severity of OA and expression of markers of chondrocyte hypertrophy: type X collagen and MMP-13, and chondocyte size. Chondrocytes were more spherical with increasing severity of OA. There was a significant correlation between Mankin score and cell size (r2= 0.80) and Ihh intensity (r2 = 0.89). Exogenous Ihh induced a 6.8 fold increase of type X collagen and 2.8 fold increase of MMP-13 mRNA expression in cultured chondrocytes. Conversely, knockdown of Ihh by siRNA and Hh inhibitor Cyclopamine had the opposite effect. Conclusions Ihh expression correlates with OA progression and changes in chondrocyte morphology and gene expression consistent with chondrocyte hypertrophy and cartilage degradation seen in OA cartilage. Thus, Ihh may be a potential therapeutic target to prevent OA progression. PMID:22469853
Sermer, Corey; Kandel, Rita; Anderson, Jesse; Hurtig, Mark; Theodoropoulos, John
2018-02-01
Current therapies for cartilage repair can be limited by an inability of the repair tissue to integrate with host tissue. Thus, there is interest in developing approaches to enhance integration. We have previously shown that platelet-rich plasma (PRP) improves cartilage tissue formation. This raised the question as to whether PRP could promote cartilage integration. Chondrocytes were isolated from cartilage harvested from bovine joints, seeded on a porous bone substitute and grown in vitro to form an osteochondral-like implant. After 7 days, the biphasic construct was soaked in PRP for 30 min before implantation into the core of a donut-shaped biphasic explant of native cartilage and bone. Controls were not soaked in PRP. The implant-explant construct was cultured for 2-4 weeks. PRP-soaked bioengineered implants integrated with host tissue in 73% of samples, whereas controls only integrated in 19% of samples. The integration strength, as determined by a push-out test, was significantly increased in the PRP-soaked implant group (219 ± 35.4 kPa) compared with controls (72.0 ± 28.5 kPa). This correlated with an increase in glycosaminoglycan and collagen accumulation in the region of integration in the PRP-treated implant group, compared with untreated controls. Immunohistochemical studies revealed that the integration zone contained collagen type II and aggrecan. The cells at the zone of integration in the PRP-soaked group had a 3.5-fold increase in matrix metalloproteinase-13 gene expression compared with controls. These results suggest that PRP-soaked bioengineered cartilage implants may be a better approach for cartilage repair due to enhanced integration. Copyright © 2017 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Elena Vasil'evna Chetina
2011-01-01
Results. The activity of collagen type II cleavage was shown to be increased in the area of age-related OA-like cartilage lesions. This was accompanied by the high expression of collagenases of metalloproteinases (MMP 1, 14 (MT1-MMP, aggrecanases - desintegrin and MMP with thrombospondin type 1 motif (ADAMTS 5, the cytokines of interleukins (IL 1α/β and tumor necrosis factor-α (TNF-α, as well as the genes associated with chondrocyte hypertrophy of type X collagen (C0L10A1, MMP 13 and 9, Indian hedgehog (Ihh and cas-pase 3 in the immediate vicinity of a lesion area. At the same time, there was a high expression of growth factors associated with the proliferation phase of chondrocytes, namely: parathyroid hormone-related peptide (PTHrP, fibroblast growth factor-2 (FGF-2, transforming growth factor β1/2 (TGF-β1/2, as well as macromolecules of matrix of type II collagen (C0L2A1 and aggrecan in both the areas adjacent to the lesions and at a considerable distance from their center. However, these areas showed no higher collagen cleavage activity. Nether higher collagen cleavage, nor excess expression of the genes examined were observed in the absolutely intact cartilage areas. Conclusion. Our studies have indicated that the area of very early age-related OA-like focal cartilage lesions exhibits enhanced type II collagen cleavage that is attended by the expression of the genes associated with chondrocyte differentiation in the embryonic growth plate.
Directory of Open Access Journals (Sweden)
A Boyde
2011-05-01
Full Text Available Arthropathy of the distal articular surfaces of the third metacarpal (Mc3 and metatarsal (Mt3 bones in the Thoroughbred racehorse (Tb is a natural model of repetitive overload arthrosis. We describe a novel pathology that affects the articular calcified cartilage (ACC and subchondral bone (SCB and which is associated with hyaline articular cartilage degeneration. Parasagittal slices cut from the palmar quadrant of the distal condyles of the left Mc3/Mt3 of 39 trained Tbs euthanased for welfare reasons were imaged by point projection microradiography, and backscattered electron (BSE scanning electron microscopy (SEM, light microscopy, and confocal scanning light microscopy. Mechanical properties were studied by nanoindentation. Data on the horses' training and racing career were also collected. Highly mineralised projections were observed extending from cracks in the ACC mineralising front into the hyaline articular cartilage (HAC up to two-thirds the thickness of the HAC, and were associated with focal HAC surface fibrillation directly overlying their site. Nanoindentation identified this extruded matrix to be stiffer than any other mineralised phase in the specimen by a factor of two. The presence of projections was associated with a higher cartilage Mankin histology score (P < 0.02 and increased amounts of gross cartilage loss pathologically on the condyle (P < 0.02. Presence of projections was not significantly associated with: total number of racing seasons, age of horse, amount of earnings, number of days in training, total distance galloped in career, or presence of wear lines.
Kück, Ulrich
2005-10-01
Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.
Biochemical effects on long-term frozen human costal cartilage
Energy Technology Data Exchange (ETDEWEB)
Santin, Stefany P.; Martinho Junior, Antonio C.; Yoshito, Daniele; Soares, Fernando A.N.; Mathor, Monica B., E-mail: mathor@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2011-07-01
Currently, the progresses on treatment of musculoskeletal diseases with the evolving of artificial implants and the success of tissue transplantation between genetically different individuals have conducted to an increase in radiosterilization. Regarding to tissue transplantation, it is essential to have sterile tissue and many tissue banks use radiosterilization as an effective method to sterilize these tissues. However, high doses of ionizing radiation and the preservation method may induce structural modifications in the tissues, as degradation of structural scaffold, decreasing its mechanical properties. Particularly, cartilage have been preserved in high concentrations of glycerol or deep-frozen at -70 degree C for storage after radiosterilization. Therefore, it is important to study the modifications induced in cartilage by preservation methods and by radiosterilization to determine the appropriated parameters for high quality of human allografts. Costal cartilages were obtained from cadaveric donors and were frozen at -20 degree C for 2 years long in order to compare with previous studies for fresh, deep-frozen and glycerolised cartilages. The mechanical tests were carried out in a universal testing machine until sample failure. According our results, there is no significant statistical difference between stress at break of fresh, long-term - 20 degree C frozen cartilages and deep-frozen cartilage. This early result suggests, regarding to tensile property, that long-term - 20 degree C frozen cartilages corresponds to glycerolised costal cartilages irradiated with 25 kGy or deep-frozen cartilages irradiated with 25 and 50 kGy. Thus, this long-term frozen cartilages may be used for tissue banks, but more studies about effects of ionizing radiation are necessary. (author)
Biochemical effects on long-term frozen human costal cartilage
International Nuclear Information System (INIS)
Santin, Stefany P.; Martinho Junior, Antonio C.; Yoshito, Daniele; Soares, Fernando A.N.; Mathor, Monica B.
2011-01-01
Currently, the progresses on treatment of musculoskeletal diseases with the evolving of artificial implants and the success of tissue transplantation between genetically different individuals have conducted to an increase in radiosterilization. Regarding to tissue transplantation, it is essential to have sterile tissue and many tissue banks use radiosterilization as an effective method to sterilize these tissues. However, high doses of ionizing radiation and the preservation method may induce structural modifications in the tissues, as degradation of structural scaffold, decreasing its mechanical properties. Particularly, cartilage have been preserved in high concentrations of glycerol or deep-frozen at -70 degree C for storage after radiosterilization. Therefore, it is important to study the modifications induced in cartilage by preservation methods and by radiosterilization to determine the appropriated parameters for high quality of human allografts. Costal cartilages were obtained from cadaveric donors and were frozen at -20 degree C for 2 years long in order to compare with previous studies for fresh, deep-frozen and glycerolised cartilages. The mechanical tests were carried out in a universal testing machine until sample failure. According our results, there is no significant statistical difference between stress at break of fresh, long-term - 20 degree C frozen cartilages and deep-frozen cartilage. This early result suggests, regarding to tensile property, that long-term - 20 degree C frozen cartilages corresponds to glycerolised costal cartilages irradiated with 25 kGy or deep-frozen cartilages irradiated with 25 and 50 kGy. Thus, this long-term frozen cartilages may be used for tissue banks, but more studies about effects of ionizing radiation are necessary. (author)
Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich
2005-04-01
The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.
Zhang, Chi; Cai, You-Zhi; Lin, Xiang-Jin
2016-07-01
To provide a comprehensive overview of the basic science rationale, surgical technique, and clinical outcomes of 1-step cartilage repair technique used as a treatment strategy for cartilage defects. A systematic review was performed in the main medical databases to evaluate the several studies concerning 1-step procedures for cartilage repair. The characteristics of cell-seed scaffolds, behavior of cells seeded into scaffolds, and surgical techniques were also discussed. Clinical outcomes and quality of repaired tissue were assessed using several standardized outcome assessment tools, magnetic resonance imaging scans, and biopsy histology. One-step cartilage repair could be divided into 2 types: chondrocyte-matrix complex (CMC) and autologous matrix-induced chondrogenesis (AMIC), both of which allow a simplified surgical approach. Studies with Level IV evidence have shown that 1-step cartilage repair techniques could significantly relieve symptoms and improve functional assessment (P studies clearly showed hyaline-like cartilage tissue in biopsy tissues by second-look arthroscopy. The 1-step cartilage repair technique, with its potential for effective, homogeneous distribution of chondrocytes and multipotent stem cells on the surface of the cartilage defect, is able to regenerate hyaline-like cartilage tissue, and it could be applied to cartilage repair by arthroscopy. Level IV, systematic review of Level II and IV studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
Developmental Pathways Are Blueprints for Designing Successful Crops
Directory of Open Access Journals (Sweden)
Ben Trevaskis
2018-06-01
Full Text Available Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.
Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P
2012-03-01
The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.
Critical temperature transitions in laser-mediated cartilage reshaping
Wong, Brian J.; Milner, Thomas E.; Kim, Hong H.; Telenkov, Sergey A.; Chew, Clifford; Kuo, Timothy C.; Smithies, Derek J.; Sobol, Emil N.; Nelson, J. Stuart
1998-07-01
In this study, we attempted to determine the critical temperature [Tc] at which accelerated stress relaxation occurred during laser mediated cartilage reshaping. During laser irradiation, mechanically deformed cartilage tissue undergoes a temperature dependent phase transformation which results in accelerated stress relaxation. When a critical temperature is attained, cartilage becomes malleable and may be molded into complex new shapes that harden as the tissue cools. Clinically, reshaped cartilage tissue can be used to recreate the underlying cartilaginous framework of structures such as the ear, larynx, trachea, and nose. The principal advantages of using laser radiation for the generation of thermal energy in tissue are precise control of both the space-time temperature distribution and time- dependent thermal denaturation kinetics. Optimization of the reshaping process requires identification of the temperature dependence of this phase transformation and its relationship to observed changes in cartilage optical, mechanical, and thermodynamic properties. Light scattering, infrared radiometry, and modulated differential scanning calorimetry (MDSC) were used to measure temperature dependent changes in the biophysical properties of cartilage tissue during fast (laser mediated) and slow (conventional calorimetric) heating. Our studies using MDSC and laser probe techniques have identified changes in cartilage thermodynamic and optical properties suggestive of a phase transformation occurring near 60 degrees Celsius.
Räsänen, Lasse P; Tanska, Petri; Zbýň, Štefan; van Donkelaar, Corrinus C; Trattnig, Siegfried; Nieminen, Miika T; Korhonen, Rami K
2017-08-16
The effect of swelling of articular cartilage, caused by the fixed charge density (FCD) of proteoglycans, has not been demonstrated on knee joint mechanics during simulated walking before. In this study, the influence of the depth-wise variation of FCD was investigated on the internal collagen fibril strains and the mechanical response of the knee joint cartilage during gait using finite element (FE) analysis. The FCD distribution of tibial cartilage was implemented from sodium ( 23 Na) MRI into a 3-D FE-model of the knee joint ("Healthy model"). For comparison, models with decreased FCD values were created according to the decrease in FCD associated with the progression of osteoarthritis (OA) ("Early OA" and "Advanced OA" models). In addition, a model without FCD was created ("No FCD" model). The effect of FCD was studied with five different collagen fibril network moduli of cartilage. Using the reference fibril network moduli, the decrease in FCD from "Healthy model" to "Early OA" and "Advanced OA" models resulted in increased axial strains (by +2 and +6%) and decreased fibril strains (by -3 and -13%) throughout the stance, respectively, calculated as mean values through cartilage depth in the tibiofemoral contact regions. Correspondingly, compared to the "Healthy model", the removal of the FCD altogether in "NoFCD model" resulted in increased mean axial strains by +16% and decreased mean fibril strains by -24%. This effect was amplified as the fibril network moduli were decreased by 80% from the reference. Then mean axial strains increased by +6, +19 and +49% and mean fibril strains decreased by -9, -20 and -32%, respectively. Our results suggest that the FCD in articular cartilage has influence on cartilage responses in the knee during walking. Furthermore, the FCD is suggested to have larger impact on cartilage function as the collagen network degenerates e.g. in OA. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).
Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T
2002-09-01
Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.
Lau, Ting Ting; Zhang, Feng; Tang, Wei; Wang, Dong-An
2016-12-01
Osteoarthritis (OA) is a prevalent condition that compromises and even jeopardizes the life quality of millions of people. Common symptoms in OA includes joint stiffness and soreness, and they are often associated with inflammations to various extend. Due to the avascular and aneural nature of articular hyaline cartilage, it has limited self-repair capabilities; especially under inflammatory conditions, damages inflicted on cartilage are often irreversible. Hence, treatment approaches focus on anti-inflammation or articular cartilage replacement. In this study, an engineered, dual-functional living hyaline cartilage graft (LhCG), capable of releasing transgenic anti-inflammatory cytokine-progranulin (PGRN) is developed and envisioned to simultaneously fulfil both requirements. The therapeutic functionality of PGRN releasing LhCG is evaluated by co-culturing the constructs with tumor necrosis factor-alpha (TNFα) secreting THP-1 cells to simulate the inflammatory condition in arthritis. Non-transgenic LhCG constructs and non-coculture sample groups were set up as controls. Gene expression and ECM composition changes across samples were assessed to understand the effects of PGRN as well as inflammatory environment on the cartilage graft. Collectively, the results in this study suggest that in situ release of transgenic recombinant PGRN protects LhCG from induced inflammation in vitro; contrastively, in the absence of PGRN, cartilage grafts are at risk of being degraded and mineralized under exposure to TNFα signaling. This shows that cartilage graft itself can be at risk of degradation or calcification when implanted in arthritic microenvironment. Hence, the inflammatory microenvironment has to be considered in cartilage replacement therapy to increase chances of successful joint mobility restoration. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2968-2977, 2016. © 2016 Wiley Periodicals, Inc.
Particulated articular cartilage: CAIS and DeNovo NT.
Farr, Jack; Cole, Brian J; Sherman, Seth; Karas, Vasili
2012-03-01
Cartilage Autograft Implantation System (CAIS; DePuy/Mitek, Raynham, MA) and DeNovo Natural Tissue (NT; ISTO, St. Louis, MO) are novel treatment options for focal articular cartilage defects in the knee. These methods involve the implantation of particulated articular cartilage from either autograft or juvenile allograft donor, respectively. In the laboratory and in animal models, both CAIS and DeNovo NT have demonstrated the ability of the transplanted cartilage cells to "escape" from the extracellular matrix, migrate, multiply, and form a new hyaline-like cartilage tissue matrix that integrates with the surrounding host tissue. In clinical practice, the technique for both CAIS and DeNovo NT is straightforward, requiring only a single surgery to affect cartilage repair. Clinical experience is limited, with short-term studies demonstrating both procedures to be safe, feasible, and effective, with improvements in subjective patient scores, and with magnetic resonance imaging evidence of good defect fill. While these treatment options appear promising, prospective randomized controlled studies are necessary to refine the indications and contraindications for both CAIS and DeNovo NT.
Directory of Open Access Journals (Sweden)
Haqqi Tariq M
2011-08-01
Full Text Available Abstract Background Conventional treatments for the articular diseases are often effective for symptom relief, but can also cause significant side effects and do not slow the progression of the disease. Several natural substances have been shown to be effective at relieving the symptoms of osteoarthritis (OA, and preliminary evidence suggests that some of these compounds may exert a favorable influence on the course of the disease. The objective of this study was to investigate the anti-inflammatory/chondroprotective potential of a Herbal and amino acid mixture containing extract of the Uncaria tomentosa, Boswellia spp., Lepidium meyenii and L-Leucine on the IL-1β-induced production of nitric oxide (NO, glycosaminoglycan (GAG, matrix metalloproteinases (MMPs, aggrecan (ACAN and type II collagen (COL2A1 in human OA chondrocytes and OA cartilage explants. Methods Primary OA chondrocytes or OA cartilage explants were pretreated with Herbal-Leucine mixture (HLM, 1-10 μg/ml and then stimulated with IL-1β (5 ng/ml. Effect of HLM on IL-1β-induced gene expression of iNOS, MMP-9, MMP-13, ACAN and COL2A1 was verified by real time-PCR. Estimation of NO and GAG release in culture supernatant was done using commercially available kits. Results HLM tested in these in vitro studies was found to be an effective anti-inflammatory agent, as evidenced by strong inhibition of iNOS, MMP-9 and MMP-13 expression and NO production in IL-1β-stimulated OA chondrocytes (p Leucine mixture (HLM up-regulation of ACAN and COL2A1 expression in IL-1β-stimulated OA chondrocytes was also noted (p Conclusion Our data suggests that HLM could be chondroprotective and anti-inflammatory agent in arthritis, switching chondrocyte gene expression from catabolic direction towards anabolic and regenerative, and consequently this approach may be potentially useful as a new adjunct therapeutic/preventive agent for OA or injury recovery.
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
Cationic Contrast Agent Diffusion Differs Between Cartilage and Meniscus.
Honkanen, Juuso T J; Turunen, Mikael J; Freedman, Jonathan D; Saarakkala, Simo; Grinstaff, Mark W; Ylärinne, Janne H; Jurvelin, Jukka S; Töyräs, Juha
2016-10-01
Contrast enhanced computed tomography (CECT) is a non-destructive imaging technique used for the assessment of composition and structure of articular cartilage and meniscus. Due to structural and compositional differences between these tissues, diffusion and distribution of contrast agents may differ in cartilage and meniscus. The aim of this study is to determine the diffusion kinematics of a novel iodine based cationic contrast agent (CA(2+)) in cartilage and meniscus. Cylindrical cartilage and meniscus samples (d = 6 mm, h ≈ 2 mm) were harvested from healthy bovine knee joints (n = 10), immersed in isotonic cationic contrast agent (20 mgI/mL), and imaged using a micro-CT scanner at 26 time points up to 48 h. Subsequently, normalized X-ray attenuation and contrast agent diffusion flux, as well as water, collagen and proteoglycan (PG) contents in the tissues were determined. The contrast agent distributions within cartilage and meniscus were different. In addition, the normalized attenuation and diffusion flux were higher (p < 0.05) in cartilage. Based on these results, diffusion kinematics vary between cartilage and meniscus. These tissue specific variations can affect the interpretation of CECT images and should be considered when cartilage and meniscus are assessed simultaneously.
Animal models used for testing hydrogels in cartilage regeneration.
Zhu, Chuntie; Wu, Qiong; Zhang, Xu; Chen, Fubo; Liu, Xiyang; Yang, Qixiang; Zhu, Lei
2018-05-14
Focal cartilage or osteochondral lesions can be painful and detrimental. Besides pain and limited function of joints, cartilage defect is considered as one of the leading extrinsic risk factors for osteoarthritis (OA). Thus, clinicians and scientists have paid great attention to regenerative therapeutic methods for the early treatment of cartilaginous defects. Regenerative medicine, showing great hope for regenerating cartilage tissue, rely on the combination of biodegradable scaffolds and specific biological cues, such as growth factors, adhesive factors and genetic materials. Among all biomaterials, hydrogels have emerged as promising cartilage tissue engineering scaffolds for simultaneous cell growth and drug delivery. A wide range of animal models have been applied in testing repair with hydrogels in cartilage defects. This review summarized the current animal models used to test hydrogels technologies for the regeneration of cartilage. Advantages and disadvantages in the establishment of the cartilage defect animal models among different species were emphasized, as well as feasibility of replication of diseases in animals. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
MR imaging of patellar cartilage degeneration at 0.02 T
International Nuclear Information System (INIS)
Koskinen, S.K.; Komu, M.; Aho, H.J.; Kormano, M.; Turku University Hospital
1991-01-01
MR imaging with a 0.02 T resistive magnet was used to establish the correlation between the histologic grading of patellar cartilage degeneration and fat water separation images or T1- and T2-relaxation times. We examined 23 cadaveric patellae. There was a positive correlation between histologically graded cartilage degeneration and T1-relaxation time. Patellar cartilage was well differentiated from surrounding structures on chemical shift water proton images, and an evaluation of cartilage degeneration was possible. No correlation was found between cartilage degeneration damage and T2-relaxation time. Chemical shift imaging at 0.02 T is easy to perform and gives further information of cartilage disorders. (orig.)
Fine-tuning Cartilage Tissue Engineering by Applying Principles from Embryonic Development
Hellingman, Catharine
2012-01-01
textabstractCartilage has a very poor capacity for regeneration in vivo. In head and neck surgery cartilage defects are usually reconstructed with autologous cartilage from for instance the external ear or the ribs. Cartilage tissue engineering may be a promising alternative to supply tissue for cartilage reconstructions in otorhinolaryngology as well as in plastic surgery and orthopaedics. The aim of this thesis is to find new tools by which cartilage tissue engineering can be better control...
Magnetic resonance imaging of hyaline cartilage regeneration in neocartilage graft implantation.
Tan, C F; Ng, K K; Ng, S H; Cheung, Y C
2003-12-01
The purpose of this study was to investigate the regenerative potential of hyaline cartilage in a neocartilage graft implant with the aid of MR cartilage imaging using a rabbit model. Surgical osteochondral defects were created in the femoral condyles of 30 mature New Zealand rabbits. The findings of neocartilage in autologous cartilage grafts packed into osteochondral defects were compared with control group of no implant to the osteochondral defect. The outcome of the implantations was correlated with histologic and MR cartilage imaging findings over a 3-month interval. Neocartilage grafts packed into osteochondral defects showed regeneration of hyaline cartilage at the outer layer of the implant using MR cartilage imaging. Fibrosis of fibrocartilage developed at the outer layer of the autologous cartilage graft together with an inflammatory reaction within the osteochondral defect. This animal study provides evidence of the regenerative ability of hyaline cartilage in neocartilage transplants to repair articular cartilage.
Properties of Cartilage on Micro- and Nanolevel
Directory of Open Access Journals (Sweden)
Sergei A. Chizhik
2010-01-01
Full Text Available Results of investigation of the elastic modulus for cartilage tissue using a technique of micro- and nanoindentation performed with help of an atomic force microscope are presented. SEM and AFM methods were applied to visualize a topography of surface layers of the entire cartilage and as well as its slices and thus to reveal features of the collagen fibers orientation. The technique used for a quantitative evaluation of the elastic modulus under compression against a ball microindenter (curvature radius - 350 micron and a nanoindenter (30 nm is described. It was shown that the cartilage behavior is highly stabile under the load if the entire composite structure of cartilage tissue is engaged into the deformation process. Tribological characteristics were investigated using the ball indenter oscillated by a tuning fork. Dependence of the friction coefficient from applied loads was obtained that revealed strong influence of an interstitial fluid on friction properties. Friction coefficient of a rat cartilage tissue as 0.08 was obtained using a developed plant prototype for tribological measurements based on the AFM construction.
Hyde, Luke W
2015-05-01
The emerging field of neurogenetics seeks to model the complex pathways from gene to brain to behavior. This field has focused on imaging genetics techniques that examine how variability in common genetic polymorphisms predict differences in brain structure and function. These studies are informed by other complimentary techniques (e.g., animal models and multimodal imaging) and have recently begun to incorporate the environment through examination of Imaging Gene × Environment interactions. Though neurogenetics has the potential to inform our understanding of the development of psychopathology, there has been little integration between principles of neurogenetics and developmental psychopathology. The paper describes a neurogenetics and Imaging Gene × Environment approach and how these approaches have been usefully applied to the study of psychopathology. Six tenets of developmental psychopathology (the structure of phenotypes, the importance of exploring mechanisms, the conditional nature of risk, the complexity of multilevel pathways, the role of development, and the importance of who is studied) are identified, and how these principles can further neurogenetics applications to understanding the development of psychopathology is discussed. A major issue of this piece is how neurogenetics and current imaging and molecular genetics approaches can be incorporated into developmental psychopathology perspectives with a goal of providing models for better understanding pathways from among genes, environments, the brain, and behavior.
A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis
Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor
2014-01-01
BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552
Directory of Open Access Journals (Sweden)
Anke Jeschke
Full Text Available Although articular cartilage degeneration represents a major public health problem, the underlying molecular mechanisms are still poorly characterized. We have previously utilized genome-wide expression analysis to identify specific markers of porcine articular cartilage, one of them being Thrombospondin-4 (Thbs4. In the present study we analyzed Thbs4 expression in mice, thereby confirming its predominant expression in articular cartilage, but also identifying expression in other tissues, including bone. To study the role of Thbs4 in skeletal development and integrity we took advantage of a Thbs4-deficient mouse model that was analyzed by undecalcified bone histology. We found that Thbs4-deficient mice do not display phenotypic differences towards wildtype littermates in terms of skeletal growth or bone mass acquisition. Since Thbs4 has previously been found over-expressed in bones of Phex-deficient Hyp mice, we additionally generated Thbs4-deficient Hyp mice, but failed to detect phenotypic differences towards Hyp littermates. With respect to articular cartilage we found that Thbs4-deficient mice display transient thinning of articular cartilage, suggesting a protective role of Thbs4 for joint integrity. Gene expression analysis using porcine primary cells revealed that Thbs4 is not expressed by synovial fibroblasts and that it represents the only member of the Thbs gene family with specific expression in articular, but not in growth plate chondrocytes. In an attempt to identify specific molecular effects of Thbs4 we treated porcine articular chondrocytes with human THBS4 in the absence or presence of conditioned medium from porcine synovial fibroblasts. Here we did not observe a significant influence of THBS4 on proliferation, metabolic activity, apoptosis or gene expression, suggesting that it does not act as a signaling molecule. Taken together, our data demonstrate that Thbs4 is highly expressed in articular chondrocytes, where its
Mumme, Marcus; Barbero, Andrea; Miot, Sylvie; Wixmerten, Anke; Feliciano, Sandra; Wolf, Francine; Asnaghi, Adelaide M; Baumhoer, Daniel; Bieri, Oliver; Kretzschmar, Martin; Pagenstert, Geert; Haug, Martin; Schaefer, Dirk J; Martin, Ivan; Jakob, Marcel
2016-10-22
Articular cartilage injuries have poor repair capacity, leading to progressive joint damage, and cannot be restored predictably by either conventional treatments or advanced therapies based on implantation of articular chondrocytes. Compared with articular chondrocytes, chondrocytes derived from the nasal septum have superior and more reproducible capacity to generate hyaline-like cartilage tissues, with the plasticity to adapt to a joint environment. We aimed to assess whether engineered autologous nasal chondrocyte-based cartilage grafts allow safe and functional restoration of knee cartilage defects. In a first-in-human trial, ten patients with symptomatic, post-traumatic, full-thickness cartilage lesions (2-6 cm 2 ) on the femoral condyle or trochlea were treated at University Hospital Basel in Switzerland. Chondrocytes isolated from a 6 mm nasal septum biopsy specimen were expanded and cultured onto collagen membranes to engineer cartilage grafts (30 × 40 × 2 mm). The engineered tissues were implanted into the femoral defects via mini-arthrotomy and assessed up to 24 months after surgery. Primary outcomes were feasibility and safety of the procedure. Secondary outcomes included self-assessed clinical scores and MRI-based estimation of morphological and compositional quality of the repair tissue. This study is registered with ClinicalTrials.gov, number NCT01605201. The study is ongoing, with an approved extension to 25 patients. For every patient, it was feasible to manufacture cartilaginous grafts with nasal chondrocytes embedded in an extracellular matrix rich in glycosaminoglycan and type II collagen. Engineered tissues were stable through handling with forceps and could be secured in the injured joints. No adverse reactions were recorded and self-assessed clinical scores for pain, knee function, and quality of life were improved significantly from before surgery to 24 months after surgery. Radiological assessments indicated variable degrees of
Ectopic mineralization of cartilage and collagen-rich tendons and ligaments in Enpp1asj-2J mice.
Zhang, Jieyu; Dyment, Nathaniel A; Rowe, David W; Siu, Sarah Y; Sundberg, John P; Uitto, Jouni; Li, Qiaoli
2016-03-15
Generalized arterial calcification of infancy (GACI), an autosomal recessive disorder caused by mutations in the ENPP1 gene, manifests with extensive mineralization of the cardiovascular system. A spontaneous asj-2J mutant mouse has been characterized as a model for GACI. Previous studies focused on phenotypic characterization of skin and vascular tissues. This study further examined the ectopic mineralization phenotype of cartilage, collagen-rich tendons and ligaments in this mouse model. The mice were placed on either control diet or the "acceleration diet" for up to 12 weeks of age. Soft connective tissues, such as ear (elastic cartilage) and trachea (hyaline cartilage), were processed for standard histology. Assessment of ectopic mineralization in articular cartilage and fibrocartilage as well as tendons and ligaments which are attached to long bones were performed using a novel cryo-histological method without decalcification. These analyses demonstrated ectopic mineralization in cartilages as well as tendons and ligaments in the homozygous asj-2J mice at 12 weeks of age, with the presence of immature osteophytes displaying alkaline phosphatase and tartrate-resistant acid phosphatase activities as early as at 6 weeks of age. Alkaline phosphatase activity was significantly increased in asj-2J mouse serum as compared to wild type mice, indicating increased bone formation rate in these mice. Together, these data highlight the key role of ENPP1 in regulating calcification of both soft and skeletal tissues.
Chondroptosis in Alkaptonuric Cartilage
Millucci, Lia; Giorgetti, Giovanna; Viti, Cecilia; Ghezzi, Lorenzo; Gambassi, Silvia; Braconi, Daniela; Marzocchi, Barbara; Paffetti, Alessandro; Lupetti, Pietro; Bernardini, Giulia; Orlandini, Maurizio
2015-01-01
Alkaptonuria (AKU) is a rare genetic disease that affects the entire joint. Current standard of treatment is palliative and little is known about AKU physiopathology. Chondroptosis, a peculiar type of cell death in cartilage, has been so far reported to occur in osteoarthritis, a rheumatic disease that shares some features with AKU. In the present work, we wanted to assess if chondroptosis might also occur in AKU. Electron microscopy was used to detect the morphological changes of chondrocytes in damaged cartilage distinguishing apoptosis from its variant termed chondroptosis. We adopted histological observation together with Scanning Electron Microscopy and Transmission Electron Microscopy to evaluate morphological cell changes in AKU chondrocytes. Lipid peroxidation in AKU cartilage was detected by fluorescence microscopy. Using the above‐mentioned techniques, we performed a morphological analysis and assessed that AKU chondrocytes undergo phenotypic changes and lipid oxidation, resulting in a progressive loss of articular cartilage structure and function, showing typical features of chondroptosis. To the best of our knowledge, AKU is the second chronic pathology, following osteoarthritis, where chondroptosis has been documented. Our results indicate that Golgi complex plays an important role in the apoptotic process of AKU chondrocytes and suggest a contribution of chondroptosis in AKU pathogenesis. These findings also confirm a similarity between osteoarthritis and AKU. J. Cell. Physiol. 230: 1148–1157, 2015. © 2014 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc. PMID:25336110
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Jeong, Da-Un; Choi, Je-Yong; Kim, Dae-Won
2017-01-01
Nkx3.2, the vertebrate homologue of Drosophila bagpipe, has been implicated as playing a role in chondrogenic differentiation. In brief, Nkx3.2 is initially expressed in chondrocyte precursor cells and later during cartilage maturation, its expression is diminished in hypertrophic chondrocytes. In addition to Nkx3.2 expression analyses, previous studies using ex vivo chick embryo cultures and in vitro cell cultures have suggested that Nkx3.2 can suppress chondrocyte hypertrophy. However, it has never been demonstrated that Nkx3.2 functions in regulating chondrocyte hypertrophy during cartilage development in vivo. Here, we show that cartilage-specific and Cre-dependent Nkx3.2 overexpression in mice results in significant postnatal dwarfism in endochondral skeletons, while intramembranous bones remain unaltered. Further, we observed significant delays in cartilage hypertrophy in conditional transgenic ciTg-Nkx3.2 mice. Together, these findings confirm that Nkx3.2 is capable of controlling hypertrophic maturation of cartilage in vivo, and this regulation plays a significant role in endochondral ossification and longitudinal bone growth. J. Cell. Physiol. 232: 78-90, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Human articular cartilage: in vitro correlation of MRI and histologic findings
Energy Technology Data Exchange (ETDEWEB)
Uhl, M.; Allmann, K.H.; Laubenberger, J.; Langer, M. [Department of Diagnostic Radiology, University Hospital of Freiburg (Germany); Ihling, C.; Tauer, U.; Adler, C.P. [Department of Pathology, University Hospital of Freiburg (Germany)
1998-09-01
The aim of our study was to correlate MRI with histologic findings in normal and degenerative cartilage. Twenty-two human knees derived from patients undergoing amputation were examined with 1.0- and 1.5-T MR imaging units. Firstly, we optimized two fat-suppressed 3D gradient-echo sequences. In this pilot study two knees were examined with fast imaging with steady precession (FISP) sequences and fast low-angle shot (FLASH, SPGR) sequence by varying the flip angles (40, 60, 90 ) and combining each flip angle with different echo time (7, 10 or 11, 20 ms). We chose the sequences with the best visual contrast between the cartilage layers and the best measured contrast-to-noise ratio between cartilage and bone marrow. Therefore, we used a 3D FLASH fat-saturated sequence (TR/TE/flip angle = 50/11 ms/40 ) and a 3D FISP fat-saturated sequence (TR/TE/flip angle = 40/10 ms/40 ) for cartilage imaging in 22 human knees. The images were obtained at various angles of the patellar cartilage in relation to the main magnetic field (0, 55, 90 ). The MR appearances were classified into five categories: normal, intracartilaginous signal changes, diffuse thinning (cartilage thickness < 3 mm), superficial erosions, and cartilage ulcers. After imaging, the knees were examined macroscopically and photographed. In addition, we performed histologic studies using light microscopy with several different stainings, polarization, and dark field microscopy as well as electron microscopy. The structural characteristics with the cartilage lesions were correlated with the MR findings. We identified a hyperintense superficial zone in the MR image which did not correlate to the histologically identifiable superficial zone. The second lamina was hypointense on MRI and correlated to the bulk of the radial zone. The third (or deep) cartilage lamina in the MR image seemed to represent the combination of the lowest portion of the radial zone and the calcified cartilage. The width of the hypointense second
Human articular cartilage: in vitro correlation of MRI and histologic findings
International Nuclear Information System (INIS)
Uhl, M.; Allmann, K.H.; Laubenberger, J.; Langer, M.; Ihling, C.; Tauer, U.; Adler, C.P.
1998-01-01
The aim of our study was to correlate MRI with histologic findings in normal and degenerative cartilage. Twenty-two human knees derived from patients undergoing amputation were examined with 1.0- and 1.5-T MR imaging units. Firstly, we optimized two fat-suppressed 3D gradient-echo sequences. In this pilot study two knees were examined with fast imaging with steady precession (FISP) sequences and fast low-angle shot (FLASH, SPGR) sequence by varying the flip angles (40, 60, 90 ) and combining each flip angle with different echo time (7, 10 or 11, 20 ms). We chose the sequences with the best visual contrast between the cartilage layers and the best measured contrast-to-noise ratio between cartilage and bone marrow. Therefore, we used a 3D FLASH fat-saturated sequence (TR/TE/flip angle = 50/11 ms/40 ) and a 3D FISP fat-saturated sequence (TR/TE/flip angle = 40/10 ms/40 ) for cartilage imaging in 22 human knees. The images were obtained at various angles of the patellar cartilage in relation to the main magnetic field (0, 55, 90 ). The MR appearances were classified into five categories: normal, intracartilaginous signal changes, diffuse thinning (cartilage thickness < 3 mm), superficial erosions, and cartilage ulcers. After imaging, the knees were examined macroscopically and photographed. In addition, we performed histologic studies using light microscopy with several different stainings, polarization, and dark field microscopy as well as electron microscopy. The structural characteristics with the cartilage lesions were correlated with the MR findings. We identified a hyperintense superficial zone in the MR image which did not correlate to the histologically identifiable superficial zone. The second lamina was hypointense on MRI and correlated to the bulk of the radial zone. The third (or deep) cartilage lamina in the MR image seemed to represent the combination of the lowest portion of the radial zone and the calcified cartilage. The width of the hypointense second
In-vivo study and histological examination of laser reshaping of cartilage
Sviridov, Alexander P.; Sobol, Emil N.; Bagratashvili, Victor N.; Omelchenko, Alexander I.; Ovchinnikov, Yuriy M.; Shekhter, Anatoliy B.; Svistushkin, Valeriy M.; Shinaev, Andrei A.; Nikiforova, G.; Jones, Nicholas
1999-06-01
The results of recent study of cartilage reshaping in vivo are reported. The ear cartilage of piglets of 8-12 weeks old have been reshaped in vivo using the radiation of a holmium laser. The stability of the shape and possible side effects have been examined during four months. Histological investigation shown that the healing of irradiated are could accompany by the regeneration of ear cartilage. Finally, elastic type cartilage has been transformed into fibrous cartilage or cartilage of hyaline type.
Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott
2016-08-01
Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.
Principles of cartilage repair
Erggelet, Christoph; Mandelbaum, Bert R
2008-01-01
Cartilage defects affect patients of all age groups. Surgeons, teamdoctors, general practitioners and physiotherapists alike are expected to provide adequate care. Only individual treatment plans combining a well balanced choice of various options will be successful. Background knowledge, operative and non-operative therapies are described in concise chapters: Articular cartilage biology - Diagnostics - Surgical techniques - Symptomatic and alternative medications - Physiotherapy. Diagnostic findings and surgical procedures are generously illustrated by aquarelles and colour photographs. Recommendations for additional reading, description of important clinical scoring systems and a listing of analytic tools are added for further information.
Tissue-engineered cartilage: the crossroads of biomaterials, cells and stimulating factors.
Bhardwaj, Nandana; Devi, Dipali; Mandal, Biman B
2015-02-01
Damage to cartilage represents one of the most challenging tasks of musculoskeletal therapeutics due to its limited propensity for healing and regenerative capabilities. Lack of current treatments to restore cartilage tissue function has prompted research in this rapidly emerging field of tissue regeneration of functional cartilage tissue substitutes. The development of cartilaginous tissue largely depends on the combination of appropriate biomaterials, cell source, and stimulating factors. Over the years, various biomaterials have been utilized for cartilage repair, but outcomes are far from achieving native cartilage architecture and function. This highlights the need for exploration of suitable biomaterials and stimulating factors for cartilage regeneration. With these perspectives, we aim to present an overview of cartilage tissue engineering with recent progress, development, and major steps taken toward the generation of functional cartilage tissue. In this review, we have discussed the advances and problems in tissue engineering of cartilage with strong emphasis on the utilization of natural polymeric biomaterials, various cell sources, and stimulating factors such as biophysical stimuli, mechanical stimuli, dynamic culture, and growth factors used so far in cartilage regeneration. Finally, we have focused on clinical trials, recent innovations, and future prospects related to cartilage engineering. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Boesen, M.; Jensen, K. E.; Qvistgaard, E.; Danneskiold-Samsoe, B.; Thomsen, C.; Oestergaard, M.; Bliddal, H.
2006-01-01
Purpose: To investigate and compare delayed gadolinium (Gd-DTPA)-enhanced magnetic resonance imaging (MRI) of cartilage (dGEMRIC) in the hip joint using intravenous (i.v.) or ultrasound-guided intra-articular (i.a.) Gd-DTPA injection. Material and Methods: In 10 patients (50% males, mean age 58 years) with clinical and radiographic hip osteoarthritis (OA; Kellgren score II-III), MRI of the hip was performed twice on a clinical 1.5T MR scanner: On day 1, before and 90-180 min after 0.3 mmol/kg body weight i.v. Gd-DTPA and, on day 8, 90-180 min after ultrasound-guided i.a. injection of a 4 mmol/l Gd-DTPA solution. Coronal STIR, coronal T1 fat-saturated spin-echo, and a cartilage-sensitive gradient-echo sequence (3D T1 SPGR) in the sagittal plane were applied. Results: Both the post-i.v. and post-i.a. Gd-DTPA images showed significantly higher signal-to-noise (SNR) and contrast-to-noise (CNR) in the joint cartilage compared to the non-enhanced images ( P <0.002). I.a. Gd-DTPA provided significantly higher SNR and CNR compared to i.v. Gd-DTPA ( P <0.01). Furthermore, a better delineation of the cartilage in the synovial/cartilage zone and of the chondral/subchondral border was observed. Conclusion: The dGEMRIC MRI method markedly improved delineation of hip joint cartilage compared to non-enhanced MRI. The i.a. Gd-DTPA provided the best cartilage delineation. dGEMRIC is a clinically applicable MRI method that may improve identification of early subtle cartilage damage and the accuracy of volume measurements of hip joint cartilage
Huang, Yi-Zhou; Xie, Hui-Qi; Silini, Antonietta; Parolini, Ornella; Zhang, Yi; Deng, Li; Huang, Yong-Can
2017-10-01
Large articular cartilage defects remain an immense challenge in the field of regenerative medicine because of their poor intrinsic repair capacity. Currently, the available medical interventions can relieve clinical symptoms to some extent, but fail to repair the cartilaginous injuries with authentic hyaline cartilage. There has been a surge of interest in developing cell-based therapies, focused particularly on the use of mesenchymal stem/progenitor cells with or without scaffolds. Mesenchymal stem/progenitor cells are promising graft cells for tissue regeneration, but the most suitable source of cells for cartilage repair remains controversial. The tissue origin of mesenchymal stem/progenitor cells notably influences the biological properties and therapeutic potential. It is well known that mesenchymal stem/progenitor cells derived from synovial joint tissues exhibit superior chondrogenic ability compared with those derived from non-joint tissues; thus, these cell populations are considered ideal sources for cartilage regeneration. In addition to the progress in research and promising preclinical results, many important research questions must be answered before widespread success in cartilage regeneration is achieved. This review outlines the biology of stem/progenitor cells derived from the articular cartilage, the synovial membrane, and the synovial fluid, including their tissue distribution, function and biological characteristics. Furthermore, preclinical and clinical trials focusing on their applications for cartilage regeneration are summarized, and future research perspectives are discussed.
Tissue engineering applications: cartilage lesions repair by the use of autologous chondrocytes
Directory of Open Access Journals (Sweden)
L. De Franceschi
2011-09-01
Full Text Available Promising new therapies based on tissue engineering have been recently developed for cartilage repair. The association of biomaterials with autologous chondrocytes expanded in vitro can represent a useful tool to regenerate this tissue. The scaffolds utilised in such therapeutical applications should provide a pre-formed three-dimensional shape, prevent cells from floating out of the defect, have sufficient mechanical strength, facilitate uniform spread of cells and stimulate the phenotype of transplanted cells. Hyaff®-11 is a hyaluronic-acid based biodegradable polymer, that has been shown to provide successful cell carrier for tissue-engineered repair. From our findings we can state that human chondrocytes seeded on Hyaff®-11 are able to maintain in vitro the characteristic of differentiated cells, expressing and producing collagen type II and aggrecan which are the main markers of cartilage phenotype, down-regulating collagen type I. Moreover, it seems to be a useful scaffold for cartilage repair both in animal models and clinical trials in humans, favouring the formation of a hyaline-like tissue. In the light of these data, we can hypothesise, for the future, the use of autologous chondrocyte transplantation together with gene therapy as a treatment for rheumatic diseases such as osteoarthritis.
Energy Technology Data Exchange (ETDEWEB)
Wiener, E. (Dept. of Radiology, Charite Universitaetsmedizin Berlin (Germany)); Hodler, J.; Pfirrmann, C.W.A. (Dept. of Radiology, Orthopedic Univ. Hospital Balgrist, Zuerich (Switzerland))
2009-01-15
Background: Delayed gadolinium-enhanced magnetic resonance imaging of cartilage (dGEMRIC) is a novel method to investigate cartilaginous and fibrocartilaginous structures. Purpose: To investigate the contrast dynamics in hyaline and fibrous cartilage of the glenohumeral joint after intraarticular injection of gadopentetate dimeglumine. Material and Methods: Transverse T1 maps were acquired on a 1.5T scanner before and after intraarticular injection of 2.0 mmol/l gadopentetate dimeglumine in five cadaveric shoulders using a dual flip angle three-dimensional gradient echo (3D-GRE) sequence. The acquisition time for the T1 maps was 5 min 5 s for the whole shoulder. Measurements were repeated every 15 min over 2.5 hours. Regions of interest (ROIs) covering the glenoid cartilage and the labrum were drawn to assess the temporal evolution of the relaxation parameters. Results: T1 of unenhanced hyaline cartilage of the glenoid was 568+-34 ms. T1 of unenhanced fibrous cartilage of the labrum was 552+-38 ms. Significant differences (P=0.002 and 0.03) in the relaxation parameters were already measurable after 15 min. After 2 to 2.5 hours, hyaline and fibrous cartilage still demonstrated decreasing relaxation parameters, with a larger range of the T1(Gd) values in fibrous cartilage. T1 and ?R1 values of hyaline and fibrous cartilage after 2.5 hours were 351+-16 ms and 1.1+-0.09/s, and 332+-31 ms and 1.2+-0.1/s, respectively. Conclusion: A significant decrease in T1(Gd) was found 15 min after intraarticular contrast injection. Contrast accumulation was faster in hyaline than in fibrous cartilage. After 2.5 hours, contrast accumulation showed a higher rate of decrease in hyaline cartilage, but neither hyaline nor fibrous cartilage had reached equilibrium
Wiener, E; Hodler, J; Pfirrmann, C W A
2009-01-01
Delayed gadolinium-enhanced magnetic resonance imaging of cartilage (dGEMRIC) is a novel method to investigate cartilaginous and fibrocartilaginous structures. To investigate the contrast dynamics in hyaline and fibrous cartilage of the glenohumeral joint after intraarticular injection of gadopentetate dimeglumine. Transverse T(1) maps were acquired on a 1.5T scanner before and after intraarticular injection of 2.0 mmol/l gadopentetate dimeglumine in five cadaveric shoulders using a dual flip angle three-dimensional gradient echo (3D-GRE) sequence. The acquisition time for the T(1) maps was 5 min 5 s for the whole shoulder. Measurements were repeated every 15 min over 2.5 hours. Regions of interest (ROIs) covering the glenoid cartilage and the labrum were drawn to assess the temporal evolution of the relaxation parameters. T(1) of unenhanced hyaline cartilage of the glenoid was 568+/-34 ms. T(1) of unenhanced fibrous cartilage of the labrum was 552+/-38 ms. Significant differences (P=0.002 and 0.03) in the relaxation parameters were already measurable after 15 min. After 2 to 2.5 hours, hyaline and fibrous cartilage still demonstrated decreasing relaxation parameters, with a larger range of the T(1)(Gd) values in fibrous cartilage. T(1) and triangle Delta R(1) values of hyaline and fibrous cartilage after 2.5 hours were 351+/-16 ms and 1.1+/-0.09 s(-1), and 332+/-31 ms and 1.2+/-0.1 s(-1), respectively. A significant decrease in T(1)(Gd) was found 15 min after intraarticular contrast injection. Contrast accumulation was faster in hyaline than in fibrous cartilage. After 2.5 hours, contrast accumulation showed a higher rate of decrease in hyaline cartilage, but neither hyaline nor fibrous cartilage had reached equilibrium.
Magneto-therapy of human joint cartilage.
Wierzcholski, Krzysztof; Miszczak, Andrzej
2017-01-01
The topic of the present paper concerns the human joint cartilage therapy performed by the magnetic induction field. There is proved the thesis that the applied magnetic field for concrete cartilage illness should depend on the proper relative and concrete values of applied magnetic induction, intensity as well the time of treatment duration. Additionally, very important are frequencies and amplitudes of magnetic field as well as magnetic permeability of the synovial fluid. The research methods used in this paper include: magnetic induction field produced by a new Polish and German magneto electronic devices for the therapy of human joint cartilage diseases, stationary and movable magnetic applicators, magnetic bandage, ferrofluid injections, author's experience gained in Germany research institutes and practical results after measurements and information from patients. The results of this paper concern concrete parameters of time dependent electro-magnetic field administration during the joint cartilage therapy duration and additionally concern the corollaries which are implied from reading values gained on the magnetic induction devices. The main conclusions obtained in this paper are as follows: Time dependent magnetic induction field increases the dynamic viscosity of movable synovial fluid and decreases symptoms of cartilage illness for concrete intensity of magnetic field and concrete field line architecture. The ferrofluid therapy and phospholipids bilayer simultaneously with the administrated external electromagnetic field, increases the dynamic viscosity of movable synovial fluid.
Jenner, F
2013-01-01
Articular chondrocytes descend from a distinct cohort of progenitor cells located in the embryonic joint anlagen, termed interzones. Their unique lineage might explain some of the problems encountered using chondrocytes of different lineages for articular cartilage tissue engineering. While it is
Phase contrast X-ray imaging at the bone-cartilage interface
International Nuclear Information System (INIS)
Che Ismail, E.; Gundogdu, O.; Bradley, D.A.
2008-01-01
Full text: Phase contrast X-ray imaging is a simple technique to investigate various biological samples. At Surrey, the bone-cartilage interface is one of the biological samples which actively been studied. Bone-cartilage interface study gives a particular interest in this research as the degeneration of cartilage is the hallmark of the degenerative joint disease such as osteoarthritis. We have been applying the phase contrast imaging technique in studying the bone-cartilage interface, obtaining information on anatomical features such as the cartilage, blood vessel, tide mark and cement line. Our samples range from dry bone-cartilage to wet bone-cartilage tissue. This work will briefly review the basic supporting physics of the study. It also shows some of the images and other results that we have obtained to-date. Fig. 1 shows examples obtained using the X-ray tube system at the University of Surrey
Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan
2017-01-01
The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...
Development of a computational technique to measure cartilage contact area.
Willing, Ryan; Lapner, Michael; Lalone, Emily A; King, Graham J W; Johnson, James A
2014-03-21
Computational measurement of joint contact distributions offers the benefit of non-invasive measurements of joint contact without the use of interpositional sensors or casting materials. This paper describes a technique for indirectly measuring joint contact based on overlapping of articular cartilage computer models derived from CT images and positioned using in vitro motion capture data. The accuracy of this technique when using the physiological nonuniform cartilage thickness distribution, or simplified uniform cartilage thickness distributions, is quantified through comparison with direct measurements of contact area made using a casting technique. The efficacy of using indirect contact measurement techniques for measuring the changes in contact area resulting from hemiarthroplasty at the elbow is also quantified. Using the physiological nonuniform cartilage thickness distribution reliably measured contact area (ICC=0.727), but not better than the assumed bone specific uniform cartilage thicknesses (ICC=0.673). When a contact pattern agreement score (s(agree)) was used to assess the accuracy of cartilage contact measurements made using physiological nonuniform or simplified uniform cartilage thickness distributions in terms of size, shape and location, their accuracies were not significantly different (p>0.05). The results of this study demonstrate that cartilage contact can be measured indirectly based on the overlapping of cartilage contact models. However, the results also suggest that in some situations, inter-bone distance measurement and an assumed cartilage thickness may suffice for predicting joint contact patterns. Copyright © 2014 Elsevier Ltd. All rights reserved.
Mechanical properties of hyaline and repair cartilage studied by nanoindentation.
Franke, O; Durst, K; Maier, V; Göken, M; Birkholz, T; Schneider, H; Hennig, F; Gelse, K
2007-11-01
Articular cartilage is a highly organized tissue that is well adapted to the functional demands in joints but difficult to replicate via tissue engineering or regeneration. Its viscoelastic properties allow cartilage to adapt to both slow and rapid mechanical loading. Several cartilage repair strategies that aim to restore tissue and protect it from further degeneration have been introduced. The key to their success is the quality of the newly formed tissue. In this study, periosteal cells loaded on a scaffold were used to repair large partial-thickness cartilage defects in the knee joint of miniature pigs. The repair cartilage was analyzed 26 weeks after surgery and compared both morphologically and mechanically with healthy hyaline cartilage. Contact stiffness, reduced modulus and hardness as key mechanical properties were examined in vitro by nanoindentation in phosphate-buffered saline at room temperature. In addition, the influence of tissue fixation with paraformaldehyde on the biomechanical properties was investigated. Although the repair process resulted in the formation of a stable fibrocartilaginous tissue, its contact stiffness was lower than that of hyaline cartilage by a factor of 10. Fixation with paraformaldehyde significantly increased the stiffness of cartilaginous tissue by one order of magnitude, and therefore, should not be used when studying biomechanical properties of cartilage. Our study suggests a sensitive method for measuring the contact stiffness of articular cartilage and demonstrates the importance of mechanical analysis for proper evaluation of the success of cartilage repair strategies.
Autofluorescence lifetime metrology for label-free detection of cartilage matrix degradation
Nickdel, Mohammad B.; Lagarto, João. L.; Kelly, Douglas J.; Manning, Hugh B.; Yamamoto, Kazuhiro; Talbot, Clifford B.; Dunsby, Christopher; French, Paul; Itoh, Yoshifumi
2014-03-01
Degradation of articular cartilage extracellular matrix (ECM) by proteolytic enzyme is the hallmark of arthritis that leads to joint destruction. Detection of early biochemical changes in cartilage before irreversible structural damages become apparent is highly desirable. Here we report that the autofluorescence decay profile of cartilage is significantly affected by proteolytic degradation of cartilage ECM and can be characterised by measurements of the autofluorescence lifetime (AFL). A multidimensional fluorometer utilizing ultraviolet excitation at 355 nm or 375 nm coupled to a fibreoptic probe was developed for single point time-resolved AFL measurements of porcine articular cartilage explants treated with different proteinases. Degradation of cartilage matrix components by treating with bacterial collagenase, matrix metalloproteinase 1, or trypsin resulted in significant reduction of AFL of the cartilage in both a dose and time dependent manner. Differences in cartilage AFL were also confirmed by fluorescence lifetime imaging microscopy (FLIM). Our data suggest that AFL of cartilage tissue is a potential non-invasive readout to monitor cartilage matrix integrity that may be utilized for diagnosis of arthritis as well as monitoring the efficacy of anti-arthritic therapeutic agents.
Automatic segmentation of the glenohumeral cartilages from magnetic resonance images
International Nuclear Information System (INIS)
Neubert, A.; Yang, Z.; Engstrom, C.; Xia, Y.; Strudwick, M. W.; Chandra, S. S.; Crozier, S.; Fripp, J.
2016-01-01
Purpose: Magnetic resonance (MR) imaging plays a key role in investigating early degenerative disorders and traumatic injuries of the glenohumeral cartilages. Subtle morphometric and biochemical changes of potential relevance to clinical diagnosis, treatment planning, and evaluation can be assessed from measurements derived from in vivo MR segmentation of the cartilages. However, segmentation of the glenohumeral cartilages, using approaches spanning manual to automated methods, is technically challenging, due to their thin, curved structure and overlapping intensities of surrounding tissues. Automatic segmentation of the glenohumeral cartilages from MR imaging is not at the same level compared to the weight-bearing knee and hip joint cartilages despite the potential applications with respect to clinical investigation of shoulder disorders. In this work, the authors present a fully automated segmentation method for the glenohumeral cartilages using MR images of healthy shoulders. Methods: The method involves automated segmentation of the humerus and scapula bones using 3D active shape models, the extraction of the expected bone–cartilage interface, and cartilage segmentation using a graph-based method. The cartilage segmentation uses localization, patient specific tissue estimation, and a model of the cartilage thickness variation. The accuracy of this method was experimentally validated using a leave-one-out scheme on a database of MR images acquired from 44 asymptomatic subjects with a true fast imaging with steady state precession sequence on a 3 T scanner (Siemens Trio) using a dedicated shoulder coil. The automated results were compared to manual segmentations from two experts (an experienced radiographer and an experienced musculoskeletal anatomist) using the Dice similarity coefficient (DSC) and mean absolute surface distance (MASD) metrics. Results: Accurate and precise bone segmentations were achieved with mean DSC of 0.98 and 0.93 for the humeral head
Automatic segmentation of the glenohumeral cartilages from magnetic resonance images
Energy Technology Data Exchange (ETDEWEB)
Neubert, A., E-mail: ales.neubert@csiro.au [School of Information Technology and Electrical Engineering, University of Queensland, Brisbane 4072, Australia and The Australian E-Health Research Centre, CSIRO Health and Biosecurity, Brisbane 4029 (Australia); Yang, Z. [School of Information Technology and Electrical Engineering, University of Queensland, Brisbane 4072, Australia and Brainnetome Center, Institute of Automation, Chinese Academy of Sciences, Beijing 100190 (China); Engstrom, C. [School of Human Movement Studies, University of Queensland, Brisbane 4072 (Australia); Xia, Y.; Strudwick, M. W.; Chandra, S. S.; Crozier, S. [School of Information Technology and Electrical Engineering, University of Queensland, Brisbane 4072 (Australia); Fripp, J. [The Australian E-Health Research Centre, CSIRO Health and Biosecurity, Brisbane, 4029 (Australia)
2016-10-15
Purpose: Magnetic resonance (MR) imaging plays a key role in investigating early degenerative disorders and traumatic injuries of the glenohumeral cartilages. Subtle morphometric and biochemical changes of potential relevance to clinical diagnosis, treatment planning, and evaluation can be assessed from measurements derived from in vivo MR segmentation of the cartilages. However, segmentation of the glenohumeral cartilages, using approaches spanning manual to automated methods, is technically challenging, due to their thin, curved structure and overlapping intensities of surrounding tissues. Automatic segmentation of the glenohumeral cartilages from MR imaging is not at the same level compared to the weight-bearing knee and hip joint cartilages despite the potential applications with respect to clinical investigation of shoulder disorders. In this work, the authors present a fully automated segmentation method for the glenohumeral cartilages using MR images of healthy shoulders. Methods: The method involves automated segmentation of the humerus and scapula bones using 3D active shape models, the extraction of the expected bone–cartilage interface, and cartilage segmentation using a graph-based method. The cartilage segmentation uses localization, patient specific tissue estimation, and a model of the cartilage thickness variation. The accuracy of this method was experimentally validated using a leave-one-out scheme on a database of MR images acquired from 44 asymptomatic subjects with a true fast imaging with steady state precession sequence on a 3 T scanner (Siemens Trio) using a dedicated shoulder coil. The automated results were compared to manual segmentations from two experts (an experienced radiographer and an experienced musculoskeletal anatomist) using the Dice similarity coefficient (DSC) and mean absolute surface distance (MASD) metrics. Results: Accurate and precise bone segmentations were achieved with mean DSC of 0.98 and 0.93 for the humeral head
Waldenmeier, Leonie; Evers, Christoph; Uder, Michael; Janka, Rolf; Hennig, Frank Friedrich; Pachowsky, Milena Liese; Welsch, Götz Hannes
2018-02-01
Objective To evaluate and characterize the appearance of articular cartilage in the tibiofemoral joint of young professional soccer players using T2-relaxation time evaluation on magnetic resonance imaging (MRI). Design In this study, we included 57 male adolescents from the youth academy of a professional soccer team. The MRI scans were acquired of the knee joint of the supporting leg. An "early unloading" (minute 0) and "late unloading" (minute 28) T2-sequence was included in the set of images. Quantitative T2-analysis was performed in the femorotibial joint cartilage in 4 slices with each 10 regions of interest (ROIs). Statistical evaluation, using Wilcoxon signed-rank tests, was primarily performed to compare the T2 values of the "early unloading" and "late unloading." Results When comparing "early unloading" with "late unloading," our findings showed a significant increase of T2-relaxation times in the weightbearing femoral cartilage of the medial ( P cartilage of the medial compartment ( P cartilage were found with a maximum in the medial condyle where the biomechanical load of the knee joint is highest, as well as where most of the chronic cartilage lesions occur. To avoid chronic damage, special focus should be laid on this region.
Williams, Ashley; Winalski, Carl S.; Chu, Constance R.
2018-01-01
Anterior cruciate ligament (ACL) injury is a known risk factor for future development of osteoarthritis (OA). This human clinical study seeks to determine if early changes to cartilage MRI T2 maps between baseline and 6 months following ACL reconstruction (ACLR) are associated with changes to cartilage T2 and cartilage thickness between baseline and 2 years after ACLR. Changes to T2 texture metrics and T2 mean values in medial knee cartilage of 17 human subjects 6 months after ACLR were compared to 2-year changes in T2 and in cartilage thickness of the same areas. T2 texture and mean assessments were also compared to that of 11 uninjured controls. In ACLR subjects, six-month changes in mean T2 correlated to 2-year changes in mean T2 (R = 0.80, p = 0.0001), and 6-month changes to T2 texture metrics, but not T2 mean, correlated with 2-year changes in medial femoral cartilage thickness in 9 of the 20 texture features assessed (R = 0.48–0.72, p ≤ 0.05). Both mean T2 and texture differed (p evaluation of T2 map and textural changes may provide early warning of cartilage at risk for progressive degeneration after ACL injury and reconstruction. PMID:27381512
Directory of Open Access Journals (Sweden)
Anna Lettieri
2015-03-01
Full Text Available The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.
Nanoparticles for diagnostics and laser medical treatment of cartilage in orthopaedics
Baum, O. I.; Soshnikova, Yu. M.; Omelchenko, A. I.; Sobol, Emil
2013-02-01
Laser reconstruction of intervertebral disc (LRD) is a new technique which uses local, non-destructive laser irradiation for the controlled activation of regenerative processes in a targeted zone of damaged disc cartilage. Despite pronounced advancements of LRD, existing treatments may be substantially improved if laser radiation is absorbed near diseased and/or damaged regions in cartilage so that required thermomechanical stress and strain at chondrocytes may be generated and non-specific injury reduced or eliminated. The aims of the work are to study possibility to use nanoparticles (NPs) to provide spatial specificity for laser regeneration of cartilage. Two types of porcine joint cartilage have been impregnated with magnetite NPs: 1) fresh cartilage; 2) mechanically damaged cartilage. NPs distribution was studied using transition electron microscopy, dynamic light scattering and analytical ultracentrifugation techniques. Laser radiation and magnetic field have been applied to accelerate NPs impregnation. It was shown that NPs penetrate by diffusion into the mechanically damaged cartilage, but do not infiltrate healthy cartilage. Temperature dynamics in cartilage impregnated with NPs have been theoretically calculated and measurements using an IR thermo vision system have been performed. Laser-induced alterations of cartilage structure and cellular surviving have been studied for cartilage impregnated with NPs using histological and histochemical techniques. Results of our study suggest that magnetite NPs might be used to provide spatial specificity of laser regeneration. When damaged, the regions of cartilage impreganted with NPs have higher absorption of laser radiation than that for healthy areas. Regions containing NPs form target sites that can be used to generate laser-induced thermo mechanical stress leading to regeneration of cartilage of hyaline type.
Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa
2018-06-01
Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .
Holmium:YAG laser effects on articular cartilage metabolism: in vitro
Smith, R. Lane; Montgomery, L.; Fanton, G.; Dillingham, M.; Schurman, D. J.
1994-09-01
We report effects of applying variable doses of Holmium:YAG laser energy to bovine articular cartilage in vitro. The response of the cartilage to the Holmium:YAG laser energy was determined by quantification of cell proliferation and extracellular matrix glycosaminoglycan synthesis. This study demonstrates that articular cartilage cell metabolism was maintained at a normal level following treatment of cartilage at a dose of 0.6 joules/pulse. The laser energy was applied at 10 Hz for 10 seconds at 1 mm distance from the cartilage. Under these conditions and at a dose of 0.6 joules/pulse, the total energy density was calculated to be 240 joules/cm2, assuming minimal loss of energy due to water absorption. Energy levels grater than 0.8 joules/pulse corresponding to calculated energy densities greater than 320 joules/cm2 proved harmful to cartilage. Our data demonstrate that low levels of Holmium:YAG laser energy can be applied to articular cartilage under conditions that maintain and/or stimulate cell metabolism.
Mechanical activation of mammalian target of rapamycin pathway is required for cartilage development
Guan, Yingjie; Yang, Xu; Yang, Wentian; Charbonneau, Cherie; Chen, Qian
2014-01-01
Mechanical stress regulates development by modulating cell signaling and gene expression. However, the cytoplasmic components mediating mechanotransduction remain unclear. In this study, elimination of muscle contraction during chicken embryonic development resulted in a reduction in the activity of mammalian target of rapamycin (mTOR) in the cartilaginous growth plate. Inhibition of mTOR activity led to significant inhibition of chondrocyte proliferation, cartilage tissue growth, and express...
Computerized tomography diagnosis of cartilage destruction in carcinoma of the larynx
International Nuclear Information System (INIS)
Kawashima, Osamu; Tomizawa, Yoshio; Yasuoka, Yoshihito; Kamei, Tamio
1991-01-01
In 20 cases of laryngeal carcinoma, the pre-operative computerized tomography (CT) films were correlated with the macroscopic appearance of specimens obtained at the time of surgery. A correct diagnosis of cartilage destruction was made by pre-operative CT in 75% of cases in which the thyroid cartilage was involved and in about 79% of those with either arytenoid or cricoid cartilage involvement. A comparison between the pathological findings and the pre-operative CT findings in 9 cases of laryngeal carcinoma with destruction of the thyroid cartilage revealed several pathological changes which may lead to an incorrect CT diagnosis. These changes include microscopic infiltration; destruction of cartilage at the anterior commisure; tumor advance to sites of ossification, especially infiltration into ossifying cartilage located between two areas of non-ossifying cartilage; and infiltration of the tumor within the cartilage with preservation of the perichondrium. (author)
MR imaging of cartilage and its repair in the knee - a review
International Nuclear Information System (INIS)
Trattnig, S.; Welsch, G.W.; Domayer, S.; Mosher, T.; Eckstein, F.
2009-01-01
Chondral injuries are common lesions of the knee joint, and many patients could benefit from cartilage repair. Widespread cartilage repair techniques require sophisticated noninvasive follow-up using MRI. In addition to the precise morphological assessment of this area of cartilage repair, the cartilage's biochemical constitution can be determined using biochemical MRI techniques. The combination of the clinical outcome after cartilage repair together with the morphological and biochemical description of the cartilage repair tissue as well as the surrounding cartilage can lead to an optimal follow-up evaluation. The present article on MR imaging techniques of cartilage repair focuses on morphological description and scoring using techniques from conventional 2D through advanced isotropic 3D MRI sequences. Furthermore the ultrastructure of the repair tissue and the surrounding cartilage is evaluated in-vivo by biochemical T1-delayed gadolinium enhanced MRI of cartilage (dGEMRIC), T2 relaxation, and diffusion-weighted imaging techniques. (orig.)
Chen, Rebecca; Mian, Michelle; Fu, Martin; Zhao, Jing Ying; Yang, Liang; Li, Yefu; Xu, Lin
2015-11-01
Transforming growth factor beta 1 (TGF-β1) is implicated in osteoarthritis. We therefore studied the role of TGF-β1 signaling in the development of osteoarthritis in a developmental stage-dependent manner. Three different mouse models were investigated. First, the Tgf-β receptor II (Tgfbr2) was specifically removed from the mature cartilage of joints. Tgfbr2-deficient mice were grown to 12 months of age and were then euthanized for collection of knee and temporomandibular joints. Second, Tgfbr2-deficient mice were subjected to destabilization of the medial meniscus (DMM) surgery. Knee joints were then collected from the mice at 8 and 16 weeks after the surgery. Third, wild-type mice were subjected to DMM at the age of 8 weeks. Immediately after the surgery, these mice were treated with the Tgfbr2 inhibitor losartan for 8 weeks and then euthanized for collection of knee joints. All joints were characterized for evidences of articular cartilage degeneration. Initiation or acceleration of articular cartilage degeneration was not observed by the genetic inactivation of Tgfbr2 in the joints at the age of 12 months. In fact, the removal of Tgfbr2 and treatment with losartan both delayed the progression of articular cartilage degeneration induced by DMM compared with control littermates. Therefore, we conclude that inhibition of Tgf-β1 signaling protects adult knee joints in mice against the development of osteoarthritis. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Distinguishing epigenetic marks of developmental and imprinting regulation
Directory of Open Access Journals (Sweden)
McEwen Kirsten R
2010-01-01
Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two
Disease gene characterization through large-scale co-expression analysis.
Directory of Open Access Journals (Sweden)
Allen Day
2009-12-01
Full Text Available In the post genome era, a major goal of biology is the identification of specific roles for individual genes. We report a new genomic tool for gene characterization, the UCLA Gene Expression Tool (UGET.Celsius, the largest co-normalized microarray dataset of Affymetrix based gene expression, was used to calculate the correlation between all possible gene pairs on all platforms, and generate stored indexes in a web searchable format. The size of Celsius makes UGET a powerful gene characterization tool. Using a small seed list of known cartilage-selective genes, UGET extended the list of known genes by identifying 32 new highly cartilage-selective genes. Of these, 7 of 10 tested were validated by qPCR including the novel cartilage-specific genes SDK2 and FLJ41170. In addition, we retrospectively tested UGET and other gene expression based prioritization tools to identify disease-causing genes within known linkage intervals. We first demonstrated this utility with UGET using genetically heterogeneous disorders such as Joubert syndrome, microcephaly, neuropsychiatric disorders and type 2 limb girdle muscular dystrophy (LGMD2 and then compared UGET to other gene expression based prioritization programs which use small but discrete and well annotated datasets. Finally, we observed a significantly higher gene correlation shared between genes in disease networks associated with similar complex or Mendelian disorders.UGET is an invaluable resource for a geneticist that permits the rapid inclusion of expression criteria from one to hundreds of genes in genomic intervals linked to disease. By using thousands of arrays UGET annotates and prioritizes genes better than other tools especially with rare tissue disorders or complex multi-tissue biological processes. This information can be critical in prioritization of candidate genes for sequence analysis.
Indian hedgehog contributes to human cartilage endplate degeneration.
Wang, Shaowei; Yang, Kun; Chen, Shuai; Wang, Jiying; Du, Guoqing; Fan, Shunwu; Wei, Lei
2015-08-01
To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n = 17) were collected. Specimens were either cut into slices for organ culture ex vivo or digested to isolate chondrocytes for cell culture in vitro. Ihh expression and the effect of Ihh on cartilage degeneration were determined by investigating degeneration markers in this study. Ihh expression and cartilage degeneration markers significantly increased in the Modic I and II groups. The expression of cartilage degeneration markers was positively correlated with degeneration severity. Gain-of-function for Ihh promoted expression of cartilage degeneration markers in vitro, while loss-of-function for Ihh inhibited their expression both in vitro and ex vivo. These findings demonstrated that Ihh promotes CEP degeneration. Blocking Ihh pathway has potential clinical usage for attenuating CEP degeneration.
Fine-tuning Cartilage Tissue Engineering by Applying Principles from Embryonic Development
C.A. Hellingman (Catharine)
2012-01-01
textabstractCartilage has a very poor capacity for regeneration in vivo. In head and neck surgery cartilage defects are usually reconstructed with autologous cartilage from for instance the external ear or the ribs. Cartilage tissue engineering may be a promising alternative to supply tissue for
High fat diet accelerates cartilage repair in DBA/1 mice.
Wei, Wu; Bastiaansen-Jenniskens, Yvonne M; Suijkerbuijk, Mathijs; Kops, Nicole; Bos, Pieter K; Verhaar, Jan A N; Zuurmond, Anne-Marie; Dell'Accio, Francesco; van Osch, Gerjo J V M
2017-06-01
Obesity is a well-known risk factor for osteoarthritis, but it is unknown what it does on cartilage repair. Here we investigated whether a high fat diet (HFD) influences cartilage repair in a mouse model of cartilage repair. We fed DBA/1 mice control or HFD (60% energy from fat). After 2 weeks, a full thickness cartilage defect was made in the trochlear groove. Mice were sacrificed, 1, 8, and 24 weeks after operation. Cartilage repair was evaluated on histology. Serum glucose, insulin and amyloid A were measured 24 h before operation and at endpoints. Immunohistochemical staining was performed on synovium and adipose tissue to evaluate macrophage infiltration and phenotype. One week after operation, mice on HFD had defect filling with fibroblast-like cells and more cartilage repair as indicated by a lower Pineda score. After 8 weeks, mice on a HFD still had a lower Pineda score. After 24 weeks, no mice had complete cartilage repair and we did not detect a significant difference in cartilage repair between diets. Bodyweight was increased by HFD, whereas serum glucose, amyloid A and insulin were not influenced. Macrophage infiltration and phenotype in adipose tissue and synovium were not influenced by HFD. In contrast to common wisdom, HFD accelerated intrinsic cartilage repair in DBA/1 mice on the short term. Resistance to HFD induced inflammatory and metabolic changes could be associated with accelerated cartilage repair. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1258-1264, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
The Role of Cartilage Stress in Patellofemoral Pain
Besier, Thor F.; Pal, Saikat; Draper, Christine E.; Fredericson, Michael; Gold, Garry E.; Delp, Scott L.; Beaupré, Gary S.
2015-01-01
Purpose Elevated cartilage stress has been identified as a potential mechanism for retropatellar pain; however, there are limited data in the literature to support this mechanism. Females are more likely to develop patellofemoral pain than males, yet the causes of this dimorphism are unclear. We used experimental data and computational modeling to determine whether patients with patellofemoral pain had elevated cartilage stress compared to pain-free controls and test the hypothesis that females exhibit greater cartilage stress than males. Methods We created finite element models of 24 patients with patellofemoral pain (11 males; 13 females) and 16 pain-free controls (8 males; 8 females) to estimate peak patellar cartilage stress (strain energy density) during a stair climb activity. Simulations took into account cartilage morphology from MRI, joint posture from weight-bearing MRI, and muscle forces from an EMG-driven model. Results We found no difference in peak patellar strain energy density between patellofemoral pain (1.9 ± 1.23 J/m3) and control subjects (1.66 ± 0.75 J/m3, p=0.52). Females exhibited greater cartilage stress compared to males (2.2 vs 1.3 J/m3, respectively, p=0.0075), with large quadriceps muscle forces (3.7BW females vs 3.3BW males) and 23% smaller joint contact area (females: 467 ± 59 mm2 vs males: 608 ± 95mm2). Conclusion Patellofemoral pain patients did not display significantly greater patellar cartilage stress compared to pain-free controls; however, there was a great deal of subject variation. Females exhibited greater peak cartilage stress compared to males, which might explain the greater prevalence of patellofemoral pain in females compared to males but other mechanical and biological factors are clearly involved in this complex pathway to pain. PMID:25899103
DEFF Research Database (Denmark)
Berg, Lise Charlotte; Mata, Xavier; Thomsen, Preben Dybdahl
2008-01-01
Cartilage-derived retinoic acid sensitive protein (CD-RAP) also known as melanoma inhibitory activity (MIA) has already been established as a marker for chondrocyte differentiation and a number of cancerous condition sin humans. Studies have also shown that CD-RAP/MIA is a potential marker of joint......RNA in articular cartilage and chondrocytes from horses with no signs of joint disease. The expression decreased as the cells dedifferentiated in monolayer culture. We also identified an equine CD-RAP/MIA splioce variant similar to that reported in humans. The CD_RAP/MIA protein was detected in equine synovial...... fluid, serum and culture medium from chondrocyte cultures. In conclusion, CD-RAP/MIA is expressed in equine cartilage and chondrocytes, and the protein can be detected in equine serum, synovial fluid and in culture medium from chondrocyte cultures. The equine gene and resulting protein share great...
Moshaverinia, Alireza; Xu, Xingtian; Chen, Chider; Akiyama, Kentaro; Snead, Malcolm L; Shi, Songtao
2013-01-01
Dental-derived MSCs are promising candidates for cartilage regeneration, with high chondrogenic differentiation capacity. This property contributes to making dental MSCs an advantageous therapeutic option compared to current treatment modalities. The MSC delivery vehicle is the principal determinant for the success of MSC-mediated cartilage regeneration therapies. The objectives of this study were to: (1) develop a novel co-delivery system based on TGF-β1 loaded RGD-coupled alginate microspheres encapsulating Periodontal Ligament Stem Cells (PDLSCs) or Gingival Mesenchymal Stem Cells (GMSCs); and (2) investigate dental MSC viability and chondrogenic differentiation in alginate microspheres. The results revealed the sustained release of TGF-β1 from the alginate microspheres. After 4 weeks of chondrogenic differentiation in vitro, PDLSCs, GMSCs as well as human bone marrow mesenchymal stem cells (hBMMSC) (as positive control) revealed chondrogenic gene expression markers (Col II and Sox-9) via qPCR, as well as matrix positively stained by toluidine blue and safranin-O. In animal studies, ectopic cartilage tissue regeneration was observed inside and around the transplanted microspheres, confirmed by histochemical and immunofluorescent staining. Interestingly, PDLSCs showed more chondrogenesis than GMSCs and hBMMSCs (Palginate microencapsulating dental MSCs make a promising candidate for cartilage regeneration. Our results highlight the vital role played by the microenvironment, as well as value of presenting inductive signals for viability and differentiation of MSCs. PMID:23891740
Processed bovine cartilage: an improved biosynthetic implant for contour defects
International Nuclear Information System (INIS)
Ersek, R.A.; Hart, W.G. Jr.; Greer, D.; Beisang, A.A.; Flynn, P.J.; Denton, D.R.
1984-01-01
Irradiated human cartilage has been found to be a superior implant material for correction of contour defects; however, availability problems have prevented this material from gaining wide acceptance. Implantation of processed irradiated bovine cartilage in primates and rabbits, as described here, provides strong evidence that this material performs like irradiated allograft cartilage antigenically and has certain cosmetic advantages over allograft cartilage. Our studies in primates have shown that there is no systemically measurable antibody-antigen reaction, either cellular or noncellular, to irradiated processed bovine cartilage. Neither primary nor second-set provocative implantations produced any measurable rejection. In rabbits, composite grafts of two pieces of irradiated bovine cartilage adjacent to each other were also well tolerated, with no measurable absorption and with capsule formation typical of a foreign body reaction to an inert object
Cutaneous Squamous Cell Carcinoma with Invasion through Ear Cartilage
Directory of Open Access Journals (Sweden)
Julie Boisen
2016-01-01
Full Text Available Cutaneous squamous cell carcinoma of the ear represents a high-risk tumor location with an increased risk of metastasis and local tissue invasion. However, it is uncommon for these cancers to invade through nearby cartilage. Cartilage invasion is facilitated by matrix metalloproteases, specifically collagenase 3. We present the unusual case of a 76-year-old man with an auricular squamous cell carcinoma that exhibited full-thickness perforation of the scapha cartilage. Permanent sections through the eroded cartilage confirmed tumor invasion extending to the posterior ear skin.
Directory of Open Access Journals (Sweden)
Chermaine Deepa Antony
2016-01-01
Full Text Available Purpose. This study investigates the association between focal nodular mass with low signal in Hoffa’s fat pad adjacent to anterior femoral cartilage of the knee (FNMHF and focal cartilage abnormality in this region. Method. The magnetic resonance fast imaging employing steady-state acquisition sequence (MR FIESTA sagittal and axial images of the B1 and C1 region (described later of 148 patients were independently evaluated by two reviewers and categorized into four categories: normal, FNMHF with underlying focal cartilage abnormality, FNMHF with normal cartilage, and cartilage abnormality with no FNMHF. Results. There was a significant association (p=0.00 between FNMHF and immediate adjacent focal cartilage abnormality with high interobserver agreement. The absence of focal nodular lesions next to the anterior femoral cartilage has a very high negative predictive value for chondral injury (97.8%. Synovial biopsy of focal nodular lesion done during arthroscopy revealed some fibrocollagenous tissue and no inflammatory cells. Conclusion. We postulate that the FNMHF adjacent to the cartilage defects is a form of normal healing response to the cartilage damage. One patient with FHMHF and underlying cartilage abnormality was rescanned six months later. In this patient, the FNMHF disappeared and normal cartilage was observed in the adjacent region which may support this theory.
Kishi, Shuji
2011-09-01
Senescence may be considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena during the process of aging. We investigated whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We conducted experiments to isolate zebrafish mutants expressing an apparent senescence phenotype during embryogenesis (embryonic senescence). Some of the genes we thereby identified had already been associated with cellular senescence and chronological aging in other organisms, but many had not yet been linked to these processes. Complete loss-of-function of developmentally essential genes induce embryonic (or larval) lethality, whereas it seems like their partial loss-of-function (i.e., decrease-of-function by heterozygote or hypomorphic mutations) still remains sufficient to go through the early developmental process because of its adaptive plasticity or rather heterozygote advantage. However, in some cases, such partial loss-of-function of genes compromise normal homeostasis due to haploinsufficiency later in adult life having many environmental stress challenges. By contrast, any heterozygote-advantageous genes might gain a certain benefit(s) (much more fitness) by such partial loss-of-function later in life. Physiological senescence may evolutionarily arise from both genetic and epigenetic drifts as well as from losing adaptive developmental plasticity in face of stress signals from the external environment that interacts with functions of multiple genes rather than effects of only a single gene mutation or defect. Previously uncharacterized developmental genes may thus mediate the aging process and play a pivotal role in senescence. Moreover, unexpected senescence-related genes might also be involved in the early developmental process and
Quasi-static elastography comparison of hyaline cartilage structures
McCredie, A. J.; Stride, E.; Saffari, N.
2009-11-01
Joint cartilage, a load bearing structure in mammals, has only limited ability for regeneration after damage. For tissue engineers to design functional constructs, better understanding of the properties of healthy tissue is required. Joint cartilage is a specialised structure of hyaline cartilage; a poroviscoelastic solid containing fibril matrix reinforcements. Healthy joint cartilage is layered, which is thought to be important for correct tissue function. However, the behaviour of each layer during loading is poorly understood. Ultrasound elastography provides access to depth-dependent information in real-time for a sample during loading. A 15 MHz focussed transducer provided details from scatterers within a small fixed region in each sample. Quasi-static loading was applied to cartilage samples while ultrasonic signals before and during compressions were recorded. Ultrasonic signals were processed to provide time-shift profiles using a sum-squared difference method and cross-correlation. Two structures of hyaline cartilage have been tested ultrasonically and mechanically to determine method suitability for monitoring internal deformation differences under load and the effect of the layers on the global mechanical material behaviour. Results show differences in both the global mechanical properties and the ultrasonically tested strain distributions between the two structures tested. It was concluded that these differences are caused primarily by the fibril orientations.
Comparison of Different Approaches for Measuring Tibial Cartilage Thickness
Directory of Open Access Journals (Sweden)
Maier Jennifer
2017-07-01
Full Text Available Osteoarthritis is a degenerative disease affecting bones and cartilage especially in the human knee. In this context, cartilage thickness is an indicator for knee cartilage health. Thickness measurements are performed on medical images acquired in-vivo. Currently, there is no standard method agreed upon that defines a distance measure in articular cartilage. In this work, we present a comparison of different methods commonly used in literature. These methods are based on nearest neighbors, surface normal vectors, local thickness and potential field lines. All approaches were applied to manual segmentations of tibia and lateral and medial tibial cartilage performed by experienced raters. The underlying data were contrast agent-enhanced cone-beam C-arm CT reconstructions of one healthy subject’s knee. The subject was scanned three times, once in supine position and two times in a standing weight-bearing position. A comparison of the resulting thickness maps shows similar distributions and high correlation coefficients between the approaches above 0.90. The nearest neighbor method results on average in the lowest cartilage thickness values, while the local thickness approach assigns the highest values. We showed that the different methods agree in their thickness distribution. The results will be used for a future evaluation of cartilage change under weight-bearing conditions.
Cartilage immunoprivilege depends on donor source and lesion location.
Arzi, B; DuRaine, G D; Lee, C A; Huey, D J; Borjesson, D L; Murphy, B G; Hu, J C Y; Baumgarth, N; Athanasiou, K A
2015-09-01
The ability to repair damaged cartilage is a major goal of musculoskeletal tissue engineering. Allogeneic (same species, different individual) or xenogeneic (different species) sources can provide an attractive source of chondrocytes for cartilage tissue engineering, since autologous (same individual) cells are scarce. Immune rejection of non-autologous hyaline articular cartilage has seldom been considered due to the popular notion of "cartilage immunoprivilege". The objective of this study was to determine the suitability of allogeneic and xenogeneic engineered neocartilage tissue for cartilage repair. To address this, scaffold-free tissue engineered articular cartilage of syngeneic (same genetic background), allogeneic, and xenogeneic origin were implanted into two different locations of the rabbit knee (n=3 per group/location). Xenogeneic engineered cartilage and control xenogeneic chondral explants provoked profound innate inflammatory and adaptive cellular responses, regardless of transplant location. Cytological quantification of immune cells showed that, while allogeneic neocartilage elicited an immune response in the patella, negligible responses were observed when implanted into the trochlea; instead the responses were comparable to microfracture-treated empty defect controls. Allogeneic neocartilage survived within the trochlea implant site and demonstrated graft integration into the underlying bone. In conclusion, the knee joint cartilage does not represent an immune privileged site, strongly rejecting xenogeneic but not allogeneic chondrocytes in a location-dependent fashion. This difference in location-dependent survival of allogeneic tissue may be associated with proximity to the synovium. Through a series of in vivo studies this research demonstrates that articular cartilage is not fully immunoprivileged. In addition, we now show that anatomical location of the defect, even within the same joint compartment, strongly influences the degree of the
Liu, Ji; Nie, Huarong; Xu, Zhengliang; Niu, Xin; Guo, Shangchun; Yin, Junhui; Guo, Fei; Li, Gang; Wang, Yang; Zhang, Changqing
2014-01-01
The discovery of induced pluripotent stem cells (iPSCs) rendered the reprogramming of terminally differentiated cells to primary stem cells with pluripotency possible and provided potential for the regeneration and restoration of cartilage defect. Chondrogenic differentiation of iPSCs is crucial for their application in cartilage tissue engineering. In this study we investigated the effect of 3D nanofibrous scaffolds on the chondrogenesis of iPSCs and articular cartilage defect restoration. Super-hydrophilic and durable mechanic polycaprolactone (PCL)/gelatin scaffolds were fabricated using two separate electrospinning processes. The morphological structure and mechanical properties of the scaffolds were characterized. The chondrogenesis of the iPSCs in vitro and the restoration of the cartilage defect was investigated using scanning electron microscopy (SEM), the Cell Counting Kit-8 (CCK-8), histological observation, RT-qPCR, and western blot analysis. iPSCs on the scaffolds expressed higher levels of chondrogenic markers than the control group. In an animal model, cartilage defects implanted with the scaffold-cell complex exhibited an enhanced gross appearance and histological improvements, higher cartilage-specific gene expression and protein levels, as well as subchondral bone regeneration. Therefore, we showed scaffolds with a 3D nanofibrous structure enhanced the chondrogenesis of iPSCs and that iPSC-containing scaffolds improved the restoration of cartilage defects to a greater degree than did scaffolds alone in vivo.
Directory of Open Access Journals (Sweden)
Ji Liu
Full Text Available The discovery of induced pluripotent stem cells (iPSCs rendered the reprogramming of terminally differentiated cells to primary stem cells with pluripotency possible and provided potential for the regeneration and restoration of cartilage defect. Chondrogenic differentiation of iPSCs is crucial for their application in cartilage tissue engineering. In this study we investigated the effect of 3D nanofibrous scaffolds on the chondrogenesis of iPSCs and articular cartilage defect restoration. Super-hydrophilic and durable mechanic polycaprolactone (PCL/gelatin scaffolds were fabricated using two separate electrospinning processes. The morphological structure and mechanical properties of the scaffolds were characterized. The chondrogenesis of the iPSCs in vitro and the restoration of the cartilage defect was investigated using scanning electron microscopy (SEM, the Cell Counting Kit-8 (CCK-8, histological observation, RT-qPCR, and western blot analysis. iPSCs on the scaffolds expressed higher levels of chondrogenic markers than the control group. In an animal model, cartilage defects implanted with the scaffold-cell complex exhibited an enhanced gross appearance and histological improvements, higher cartilage-specific gene expression and protein levels, as well as subchondral bone regeneration. Therefore, we showed scaffolds with a 3D nanofibrous structure enhanced the chondrogenesis of iPSCs and that iPSC-containing scaffolds improved the restoration of cartilage defects to a greater degree than did scaffolds alone in vivo.
Measurements of surface layer of the articular cartilage using microscopic techniques
International Nuclear Information System (INIS)
Ryniewicz, A. M; Ryniewicz, W.; Ryniewicz, A.; Gaska, A.
2010-01-01
The articular cartilage is the structure that directly cooperates tribologically in biobearing. It belongs to the connective tissues and in the joints it assumes two basic forms: hyaline cartilage that builds joint surfaces and fibrocartilage which may create joint surfaces. From this fibrocartilage are built semilunar cartilage and joint disc are built as well. The research of articular cartilage have been done in macro, micro and nano scale. In all these measurement areas characteristic features occur which can identify biobearing tribology. The aim of the research was the identification of surface layer of articular cartilage by means of scanning electron microscopy (SEM) and atom force microscopy (AFM) and the analysis of topography of these layers. The material used in the research of surface layer was the animal articular cartilage: hyaline cartilage and fibrocartilage.
Measurements of surface layer of the articular cartilage using microscopic techniques
Ryniewicz, A. M.; Ryniewicz, A.; Ryniewicz, W.; Gaska, A.
2010-07-01
The articular cartilage is the structure that directly cooperates tribologically in biobearing. It belongs to the connective tissues and in the joints it assumes two basic forms: hyaline cartilage that builds joint surfaces and fibrocartilage which may create joint surfaces. From this fibrocartilage are built semilunar cartilage and joint disc are built as well. The research of articular cartilage have been done in macro, micro and nano scale. In all these measurement areas characteristic features occur which can identify biobearing tribology. The aim of the research was the identification of surface layer of articular cartilage by means of scanning electron microscopy (SEM) and atom force microscopy (AFM) and the analysis of topography of these layers. The material used in the research of surface layer was the animal articular cartilage: hyaline cartilage and fibrocartilage.
Directory of Open Access Journals (Sweden)
Jin Nam
Full Text Available Chronic inflammation is one of the major causes of cartilage destruction in osteoarthritis. Here, we systematically analyzed the changes in gene expression associated with the progression of cartilage destruction in monoiodoacetate-induced arthritis (MIA of the rat knee. Sprague Dawley female rats were given intra-articular injection of monoiodoacetate in the knee. The progression of MIA was monitored macroscopically, microscopically and by micro-computed tomography. Grade 1 damage was observed by day 5 post-monoiodoacetate injection, progressively increasing to Grade 2 by day 9, and to Grade 3-3.5 by day 21. Affymetrix GeneChip was utilized to analyze the transcriptome-wide changes in gene expression, and the expression of salient genes was confirmed by real-time-PCR. Functional networks generated by Ingenuity Pathways Analysis (IPA from the microarray data correlated the macroscopic/histologic findings with molecular interactions of genes/gene products. Temporal changes in gene expression during the progression of MIA were categorized into five major gene clusters. IPA revealed that Grade 1 damage was associated with upregulation of acute/innate inflammatory responsive genes (Cluster I and suppression of genes associated with musculoskeletal development and function (Cluster IV. Grade 2 damage was associated with upregulation of chronic inflammatory and immune trafficking genes (Cluster II and downregulation of genes associated with musculoskeletal disorders (Cluster IV. The Grade 3 to 3.5 cartilage damage was associated with chronic inflammatory and immune adaptation genes (Cluster III. These findings suggest that temporal regulation of discrete gene clusters involving inflammatory mediators, receptors, and proteases may control the progression of cartilage destruction. In this process, IL-1β, TNF-α, IL-15, IL-12, chemokines, and NF-κB act as central nodes of the inflammatory networks, regulating catabolic processes. Simultaneously
Techniques and Applications of in vivo Diffusion Imaging of Articular Cartilage
Raya, José G.
2014-01-01
Early in the process of osteoarthritis (OA) the composition (water, proteoglycan [PG], and collagen) and structure of articular cartilage is altered leading to changes in its mechanical properties. A technique that can assess the composition and structure of the cartilage in vivo can provide insight in the mechanical integrity of articular cartilage and become a powerful tool for the early diagnosis of OA. Diffusion tensor imaging (DTI) has been proposed as a biomarker for cartilage composition and structure. DTI is sensitive to the PG content through the mean diffusivity (MD) and to the collagen architecture through the fractional anisotropy (FA). However, the acquisition of DTI of articular cartilage in vivo is challenging due to the short T2 of articular cartilage (~40 ms at 3 T) and the high resolution needed (0.5–0.7 mm in plane) to depict the cartilage anatomy. We describe the pulse sequences used for in vivo DTI of articular cartilage and discus general strategies for protocol optimization. We provide a comprehensive review of measurements of DTI of articular cartilage from ex vivo validation experiments to its recent clinical applications. PMID:25865215
Zhu, Danqing; Wang, Huiyuan; Trinh, Pavin; Heilshorn, Sarah C; Yang, Fan
2017-05-01
Hyaluronic acid (HA) is a major component of cartilage extracellular matrix and is an attractive material for use as 3D injectable matrices for cartilage regeneration. While previous studies have shown the promise of HA-based hydrogels to support cell-based cartilage formation, varying HA concentration generally led to simultaneous changes in both biochemical cues and stiffness. How cells respond to the change of biochemical content of HA remains largely unknown. Here we report an adaptable elastin-like protein-hyaluronic acid (ELP-HA) hydrogel platform using dynamic covalent chemistry, which allows variation of HA concentration without affecting matrix stiffness. ELP-HA hydrogels were created through dynamic hydrazone bonds via the reaction between hydrazine-modified ELP (ELP-HYD) and aldehyde-modified HA (HA-ALD). By tuning the stoichiometric ratio of aldehyde groups to hydrazine groups while maintaining ELP-HYD concentration constant, hydrogels with variable HA concentration (1.5%, 3%, or 5%) (w/v) were fabricated with comparable stiffness. To evaluate the effects of HA concentration on cell-based cartilage regeneration, chondrocytes were encapsulated within ELP-HA hydrogels with varying HA concentration. Increasing HA concentration led to a dose-dependent increase in cartilage-marker gene expression and enhanced sGAG deposition while minimizing undesirable fibrocartilage phenotype. The use of adaptable protein hydrogels formed via dynamic covalent chemistry may be broadly applicable as 3D scaffolds with decoupled niche properties to guide other desirable cell fates and tissue repair. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tailored PVA/ECM Scaffolds for Cartilage Regeneration
Directory of Open Access Journals (Sweden)
Elena Stocco
2014-01-01
Full Text Available Articular cartilage lesions are a particular challenge for regenerative medicine due to cartilage low self-ability repair in case of damage. Hence, a significant goal of musculoskeletal tissue engineering is the development of suitable structures in virtue of their matrix composition and biomechanical properties. The objective of our study was to design in vitro a supporting structure for autologous chondrocyte growth. We realized a biohybrid composite scaffold combining a novel and nonspecific extracellular matrix (ECM, which is decellularized Wharton’s jelly ECM, with the biomechanical properties of the synthetic hydrogel polyvinyl alcohol (PVA. Wharton’s jelly ECM was tested for its ability in promoting scaffold colonization by chondrocytes and compared with polyvinyl alcohol itself and the more specific decellularized cartilage matrix. Our preliminary evidences highlighted the chance of using Wharton’s jelly ECM in combination with PVA hydrogels as an innovative and easily available scaffold for cartilage restoration.
Bhatlekar, Seema; Addya, Sankar; Salunek, Moreh; Orr, Christopher R; Surrey, Saul; McKenzie, Steven; Fields, Jeremy Z; Boman, Bruce M
2014-01-15
Our goal was to identify a unique gene expression signature for human colonic stem cells (SCs). Accordingly, we determined the gene expression pattern for a known SC-enriched region--the crypt bottom. Colonic crypts and isolated crypt subsections (top, middle, and bottom) were purified from fresh, normal, human, surgical specimens. We then used an innovative strategy that used two-color microarrays (∼18,500 genes) to compare gene expression in the crypt bottom with expression in the other crypt subsections (middle or top). Array results were validated by PCR and immunostaining. About 25% of genes analyzed were expressed in crypts: 88 preferentially in the bottom, 68 in the middle, and 131 in the top. Among genes upregulated in the bottom, ∼30% were classified as growth and/or developmental genes including several in the PI3 kinase pathway, a six-transmembrane protein STAMP1, and two homeobox (HOXA4, HOXD10) genes. qPCR and immunostaining validated that HOXA4 and HOXD10 are selectively expressed in the normal crypt bottom and are overexpressed in colon carcinomas (CRCs). Immunostaining showed that HOXA4 and HOXD10 are co-expressed with the SC markers CD166 and ALDH1 in cells at the normal crypt bottom, and the number of these co-expressing cells is increased in CRCs. Thus, our findings show that these two HOX genes are selectively expressed in colonic SCs and that HOX overexpression in CRCs parallels the SC overpopulation that occurs during CRC development. Our study suggests that developmental genes play key roles in the maintenance of normal SCs and crypt renewal, and contribute to the SC overpopulation that drives colon tumorigenesis.
Radiation synovectomy stimulates glycosaminoglycan synthesis by normal articular cartilage
International Nuclear Information System (INIS)
Myers, S.L.; Slowman, S.D.; Brandt, K.D.
1989-01-01
Radiation synovectomy has been considered a therapeutic alternative to surgical synovectomy. Whether intraarticular irradiation affects the composition or biochemistry, and therefore the biomechanical properties, of normal articular cartilage has not been established. In the present study, yttrium 90 silicate was injected into one knee of nine normal adult dogs, and three other dogs received nonradioactive yttrium silicate. When the animals were killed 4 to 13 weeks after the injection, synovium from the irradiated knees showed areas of necrosis and fibrosis. Up to 29% less hyaluronate was synthesized in vitro by the synovial intima from irradiated knees than by the intima from the contralateral knees (mean difference 18%). Morphologic abnormalities were not observed in articular cartilage from either the irradiated or control knees, nor did the water content or concentrations of uronic acid or DNA in cartilage from the irradiated knees differ from that in cartilage from the contralateral knees. However, net 35 SO 4 -labeled glycosaminoglycan synthesis in organ cultures of cartilage from irradiated knees was increased (mean difference 21%, p = 0.03) in comparison with that in cultures of contralateral knee cartilage
Body Weight Independently Affects Articular Cartilage Catabolism
Directory of Open Access Journals (Sweden)
W. Matt Denning, Jason G. Winward, Michael Becker Pardo, J. Ty Hopkins, Matthew K. Seeley
2015-06-01
Full Text Available Although obesity is associated with osteoarthritis, it is unclear whether body weight (BW independently affects articular cartilage catabolism (i.e., independent from physiological factors that also accompany obesity. The primary purpose of this study was to evaluate the independent effect of BW on articular cartilage catabolism associated with walking. A secondary purpose was to determine how decreased BW influenced cardiovascular response due to walking. Twelve able-bodied subjects walked for 30 minutes on a lower-body positive pressure treadmill during three sessions: control (unadjusted BW, +40%BW, and -40%BW. Serum cartilage oligomeric matrix protein (COMP was measured immediately before (baseline and after, and 15 and 30 minutes after the walk. Heart rate (HR and rate of perceived exertion (RPE were measured every three minutes during the walk. Relative to baseline, average serum COMP concentration was 13% and 5% greater immediately after and 15 minutes after the walk. Immediately after the walk, serum COMP concentration was 14% greater for the +40%BW session than for the -40%BW session. HR and RPE were greater for the +40%BW session than for the other two sessions, but did not differ between the control and -40%BW sessions. BW independently influences acute articular cartilage catabolism and cardiovascular response due to walking: as BW increases, so does acute articular cartilage catabolism and cardiovascular response. These results indicate that lower-body positive pressure walking may benefit certain individuals by reducing acute articular cartilage catabolism, due to walking, while maintaining cardiovascular response.
Autologous chondrocyte implantation: superior biologic properties of hyaline cartilage repairs.
Henderson, Ian; Lavigne, Patrick; Valenzuela, Herminio; Oakes, Barry
2007-02-01
Information regarding the quality of autologous chondrocyte implantation repair is needed to determine whether the current autologous chondrocyte implantation surgical technology and the subsequent biologic repair processes are capable of reliably forming durable hyaline or hyaline-like cartilage in vivo. We report and analyze the properties and qualities of autologous chondrocyte implantation repairs. We evaluated 66 autologous chondrocyte implantation repairs in 57 patients, 55 of whom had histology, indentometry, and International Cartilage Repair Society repair scoring at reoperation for mechanical symptoms or pain. International Knee Documentation Committee scores were used to address clinical outcome. Maximum stiffness, normalized stiffness, and International Cartilage Repair Society repair scoring were higher for hyaline articular cartilage repairs compared with fibrocartilage, with no difference in clinical outcome. Reoperations revealed 32 macroscopically abnormal repairs (Group B) and 23 knees with normal-looking repairs in which symptoms leading to arthroscopy were accounted for by other joint disorders (Group A). In Group A, 65% of repairs were either hyaline or hyaline-like cartilage compared with 28% in Group B. Autologous chondrocyte repairs composed of fibrocartilage showed more morphologic abnormalities and became symptomatic earlier than hyaline or hyaline-like cartilage repairs. The hyaline articular cartilage repairs had biomechanical properties comparable to surrounding cartilage and superior to those associated with fibrocartilage repairs.
Chondroma of the cricoid cartilage
Directory of Open Access Journals (Sweden)
Melo, Giulianno Molina de
2008-12-01
Full Text Available Introduction: The larynx cartilaginous tumors are uncommon and comprise 1% of all cartilaginous tumors. The chondroma is the most common benign tumor affecting the larynx cricoid cartilage (75%, and manifests normally in the male gender with dysphonia, progressive dyspnea and dysphagy in some cases. Objective: The objective of this study is to report a case of cricoid cartilage chondroma, in a patient with the symptom of a nodular lesion in the frontal cervical region of slow and progressive growth. Case Report: The treatment was the modified partial laryngectomy with resection of the lower hemisegment of the thyroid cartilage, cricoid hemicartilage and the first tracheal ring with free margins and reconstruction with a pericondrium and muscular prethyroidean piece. The anatomopathological exam showed a chondroma of 1.1 cm, of atypical low cellularity and low figures of mitosis in the frontal region of the cricoid cartilage. Conclusion: In this report we agreed with the literature for the primarily extensive surgical treatment depending on the location and the size of the cricoid chondroma; however, other modalities of treatment may be adopted in cases where the tumor extension appoints a total laryngectomy or when this is not possible to carry out, aiming at the preservation of the larynx. For the suitable treatment of cricoid chondromas, the understanding of the disease natural evolution and more case reports are still necessary.
Directory of Open Access Journals (Sweden)
Shuhua Zhan
Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.
Materials science: Like cartilage, but simpler
DEFF Research Database (Denmark)
Skov, Anne Ladegaard
2015-01-01
The properties of articular cartilage, which lines bones in joints, depend partlyon repulsion between components of the material. A new synthetic gel that mimics this feature has rare, direction-dependent properties.......The properties of articular cartilage, which lines bones in joints, depend partlyon repulsion between components of the material. A new synthetic gel that mimics this feature has rare, direction-dependent properties....
Directory of Open Access Journals (Sweden)
Feng Ding
Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.
Articular cartilage: from formation to tissue engineering.
Camarero-Espinosa, Sandra; Rothen-Rutishauser, Barbara; Foster, E Johan; Weder, Christoph
2016-05-26
Hyaline cartilage is the nonlinear, inhomogeneous, anisotropic, poro-viscoelastic connective tissue that serves as friction-reducing and load-bearing cushion in synovial joints and is vital for mammalian skeletal movements. Due to its avascular nature, low cell density, low proliferative activity and the tendency of chondrocytes to de-differentiate, cartilage cannot regenerate after injury, wear and tear, or degeneration through common diseases such as osteoarthritis. Therefore severe damage usually requires surgical intervention. Current clinical strategies to generate new tissue include debridement, microfracture, autologous chondrocyte transplantation, and mosaicplasty. While articular cartilage was predicted to be one of the first tissues to be successfully engineered, it proved to be challenging to reproduce the complex architecture and biomechanical properties of the native tissue. Despite significant research efforts, only a limited number of studies have evolved up to the clinical trial stage. This review article summarizes the current state of cartilage tissue engineering in the context of relevant biological aspects, such as the formation and growth of hyaline cartilage, its composition, structure and biomechanical properties. Special attention is given to materials development, scaffold designs, fabrication methods, and template-cell interactions, which are of great importance to the structure and functionality of the engineered tissue.
Directory of Open Access Journals (Sweden)
S Munirah
2008-02-01
Full Text Available Our preliminary results indicated that fibrin and poly(lactic-co-glycolic acid (PLGA hybrid scaffold promoted early chondrogenesis of articular cartilage constructs in vitro. The aim of this study was to evaluate in vivo cartilaginous tissue formation by chondrocyte-seeded fibrin/PLGA hybrid scaffolds. PLGA scaffolds were soaked carefully, in chondrocyte-fibrin suspension, and polymerized by dropping thrombin-calcium chloride (CaCl2 solution. PLGA-seeded chondrocytes were used as a control. Resulting constructs were implanted subcutaneously, at the dorsum of nude mice, for 4 weeks. Macroscopic observation, histological evaluation, gene expression and sulphated-glycosaminoglycan (sGAG analyses were performed at each time point of 1, 2 and 4 weeks post-implantation. Cartilaginous tissue formation in fibrin/PLGA hybrid construct was confirmed by the presence of lacunae and cartilage-isolated cells embedded within basophilic ground substance. Presence of proteoglycan and glycosaminoglycan (GAG in fibrin/PLGA hybrid constructs was confirmed by positive Safranin O and Alcian Blue staining. Collagen type II exhibited intense immunopositivity at the pericellular matrices. Chondrogenic properties were further demonstrated by the expression of gene encoded cartilage-specific markers, collagen type II and aggrecan core protein. The sGAG production in fibrin/PLGA hybrid constructs was higher than in the PLGA group. In conclusion, fibrin/PLGA hybrid scaffold promotes cartilaginous tissue formation in vivo and may serve as a potential cell delivery vehicle and a structural basis for articular cartilage tissue-engineering.
Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon
2017-07-03
Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.
Tsuchida, Anika I.; Beekhuizen, Michiel; Rutgers, Marijn; van Osch, Gerjo J.V.M.; Bekkers, Joris E.J.; Bot, Arjan G.J.; Geurts, Bernd; Dhert, Wouter J.A.; Saris, Daniël B.F.; Creemers, Laura B.
2012-01-01
Introduction This study aimed to determine whether, as in osteoarthritis, increased levels of interleukin-6 (IL-6) are present in the synovial fluid of patients with symptomatic cartilage defects and whether this IL-6 affects cartilage regeneration as well as the cartilage in the degenerated knee.
International Nuclear Information System (INIS)
Holstein, Arne; Zilkens, Christoph; Bittersohl, Bernd
2011-01-01
The purpose of the present study was to evaluate the feasibility of delayed gadolinium-enhanced magnetic resonance imaging of cartilage (dGEMRIC) in the detection of cartilage changes versus morphologic imaging in the long-term course of Legg–Calvé–Perthes disease (LCPD). A total of 31 hips in 26 patients (mean age, 30.0 years; range, 18–54 years) who were diagnosed with LCPD in childhood were included. Twenty-one radiographically normal contralateral hips served as controls. dGEMRIC indices of femoral and acetabular cartilage in the weight-bearing zone. Cartilage morphology was classified on radial PD-weighted images according to the modified Outerbridge classification. Mean dGEMRIC values of cartilage were significantly lower in hips after LCPD than in the radiographically normal contralateral hips (513 ± 100 ms vs. 579 ± 103 ms; P = 0.026). In 24 out of 31 LCPD hips and in 4 out of 21 radiographically normal contralateral hips, morphological cartilage changes were noted. Analysis of variance analysis revealed a significant influence of Outerbridge grading on decreased T1-values (P = 0.031). Our results suggest that dGEMRIC at 1.5 T is suitable to assess cartilage quality changes in the long-term follow-up after LCPD. The evaluation of biochemical cartilage quality with dGEMRIC may provide additional information about early cartilage changes occurring without visible alterations of cartilage morphology.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Strategic Design and Fabrication of Engineered Scaffolds for Articular Cartilage Repair
Izadifar, Zohreh; Chen, Xiongbiao; Kulyk, William
2012-01-01
Damage to articular cartilage can eventually lead to osteoarthritis (OA), a debilitating, degenerative joint disease that affects millions of people around the world. The limited natural healing ability of cartilage and the limitations of currently available therapies make treatment of cartilage defects a challenging clinical issue. Hopes have been raised for the repair of articular cartilage with the help of supportive structures, called scaffolds, created through tissue engineering (TE). Over the past two decades, different designs and fabrication techniques have been investigated for developing TE scaffolds suitable for the construction of transplantable artificial cartilage tissue substitutes. Advances in fabrication technologies now enable the strategic design of scaffolds with complex, biomimetic structures and properties. In particular, scaffolds with hybrid and/or biomimetic zonal designs have recently been developed for cartilage tissue engineering applications. This paper reviews critical aspects of the design of engineered scaffolds for articular cartilage repair as well as the available advanced fabrication techniques. In addition, recent studies on the design of hybrid and zonal scaffolds for use in cartilage tissue repair are highlighted. PMID:24955748
Lin, Yang; Lewallen, Eric A.; Camilleri, Emily T.; Bonin, Carolina A.; Jones, Dakota L.; Dudakovic, Amel; Galeano-Garces, Catalina; Wang, Wei; Karperien, Marcel J.; Larson, Annalise N.; Dahm, Diane L.; Stuart, Michael J.; Levy, Bruce A.; Smith, Jay; Ryssman, Daniel B.; Westendorf, Jennifer J.; Im, Hee-Jeong; van Wijnen, Andre J.; Riester, Scott M.; Krych, Aaron J.
2016-01-01
Preservation of osteochondral allografts used for transplantation is critical to ensure favorable outcomes for patients after surgical treatment of cartilage defects. To study the biological effects of protocols currently used for cartilage storage, we investigated differences in gene expression
Sagittal-Plane Knee Moment During Gait and Knee Cartilage Thickness.
Schmitz, Randy J; Harrison, David; Wang, Hsin-Min; Shultz, Sandra J
2017-06-02
Understanding the factors associated with thicker cartilage in a healthy population is important when developing strategies aimed at minimizing the cartilage thinning associated with knee osteoarthritis progression. Thicker articular cartilage is commonly thought to be healthier cartilage, but whether the sagittal-plane biomechanics important to gait are related to cartilage thickness is unknown. To determine the relationship of a weight-bearing region of the medial femoral condyle's cartilage thickness to sagittal gait biomechanics in healthy individuals. Descriptive laboratory study. Laboratory. Twenty-eight healthy participants (15 women: age = 21.1 ± 2.1 years, height = 1.63 ± 0.07 m, weight = 64.6 ± 9.9 kg; 13 men: age = 22.1 ± 2.9 years, height = 1.79 ± 0.05 m, weight = 75.2 ± 9.6 kg). Tibiofemoral angle (°) was obtained via goniometric assessment, thickness of the medial femoral condyle cartilage (mm) was obtained via ultrasound imaging, and peak internal knee-extensor moment (% body weight · height) was measured during 10 trials of over-ground walking at a self-selected pace. We used linear regression to examine the extent to which peak internal knee-extensor moment predicted cartilage thickness after accounting for tibiofemoral angle and sex. Sex and tibiofemoral angle (12.3° ± 3.2°) were entered in the initial step as control factors (R 2 = 0.01, P = .872). In the final step, internal knee-extensor moment (1.5% ± 1.3% body weight · height) was entered, which resulted in greater knee-extensor moment being related to greater cartilage thickness (2.0 ± 0.3 mm; R 2 Δ = 0.31, PΔ = .003). Individuals who walked with a greater peak internal knee-extensor moment during gait had a cartilage structure that is generally considered beneficial in a healthy population. Our study offers promising findings that a potentially modifiable biomechanical factor is associated with cartilage status in a healthy population
Developmental transcriptome of Aplysia californica'
Heyland, Andreas
2010-12-06
Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.
Nd:YAG 1.44 laser ablation of human cartilage
Cummings, Robert S.; Prodoehl, John A.; Rhodes, Anthony L.; Black, Johnathan D.; Sherk, Henry H.
1993-07-01
This study determined the effectiveness of a Neodymium:YAG 1.44 micrometers wavelength laser on human cartilage. This wavelength is strongly absorbed by water. Cadaveric meniscal fibrocartilage and articular hyaline cartilage were harvested and placed in normal saline during the study. A 600 micrometers quartz fiber was applied perpendicularly to the tissues with a force of 0.098 N. Quantitative measurements were then made of the ablation rate as a function of fluence. The laser energy was delivered at a constant repetition rate of 5 Hz., 650 microsecond(s) pulsewidth, and energy levels ranging from 0.5 joules to 2.0 joules. Following the ablation of the tissue, the specimens were fixed in formalin for histologic evaluation. The results of the study indicate that the ablation rate is 0.03 mm/mj/mm2 for hyaline cartilage and fibrocartilage. Fibrocartilage was cut at approximately the same rate as hyaline cartilage. There was a threshold fluence projected to be 987 mj/mm2 for hyaline cartilage and fibrocartilage. Our results indicate that the pulsed Nd:YAG laser operating at 1.44 micrometers has a threshold fluence above which it will ablate human cartilage, and that its ablation rate is directly proportional to fluence over the range of parameters tested. Fibrocartilage and hyaline cartilage demonstrated similar threshold fluence and ablation rates which is related to the high water content of these tissues.
Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.
2012-01-01
Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.
Experimental Influences in the Accurate Measurement of Cartilage Thickness in MRI.
Wang, Nian; Badar, Farid; Xia, Yang
2018-01-01
Objective To study the experimental influences to the measurement of cartilage thickness by magnetic resonance imaging (MRI). Design The complete thicknesses of healthy and trypsin-degraded cartilage were measured at high-resolution MRI under different conditions, using two intensity-based imaging sequences (ultra-short echo [UTE] and multislice-multiecho [MSME]) and 3 quantitative relaxation imaging sequences (T 1 , T 2 , and T 1 ρ). Other variables included different orientations in the magnet, 2 soaking solutions (saline and phosphate buffered saline [PBS]), and external loading. Results With cartilage soaked in saline, UTE and T 1 methods yielded complete and consistent measurement of cartilage thickness, while the thickness measurement by T 2 , T 1 ρ, and MSME methods were orientation dependent. The effect of external loading on cartilage thickness is also sequence and orientation dependent. All variations in cartilage thickness in MRI could be eliminated with the use of a 100 mM PBS or imaged by UTE sequence. Conclusions The appearance of articular cartilage and the measurement accuracy of cartilage thickness in MRI can be influenced by a number of experimental factors in ex vivo MRI, from the use of various pulse sequences and soaking solutions to the health of the tissue. T 2 -based imaging sequence, both proton-intensity sequence and quantitative relaxation sequence, similarly produced the largest variations. With adequate resolution, the accurate measurement of whole cartilage tissue in clinical MRI could be utilized to detect differences between healthy and osteoarthritic cartilage after compression.
Assessment of hyaline cartilage matrix composition using near infrared spectroscopy.
Palukuru, Uday P; McGoverin, Cushla M; Pleshko, Nancy
2014-09-01
Changes in the composition of the extracellular matrix (ECM) are characteristic of injury or disease in cartilage tissue. Various imaging modalities and biochemical techniques have been used to assess the changes in cartilage tissue but lack adequate sensitivity, or in the case of biochemical techniques, result in destruction of the sample. Fourier transform near infrared (FT-NIR) spectroscopy has shown promise for the study of cartilage composition. In the current study NIR spectroscopy was used to identify the contributions of individual components of cartilage in the NIR spectra by assessment of the major cartilage components, collagen and chondroitin sulfate, in pure component mixtures. The NIR spectra were obtained using homogenous pellets made by dilution with potassium bromide. A partial least squares (PLS) model was calculated to predict composition in bovine cartilage samples. Characteristic absorbance peaks between 4000 and 5000 cm(-1) could be attributed to components of cartilage, i.e. collagen and chondroitin sulfate. Prediction of the amount of collagen and chondroitin sulfate in tissues was possible within 8% (w/dw) of values obtained by gold standard biochemical assessment. These results support the use of NIR spectroscopy for in vitro and in vivo applications to assess matrix composition of cartilage tissues, especially when tissue destruction should be avoided. Copyright © 2014. Published by Elsevier B.V.
Benjamin, M
1989-01-01
The development of hyaline-cell cartilage attached to membrane (dentary, maxilla, nasal, lacrimal and cleithrum) and cartilage (basioccipital) bones has been studied in the viviparous black molly, Poecilia sphenops. Intramembranous ossification commences before the first appearance of hyaline cells. As hyaline-cell cartilage is densely cellular and as that attached to the dentary, maxilla and cleithrum develops from the periosteum of these membrane bones, it must be regarded as secondary cart...
A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.
Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis
2014-09-01
A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of
Hirose, Jun; Ryan, Lawrence M; Masuda, Ikuko
2002-12-01
Excess accumulation of extracellular inorganic pyrophosphate (ePPi) in aged human cartilage is crucial in calcium pyrophosphate dihydrate (CPPD) crystal formation in cartilage matrix. Two sources of ePPi are ePPi-generating ectoenzymes (NTPPPH) and extracellular transport of intracellular PPi by ANK. This study was undertaken to evaluate the role of NTPPPH and ANK in ePPi elaboration, by investigating expression of NTPPPH enzymes (cartilage intermediate-layer protein [CILP] and plasma cell membrane glycoprotein 1 [PC-1]) and ANK in human chondrocytes from osteoarthritic (OA) articular cartilage containing CPPD crystals and without crystals. Chondrocytes were harvested from knee cartilage at the time of arthroplasty (OA with CPPD crystals [CPPD], n = 8; OA without crystals [OA], n = 10). Normal adult human chondrocytes (n = 1) were used as a control. Chondrocytes were cultured with transforming growth factor beta1 (TGFbeta1), which stimulates ePPi elaboration, and/or insulin-like growth factor 1 (IGF-1), which inhibits ePPi elaboration. NTPPPH and ePPi were measured in the media at 48 hours. Media CILP, PC-1, and ANK were determined by dot-immunoblot analysis. Chondrocyte messenger RNA (mRNA) was extracted for reverse transcriptase-polymerase chain reaction to study expression of mRNA for CILP, PC-1, and ANK. NTPPPH and ANK mRNA and protein were also studied in fresh frozen cartilage. Basal ePPi elaboration and NTPPPH activity in conditioned media from CPPD chondrocytes were elevated compared with normal chondrocytes, and tended to be higher compared with OA chondrocytes. Basal expression of mRNA for CILP (chondrocytes) and ANK (cartilage) was higher in both CPPD chondrocytes and CPPD cartilage extract than in OA or normal samples. PC-1 mRNA was less abundant in CPPD chondrocytes and cartilage extract than in OA chondrocytes and extract, although the difference was not significant. CILP, PC-1, and ANK protein levels were similar in CPPD, OA, and normal chondrocytes
Directory of Open Access Journals (Sweden)
Peter A. Bell
2013-06-01
Pseudoachondroplasia and multiple epiphyseal dysplasia are genetic skeletal diseases resulting from mutations in cartilage structural proteins. Electron microscopy and immunohistochemistry previously showed that the appearance of the cartilage extracellular matrix (ECM in targeted mouse models of these diseases is disrupted; however, the precise changes in ECM organization and the pathological consequences remain unknown. Our aim was to determine the effects of matrilin-3 and COMP mutations on the composition and extractability of ECM components to inform how these detrimental changes might influence cartilage organization and degeneration. Cartilage was sequentially extracted using increasing denaturants and the extraction profiles of specific proteins determined using SDS-PAGE/Western blotting. Furthermore, the relative composition of protein pools was determined using mass spectrometry for a non-biased semi-quantitative analysis. Western blotting revealed changes in the extraction of matrilins, COMP and collagen IX in mutant cartilage. Mass spectrometry confirmed quantitative changes in the extraction of structural and non-structural ECM proteins, including proteins with roles in cellular processes such as protein folding and trafficking. In particular, genotype-specific differences in the extraction of collagens XII and XIV and tenascins C and X were identified; interestingly, increased expression of several of these genes has recently been implicated in susceptibility and/or progression of murine osteoarthritis. We demonstrated that mutation of matrilin-3 and COMP caused changes in the extractability of other cartilage proteins and that proteomic analyses of Matn3 V194D, Comp T585M and Comp DelD469 mouse models revealed both common and discrete disease signatures that provide novel insight into skeletal disease mechanisms and cartilage degradation.
Radiation synovectomy stimulates glycosaminoglycan synthesis by normal articular cartilage
Energy Technology Data Exchange (ETDEWEB)
Myers, S.L.; Slowman, S.D.; Brandt, K.D.
1989-07-01
Radiation synovectomy has been considered a therapeutic alternative to surgical synovectomy. Whether intraarticular irradiation affects the composition or biochemistry, and therefore the biomechanical properties, of normal articular cartilage has not been established. In the present study, yttrium 90 silicate was injected into one knee of nine normal adult dogs, and three other dogs received nonradioactive yttrium silicate. When the animals were killed 4 to 13 weeks after the injection, synovium from the irradiated knees showed areas of necrosis and fibrosis. Up to 29% less hyaluronate was synthesized in vitro by the synovial intima from irradiated knees than by the intima from the contralateral knees (mean difference 18%). Morphologic abnormalities were not observed in articular cartilage from either the irradiated or control knees, nor did the water content or concentrations of uronic acid or DNA in cartilage from the irradiated knees differ from that in cartilage from the contralateral knees. However, net /sup 35/SO/sub 4/-labeled glycosaminoglycan synthesis in organ cultures of cartilage from irradiated knees was increased (mean difference 21%, p = 0.03) in comparison with that in cultures of contralateral knee cartilage.
Quantitative imaging of excised osteoarthritic cartilage using spectral CT
Energy Technology Data Exchange (ETDEWEB)
Rajendran, Kishore; Bateman, Christopher J.; Younis, Raja Aamir; De Ruiter, Niels J.A.; Ramyar, Mohsen; Anderson, Nigel G. [University of Otago - Christchurch, Department of Radiology, Christchurch (New Zealand); Loebker, Caroline [University of Otago, Christchurch Regenerative Medicine and Tissue Engineering Group, Department of Orthopaedic Surgery and Musculoskeletal Medicine, Christchurch (New Zealand); University of Twente, Department of Developmental BioEngineering, Enschede (Netherlands); Schon, Benjamin S.; Hooper, Gary J.; Woodfield, Tim B.F. [University of Otago, Christchurch Regenerative Medicine and Tissue Engineering Group, Department of Orthopaedic Surgery and Musculoskeletal Medicine, Christchurch (New Zealand); Chernoglazov, Alex I. [University of Canterbury, Human Interface Technology Laboratory New Zealand, Christchurch (New Zealand); Butler, Anthony P.H. [University of Otago - Christchurch, Department of Radiology, Christchurch (New Zealand); European Organisation for Nuclear Research (CERN), Geneva (Switzerland); MARS Bioimaging, Christchurch (New Zealand)
2017-01-15
To quantify iodine uptake in articular cartilage as a marker of glycosaminoglycan (GAG) content using multi-energy spectral CT. We incubated a 25-mm strip of excised osteoarthritic human tibial plateau in 50 % ionic iodine contrast and imaged it using a small-animal spectral scanner with a cadmium telluride photon-processing detector to quantify the iodine through the thickness of the articular cartilage. We imaged both spectroscopic phantoms and osteoarthritic tibial plateau samples. The iodine distribution as an inverse marker of GAG content was presented in the form of 2D and 3D images after applying a basis material decomposition technique to separate iodine in cartilage from bone. We compared this result with a histological section stained for GAG. The iodine in cartilage could be distinguished from subchondral bone and quantified using multi-energy CT. The articular cartilage showed variation in iodine concentration throughout its thickness which appeared to be inversely related to GAG distribution observed in histological sections. Multi-energy CT can quantify ionic iodine contrast (as a marker of GAG content) within articular cartilage and distinguish it from bone by exploiting the energy-specific attenuation profiles of the associated materials. (orig.)
Mesenchymal Stem Cells for Cartilage Regeneration of TMJ Osteoarthritis
Directory of Open Access Journals (Sweden)
Dixin Cui
2017-01-01
Full Text Available Temporomandibular joint osteoarthritis (TMJ OA is a degenerative disease, characterized by progressive cartilage degradation, subchondral bone remodeling, synovitis, and chronic pain. Due to the limited self-healing capacity in condylar cartilage, traditional clinical treatments have limited symptom-modifying and structure-modifying effects to restore impaired cartilage as well as other TMJ tissues. In recent years, stem cell-based therapy has raised much attention as an alternative approach towards tissue repair and regeneration. Mesenchymal stem cells (MSCs, derived from the bone marrow, synovium, and even umbilical cord, play a role as seed cells for the cartilage regeneration of TMJ OA. MSCs possess multilineage differentiation potential, including chondrogenic differentiation as well as osteogenic differentiation. In addition, the trophic modulations of MSCs exert anti-inflammatory and immunomodulatory effects under aberrant conditions. Furthermore, MSCs combined with appropriate scaffolds can form cartilaginous or even osseous compartments to repair damaged tissue and impaired function of TMJ. In this review, we will briefly discuss the pathogenesis of cartilage degeneration in TMJ OA and emphasize the potential sources of MSCs and novel approaches for the cartilage regeneration of TMJ OA, particularly focusing on the MSC-based therapy and tissue engineering.
MRI demonstration of hypertrophic articular cartilage repair in osteoarthritis
International Nuclear Information System (INIS)
Braunstein, E.M.; Brandt, K.D.; Albrecht, M.
1990-01-01
Transection of the anterior cruciate ligament in the dog produces changes in the unstable joint typical of osteoarthritis, although full-thickness catilage ulceration is rare. Information concerning the late fate of the cartilage after transection is meager. In the present study magnetic resonance imaging (MRI) was used to evaluate cartilage abnormalities 3 years after transection. Plain radiographs of the osteoarthritic and contralateral knees were obtained serially. MRI was performed 3 years after anterior cruciate ligament transection, at which time all three animals exhibited knee instability. Radiographs of the osteoarthritic knees showed osteophytes and subchondral sclerosis with progression between 2 and 3 years. On MRI, articular cartilage margins in the knee were indistinct, and the cartilage was thicker than that in the contralateral knee (maximum difference = 2.7 mm). This increase in thickness is consistent with biochemical data from dogs killed up to 64 weeks after creation of knee instability, which showed marked increases in cartilage bulk and in proteoglycan synthesis and concentration. The findings emphasize that increased matrix synthesis after anterior cruciate ligament transection leads to functional cartilage repair sustained even in the presence of persistent alteration of joint mechanics. (orig.)
Christensen, Bjørn Borsøe; Olesen, Morten Lykke; Lind, Martin; Foldager, Casper Bindzus
2017-06-01
Repair of chondral injuries by use of cartilage chips has recently demonstrated clinical feasibility. To investigate in vivo cartilage repair outcome of autologous cartilage chips compared with marrow stimulation in full-thickness cartilage defects in a minipig model. Controlled laboratory study. Six Göttingen minipigs received two 6-mm chondral defects in the medial and lateral trochlea of each knee. The two treatment groups were (1) autologous cartilage chips embedded in fibrin glue (ACC) (n = 12) and (2) marrow stimulation (MST) (n = 12). The animals were euthanized after 6 months, and the composition of repair tissue was quantitatively determined using histomorphometry. Semiquantitative evaluation was performed by means of the International Cartilage Repair Society (ICRS) II score. Collagen type II staining was used to further evaluate the repair tissue composition. Significantly more hyaline cartilage was found in the ACC (17.1%) compared with MST (2.9%) group ( P cartilage repair tissue compared with MST at 6 months postoperatively. Further studies are needed to investigate ACC as a possible alternative first-line treatment for focal cartilage injuries in the knee.
Buckland, J.; Leijten, Jeroen Christianus Hermanus; van Blitterswijk, Clemens; Karperien, Hermanus Bernardus Johannes
2012-01-01
Disruption of articular cartilage homeostasis is important in osteoarthritis (OA) pathogenesis, key to which is activation of articular chondrocyte hypertrophic differentiation. Healthy articular cartilage is resistant to hypertrophic differentiation, whereas growth-plate cartilage is destined to
Xiphoid Process-Derived Chondrocytes: A Novel Cell Source for Elastic Cartilage Regeneration
Nam, Seungwoo; Cho, Wheemoon; Cho, Hyunji; Lee, Jungsun
2014-01-01
Reconstruction of elastic cartilage requires a source of chondrocytes that display a reliable differentiation tendency. Predetermined tissue progenitor cells are ideal candidates for meeting this need; however, it is difficult to obtain donor elastic cartilage tissue because most elastic cartilage serves important functions or forms external structures, making these tissues indispensable. We found vestigial cartilage tissue in xiphoid processes and characterized it as hyaline cartilage in the proximal region and elastic cartilage in the distal region. Xiphoid process-derived chondrocytes (XCs) showed superb in vitro expansion ability based on colony-forming unit fibroblast assays, cell yield, and cumulative cell growth. On induction of differentiation into mesenchymal lineages, XCs showed a strong tendency toward chondrogenic differentiation. An examination of the tissue-specific regeneration capacity of XCs in a subcutaneous-transplantation model and autologous chondrocyte implantation model confirmed reliable regeneration of elastic cartilage regardless of the implantation environment. On the basis of these observations, we conclude that xiphoid process cartilage, the only elastic cartilage tissue source that can be obtained without destroying external shape or function, is a source of elastic chondrocytes that show superb in vitro expansion and reliable differentiation capacity. These findings indicate that XCs could be a valuable cell source for reconstruction of elastic cartilage. PMID:25205841
Mechanical stimulation of mesenchymal stem cells: Implications for cartilage tissue engineering.
Fahy, Niamh; Alini, Mauro; Stoddart, Martin J
2018-01-01
Articular cartilage is a load-bearing tissue playing a crucial mechanical role in diarthrodial joints, facilitating joint articulation, and minimizing wear. The significance of biomechanical stimuli in the development of cartilage and maintenance of chondrocyte phenotype in adult tissues has been well documented. Furthermore, dysregulated loading is associated with cartilage pathology highlighting the importance of mechanical cues in cartilage homeostasis. The repair of damaged articular cartilage resulting from trauma or degenerative joint disease poses a major challenge due to a low intrinsic capacity of cartilage for self-renewal, attributable to its avascular nature. Bone marrow-derived mesenchymal stem cells (MSCs) are considered a promising cell type for cartilage replacement strategies due to their chondrogenic differentiation potential. Chondrogenesis of MSCs is influenced not only by biological factors but also by the environment itself, and various efforts to date have focused on harnessing biomechanics to enhance chondrogenic differentiation of MSCs. Furthermore, recapitulating mechanical cues associated with cartilage development and homeostasis in vivo, may facilitate the development of a cellular phenotype resembling native articular cartilage. The goal of this review is to summarize current literature examining the effect of mechanical cues on cartilage homeostasis, disease, and MSC chondrogenesis. The role of biological factors produced by MSCs in response to mechanical loading will also be examined. An in-depth understanding of the impact of mechanical stimulation on the chondrogenic differentiation of MSCs in terms of endogenous bioactive factor production and signaling pathways involved, may identify therapeutic targets and facilitate the development of more robust strategies for cartilage replacement using MSCs. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:52-63, 2018. © 2017 Orthopaedic Research
Sykes, J G; Kuiper, J H; Richardson, J B; Roberts, S; Wright, K T; Kuiper, N J
2018-05-01
High hopes have been pinned on regenerative medicine strategies in order to prevent the progression of cartilage damage to osteoarthritis, particularly by autologous chondrocyte implantation (ACI). The loss of chondrocyte phenotype during in vitro monolayer expansion, a necessary step to obtain sufficient cell numbers, may be a key limitation in ACI. In this study, it was determined whether a shorter monolayer expansion approach could improve chondrogenic differentiation. The effects of two supplement types, foetal bovine serum (FBS) and Stemulate™ (a commercial source of human platelet lysate), on the expansion and re-differentiation potential of human chondrocytes, isolated from five individuals, were compared. Chondrocytes were expanded with 10 % FBS or 10 % Stemulate™. Pellets were cultured for 28 d in chondrogenic differentiation medium and assessed for the presence of cartilage matrix molecules and genes associated with chondrogenicity. Stemulate™ significantly enhanced the proliferation rate [average population doubling times: FBS, 25.07 ± 6.98 d (standard error of the mean, SEM) vs. Stemulate™, 13.10 ± 2.57 d (SEM)]. Sulphated glycosaminoglycans (sGAG), total collagen and qRT-PCR analyses of cartilage genes showed that FBS-expanded chondrocytes demonstrated significantly better chondrogenic capacity than Stemulate™-expanded chondrocytes. Histologically, FBS-expanded chondrocyte pellets appeared to be more stable, with a more intense staining for toluidine blue, indicating a greater chondrogenic capacity. Although Stemulate™ positively influenced chondrocyte proliferation, it had a negative effect on chondrogenic differentiation potential. This suggested that, in the treatment of cartilage defects, Stemulate™ might not be the ideal supplement for expanding chondrocytes (which maintained a chondrocyte phenotype) and, hence, for cell therapies (including ACI).
Directory of Open Access Journals (Sweden)
JG Sykes
2018-05-01
Full Text Available High hopes have been pinned on regenerative medicine strategies in order to prevent the progression of cartilage damage to osteoarthritis, particularly by autologous chondrocyte implantation (ACI. The loss of chondrocyte phenotype during in vitro monolayer expansion, a necessary step to obtain sufficient cell numbers, may be a key limitation in ACI. In this study, it was determined whether a shorter monolayer expansion approach could improve chondrogenic differentiation. The effects of two supplement types, foetal bovine serum (FBS and Stemulate™ (a commercial source of human platelet lysate, on the expansion and re-differentiation potential of human chondrocytes, isolated from five individuals, were compared. Chondrocytes were expanded with 10 % FBS or 10 % Stemulate™. Pellets were cultured for 28 d in chondrogenic differentiation medium and assessed for the presence of cartilage matrix molecules and genes associated with chondrogenicity. Stemulate™ significantly enhanced the proliferation rate [average population doubling times: FBS, 25.07 ± 6.98 d (standard error of the mean, SEM vs. Stemulate™, 13.10 ± 2.57 d (SEM]. Sulphated glycosaminoglycans (sGAG, total collagen and qRT-PCR analyses of cartilage genes showed that FBS-expanded chondrocytes demonstrated significantly better chondrogenic capacity than Stemulate™-expanded chondrocytes. Histologically, FBS-expanded chondrocyte pellets appeared to be more stable, with a more intense staining for toluidine blue, indicating a greater chondrogenic capacity. Although Stemulate™ positively influenced chondrocyte proliferation, it had a negative effect on chondrogenic differentiation potential. This suggested that, in the treatment of cartilage defects, Stemulate™ might not be the ideal supplement for expanding chondrocytes (which maintained a chondrocyte phenotype and, hence, for cell therapies (including ACI.
Jonasson, Kristin A; Russell, Anthony P; Vickaryous, Matthew K
2012-06-01
The persistence of the notochord into the skeletally mature life stage is characteristic of gekkotans, but is otherwise of rare occurrence among amniotes. The taxonomic diversity of Gekkota affords the opportunity to investigate the structure and development of this phylogenetically ancestral component of the skeleton, and to determine its basic characteristics. The gekkotan notochord spans almost the entire postcranial long axis and is characterized by a moniliform morphology with regularly alternating zones of chordoid and chondroid tissue. Chordoid tissue persists in the region of intervertebral articulations and occupies the cavitations that lie between the centra of the amphicoelous vertebrae. Chondroid tissue is restricted to zones in which the diameter of the notochord is reduced, corresponding to mid-vertebral locations. In the tail, these zones of chondroid tissue are associated with the autotomic fracture planes. Chondroid tissue first manifests during late embryogenesis, appears to differentiate from pre-existing chordoid tissue, and has the histological and histochemical characteristics of cartilage. Our observations lend support to the hypothesis that cartilage can be derived directly from notochordal tissue, and suggest that the latter may be an evolutionary and developmental precursor to chordate cartilage. The persistence of chordoid tissue in the intervertebral regions of amphicoelous vertebrae is consistent with a suite of paedomorphic traits exhibited by gekkotans and suggests that the typical hydrostatic nature of notochordal tissue may play a role in mechanically governing patterns of displacement between adjacent amphicoelous vertebrae that lack extensive centrum-to-centrum contact. Copyright © 2012 Wiley Periodicals, Inc.
Kang, Chang Ho; Kim, Hee Kyung; Shiraj, Sahar; Anton, Christopher; Kim, Dong Hoon; Horn, Paul S
2016-07-01
Patellofemoral instability is one of the most common causes of cartilage damage in teenagers. To quantitatively evaluate the patellar cartilage in patients with patellofemoral instability using T2 relaxation time maps (T2 maps), compare the values to those in patients without patellofemoral instability and correlate them with morphological grades in patients with patellofemoral instability. Fifty-three patients with patellofemoral instability (mean age: 15.9 ± 2.4 years) and 53 age- and gender-matched patients without patellofemoral instability were included. Knee MR with axial T2 map was performed. Mean T2 relaxation times were obtained at the medial, central and lateral zones of the patellar cartilage and compared between the two groups. In the patellofemoral instability group, morphological grading of the patellar cartilage (0-4) was performed and correlated with T2 relaxation times. Mean T2 relaxation times were significantly longer in the group with patellofemoral instability as compared to those of the control group across the patellar cartilage (Student's t-test, Ppatellofemoral instability, patellar cartilage damage occurs across the entire cartilage with the highest T2 values at the apex. T2 relaxation times directly reflect the severity in low-grade cartilage damage, which implies an important role for T2 maps in differentiating between normal and low-grade cartilage damage.
Wavelength-dependent penetration depth of near infrared radiation into cartilage.
Padalkar, M V; Pleshko, N
2015-04-07
Articular cartilage is a hyaline cartilage that lines the subchondral bone in the diarthrodial joints. Near infrared (NIR) spectroscopy is emerging as a nondestructive modality for the evaluation of cartilage pathology; however, studies regarding the depth of penetration of NIR radiation into cartilage are lacking. The average thickness of human cartilage is about 1-3 mm, and it becomes even thinner as OA progresses. To ensure that spectral data collected is restricted to the tissue of interest, i.e. cartilage in this case, and not from the underlying subchondral bone, it is necessary to determine the depth of penetration of NIR radiation in different wavelength (frequency) regions. In the current study, we establish how the depth of penetration varies throughout the NIR frequency range (4000-10 000 cm(-1)). NIR spectra were collected from cartilage samples of different thicknesses (0.5 mm to 5 mm) with and without polystyrene placed underneath. A separate NIR spectrum of polystyrene was collected as a reference. It was found that the depth of penetration varied from ∼1 mm to 2 mm in the 4000-5100 cm(-1) range, ∼3 mm in the 5100-7000 cm(-1) range, and ∼5 mm in the 7000-9000 cm(-1) frequency range. These findings suggest that the best NIR region to evaluate cartilage with no subchondral bone contribution is in the range of 4000-7000 cm(-1).
Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M
2010-10-01
To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.
Advances in Application of Mechanical Stimuli in Bioreactors for Cartilage Tissue Engineering.
Li, Ke; Zhang, Chunqiu; Qiu, Lulu; Gao, Lilan; Zhang, Xizheng
2017-08-01
Articular cartilage (AC) is the weight-bearing tissue in diarthroses. It lacks the capacity for self-healing once there are injuries or diseases due to its avascularity. With the development of tissue engineering, repairing cartilage defects through transplantation of engineered cartilage that closely matches properties of native cartilage has become a new option for curing cartilage diseases. The main hurdle for clinical application of engineered cartilage is how to develop functional cartilage constructs for mass production in a credible way. Recently, impressive hyaline cartilage that may have the potential to provide capabilities for treating large cartilage lesions in the future has been produced in laboratories. The key to functional cartilage construction in vitro is to identify appropriate mechanical stimuli. First, they should ensure the function of metabolism because mechanical stimuli play the role of blood vessels in the metabolism of AC, for example, acquiring nutrition and removing wastes. Second, they should mimic the movement of synovial joints and produce phenotypically correct tissues to achieve the adaptive development between the micro- and macrostructure and function. In this article, we divide mechanical stimuli into three types according to forces transmitted by different media in bioreactors, namely forces transmitted through the liquid medium, solid medium, or other media, then we review and summarize the research status of bioreactors for cartilage tissue engineering (CTE), mainly focusing on the effects of diverse mechanical stimuli on engineered cartilage. Based on current researches, there are several motion patterns in knee joints; but compression, tension, shear, fluid shear, or hydrostatic pressure each only partially reflects the mechanical condition in vivo. In this study, we propose that rolling-sliding-compression load consists of various stimuli that will represent better mechanical environment in CTE. In addition, engineers
2014-01-01
Background Impaired stability is a risk factor in knee osteoarthritis (OA), where the whole joint and not only the joint cartilage is affected. The meniscus provides joint stability and is involved in the early pathological progress of OA. Delayed gadolinium-enhanced MRI of cartilage (dGEMRIC) has been used to identify pre-radiographic changes in the cartilage in OA, but has been used less commonly to examine the meniscus, and then using only a double dose of the contrast agent. The purpose of this study was to enable improved early OA diagnosis by investigate the temporal contrast agent distribution in the meniscus and femoral cartilage simultaneously, in healthy volunteers, using 3D dGEMRIC at two different doses of the contrast agent Gd-DTPA2-. Methods The right knee in 12 asymptomatic volunteers was examined using a 3D Look-Locker sequence on two occasions after an intravenous injection of a double or triple dose of Gd-DTPA2- (0.2 or 0.3 mmol/kg body weight). The relaxation time (T1) and relaxation rate (R1 = 1/T1) were measured in the meniscus and femoral cartilage before, and 60, 90, 120 and 180 minutes after injection, and the change in relaxation rate (ΔR1) was calculated. Paired t-test and Analysis of Variance (ANOVA) were used for statistical evaluation. Results The triple dose yielded higher concentrations of Gd-DTPA2- in the meniscus and cartilage than the double dose, but provided no additional information. The observed patterns of ΔR1 were similar for double and triple doses of the contrast agent. ΔR1 was higher in the meniscus than in femoral cartilage in the corresponding compartments at all time points after injection. ΔR1 increased until 90-180 minutes in both the cartilage and the meniscus (p meniscus at all time points (p meniscus, than in the avascular central part of the posterior medial meniscus during the first 60 minutes (p meniscus and cartilage simultaneously using dGEMRIC, preferably 90 minutes after the injection of a
Photoactivated methods for enabling cartilage-to-cartilage tissue fixation
Sitterle, Valerie B.; Roberts, David W.
2003-06-01
The present study investigates whether photoactivated attachment of cartilage can provide a viable method for more effective repair of damaged articular surfaces by providing an alternative to sutures, barbs, or fibrin glues for initial fixation. Unlike artificial materials, biological constructs do not possess the initial strength for press-fitting and are instead sutured or pinned in place, typically inducing even more tissue trauma. A possible alternative involves the application of a photosensitive material, which is then photoactivated with a laser source to attach the implant and host tissues together in either a photothermal or photochemical process. The photothermal version of this method shows potential, but has been almost entirely applied to vascularized tissues. Cartilage, however, exhibits several characteristics that produce appreciable differences between applying and refining these techniques when compared to previous efforts involving vascularized tissues. Preliminary investigations involving photochemical photosensitizers based on singlet oxygen and electron transfer mechanisms are discussed, and characterization of the photodynamic effects on bulk collagen gels as a simplified model system using FTIR is performed. Previous efforts using photothermal welding applied to cartilaginous tissues are reviewed.
Hirose, Jun; Nishioka, Hiroaki; Okamoto, Nobukazu; Oniki, Yasunari; Nakamura, Eiichi; Yamashita, Yasuyuki; Usuku, Koichiro; Mizuta, Hiroshi
2013-10-01
Articular cartilage degeneration can develop after anterior cruciate ligament reconstruction (ACLR). Although radiological studies have identified risk factors for the progression of degenerative cartilage changes in the long term, risk factors in the early postoperative period remain to be documented. Cartilage lesions that are present at surgery progress to cartilage degeneration in the early phase after ACLR. Case series; Level of evidence, 4. T1ρ is the spin-lattice relaxation in the rotating frame magnetic resonance imaging. Sagittal T1ρ maps of the femorotibial joint were obtained before and 1 year after ACLR in 23 patients with ACL injuries. Four regions of interest (ROIs) were placed on images of the cartilage in the medial and lateral femoral condyle (MFC, LFC) and the medial and lateral tibia plateau (MTP, LTP). Changes in the T1ρ value (milliseconds) of each ROI were recorded, and differences between patients with and without cartilage lesions were evaluated. The relationship between changes in the T1ρ value and meniscal tears was also studied. Arthroscopy at ACLR detected cartilage lesions in 15 MFCs, 7 LFCs, and 2 LTPs. The baseline T1ρ value of the MFC and LFC was significantly higher in patients with cartilage lesions (MFC, 40.7 ms; LFC, 42.2 ms) than in patients without cartilage lesions (MFC, 38.0 ms, P = .025; LFC, 39.4 ms, P = .010). At 1-year follow-up, the T1ρ value of the MFC and LFC was also significantly higher in patients with lesions (MFC, 43.1 ms; LFC, 42.7 ms) than in patients without such lesions (MFC, 39.1 ms, P = .002; LFC, 40.4 ms, P = .023, respectively). In patients with cartilage injury, the T1ρ value of the MFC increased during the year after treatment (P = .002). There was no significant difference in the baseline and follow-up T1ρ value in patients with or without meniscal tears on each side although the T1ρ value of the MFC, MTP, and LFC increased during the first year after surgery regardless of the presence or
Trisomy 21 and facial developmental instability.
Starbuck, John M; Cole, Theodore M; Reeves, Roger H; Richtsmeier, Joan T
2013-05-01
The most common live-born human aneuploidy is trisomy 21, which causes Down syndrome (DS). Dosage imbalance of genes on chromosome 21 (Hsa21) affects complex gene-regulatory interactions and alters development to produce a wide range of phenotypes, including characteristic facial dysmorphology. Little is known about how trisomy 21 alters craniofacial morphogenesis to create this characteristic appearance. Proponents of the "amplified developmental instability" hypothesis argue that trisomy 21 causes a generalized genetic imbalance that disrupts evolutionarily conserved developmental pathways by decreasing developmental homeostasis and precision throughout development. Based on this model, we test the hypothesis that DS faces exhibit increased developmental instability relative to euploid individuals. Developmental instability was assessed by a statistical analysis of fluctuating asymmetry. We compared the magnitude and patterns of fluctuating asymmetry among siblings using three-dimensional coordinate locations of 20 anatomic landmarks collected from facial surface reconstructions in four age-matched samples ranging from 4 to 12 years: (1) DS individuals (n = 55); (2) biological siblings of DS individuals (n = 55); 3) and 4) two samples of typically developing individuals (n = 55 for each sample), who are euploid siblings and age-matched to the DS individuals and their euploid siblings (samples 1 and 2). Identification in the DS sample of facial prominences exhibiting increased fluctuating asymmetry during facial morphogenesis provides evidence for increased developmental instability in DS faces. We found the highest developmental instability in facial structures derived from the mandibular prominence and lowest in facial regions derived from the frontal prominence. Copyright © 2013 Wiley Periodicals, Inc.
PRP and Articular Cartilage: A Clinical Update
Rossi, Roberto; Castoldi, Filippo; Michielon, Gianni
2015-01-01
The convincing background of the recent studies, investigating the different potentials of platelet-rich plasma, offers the clinician an appealing alternative for the treatment of cartilage lesions and osteoarthritis. Recent evidences in literature have shown that PRP may be helpful both as an adjuvant for surgical treatment of cartilage defects and as a therapeutic tool by intra-articular injection in patients affected by osteoarthritis. In this review, the authors introduce the trophic and anti-inflammatory properties of PRP and the different products of the available platelet concentrates. Then, in a complex scenario made of a great number of clinical variables, they resume the current literature on the PRP applications in cartilage surgery as well as the use of intra-articular PRP injections for the conservative treatment of cartilage degenerative lesions and osteoarthritis in humans, available as both case series and comparative studies. The result of this review confirms the fascinating biological role of PRP, although many aspects yet remain to be clarified and the use of PRP in a clinical setting has to be considered still exploratory. PMID:26075244
PRP and Articular Cartilage: A Clinical Update
Directory of Open Access Journals (Sweden)
Antonio Marmotti
2015-01-01
Full Text Available The convincing background of the recent studies, investigating the different potentials of platelet-rich plasma, offers the clinician an appealing alternative for the treatment of cartilage lesions and osteoarthritis. Recent evidences in literature have shown that PRP may be helpful both as an adjuvant for surgical treatment of cartilage defects and as a therapeutic tool by intra-articular injection in patients affected by osteoarthritis. In this review, the authors introduce the trophic and anti-inflammatory properties of PRP and the different products of the available platelet concentrates. Then, in a complex scenario made of a great number of clinical variables, they resume the current literature on the PRP applications in cartilage surgery as well as the use of intra-articular PRP injections for the conservative treatment of cartilage degenerative lesions and osteoarthritis in humans, available as both case series and comparative studies. The result of this review confirms the fascinating biological role of PRP, although many aspects yet remain to be clarified and the use of PRP in a clinical setting has to be considered still exploratory.
Radiological observation of determination of sex by costal cartilage calcification
International Nuclear Information System (INIS)
Kang, Shin Hwa; Won, Jong Jin; Rhee, Song Joo; Moon, Moo Chang; Oh, Jong Hyun; Choi, Ki Chul
1979-01-01
The difference of patterns of costal cartilage calcification in male and female had been first described by Fischer in 1955. Thereafter several reports were published, but specific clinical significance was not found. During the period from January, 1978 to December, 1978, we, in the Department of Radiology, Jeonbug National University, studied 2164 cases that showed the entire 12 pairs of ribs. Among these we detected 1494 cases of costal cartilage calcification and frequent sites of calcification. Patterns of costal cartilage calcification were classified into six groups- type l: central, type II: marginal, type III: junctional type, type IV: railroad, type V: diffuse, type VI: mixed. Results are as follows; 1. In a total of 2164 cases, calcification of costal cartilage was present in 1494 cases(69.0%). Of 1181 males 780 cases(66.0%) showed calcification, and of 983 females 714 cases (72.6%) showed calcification. 2. In 439 cases of males, except for 341 cases that showed calcification within the first costal cartilage, patterns of costal cartilage calcification were as follows: marginal type in 265 cases (60.4%), junctional type in 134 cases (30.5%), mixed type in 21 cases (0.5%), central type in 17 cases(3.8%), and railroad type in 2 cases (0.5%). Diffuse type was not present. 3. In 492 cases of females, except of 222 cases that showed calcification within the first costal cartilage, patterns of costal cartilage calcification were as follows; central type in 336 cases (68.3%), junctional type in 94 cases(19.1%), mixed type in 24 cases (4.9%), railroad type in 19 cases (3.9%), and diffuse type in 14 cases (2.8%). 4. When central calcification was observed, predictive value to female was 94.7%. When marginal calcification was observed, predictive value to male was 987.4%. 5. Males frequently showed calcification in upper costal cartilages, and females in lower costal cartilages.
Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A
2015-08-01
Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
A Dual Flow Bioreactor for Cartilage Tissue Engineering
Spitters, Tim
2014-01-01
Preventing the onset of a degenerative disease like osteoarthritis by restoring tissue function before cartilage degradation occurs will decrease health costs, reduce socio-economic burdens of patients and preserve quality of life. However, producing ex vivo cartilage implants of clinically relevant
Directory of Open Access Journals (Sweden)
Christopher Terranova
Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.
Strain ratio measurement of femoral cartilage by real-time elastosonography: preliminary results
International Nuclear Information System (INIS)
Ipek, Ali; Unal, Ozlem; Kartal, Merve Gulbiz; Arslan, Halil; Isik, Cetin; Bozkurt, Murat
2015-01-01
The purpose of this study was to evaluate strain ratio measurement of femoral cartilage using real-time elastosonography. Twenty-five patients with femoral cartilage pathology on MRI (study group) were prospectively compared with 25 subjects with normal findings on MRI (control group) using real-time elastosonography. Strain ratio measurements of pathologic and normal cartilage were performed and compared, both within the study group and between the two groups. Elastosonography colour-scale coding showed a colour change from blue to red in pathologic cartilage and only blue colour-coding in normal cartilage. In the study group, the median strain ratio was higher in pathologic cartilage areas compared to normal areas (median, 1.49 [interquartile range, 0.80-2.53] vs. median, 0.01 [interquartile range, 0.01-0.01], p < 0.001, respectively). The median strain ratio of the control group was 0.01 (interquartile range, 0.01-0.01), and there was no significant difference compared to normal areas of the study group. There was, however, a significant difference between the control group cartilage and pathologic cartilage of the study group (p < 0.001). Elastosonography may be an effective, easily accessible, and relatively simple tool to demonstrate pathologic cartilage and to differentiate it from normal cartilage in the absence of advanced imaging facility such as MRI. (orig.)
Kuratani, Shigeru; Adachi, Noritaka; Wada, Naoyuki; Oisi, Yasuhiro; Sugahara, Fumiaki
2013-01-01
The cephalic neural crest produces streams of migrating cells that populate pharyngeal arches and a more rostral, premandibular domain, to give rise to an extensive ectomesenchyme in the embryonic vertebrate head. The crest cells forming the trigeminal stream are the major source of the craniofacial skeleton; however, there is no clear distinction between the mandibular arch and the premandibular domain in this ectomesenchyme. The question regarding the evolution of the gnathostome jaw is, in part, a question about the differentiation of the mandibular arch, the rostralmost component of the pharynx, and in part a question about the developmental fate of the premandibular domain. We address the developmental definition of the mandibular arch in connection with the developmental origin of the trabeculae, paired cartilaginous elements generally believed to develop in the premandibular domain, and also of enigmatic cartilaginous elements called polar cartilages. Based on comparative embryology, we propose that the mandibular arch ectomesenchyme in gnathostomes can be defined as a Dlx1-positive domain, and that the polar cartilages, which develop from the Dlx1-negative premandibular ectomesenchyme, would represent merely posterior parts of the trabeculae. We also show, in the lamprey embryo, early migration of mandibular arch mesenchyme into the premandibular domain, and propose an updated version of the heterotopy theory on the origin of the jaw. PMID:22500853
van Roon, J. A.; van Roy, J. L.; Lafeber, F. P.; Bijlsma, J. W.
1996-01-01
To study the modulation of mononuclear cell (MNC) activity in patients with rheumatoid arthritis (RA) by constituents released from human articular cartilage, which may be present in vivo during early events of the disease, when articular cartilage is not only mildly damaged. In an attempt to
Laser-assisted cartilage reshaping: in vitro and in vivo animal studies
Wang, Zhi; Pankratov, Michail M.; Perrault, Donald F., Jr.; Shapshay, Stanley M.
1995-05-01
Correction of cartilaginous defects in the head and neck area remains a challenge for the surgeon. This study investigated a new technique for laser-assisted cartilage reshaping. The pulsed 1.44 micrometers Nd:YAG laser was used in vitro and in vivo experiments to irradiate cartilage to change it's shape without carbonization or vaporization of tissue. Two watts of average power in non contact manner was used to irradiate and reshape the cartilage. The extracted reshaped cartilage specimens underwent testing of elastic force with a computer assisted measurement system that recorded the changes in elastic force in the specimens from 1 hr to 11 days post-irradiation. An animal model of defective tracheal cartilage (collapsed tracheal wall) was created, allowed to heal for 6 weeks and then corrected endoscopically with the laser-assisted technique. The results of the in vitro and in vivo investigations demonstrated that it was possible to alter the cartilage and that cartilage would retain its new shape. The clinical significance of the technique is evident and warrants further animal studies and clinical trials.
International Nuclear Information System (INIS)
Saarakkala, Simo; Laasanen, Mikko S; Jurvelin, Jukka S; Toeyraes, Juha
2006-01-01
Previous studies have suggested that quantitative ultrasound imaging could sensitively diagnose degeneration of the articular surface and changes in the subchondral bone during the development of osteoarthrosis (OA). We have recently introduced a new parameter, ultrasound roughness index (URI), for the quantification of cartilage surface roughness, and successfully tested it with normal and experimentally degraded articular surfaces. In this in vitro study, the applicability of URI was tested in bovine cartilage samples with spontaneously developed tissue degeneration. Simultaneously, we studied the sensitivity of quantitative ultrasound imaging to detect degenerative changes in the cartilage-bone interface. For reference, histological degenerative grade of the cartilage samples was determined. Mechanical reference measurements were also conducted. Cartilage surface roughness (URI) was significantly (p < 0.05) higher in histologically degenerated samples with inferior mechanical properties. Ultrasound reflection at the cartilage-bone interface was also significantly (p < 0.05) increased in degenerated samples. Furthermore, it was quantitatively confirmed that ultrasound attenuation in the overlying cartilage significantly affects the measured ultrasound reflection values from the cartilage-bone interface. To conclude, the combined ultrasound measurement of the cartilage surface roughness and ultrasound reflection at the cartilage-bone interface complement each other, and may together enable more sensitive and quantitative diagnosis of early OA or follow up after surgical cartilage repair
Seol, Young-Joon; Park, Ju Young; Jeong, Wonju; Kim, Tae-Ho; Kim, Shin-Yoon; Cho, Dong-Woo
2015-04-01
The regeneration of articular cartilage consisting of hyaline cartilage and hydrogel scaffolds has been generally used in tissue engineering. However, success in in vivo studies has been rarely reported. The hydrogel scaffolds implanted into articular cartilage defects are mechanically unstable and it is difficult for them to integrate with the surrounding native cartilage tissue. Therefore, it is needed to regenerate cartilage and bone tissue simultaneously. We developed hybrid scaffolds with hydrogel scaffolds for cartilage tissue and with ceramic scaffolds for bone tissue. For in vivo study, hybrid scaffolds were press-fitted into osteochondral tissue defects in a rabbit knee joints and the cartilage tissue regeneration in blank, hydrogel scaffolds, and hybrid scaffolds was compared. In 12th week after implantation, the histological and immunohistochemical analyses were conducted to evaluate the cartilage tissue regeneration. In the blank and hydrogel scaffold groups, the defects were filled with fibrous tissues and the implanted hydrogel scaffolds could not maintain their initial position; in the hybrid scaffold group, newly generated cartilage tissues were morphologically similar to native cartilage tissues and were smoothly connected to the surrounding native tissues. This study demonstrates hybrid scaffolds containing hydrogel and ceramic scaffolds can provide mechanical stability to hydrogel scaffolds and enhance cartilage tissue regeneration at the defect site. © 2014 Wiley Periodicals, Inc.
Kundu, Joydip; Shim, Jin-Hyung; Jang, Jinah; Kim, Sung-Won; Cho, Dong-Woo
2015-11-01
Regenerative medicine is targeted to improve, restore or replace damaged tissues or organs using a combination of cells, materials and growth factors. Both tissue engineering and developmental biology currently deal with the process of tissue self-assembly and extracellular matrix (ECM) deposition. In this investigation, additive manufacturing (AM) with a multihead deposition system (MHDS) was used to fabricate three-dimensional (3D) cell-printed scaffolds using layer-by-layer (LBL) deposition of polycaprolactone (PCL) and chondrocyte cell-encapsulated alginate hydrogel. Appropriate cell dispensing conditions and optimum alginate concentrations for maintaining cell viability were determined. In vitro cell-based biochemical assays were performed to determine glycosaminoglycans (GAGs), DNA and total collagen contents from different PCL-alginate gel constructs. PCL-alginate gels containing transforming growth factor-β (TGFβ) showed higher ECM formation. The 3D cell-printed scaffolds of PCL-alginate gel were implanted in the dorsal subcutaneous spaces of female nude mice. Histochemical [Alcian blue and haematoxylin and eosin (H&E) staining] and immunohistochemical (type II collagen) analyses of the retrieved implants after 4 weeks revealed enhanced cartilage tissue and type II collagen fibril formation in the PCL-alginate gel (+TGFβ) hybrid scaffold. In conclusion, we present an innovative cell-printed scaffold for cartilage regeneration fabricated by an advanced bioprinting technology. Copyright © 2013 John Wiley & Sons, Ltd.
Mehl, Julian; Feucht, Matthias J; Bode, Gerrit; Dovi-Akue, David; Südkamp, Norbert P; Niemeyer, Philipp
2016-03-01
To compare the geometry of the patellofemoral joint on magnetic resonance images (MRI) between patients with isolated cartilage defects of the patella and a gender- and age-matched control group of patients without patellar cartilage defects. A total of 43 patients (17 female, 26 male) with arthroscopically verified grade III and IV patellar cartilage defects (defect group) were compared with a matched-pair control group of patients with isolated traumatic rupture of the anterior cruciate ligament without cartilage defects of the patellofemoral joint. Preoperative MRI images were analysed retrospectively with regard to patellar geometry (width, thickness, facet angle), trochlear geometry (dysplasia according to Dejour, sulcus angle, sulcus depth, lateral condyle index, trochlea facet asymmetry, lateral trochlea inclination) and patellofemoral alignment (tibial tuberosity-trochlear groove distance, patella height, lateral patella displacement, lateral patellofemoral angle, patella tilt, congruence angle). In addition to the comparison of group values, the measured values were compared to normal values reported in the literature, and the frequency of patients with pathologic findings was compared between both groups. The defect group demonstrated a significantly higher proximal chondral sulcus angle (p patellofemoral joint. In particular, a flat and shallow trochlea, trochlea dysplasia and patella alta seem to contribute to the development of patellar cartilage defects, which must be taken into consideration when planning to do surgical cartilage repair at the patella. III.
Lafeber, F. P.; van der Kraan, P. M.; van Roy, H. L.; Vitters, E. L.; Huber-Bruning, O.; van den Berg, W. B.; Bijlsma, J. W.
1992-01-01
Proteoglycan synthesis of mild-to-moderate osteoarthritic human knee cartilage was compared with that of normal cartilage of the same donor. Immediately after cartilage was obtained, the synthesis rate of proteoglycans was higher for osteoarthritic cartilage than for normal cartilage. Proteoglycan
Depth-resolved phase retardation measurements for laser-assisted non-ablative cartilage reshaping
Energy Technology Data Exchange (ETDEWEB)
Youn, Jong-In [Beckman Laser Institute and Medical Clinic, University of California, Irvine, CA 92612 (United States); Vargas, Gracie [Center for Bioengineering, University of Texas Medical Branch, Galveston, TX 77555 (United States); Wong, Brian J F [Beckman Laser Institute and Medical Clinic, University of California, Irvine, CA 92612 (United States); Milner, Thomas E [Department of Biomedical Engineering, University of Texas at Austin, Austin, TX 78712 (United States)
2005-05-07
Since polarization-sensitive optical coherence tomography (PS-OCT) is emerging as a new technique for determining phase retardation in biological materials, we measured phase retardation changes in cartilage during local laser heating for application to laser-assisted cartilage reshaping. Thermally-induced changes in phase retardation of nasal septal cartilage following Nd:YAG laser irradiation were investigated using a PS-OCT system. A PS-OCT system and infrared imaging radiometer were used to record, respectively, depth-resolved images of the Stokes parameters of light backscattered from ex vivo porcine nasal septal cartilage and radiometric temperature changes following laser irradiation. PS-OCT images of cartilage were recorded before (control), during and after laser irradiation. From the measured Stokes parameters (I, Q, U and V), an estimate of the relative phase retardation between two orthogonal polarizations was computed to determine birefringence in cartilage. Phase retardation images of light backscattered from cartilage show significant changes in retardation following laser irradiation. To investigate the origin of retardation changes in response to local heat generation, we differentiated two possible mechanisms: dehydration and thermal denaturation. PS-OCT images of cartilage were recorded after dehydration in glycerol and thermal denaturation in heated physiological saline. In our experiments, observed retardation changes in cartilage are primarily due to dehydration. Since dehydration is a principal source for retardation changes in cartilage over the range of heating profiles investigated, our studies suggest that the use of PS-OCT as a feedback control methodology for non-ablative cartilage reshaping requires further investigation.
Depth-resolved phase retardation measurements for laser-assisted non-ablative cartilage reshaping
International Nuclear Information System (INIS)
Youn, Jong-In; Vargas, Gracie; Wong, Brian J F; Milner, Thomas E
2005-01-01
Since polarization-sensitive optical coherence tomography (PS-OCT) is emerging as a new technique for determining phase retardation in biological materials, we measured phase retardation changes in cartilage during local laser heating for application to laser-assisted cartilage reshaping. Thermally-induced changes in phase retardation of nasal septal cartilage following Nd:YAG laser irradiation were investigated using a PS-OCT system. A PS-OCT system and infrared imaging radiometer were used to record, respectively, depth-resolved images of the Stokes parameters of light backscattered from ex vivo porcine nasal septal cartilage and radiometric temperature changes following laser irradiation. PS-OCT images of cartilage were recorded before (control), during and after laser irradiation. From the measured Stokes parameters (I, Q, U and V), an estimate of the relative phase retardation between two orthogonal polarizations was computed to determine birefringence in cartilage. Phase retardation images of light backscattered from cartilage show significant changes in retardation following laser irradiation. To investigate the origin of retardation changes in response to local heat generation, we differentiated two possible mechanisms: dehydration and thermal denaturation. PS-OCT images of cartilage were recorded after dehydration in glycerol and thermal denaturation in heated physiological saline. In our experiments, observed retardation changes in cartilage are primarily due to dehydration. Since dehydration is a principal source for retardation changes in cartilage over the range of heating profiles investigated, our studies suggest that the use of PS-OCT as a feedback control methodology for non-ablative cartilage reshaping requires further investigation
International Nuclear Information System (INIS)
Jungmann, Pia M.; Baum, Thomas; Schaeffeler, Christoph; Sauerschnig, Martin; Brucker, Peter U.; Mann, Alexander; Ganter, Carl; Bieri, Oliver
2015-01-01
Highlights: • Axial traction is applicable during high resolution MR imaging of the ankle. • Axial traction during MR imaging oft the ankle improves cartilage surface delineation of the individual tibial and talar cartilage layer for better morphological evaluation without the need of intraarticular contrast agent application. • Coronal T1-weighted MR images with a driven equilibrium pulse performed best. • Axial traction during MR imaging of the ankle facilitates compartment discrimination for segmentation purposes resulting in better reproducibility. - Abstract: Purpose: To determine the impact of axial traction during high resolution 3.0 T MR imaging of the ankle on morphological assessment of articular cartilage and quantitative cartilage imaging parameters. Materials and Methods: MR images of n = 25 asymptomatic ankles were acquired with and without axial traction (6 kg). Coronal and sagittal T1-weighted (w) turbo spin echo (TSE) sequences with a driven equilibrium pulse and sagittal fat-saturated intermediate-w (IMfs) TSE sequences were acquired for morphological evaluation on a four-point scale (1 = best, 4 = worst). For quantitative assessment of cartilage degradation segmentation was performed on 2D multislice-multiecho (MSME) SE T2, steady-state free-precession (SSFP; n = 8) T2 and SSFP diffusion-weighted imaging (DWI; n = 8) images. Wilcoxon-tests and paired t-tests were used for statistical analysis. Results: With axial traction, joint space width increased significantly and delineation of cartilage surfaces was rated superior (P < 0.05). Cartilage surfaces were best visualized on coronal T1-w images (P < 0.05). Differences for cartilage matrix evaluation were smaller. Subchondral bone evaluation, motion artifacts and image quality were not significantly different between the acquisition methods (P > 0.05). T2 values were lower at the tibia than at the talus (P < 0.001). Reproducibility was better for images with axial traction. Conclusion
Energy Technology Data Exchange (ETDEWEB)
Jungmann, Pia M., E-mail: pia.jungmann@tum.de [Department of Radiology, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Baum, Thomas, E-mail: thomas.baum@tum.de [Department of Radiology, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Schaeffeler, Christoph, E-mail: schaeffeler@me.com [Department of Radiology, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Musculoskeletal Imaging, Kantonsspital Graubuenden, Loestrasse 170, CH-7000 Chur (Switzerland); Sauerschnig, Martin, E-mail: martin.sauerschnig@mri.tum.de [Department of Trauma Surgery, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Department of Orthopaedic Sports Medicine, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Brucker, Peter U., E-mail: peter.brucker@lrz.tu-muenchen.de [Department of Orthopaedic Sports Medicine, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Mann, Alexander, E-mail: abmann@onlinemed.de [Department of Radiology, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Department of Orthopaedic Sports Medicine, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Ganter, Carl, E-mail: cganter@tum.de [Department of Radiology, Klinikum rechts der Isar, Technische Universitaet Muenchen, Ismaninger Strasse 22, 81675 Munich (Germany); Bieri, Oliver, E-mail: oliver.bieri@unibas.ch [Division of Radiological Physics, Department of Radiology, University of Basel Hospital, Petersgraben 4, 4031 Basel (Switzerland); and others
2015-08-15
Highlights: • Axial traction is applicable during high resolution MR imaging of the ankle. • Axial traction during MR imaging oft the ankle improves cartilage surface delineation of the individual tibial and talar cartilage layer for better morphological evaluation without the need of intraarticular contrast agent application. • Coronal T1-weighted MR images with a driven equilibrium pulse performed best. • Axial traction during MR imaging of the ankle facilitates compartment discrimination for segmentation purposes resulting in better reproducibility. - Abstract: Purpose: To determine the impact of axial traction during high resolution 3.0 T MR imaging of the ankle on morphological assessment of articular cartilage and quantitative cartilage imaging parameters. Materials and Methods: MR images of n = 25 asymptomatic ankles were acquired with and without axial traction (6 kg). Coronal and sagittal T1-weighted (w) turbo spin echo (TSE) sequences with a driven equilibrium pulse and sagittal fat-saturated intermediate-w (IMfs) TSE sequences were acquired for morphological evaluation on a four-point scale (1 = best, 4 = worst). For quantitative assessment of cartilage degradation segmentation was performed on 2D multislice-multiecho (MSME) SE T2, steady-state free-precession (SSFP; n = 8) T2 and SSFP diffusion-weighted imaging (DWI; n = 8) images. Wilcoxon-tests and paired t-tests were used for statistical analysis. Results: With axial traction, joint space width increased significantly and delineation of cartilage surfaces was rated superior (P < 0.05). Cartilage surfaces were best visualized on coronal T1-w images (P < 0.05). Differences for cartilage matrix evaluation were smaller. Subchondral bone evaluation, motion artifacts and image quality were not significantly different between the acquisition methods (P > 0.05). T2 values were lower at the tibia than at the talus (P < 0.001). Reproducibility was better for images with axial traction. Conclusion
Hosseininia, Shahrzad; Lindberg, Lisbeth R; Dahlberg, Leif E
2013-01-09
It remains to be shown whether OA shares molecular similarities between different joints in humans. This study provides evidence for similarities in cartilage molecular damage in osteoarthritic (OA) joints. Articular cartilage from osteoarthritic hip joints were analysed and compared to non-OA controls regarding collagen, glycosaminoglycan and water content. Femoral heads from 16 osteoarthritic (OA) and 20 reference patients were obtained from hip replacement surgery due to OA and femoral neck fracture, respectively. Cartilage histological changes were assessed by Mankin grading and denatured collagen type II immunostaining and cartilage was extracted by α-chymotrypsin. Hydroxyproline and Alcian blue binding assays were used to measure collagen and glycosaminoglycan (GAG) content, respectively. Mankin and immunohistology scores were significantly higher in hip OA samples than in reference samples. Cartilage water content was 6% higher in OA samples than in references. 2.5 times more collagen was extracted from OA than from reference samples. There was a positive association between water content and percentage of extractable collagen pool (ECP) in both groups. The amounts of collagen per wet and dry weights did not differ statistically between OA and reference cartilage. % Extractable collagen was not related to collagen per dry weight in either group. However when collagen was expressed by wet weight there was a negative correlation between % extractable and collagen in OA cartilage. The amount of GAG per wet weight was similar in both groups but the amount of GAG per dry weight was higher in OA samples compared to reference samples, which suggests a capacity for GAG biosynthesis in hip OA cartilage. Neither of the studied parameters was related to age in either group. Increased collagen extractability and water content in human hip cartilage is associated with OA pathology and can be observed at early stages of the degenerative hip OA process. Our results
The Role of Interstitial Fluid Pressurization in Articular Cartilage Lubrication
Ateshian, Gerard A.
2009-01-01
Over the last two decades, considerable progress has been reported in the field of cartilage mechanics that impacts our understanding of the role of interstitial fluid pressurization on cartilage lubrication. Theoretical and experimental studies have demonstrated that the interstitial fluid of cartilage pressurizes considerably under loading, potentially supporting most of the applied load under various transient or steady-state conditions. The fraction of the total load supported by fluid pressurization has been called the fluid load support. Experimental studies have demonstrated that the friction coefficient of cartilage correlates negatively with this variable, achieving remarkably low values when the fluid load support is greatest. A theoretical framework that embodies this relationship has been validated against experiments, predicting and explaining various outcomes, and demonstrating that a low friction coefficient can be maintained for prolonged loading durations under normal physiological function. This paper reviews salient aspects of this topic, as well as its implications for improving our understanding of boundary lubrication by molecular species in synovial fluid and the cartilage superficial zone. Effects of cartilage degeneration on its frictional response are also reviewed. PMID:19464689
Cartilage Degeneration and Alignment in Severe Varus Knee Osteoarthritis.
Nakagawa, Yasuaki; Mukai, Shogo; Yabumoto, Hiromitsu; Tarumi, Eri; Nakamura, Takashi
2015-10-01
The aim of this study was to examine the relationship between cartilage, ligament, and meniscus degeneration and radiographic alignment in severe varus knee osteoarthritis in order to understand the development of varus knee osteoarthritis. Fifty-three patients (71 knees) with primary varus knee osteoarthritis and who underwent total knee arthroplasty were selected for this study. There were 6 men and 47 women, with 40 right knees and 31 left knees studied; their mean age at operation was 73.5 years. The ligament, meniscus, degeneration of joint cartilage, and radiographic alignments were examined visually. The tibial plateau-tibial shaft angle was larger if the condition of the cartilage in the lateral femoral condyle was worse. The femorotibial angle and tibial plateau-tibial shaft angle were larger if the conditions of the lateral meniscus or the cartilage in the lateral tibial plateau were worse. Based on the results of this study, progression of varus knee osteoarthritis may occur in the following manner: medial knee osteoarthritis starts in the central portion of the medial tibial plateau, and accompanied by medial meniscal extrusion and anterior cruciate ligament rupture, cartilage degeneration expands from the anterior to the posterior in the medial tibial plateau. Bone attrition occurs in the medial tibial plateau, and the femoro-tibial angle and tibial plateau-tibial shaft angle increase. Therefore, the lateral intercondylar eminence injures the cartilage of the lateral femoral condyle in the longitudinal fissure type. Thereafter, the cartilage degeneration expands in the whole of the knee joints.
Brachvogel, Bent; Zaucke, Frank; Dave, Keyur; Norris, Emma L; Stermann, Jacek; Dayakli, Münire; Koch, Manuel; Gorman, Jeffrey J; Bateman, John F; Wilson, Richard
2013-05-10
Collagen IX is an integral cartilage extracellular matrix component important in skeletal development and joint function. Proteomic analysis and validation studies revealed novel alterations in collagen IX null cartilage. Matrilin-4, collagen XII, thrombospondin-4, fibronectin, βig-h3, and epiphycan are components of the in vivo collagen IX interactome. We applied a proteomics approach to advance our understanding of collagen IX ablation in cartilage. The cartilage extracellular matrix is essential for endochondral bone development and joint function. In addition to the major aggrecan/collagen II framework, the interacting complex of collagen IX, matrilin-3, and cartilage oligomeric matrix protein (COMP) is essential for cartilage matrix stability, as mutations in Col9a1, Col9a2, Col9a3, Comp, and Matn3 genes cause multiple epiphyseal dysplasia, in which patients develop early onset osteoarthritis. In mice, collagen IX ablation results in severely disturbed growth plate organization, hypocellular regions, and abnormal chondrocyte shape. This abnormal differentiation is likely to involve altered cell-matrix interactions but the mechanism is not known. To investigate the molecular basis of the collagen IX null phenotype we analyzed global differences in protein abundance between wild-type and knock-out femoral head cartilage by capillary HPLC tandem mass spectrometry. We identified 297 proteins in 3-day cartilage and 397 proteins in 21-day cartilage. Components that were differentially abundant between wild-type and collagen IX-deficient cartilage included 15 extracellular matrix proteins. Collagen IX ablation was associated with dramatically reduced COMP and matrilin-3, consistent with known interactions. Matrilin-1, matrilin-4, epiphycan, and thrombospondin-4 levels were reduced in collagen IX null cartilage, providing the first in vivo evidence for these proteins belonging to the collagen IX interactome. Thrombospondin-4 expression was reduced at the mRNA level
DEFF Research Database (Denmark)
Sondergaard, B-C; Schultz, N; Madsen, S H
2010-01-01
Matrix metalloproteinases (MMPs) and aggrecanases are essential players in cartilage degradation. However, the signaling pathways that results in MMP and/or aggrecanase synthesis and activation are not well understood. We investigated the molecular events leading to MMP- and aggrecanase-mediated ......Matrix metalloproteinases (MMPs) and aggrecanases are essential players in cartilage degradation. However, the signaling pathways that results in MMP and/or aggrecanase synthesis and activation are not well understood. We investigated the molecular events leading to MMP- and aggrecanase......-mediated cartilage degradation....
Evaluation of degenerative changes in articular cartilage of osteoarthritis by Raman spectroscopy
Oshima, Yusuke; Ishimaru, Yasumitsu; Kiyomatsu, Hiroshi; Hino, Kazunori; Miura, Hiromasa
2018-02-01
Osteoarthritis (OA) is a very common joint disease in the aging population. Main symptom of OA is accompanied by degenerative changes of articular cartilage. Cartilage contains mostly type II collagen and proteoglycans, so it is difficult to access the quality and morphology of cartilage tissue in situ by conventional diagnostic tools (X-ray, MRI and echography) directly or indirectly. Raman spectroscopy is a label-free technique which enables to analyze molecular composition in degenerative cartilage. In this proposal, we aim to develop Raman spectroscopic system for the quality assessment of articular cartilage during arthroscopic surgery. Toward this goal, we are focusing on the proteoglycan content and collagen fiber alignment in cartilage matrix which may be associated with degenerative changes in OA, and we designed an original Raman device for remote sensing during arthroscopic surgery. In this project, we define the grading system for cartilage defect based on Raman spectroscopy, and we complete the evaluation of the Raman probing system which makes it possible to detect early stage of degenerative cartilage as a novel tool for OA diagnosis using human subject.
Directory of Open Access Journals (Sweden)
Amilton M Fernandes
Full Text Available Lesions of hyaline cartilage do not heal spontaneously, and represent a therapeutic challenge. In vitro engineering of articular cartilage using cells and biomaterials may prove to be the best solution. Patients with osteoarthritis (OA may require tissue engineered cartilage therapy. Chondrocytes obtained from OA joints are thought to be involved in the disease process, and thus to be of insufficient quality to be used for repair strategies. Bone marrow (BM derived mesenchymal stem cells (MSCs from healthy donors may represent an alternative cell source. We have isolated chondrocytes from OA joints, performed cell culture expansion and tissue engineering of cartilage using a disc-shaped alginate scaffold and chondrogenic differentiation medium. We performed real-time reverse transcriptase quantitative PCR and fluorescence immunohistochemistry to evaluate mRNA and protein expression for a range of molecules involved in chondrogenesis and OA pathogenesis. Results were compared with those obtained by using BM-MSCs in an identical tissue engineering strategy. Finally the two populations were compared using genome-wide mRNA arrays. At three weeks of chondrogenic differentiation we found high and similar levels of hyaline cartilage-specific type II collagen and fibrocartilage-specific type I collagen mRNA and protein in discs containing OA and BM-MSC derived chondrocytes. Aggrecan, the dominant proteoglycan in hyaline cartilage, was more abundantly distributed in the OA chondrocyte extracellular matrix. OA chondrocytes expressed higher mRNA levels also of other hyaline extracellular matrix components. Surprisingly BM-MSC derived chondrocytes expressed higher mRNA levels of OA markers such as COL10A1, SSP1 (osteopontin, ALPL, BMP2, VEGFA, PTGES, IHH, and WNT genes, but lower levels of MMP3 and S100A4. Based on the results presented here, OA chondrocytes may be suitable for tissue engineering of articular cartilage.
The study of selective water excitation in the MR imaging of articular cartilage
International Nuclear Information System (INIS)
Gu Fei; Zhang Xuezhe
2007-01-01
Objective: To investigate the value of selective water excitation technique for the assessment of articular cartilage. Methods: MR sagittal scanning of knee joints was performed in the fifteen healthy volunteers. MR scan sequences were 3D-FFE-SPIR and 3D-FFE-WATS. The signal noise ratio (SNR) of the cartilage, the contrast noise ratio (CNR) between cartilage and adjacent tissue and their efficiency were calculated and analyzed statistically. Tweenty-nine patients who were suspected having cartilage injury were performed MR examination and the image characteristics and the detecting ability of each sequence on cartilage lesions were analyzed. Results: In the healthy volunteers, the cartilage SNR was 3D-FFE-SPIR: 197.93±18.58, 3D-FFE-WATS: 187.32±21.50 (P=0.159). CNR (cartilage/bone) was 3D-FFE-SPIR: 185.50±18.34, 3D-FFE-WATS: 169.55±24.57 (P=0.054). CNR ( cartilage/muscle ) was 3D-FFE-SPIR: 61.40±19.04, 3D-FFE-WATS: 47.27±21.05 (P=0.064). The cartilage SNR and CNR between cartilage and bone, muscle of 3D-FFE-SPIR weren't significantly higher than that of 3D-FFE- WATS. CNR(cartilage/liquid) was 3D-FFE-SPIR: 91.53±14.46, 3D-FFE-WATS: 149.28±32.30 (P0.000). CNR (cartilage/marrow) was 3D-FFE-SPIR: 159.26±18.83, 3D-FFE-WATS: 176.87± 22.50 (P=0.028). CNR (cartilage/fat) was 3 D-FFE-SPIR: 134.56±15.80,3 D-FFE-WATS: 154. 01 + 22.42 (P=0.010). The CNR between cartilage and liquid, marrow, fat were higher in 3 D-FFE-WATS and significantly different than that of 3 D-FFE-SPIR. Thirty detected cartilage injuries of patients were 3D-FFE- WATS: 39, 3D-FFE-SPIR: 45 and there was no statistical difference between them (P=0.37). Conclusion: 3D-FFE-WATS can show the articular cartilage clearly. It has high scan speed and suppress the fat signal evenly. Its ability for finding cartilage damage is equal to that of 3D-FFE-SPIR. So WATS can be used in the routine clinical cartilage examination. (authors)
Namaste (counterbalancing) technique: Overcoming warping in costal cartilage.
Agrawal, Kapil S; Bachhav, Manoj; Shrotriya, Raghav
2015-01-01
Indian noses are broader and lack projection as compared to other populations, hence very often need augmentation, that too by large volume. Costal cartilage remains the material of choice in large volume augmentations and repair of complex primary and secondary nasal deformities. One major disadvantage of costal cartilage grafts (CCG) which offsets all other advantages is the tendency to warp and become distorted over a period of time. We propose a simple technique to overcome this menace of warping. We present the data of 51 patients of rhinoplasty done using CCG with counterbalancing technique over a period of 4 years. No evidence of warping was found in any patient up to a maximum follow-up period of 4 years. Counterbalancing is a useful technique to overcome the problem of warping. It gives liberty to utilize even unbalanced cartilage safely to provide desired shape and use the cartilage without any wastage.
Starch-modified magnetite nanoparticles for impregnation into cartilage
Energy Technology Data Exchange (ETDEWEB)
Soshnikova, Yulia M., E-mail: yuliasoshnikova@gmail.com [Russian Academy of Sciences, Institute on Laser and Information Technologies (Russian Federation); Roman, Svetlana G.; Chebotareva, Natalia A. [A.N. Bach Institute of Biochemistry (Russian Federation); Baum, Olga I. [Russian Academy of Sciences, Institute on Laser and Information Technologies (Russian Federation); Obrezkova, Mariya V. [Lomonosov Moscow State University, Department of Chemistry (Russian Federation); Gillis, Richard B.; Harding, Stephen E. [University of Nottingham, National Centre for Macromolecular Hydrodynamics (United Kingdom); Sobol, Emil N. [Russian Academy of Sciences, Institute on Laser and Information Technologies (Russian Federation); Lunin, Valeriy V. [Lomonosov Moscow State University, Department of Chemistry (Russian Federation)
2013-11-15
The paper presents preparation and characterization of starch-modified Fe{sub 3}O{sub 4} nanoparticles (NPs) in aqueous dispersion after impregnation into healthy and damaged types of cartilage. We show that starch-modified dispersion has a narrower size distribution than a non‐stabilized one. The average hydrodynamic radius of magnetite NPs in a dispersion used for impregnation into cartilage is (48 ± 1) nm with the width of the distribution from 5 to 200 nm. We investigate stability of aqueous magnetite NPs dispersions during storage and with increase in temperature (up to 70 °C). We find that polydisperse magnetite NPs can penetrate into cartilage and the size and concentration of impregnated particles depend on the organization of the tissue structure. The results confirm the possibility of application of magnetite NPs in diagnostics and laser treatment of degenerative cartilage deceases.
Preclinical Studies for Cartilage Repair
Hurtig, Mark B.; Buschmann, Michael D.; Fortier, Lisa A.; Hoemann, Caroline D.; Hunziker, Ernst B.; Jurvelin, Jukka S.; Mainil-Varlet, Pierre; McIlwraith, C. Wayne; Sah, Robert L.; Whiteside, Robert A.
2011-01-01
Investigational devices for articular cartilage repair or replacement are considered to be significant risk devices by regulatory bodies. Therefore animal models are needed to provide proof of efficacy and safety prior to clinical testing. The financial commitment and regulatory steps needed to bring a new technology to clinical use can be major obstacles, so the implementation of highly predictive animal models is a pressing issue. Until recently, a reductionist approach using acute chondral defects in immature laboratory species, particularly the rabbit, was considered adequate; however, if successful and timely translation from animal models to regulatory approval and clinical use is the goal, a step-wise development using laboratory animals for screening and early development work followed by larger species such as the goat, sheep and horse for late development and pivotal studies is recommended. Such animals must have fully organized and mature cartilage. Both acute and chronic chondral defects can be used but the later are more like the lesions found in patients and may be more predictive. Quantitative and qualitative outcome measures such as macroscopic appearance, histology, biochemistry, functional imaging, and biomechanical testing of cartilage, provide reliable data to support investment decisions and subsequent applications to regulatory bodies for clinical trials. No one model or species can be considered ideal for pivotal studies, but the larger animal species are recommended for pivotal studies. Larger species such as the horse, goat and pig also allow arthroscopic delivery, and press-fit or sutured implant fixation in thick cartilage as well as second look arthroscopies and biopsy procedures. PMID:26069576
PIXE and cSAXS studies at the bone-cartilage interface
International Nuclear Information System (INIS)
Kaabar, W.; Gundogdu, O.; Bradley, D.A.; Bunk, O.; Pfeiffer, F.; Farquharson, M.J.; Webb, M.; Jeynes, C.
2008-01-01
Full text: Divalent cations such as Zn and Ca play a central role both in the normal processes of growth and remodelling as well as in the degenerative and inflammatory processes of articular cartilage during arthritis. These cations act as co-factors of a class of enzymes known as metalloproteinases, believed to be active during the initiation, progress and remodelling processes associated with osteoarthritis. Other important enzymes such as alkaline phosphatase, involved in cartilage mineralization, are also associated with the presence of these metallic co-factors. A number of authors have used X-ray fluorescence, employing synchrotron radiation sources to map metal ion distributions in bone and cartilage. In the present work, investigations were carried out on the distribution of metallic ions (Zn, Ca, P and S) in articular cartilage samples at the University of Surrey hosted EPSRC national ion beam facility based on a 2 MV Tandetron accelerator. An in-air beam line was used, with proton energy of 2.5 MeV. Micro Proton-Induced X-ray Emission (μ-PIXE) analysis has been made of the bone-cartilage interface for samples taken from the human femoral head. The bone-cartilage interface region between uncalcified and mineralized cartilage regions has attracted particular interest, being identified to be an active site of remodelling. Here coherent small angle X-ray scattering (cSAXS) has also been employed to investigate the structure and organization of the collagen network in decalcified diseased human femoral heads and the equine metacarpus joint, study being carried out at the Paul Scherrer Institute (PSI) synchrotron beamline cSAXS. (Fig. 1: cSAXS over a 1 mm x 1.5 mm area of a cartilage/bone sample; the left- and right hand panels corresponds to the length scales 658-568 A and 962-833 A respectively. The bar scale indicates relative orientation, from 0 deg (blue) to 90 deg (red)). The results of Fig. 1 are plotted in terms of orientation of cartilage and bone
Li, Siming; Yang, Xiaohong; Tang, Shenghui; Zhang, Xunmeng; Feng, Zhencheng; Cui, Shuliang
2015-08-01
Surgical replacement of massively defected joints necessarily relies on osteochondral grafts effective to both of bone and cartilage. Demineralized bone matrix (DBM) retains the osteoconductivity but destroys viable chondrocytes in the cartilage portion essential for successful restoration of defected joints. This study prepared osteochondral grafts of DBM with protected cartilage. Protected cartilage portions was characterized by cellular and molecular biology and the grafts were allogenically used for grafting. Protected cartilage showed similar histomorphological structure and protected proteins estimated by total proteins and cartilage specific proteins as in those of fresh controls when DBMs were generated in bone portions. Such grafts were successfully used for simultaneously repair of bone and cartilage in massively defected osteoarticular joints within 16 weeks post-surgery. These results present an allograft with clinical potential for simultaneous restoration of bone and cartilage in defected joints.
Repair of full-thickness articular cartilage defect using stem cell-encapsulated thermogel.
Zhang, Yanbo; Zhang, Jin; Chang, Fei; Xu, Weiguo; Ding, Jianxun
2018-07-01
Cartilage defect repair by hydrogel-based tissue engineering is becoming one of the most potential treatment strategies. In this work, a thermogel of triblock copolymer poly(lactide-co-glycolide)-block-poly(ethylene glycol)-block-poly(lactide-co-glycolide) (PLGA-PEG-PLGA) was prepared as scaffold of bone marrow mesenchymal stem cells (BMMSCs) for repair of full-thickness articular cartilage defect. At first, the copolymer solution showed a reversible sol-gel transition at physiological temperature range, and the mechanical properties of such thermogel were high enough to support the repair of cartilage. Additionally, excellent biodegradability and biocompatibility of the thermogel were demonstrated. By implanting the BMMSC-encapsulated thermogel into the full-thickness articular cartilage defect (5.0 mm in diameter and 4.0 mm in depth) in the rabbit, it was found that the regenerated cartilage integrated well with the surrounding normal cartilage and subchondral bone at 12 weeks post-surgery. The upregulated expression of glycosaminoglycan and type II collagen in the repaired cartilage, and the comparable biomechanical properties with normal cartilage suggested that the cell-encapsulated PLGA-PEG-PLGA thermogel had great potential in serving as the promising scaffold for cartilage regeneration. Copyright © 2018 Elsevier B.V. All rights reserved.
Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.
Directory of Open Access Journals (Sweden)
Vijee Mohan
Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.
Pleumeekers, M.M.; Nimeskern, L.M.; Koevoet, W.L.M.; Karperien, Hermanus Bernardus Johannes; Stok, K.S.; van Osch, G.J.V.M.
2015-01-01
Background: Cartilage tissue engineering can offer promising solutions for restoring cartilage defects in the head and neck area and has the potential to overcome limitations of current treatments. However, to generate a construct of reasonable size, large numbers of chondrocytes are required, which
The distribution of YKL-40 in osteoarthritic and normal human articular cartilage
DEFF Research Database (Denmark)
Volck, B; Ostergaard, K; Johansen, J S
1999-01-01
YKL-40, also called human cartilage glycoprotein-39, is a major secretory protein of human chondrocytes in cell culture. YKL-40 mRNA is expressed by cartilage from patients with rheumatoid arthritis, but is not detectable in normal human cartilage. The aim was to investigate the distribution of YKL......-40 in osteoarthritic (n=9) and macroscopically normal (n=5) human articular cartilage, collected from 12 pre-selected areas of the femoral head, to discover a potential role for YKL-40 in cartilage remodelling in osteoarthritis. Immunohistochemical analysis showed that YKL-40 staining was found...... in chondrocytes of osteoarthritic cartilage mainly in the superficial and middle zone of the cartilage rather than the deep zone. There was a tendency for high number of YKL-40 positive chondrocytes in areas of the femoral head with a considerable biomechanical load. The number of chondrocytes with a positive...
Follistatin Alleviates Synovitis and Articular Cartilage Degeneration Induced by Carrageenan
Directory of Open Access Journals (Sweden)
Jun Yamada
2014-01-01
Full Text Available Activins are proinflammatory cytokines which belong to the TGFβ superfamily. Follistatin is an extracellular decoy receptor for activins. Since both activins and follistatin are expressed in articular cartilage, we hypothesized that activin-follistatin signaling participates in the process of joint inflammation and cartilage degeneration. To test this hypothesis, we examined the effects of follistatin in a carrageenan-induced mouse arthritis model. Synovitis induced by intra-articular injection of carrageenan was significantly alleviated by preinjection with follistatin. Macrophage infiltration into the synovial membrane was significantly reduced in the presence of follistatin. In addition, follistatin inhibited proteoglycan erosion induced by carrageenan in articular cartilage. These data indicate that activin-follistatin signaling is involved in joint inflammation and cartilage homeostasis. Our data suggest that follistatin can be a new therapeutic target for inflammation-induced articular cartilage degeneration.
Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène
2013-01-01
Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy
Directory of Open Access Journals (Sweden)
David Cohen
Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of
Evaluation of articular cartilage degeneration with contrast-enhanced magnetic resonance imaging
International Nuclear Information System (INIS)
Fujioka, Mikihiro
1994-01-01
The evaluation of glycosaminoglycan (GAG) concentration is important in the clinical diagnosis of articular cartilage degeneration. Glycosaminoglycan provides a large number of fixed negative charges. When manganese ion (Mn 2+ ) is administered to the cartilage matrix, this cation diffuses into the matrix and accumulates in accordance with the distribution of fixed negative charges owing to the electrostatic interaction. The accumulation of Mn 2+ causes a shortening of the relaxation times, resulting in high signal intensity in the MR image, when a T 1 -weighted image is obtained. The present study applied this new method to the articular cartilage to evaluate the degree of the cartilage degeneration. Small pieces of articular cartilage were dissected from the knee joints of young chickens. Experimentally degenerated articular cartilage was obtained by treating the specimen with various concentrations of papain solution. Then specimens were soaked in manganese solution until they obtained equilibrium and served for MR microimaging. The fixed charge density (FCD), the concentration of Mn 2+ and Na + , T 1 and T 2 relaxation times were also measured. In degenerated cartilage, lower accumulation of Mn 2+ due to lower GAG density caused a lower than normal signal intensity. Thus, administration of Mn 2+ enhances the biochemical change in the cartilage matrix in terms of differences in the relaxation time. The actual signal intensity on MRI of each specimen corresponded to the theoretical signal intensity, which was calculated from the FCD. It was concluded that MR images taken with contrast enhancement by Mn 2+ give direct visual information about the GAG density in the articular cartilage. MRI with cationic contrast agent could develop into a new method for early non-invasive diagnosis of cartilage dysfunction and degeneration. (author)
Can Glucosamine Supplements Protect My Knee Cartilage from Osteoarthritis?
... cartilage in osteoarthritis? Can glucosamine supplements protect my knee cartilage from osteoarthritis? Answers from Brent A. Bauer, M.D. Study results on this question have been mixed, with some suggesting possible ...
T2 relaxation time mapping of the cartilage cap of osteochondromas
Energy Technology Data Exchange (ETDEWEB)
Kim, Hee Kyung; Horn, Paul; Laor, Tal [Cincinnati Children' s Hospital Medical Center, Cincinnati (United States); Daedzinski, Bernard J. [Dept. of Radiology, Children' s Hospital of Philadelphia, University of Pennsylvania, Philadelphia (United States); Kim, Dong Hoon [Dept. of Radiology, Pharmacology, Korea University College of Medicine, Seoul (Korea, Republic of)
2016-02-15
Our aim was to evaluate the cartilage cap of osteochondromas using T2 maps and to compare these values to those of normal patellar cartilage, from age and gender matched controls. This study was approved by the Institutional Review Board and request for informed consent was waived. Eleven children (ages 5-17 years) with osteochondromas underwent MR imaging, which included T2-weighted fat suppressed and T2 relaxation time mapping (echo time = 9-99/repetition time = 1500 msec) sequences. Lesion origins were femur (n = 5), tibia (n = 3), fibula (n = 2), and scapula (n = 1). Signal intensity of the cartilage cap, thickness, mean T2 relaxation times, and T2 spatial variation (mean T2 relaxation times as a function of distance) were evaluated. Findings were compared to those of patellar cartilage from a group of age and gender matched subjects. The cartilage caps showed a fluid-like high T2 signal, with mean thickness of 4.8 mm. The mean value of mean T2 relaxation times of the osteochondromas was 264.0 ± 80.4 msec (range, 151.0-366.0 msec). Mean T2 relaxation times were significantly longer than the values from patellar cartilage (39.0 msec) (p < 0.0001). These findings were observed with T2 spatial variation plots across the entire distance of the cartilage cap, with the most pronounced difference in the middle section of the cartilage. Longer T2 relaxation times of the cartilage caps of osteochondromas should be considered as normal, and likely to reflect an increased water content, different microstructure and component.
T2 relaxation time mapping of the cartilage cap of osteochondromas
International Nuclear Information System (INIS)
Kim, Hee Kyung; Horn, Paul; Laor, Tal; Daedzinski, Bernard J.; Kim, Dong Hoon
2016-01-01
Our aim was to evaluate the cartilage cap of osteochondromas using T2 maps and to compare these values to those of normal patellar cartilage, from age and gender matched controls. This study was approved by the Institutional Review Board and request for informed consent was waived. Eleven children (ages 5-17 years) with osteochondromas underwent MR imaging, which included T2-weighted fat suppressed and T2 relaxation time mapping (echo time = 9-99/repetition time = 1500 msec) sequences. Lesion origins were femur (n = 5), tibia (n = 3), fibula (n = 2), and scapula (n = 1). Signal intensity of the cartilage cap, thickness, mean T2 relaxation times, and T2 spatial variation (mean T2 relaxation times as a function of distance) were evaluated. Findings were compared to those of patellar cartilage from a group of age and gender matched subjects. The cartilage caps showed a fluid-like high T2 signal, with mean thickness of 4.8 mm. The mean value of mean T2 relaxation times of the osteochondromas was 264.0 ± 80.4 msec (range, 151.0-366.0 msec). Mean T2 relaxation times were significantly longer than the values from patellar cartilage (39.0 msec) (p < 0.0001). These findings were observed with T2 spatial variation plots across the entire distance of the cartilage cap, with the most pronounced difference in the middle section of the cartilage. Longer T2 relaxation times of the cartilage caps of osteochondromas should be considered as normal, and likely to reflect an increased water content, different microstructure and component
Understanding Magnetic Resonance Imaging of Knee Cartilage Repair: A Focus on Clinical Relevance.
Hayashi, Daichi; Li, Xinning; Murakami, Akira M; Roemer, Frank W; Trattnig, Siegfried; Guermazi, Ali
2017-06-01
The aims of this review article are (a) to describe the principles of morphologic and compositional magnetic resonance imaging (MRI) techniques relevant for the imaging of knee cartilage repair surgery and their application to longitudinal studies and (b) to illustrate the clinical relevance of pre- and postsurgical MRI with correlation to intraoperative images. First, MRI sequences that can be applied for imaging of cartilage repair tissue in the knee are described, focusing on comparison of 2D and 3D fast spin echo and gradient recalled echo sequences. Imaging features of cartilage repair tissue are then discussed, including conventional (morphologic) MRI and compositional MRI techniques. More specifically, imaging techniques for specific cartilage repair surgery techniques as described above, as well as MRI-based semiquantitative scoring systems for the knee cartilage repair tissue-MR Observation of Cartilage Repair Tissue and Cartilage Repair OA Knee Score-are explained. Then, currently available surgical techniques are reviewed, including marrow stimulation, osteochondral autograft, osteochondral allograft, particulate cartilage allograft, autologous chondrocyte implantation, and others. Finally, ongoing research efforts and future direction of cartilage repair tissue imaging are discussed.
Ultrasound arthroscopy of human knee cartilage and subchondral bone in vivo.
Liukkonen, Jukka; Lehenkari, Petri; Hirvasniemi, Jukka; Joukainen, Antti; Virén, Tuomas; Saarakkala, Simo; Nieminen, Miika T; Jurvelin, Jukka S; Töyräs, Juha
2014-09-01
Arthroscopic ultrasound imaging enables quantitative evaluation of articular cartilage. However, the potential of this technique for evaluation of subchondral bone has not been investigated in vivo. In this study, we address this issue in clinical arthroscopy of the human knee (n = 11) by determining quantitative ultrasound (9 MHz) reflection and backscattering parameters for cartilage and subchondral bone. Furthermore, in each knee, seven anatomical sites were graded using the International Cartilage Repair Society (ICRS) system based on (i) conventional arthroscopy and (ii) ultrasound images acquired in arthroscopy with a miniature transducer. Ultrasound enabled visualization of articular cartilage and subchondral bone. ICRS grades based on ultrasound images were higher (p ultrasound-based ICRS grades were expected as ultrasound reveals additional information on, for example, the relative depth of the lesion. In line with previous literature, ultrasound reflection and scattering in cartilage varied significantly (p ultrasound parameters and structure or density of subchondral bone could be demonstrated. To conclude, arthroscopic ultrasound imaging had a significant effect on clinical grading of cartilage, and it was found to provide quantitative information on cartilage. The lack of correlation between the ultrasound parameters and bone properties may be related to lesser bone change or excessive attenuation in overlying cartilage and insufficient power of the applied miniature transducer. Copyright © 2014 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Moshaverinia, Alireza; Xu, Xingtian; Chen, Chider; Akiyama, Kentaro; Snead, Malcolm L; Shi, Songtao
2013-12-01
Dental-derived mesenchymal stem cells (MSCs) are promising candidates for cartilage regeneration, with a high capacity for chondrogenic differentiation. This property helps make dental MSCs an advantageous therapeutic option compared to current treatment modalities. The MSC delivery vehicle is the principal determinant for the success of MSC-mediated cartilage regeneration therapies. The objectives of this study were to: (1) develop a novel co-delivery system based on TGF-β1 loaded RGD-coupled alginate microspheres encapsulating periodontal ligament stem cells (PDLSCs) or gingival mesenchymal stem cells (GMSCs); and (2) investigate dental MSC viability and chondrogenic differentiation in alginate microspheres. The results revealed the sustained release of TGF-β1 from the alginate microspheres. After 4 weeks of chondrogenic differentiation in vitro, PDLSCs and GMSCs as well as human bone marrow mesenchymal stem cells (hBMMSCs) (as positive control) revealed chondrogenic gene expression markers (Col II and Sox-9) via qPCR, as well as matrix positively stained by Toluidine Blue and Safranin-O. In animal studies, ectopic cartilage tissue regeneration was observed inside and around the transplanted microspheres, confirmed by histochemical and immunofluorescent staining. Interestingly, PDLSCs showed more chondrogenesis than GMSCs and hBMMSCs (palginate microencapsulating dental MSCs make a promising candidate for cartilage regeneration. Our results highlight the vital role played by the microenvironment, as well as value of presenting inductive signals for viability and differentiation of MSCs. Copyright © 2013 Acta Materialia Inc. All rights reserved.