Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

Directory of Open Access Journals (Sweden)

Venkata Saroja eVoruganti

2013-12-01

Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

The Effect of Turmeric (Curcuma longa Extract on the Functionality of the Solute Carrier Protein 22 A4 (SLC22A4 and Interleukin-10 (IL-10 Variants Associated with Inflammatory Bowel Disease

Directory of Open Access Journals (Sweden)

Mark J. McCann

2014-10-01

Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

The effect of turmeric (Curcuma longa) extract on the functionality of the solute carrier protein 22 A4 (SLC22A4) and interleukin-10 (IL-10) variants associated with inflammatory bowel disease.

Science.gov (United States)

McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C

2014-10-13

Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

Science.gov (United States)

Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

2011-12-01

Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

OpenAIRE

Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

2002-01-01

Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

Science.gov (United States)

Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

2017-10-26

Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Organic solute carrier 22 (SLC22 family: Potential for interactions with food, herbal/dietary supplements, endogenous compounds, and drugs

Directory of Open Access Journals (Sweden)

Raymond E. Lai

2018-04-01

Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport

Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

Directory of Open Access Journals (Sweden)

Hemant Kulkarni

2016-01-01

Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

Directory of Open Access Journals (Sweden)

Deborah Cook

2008-09-01

Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

Dicty_cDB: SLC832 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

Science.gov (United States)

Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

2015-06-01

Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

Directory of Open Access Journals (Sweden)

Karen M Vernau

Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

Science.gov (United States)

Lean, Choo Bee; Lee, Edmund Jon Deoon

2009-01-01

MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

OpenAIRE

Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

2014-01-01

Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

Directory of Open Access Journals (Sweden)

Maura Mack

2017-08-01

Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.

Detection of haplotypes associated with prenatal death in dairy cattle and identification of deleterious mutations in GART, SHBG and SLC37A2.

Directory of Open Access Journals (Sweden)

Sébastien Fritz

Full Text Available The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1% showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals. Thirty-four candidate haplotypes (p<10(-4 including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total. Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina, SLC35A3 (CVM, APAF1 (HH1 and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.

Detection of Haplotypes Associated with Prenatal Death in Dairy Cattle and Identification of Deleterious Mutations in GART, SHBG and SLC37A2

Science.gov (United States)

Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C.; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier

2013-01-01

The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10−4) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle. PMID:23762392

Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

Science.gov (United States)

Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

2016-08-01

The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

Science.gov (United States)

Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

2016-10-01

The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

Detection of haplotypes associated with prenatal death in dairy cattle and identification of deleterious mutations in GART, SHBG and SLC37A2.

Science.gov (United States)

Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier

2013-01-01

The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (pHH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.

Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study.

Science.gov (United States)

Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

2015-04-01

Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.

Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

Directory of Open Access Journals (Sweden)

Jing Yuan

Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

Science.gov (United States)

Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

2017-01-01

Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

The renal urate transporter SLC17A1 locus: confirmation of association with gout.

Science.gov (United States)

Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

2012-04-27

Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study1234

Science.gov (United States)

Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

2015-01-01

Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971

Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

Science.gov (United States)

Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

2014-11-01

Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

The SLC4A7 variant rs4973768 is associated with breast cancer risk: evidence from a case-control study and a meta-analysis.

Science.gov (United States)

Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao

2012-12-01

Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.

Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures

Science.gov (United States)

Stödberg, Tommy; McTague, Amy; Ruiz, Arnaud J.; Hirata, Hiromi; Zhen, Juan; Long, Philip; Farabella, Irene; Meyer, Esther; Kawahara, Atsuo; Vassallo, Grace; Stivaros, Stavros M.; Bjursell, Magnus K.; Stranneheim, Henrik; Tigerschiöld, Stephanie; Persson, Bengt; Bangash, Iftikhar; Das, Krishna; Hughes, Deborah; Lesko, Nicole; Lundeberg, Joakim; Scott, Rod C.; Poduri, Annapurna; Scheffer, Ingrid E.; Smith, Holly; Gissen, Paul; Schorge, Stephanie; Reith, Maarten E. A.; Topf, Maya; Kullmann, Dimitri M.; Harvey, Robert J.; Wedell, Anna; Kurian, Manju A.

2015-01-01

The potassium-chloride co-transporter KCC2, encoded by SLC12A5, plays a fundamental role in fast synaptic inhibition by maintaining a hyperpolarizing gradient for chloride ions. KCC2 dysfunction has been implicated in human epilepsy, but to date, no monogenic KCC2-related epilepsy disorders have been described. Here we show recessive loss-of-function SLC12A5 mutations in patients with a severe infantile-onset pharmacoresistant epilepsy syndrome, epilepsy of infancy with migrating focal seizures (EIMFS). Decreased KCC2 surface expression, reduced protein glycosylation and impaired chloride extrusion contribute to loss of KCC2 activity, thereby impairing normal synaptic inhibition and promoting neuronal excitability in this early-onset epileptic encephalopathy. PMID:26333769

Inhibition of the Mitochondrial Glutamate Carrier SLC25A22 in Astrocytes Leads to Intracellular Glutamate Accumulation

Directory of Open Access Journals (Sweden)

Emmanuelle Goubert

2017-05-01

Full Text Available The solute carrier family 25 (SLC25 drives the import of a large diversity of metabolites into mitochondria, a key cellular structure involved in many metabolic functions. Mutations of the mitochondrial glutamate carrier SLC25A22 (also named GC1 have been identified in early epileptic encephalopathy (EEE and migrating partial seizures in infancy (MPSI but the pathophysiological mechanism of GC1 deficiency is still unknown, hampered by the absence of an in vivo model. This carrier is mainly expressed in astrocytes and is the principal gate for glutamate entry into mitochondria. A sufficient supply of energy is essential for the proper function of the brain and mitochondria have a pivotal role in maintaining energy homeostasis. In this work, we wanted to study the consequences of GC1 absence in an in vitro model in order to understand if glutamate catabolism and/or mitochondrial function could be affected. First, short hairpin RNA (shRNA designed to specifically silence GC1 were validated in rat C6 glioma cells. Silencing GC1 in C6 resulted in a reduction of the GC1 mRNA combined with a decrease of the mitochondrial glutamate carrier activity. Then, primary astrocyte cultures were prepared and transfected with shRNA-GC1 or mismatch-RNA (mmRNA constructs using the Neon® Transfection System in order to target a high number of primary astrocytes, more than 64%. Silencing GC1 in primary astrocytes resulted in a reduced nicotinamide adenine dinucleotide (Phosphate (NAD(PH formation upon glutamate stimulation. We also observed that the mitochondrial respiratory chain (MRC was functional after glucose stimulation but not activated by glutamate, resulting in a lower level of cellular adenosine triphosphate (ATP in silenced astrocytes compared to control cells. Moreover, GC1 inactivation resulted in an intracellular glutamate accumulation. Our results show that mitochondrial glutamate transport via GC1 is important in sustaining glutamate homeostasis in

Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

Science.gov (United States)

Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

2017-07-01

Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

SLC2A9 is a high-capacity urate transporter in humans.

Directory of Open Access Journals (Sweden)

Mark J Caulfield

2008-10-01

] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.

Upregulation of the Creatine Transporter Slc6A8 by Klotho

Directory of Open Access Journals (Sweden)

Ahmad Almilaji

2014-11-01

Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

Science.gov (United States)

Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

2017-04-01

A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.

Science.gov (United States)

Wijesena, Hiruni R; Schmutz, Sheila M

2015-01-01

Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: The Viva La Familia Study

Science.gov (United States)

Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it...

Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

Science.gov (United States)

Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

2017-10-01

Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

OpenAIRE

Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

2014-01-01

Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

Solute Carrier Family 26 Member a2 (slc26a2 Regulates Otic Development and Hair Cell Survival in Zebrafish.

Directory of Open Access Journals (Sweden)

Fei Liu

Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.

Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

Science.gov (United States)

Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

2018-06-15

Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

Science.gov (United States)

Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

2014-04-01

Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

Dicty_cDB: SLC484 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

Science.gov (United States)

Santos-Sacchi, Joseph; Song, Lei

2016-06-07

In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

Directory of Open Access Journals (Sweden)

Chi-Jiunn Pan

Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

Characterization of SLC transporters in human skin

Directory of Open Access Journals (Sweden)

Marion Alriquet

2015-03-01

Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

Science.gov (United States)

Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

2012-01-01

Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

Dicty_cDB: SLC478 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

Dicty_cDB: SLC448 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

Science.gov (United States)

Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

2012-01-01

Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

The solute carrier 6 family of transporters

DEFF Research Database (Denmark)

Bröer, Stefan; Gether, Ulrik

2012-01-01

of these transporters is associated with a variety of diseases. Pharmacological inhibition of the neurotransmitter transporters in this family is an important strategy in the management of neurological and psychiatric disorders. This review provides an overview of the biochemical and pharmacological properties......The solute carrier 6 (SLC6) family of the human genome comprises transporters for neurotransmitters, amino acids, osmolytes and energy metabolites. Members of this family play critical roles in neurotransmission, cellular and whole body homeostasis. Malfunction or altered expression...... of the SLC6 family transporters....

Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

Directory of Open Access Journals (Sweden)

Lindholm Carlström Eva

2012-05-01

Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

Directory of Open Access Journals (Sweden)

Naila Al Mahmuda

2016-05-01

Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

Science.gov (United States)

Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

2001-09-01

Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes

Directory of Open Access Journals (Sweden)

M. Vignesh

2016-11-01

Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.

AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

Directory of Open Access Journals (Sweden)

2005-09-01

= 250.44, p = 0.011. Similarly, significant association was observed between Tridimensional Personality Questionnaire Reward Dependence scores and AVPR1a RS1 (chi-square = 20.16, p = 0.01. Two-locus analysis (RS1 and RS3 conditional on HTTLPR and VNTR was highly significant (LRS = 162.95, p = 0.001. Promoter repeat regions in the AVPR1a gene have been robustly demonstrated to play a role in molding a range of social behaviors in many vertebrates and, more recently, in humans. Additionally, serotonergic neurotransmission in some human studies appears to mediate human religious and spiritual experiences. We therefore hypothesize that the association between AVPR1a and SLC6A4 reflects the social communication, courtship, and spiritual facets of the dancing phenotype rather than other aspects of this complex phenotype, such as sensorimotor integration.

AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

Directory of Open Access Journals (Sweden)

Rachel Bachner-Melman

2005-09-01

= 250.44, p = 0.011. Similarly, significant association was observed between Tridimensional Personality Questionnaire Reward Dependence scores and AVPR1a RS1 (chi-square = 20.16, p = 0.01. Two-locus analysis (RS1 and RS3 conditional on HTTLPR and VNTR was highly significant (LRS = 162.95, p = 0.001. Promoter repeat regions in the AVPR1a gene have been robustly demonstrated to play a role in molding a range of social behaviors in many vertebrates and, more recently, in humans. Additionally, serotonergic neurotransmission in some human studies appears to mediate human religious and spiritual experiences. We therefore hypothesize that the association between AVPR1a and SLC6A4 reflects the social communication, courtship, and spiritual facets of the dancing phenotype rather than other aspects of this complex phenotype, such as sensorimotor integration.

Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

LENUS (Irish Health Repository)

Murphy, Therese M

2012-02-01

BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

Assessing associations between the AURKA-HMMR-TPX2-TUBG1 functional module and breast cancer risk in BRCA1/2 mutation carriers.

Directory of Open Access Journals (Sweden)

Ignacio Blanco

Full Text Available While interplay between BRCA1 and AURKA-RHAMM-TPX2-TUBG1 regulates mammary epithelial polarization, common genetic variation in HMMR (gene product RHAMM may be associated with risk of breast cancer in BRCA1 mutation carriers. Following on these observations, we further assessed the link between the AURKA-HMMR-TPX2-TUBG1 functional module and risk of breast cancer in BRCA1 or BRCA2 mutation carriers. Forty-one single nucleotide polymorphisms (SNPs were genotyped in 15,252 BRCA1 and 8,211 BRCA2 mutation carriers and subsequently analyzed using a retrospective likelihood approach. The association of HMMR rs299290 with breast cancer risk in BRCA1 mutation carriers was confirmed: per-allele hazard ratio (HR = 1.10, 95% confidence interval (CI 1.04-1.15, p = 1.9 x 10(-4 (false discovery rate (FDR-adjusted p = 0.043. Variation in CSTF1, located next to AURKA, was also found to be associated with breast cancer risk in BRCA2 mutation carriers: rs2426618 per-allele HR = 1.10, 95% CI 1.03-1.16, p = 0.005 (FDR-adjusted p = 0.045. Assessment of pairwise interactions provided suggestions (FDR-adjusted pinteraction values > 0.05 for deviations from the multiplicative model for rs299290 and CSTF1 rs6064391, and rs299290 and TUBG1 rs11649877 in both BRCA1 and BRCA2 mutation carriers. Following these suggestions, the expression of HMMR and AURKA or TUBG1 in sporadic breast tumors was found to potentially interact, influencing patients' survival. Together, the results of this study support the hypothesis of a causative link between altered function of AURKA-HMMR-TPX2-TUBG1 and breast carcinogenesis in BRCA1/2 mutation carriers.

Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

Science.gov (United States)

Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

2009-11-01

The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

Solute carrier transporters: potential targets for digestive system neoplasms

OpenAIRE

Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang

2018-01-01

Jing Xie,1,2 Xiao Yan Zhu,1,2 Lu Ming Liu,1,2 Zhi Qiang Meng1,2 1Department of Integrative Oncology, Fudan University Shanghai Cancer Center, 2Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, People’s Republic of China Abstract: Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues o...

Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

Science.gov (United States)

Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

2011-02-01

We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

Science.gov (United States)

Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

2016-11-01

Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

Science.gov (United States)

Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

2015-04-03

Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

International Nuclear Information System (INIS)

Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

2009-01-01

Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

Directory of Open Access Journals (Sweden)

Kaifeng Yin

2017-05-01

Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

Joint linkage and association analysis with exome sequence data implicates SLC25A40 in hypertriglyceridemia.

Science.gov (United States)

Rosenthal, Elisabeth A; Ranchalis, Jane; Crosslin, David R; Burt, Amber; Brunzell, John D; Motulsky, Arno G; Nickerson, Deborah A; Wijsman, Ellen M; Jarvik, Gail P

2013-12-05

Hypertriglyceridemia (HTG) is a heritable risk factor for cardiovascular disease. Investigating the genetics of HTG may identify new drug targets. There are ~35 known single-nucleotide variants (SNVs) that explain only ~10% of variation in triglyceride (TG) level. Because of the genetic heterogeneity of HTG, a family study design is optimal for identification of rare genetic variants with large effect size because the same mutation can be observed in many relatives and cosegregation with TG can be tested. We considered HTG in a five-generation family of European American descent (n = 121), ascertained for familial combined hyperlipidemia. By using Bayesian Markov chain Monte Carlo joint oligogenic linkage and association analysis, we detected linkage to chromosomes 7 and 17. Whole-exome sequence data revealed shared, highly conserved, private missense SNVs in both SLC25A40 on chr7 and PLD2 on chr17. Jointly, these SNVs explained 49% of the genetic variance in TG; however, only the SLC25A40 SNV was significantly associated with TG (p = 0.0001). This SNV, c.374A>G, causes a highly disruptive p.Tyr125Cys substitution just outside the second helical transmembrane region of the SLC25A40 inner mitochondrial membrane transport protein. Whole-gene testing in subjects from the Exome Sequencing Project confirmed the association between TG and SLC25A40 rare, highly conserved, coding variants (p = 0.03). These results suggest a previously undescribed pathway for HTG and illustrate the power of large pedigrees in the search for rare, causal variants. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

rs1004819 is the main disease-associated IL23R variant in German Crohn's disease patients: combined analysis of IL23R, CARD15, and OCTN1/2 variants.

Directory of Open Access Journals (Sweden)

Jürgen Glas

Full Text Available BACKGROUND: The IL23R gene has been identified as a susceptibility gene for inflammatory bowel disease (IBD in the North American population. The aim of our study was to test this association in a large German IBD cohort and to elucidate potential interactions with other IBD genes as well as phenotypic consequences of IL23R variants. METHODS: Genomic DNA from 2670 Caucasian individuals including 833 patients with Crohn's disease (CD, 456 patients with ulcerative colitis (UC, and 1381 healthy unrelated controls was analyzed for 10 IL23R SNPs. Genotyping included the NOD2 variants p.Arg702Trp, p.Gly908Arg, and p.Leu1007fsX1008 and polymorphisms in SLC22A4/OCTN1 (1672 C-->T and SLC22A5/OCTN2 (-207 G-->C. RESULTS: All IL23R gene variants analyzed displayed highly significant associations with CD. The strongest association was found for the SNP rs1004819 [P = 1.92x10(-11; OR 1.56; 95 % CI (1.37-1.78]. 93.2% of the rs1004819 TT homozygous carriers as compared to 78% of CC wildtype carriers had ileal involvement [P = 0.004; OR 4.24; CI (1.46-12.34]. The coding SNP rs11209026 (p.Arg381Gln was protective for CD [P = 8.04x10(-8; OR 0.43; CI (0.31-0.59]. Similar, but weaker associations were found in UC. There was no evidence for epistasis between the IL23R gene and the CD susceptibility genes CARD15 and SLC22A4/5. CONCLUSION: IL23R is an IBD susceptibility gene, but has no epistatic interaction with CARD15 and SLC22A4/5. rs1004819 is the major IL23R variant associated with CD in the German population, while the p.Arg381Gln IL23R variant is a protective marker for CD and UC.

SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

Science.gov (United States)

Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

2017-07-01

Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

Mitochondrial oxodicarboxylate carrier deficiency is associated with mitochondrial DNA depletion and spinal muscular atrophy-like disease.

Science.gov (United States)

Boczonadi, Veronika; King, Martin S; Smith, Anthony C; Olahova, Monika; Bansagi, Boglarka; Roos, Andreas; Eyassu, Filmon; Borchers, Christoph; Ramesh, Venkateswaran; Lochmüller, Hanns; Polvikoski, Tuomo; Whittaker, Roger G; Pyle, Angela; Griffin, Helen; Taylor, Robert W; Chinnery, Patrick F; Robinson, Alan J; Kunji, Edmund R S; Horvath, Rita

2018-03-08

PurposeTo understand the role of the mitochondrial oxodicarboxylate carrier (SLC25A21) in the development of spinal muscular atrophy-like disease.MethodsWe identified a novel pathogenic variant in a patient by whole-exome sequencing. The pathogenicity of the mutation was studied by transport assays, computer modeling, followed by targeted metabolic testing and in vitro studies in human fibroblasts and neurons.ResultsThe patient carries a homozygous pathogenic variant c.695A>G; p.(Lys232Arg) in the SLC25A21 gene, encoding the mitochondrial oxodicarboxylate carrier, and developed spinal muscular atrophy and mitochondrial myopathy. Transport assays show that the mutation renders SLC25A21 dysfunctional and 2-oxoadipate cannot be imported into the mitochondrial matrix. Computer models of central metabolism predicted that impaired transport of oxodicarboxylate disrupts the pathways of lysine and tryptophan degradation, and causes accumulation of 2-oxoadipate, pipecolic acid, and quinolinic acid, which was confirmed in the patient's urine by targeted metabolomics. Exposure to 2-oxoadipate and quinolinic acid decreased the level of mitochondrial complexes in neuronal cells (SH-SY5Y) and induced apoptosis.ConclusionMitochondrial oxodicarboxylate carrier deficiency leads to mitochondrial dysfunction and the accumulation of oxoadipate and quinolinic acid, which in turn cause toxicity in spinal motor neurons leading to spinal muscular atrophy-like disease.GENETICS in MEDICINE advance online publication, 8 March 2018; doi:10.1038/gim.2017.251.

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

Science.gov (United States)

Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

2011-09-30

Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

Association of the solute carrier family 11 member 1 gene polymorphisms with susceptibility to leprosy in a Brazilian sample

Directory of Open Access Journals (Sweden)

Maria José Franco Brochado

2016-02-01

Full Text Available Natural resistance-associated macrophage protein 1/solute carrier family 11 member 1 gene (Nramp1/Slc11a1 is a gene that controls the susceptibility of inbred mice to intracellular pathogens. Polymorphisms in the human Slc11a1/Nramp1 gene have been associated with host susceptibility to leprosy. This study has evaluated nine polymorphisms of the Slc11a1/Nramp1 gene [(GTn, 274C/T, 469+14G/C, 577-18G/A, 823C/T, 1029 C/T, 1465-85G/A, 1703G/A, and 1729+55del4] in 86 leprosy patients (67 and 19 patients had the multibacillary and the paucibacillary clinical forms of the disease, respectively, and 239 healthy controls matched by age, gender, and ethnicity. The frequency of allele 2 of the (GTn polymorphism was higher in leprosy patients [p = 0.04, odds ratio (OR = 1.49], whereas the frequency of allele 3 was higher in the control group (p = 0.03; OR = 0.66. Patients carrying the 274T allele (p = 0.04; OR = 1.49 and TT homozygosis (p = 0.02; OR = 2.46, such as the 469+14C allele (p = 0.03; OR = 1.53 of the 274C/T and 469+14G/C polymorphisms, respectively, were more frequent in the leprosy group. The leprosy and control groups had similar frequency of the 577-18G/A, 823C/T, 1029C/T, 1465-85G/A, 1703G/A, and 1729+55del4 polymorphisms. The 274C/T polymorphism in exon 3 and the 469+14G/C polymorphism in intron 4 were associated with susceptibility to leprosy, while the allele 2 and 3 of the (GTn polymorphism in the promoter region were associated with susceptibility and protection to leprosy, respectively.

Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

Science.gov (United States)

Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

2017-07-05

Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

Science.gov (United States)

Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

2013-01-01

Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

Directory of Open Access Journals (Sweden)

Keijiro Mizukami

Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

Science.gov (United States)

Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

2016-11-01

The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

Energy Technology Data Exchange (ETDEWEB)

Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

2009-11-20

Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

SLC-2000: A luminosity upgrade for the SLC

International Nuclear Information System (INIS)

Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

1996-01-01

We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

Expression of RFC/SLC19A1 is associated with tumor type in bladder cancer patients.

Directory of Open Access Journals (Sweden)

Alyaa M Abdel-Haleem

Full Text Available Urinary bladder cancer (UBC ranks ninth in worldwide cancer. In Egypt, the pattern of bladder cancer is unique in that both the transitional and squamous cell types prevail. Despite much research on the topic, it is still difficult to predict tumor progression, optimal therapy and clinical outcome. The reduced folate carrier (RFC/SLC19A1 is the major transport system for folates in mammalian cells and tissues. RFC is also the primary means of cellular uptake for antifolate cancer chemotherapeutic drugs, however, membrane transport of antifolates by RFC is considered as limiting to antitumor activity. The purpose of this study was to compare the mRNA expression level of RFC/SLC19A1 in urothelial and non-urothelial variants of bladder carcinomas. Quantification of RFC mRNA in the mucosa of 41 untreated bladder cancer patients was performed using RT-qPCR. RFC mRNA steady-state levels were ∼9-fold higher (N = 39; P<0.0001 in bladder tumor specimens relative to normal bladder mRNA. RFC upregulation was strongly correlated with tumor type (urothelial vs. non-urothelial; p<0.05 where median RFC mRNA expression was significantly (p<0.05 higher in the urothelial (∼14-fold compared to the non-urothelial (∼4-fold variant. This may account for the variation in response to antifolate-containing regimens used in the treatment of either type. RFC mRNA levels were not associated with tumor grade (I, II and III or stage (muscle-invasive vs. non-muscle invasive implying that RFC cannot be used for prognostic purposes in bladder carcinomas and its increased expression is an early event in human bladder tumors pathogenesis. Further, RFC can be considered as a potential marker for predicting response to antifolate chemotherapy in urothelial carcinomas.

Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

Science.gov (United States)

DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

2015-07-10

Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

Science.gov (United States)

Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

2016-01-01

To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

Directory of Open Access Journals (Sweden)

Beever Jonathan E

2010-05-01

Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

Science.gov (United States)

Archer, N S; Nassif, N T; O'Brien, B A

2015-06-01

A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

Directory of Open Access Journals (Sweden)

Yan Xiaofei

2011-09-01

Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

Science.gov (United States)

Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

2016-08-08

Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

Directory of Open Access Journals (Sweden)

Etienne Masle-Farquhar

2017-05-01

Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

Science.gov (United States)

Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

2018-04-12

Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

Science.gov (United States)

Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

2015-01-01

Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

Directory of Open Access Journals (Sweden)

Yuan-Zong Song

Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

Association between SLC19A1 Gene Polymorphism and High Dose Methotrexate Toxicity in Childhood Acute Lymphoblastic Leukaemia and Non Hodgkin Malignant Lymphoma: Introducing a Haplotype based Approach

Science.gov (United States)

Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina

2017-01-01

Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125

Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

Directory of Open Access Journals (Sweden)

Mark W Neff

Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

Science.gov (United States)

Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

2017-03-15

Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

DEFF Research Database (Denmark)

Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

2011-01-01

The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

Science.gov (United States)

Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

2018-01-01

The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

Science.gov (United States)

Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

2017-07-01

To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Zinc-Associated Variant in SLC30A8 Gene Interacts With Gestational Weight Gain on Postpartum Glycemic Changes: A Longitudinal Study in Women With Prior Gestational Diabetes Mellitus.

Science.gov (United States)

Wang, Tiange; Liu, Huikun; Wang, Leishen; Huang, Tao; Li, Weiqin; Zheng, Yan; Heianza, Yoriko; Sun, Dianjianyi; Leng, Junhong; Zhang, Shuang; Li, Nan; Hu, Gang; Qi, Lu

2016-12-01

Zinc transporter 8 genetic variant SLC30A8 has been associated with postpartum risk of type 2 diabetes among women with gestational diabetes mellitus (GDM). Gestational weight gain is one of the strongest risk factors for postpartum hyperglycemia. We assessed the interaction between type 2 diabetes-associated SLC30A8 rs13266634 and gestational weight gain on 1-5 years of postpartum glycemic changes in 1,071 women with prior GDM in a longitudinal study. Compared with gestation of 26-30 weeks, postpartum levels of fasting glucose, oral glucose tolerance test 2-h glucose, and hemoglobin A 1c (HbA 1c ) increased across rs13266634 TT, CT, and CC genotypes in women with excessive gestational weight gain, whereas opposite genetic associations were found in women with inadequate or adequate gestational weight gain. Postpartum changes in fasting glucose per additional copy of the C allele were -0.18, -0.04, and 0.12 mmol/L in women with inadequate, adequate, and excessive gestational weight gain, respectively (P for interaction = 0.002). We also found similar interactions for changes in 2-h glucose and HbA 1c (P for interaction = 0.003 and 0.005, respectively). Our data indicate that gestational weight gain may modify SLC30A8 variant on long-term glycemic changes, highlighting the importance of gestational weight control in the prevention of postpartum hyperglycemia in women with GDM. © 2016 by the American Diabetes Association.

Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

Science.gov (United States)

Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

2017-07-01

Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

The pulsed amplitude unit for the SLC

International Nuclear Information System (INIS)

Rolfe, J.; Browne, M.J.; Jobe, R.K.

1987-02-01

There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital Converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU is a part of the system that controls the output of Klystrons in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

The pulsed amplitude unit for the SLC

International Nuclear Information System (INIS)

Rolfe, J.; Browne, M.J.; Jobe, R.K.

1987-01-01

There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU at is as part of the system that controls the output of Klystorns in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

Directory of Open Access Journals (Sweden)

Sughondhabirom Atapol

2007-10-01

Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

Science.gov (United States)

Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

2015-06-11

ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

Directory of Open Access Journals (Sweden)

Dongsha Wang

Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

Solute carrier transporters: potential targets for digestive system neoplasms.

Science.gov (United States)

Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang

2018-01-01

Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues of digestive systems and mediate specific uptake of small molecule substrates in facilitative manner. Given the important role of SLC proteins in maintaining normal functions of digestive system, dysregulation of these protein in digestive system neoplasms may deliver biological and clinical significance that deserves systemic studies. In this review, we critically summarized the recent advances in understanding the role of SLC proteins in digestive system neoplasms. We highlighted that several SLC subfamilies, including metal ion transporters, transporters of glucose and other sugars, transporters of urea, neurotransmitters and biogenic amines, ammonium and choline, inorganic cation/anion transporters, transporters of nucleotide, amino acid and oligopeptide organic anion transporters, transporters of vitamins and cofactors and mitochondrial carrier, may play important roles in mediating the initiation, progression, metastasis, and chemoresistance of digestive system neoplasms. Proteins in these SLC subfamilies may also have diagnostic and prognostic values to particular cancer types. Differential expression of SLC proteins in tumors of digestive system was analyzed by extracting data from human cancer database, which revealed that the roles of SLC proteins may either be dependent on the substrates they transport or be tissue specific. In addition, small molecule modulators that pharmacologically regulate the functions of SLC proteins were discussed for their possible application in the treatment of digestive system neoplasms. This review highlighted the potential of SLC family proteins as drug target for the treatment of digestive system neoplasms.

Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

Science.gov (United States)

Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

2018-01-01

The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

Mitochondrial glutamate carriers from Drosophila melanogaster: biochemical, evolutionary and modeling studies.

Science.gov (United States)

Lunetti, Paola; Cappello, Anna Rita; Marsano, René Massimiliano; Pierri, Ciro Leonardo; Carrisi, Chiara; Martello, Emanuela; Caggese, Corrado; Dolce, Vincenza; Capobianco, Loredana

2013-10-01

The mitochondrial carriers are members of a family of transport proteins that mediate solute transport across the inner mitochondrial membrane. Two isoforms of the glutamate carriers, GC1 and GC2 (encoded by the SLC25A22 and SLC25A18 genes, respectively), have been identified in humans. Two independent mutations in SLC25A22 are associated with severe epileptic encephalopathy. In the present study we show that two genes (CG18347 and CG12201) phylogenetically related to the human GC encoding genes are present in the D. melanogaster genome. We have functionally characterized the proteins encoded by CG18347 and CG12201, designated as DmGC1p and DmGC2p respectively, by overexpression in Escherichia coli and reconstitution into liposomes. Their transport properties demonstrate that DmGC1p and DmGC2p both catalyze the transport of glutamate across the inner mitochondrial membrane. Computational approaches have been used in order to highlight residues of DmGC1p and DmGC2p involved in substrate binding. Furthermore, gene expression analysis during development and in various adult tissues reveals that CG18347 is ubiquitously expressed in all examined D. melanogaster tissues, while the expression of CG12201 is strongly testis-biased. Finally, we identified mitochondrial glutamate carrier orthologs in 49 eukaryotic species in order to attempt the reconstruction of the evolutionary history of the glutamate carrier function. Comparison of the exon/intron structure and other key features of the analyzed orthologs suggests that eukaryotic glutamate carrier genes descend from an intron-rich ancestral gene already present in the common ancestor of lineages that diverged as early as bilateria and radiata. © 2013.

Genaesthics : Breast Surgery in BRCA1/2 Gene Mutation Carriers

NARCIS (Netherlands)

V.M.T. van Verschuer (Victorien)

2017-01-01

markdownabstractThe present thesis focuses on breast surgery in BRCA1/2 gene mutation carriers. The topics that are studied vary broadly, representing the multiple disciplines that are involved in the diagnostic work-up and treatment of BRCA1/2-associated breast cancer. The first part contains

No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

Science.gov (United States)

González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

2015-01-01

Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

A customized pigmentation SNP array identifies a novel SNP associated with melanoma predisposition in the SLC45A2 gene.

Directory of Open Access Journals (Sweden)

Maider Ibarrola-Villava

Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.

Do BRCA1/2 mutation carriers have an earlier onset of natural menopause?

Science.gov (United States)

van Tilborg, Theodora C; Broekmans, Frank J; Pijpe, Anouk; Schrijver, Lieske H; Mooij, Thea M; Oosterwijk, Jan C; Verhoef, Senno; Gómez Garcia, Encarna B; van Zelst-Stams, Wendy A; Adank, Muriel A; van Asperen, Christi J; van Doorn, Helena C; van Os, Theo A; Bos, Anna M; Rookus, Matti A; Ausems, Margreet G

2016-08-01

It has been hypothesized that BRCA1/2 mutation carriers have an earlier age at natural menopause (ANM), although to date findings are inconclusive. This study assessed the influence of BRCA mutation status on ANM, and aimed to explore the reasons of inconsistency in the literature. Cross-sectional assessment from an ongoing nationwide cohort study among members of BRCA1/2 mutated families. Information was obtained by a standardized questionnaire. Kaplan-Meier curves were constructed, and Cox regression was used to assess the association between BRCA1/2 mutation status and ANM. Adjustments were made for birth cohort, family, smoking, use of hormonal contraceptives, and parity. A total of 1,208 BRCA1/2 mutation carriers and 2,211 proven noncarriers were included. Overall, no association was found between BRCA1/2 mutation status and ANM (adjusted hazard ratio [HR] = 1.06 [95% CI, 0.87-1.30]). We examined if the null finding was due to informative censoring by uptake of risk-reducing salpingo-oophorectomy. Indeed, within the oldest birth cohort, in which the percentage of surgical menopause events was lowest and comparable between carriers and noncarriers, the HR for earlier natural menopause in carriers was 1.45 (95% CI, 1.09-1.94). The second oldest birth cohort, however, demonstrated a decreased HR (0.67 [95% CI, 0.46-0.98]), and thus no trend over birth cohorts was found. Various types of selection bias hamper the comparison of ANM between BRCA1/2 mutation carriers and noncarriers, genetically tested in the clinic.

Hearing-loss-associated gene detection in neonatal intensive care unit.

Science.gov (United States)

Yang, S M; Liu, Ying; Liu, C; Yin, A H; Wu, Y F; Zheng, X E; Yang, H M; Yang, J

2018-02-01

To investigate the frequency and mutation spectrum of hearing loss-associated gene mutation in Neonatal Intensive Care Unit (NICU). Neonates (n=2305) admitted to NICU were enrolled in this study. Nine prominent hearing loss-associated genes, GJB2 (35 del G, 176 del 16,235 del C, 299 del AT), GJB3 (538 C > T), SLC26A4 (IVS7-2A > G, 2168 A > G) and mtDNA 12S rRNA(1555 A > G, 1494 C > T), were detected. There were 73 cases hearing-loss-associated gene mutation among 2305 cases, the mutation frequency was 3.1%, with 40 cases GJB2 (235del C) mutation (54.8%), 6 cases GJB2 (299 del AT) mutation (8.2%), 21 cases SLC26A4 (IVS 7-2 A > G) mutation (28.7%), 4 cases SLC26A4 (2168 A > G) mutation (5.5%), 2 cases of GJB2 (235del C) combined SLC26A4 (IVS 7-2 A > G, 2168 A > G) mutation (2.8%). Among 73 gene mutation cases, preterm neonates presented in 18 cases, accounting for 24.7% (18/73); hyperbilirubinemia in 13 cases, accounting for 17.8% (13/73); Torch Syndrome in 15 cases, with 12 cases CMV, 2 cases rubella, 1 case toxoplasm, respectively, totally accounting for 20.54% (15/73); neonatal pneumonia in 12 cases, accounting for 16.4% (12/73); birth asphyxia in 5 cases, accounting for 6.9% (5/73); sepsis in 5 cases, accounting for 6.9% (5/73); others in 5 cases, accounting for 6.8% (5/73) . The frequency of hearing loss-associated gene mutation was higher in NICU.There were hearing loss-associated gene mutations in the NICU, suggesting this mutation may complicate with perinatal high-risk factors.

Pathogenic mutations of the human mitochondrial citrate carrier SLC25A1 lead to impaired citrate export required for lipid, dolichol, ubiquinone and sterol synthesis.

Science.gov (United States)

Majd, Homa; King, Martin S; Smith, Anthony C; Kunji, Edmund R S

2018-01-01

Missense mutations of the human mitochondrial citrate carrier, encoded by the SLC25A1 gene, lead to an autosomal recessive neurometabolic disorder characterised by neonatal-onset encephalopathy with severe muscular weakness, intractable seizures, respiratory distress, and lack of psychomotor development, often resulting in early death. Here, we have measured the effect of all twelve known pathogenic mutations on the transport activity. The results show that nine mutations abolish transport of citrate completely, whereas the other three reduce the transport rate by >70%, indicating that impaired citrate transport is the most likely primary cause of the disease. Some mutations may be detrimental to the structure of the carrier, whereas others may impair key functional elements, such as the substrate binding site and the salt bridge network on the matrix side of the carrier. To understand the consequences of impaired citrate transport on metabolism, the substrate specificity was also determined, showing that the human citrate carrier predominantly transports citrate, isocitrate, cis-aconitate, phosphoenolpyruvate and malate. Although D-2- and L-2 hydroxyglutaric aciduria is a metabolic hallmark of the disease, it is unlikely that the citrate carrier plays a significant role in the removal of hydroxyglutarate from the cytosol for oxidation to oxoglutarate in the mitochondrial matrix. In contrast, computer simulations of central metabolism predict that the export of citrate from the mitochondrion cannot be fully compensated by other pathways, restricting the cytosolic production of acetyl-CoA that is required for the synthesis of lipids, sterols, dolichols and ubiquinone, which in turn explains the severe disease phenotypes. Copyright © 2017. Published by Elsevier B.V.

Common variants related to serum uric acid concentrations are associated with glucose metabolism and insulin secretion in a Chinese population.

Directory of Open Access Journals (Sweden)

Xue Sun

Full Text Available Elevated serum uric acid concentration is an independent risk factor and predictor of type 2 diabetes (T2D. Whether the uric acid-associated genes have an impact on T2D remains unclear. We aimed to investigate the effects of the uric acid-associated genes on the risk of T2D as well as glucose metabolism and insulin secretion.We recruited 2,199 normal glucose tolerance subjects from the Shanghai Diabetes Study I and II and 2,999 T2D patients from the inpatient database of Shanghai Diabetes Institute. Fifteen single nucleotide polymorphisms (SNPs mapped in or near 11 loci (PDZK1, GCKR, LRP2, SLC2A9, ABCG2, LRRC16A, SLC17A1, SLC17A3, SLC22A11, SLC22A12 and SF1 were genotyped and serum biochemical parameters related to uric acid and T2D were determined.SF1 rs606458 showed strong association to T2D in both males and females (p = 0.034 and 0.0008. In the males, LRRC16A was associated with 2-h insulin and insulin secretion (p = 0.009 and 0.009. SLC22A11 was correlated with HOMA-B and insulin secretion (p = 0.048 and 0.029. SLC2A9 rs3775948 was associated with 2-h glucose (p = 0.043. In the females, LRP2 rs2544390 and rs1333049 showed correlations with fasting insulin, HOMA-IR and insulin secretion (p = 0.028, 0.033 and 0.052 and p = 0.034, 0.047 and 0.038, respectively. SLC2A9 rs11722228 was correlated with 2-h glucose, 2-h insulin and insulin secretion (p = 0.024, 0.049 and 0.049, respectively.Our results indicated that the uric acid-associated genes have an impact on the risk of T2D, glucose metabolism and insulin secretion in a Chinese population.

Mirror extreme BMI phenotypes associated with gene dosage at the chromosome 16p11.2 locus

Science.gov (United States)

Jacquemont, Sébastien; Reymond, Alexandre; Zufferey, Flore; Harewood, Louise; Walters, Robin G.; Kutalik, Zoltán; Martinet, Danielle; Shen, Yiping; Valsesia, Armand; Beckmann, Noam D.; Thorleifsson, Gudmar; Belfiore, Marco; Bouquillon, Sonia; Campion, Dominique; De Leeuw, Nicole; De Vries, Bert B. A.; Esko, Tõnu; Fernandez, Bridget A.; Fernández-Aranda, Fernando; Fernández-Real, José Manuel; Gratacòs, Mònica; Guilmatre, Audrey; Hoyer, Juliane; Jarvelin, Marjo-Riitta; Kooy, Frank R.; Kurg, Ants; Le Caignec, Cédric; Männik, Katrin; Platt, Orah S.; Sanlaville, Damien; Van Haelst, Mieke M.; Villatoro Gomez, Sergi; Walha, Faida; Wu, Bai-Lin; Yu, Yongguo; Aboura, Azzedine; Addor, Marie-Claude; Alembik, Yves; Antonarakis, Stylianos E.; Arveiler, Benoît; Barth, Magalie; Bednarek, Nathalie; Béna, Frédérique; Bergmann, Sven; Beri, Mylène; Bernardini, Laura; Blaumeiser, Bettina; Bonneau, Dominique; Bottani, Armand; Boute, Odile; Brunner, Han G.; Cailley, Dorothée; Callier, Patrick; Chiesa, Jean; Chrast, Jacqueline; Coin, Lachlan; Coutton, Charles; Cuisset, Jean-Marie; Cuvellier, Jean-Christophe; David, Albert; De Freminville, Bénédicte; Delobel, Bruno; Delrue, Marie-Ange; Demeer, Bénédicte; Descamps, Dominique; Didelot, Gérard; Dieterich, Klaus; Disciglio, Vittoria; Doco-Fenzy, Martine; Drunat, Séverine; Duban-Bedu, Bénédicte; Dubourg, Christèle; El-Sayed Moustafa, Julia S.; Elliott, Paul; Faas, Brigitte H. W.; Faivre, Laurence; Faudet, Anne; Fellmann, Florence; Ferrarini, Alessandra; Fisher, Richard; Flori, Elisabeth; Forer, Lukas; Gaillard, Dominique; Gerard, Marion; Gieger, Christian; Gimelli, Stefania; Gimelli, Giorgio; Grabe, Hans J.; Guichet, Agnès; Guillin, Olivier; Hartikainen, Anna-Liisa; Heron, Délphine; Hippolyte, Loyse; Holder, Muriel; Homuth, Georg; Isidor, Bertrand; Jaillard, Sylvie; Jaros, Zdenek; Jiménez-Murcia, Susana; Joly Helas, Géraldine; Jonveaux, Philippe; Kaksonen, Satu; Keren, Boris; Kloss-Brandstätter, Anita; Knoers, Nine V. A. M.; Koolen, David A.; Kroisel, Peter M.; Kronenberg, Florian; Labalme, Audrey; Landais, Emilie; Lapi, Elisabetta; Layet, Valérie; Legallic, Solenn; Leheup, Bruno; Leube, Barbara; Lewis, Suzanne; Lucas, Josette; Macdermot, Kay D.; Magnusson, Pall; Marshall, Christian R.; Mathieu-Dramard, Michèle; Mccarthy, Mark I.; Meitinger, Thomas; Antonietta Mencarelli, Maria; Merla, Giuseppe; Moerman, Alexandre; Mooser, Vincent; Morice-Picard, Fanny; Mucciolo, Mafalda; Nauck, Matthias; Coumba Ndiaye, Ndeye; Nordgren, Ann; Pasquier, Laurent; Petit, Florence; Pfundt, Rolph; Plessis, Ghislaine; Rajcan-Separovic, Evica; Paolo Ramelli, Gian; Rauch, Anita; Ravazzolo, Roberto; Reis, Andre; Renieri, Alessandra; Richart, Cristobal; Ried, Janina S.; Rieubland, Claudine; Roberts, Wendy; Roetzer, Katharina M.; Rooryck, Caroline; Rossi, Massimiliano; Saemundsen, Evald; Satre, Véronique; Schurmann, Claudia; Sigurdsson, Engilbert; Stavropoulos, Dimitri J.; Stefansson, Hreinn; Tengström, Carola; Thorsteinsdóttir, Unnur; Tinahones, Francisco J.; Touraine, Renaud; Vallée, Louis; Van Binsbergen, Ellen; Van Der Aa, Nathalie; Vincent-Delorme, Catherine; Visvikis-Siest, Sophie; Vollenweider, Peter; Völzke, Henry; Vulto-Van Silfhout, Anneke T.; Waeber, Gérard; Wallgren-Pettersson, Carina; Witwicki, Robert M.; Zwolinksi, Simon; Andrieux, Joris; Estivill, Xavier; Gusella, James F.; Gustafsson, Omar; Metspalu, Andres; Scherer, Stephen W.; Stefansson, Kari; Blakemore, Alexandra I. F.; Beckmann, Jacques S.; Froguel, Philippe

2011-01-01

Both underweight and obesity have been associated with increased mortality1,2. Underweight, defined as body mass index (BMI) ≤ 18,5 kg/m2 in adults 3 and ≤ −2 standard deviations (SD) in children4,5, is the main sign of a series of heterogeneous clinical conditions such as failure to thrive (FTT) 6–8, feeding and eating disorder and/or anorexia nervosa9,10. In contrast to obesity, few genetic variants underlying these clinical conditions have been reported 11, 12. We previously demonstrated that hemizygosity of a ~600 kb region on the short arm of chromosome 16 (chr16:29.5–30.1Mb), causes a highly-penetrant form of obesity often associated with hyperphagia and intellectual disabilities13. Here we show that the corresponding reciprocal duplication is associated with underweight. We identified 138 (132 novel cases) duplication carriers (108 unrelated carriers) from over 95,000 individuals clinically-referred for developmental or intellectual disabilities (DD/ID), psychiatric disorders or recruited from population-based cohorts. These carriers show significantly reduced postnatal weight (mean Z-score −0.6; p=4.4×10−4) and BMI (mean Z-score −0.5; p=2.0×10−3). In particular, half of the boys younger than 5 years are underweight with a probable diagnosis of FTT, while adult duplication carriers have an 8.7-fold (p=5.9×10−11; CI_95=[4.5–16.6]) increased risk of being clinically underweight. We observe a significant trend towards increased severity in males, as well as a depletion of male carriers among non-medically ascertained cases. These features are associated with an unusually high frequency of selective and restrictive feeding behaviours and a significant reduction in head circumference (mean Z-score −0.9; p=7.8×10−6). Each of the observed phenotypes is the converse of one reported in carriers of deletions at this locus, correlating with changes in transcript levels for genes mapping within the duplication but not within flanking

[The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

Science.gov (United States)

Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

2014-01-01

We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

Haplotype analysis of TP53 polymorphisms, Arg72Pro and Ins16, in BRCA1 and BRCA2 mutation carriers of French Canadian descent

International Nuclear Information System (INIS)

Cavallone, Luca; Arcand, Suzanna L; Maugard, Christine; Ghadirian, Parviz; Mes-Masson, Anne-Marie; Provencher, Diane; Tonin, Patricia N

2008-01-01

The TP53 polymorphisms Arg72Pro (Ex4+199 G>C) and Ins16 (IVS3+24 ins16) have been proposed to modify risk of breast cancer associated with germline BRCA1 and BRCA2 mutations. Allele frequencies of these polymorphisms were investigated to determine if they modify risk in BRCA mutation carriers in breast cancer cases drawn from French Canadian cancer families, a population shown to exhibit strong founder effects. The frequencies of the TP53 alleles, genotypes and haplotypes of 157 index breast cancer cases comprised of 42 BRCA1 mutation carriers, 57 BRCA2 mutation carriers, and 58 BRCA mutation-negative cases, where each case was drawn from independently ascertained families were compared. The effect of TP53 variants on the age of diagnosis was also investigated for these groups. The TP53 polymorphisms were also investigated in 112 women of French Canadian descent with no personal history of cancer. The BRCA mutation-positive groups had the highest frequency of homozygous carriers of the 72Pro allele compared with mutation-negative group. The TP53 polymorphisms exhibited linkage disequilibrium (p < 0.001), where the 72Arg and Ins16minus alleles occurred in strong disequilibrium. The highest frequency of carriers of Ins16minus-72Arg haplotype occurred in the BRCA mutation-negative groups. The BRCA1 mutation carriers homozygous for the 72Pro allele had the youngest ages of diagnosis of breast cancer. However none of these observations were statistically significant. In contrast, the BRCA2 mutation carriers homozygous for the 72Pro allele had a significantly older age of diagnosis of breast cancer (p = 0.018). Moreover, in this group, the mean age of diagnosis of breast cancer in carriers of the Ins16minus-72Arg haplotype was significantly younger than that of the individuals who did not this carry this haplotype (p = 0.009). We observed no significant association of breast cancer risk with TP53 genetic variants based on BRCA1/2 mutation carrier status. Although the

Meiotic and pedigree segregation analyses in carriers of t(4;8)(p16;p23.1) differing in localization of breakpoint positions at 4p subband 4p16.3 and 4p16.1.

Science.gov (United States)

Midro, Alina T; Zollino, Marcella; Wiland, Ewa; Panasiuk, Barbara; Iwanowski, Piotr S; Murdolo, Marina; Śmigiel, Robert; Sąsiadek, Maria; Pilch, Jacek; Kurpisz, Maciej

2016-02-01

The purpose of this study was to compare meiotic segregation in sperm cells from two carriers with t(4;8)(p16;p23.1) reciprocal chromosome translocations (RCTs), differing in localization of the breakpoint positions at the 4p subband-namely, 4p16.3 (carrier 1) and 4p16.1 (carrier 2)-and to compare data of the pedigree analyses performed by direct method. Three-color fluorescent in situ hybridization (FISH) on sperm cells and FISH mapping for the evaluation of the breakpoint positions, data from pedigrees, and direct segregation analysis of the pedigrees were performed. Similar proportions of normal/balanced and unbalanced sperm cells were found in both carriers. The most common was an alternate type of segregation (about 52 % and about 48 %, respectively). Unbalanced adjacent I and adjacent II karyotypes were found in similar proportions about 15 %. The direct segregation analysis (following Stengel-Rutkowski) of the pedigree of carriers of t(4;8)(p16.1;p23.1) was performed and results were compared with the data of the pedigree segregation analysis obtained earlier through the indirect method. The probability of live-born progeny with unbalanced karyotype for carriers of t(4;8)(p16.1;p23.1) was moderately high at 18.8 %-comparable to the value obtained using the indirect method for the same carriership, which was 12 %. This was, however, markedly lower than the value of 41.2 % obtained through the pedigree segregation indirect analysis estimated for carriers of t(4;8)(p16.3;p23.1), perhaps due to the unique composition of genes present within the 4p16.1-4p 16.3 region. Revealed differences in pedigree segregation analysis did not correspond to the very similar profile of meiotic segregation patterns presented by carrier 1 and carrier 2. Most probably, such discordances may be due to differences in embryo survival rates arising from different genetic backgrounds.

The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

Science.gov (United States)

Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

2015-09-01

Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

Science.gov (United States)

Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

2016-10-03

The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

Common variants at 12p11, 12q24, 9p21, 9q31.2 and in ZNF365 are associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers

Science.gov (United States)

2012-01-01

Introduction Several common alleles have been shown to be associated with breast and/or ovarian cancer risk for BRCA1 and BRCA2 mutation carriers. Recent genome-wide association studies of breast cancer have identified eight additional breast cancer susceptibility loci: rs1011970 (9p21, CDKN2A/B), rs10995190 (ZNF365), rs704010 (ZMIZ1), rs2380205 (10p15), rs614367 (11q13), rs1292011 (12q24), rs10771399 (12p11 near PTHLH) and rs865686 (9q31.2). Methods To evaluate whether these single nucleotide polymorphisms (SNPs) are associated with breast cancer risk for BRCA1 and BRCA2 carriers, we genotyped these SNPs in 12,599 BRCA1 and 7,132 BRCA2 mutation carriers and analysed the associations with breast cancer risk within a retrospective likelihood framework. Results Only SNP rs10771399 near PTHLH was associated with breast cancer risk for BRCA1 mutation carriers (per-allele hazard ratio (HR) = 0.87, 95% CI: 0.81 to 0.94, P-trend = 3 × 10-4). The association was restricted to mutations proven or predicted to lead to absence of protein expression (HR = 0.82, 95% CI: 0.74 to 0.90, P-trend = 3.1 × 10-5, P-difference = 0.03). Four SNPs were associated with the risk of breast cancer for BRCA2 mutation carriers: rs10995190, P-trend = 0.015; rs1011970, P-trend = 0.048; rs865686, 2df-P = 0.007; rs1292011 2df-P = 0.03. rs10771399 (PTHLH) was predominantly associated with estrogen receptor (ER)-negative breast cancer for BRCA1 mutation carriers (HR = 0.81, 95% CI: 0.74 to 0.90, P-trend = 4 × 10-5) and there was marginal evidence of association with ER-negative breast cancer for BRCA2 mutation carriers (HR = 0.78, 95% CI: 0.62 to 1.00, P-trend = 0.049). Conclusions The present findings, in combination with previously identified modifiers of risk, will ultimately lead to more accurate risk prediction and an improved understanding of the disease etiology in BRCA1 and BRCA2 mutation carriers. PMID:22348646

Global transcriptome profiling identifies KLF15 and SLC25A10 as modifiers of adipocytes insulin sensitivity in obese women.

Directory of Open Access Journals (Sweden)

Agné Kulyté

Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in

Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

Directory of Open Access Journals (Sweden)

Mychaleckyj Josyf C

2005-12-01

Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

Science.gov (United States)

Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

2017-04-01

The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

Science.gov (United States)

Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

2013-01-01

To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

Resonance states in 16O+16O, 12C+16O, α+ 16O and α+ 12C with ...

Indian Academy of Sciences (India)

The resonance states in 16O + 16O, 12C + 16O, + 16O and + 12C are described using modified Morse potential proposed earlier whose success has already been demon-strated in the case of 12C + 12C system. The general validity of such a potential with long range, shallow depth and repulsive soft core determined ...

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

Science.gov (United States)

Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

2010-01-01

Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

De Novo Mutations in SLC25A24 Cause a Craniosynostosis Syndrome with Hypertrichosis, Progeroid Appearance, and Mitochondrial Dysfunction.

Science.gov (United States)

Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe

2017-11-02

Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

Dicty_cDB: SLC402 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

Dicty_cDB: SLC481 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

International Nuclear Information System (INIS)

Tan, Hua-Zhen; Wu, Zhi-Yong; Wu, Jian-Yi; Long, Lin; Jiao, Ji-Wei; Peng, Yu-Hui; Xu, Yi-Wei; Li, Shan-Shan; Wang, Wei; Zhang, Jian-Jun; Li, En-Min; Xu, Li-Yan

2016-01-01

SLC52A3 was recently identified as a susceptibility gene for esophageal squamous cell carcinoma (ESCC). However, associations between the single nucleotide polymorphisms (SNPs) rs13042395 (C > T) and rs3746803 (G > A) in SLC52A3 and risk, tumor characteristics and survival of ESCC patients remain inconclusive and of unknown prognostic significance. Analyses of the association between SNPs in SLC52A3 and ESCC risk were performed on 479 ESCC cases, together with 479 controls, in a case-control study. Blood samples for cases and controls were collected and genotyped by real-time polymerase chain reaction (PCR) using TaqMan assays. Among the 479 ESCC cases, 343 cases with complete clinical data were used to investigate the association between SNPs and ESCC clinical characteristics; 288 cases with complete clinical data and 5-year follow-up data were used to analyze the association between SNPs and prognosis. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSAs) were used to investigate the biological function of rs13042395. No association was found between SLC52A3 rs3746803 and susceptibility, tumor characteristics or survival of ESCC patients. For rs13042395, TT genotype carriers were likely to have reduced lymph node metastasis (odds ratio (OR) = 0.55, 95 % confidence interval (CI), 0.31–0.98) and longer relapse-free survival time (P = 0.03) . Also, both rs13042395 (hazard ratio (HR) = 0.62, 95 % CI, 0.38–0.99) and regional lymph node metastasis (HR = 2.06, 95 % CI, 1.36–3.13 for N1 vs. N0; HR = 2.88, 95 % CI, 1.70–4.86 for N2 vs. N0; HR = 2.08, 95 % CI, 1.01–4.30 for N3 vs. N0) were independent factors affecting relapse-free survival for ESCC patients who underwent surgery. Dual luciferase reporter assays and EMSAs suggested that the CC genotype of rs13042395 enhanced SLC52A3 expression, probably via binding with specific transcription factors. The rs13042395 polymorphism in SLC52A3 is associated with regional lymph node

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Dicty_cDB: SLC405 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Dicty_cDB: SLC424 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC411 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

DEFF Research Database (Denmark)

Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

2012-01-01

ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

Science.gov (United States)

Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

2016-04-01

Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dicty_cDB: SLC420 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

Directory of Open Access Journals (Sweden)

Ana Osorio

2014-04-01

Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Directory of Open Access Journals (Sweden)

Anna Rita Cappello

2018-04-01

Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Science.gov (United States)

Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

2018-04-01

The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

DEFF Research Database (Denmark)

Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

2013-01-01

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

Science.gov (United States)

Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

2017-01-01

Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.

Science.gov (United States)

Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel

2013-12-05

Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Investigation of SLC6A4 gene expression in autism spectrum disorders

Directory of Open Access Journals (Sweden)

Elif Funda Şener

2015-06-01

Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

Recent SLC developments

International Nuclear Information System (INIS)

Ross, M.

1993-04-01

The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

Dicty_cDB: SLC495 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC429 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

Dicty_cDB: SLC428 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

Dicty_cDB: SLC494 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

Dicty_cDB: SLC418 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

Genaesthics : Breast Surgery in BRCA1/2 Gene Mutation Carriers

OpenAIRE

Verschuer, Victorien

2017-01-01

markdownabstractThe present thesis focuses on breast surgery in BRCA1/2 gene mutation carriers. The topics that are studied vary broadly, representing the multiple disciplines that are involved in the diagnostic work-up and treatment of BRCA1/2-associated breast cancer. The first part contains studies on molecular and prognostic tumor characteristics in breast cancer. The thesis continues with an anatomical study on safety of prophylactic mastectomy, and finishes with studies on aesthetics an...

An Integrated Enterprise Accelerator Database for the SLC Control System

International Nuclear Information System (INIS)

2002-01-01

Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations

Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

Science.gov (United States)

Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

2018-03-05

Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

Dicty_cDB: SLC483 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Dicty_cDB: SLC469 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

Dicty_cDB: SLC452 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

Directory of Open Access Journals (Sweden)

Onkar Singh

Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC455 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

Dicty_cDB: SLC492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

Oral contraceptives and breast cancer risk in the international BRCA1/2 carrier cohort study

DEFF Research Database (Denmark)

Brohet, Richard M; Goldgar, David E; Easton, Douglas F

2007-01-01

PURPOSE Earlier studies have shown that endogenous gonadal hormones play an important role in the etiology of breast cancer among BRCA1/2 mutation carriers. So far, little is known about the safety of exogenous hormonal use in mutation carriers. In this study, we examined the association between ...

Dicty_cDB: SLC442 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC456 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

Dicty_cDB: SLC438 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

Dicty_cDB: SLC480 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

Dicty_cDB: SLC466 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

Dicty_cDB: SLC461 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

Dicty_cDB: SLC437 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

Dicty_cDB: SLC444 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

Dicty_cDB: SLC490 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC433 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

Dicty_cDB: SLC496 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

Dicty_cDB: SLC449 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

Science.gov (United States)

Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

2010-01-01

Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

SLC and SLD: Experimental experience with a linear collider

International Nuclear Information System (INIS)

Breidenbach, M.

1993-08-01

The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

Overexpression of monocarboxylate transporter-1 (Slc16a1) in mouse pancreatic ß-cells leads to relative hyperinsulinism during exercise

DEFF Research Database (Denmark)

Pullen, Timothy J; Sylow, Lykke; Sun, Gao

2012-01-01

Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...

A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

Directory of Open Access Journals (Sweden)

Paige A Winkler

Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.

Science.gov (United States)

Dai, Dong-Wei; Lu, Qiong; Wang, Lai-Xing; Zhao, Wen-Yuan; Cao, Yi-Qun; Li, Ya-Nan; Han, Guo-Sheng; Liu, Jian-Min; Yue, Zhi-Jian

2013-10-14

MiR-106a is frequently down-regulated in various types of human cancer. However the underlying mechanism of miR-106a involved in glioma remains elusive. The association of miR-106a with glioma grade and patient survival was analyzed. The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a-mediated cell glycolysis and proliferation. Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. SLC2A3 was identified as a core target of miR-106a in GBM cells. Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. In addition, for each biological process we identified ontology-associated transcripts that significantly correlated with SLC2A3 expression. Finally, the expression of SLC2A3 largely abrogated miR-106a-mediated cell proliferation and glucose uptake in GBM cells. Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM.

The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

Directory of Open Access Journals (Sweden)

Nadia Bayou

2008-01-01

We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

ρ0 Cells Feature De-Ubiquitination of SLC Transporters and Increased Levels and Fluxes of Amino Acids

Directory of Open Access Journals (Sweden)

André Bordinassi Medina

2017-04-01

Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.

SLC energy spectrum monitor using synchrotron radiation

International Nuclear Information System (INIS)

Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

1986-01-01

The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986

SLC energy spectrum monitor using synchrotron radiation

International Nuclear Information System (INIS)

Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

1986-04-01

The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

Advances in coherent optical modems and 16-QAM transmission with feedforward carrier recovery

Science.gov (United States)

Noé, Reinhold; Hoffmann, Sebastian; Wördehoff, Christian; Al-Bermani, Ali; El-Darawy, Mohamed

2011-01-01

Polarization multiplexing and quadrature phase shift keying (QPSK) both double spectral efficiency. Combined with synchronous coherent polarization diverse intradyne receivers this modulation format is ultra-robust and cost-efficient. A feedforward carrier recovery is required in order to tolerate phase noise of normal DFB lasers. Signal processing in the digital domain permits compensation of at least chromatic and polarization mode dispersion. Some companies have products on the market, others are working on them. For 100 GbE transmission, 50 GHz channel spacing is sufficient. 16ary quadrature amplitude modulation (16-QAM) is attractive to double capacity once more, possibly in a modulation format flexible transponder which is switched down to QPSK only if system margin is too low. For 16-QAM the phase noise problem is sharply increased. However, also here a feedforward carrier recovery has been implemented. A number of carrier phase angles is tested in parallel, and the recovered data is selected for that phase angle where squared distance of recovered data to the nearest constellation point, averaged over a number of symbols, is minimum. An intradyne/selfhomodyne synchronous coherent 16-QAM experiment (2.5 Gb/s, 81 km) is presented.

Kicker for the SLC electron damping ring

International Nuclear Information System (INIS)

Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.

1987-01-01

The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see

Study of the alpha+12C →16O capture via 12C(16O,12C)16O transfer reaction

International Nuclear Information System (INIS)

Morais, M.C.; Lichtenthaeler, R.; Arazi, A.; Hojman, D.; Cardona, M.A.; Fimiani, L.; Carnelli, P.F.; Marti, G.V.; Pacheco, A.J.; Heimann, D. Martinez; Negri, A.E.; Capurro, O.A.; Niello, J.O. Fernandez; Montero, P.

2009-01-01

Full text: The 12 C(α γ) 16 O reaction is one of the most important in nuclear astrophysics. The rate of this reaction influences the subsequent nucleosynthesis of heavier elements in massive stars and consequently determines the stellar evolution. The 12 C(α γ) 16 O reaction cross section is extremely small at stellar temperature, this is mainly due to the Gamow energy (∼ 300KeV at T= 2x10 8 K) be much lower than the Coulomb barrier, E C.B. : = 3:142MeV. The α+ 12 C → 16 O at low energies is dominated by subthreshold states (1 - , 7:12MeV) and (2 + , 6:92MeV) of the 16 O, thus spectroscopic factors measurements of these states are very important. We propose to use the α-transfer reaction 12 C( 16 O, 12 C) 16 O * at very forward angles to obtain those spectroscopic factors. In this way, measurements of elastic and inelastic angular distributions for the 12 C+ 16 O system were performed at the TANDAR Laboratory in Buenos Aires, using an 16 O beam of E lab = 46.3MeV. These angular distributions were obtained using 8 adjacent surface barrier detectors and the measurements were performed from 5 deg to 48.5 deg with steps of 1 deg. The scattering chamber has an angular precision better than 0.1 deg. The transfer angular distributions are being analysed by DWBA using the computer code FRESCO in order to obtain the two spectroscopic factors. (author)

The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

Science.gov (United States)

Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

2014-09-18

SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

Directory of Open Access Journals (Sweden)

Quirino Cordeiro

2010-10-01

Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

Positive selection in the SLC11A1 gene in the family Equidae

DEFF Research Database (Denmark)

Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

2016-01-01

Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

Comparison of age at natural menopause in BRCA1/2 mutation carriers with a non-clinic-based sample of women in northern California.

Science.gov (United States)

Lin, Wayne T; Beattie, Mary; Chen, Lee-May; Oktay, Kutluk; Crawford, Sybil L; Gold, Ellen B; Cedars, Marcelle; Rosen, Mitchell

2013-05-01

Germline mutations in BRCA1 and BRCA2 (BRCA1/2) are related to an increased lifetime risk of developing breast and ovarian cancer. Although risk-reducing salpingo-oophorectomy reduces the risk of both cancers, loss of fertility is a major concern. A recent study suggested an association between BRCA1 mutation and occult primary ovarian insufficiency. The objective of the current study was to determine whether BRCA1/2 mutation carriers have an earlier onset of natural menopause compared with unaffected women. White carriers of the BRCA1/2 gene (n = 382) were identified within the Breast Cancer Risk Program Registry at the University of California at San Francisco and compared with non-clinic-based white women in northern California (n = 765). The 2 groups were compared with regard to median age at the time of natural menopause before and after adjustment for known risk factors, and the role of smoking within each group was examined using the Kaplan-Meier approach for unadjusted analyses and Cox proportional hazards regression analyses for adjusted analyses. The median age at the time of natural menopause in the BRCA1/2 carriers was significantly younger than among the unaffected sample (50 years vs 53 years; P < .001). The unadjusted hazard ratio for natural menopause when comparing BRCA1/2 carriers with unaffected women was 4.06 (95% confidence interval, 3.03-5.45) and was 3.98 (95% confidence interval, 2.87-5.53) after adjusting for smoking, parity, and oral contraceptive use. For BRCA1/2 carriers who were current heavy smokers (smoking ≥ 20 cigarettes/day), the median age at natural menopause was 46 years versus 49 years for nonsmokers (P = .027). The BRCA1/2 mutation was associated with a significantly earlier age at natural menopause, and heavy smoking compounded this risk. Because the relationship between menopause and the end of natural fertility is considered to be fixed, these findings suggest the risk of earlier infertility among BRCA1/2 carriers

Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

Directory of Open Access Journals (Sweden)

Markus Grube

2018-04-01

Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

16 CFR 16.12 - Termination of advisory committees.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Termination of advisory committees. 16.12 Section 16.12 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE...) Its duration is otherwise provided by law; (b) It is renewed in accordance with § 16.13 of this part...

Slc39a7/zip7 plays a critical role in development and zinc homeostasis in zebrafish.

Directory of Open Access Journals (Sweden)

Guang Yan

Full Text Available BACKGROUND: Slc39a7/Zip7, also known as Ke4, is a member of solute carrier family 39 (Slc39a and plays a critical role in regulating cell growth and death. Because the function of Zip7 in vivo was unclear, the present study investigated the function of zip7 in vertebrate development and zinc metabolism using zebrafish as a model organism. PRINCIPAL FINDING: Using real-time PCR to determine the gene expression pattern of zip7 during zebrafish development, we found that zip7 mRNA is expressed throughout embryonic development and into maturity. Interestingly, whole mount in situ hybridization revealed that while zip7 mRNA is ubiquitously expressed until 12 hours post-fertilization (hpf; at 24 hpf and beyond, zip7 mRNA was specifically detected only in eyes. Morpholino-antisense (MO gene knockdown assay revealed that downregulation of zip7 expression resulted in several morphological defects in zebrafish including decreased head size, smaller eyes, shorter palates, and shorter and curved spinal cords. Analysis by synchrotron radiation X-ray fluorescence (SR-XRF showed reduced concentrations of zinc in brain, eyes, and gills of zip7-MO-injected embryos. Furthermore, incubation of the zip7 knockdown embryos in a zinc-supplemented solution was able to rescue the MO-induced morphological defects. SIGNIFICANCE: Our data suggest that zip7 is required for eye, brain, and skeleton formation during early embryonic development in zebrafish. Moreover, zinc supplementation can partially rescue defects resulting from zip7 gene knockdown. Taken together, our data provide critical insight into a novel function of zip7 in development and zinc homeostasis in vivo in zebrafish.

Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

Directory of Open Access Journals (Sweden)

Thomas Lundåsen

Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

22 CFR 16.12 - Hearing.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Hearing. 16.12 Section 16.12 Foreign Relations DEPARTMENT OF STATE PERSONNEL FOREIGN SERVICE GRIEVANCE SYSTEM § 16.12 Hearing. (a) Appearances and... reasonable number of agency representatives, are entitled to be present at the hearing. The Grievance Board...

Structure in the 12C+ 12C and 8Be+16O fission width distribution of 24Mg observed via the reaction 12C(16O,α)24Mg(→X+Y)

International Nuclear Information System (INIS)

Lazzarini, A.J.; Steadman, S.G.; Ledoux, R.J.; Sperduto, A.; Young, G.R.; Van Bibber, K.; Cosman, E.R.

1983-01-01

Prominent gross and intermediate width structures are observed in the 12 C+ 12 C, 12 C+ 12 C((2 + ), 1 C((2 + )+ 12 C((2 + ), 8 Be+ 16 O, and 8 Be+ 16 O + (3 - , O + ) decay channels following 24 Mg* population via the 12 C( 16 O,α) 24 Mg reaction at E/sub c.m./ = 33 MeV. Evidence that the 12 C( 16 O,α) 24 Mg reaction populates states in 24 Mg which are associated with 12 C+ 12 C resonances is presented in the form of correlation analyses between the α+ 12 C+ 12 C three-body spectra and previously measured 12 C+ 12 C elastic and inelastic excitation functions. Direct determination of 12 C+ 12 C widths from these measurements is obscured by a background of other strong transitions which appear to be present in the 12 C( 16 O,α) 24 Mg singles spectrum

Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

Science.gov (United States)

Thurtle-Schmidt, Bryan H; Stroud, Robert M

2016-09-20

Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

Science.gov (United States)

Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

2017-05-30

Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

Association of a serotonin transporter gene (SLC6A4) 5-HTTLPR polymorphism with body mass index categories but not type 2 diabetes mellitus in Mexicans

Science.gov (United States)

Peralta-Leal, Valeria; Leal-Ugarte, Evelia; Meza-Espinoza, Juan P.; Dávalos-Rodríguez, Ingrid P.; Bocanegra-Alonso, Anabel; Acosta-González, Rosa I.; Gonzales, Enrique; Nair, Saraswathy; Durán-González, Jorge

2012-01-01

The serotonergic system has been hypothesized to contribute to the biological susceptibility to type 2 diabetes mellitus (T2DM) and body-mass index (BMI) categories. We investigate a possible association of 5-HTTLPR polymorphism (L and S alleles) in the promoter region of the serotonin transporter gene (SLC6A4) with the development of T2DM and/or higher BMI by analyzing a sample of 138 individuals diagnosed with T2DM and 172 unrelated controls from the Mexican general population. In the total sample genotypes were distributed according to Hardy-Weinberg equilibrium, and S allele frequency was 0.58. There was no statistical association between 5-HTTLPR polymorphism and the development of T2DM in this Mexican population sample (p = 0.12). Nevertheless, logistic regression analysis of the L allele and increased BMI disclosed an association, after adjusting for age, sex and T2DM (p = 0.02, OR 1.74, 95% CI: 1.079–2.808). PMID:23055796

Feedback systems in the SLC

International Nuclear Information System (INIS)

Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

1987-02-01

Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

Science.gov (United States)

Zhong, Xi Zoë; Cao, Qi; Sun, Xue

2016-01-01

Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

Family-Based Association Study Between SLC2A1, HK1, and LEPR Polymorphisms With Myelomeningocele in Chile

Science.gov (United States)

Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva

2013-01-01

Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181

SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

DEFF Research Database (Denmark)

Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

2007-01-01

Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

Associations of serum uric acid and SLC2A9 variant with depressive and anxiety disorders: a population-based study.

Directory of Open Access Journals (Sweden)

Tanica Lyngdoh

Full Text Available Limited information exists regarding the association between serum uric acid (SUA and psychiatric disorders. We explored the relationship between SUA and subtypes of major depressive disorder (MDD and specific anxiety disorders. Additionally, we examined the association of SLC2A9 rs6855911 variant with anxiety disorders.We conducted a cross-sectional analysis on 3,716 individuals aged 35-66 years previously selected for the population-based CoLaus survey and who agreed to undergo further psychiatric evaluation. SUA was measured using uricase-PAP method. The French translation of the semi-structured Diagnostic Interview for Genetic Studies was used to establish lifetime and current diagnoses of depression and anxiety disorders according to the DSM-IV criteria.Men reported significantly higher levels of SUA compared to women (357±74 µmol/L vs. 263±64 µmol/L. The prevalence of lifetime and current MDD was 44% and 18% respectively while the corresponding estimates for any anxiety disorders were 18% and 10% respectively. A quadratic hockey-stick shaped curve explained the relationship between SUA and social phobia better than a linear trend. However, with regards to the other specific anxiety disorders and other subtypes of MDD, there was no consistent pattern of association. Further analyses using SLC2A9 rs6855911 variant, known to be strongly associated with SUA, supported the quadratic relationship observed between SUA phenotype and social phobia.A quadratic relationship between SUA and social phobia was observed consistent with a protective effect of moderately elevated SUA on social phobia, which disappears at higher concentrations. Further studies are needed to confirm our observations.

Common breast cancer susceptibility alleles and the risk of breast cancer for BRCA1 and BRCA2 mutation carriers: implications for risk prediction

DEFF Research Database (Denmark)

Antoniou, Antonis C; Beesley, Jonathan; McGuffog, Lesley

2010-01-01

The known breast cancer susceptibility polymorphisms in FGFR2, TNRC9/TOX3, MAP3K1, LSP1, and 2q35 confer increased risks of breast cancer for BRCA1 or BRCA2 mutation carriers. We evaluated the associations of 3 additional single nucleotide polymorphisms (SNPs), rs4973768 in SLC4A7/NEK10, rs650495...

Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Ming LEI

2012-01-01

Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.

Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

Science.gov (United States)

Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

2015-07-01

The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

Directory of Open Access Journals (Sweden)

Amy J Osborne

Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification

Science.gov (United States)

Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús

2014-01-01

Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463

12 CFR 541.16 - Improved residential real estate.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Improved residential real estate. 541.16... REGULATIONS AFFECTING FEDERAL SAVINGS ASSOCIATIONS § 541.16 Improved residential real estate. The term improved residential real estate means residential real estate containing offsite or other improvements...

Regulators of Slc4 bicarbonate transporter activity

Directory of Open Access Journals (Sweden)

Ian M. Thornell

2015-06-01

Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

Exposure to diagnostic radiation and risk of breast cancer among carriers of BRCA1/2 mutations: retrospective cohort study (GENE-RAD-RISK)

NARCIS (Netherlands)

Pijpe, Anouk; Andrieu, Nadine; Easton, Douglas F.; Kesminiene, Ausrele; Cardis, Elisabeth; Noguès, Catherine; Gauthier-Villars, Marion; Lasset, Christine; Fricker, Jean-Pierre; Peock, Susan; Frost, Debra; Evans, D. Gareth; Eeles, Rosalind A.; Paterson, Joan; Manders, Peggy; van Asperen, Christi J.; Ausems, Margreet G. E. M.; Meijers-Heijboer, Hanne; Thierry-Chef, Isabelle; Hauptmann, Michael; Goldgar, David; Rookus, Matti A.; van Leeuwen, Flora E.; Fourme, Emmanuelle; Lidereau, Rosette; Stevens, Denise; Stoppa-Lyonnet, Dominique; Chompret, Agnès; Berthet, Pascaline; Luporsi, Elisabeth; Bonadona, Valérie; Gauducheau, René; de Sienne, Catherine; Lortholary, Alain; Frénay, Marc; Faivre, Laurence; Sobol, Hagay; Huiart, Laetitia; Longy, Michel; Nguyen, Tan Dat; Gladieff, Laurence; Guimbaud, Rosine; Gesta, Paul; Vennin, Philippe; Adenis, Claude; Chevrier, Annie; Rossi, Annick; Perrin, Jean; Bignon, Yves-Jean; Limacher, Jean-Marc; Dugast, Catherine; Courlancy, Polyclinique; Demange, Liliane; Zattara-Cannoni, Hélène; Dreyfus, Hélène; Noruzinia, Mehrdad; Venat-Bouvet, Laurence; Cook, Margaret; Oliver, Clare; Gregory, Helen; Cole, Trevor; Burgess, Lucy; Rogers, Mark; Hughes, Lisa; Brewer, Carole; Davidson, Rosemarie; Bradshaw, Nicola; Izatt, Louise; Pichert, Gabriella; Langman, Caroline; Chu, Carol; Miller, Julie; Evans, Gareth; Lalloo, Fiona; Shenton, Andrew; Side, Lucy; Bancroft, Elizabeth; Page, Elizabeth; Castro, Elena; Houlston, Richard; Rahman, Nazneen; Shanley, Susan; Cook, Jackie; Baxter, Lauren; Hodgson, Shirley; Goff, Sheila; Eccles, Diana; Verhoef, Senno; Brohet, Richard; Hogervorst, Frans; van 't Veer, Laura; van Leeuwen, Flora; Rookus, Matti; Collée, Margriet; van den Ouweland, Ans; Kriege, Mieke; Schutte, Mieke; Hooning, Maartje; Seynaeve, Caroline; Tollenaar, Rob; van Asperen, Christi; Wijnen, Juul; Devilee, Peter; Ligtenberg, Marjolijn; Ausems, Margreet; van der Luijt, Rob; Aalfs, Cora; van Os, Theo; Gille, Hans; Gomez-Garcia, Encarna; Blok, Rien; Oosterwijk, Jan; van der Hout, Annemiek; Vasen, Hans; van Leeuwen, Inge

2012-01-01

To estimate the risk of breast cancer associated with diagnostic radiation in carriers of BRCA1/2 mutations. Retrospective cohort study (GENE-RAD-RISK). Three nationwide studies (GENEPSO, EMBRACE, HEBON) in France, United Kingdom, and the Netherlands, 1993 female carriers of BRCA1/2 mutations

Inconspicuous insertion 22;12 in myxoid/round cell liposarcoma accompanied by the secondary structural abnormality der(16)t(1;16).

Science.gov (United States)

Birch, Nathan C; Antonescu, Cristina R; Nelson, Marilu; Sarran, Lisa; Neff, James R; Seemayer, Thomas; Bridge, Julia A

2003-08-01

In myxoid/round cell liposarcoma, the t(12;16)(q13;p11) and its associated fusion transcript, FUS-CHOP, characterize greater than 95% of cases. The variant translocation t(12;22)(q13;q12) and associated EWS-CHOP fusion transcript are rare. A second non-random aberration observed in roughly 20% of Ewing's sarcomas, and to a lesser extent other select sarcomas, is the unbalanced 1;16 translocation. Recognition of this secondary aberration in the absence of an obvious primary karyotypic abnormality strongly suggests that the use of other genetic approaches will be informative in uncovering a clinically suspected primary anomaly. The following case illustrates the utility of molecular cytogenetic and reverse transcriptase-polymerase chain reaction techniques in diagnosing an ins(22;12)(q12;q13q14) and associated EWS-CHOP fusion transcript in a myxoid/round cell liposarcoma exhibiting a der(16)t(1;16)(q11;q11).

NCBI nr-aa BLAST: CBRC-DYAK-02-0020 [SEVENS

Lifescience Database Archive (English)

Full Text Available 12 (potassium/chloride transporters), member 9 (SLC12A9) [Danio rerio] emb|CAM14083.1| novel protein to ver...tebrate solute carrier family 12 (potassium/chloride transporters), member 9 (SLC12A9) [Danio rerio] CAM14224.1 1e-123 51% ...

Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

Science.gov (United States)

Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

2012-06-01

Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

The association of reduced folate carrier 80G>A polymorphism to outcome in childhood acute lymphoblastic leukemia interacts with chromosome 21 copy number

DEFF Research Database (Denmark)

Gregers, Jannie; Christensen, Ib Jarle; Dalhoff, Kim

2010-01-01

with chromosome 21 copy number in the leukemic clone. A total of 500 children with acute lymphoblastic leukemia treated according to the common Nordic treatment protocols were included, and we found that the RFC AA variant was associated with a 50% better chance of staying in remission compared with GG or GA......The reduced folate carrier (RFC) is involved in the transport of methotrexate (MTX) across the cell membrane. The RFC gene (SLC19A1) is located on chromosome 21, and we hypothesized that the RFC80 G>A polymorphism would affect outcome and toxicity in childhood leukemia and that this could interact...... variants (P = .046). Increased copy numbers of chromosome 21 appear to improve outcome also in children with GA or GG variant. In a subset of 182 children receiving 608 high-dose MTX courses, we observed higher degree of bone marrow toxicity in patients with the RFC AA variant compared with GA/GG variants...

From early stress to 12-month development in very preterm infants: Preliminary findings on epigenetic mechanisms and brain growth.

Science.gov (United States)

Fumagalli, Monica; Provenzi, Livio; De Carli, Pietro; Dessimone, Francesca; Sirgiovanni, Ida; Giorda, Roberto; Cinnante, Claudia; Squarcina, Letizia; Pozzoli, Uberto; Triulzi, Fabio; Brambilla, Paolo; Borgatti, Renato; Mosca, Fabio; Montirosso, Rosario

2018-01-01

Very preterm (VPT) infants admitted to Neonatal Intensive Care Unit (NICU) are at risk for altered brain growth and less-than-optimal socio-emotional development. Recent research suggests that early NICU-related stress contributes to socio-emotional impairments in VPT infants at 3 months through epigenetic regulation (i.e., DNA methylation) of the serotonin transporter gene (SLC6A4). In the present longitudinal study we assessed: (a) the effects of NICU-related stress and SLC6A4 methylation variations from birth to discharge on brain development at term equivalent age (TEA); (b) the association between brain volume at TEA and socio-emotional development (i.e., Personal-Social scale of Griffith Mental Development Scales, GMDS) at 12 months corrected age (CA). Twenty-four infants had complete data at 12-month-age. SLC6A4 methylation was measured at a specific CpG previously associated with NICU-related stress and socio-emotional stress. Findings confirmed that higher NICU-related stress associated with greater increase of SLC6A4 methylation at NICU discharge. Moreover, higher SLC6A4 discharge methylation was associated with reduced anterior temporal lobe (ATL) volume at TEA, which in turn was significantly associated with less-than-optimal GMDS Personal-Social scale score at 12 months CA. The reduced ATL volume at TEA mediated the pathway linking stress-related increase in SLC6A4 methylation at NICU discharge and socio-emotional development at 12 months CA. These findings suggest that early adversity-related epigenetic changes might contribute to the long-lasting programming of socio-emotional development in VPT infants through epigenetic regulation and structural modifications of the developing brain.

Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

Science.gov (United States)

Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

2011-01-01

Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

Science.gov (United States)

Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

2012-11-01

Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

Quantifying the relative contributions of different solute carriers to aggregate substrate transport

Science.gov (United States)

Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria

2017-01-01

Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567

Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

DEFF Research Database (Denmark)

Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

2012-01-01

BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

Adding PCs to SLC Control System

International Nuclear Information System (INIS)

Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

1993-05-01

The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

Directory of Open Access Journals (Sweden)

Hassan Brim

Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

Effects of 16 genetic variants on fasting glucose and type 2 diabetes in South Asians: ADCY5 and GLIS3 variants may predispose to type 2 diabetes.

Directory of Open Access Journals (Sweden)

Simon D Rees

Full Text Available BACKGROUND: The Meta-Analysis of Glucose and Insulin related traits Consortium (MAGIC recently identified 16 loci robustly associated with fasting glucose, some of which were also associated with type 2 diabetes. The purpose of our study was to explore the role of these variants in South Asian populations of Punjabi ancestry, originating predominantly from the District of Mirpur, Pakistan. METHODOLOGY/PRINCIPAL FINDINGS: Sixteen single nucleotide polymorphisms (SNPs were genotyped in 1678 subjects with type 2 diabetes and 1584 normoglycaemic controls from two Punjabi populations; one resident in the UK and one indigenous to the District of Mirpur. In the normoglycaemic controls investigated for fasting glucose associations, 12 of 16 SNPs displayed β values with the same direction of effect as that seen in European studies, although only the SLC30A8 rs11558471 SNP was nominally associated with fasting glucose (β = 0.063 [95% CI: 0.013, 0.113] p = 0.015. Of interest, the MTNR1B rs10830963 SNP displayed a negative β value for fasting glucose in our study; this effect size was significantly lower than that seen in Europeans (p = 1.29×10(-4. In addition to previously reported type 2 diabetes risk variants in TCF7L2 and SLC30A8, SNPs in ADCY5 (rs11708067 and GLIS3 (rs7034200 displayed evidence for association with type 2 diabetes, with odds ratios of 1.23 (95% CI: 1.09, 1.39; p = 9.1×10(-4 and 1.16 (95% CI: 1.05, 1.29; p = 3.49×10(-3 respectively. CONCLUSIONS/SIGNIFICANCE: Although only the SLC30A8 rs11558471 SNP was nominally associated with fasting glucose in our study, the finding that 12 out of 16 SNPs displayed a direction of effect consistent with European studies suggests that a number of these variants may contribute to fasting glucose variation in individuals of South Asian ancestry. We also provide evidence for the first time in South Asians that alleles of SNPs in GLIS3 and ADCY5 may confer risk of type 2 diabetes.

SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

Directory of Open Access Journals (Sweden)

Hassen Hadj-Kacem

2010-01-01

Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

15 CFR 16.12 - Consumer education.

Science.gov (United States)

2010-01-01

... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Consumer education. 16.12 Section 16.12 Commerce and Foreign Trade Office of the Secretary of Commerce PROCEDURES FOR A VOLUNTARY CONSUMER PRODUCT INFORMATION LABELING PROGRAM § 16.12 Consumer education. The Secretary, in close cooperation and...

Kicker thyratron experience from SLC

International Nuclear Information System (INIS)

Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

1991-05-01

The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

Energy Technology Data Exchange (ETDEWEB)

Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

1995-12-10

The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

Directory of Open Access Journals (Sweden)

Fabian R. Reimold

2015-06-01

Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

Science.gov (United States)

Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

2018-05-15

Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

Separation of carrier-free 181Re produced in 16O-irradiated thulium target

International Nuclear Information System (INIS)

Lahiri, Susanta; Mukhopadhyay, Krishnendu; Banerjee, Kakoli; Ramaswami, A.; Manohar, S.B.

2001-01-01

Heavy ion activation of natural Tm 2 O 3 with 90 MeV 16 O beam results in the formation of carrier-free short-lived 181 Ir and 181 Os which ultimately decay out to 181 Re in the matrix. The liquid cation exchanger, HDEHP, has effectively been utilized as an extractant for quantitative separation of bulk thulium target matrix from carrier-free rhenium radionuclide