Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.
Johnson, Eric A
2013-09-01
Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary
Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik
2015-02-01
Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.
A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts
Kreger-van Rij, N.J.W.; Veenhuis, M.
1971-01-01
The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the
The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans
Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.
2005-01-01
Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...
Laich, Federico; Vaca, Inmaculada; Chávez, Renato
2013-10-01
During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T) = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.
The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans
Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.
2012-01-01
Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466
Directory of Open Access Journals (Sweden)
Liang Huo
2018-02-01
Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.
Bacterial communities in the fruit bodies of ground basidiomycetes
Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.
2015-06-01
Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.
Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai
2010-10-01
The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.
Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell Capell, Teresa; Sandmann, Gerhard; Christou, Paul
2014-01-01
Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, th...
Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul
2014-04-01
Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.
Proteomic analysis of Rhodotorula mucilaginosa: dealing with the issues of a non-conventional yeast.
Addis, Maria Filippa; Tanca, Alessandro; Landolfo, Sara; Abbondio, Marcello; Cutzu, Raffaela; Biosa, Grazia; Pagnozzi, Daniela; Uzzau, Sergio; Mannazzu, Ilaria
2016-08-01
Red yeasts ascribed to the species Rhodotorula mucilaginosa are gaining increasing attention, due to their numerous biotechnological applications, spanning carotenoid production, liquid bioremediation, heavy metal biotransformation and antifungal and plant growth-promoting actions, but also for their role as opportunistic pathogens. Nevertheless, their characterization at the 'omic' level is still scarce. Here, we applied different proteomic workflows to R. mucilaginosa with the aim of assessing their potential in generating information on proteins and functions of biotechnological interest, with a particular focus on the carotenogenic pathway. After optimization of protein extraction, we tested several gel-based (including 2D-DIGE) and gel-free sample preparation techniques, followed by tandem mass spectrometry analysis. Contextually, we evaluated different bioinformatic strategies for protein identification and interpretation of the biological significance of the dataset. When 2D-DIGE analysis was applied, not all spots returned a unambiguous identification and no carotenogenic enzymes were identified, even upon the application of different database search strategies. Then, the application of shotgun proteomic workflows with varying levels of sensitivity provided a picture of the information depth that can be reached with different analytical resources, and resulted in a plethora of information on R. mucilaginosa metabolism. However, also in these cases no proteins related to the carotenogenic pathway were identified, thus indicating that further improvements in sequence databases and functional annotations are strictly needed for increasing the outcome of proteomic analysis of this and other non-conventional yeasts. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Sônia C. Melo
2015-06-01
Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.
Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.
2010-01-01
During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.
Marty, I; Bureau, S; Sarkissian, G; Gouble, B; Audergon, J M; Albagnac, G
2005-07-01
In order to elucidate the regulation mechanisms of carotenoid biosynthesis in apricot fruit (Prunus armeniaca), carotenoid content and carotenogenic gene expression were analysed as a function of ethylene production in two colour-contrasted apricot varieties. Fruits from Goldrich (GO) were orange, while Moniqui (MO) fruits were white. Biochemical analysis showed that GO accumulated precursors of the uncoloured carotenoids, phytoene and phytofluene, and the coloured carotenoid, beta-carotene, while Moniqui (MO) fruits only accumulated phytoene and phytofluene but no beta-carotene. Physiological analysis showed that ethylene production was clearly weaker in GO than in MO. Carotenogenic gene expression (Psy-1, Pds, and Zds) and carotenoid accumulation were measured with respect to ethylene production which is initiated in mature green fruits at the onset of the climacteric stage or following exo-ethylene or ethylene-receptor inhibitor (1-MCP) treatments. Results showed (i) systematically stronger expression of carotenogenic genes in white than in orange fruits, even for the Zds gene involved in beta-carotene synthesis that is undetectable in MO fruits, (ii) ethylene-induction of Psy-1 and Pds gene expression and the corresponding product accumulation, (iii) Zds gene expression and beta-carotene production independent of ethylene. The different results obtained at physiological, biochemical, and molecular levels revealed the complex regulation of carotenoid biosynthesis in apricots and led to suggestions regarding some possible ways to regulate it.
Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes
Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.
2014-01-01
SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937
Fungicide selective for basidiomycetes.
Edgington, L V; Walton, G S; Miller, P M
1966-07-15
Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.
Directory of Open Access Journals (Sweden)
Cheng-Siang Wong
2013-09-01
Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.
The yeast flora of some decaying mushrooms on trunks of living trees
Middelhoven, W.J.
2004-01-01
Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii
Comparative Genome Analysis of Basidiomycete Fungi
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor
2012-03-19
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.
Directory of Open Access Journals (Sweden)
Marie Desnos-Ollivier
Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.
Yeasts associated with fresh and frozen pulps of Brazilian tropical fruits.
Trindade, Rita C; Resende, Maria Aparecida; Silva, Claudia M; Rosa, Carlos A
2002-08-01
The occurrence of yeasts on ripe fruits and frozen pulps of pitanga (Eugenia uniflora L), mangaba (Hancornia speciosa Gom.), umbu (Spondias tuberosa Avr. Cam.), and acerola (Malpighia glaba L) was verified. The incidence of proteolytic, pectinolytic, and mycocinogenic yeasts on these communities was also determined. A total of 480 colonies was isolated and grouped in 405 different strains. These corresponded to 42 ascomycetous and 28 basidiomycetous species. Candida sorbosivorans, Pseudozyma antarctica, C. spandovensis-like, C. spandovensis, Kloeckera apis, C. parapsilosis, Rhodotorula graminis, Kluyveromyces marxianus, Cryptococcus laurentii, Metchnikowia sp (isolated only from pitanga ripe fruits), Issatchenkia occidentalis and C. krusei (isolated only from mangaba frozen pulps), were the most frequent species. The yeast communities from pitanga ripe fruits exhibited the highest frequency of species, followed by communities from acerola ripe fruits and mangaba frozen pulps. Yeast communities from frozen pulp and ripe fruits of umbu had the lowest number of species. Except the yeasts from pitanga, yeast communities from frozen pulp exhibited higher number of yeasts than ripe fruit communities. Mycocinogenic yeasts were found in all of the substrates studied except in communities from umbu ripe fruits and pitanga frozen pulps. Most of the yeasts found to produce mycocins were basidiomycetes and included P. antarctica, Cryptococcus albidus, C. bhutanensis-like, R. graminis and R. mucilaginosa-like from pitanga ripe fruits as well as black yeasts from pitanga and acerola ripe fruits. The umbu frozen pulps community had the highest frequency of proteolytic species. Yeasts able to hydrolyse casein at pH 5.0 represented 38.5% of the species isolated. Thirty-seven percent of yeast isolates were able to hydrolyse casein at pH 7.0. Pectinolytic yeasts were found in all of the communities studied, excepted for those of umbu frozen pulps. The highest frequency of
An update on organohalogen metabolites produced by basidiomycetes
Field, J.A.; Wijnberg, J.B.P.A.
2003-01-01
Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript
Preservation of live cultures of basidiomycetes - recent methods.
Homolka, Ladislav
2014-02-01
Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Comparative genome analysis of Basidiomycete fungi
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor
2013-08-07
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.
Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.
Directory of Open Access Journals (Sweden)
Patricia Valente
Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T = DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T = CBS 12527(T = ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T = ATCC MYA-4603(T = MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T = NU7M71(T = BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T = NRRL Y-48076(T = ATCC MYA-4760(T = BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T = DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T = NRRL Y-48783(T = NCAIM Y.01952(T.
SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES
Directory of Open Access Journals (Sweden)
Fedotov О. V.
2014-02-01
Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.
Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.
2002-01-01
Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The
Genome sequence of the oleaginous yeast Rhodotorula toruloides strain CGMCC 2.1609
Directory of Open Access Journals (Sweden)
Christine Sambles
2017-09-01
Full Text Available Most eukaryotic oleaginous species are yeasts and among them the basidiomycete red yeast, Rhodotorula (Rhodosporidium toruloides (Pucciniomycotina is known to produce high quantities of lipids when grown in nitrogen-limiting media, and has potential for biodiesel production. The genome of the CGMCC 2.1609 strain of this oleaginous red yeast was sequenced using a hybrid of Roche 454 and Illumina technology generating 13× coverage. The de novo assembly was carried out using MIRA and scaffolded using MAQ and BAMBUS. The sequencing and assembly resulted in 365 scaffolds with total genome size of 33.4 Mb. The complete genome sequence of this strain was deposited in GenBank and the accession number is LKER00000000. The annotation is available on Figshare (doi:10.6084/m9.figshare.4754251.
The yeast flora of some decaying mushrooms on trunks of living trees
Middelhoven, W.J.
2004-01-01
Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...
Diversity and evolution of ABC proteins in basidiomycetes.
Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O
2013-01-01
ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.
Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G
2007-04-01
Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.
Phylogeny and comparative genome analysis of a Basidiomycete fungi
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David
2011-03-14
Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.
Libkind, Diego; Sampaio, José Paulo; van Broock, Maria
2010-09-01
A basidiomycetous yeast, strain CRUB 1032(T), which formed salmon-pink colonies, was isolated from glacial meltwater in Patagonia, Argentina. Morphological, physiological and biochemical characterization indicated that this strain belonged to the genus Rhodotorula. Molecular taxonomic analysis based on the 26S rDNA D1/D2 domain and internal transcribed spacer region sequences showed that strain CRUB 1032(T) represents an undescribed yeast species, for which the name Rhodotorula meli sp. nov. is proposed (type strain is CRUB 1032(T)=CBS 10797(T)=JCM 15319(T)). Phylogenetic analysis showed that Rhodotorula lamellibrachii was the closest known species, which, together with R. meli, formed a separate cluster related to the Sakaguchia clade within the Cystobasidiomycetes. Additional Patagonian yeast isolates of the class Cystobasidiomycetes are also investigated in the present work.
Lectins from Mycelia of Basidiomycetes
Directory of Open Access Journals (Sweden)
Valentina E. Nikitina
2017-06-01
Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.
Use of molecular markers for the study of wild fungus basidiomycetes
Directory of Open Access Journals (Sweden)
Blanca Estela Gómez Luna
2012-09-01
Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.
Armillaria mellea: an ozonophilic basidiomycete
Energy Technology Data Exchange (ETDEWEB)
Berliner, M D
1963-01-19
Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.
Sitepu, Irnayuli R.; Sestric, Ryan; Ignatia, Laura; Levin, David; German, J. Bruce; Gillies, Laura A.; Almada, Luis A.G.; Boundy-Mills, Kyria L.
2013-01-01
Oleaginous yeasts have been studied for oleochemical production for over 80 years. Only a few species have been studied intensely. To expand the diversity of oleaginous yeasts available for lipid research, we surveyed a broad diversity of yeasts with indicators of oleaginicity including known oleaginous clades, and buoyancy. Sixty-nine strains representing 17 genera and 50 species were screened for lipid production. Yeasts belonged to Ascomycota families, Basidiomycota orders, and the yeast-like algal genus Prototheca. Total intracellular lipids and fatty acid composition were determined under different incubation times and nitrogen availability. Thirteen new oleaginous yeast species were discovered, representing multiple ascomycete and basidiomycete clades. Nitrogen starvation generally increased intracellular lipid content. The fatty acid profiles varied with the growth conditions regardless of taxonomic affiliation. The dominant fatty acids were oleic acid, palmitic acid, linoleic acid, and stearic acid. Yeasts and culture conditions that produced fatty acids appropriate for biodiesel were identified. PMID:23891835
Sitepu, Irnayuli R; Sestric, Ryan; Ignatia, Laura; Levin, David; German, J Bruce; Gillies, Laura A; Almada, Luis A G; Boundy-Mills, Kyria L
2013-09-01
Oleaginous yeasts have been studied for oleochemical production for over 80 years. Only a few species have been studied intensely. To expand the diversity of oleaginous yeasts available for lipid research, we surveyed a broad diversity of yeasts with indicators of oleaginicity including known oleaginous clades, and buoyancy. Sixty-nine strains representing 17 genera and 50 species were screened for lipid production. Yeasts belonged to Ascomycota families, Basidiomycota orders, and the yeast-like algal genus Prototheca. Total intracellular lipids and fatty acid composition were determined under different incubation times and nitrogen availability. Thirteen new oleaginous yeast species were discovered, representing multiple ascomycete and basidiomycete clades. Nitrogen starvation generally increased intracellular lipid content. The fatty acid profiles varied with the growth conditions regardless of taxonomic affiliation. The dominant fatty acids were oleic acid, palmitic acid, linoleic acid, and stearic acid. Yeasts and culture conditions that produced fatty acids appropriate for biodiesel were identified. Copyright © 2013 Elsevier Ltd. All rights reserved.
A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.
Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk
2017-08-25
The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the
Degradation of cellulose by basidiomycetous fungi
Czech Academy of Sciences Publication Activity Database
Baldrian, Petr; Valášková, Vendula
2008-01-01
Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008
Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D
Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic
Directory of Open Access Journals (Sweden)
Chaika A. V.
2013-12-01
Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.
Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R
2017-01-01
The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T
Directory of Open Access Journals (Sweden)
Javier Ribera
Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens
Terekhova, V A; Semenova, T A
2005-01-01
We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.
Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.
2013-03-11
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.
Rovati, José I; Pajot, Hipólito F; Ruberto, Lucas; Mac Cormack, Walter; Figueroa, Lucía I C
2013-11-01
Antarctica offers a range of extreme climatic conditions, such as low temperatures, high solar radiation and low nutrient availability, and constitutes one of the harshest environments on Earth. Despite that, it has been successfully colonized by ’cold-loving’ fungi, which play a key role in decomposition cycles in cold ecosystems. However, knowledge about the ecological role of yeasts in nutrient or organic matter recycling/mineralization remains highly fragmentary. The aim of this work was to study the yeast microbiota in samples collected on 25 de Mayo/King George Island regarding the scope of their ability to degrade polyphenolic substrates such as lignin and azo dyes. Sixty-one yeast isolates were obtained from 37 samples, including soil, rocks, wood and bones. Molecular analyses based on rDNA sequences revealed that 35 yeasts could be identified at the species level and could be classified in the genera Leucosporidiella, Rhodotorula, Cryptococcus, Bullera and Candida. Cryptococcus victoriae was by far the most ubiquitous species. In total, 33% of the yeast isolates examined showed significant activity for dye decolorization, 25% for laccase activity and 38% for ligninolytic activity. Eleven yeasts did not show positive activity in any of the assays performed and no isolates showed positive activity across all tested substrates. A high diversity of yeasts were isolated in this work, possibly including undescribed species and conspicuous Antarctic yeasts, most of them belonging to oligotrophic, slow-growing and metabolically diverse basidiomycetous genera.
Hagler, A N; Rosa, C A; Morais, P B; Mendonça-Hagler, L C; Franco, G M; Araujo, F V; Soares, C A
1993-10-01
Yeasts and coliform bacteria were isolated from water that accumulated in the central cups and adjacent leaf axilae of two bromeliads, Neoregelia cruenta of a coastal sand dune and Quesnelia quesneliana of a mangrove ecosystem near the city of Rio de Janeiro, Brazil. The mean total coliform counts were above 10,000 per 100 mL for waters of both plants, but the mean fecal coliform counts were only 74 per 100 mL for Q. quesneliana and mostly undetected in water from N. cruenta. Of 90 fecal coliform isolates, 51 were typical of Escherichia coli in colony morphology and indol, methyl red, Volges-Proskauer, and citrate (IMViC) tests. Seven representatives of the typical E. coli cultures were identified as this species, but the identifications of nine other coliform bacteria were mostly dubious. The yeast community of N. cruenta was typical of plant surfaces with basidiomycetous yeasts anamorphs, and the black yeast Aureobasidium pullulans was prevalent. Quesnelia quesneliana had a substantial proportion of ascomycetous yeasts and their anamorphs, including a probable new biotype of Saccharomyces unisporus. Our results suggested that the microbial communities in bromeliad waters are typically autochtonous and not contaminants.
Occurrence of indoor wood decay basidiomycetes in Europe
Czech Academy of Sciences Publication Activity Database
Gabriel, Jiří; Švec, Karel
2017-01-01
Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016
[Evaluation of mass spectrometry for the identification of clinically interesting yeasts].
Galán, Fátima; García-Agudo, Lidia; Guerrero, Inmaculada; Marín, Pilar; García-Tapia, Ana; García-Martos, Pedro; Rodríguez-Iglesias, Manuel
2015-01-01
Identification of yeasts is based on morphological, biochemical and nutritional characteristics, and using molecular methods. Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, a new method for the identification of microorganisms, has demonstrated to be very useful. The aim of this study is to evaluate this new method in the identification of yeasts. A total of 600 strains of yeasts isolated from clinical specimens belonging to 9 genera and 43 species were tested. Identification was made by sequencing of the ITS regions of ribosomal DNA, assimilation of carbon compounds (ID 32C), and mass spectrometry on a Microflex spectrometer (Bruker Daltonics GmbH, Germany). A total of 569 strains (94.8%) were identified to species level by ID 32C, and 580 (96.7%) by MALDI-TOF. Concordance between both methods was observed for 553 strains (92.2%), with 100% in clinically relevant species: C. albicans, C. glabrata, C. parapsilosis, C. tropicalis, and almost 100% in C. krusei. MALDI-TOF identified species requiring molecular methods: Candida dubliniensis, C. nivariensis, C. metapsilosis and C. orthopsilosis. Some irregularities were observed in the identification of arthroconidia yeast and basidiomycetes. MALDI-TOF is a rapid, effective and economic method, which enables the identification of most clinically important yeasts and the differentiation of closely related species. It would be desirable to include more species in its database to expand its performance. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Directory of Open Access Journals (Sweden)
Azusa Saika
Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.
International Nuclear Information System (INIS)
Boettcher, F.; Samsonova, I.A.
1977-01-01
The inactivation of stationary phase cells by ultraviolet light (UV) and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was examined in eight wild strains of Rhodotorula, six of which are the sporidial yeast phase of Rhodosporidium, a basidiomycetous fungus. It thas been found that (1) the UV-resistance of Rhodosporidium and Rhodotorula yeasts is higher and the MNNG-resistance lower than the resistance of Candida and Hansenula yeasts, (2) the shape of the survival curves is sigmoid in the case of UV and two-phase exponential in the case of MNNG, (3) the mutagen sensitivities but not the inactivation kinetics of the strains are different, (4) the UV- and MNNG-sensitivities for each of the strains are correlated, (5) the relatively high resistance to UV cannot be due to the carotenoid pigments of the cells, (6) mutations to UV-sensitivity can be induced with a high rate, (7) the sigmoidal character of the UV survival curves were reduced or transformed to an exponential shape by the UVS-mutations. (author)
Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...
DEFF Research Database (Denmark)
Lopez, Javiera; Essus, Karen; Kim, Il-Kwon
2015-01-01
cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods.......Background: Apocarotenoids, like the C13-norisoprenoids, are natural compounds that contribute to the flavor and/or aroma of flowers and foods. They are produced in aromatic plants-like raspberries and roses-by the enzymatic cleavage of carotenes. Due to their pleasant aroma and flavour...
Directory of Open Access Journals (Sweden)
Lehlohonolo Benedict Qhanya
Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host
Directory of Open Access Journals (Sweden)
Alexander Michael Bedford Johns
2016-10-01
Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.
Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev
2014-01-01
Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...
Directory of Open Access Journals (Sweden)
Martin Vohník
Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet
Ismail, S A; Deak, T; El-Rahman, H A; Yassien, M A; Beuchat, L R
2000-12-05
A study was undertaken to determine populations and profiles of yeast species on fresh and processed poultry products upon purchase from retail supermarkets and after storage at 5 degrees C until shelf life expiration, and to assess the potential role of these yeasts in product spoilage. Fifty samples representing 15 commercial raw, marinated, smoked, or roasted chicken and turkey products were analyzed. Yeast populations were determined by plating on dichloran rose bengal chloramphenicol (DRBC) agar and tryptone glucose yeast extract (TGY) agar. Proteolytic activity was determined using caseinate and gelatin agars and lipolytic activity was determined on plate count agar supplemented with tributyrin. Populations of aerobic microorganisms were also determined. Initial populations of yeasts (log10 cfu/g) ranged from less than 1 (detection limit) to 2.89, and increased by the expiration date to 0.37-5.06, indicating the presence of psychrotrophic species. Highest initial populations were detected in raw chicken breast, wings, and ground chicken, as well as in turkey necks and legs, whereas roasted chicken and turkey products contained less than 1 log10 cfu/g. During storage, yeast populations increased significantly (P chicken, ground chicken, liver, heart and gizzard, and in ground turkey and turkey sausage. Isolates (152 strains) of yeasts from poultry products consisted of 12 species. Yarrowia lipolytica and Candida zeylanoides were predominant, making up 39 and 26% of the isolates, respectively. Six different species of basidiomycetous yeasts representing 24% of the isolates were identified. Most Y. lipolytica strains showed strong proteolytic and lipolytic activities, whereas C. zeylanoides was weakly lipolytic. Results suggest that yeasts, particularly Y. lipolytica, may play a more prominent role than previously recognized in the spoilage of fresh and processed poultry stored at 5 degrees C.
Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips
CSIR Research Space (South Africa)
Wolfaardt, F
2004-10-01
Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...
DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES
B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*
2014-01-01
ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates. The textile industry, by far the most avid user of synthetic dyes, is in need...
Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui
2016-11-25
excellent promoters for metabolic engineering in the oleaginous and carotenogenic yeast, R. toruloides.
Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa
Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.
2015-01-01
Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high
Analysis of basidiomycete pigments in situ by Raman spectroscopy.
Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen
2018-02-07
Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES
Directory of Open Access Journals (Sweden)
Veligodska A. K.
2013-12-01
Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.
[Oil degradation by basidiomycetes in soil and peat at low temperatures].
Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V
2016-01-01
A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.
Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.
2011-01-01
Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme
Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389
Directory of Open Access Journals (Sweden)
Masahiko Isaka
2016-08-01
Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract
Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.
2003-01-01
A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus
Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides
Geiselman, Gina M; Ito, Masakazu; Mondo, Stephen J; Reilly, Morgann C; Cheng, Ya-Fang; Bauer, Stefan; Grigoriev, Igor V; Gladden, John M; Simmons, Blake A; Brem, Rachel B
2018-01-01
The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted function in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. These results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi. PMID:29521624
The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery
International Nuclear Information System (INIS)
Bayles, C.J.; Aist, J.R.; Berns, M.W.
1993-01-01
Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated
Chiaki Hori; Daniel Cullen
2016-01-01
Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...
Han, J R; An, C H; Yuan, J M
2005-01-01
The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.
Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.
Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges
2015-11-01
Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C
2011-01-01
When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.
Wang, Yifei; Bao, Yihong; Shen, Danhong; Feng, Wu; Yu, Ting; Zhang, Jia; Zheng, Xiao Dong
2008-04-30
The basidiomycetous yeast Rhodosporidium paludigenum Fell & Tallman isolated from the south of East China Sea was evaluated for its activity in reducing postharvest decay of cherry tomatoes caused by Alternaria alternata in vitro and in vivo tests. The results showed that washed cell suspension of R. paludigenum provided better control of A. alternata than any other treatment, while the autoclaved cell culture failed to provide protection against the pathogen. The concentration of antagonist had significant effect on biocontrol effectiveness in vivo: when the concentration of the washed yeast cell suspension was used at 1 x 10(9)cells/ml, the percentage rate of black rot of cherry tomato fruit was only 37%, which was remarkably lower than that treated with water (the control) after 5days of incubation at 25 degrees C. Furthermore, a great biocontrol efficacy of R. paludigenum was observed when it was applied prior to inoculation with A. alternata: the longer the incubation time of R. paludigenum, the lower disease incidence would be. However, there was little efficacy when R. paludigenum was applied after A. alternata inoculation. In addition, on the wounds of cherry tomato, it was observed that R. paludigenum grew rapidly increasing 50-fold during the first 12h at 25 degrees C. To the best of our knowledge, this is a first report concerning that the marine yeast R. paludigenum could be used as a biocontrol agent of postharvest fungal disease.
Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina
2010-11-01
Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.
Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan
2006-01-01
Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.
Directory of Open Access Journals (Sweden)
Masaharu Tsuji
Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.
Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco
2004-01-01
We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...
Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785
2010-01-01
Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1), lipid/biomass (68%) and lipid/glucose yields (16%). Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils. PMID:20863365
Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785
Directory of Open Access Journals (Sweden)
De Lucia Marzia
2010-09-01
Full Text Available Abstract Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1, lipid/biomass (68% and lipid/glucose yields (16%. Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils.
Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping
2009-02-01
Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.
Steffen, K T; Hofrichter, M; Hatakka, A
2000-12-01
Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.
Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.
Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C
2008-07-01
The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.
Directory of Open Access Journals (Sweden)
Zhengquan Gao
Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.
Directory of Open Access Journals (Sweden)
FELIPE B. VALER
2016-01-01
Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.
Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel
2004-01-01
Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...
ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS
Directory of Open Access Journals (Sweden)
N. P.
2016-02-01
Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.
Satoh, Kazuo; Maeda, Mari; Umeda, Yoshiko; Sugamata, Miho; Makimura, Koichi
2013-07-01
A total of 515 yeast strains were isolated from the nasal smears of Queensland koalas and their breeding environments in Japanese zoological parks between 2005 and 2012. The most frequent species in the basidiomycetous yeast biota isolated from koala nasal passages was Cryptococcus neoformans, followed by Rhodotorula minuta. R. minuta was the most frequent species in the breeding environments, while C. neoformans was rare. Seven strains representing two novel yeast species were identified. Analyses of the 26S rDNA (LSU) D1/D2 domain and nuclear ribosomal DNA internal transcribed spacer region sequences indicated that these strains represent new species with close phylogenetic relationships to Cryptococcus and Rhodotorula. A sexual state was not found for either of these two novel yeasts. Key phenotypic characters confirmed that these strains could be placed in Cryptococcus and Rhodotorula. The names Cryptococcus lacticolor sp. nov. (type strain TIMM 10013(T) = JCM 15449(T) = CBS 10915(T) = DSM 21093(T), DDBJ/EMBL/Genbank Accession No.; AB375774 (ITS) and AB375775 (26S rDNA D1/D2 region), MycoBank ID; MB 802688, Fungal Barcoding Database ID; 3174), and Rhodotorula oligophaga sp. nov. (type strain TIMM 10017(T) = JCM 18398(T) = CBS 12623(T) = DSM 25814(T), DDBJ/EMBL/Genbank Accession No.; AB702967 (ITS) and AB702967 (26S rDNA D1/D2 region), MycoBank ID; MB 802689, Fungal Barcoding Database ID; 3175) are proposed for these new species.
Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)
2010-04-09
We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.
International Nuclear Information System (INIS)
Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki
2010-01-01
We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.
Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin
2015-10-01
In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.
2014-03-14
Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.
Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske
2017-07-01
The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum
International Nuclear Information System (INIS)
Takimoto, K.
1980-01-01
The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)
Czech Academy of Sciences Publication Activity Database
Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr
2010-01-01
Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology
Degenkolb, Thomas; Vilcinskas, Andreas
2016-05-01
In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.
SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES
Directory of Open Access Journals (Sweden)
A. K. Veligodska
2015-11-01
Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and
BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES
Directory of Open Access Journals (Sweden)
Tiberius BALAEŞ
2015-12-01
Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.
Directory of Open Access Journals (Sweden)
Sujatha eKandhasamy
2016-05-01
Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.
Czech Academy of Sciences Publication Activity Database
Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav
2012-01-01
Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012
Directory of Open Access Journals (Sweden)
Andrej Liner
2013-01-01
Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.
Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland
Directory of Open Access Journals (Sweden)
Marcin Piątek
2014-08-01
Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.
DNA quantification of basidiomycetous fungi during storage of logging residues
Directory of Open Access Journals (Sweden)
Isabella Børja
2015-04-01
Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.
Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.
Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo
2016-10-24
Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bezdíčka, Martin
2013-01-01
The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...
Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree
2015-07-01
Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).
Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada
Hagen, F; Boekhout, T
2006-01-01
Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a
Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.
Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A
2014-05-10
Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
A rare case of urinary tract infection due to Trichosporonasahii in a ...
African Journals Online (AJOL)
Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...
Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879
Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia
2015-01-01
Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839
Radiation stimulation of yeast crops for increasing output of alcohol and baker yeasts
International Nuclear Information System (INIS)
Vlad, E.; Marsheu, P.
1974-01-01
The purpose of this study was to stimulate by gamma radiation the existing commercial types of yeast so as to obtain yeasts that would better reflect the substrate and have improved reproductive capacity. The experiments were conducted under ordinary conditions using commercial yeasts received from one factory producing alcohol and bakery yeasts and isolated as pure cultures. Irradiating yeast cultures with small doses (up to 10 krad) was found to stimulate the reproduction and fermenting activity of yeast cells as manifested in increased accumulation of yeast biomass and greater yield of ethyl alcohol. (E.T.)
Directory of Open Access Journals (Sweden)
M. Wadhwa
2016-12-01
Full Text Available A genetic screen to identify mutants that can increase flux in the isoprenoid pathway of yeast has been lacking. We describe a carotenoid-based visual screen built with the core carotenogenic enzymes from the red yeast Rhodosporidium toruloides. Enzymes from this yeast displayed the required, higher capacity in the carotenoid pathway. The development also included the identification of the metabolic bottlenecks, primarily phytoene dehydrogenase, that was subjected to a directed evolution strategy to yield more active mutants. To further limit phytoene pools, a less efficient version of GGPP synthase was employed. The screen was validated with a known flux increasing gene, tHMG1. New mutants in the TATA binding protein SPT15 were isolated using this screen that increased the yield of carotenoids, and an alternate isoprenoid, α-Farnesene confirming increase in overall flux. The findings indicate the presence of previously unknown links to the isoprenoid pathway that can be uncovered using this screen. Keywords: Metabolic engineering, Carotenoids, Isoprenoids, α-Farnesene, Rhodosporidium toruloides, SPT15
Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland
2011-01-01
Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the
ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA
Directory of Open Access Journals (Sweden)
А. Бухало
2011-02-01
Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes Grifola frondosa in a surface and submerged culture. 8 strains of Gf. frondosa, mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of Вotany National Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains on agar mediums were shown the following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease, xylanase, lipase and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.
Fatty acids from oleaginous yeasts and yeast-like fungi and their potential applications.
Xue, Si-Jia; Chi, Zhe; Zhang, Yu; Li, Yan-Feng; Liu, Guang-Lei; Jiang, Hong; Hu, Zhong; Chi, Zhen-Ming
2018-02-01
Oleaginous yeasts, fatty acids biosynthesis and regulation in the oleaginous yeasts and the fatty acids from the oleaginous yeasts and their applications are reviewed in this article. Oleaginous yeasts such as Rhodosporidium toruloides, Yarrowia lipolytica, Rhodotorula mucilaginosa, and Aureobasidium melanogenum, which can accumulate over 50% lipid of their cell dry weight, have many advantages over other oleaginous microorganisms. The fatty acids from the oleaginous yeasts have many potential applications. Many oleaginous yeasts have now been genetically modified to over-produce fatty acids and their derivatives. The most important features of the oleaginous yeasts are that they have special enzymatic systems for enhanced biosynthesis and regulation of fatty acids in their lipid particles. Recently, some oleaginous yeasts such as R. toruloides have been found to have a unique fatty acids synthetase and other oleaginous yeasts such as A. melanogenum have a unique highly reducing polyketide synthase (HR-PKS) involved in the biosynthesis of hydroxyl fatty acids. It is necessary to further enhance lipid biosynthesis using metabolic engineering and explore new applications of fatty acids in biotechnology.
Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.
Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming
2014-01-01
Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.
Zhao, Richard Yuqi
2017-01-01
Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230
Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric
2013-02-12
An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.
Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.
2014-01-01
Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID
Directory of Open Access Journals (Sweden)
Daniil N. Olennikov
2014-03-01
Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.
Yeast Flocculation—Sedimentation and Flotation
Directory of Open Access Journals (Sweden)
Graham G. Stewart
2018-04-01
Full Text Available Unlike most fermentation alcohol beverage production processes, brewers recycle their yeast. This is achieved by employing a yeast culture’s: flocculation, adhesion, sedimentation, flotation, and cropping characteristics. As a consequence of yeast recycling, the quality of the cropped yeast culture’s characteristics is critical. However, the other major function of brewer’s yeast is to metabolise wort into ethanol, carbon dioxide, glycerol, and other fermentation products, many of which contribute to beer’s overall flavour characteristics. This review will only focus on brewer’s yeast flocculation characteristics.
Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.
Palková, Zdena; Váchová, Libuše
2016-09-01
Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko
2010-12-07
An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##
Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand
Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing
Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate
Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.
2012-01-01
Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast densit...
New yeasts-new brews: modern approaches to brewing yeast design and development.
Gibson, B; Geertman, J-M A; Hittinger, C T; Krogerus, K; Libkind, D; Louis, E J; Magalhães, F; Sampaio, J P
2017-06-01
The brewing industry is experiencing a period of change and experimentation largely driven by customer demand for product diversity. This has coincided with a greater appreciation of the role of yeast in determining the character of beer and the widespread availability of powerful tools for yeast research. Genome analysis in particular has helped clarify the processes leading to domestication of brewing yeast and has identified domestication signatures that may be exploited for further yeast development. The functional properties of non-conventional yeast (both Saccharomyces and non-Saccharomyces) are being assessed with a view to creating beers with new flavours as well as producing flavoursome non-alcoholic beers. The discovery of the psychrotolerant S. eubayanus has stimulated research on de novo S. cerevisiae × S. eubayanus hybrids for low-temperature lager brewing and has led to renewed interest in the functional importance of hybrid organisms and the mechanisms that determine hybrid genome function and stability. The greater diversity of yeast that can be applied in brewing, along with an improved understanding of yeasts' evolutionary history and biology, is expected to have a significant and direct impact on the brewing industry, with potential for improved brewing efficiency, product diversity and, above all, customer satisfaction. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts ...
Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.
Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E
2014-07-20
We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.
Schizosaccharomyces japonicus: the fission yeast is a fusion of yeast and hyphae.
Niki, Hironori
2014-03-01
The clade of Schizosaccharomyces includes 4 species: S. pombe, S. octosporus, S. cryophilus, and S. japonicus. Although all 4 species exhibit unicellular growth with a binary fission mode of cell division, S. japonicus alone is dimorphic yeast, which can transit from unicellular yeast to long filamentous hyphae. Recently it was found that the hyphal cells response to light and then synchronously activate cytokinesis of hyphae. In addition to hyphal growth, S. japonicas has many properties that aren't shared with other fission yeast. Mitosis of S. japonicas is referred to as semi-open mitosis because dynamics of nuclear membrane is an intermediate mode between open mitosis and closed mitosis. Novel genetic tools and the whole genomic sequencing of S. japonicas now provide us with an opportunity for revealing unique characters of the dimorphic yeast. © 2013 The Author. Yeast Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Aza Kobakhidze
2016-09-01
Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.
Yeast ecology of Kombucha fermentation.
Teoh, Ai Leng; Heard, Gillian; Cox, Julian
2004-09-01
Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.
DEFF Research Database (Denmark)
Piskur, Jure; Langkjær, Rikke Breinhold
2004-01-01
For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...
NetPhosYeast: prediction of protein phosphorylation sites in yeast
DEFF Research Database (Denmark)
Ingrell, C.R.; Miller, Martin Lee; Jensen, O.N.
2007-01-01
sites compared to those in humans, suggesting the need for an yeast-specific phosphorylation site predictor. NetPhosYeast achieves a correlation coefficient close to 0.75 with a sensitivity of 0.84 and specificity of 0.90 and outperforms existing predictors in the identification of phosphorylation sites...
Directory of Open Access Journals (Sweden)
Lili Li
2017-03-01
Full Text Available Objectives: To improve ethanolic fermentation performance of self-flocculating yeast, difference between a flocculating yeast strain and a regular industrial yeast strain was analyzed by transcriptional and metabolic approaches. Results: The number of down-regulated (industrial yeast YIC10 vs. flocculating yeast GIM2.71 and up-regulated genes were 4503 and 228, respectively. It is the economic regulation for YIC10 that non-essential genes were down-regulated, and cells put more “energy” into growth and ethanol production. Hexose transport and phosphorylation were not the limiting-steps in ethanol fermentation for GIM2.71 compared to YIC10, whereas the reaction of 1,3-disphosphoglycerate to 3-phosphoglycerate, the decarboxylation of pyruvate to acetaldehyde and its subsequent reduction to ethanol were the most limiting steps. GIM2.71 had stronger stress response than non-flocculating yeast and much more carbohydrate was distributed to other bypass, such as glycerol, acetate and trehalose synthesis. Conclusions: Differences between flocculating yeast and regular industrial yeast in transcription and metabolite profiling will provide clues for improving the fermentation performance of GIM2.71.
Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains
Directory of Open Access Journals (Sweden)
R.L. Arakaki
2013-12-01
Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.
Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.
Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E
2013-12-01
Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.
Directory of Open Access Journals (Sweden)
D Tagu
2009-12-01
Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.
Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.
Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena
2012-12-01
Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.
Interaction Between Yeasts and Zinc
Nicola, Raffaele De; Walker, Graeme
Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses
International Nuclear Information System (INIS)
Kim, Jongkwang; Kim, Sowun; Lee, Kunsang; Kwon, Younghun
2009-01-01
In this article, we investigate the language structure in yeast 16 chromosomes. In order to find it, we use the entropy analysis for codons (or amino acids) of yeast 16 chromosomes, developed in analysis of natural language by Montemurro et al. From the analysis, we can see that there exists a language structure in codons (or amino acids) of yeast 16 chromosomes. Also we find that the grammar structure of amino acids of yeast 16 chromosomes has a deep relationship with secondary structure of protein.
Yeast flocculation: New story in fuel ethanol production.
Zhao, X Q; Bai, F W
2009-01-01
Yeast flocculation has been used in the brewing industry to facilitate biomass recovery for a long time, and thus its mechanism of yeast flocculation has been intensively studied. However, the application of flocculating yeast in ethanol production garnered attention mainly in the 1980s and 1990s. In this article, updated research progress in the molecular mechanism of yeast flocculation and the impact of environmental conditions on yeast flocculation are reviewed. Construction of flocculating yeast strains by genetic approach and utilization of yeast flocculation for ethanol production from various feedstocks were presented. The concept of self-immobilized yeast cells through their flocculation is revisited through a case study of continuous ethanol fermentation with the flocculating yeast SPSC01, and their technical and economic advantages are highlighted by comparing with yeast cells immobilized with supporting materials and regular free yeast cells as well. Taking the flocculating yeast SPSC01 as an example, the ethanol tolerance of the flocculating yeast was also discussed.
Brewing characteristics of piezosensitive sake yeasts
Nomura, Kazuki; Hoshino, Hirofumi; Igoshi, Kazuaki; Onozuka, Haruka; Tanaka, Erika; Hayashi, Mayumi; Yamazaki, Harutake; Takaku, Hiroaki; Iguchi, Akinori; Shigematsu, Toru
2018-04-01
Application of high hydrostatic pressure (HHP) treatment to food processing is expected as a non-thermal fermentation regulation technology that supresses over fermentation. However, the yeast Saccharomyces cerevisiae used for Japanese rice wine (sake) brewing shows high tolerance to HHP. Therefore, we aimed to generate pressure-sensitive (piezosensitive) sake yeast strains by mating sake with piezosensitive yeast strains to establish an HHP fermentation regulation technology and extend the shelf life of fermented foods. The results of phenotypic analyses showed that the generated yeast strains were piezosensitive and exhibited similar fermentation ability compared with the original sake yeast strain. In addition, primary properties of sake brewed using these strains, such as ethanol concentration, sake meter value and sake flavor compounds, were almost equivalent to those obtained using the sake yeast strain. These results suggest that the piezosensitive strains exhibit brewing characteristics essentially equivalent to those of the sake yeast strain.
Production of Food Grade Yeasts
Directory of Open Access Journals (Sweden)
Argyro Bekatorou
2006-01-01
Full Text Available Yeasts have been known to humans for thousands of years as they have been used in traditional fermentation processes like wine, beer and bread making. Today, yeasts are also used as alternative sources of high nutritional value proteins, enzymes and vitamins, and have numerous applications in the health food industry as food additives, conditioners and flavouring agents, for the production of microbiology media and extracts, as well as livestock feeds. Modern scientific advances allow the isolation, construction and industrial production of new yeast strains to satisfy the specific demands of the food industry. Types of commercial food grade yeasts, industrial production processes and raw materials are highlighted. Aspects of yeast metabolism, with respect to carbohydrate utilization, nutritional aspects and recent research advances are also discussed.
Not your ordinary yeast: non-Saccharomyces yeasts in wine production uncovered.
Jolly, Neil P; Varela, Cristian; Pretorius, Isak S
2014-03-01
Saccharomyces cerevisiae and grape juice are 'natural companions' and make a happy wine marriage. However, this relationship can be enriched by allowing 'wild' non-Saccharomyces yeast to participate in a sequential manner in the early phases of grape must fermentation. However, such a triangular relationship is complex and can only be taken to 'the next level' if there are no spoilage yeast present and if the 'wine yeast' - S. cerevisiae - is able to exert its dominance in time to successfully complete the alcoholic fermentation. Winemakers apply various 'matchmaking' strategies (e.g. cellar hygiene, pH, SO2 , temperature and nutrient management) to keep 'spoilers' (e.g. Dekkera bruxellensis) at bay, and allow 'compatible' wild yeast (e.g. Torulaspora delbrueckii, Pichia kluyveri, Lachancea thermotolerans and Candida/Metschnikowia pulcherrima) to harmonize with potent S. cerevisiae wine yeast and bring the best out in wine. Mismatching can lead to a 'two is company, three is a crowd' scenario. More than 40 of the 1500 known yeast species have been isolated from grape must. In this article, we review the specific flavour-active characteristics of those non-Saccharomyces species that might play a positive role in both spontaneous and inoculated wine ferments. We seek to present 'single-species' and 'multi-species' ferments in a new light and a new context, and we raise important questions about the direction of mixed-fermentation research to address market trends regarding so-called 'natural' wines. This review also highlights that, despite the fact that most frontier research and technological developments are often focussed primarily on S. cerevisiae, non-Saccharomyces research can benefit from the techniques and knowledge developed by research on the former. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Pejin Dušanka J.
2009-01-01
Full Text Available Baker's yeast is a set of living cells of Saccharomyces cerevisiae. It contains around 70-72% of water, 42-45% of proteins, around 40% of carbohydrates, around 7.5% of lipids (based on dry matter, and vitamin B-complex. On the basis of yeast cell analysis it can be concluded that yeast is a complex biological system which changes in time. The intensity of the changes depends on temperature. Yeast sample was stored at 4°C i 24°C for 12 days. During storage at 4°C, the content of total carbohydrates decreased from 48.81% to 37.50% (dry matter, whereas carbohydrate loss ranged from 40.81% to 29.28% at 24°C. The content of trehalose was 12.33% in the yeast sample stored at 4°C and 0.24% at 24°C. Loss of fermentative activity was 81.76% in the sample stored at 24°C for 12 days. The composition of five samples of 1st category flour was investigated. It was found that flours containing more reducing sugars and maltose enable higher fermentation activities. The flours with higher ash content (in the range 0.5-0.94% had higher contents of phytic acid. Higher ash and phytic contents in flour increased the yeast fermentative efficiency. In bakery industry, a range of ingredients has been applied to improve the product's quality such as surface active substances (emulsifiers, enzymes, sugars and fats. In the paper, the effect of some ingredients added to dough (margarine, saccharose, sodium chloride and malted barley on the yeast fermentative activity was studied. The mentioned ingredients were added to dough at different doses: 0.5, 1.0, 1.5 and 2.0%, flour basis. It was found that the investigated ingredients affected the fermentative activity of yeast and improved the bread quality.
2014-01-01
Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862
Yeast strains and methods of use thereof
Goddard, Matthew Robert; Gardner, Richard Clague; Anfang, Nicole
2013-01-01
The present invention relates to yeast strains and, in particular, to yeast stains for use in fermentation processes. The invention also relates to methods of fermentation using the yeast strains of the invention either alone or in combination with other yeast strains. The invention thither relates to methods for the selection of yeast strains suitable for fermentation cultures by screening for various metabolic products and the use of specific nutrient sources.
Immobilization of yeast cells by radiation-induced polymerization
International Nuclear Information System (INIS)
Fujimura, T.; Kaetsu, I.
1982-01-01
Radiation-induced polymerization method was applied to the immobilization of yeast cells. The effects of irradiation, cooling and monomer, which are neccessary for polymerization, were recovered completely by subsequent aerobical incubation of yeast cells. The ethanol productive in immobilized yeast cells increased with the increase of aerobical incubation period. The growth of yeast cells in immobilized yeast cells was indicated. The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. (orig.)
Evolutionary History of Ascomyceteous Yeasts
Energy Technology Data Exchange (ETDEWEB)
Haridas, Sajeet; Riley, Robert; Salamov, Asaf; Goker, Markus; Klenk, Hans-Peter; Kurtzman, Cletus P.; Blackwell, Meredith; Grigoriev, Igor; Jeffries, Thomas W.
2014-06-06
Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.
Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767
Energy Technology Data Exchange (ETDEWEB)
Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)
1995-12-01
It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.
Sexual differentiation in fission yeast
DEFF Research Database (Denmark)
Egel, R; Nielsen, O; Weilguny, D
1990-01-01
The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....
Occurrence of Killer Yeast Strains in Fruit and Berry Wine Yeast Populations
Directory of Open Access Journals (Sweden)
Gintare Gulbiniene
2004-01-01
Full Text Available Apple, cranberry, chokeberry and Lithuanian red grape wine yeast populations were used for the determination of killer yeast occurrence. According to the tests of the killer characteristics and immunity the isolated strains were divided into seven groups. In this work the activity of killer toxins purified from some typical strains was evaluated. The analysed strains produced different amounts of active killer toxin and some of them possessed new industrially significant killer properties. Total dsRNA extractions in 11 killer strains of yeast isolated from spontaneous fermentations revealed that the molecular basis of the killer phenomenon was not only dsRNAs, but also unidentified genetic determinants.
Roohvand, Farzin; Shokri, Mehdi; Abdollahpour-Alitappeh, Meghdad; Ehsani, Parastoo
2017-08-01
Yeasts, as Eukaryotes, offer unique features for ease of growth and genetic manipulation possibilities, making it an exceptional microbial host. Areas covered: This review provides general and patent-oriented insights into production of biopharmaceuticals by yeasts. Patents, wherever possible, were correlated to the original or review articles. The review describes applications of major GRAS (generally regarded as safe) yeasts for the production of therapeutic proteins and subunit vaccines; additionally, immunomodulatory properties of yeast cell wall components were reviewed for use of whole yeast cells as a new vaccine platform. The second part of the review will discuss yeast- humanization strategies and innovative applications. Expert opinion: Biomedical applications of yeasts were initiated by utilization of Saccharomyces cerevisiae, for production of leavened (fermented) products, and advanced to serve to produce biopharmaceuticals. Higher biomass production and expression/secretion yields, more similarity of glycosylation patterns to mammals and possibility of host-improvement strategies through application of synthetic biology might enhance selection of Pichia pastoris (instead of S. cerevisiae) as a host for production of biopharmaceutical in future. Immunomodulatory properties of yeast cell wall β-glucans and possibility of intracellular expression of heterologous pathogen/tumor antigens in yeast cells have expanded their application as a new platform, 'Whole Yeast Vaccines'.
Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.
2018-01-01
Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.
Virgin olive oil yeasts: A review.
Ciafardini, Gino; Zullo, Biagi Angelo
2018-04-01
This review summarizes current knowledge on virgin olive oil yeasts. Newly produced olive oil contains solid particles and micro drops of vegetation water in which yeasts reproduce to become the typical microbiota of olive oil. To date, about seventeen yeast species have been isolated from different types of olive oils and their by-products, of which six species have been identified as new species. Certain yeast species contribute greatly to improving the sensorial characteristics of the newly produced olive oil, whereas other species are considered harmful as they can damage the oil quality through the production of unpleasant flavors and triacylglycerol hydrolysis. Studies carried out in certain yeast strains have demonstrated the presence of defects in olive oil treated with Candida adriatica, Nakazawaea wickerhamii and Candida diddensiae specific strains, while other olive oil samples treated with other Candida diddensiae strains were defect-free after four months of storage and categorized as extra virgin. A new acetic acid producing yeast species, namely, Brettanomyces acidodurans sp. nov., which was recently isolated from olive oil, could be implicated in the wine-vinegary defect of the product. Other aspects related to the activity of the lipase-producing yeasts and the survival of the yeast species in the flavored olive oils are also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
E.P. Vetchinkina
2017-05-01
Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.
Directory of Open Access Journals (Sweden)
Gerhards Daniel
2015-01-01
Full Text Available The site specific influence on wine (Terroir is an often by wine producers, consumers and scientists discussed topic in the world of wine. A study on grapes and (spontaneous fermentations from six different vineyards was done to investigate the biodiversity of yeasts and to answer the question if there is a terroir of yeast and how it could be influenced. Randomly isolated yeasts were identified by FTIR-spectroscopy and molecular methods on species and strain level. Vineyard specific yeast floras would be observed but they are not such important as expected. Only a few overlapping strain patterns would be identified during both vintages. The yeast flora of the winery had a huge impact on the spontaneous fermentations, but is not really constant and influenced by different factors from outside.
21 CFR 184.1983 - Bakers yeast extract.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b) The...
Endoplasmic reticulum involvement in yeast cell death
International Nuclear Information System (INIS)
Nicanor Austriaco, O.
2012-01-01
Yeast cells undergo programed cell death (PCD) with characteristic markers associated with apoptosis in mammalian cells including chromatin breakage, nuclear fragmentation, reactive oxygen species generation, and metacaspase activation. Though significant research has focused on mitochondrial involvement in this phenomenon, more recent work with both Saccharomyces cerevisiae and Schizosaccharomyces pombe has also implicated the endoplasmic reticulum (ER) in yeast PCD. This minireview provides an overview of ER stress-associated cell death (ER-SAD) in yeast. It begins with a description of ER structure and function in yeast before moving to a discussion of ER-SAD in both mammalian and yeast cells. Three examples of yeast cell death associated with the ER will be highlighted here including inositol starvation, lipid toxicity, and the inhibition of N-glycosylation. It closes by suggesting ways to further examine the involvement of the ER in yeast cell death.
History of genome editing in yeast.
Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela
2018-05-01
For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.
21 CFR 172.898 - Bakers yeast glycan.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast glycan. 172.898 Section 172.898 Food... Multipurpose Additives § 172.898 Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized, and...
The wine and beer yeast Dekkera bruxellensis.
Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure
2014-09-01
Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd.
Between science and industry-applied yeast research.
Korhola, Matti
2018-03-01
I was fortunate to enter yeast research at the Alko Research Laboratories with a strong tradition in yeast biochemistry and physiology studies. At the same time in the 1980s there was a fundamental or paradigm change in molecular biology research with discoveries in DNA sequencing and other analytical and physical techniques for studying macromolecules and cells. Since that time biotechnological research has expanded the traditional fermentation industries to efficient production of industrial and other enzymes and specialty chemicals. Our efforts were directed towards improving the industrial production organisms: minerals enriched yeasts (Se, Cr, Zn) and high glutathione content yeast, baker´s, distiller´s, sour dough and wine yeasts, and the fungal Trichoderma reesei platform for enzyme production. I am grateful for the trust of my colleagues in several leadership positions at the Alko Research Laboratories, Yeast Industry Platform and at the international yeast community.
SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES
Directory of Open Access Journals (Sweden)
Veligodska A. K.
2015-12-01
Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and
Yeast-based biosensors: design and applications.
Adeniran, Adebola; Sherer, Michael; Tyo, Keith E J
2015-02-01
Yeast-based biosensing (YBB) is an exciting research area, as many studies have demonstrated the use of yeasts to accurately detect specific molecules. Biosensors incorporating various yeasts have been reported to detect an incredibly large range of molecules including but not limited to odorants, metals, intracellular metabolites, carcinogens, lactate, alcohols, and sugars. We review the detection strategies available for different types of analytes, as well as the wide range of output methods that have been incorporated with yeast biosensors. We group biosensors into two categories: those that are dependent upon transcription of a gene to report the detection of a desired molecule and those that are independent of this reporting mechanism. Transcription-dependent biosensors frequently depend on heterologous expression of sensing elements from non-yeast organisms, a strategy that has greatly expanded the range of molecules available for detection by YBBs. Transcription-independent biosensors circumvent the problem of sensing difficult-to-detect analytes by instead relying on yeast metabolism to generate easily detected molecules when the analyte is present. The use of yeast as the sensing element in biosensors has proven to be successful and continues to hold great promise for a variety of applications. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.
Directory of Open Access Journals (Sweden)
Hashemi SJ
2011-04-01
Full Text Available "n 800x600 Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Background: Infections caused by opportunistic yeasts such as Candida species, Trichosporon, Rhodotorula and Saccharomyces have increased in immunocompromis-ed patients and their identification is crucial as intrinsic and acquired resistance of some yeast species to antifungal agents are on the rise. The aim of this study was to identify the organisms to the species level in order to suggest accurate and effective antifungal therapies."n"nMethods: In this study that carried out in Tehran, Iran in 2009, 200 patients with yeast infection were medically examined and clinical specimens were prepared for direct examination and culture on Sabouraud dextrose agar. Subsequently, the isolated yeast colonies were identified using various tests including culture on Corn Meal agar with Tween 80, CHROMagar Candida and casein agar. For the definite identification of organisms some biochemical tests were done based on carbohydrate assimilation by RapID Yeast Plus System kit, and, finally, a molecular method, PCR-RFLP, using Hpa II enzyme, was performed for the remaining unknown yeast species."n"nResults: A total of 211 yeast isolates were identified in 200 patients with yeast infections. The most frequent isolated yeasts were Candida albicans, 124 (58.77%, followed by Candida parapsilosis, 36 (17.06%, Candida tropicalis, 17 (8.06%, Candida glabrata, 13 (6.16%, Candida krusei, 8 (3.79%, Candida guilliermondii, 2 (0.96%, Trichosporon, 3 (1.14%, Rhodotorula, 1 (0.47%, Saccaromyces cerevisiae, 1 (0.47% and other
Oral yeast colonization throughout pregnancy.
Rio, R; Simões-Silva, L; Garro, S; Silva, M-J; Azevedo, Á; Sampaio-Maia, B
2017-03-01
Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with non-pregnant women. The oral yeast colonization was assessed in saliva of 30 pregnant and non-pregnant women longitudinally over a 6-months period. Demographic information was collected, a non-invasive intra-oral examination was performed and saliva flow and pH were determined. Pregnant and non-pregnant groups were similar regarding age and level of education. Saliva flow rate did not differ, but saliva pH was lower in pregnant than in non-pregnant women. Oral yeast prevalence was higher in pregnant than in non-pregnant women, either in the first or in the third trimester, but did not attain statistical significance. In individuals colonized with yeast, the total yeast quantification (Log10CFU/mL) increase from the 1st to the 3rd trimester in pregnant women, but not in non-pregnant women. Pregnancy may favour oral yeast growth that may be associated with an acidic oral environment.
Biotechnological Applications of Dimorphic Yeasts
Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.
The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.
Electron transport chain in a thermotolerant yeast.
Mejía-Barajas, Jorge A; Martínez-Mora, José A; Salgado-Garciglia, Rafael; Noriega-Cisneros, Ruth; Ortiz-Avila, Omar; Cortés-Rojo, Christian; Saavedra-Molina, Alfredo
2017-04-01
Yeasts capable of growing and surviving at high temperatures are regarded as thermotolerant. For appropriate functioning of cellular processes and cell survival, the maintenance of an optimal redox state is critical of reducing and oxidizing species. We studied mitochondrial functions of the thermotolerant Kluyveromyces marxianus SLP1 and the mesophilic OFF1 yeasts, through the evaluation of its mitochondrial membrane potential (ΔΨ m ), ATPase activity, electron transport chain (ETC) activities, alternative oxidase activity, lipid peroxidation. Mitochondrial membrane potential and the cytoplasmic free Ca 2+ ions (Ca 2+ cyt) increased in the SLP1 yeast when exposed to high temperature, compared with the mesophilic yeast OFF1. ATPase activity in the mesophilic yeast diminished 80% when exposed to 40° while the thermotolerant SLP1 showed no change, despite an increase in the mitochondrial lipid peroxidation. The SLP1 thermotolerant yeast exposed to high temperature showed a diminution of 33% of the oxygen consumption in state 4. The uncoupled state 3 of oxygen consumption did not change in the mesophilic yeast when it had an increase of temperature, whereas in the thermotolerant SLP1 yeast resulted in an increase of 2.5 times when yeast were grown at 30 o , while a decrease of 51% was observed when it was exposed to high temperature. The activities of the ETC complexes were diminished in the SLP1 when exposed to high temperature, but also it was distinguished an alternative oxidase activity. Our results suggest that the mitochondria state, particularly ETC state, is an important characteristic of the thermotolerance of the SLP1 yeast strain.
Hoang, Don; Kopp, Artyom; Chandler, James Angus
2015-01-01
Yeasts play an important role in the biology of the fruit fly, Drosophila melanogaster. In addition to being a valuable source of nutrition, yeasts affect D. melanogaster behavior and interact with the host immune system. Most experiments investigating the role of yeasts in D. melanogaster biology use the baker's yeast, Saccharomyces cerevisiae. However, S. cerevisiae is rarely found with natural populations of D. melanogaster or other Drosophila species. Moreover, the strain of S. cerevisiae used most often in D. melanogaster experiments is a commercially and industrially important strain that, to the best of our knowledge, was not isolated from flies. Since disrupting natural host-microbe interactions can have profound effects on host biology, the results from D. melanogaster-S. cerevisiae laboratory experiments may not be fully representative of host-microbe interactions in nature. In this study, we explore the D. melanogaster-yeast relationship using five different strains of yeast that were isolated from wild Drosophila populations. Ingested live yeasts have variable persistence in the D. melanogaster gastrointestinal tract. For example, Hanseniaspora occidentalis persists relative to S. cerevisiae, while Brettanomyces naardenensis is removed. Despite these differences in persistence relative to S. cerevisiae, we find that all yeasts decrease in total abundance over time. Reactive oxygen species (ROS) are an important component of the D. melanogaster anti-microbial response and can inhibit S. cerevisiae growth in the intestine. To determine if sensitivity to ROS explains the differences in yeast persistence, we measured yeast growth in the presence and absence of hydrogen peroxide. We find that B. naardenesis is completely inhibited by hydrogen peroxide, while H. occidentalis is not, which is consistent with yeast sensitivity to ROS affecting persistence within the D. melanogaster gastrointestinal tract. We also compared the feeding preference of D
Genomics and the making of yeast biodiversity.
Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P
2015-12-01
Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces cerevisiae; the common human commensal and opportunistic pathogen, Candida albicans; and over 1000 other known species (with more continuing to be discovered). Yeasts are found in every biome and continent and are more genetically diverse than angiosperms or chordates. Ease of culture, simple life cycles, and small genomes (∼10-20Mbp) have made yeasts exceptional models for molecular genetics, biotechnology, and evolutionary genomics. Here we discuss recent developments in understanding the genomic underpinnings of the making of yeast biodiversity, comparing and contrasting natural and human-associated evolutionary processes. Only a tiny fraction of yeast biodiversity and metabolic capabilities has been tapped by industry and science. Expanding the taxonomic breadth of deep genomic investigations will further illuminate how genome function evolves to encode their diverse metabolisms and ecologies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Accelerating Yeast Prion Biology using Droplet Microfluidics
Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David
2012-02-01
Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.
Lifescience Database Archive (English)
Full Text Available List Contact us Yeast Interacting Proteins Database Full Data of Yeast Interacting Proteins Database (Origin...al Version) Data detail Data name Full Data of Yeast Interacting Proteins Database (Original Version) DOI 10....18908/lsdba.nbdc00742-004 Description of data contents The entire data in the Yeast Interacting Proteins Database...eir interactions are required. Several sources including YPD (Yeast Proteome Database, Costanzo, M. C., Hoga...ematic name in the SGD (Saccharomyces Genome Database; http://www.yeastgenome.org /). Bait gene name The gen
Genomics and the making of yeast biodiversity
Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P
2015-01-01
Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces
Yeasts preservation: alternatives for lyophilisation
Nyanga, Loveness K.; Nout, Martinus J. R.; Smid, Eddy J.; Boekhout, Teun; Zwietering, Marcel H.
2012-01-01
The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts during 6 months storage at 4 and 25 °C. None of the yeast cultures showed a significant loss in viable cell count during 6 months of storage at 4 °C upon lyophilisation and preservation in dry rice cak...
Yeasts Diversity in Fermented Foods and Beverages
Tamang, Jyoti Prakash; Fleet, Graham H.
People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy
Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela
The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.
Inheritance of the yeast mitochondrial genome
DEFF Research Database (Denmark)
Piskur, Jure
1994-01-01
Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...
21 CFR 172.590 - Yeast-malt sprout extract.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...
Yeasts in sustainable bioethanol production: A review.
Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis
2017-07-01
Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.
Yeasts in sustainable bioethanol production: A review
Directory of Open Access Journals (Sweden)
Siti Hajar Mohd Azhar
2017-07-01
Full Text Available Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.
Comet assay on tetraploid yeast cells
DEFF Research Database (Denmark)
Rank, Jette; Syberg, Kristian; Jensen, Klara
2009-01-01
Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from...... three municipal treatment plants were tested for their effect on the yeast-cell DNA. The main problem with using yeast in the comet assay is the necessity to degrade the cell wall. This was achieved by using Zymolase 100 T twice during the procedure, since Zymolase 20 T did not open the cell wall....... Analytical problems that arose due to the small amount of DNA in the yeast nuclei in haploid and diploid cells, which contain 13 Mbp and 26 Mbp DNA per cell, respectively, were solved by using tetraploid yeast cells (52 Mbp) instead. DNA damage was shown after exposure to H2O2 and acrylamide. The lowest dose...
Revaluation of Waste Yeast from Beer Production
Directory of Open Access Journals (Sweden)
Nicoleta Suruceanu
2013-11-01
Full Text Available Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, identification and quantification of xanthohumol by HPLC method. Waste yeast from brewery pilot plant of USAMV Cluj Napoca it was dried by atomization and the powder was analyzed on xanthohumol content by HPLC method. For quantification a calibration curve it was used. The process of drying by atomisation lead to a powder product. It was used malt dextrin powder for stabilisation. The final product it was encapsulated. The xanthohumol content of powdered yeast it was 1.94 µg/ml. In conclusion the slurry yeast from beer production it is an important source of prenylflavonoids compounds.
Aboveground Deadwood Deposition Supports Development of Soil Yeasts
Directory of Open Access Journals (Sweden)
Thorsten Wehde
2012-12-01
Full Text Available Unicellular saprobic fungi (yeasts inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil-borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon. Unlike soils underneath logs, yeast communities in adjacent areas harbored a considerable number of transient (phylloplane-related yeasts reaching 30% of the total yeast quantity. We showed that distinguishing autochthonous community members and species transient in soils is essential to estimate appropriate effects of environmental factors on soil fungi. Furthermore, a better understanding of species niches is crucial for analyses of culture-independent data, and may hint to the discovery of unifying patterns of microbial species distribution.
[Distiller Yeasts Producing Antibacterial Peptides].
Klyachko, E V; Morozkina, E V; Zaitchik, B Ts; Benevolensky, S V
2015-01-01
A new method of controlling lactic acid bacteria contamination was developed with the use of recombinant Saccharomyces cerevisiae strains producing antibacterial peptides. Genes encoding the antibacterial peptides pediocin and plantaricin with codons preferable for S. cerevisiae were synthesized, and a system was constructed for their secretory expression. Recombinant S. cerevisiae strains producing antibacterial peptides effectively inhibit the growth of Lactobacillus sakei, Pediacoccus pentasaceus, Pediacoccus acidilactici, etc. The application of distiller yeasts producing antibacterial peptides enhances the ethanol yield in cases of bacterial contamination. Recombinant yeasts producing the antibacterial peptides pediocin and plantaricin can successfully substitute the available industrial yeast strains upon ethanol production.
Made for Each Other: Ascomycete Yeasts and Insects.
Blackwell, Meredith
2017-06-01
Fungi and insects live together in the same habitats, and many species of both groups rely on each other for success. Insects, the most successful animals on Earth, cannot produce sterols, essential vitamins, and many enzymes; fungi, often yeast-like in growth form, make up for these deficits. Fungi, however, require constantly replenished substrates because they consume the previous ones, and insects, sometimes lured by volatile fungal compounds, carry fungi directly to a similar, but fresh, habitat. Yeasts associated with insects include Ascomycota (Saccharomycotina, Pezizomycotina) and a few Basidiomycota. Beetles, homopterans, and flies are important associates of fungi, and in turn the insects carry yeasts in pits, specialized external pouches, and modified gut pockets. Some yeasts undergo sexual reproduction within the insect gut, where the genetic diversity of the population is increased, while others, well suited to their stable environment, may never mate. The range of interactions extends from dispersal of yeasts on the surface of insects (e.g., cactus- Drosophila -yeast and ephemeral flower communities, ambrosia beetles, yeasts with holdfasts) to extremely specialized associations of organisms that can no longer exist independently, as in the case of yeast-like symbionts of planthoppers. In a few cases yeast-like fungus-insect associations threaten butterflies and other species with extinction. Technical advances improve discovery and identification of the fungi but also inform our understanding of the evolution of yeast-insect symbioses, although there is much more to learn.
The growth of solar radiated yeast
Energy Technology Data Exchange (ETDEWEB)
Kraft, T.
1995-09-01
This researcher plans to determine if solar radiation affects the growth of yeast. The irradiated yeast was obtained from a sample exposed in space during a Space Shuttle flight of September 9-20, 1994. Further, the control groups were held at: (1) Goddard Space Flight Center (GSFC) in Greenbelt, Maryland; and (2) South Dakota School of Mines and Technology. The procedure used was based on the fact that yeast is most often used in consumable baked goods. Therefore, the yeast was incorporated into a basic Betty Crocker bread recipe. Data was collected by placing measured amounts of dough into sample containers with fifteen minute growth in height measurements collected and recorded. This researcher assumed the viability of yeast to be relative to its ability to produce carbon dioxide gas and cause the dough to rise. As all ingredients and surroundings were equal, this researcher assumed the yeast will produce the only significant difference in data collected. This researcher noted the approximate use date on all sample packages to be prior to arrival and experiment date. All dates equal, it was then assumed each would act in a similar manner of response. This assumption will allow for equally correct data collection.
The growth of solar radiated yeast
Kraft, Tyrone
1995-01-01
This researcher plans to determine if solar radiation affects the growth of yeast. The irradiated yeast was obtained from a sample exposed in space during a Space Shuttle flight of September 9-20, 1994. Further, the control groups were held at: (1) Goddard Space Flight Center (GSFC) in Greenbelt, Maryland; and (2) South Dakota School of Mines and Technology. The procedure used was based on the fact that yeast is most often used in consumable baked goods. Therefore, the yeast was incorporated into a basic Betty Crocker bread recipe. Data was collected by placing measured amounts of dough into sample containers with fifteen minute growth in height measurements collected and recorded. This researcher assumed the viability of yeast to be relative to its ability to produce carbon dioxide gas and cause the dough to rise. As all ingredients and surroundings were equal, this researcher assumed the yeast will produce the only significant difference in data collected. This researcher noted the approximate use date on all sample packages to be prior to arrival and experiment date. All dates equal, it was then assumed each would act in a similar manner of response. This assumption will allow for equally correct data collection.
Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes
Directory of Open Access Journals (Sweden)
Tony Hadibarata
2011-11-01
Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.
Urbina, Hector; Frank, Robert; Blackwell, Meredith
2013-01-01
The gut of wood-feeding insects is a microhabitat for a specialized community of microbes, including bacteria and several groups of eukaryotes such as nematodes, parabasalids and fungi. The characterization of gut yeast communities from a variety of insects has shown that certain yeasts often are associated with the insects. The gut of wood-feeding insects is rich in ascomycete yeasts and in particular xylose-fermenting (X-F) and assimilating yeasts have been consistently present in the gut of lignicolous insects. The objective of this study was the characterization of the yeast flora from the gut of the wood roach Cryptocercus sp. (Blattodea: Cryptocercidae). Five wood roaches were collected along the Appalachian Trail near the border between Tennessee and North Carolina, USA. We isolated 18 yeast strains from the wood roaches identified as Sugiyamaella paludigena and Sugiyamaella lignohabitans, xylose-assimilating yeasts, and Scheffersomyces cryptocercus (NRRL Y-48824(T) = CBS 12658) a new species of X-F yeast. The presence of X-F and certain non X-F yeasts in the gut of the subsocial wood roach Cryptocercus sp. extends the previous findings of associations between certain ascomycete yeasts and lignicolous insects. New combinations were made for 13 asexual members of the Sugiyamaella clade.
Effect of increasing growth temperature on yeast fermentation ...
African Journals Online (AJOL)
The effect of increasing growth temperature on yeast fermentation was studied at approximately 5 oC intervals over a range of 18 – 37 oC, using one strain each of ale, lager and wine yeast. The ale and wine yeasts grew at all the temperatures tested, but lager yeast failed to grow at 37 oC. All these strains gave lower ...
Yeasts preservation: alternatives for lyophilisation
Nyanga, L.K.; Nout, M.J.R.; Smid, E.J.; Boekhout, T.; Zwietering, M.H.
2012-01-01
The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts
Biotechnology of non-Saccharomyces yeasts--the ascomycetes.
Johnson, Eric A
2013-01-01
Saccharomyces cerevisiae and several other yeast species are among the most important groups of biotechnological organisms. S. cerevisiae and closely related ascomycetous yeasts are the major producer of biotechnology products worldwide, exceeding other groups of industrial microorganisms in productivity and economic revenues. Traditional industrial attributes of the S. cerevisiae group include their primary roles in food fermentations such as beers, cider, wines, sake, distilled spirits, bakery products, cheese, sausages, and other fermented foods. Other long-standing industrial processes involving S. cerevisae yeasts are production of fuel ethanol, single-cell protein (SCP), feeds and fodder, industrial enzymes, and small molecular weight metabolites. More recently, non-Saccharomyces yeasts (non-conventional yeasts) have been utilized as industrial organisms for a variety of biotechnological roles. Non-Saccharomyces yeasts are increasingly being used as hosts for expression of proteins, biocatalysts and multi-enzyme pathways for the synthesis of fine chemicals and small molecular weight compounds of medicinal and nutritional importance. Non-Saccharomyces yeasts also have important roles in agriculture as agents of biocontrol, bioremediation, and as indicators of environmental quality. Several of these products and processes have reached commercial utility, while others are in advanced development. The objective of this mini-review is to describe processes currently used by industry and those in developmental stages and close to commercialization primarily from non-Saccharomyces yeasts with an emphasis on new opportunities. The utility of S. cerevisiae in heterologous production of selected products is also described.
Taming wild yeast: potential of conventional and nonconventional yeasts in industrial fermentations.
Steensels, Jan; Verstrepen, Kevin J
2014-01-01
Yeasts are the main driving force behind several industrial food fermentation processes, including the production of beer, wine, sake, bread, and chocolate. Historically, these processes developed from uncontrolled, spontaneous fermentation reactions that rely on a complex mixture of microbes present in the environment. Because such spontaneous processes are generally inconsistent and inefficient and often lead to the formation of off-flavors, most of today's industrial production utilizes defined starter cultures, often consisting of a specific domesticated strain of Saccharomyces cerevisiae, S. bayanus, or S. pastorianus. Although this practice greatly improved process consistency, efficiency, and overall quality, it also limited the sensorial complexity of the end product. In this review, we discuss how Saccharomyces yeasts were domesticated to become the main workhorse of food fermentations, and we investigate the potential and selection of nonconventional yeasts that are often found in spontaneous fermentations, such as Brettanomyces, Hanseniaspora, and Pichia spp.
Bellon, Jennifer R; Schmid, Frank; Capone, Dimitra L; Dunn, Barbara L; Chambers, Paul J
2013-01-01
Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.
International Nuclear Information System (INIS)
Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.
1990-01-01
During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)
Yeast Interacting Proteins Database: YFR015C, YFR015C [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...ression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary ...tion, nitrogen starvation, environmental stress, and entry into stationary phase Rows with this bait as bait..., the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental
Radiodiagnosis of yeast alveolits (a clinicoexperimental study)
International Nuclear Information System (INIS)
Amosov, I.S.; Smirnov, V.A.
1984-01-01
A clinicoroetgenological study was made of 115 workers engaged in the yeast production for different periods of time. Disorders of the respiration biomechanics were revealed depending on the period of service. These data were obtained as a result of the use of roentgenopneumopolygraphy. An experimental study was conducted to establish the nature of lesions in the bronchopulmonary system in allergic alveolitis. The effect of finely divided yeast dust on the bronchopulmonary system was studied on 132 guinea-pigs usinq microbronchography and morphological examination. As a result of the study it has been established that during the inhalation of yeast dust, notnceable dystrophy of the bronchi develops, the sizes of alveoli enlarge and part of them undergo emphysematous distension with the rupture of the interalveolar septa. In the course of the study, it has been shown that yeast dust is little agreessive, yeast alveolitis develops after many years of work. The clinical symptoms are non-specific and insignificant. X-ray and morphological changes are followed by the physical manifestations of yeast alveolitis
MALDI-TOF MS as a tool to identify foodborne yeasts and yeast-like fungi.
Quintilla, Raquel; Kolecka, Anna; Casaregola, Serge; Daniel, Heide M; Houbraken, Jos; Kostrzewa, Markus; Boekhout, Teun; Groenewald, Marizeth
2018-02-02
Since food spoilage by yeasts causes high economic losses, fast and accurate identifications of yeasts associated with food and food-related products are important for the food industry. In this study the efficiency of the matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify food related yeasts was evaluated. A CBS in-house MALDI-TOF MS database was created and later challenged with a blinded test set of 146 yeast strains obtained from food and food related products. Ninety eight percent of the strains were correctly identified with log score values>1.7. One strain, Mrakia frigida, gained a correct identification with a score value1.7. Ambiguous identifications were observed due to two incorrect reference mass spectra's found in the commercial database BDAL v.4.0, namely Candida sake DSM 70763 which was re-identified as Candida oleophila, and Candida inconspicua DSM 70631 which was re-identified as Pichia membranifaciens. MALDI-TOF MS can distinguish between most of the species, but for some species complexes, such as the Kazachstania telluris and Mrakia frigida complexes, MALDI-TOF MS showed limited resolution and identification of sibling species was sometimes problematic. Despite this, we showed that the MALDI-TOF MS is applicable for routine identification and validation of foodborne yeasts, but a further update of the commercial reference databases is needed. Copyright © 2017 Elsevier B.V. All rights reserved.
Yeasts are essential for cocoa bean fermentation.
Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham
2014-03-17
Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.
Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen
2015-01-14
Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.
Genomic Evolution of the Ascomycete Yeasts
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas
2015-03-16
Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.
Specialist nectar-yeasts decline with urbanization in Berlin
Wehner, Jeannine; Mittelbach, Moritz; Rillig, Matthias C.; Verbruggen, Erik
2017-03-01
Nectar yeasts are common inhabitants of insect-pollinated flowers but factors determining their distribution are not well understood. We studied the influence of host identity, environmental factors related to pollution/urbanization, and the distance to a target beehive on local distribution of nectar yeasts within Robinia pseudoacacia L. and Tilia tomentosa Moench in Berlin, Germany. Nectar samples of six individuals per species were collected at seven sites in a 2 km radius from each target beehive and plated on YM-Agar to visualise the different morphotypes, which were then identified by sequencing a section of the 26S rDNA gene. Multivariate linear models were used to analyze the effects of all investigated factors on yeast occurrence per tree. Yeast distribution was mainly driven by host identity. The influence of the environmental factors (NO2, height of construction, soil sealing) strongly depended on the radius around the tree, similar to the distance of the sampled beehive. Incidence of specialist nectar-borne yeast species decreased with increasing pollution/urbanization index. Given that specialist yeast species gave way to generalist yeasts that have a reduced dependency on pollinators for between-flower dispersal, our results indicate that increased urbanization may restrict the movement of nectar-specialized yeasts, via limitations of pollinator foraging behavior.
Black yeast-like fungi in skin and nail
DEFF Research Database (Denmark)
Saunte, D M; Tarazooie, B; Arendrup, M C
2011-01-01
Black yeast-like fungi are rarely reported from superficial infections. We noticed a consistent prevalence of these organisms as single isolations from mycological routine specimens. To investigate the prevalence of black yeast-like fungi in skin, hair and nail specimens and to discuss...... the probability of these species to be involved in disease. Slow-growing black yeast-like fungi in routine specimens were prospectively collected and identified. A questionnaire regarding patient information was sent to physicians regarding black yeast-like fungus positive patients. A total of 20 746...... dermatological specimens were examined by culture. Black yeast-like fungi accounted for 2.2% (n = 108) of the positive cultures. Only 31.0% of the samples, culture positive for black yeast-like fungi were direct microscopy positive when compared with overall 68.8% of the culture positive specimens. The most...
Directory of Open Access Journals (Sweden)
Jennifer R Bellon
Full Text Available Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade, has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.
Bellon, Jennifer R.; Schmid, Frank; Capone, Dimitra L.; Dunn, Barbara L.; Chambers, Paul J.
2013-01-01
Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment. PMID:23614011
Chemical signaling and insect attraction is a conserved trait in yeasts.
Becher, Paul G; Hagman, Arne; Verschut, Vasiliki; Chakraborty, Amrita; Rozpędowska, Elżbieta; Lebreton, Sébastien; Bengtsson, Marie; Flick, Gerhard; Witzgall, Peter; Piškur, Jure
2018-03-01
Yeast volatiles attract insects, which apparently is of mutual benefit, for both yeasts and insects. However, it is unknown whether biosynthesis of metabolites that attract insects is a basic and general trait, or if it is specific for yeasts that live in close association with insects. Our goal was to study chemical insect attractants produced by yeasts that span more than 250 million years of evolutionary history and vastly differ in their metabolism and lifestyle. We bioassayed attraction of the vinegar fly Drosophila melanogaster to odors of phylogenetically and ecologically distinct yeasts grown under controlled conditions. Baker's yeast Saccharomyces cerevisiae , the insect-associated species Candida californica , Pichia kluyveri and Metschnikowia andauensis , wine yeast Dekkera bruxellensis , milk yeast Kluyveromyces lactis , the vertebrate pathogens Candida albicans and Candida glabrata , and oleophilic Yarrowia lipolytica were screened for fly attraction in a wind tunnel. Yeast headspace was chemically analyzed, and co-occurrence of insect attractants in yeasts and flowering plants was investigated through a database search. In yeasts with known genomes, we investigated the occurrence of genes involved in the synthesis of key aroma compounds. Flies were attracted to all nine yeasts studied. The behavioral response to baker's yeast was independent of its growth stage. In addition to Drosophila , we tested the basal hexapod Folsomia candida (Collembola) in a Y-tube assay to the most ancient yeast, Y. lipolytica, which proved that early yeast signals also function on clades older than neopteran insects. Behavioral and chemical data and a search for selected genes of volatile metabolites underline that biosynthesis of chemical signals is found throughout the yeast clade and has been conserved during the evolution of yeast lifestyles. Literature and database reviews corroborate that yeast signals mediate mutualistic interactions between insects and yeasts
Effect of fungicides on epiphytic yeasts associated with strawberry
Debode, Jane; Van Hemelrijck, Wendy; Creemers, Piet; Maes, Martine
2013-01-01
We studied the effect of two commonly used fungicides on the epiphytic yeast community of strawberry. Greenhouse and field experiments were conducted applying Switch (cyprodinil plus fludioxonil) or Signum (boscalid plus pyraclostrobin) to strawberry plants. Yeasts on leaves and fruits were assessed on treated and untreated plants at several time points via plating and denaturing gradient gel electrophoresis (DGGE) analysis. The yeast counts on plates of the treated plants were similar to the control plants. Unripe fruits had 10 times larger yeast concentrations than ripe fruits or leaves. Some dominant yeast types were isolated and in vitro tests showed that they were at least 10 times less sensitive to Switch and Signum as compared with two important fungal strawberry pathogens Botrytis cinerea and Colletotrichum acutatum, which are the targets for the fungicide control. DGGE analysis showed that the applied fungicides had no effect on the composition of the yeast communities, while the growing system, strawberry tissue, and sampling time did affect the yeast communities. The yeast species most commonly identified were Cryptococcus, Rhodotorula, and Sporobolomyces. These results point toward the potential applicability of natural occurring yeast antagonists into an integrated disease control strategy for strawberry diseases.
Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes
Energy Technology Data Exchange (ETDEWEB)
Hong, J. S.; Kim, D.H.
1981-01-01
Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.
Flor Yeast: New Perspectives Beyond Wine Aging
Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena
2016-01-01
The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192
Construction of gateway-compatible yeast two-hybrid vectors for ...
African Journals Online (AJOL)
Yeast two-hybrid system combined with the gateway technology will greatly facilitate the cloning of interested DNA fragment into yeast two-hybrid vectors and therefore increase the efficiency of yeast two-hybrid analysis. In this study, we constructed a pair of Gateway-compatible yeast two-hybrid vectors pBTM116GW and ...
Antimicrobial activity of yeasts against some pathogenic bacteria
Directory of Open Access Journals (Sweden)
Gamal Younis
2017-08-01
Full Text Available Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR for detection of khs (kievitone hydratase and pelA (pectate degrading enzyme genes. Results: The recovery rate of yeasts from sausage was 20% (2/10 followed by kareish cheese, processed cheese, and butter 10% (1/10 each as well as raw milk 9% (9/100, and fruit yoghurt 30% (6/20. Different yeast species were recovered, namely, Candida kefyr (5 isolates, Saccharomyces cerevisiae (4 isolates, Candida intermedia (3 isolates, Candida tropicalis (2 isolates, Candida lusitaniae (2 isolates, and Candida krusei (1 isolate. khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food.
Yeast species associated with wine grapes in China.
Li, Shuang-Shi; Cheng, Chao; Li, Zheng; Chen, Jing-Yu; Yan, Bin; Han, Bei-Zhong; Reeves, Malcolm
2010-03-31
Having more information on the yeast ecology of grapes is important for wine-makers to produce wine with high quality and typical attributes. China is a significant wine-consuming country and is becoming a serious wine-producer, but little has been reported about the yeast ecology of local ecosystems. This study provides the first step towards the exploitation of the yeast wealth in China's vine-growing regions. The aim of this study was to investigate the yeast population density and diversity on three grape varieties cultivated in four representative vine-growing regions of China. Yeast species diversity was evaluated by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequence analysis of the 5.8S internal transcribed spacer (ITS) ribosomal DNA (rDNA) region of cultivable yeasts. The grapes harbored yeast populations at 10(2)-10(6)CFU/mL, consisting mostly of non-Saccharomyces species. Seventeen different yeast species belonging to eight genera were detected on the grape samples tested, including Hanseniaspora uvarum, Cryptococcus flavescens, Pichia fermentans, Candida zemplinina, Cryptococcus carnescens, Candida inconpicua, Zygosaccharomyces fermentati, Issatchenkia terricola, Candida quercitrusa, Hanseniaspora guilliermondii, Candida bombi, Zygosaccharomyces bailii, Sporidiobolus pararoseus, Cryptococcus magnus, Metschnikowia pulcherrima, Issatchenkia orientalis and Pichia guilliermondii. H. uvarum and C. flavescens were the dominant species present on the grapes. For the first time Sporidiobolus pararoseus was discovered as an inhabitant of the grape ecosystem. The yeast community on grape berries was influenced by the grape chemical composition, vine-variety and vine-growing region. This study is the first to identify the yeast communities associated with grapes in China using molecular methods. The results enrich our knowledge of wine-related microorganisms, and can be used to promote the development of the local wine
Directory of Open Access Journals (Sweden)
M Bayarjargal
2014-09-01
Full Text Available Spent brewer’s yeast (Saccharomyces cerevisiae is a rich source of protein, vitamins and widely used as a raw material for production of food supplements. The autolysis and enzymatic treatment of spent brewer’s yeast using Pancreatin (2.5% and Flavourzyme (2.5% were performed at 45 °C and 50 °C, respectively. The autolysis and hydrolysis processes were evaluated by determining a soluble solids, soluble protein concentration and α-amino nitrogen content in a reaction mixture. The yield of pancreatic digest and α-amino nitrogen content was high in comparison with autolysis and Flavourzyme treatment. The total solids recovery in dry Yeast hydrolysate was about 50%, a protein and α-amino nitrogen content was 55.9 and 4.8%, respectively. These results show the possibility of utilizing the spent brewer’s yeast as hydrolysate using hydrolytic enzymes and use it as a food supplement after biological experiments.DOI: http://dx.doi.org/10.5564/mjc.v12i0.179 Mongolian Journal of Chemistry Vol.12 2011: 88-91
Yeast cell factories on the horizon
DEFF Research Database (Denmark)
Nielsen, Jens
2015-01-01
For thousands of years, yeast has been used for making beer, bread, and wine. In modern times, it has become a commercial workhorse for producing fuels, chemicals, and pharmaceuticals such as insulin, human serum albumin, and vaccines against hepatitis virus and human papillomavirus. Yeast has also...... been engineered to make chemicals at industrial scale (e.g., succinic acid, lactic acid, resveratrol) and advanced biofuels (e.g., isobutanol) (1). On page 1095 of this issue, Galanie et al. (2) demonstrate that yeast can now be engineered to produce opioids (2), a major class of compounds used...
Selection of oleaginous yeasts for fatty acid production
Lamers, Dennis; Biezen, van Nick; Martens, Dirk; Peters, Linda; Zilver, van de Eric; Jacobs-van Dreumel, Nicole; Wijffels, René H.; Lokman, Christien
2016-01-01
Background: Oleaginous yeast species are an alternative for the production of lipids or triacylglycerides (TAGs). These yeasts are usually non-pathogenic and able to store TAGs ranging from 20 % to 70 % of their cell mass depending on culture conditions. TAGs originating from oleaginous yeasts
DEFF Research Database (Denmark)
2014-01-01
A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate semialde......A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate...... semialdehyde. The yeast may also express a 3-hydroxyisobutyrate dehydrogenase (HIBADH) and a 3-hydroxypropanoate dehydrogenase (3-HPDH) and aspartate 1-decarboxylase. Additionally the yeast may express pyruvate carboxylase and aspartate aminotransferase....
International Nuclear Information System (INIS)
Sikumbang, I.; Nasution, A.I.; Indarwatmi, M.; Kuswandi, A.N.
2000-01-01
The use of local product yeast I.e brewer yeast, yeast of tapai (fermented cassava), yeast of tempe (fermented soy beam), and brem(intoxicating beverage made of fermented rice) after cooked and uncooked were used to substitute torula yeast to reduce cost production for mass-rearing of fruit fly had been carried out. Artificial diet formulation consisted of torula yeast, wheat bran, nipagin, sodium benzoate, cane sugar, water and HCI ti make pH of 4. One kilogram of diet was inoculated with 1 ml of fruit fly eggs. Parameters of the experiment were, the number of pupae, weight of pupae, percentage of pupae and the percentage of viable fly. The results showed that the number of pupae were 6356 for brewers yeast with cooked and 0.942 gram/100 pupae for brem. Percentage viable emergence fly were 70%, 18.25% and 15.25% for brewers yeast with cooked and uncooked respectively. Cost production for 1.000.000 using cooked brewer yeast was reduced about Rp.179,200 or cost efficiency were 55.56%
Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina
2017-04-01
The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.
Guidelines and recommendations on yeast cell death nomenclature
Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andres; Austriaco, Nicanor; Sigrist, Stephan J.
2018-01-01
Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of mor...
Guidelines and recommendations on yeast cell death nomenclature
Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J; Breitenbach, Michael; Burhans, William C; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W; Grant, Chris M; Greenwood, Michael T; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D; Outeiro, Tiago F; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F; Sharon, Amir; Sigrist, Stephan J; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B; Tuite, Mick; Vögtle, F-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J; Zhao, Richard Y; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank
2018-01-01
Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cel-lular demise. However, the investigation of yeast cell death is a relatively young field, and a widely
Heat-treated mineral-yeast as a potent post-irradiation radioprotector
International Nuclear Information System (INIS)
Anzai, Kazunori; Ueno, Megumi; Nyui, Minako; Ikota, Nobuo; Kagiya, Tsutomu V.
2008-01-01
In vivo radioprotection of C3H mice by i.p. administration of Zn-, Mn-, Cu-, or Se-containing heat-treated Saccharomyces serevisiae yeast sample was examined. The 30-day survival of the group treated 30 min before 7.5 Gy whole-body X-irradiation with mineral-containing yeast powders suspended in 0.5% methylcellulose was significantly higher than that of control group. When mineral-yeast was administered immediately after irradiation, the survival rate was even higher and Zn- or Cu-yeast showed the highest rate (more than 90%). Although treatment with simple yeast showed a high survival rate (73%), it was significantly lower than that obtained by the Zn-yeast treatment. The effects of Zn-yeast were studied further. When the interval between irradiation and administration was varied, the protective activity of Zn-yeast decreased gradually by increasing the interval but was still significantly high for the administration at 10 h post-irradiation. The dose reduction factor of Zn-yeast (100 mg/kg, i.p. administration immediately after irradiation) was about 1.2. When the suspension of Zn-yeast was fractionated by centrifugation, the insoluble fraction showed a potent effect, while the soluble fraction had only a moderate effect. In conclusion, mineral-yeast, especially Zn-yeast, provides remarkable post-irradiation protection against lethal whole body X-irradiation. The activity is mainly attributable to the insoluble fraction, whereas some soluble components might contribute to the additional protective activity. (author)
Yeast diversity and native vigor for flavor phenotypes.
Carrau, Francisco; Gaggero, Carina; Aguilar, Pablo S
2015-03-01
Saccharomyces cerevisiae, the yeast used widely for beer, bread, cider, and wine production, is the most resourceful eukaryotic model used for genetic engineering. A typical concern about using engineered yeasts for food production might be negative consumer perception of genetically modified organisms. However, we believe the true pitfall of using genetically modified yeasts is their limited capacity to either refine or improve the sensory properties of fermented foods under real production conditions. Alternatively, yeast diversity screening to improve the aroma and flavors could offer groundbreaking opportunities in food biotechnology. We propose a 'Yeast Flavor Diversity Screening' strategy which integrates knowledge from sensory analysis and natural whole-genome evolution with information about flavor metabolic networks and their regulation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Oral yeast carriage in patients with advanced cancer.
Davies, A N; Brailsford, S; Broadley, K; Beighton, D
2002-04-01
The aim of this study was to investigate oral yeast carriage amongst patients with advanced cancer. Oral rinse samples were obtained from 120 subjects. Yeasts were isolated using Sabouraud's dextrose agar and CHROMagar Candida, and were identified using a combination of the API 20 C AUX yeast identification system, species-specific PCR and 26S rDNA gene sequencing. Oral yeast carriage was present in 66% of subjects. The frequency of isolation of individual species was: Candida albicans, 46%; Candida glabrata, 18%; Candida dubliniensis, 5%; others, yeast carriage was associated with denture wearing (P = 0.006), and low stimulated whole salivary flow rate (P = 0.009). Identification of these risk factors offers new strategies for the prevention of oral candidosis in this group of patients.
Gram-scale production of a basidiomycetous laccase in Aspergillus niger.
Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry
2014-01-01
We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Novel brewing yeast hybrids: creation and application.
Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian
2017-01-01
The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.
Making Sense of the Yeast Sphingolipid Pathway.
Megyeri, Márton; Riezman, Howard; Schuldiner, Maya; Futerman, Anthony H
2016-12-04
Sphingolipids (SL) and their metabolites play key roles both as structural components of membranes and as signaling molecules. Many of the key enzymes and regulators of SL metabolism were discovered using the yeast Saccharomyces cerevisiae, and based on the high degree of conservation, a number of mammalian homologs were identified. Although yeast continues to be an important tool for SL research, the complexity of SL structure and nomenclature often hampers the ability of new researchers to grasp the subtleties of yeast SL biology and discover new modulators of this intricate pathway. Moreover, the emergence of lipidomics by mass spectrometry has enabled the rapid identification of SL species in yeast and rendered the analysis of SL composition under various physiological and pathophysiological conditions readily amenable. However, the complex nomenclature of the identified species renders much of the data inaccessible to non-specialists. In this review, we focus on parsing both the classical SL nomenclature and the nomenclature normally used during mass spectrometry analysis, which should facilitate the understanding of yeast SL data and might shed light on biological processes in which SLs are involved. Finally, we discuss a number of putative roles of various yeast SL species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Improving industrial yeast strains: exploiting natural and artificial diversity
Steensels, Jan; Snoek, Tim; Meersman, Esther; Nicolino, Martina Picca; Voordeckers, Karin; Verstrepen, Kevin J
2014-01-01
Yeasts have been used for thousands of years to make fermented foods and beverages, such as beer, wine, sake, and bread. However, the choice for a particular yeast strain or species for a specific industrial application is often based on historical, rather than scientific grounds. Moreover, new biotechnological yeast applications, such as the production of second-generation biofuels, confront yeast with environments and challenges that differ from those encountered in traditional food fermentations. Together, this implies that there are interesting opportunities to isolate or generate yeast variants that perform better than the currently used strains. Here, we discuss the different strategies of strain selection and improvement available for both conventional and nonconventional yeasts. Exploiting the existing natural diversity and using techniques such as mutagenesis, protoplast fusion, breeding, genome shuffling and directed evolution to generate artificial diversity, or the use of genetic modification strategies to alter traits in a more targeted way, have led to the selection of superior industrial yeasts. Furthermore, recent technological advances allowed the development of high-throughput techniques, such as ‘global transcription machinery engineering’ (gTME), to induce genetic variation, providing a new source of yeast genetic diversity. PMID:24724938
Protein patterns of yeast during sporulation
International Nuclear Information System (INIS)
Litske Petersen, J.G.; Kielland-Brandt, M.C.; Nilsson-Tillgren, T.
1979-01-01
High resolution two-dimensional gel electrophoresis was used to study protein synthesis during synchronous meiosis and ascospore formation of Saccharomyces cerevisiae. The stained protein patterns of samples harvested at any stage between meiotic prophase and the four-spore stage in two sporulating strains showed the same approximately 250 polypeptides. Of these only a few seemed to increase or decrease in concentration during sporulation. The characteristic pattern of sporulating yeast was identical to the pattern of glucose-grown staitonary yeast cells adapted to respiration. The latter type of cells readily initiates meiosis when transferred to sporulation medium. This pattern differed from the protein patterns of exponentially growing cells in glucose or acetate presporulation medium. Five major proteins in stationary and sporulating yeast cells were not detected in either type of exponential culture. Two-dimensional autoradiograms of [ 35 S]methionine-labelled yeast proteins revealed that some proteins were preferentially labelled during sporulation, while other proteins were labelled at later stages. These patterns differed from the auroradiograms of exponentially growing yeast cells in glucose presporulation medium in a number of spots. No differences were observed when stained gels or autoradiograms of sporulating cultures and non-sporulating strains in sporulation medium were compared. (author)
Yeast cell wall chitin reduces wine haze formation.
Ndlovu, Thulile; Divol, Benoit; Bauer, Florian F
2018-04-27
Protein haze formation in bottled wines is a significant concern for the global wine industry and wine clarification before bottling is therefore a common but expensive practice. Previous studies have shown that wine yeast strains can reduce haze formation through the secretion of certain mannoproteins, but it has been suggested that other yeast-dependent haze protective mechanisms exist. On the other hand, addition of chitin has been shown to reduce haze formation, likely because grape chitinases have been shown to be the major contributors to haze. In this study, Chardonnay grape must fermented by various yeast strains resulted in wines with different protein haze levels indicating differences in haze protective capacities of the strains. The cell wall chitin levels of these strains were determined, and a strong correlation between cell wall chitin levels and haze protection capability was observed. To further evaluate the mechanism of haze protection, Escherichia coli -produced GFP-tagged grape chitinase was shown to bind efficiently to yeast cell walls in a cell wall chitin concentration-dependent manner, while commercial chitinase was removed from synthetic wine in quantities also correlated with the cell wall chitin levels of the strains. Our findings suggest a new mechanism of reducing wine haze, and propose a strategy for optimizing wine yeast strains to improve wine clarification. Importance In this study, we establish a new mechanism by which wine yeast strains can impact on the protein haze formation of wines, and demonstrate that yeast cell wall chitin binds grape chitinase in a chitin-concentration dependent manner. We also show that yeast can remove this haze-forming protein from wine. Chitin has in the past been shown to efficiently reduce wine haze formation when added to the wine in high concentration as a clarifying agent. Our data suggest that the selection of yeast strains with high levels of cell wall chitin can reduce protein haze. We also
Isolation and identification of radiation resistant yeasts from sea water
International Nuclear Information System (INIS)
Park, Jong Cheon; Jeong, Yong Uk; Kim, Du Hong; Jo, Eun A
2011-12-01
This study was conducted to isolate radiation-resistant yeasts from sea water for development of application technology of radiation-resistant microorganism. · Isolation of 656 yeasts from sea water and selection of 2 radiation-resistant yeasts (D 10 value >3) · Identification of isolated yeasts as Filobasidium elegans sharing 99% sequence similarity · Characterization of isolated yeast with ability to repair of the DNA damage and membrane integrity to irradiation
The yeast spectrum of the 'tea fungus Kombucha'.
Mayser, P; Fromme, S; Leitzmann, C; Gründer, K
1995-01-01
The tea fungus 'Kombucha' is a symbiosis of Acetobacter, including Acetobacter xylinum as a characteristic species, and various yeasts. A characteristic yeast species or genus has not yet been identified. Kombucha is mainly cultivated in sugared black tea to produce a slightly acidulous effervescent beverage that is said to have several curative effects. In addition to sugar, the beverage contains small amounts of alcohol and various acids, including acetic acid, gluconic acid and lactic acid, as well as some antibiotic substances. To characterize the yeast spectrum with special consideration given to facultatively pathogenic yeasts, two commercially available specimens of tea fungus and 32 from private households in Germany were analysed by micromorphological and biochemical methods. Yeasts of the genera Brettanomyces, Zygosaccharomyces and Saccharomyces were identified in 56%, 29% and 26% respectively. The species Saccharomycodes ludwigii and Candida kefyr were only demonstrated in isolated cases. Furthermore, the tests revealed pellicle-forming yeasts such as Candida krusei or Issatchenkia orientalis/occidentalis as well as species of the apiculatus yeasts (Kloeckera, Hanseniaspora). Thus, the genus Brettanomyces may be a typical group of yeasts that are especially adapted to the environment of the tea fungus. However, to investigate further the beneficial effects of tea fungus, a spectrum of the other typical genera must be defined. Only three specimens showed definite contaminations. In one case, no yeasts could be isolated because of massive contamination with Penicillium spp. In the remaining two samples (from one household), Candida albicans was demonstrated. The low rate of contamination might be explained by protective mechanisms, such as formation of organic acids and antibiotic substances. Thus, subjects with a healthy metabolism do not need to be advised against cultivating Kombucha. However, those suffering from immunosuppression should preferably
21 CFR 573.750 - Pichia pastoris dried yeast.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Pichia pastoris dried yeast. 573.750 Section 573... Food Additive Listing § 573.750 Pichia pastoris dried yeast. (a) Identity. The food additive Pichia pastoris dried yeast may be used in feed formulations of broiler chickens as a source of protein not to...
Chen, Yan; Xiao, Wenhai; Wang, Ying; Liu, Hong; Li, Xia; Yuan, Yingjin
2016-06-21
Microbial production of lycopene, a commercially and medically important compound, has received increasing concern in recent years. Saccharomyces cerevisiae is regarded as a safer host for lycopene production than Escherichia coli. However, to date, the lycopene yield (mg/g DCW) in S. cerevisiae was lower than that in E. coli and did not facilitate downstream extraction process, which might be attributed to the incompatibility between host cell and heterologous pathway. Therefore, to achieve lycopene overproduction in S. cerevisiae, both host cell and heterologous pathway should be delicately engineered. In this study, lycopene biosynthesis pathway was constructed by integration of CrtE, CrtB and CrtI in S. cerevisiae CEN.PK2. When YPL062W, a distant genetic locus, was deleted, little acetate was accumulated and approximately 100 % increase in cytosolic acetyl-CoA pool was achieved relative to that in parental strain. Through screening CrtE, CrtB and CrtI from diverse species, an optimal carotenogenic enzyme combination was obtained, and CrtI from Blakeslea trispora (BtCrtI) was found to have excellent performance on lycopene production as well as lycopene proportion in carotenoid. Then, the expression level of BtCrtI was fine-tuned and the effect of cell mating types was also evaluated. Finally, potential distant genetic targets (YJL064W, ROX1, and DOS2) were deleted and a stress-responsive transcription factor INO2 was also up-regulated. Through the above modifications between host cell and carotenogenic pathway, lycopene yield was increased by approximately 22-fold (from 2.43 to 54.63 mg/g DCW). Eventually, in fed-batch fermentation, lycopene production reached 55.56 mg/g DCW, which is the highest reported yield in yeasts. Saccharomyces cerevisiae was engineered to produce lycopene in this study. Through combining host engineering (distant genetic loci and cell mating types) with pathway engineering (enzyme screening and gene fine-tuning), lycopene yield was
Yeast signaling pathways in the oxidative stress response
Energy Technology Data Exchange (ETDEWEB)
Ikner, Aminah [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States); Shiozaki, Kazuhiro [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States)]. E-mail: kshiozaki@ucdavis.edu
2005-01-06
Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed.
Yeast signaling pathways in the oxidative stress response
International Nuclear Information System (INIS)
Ikner, Aminah; Shiozaki, Kazuhiro
2005-01-01
Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed
[Yeast species in vulvovaginitis candidosa].
Nemes-Nikodém, Éva; Tamási, Béla; Mihalik, Noémi; Ostorházi, Eszter
2015-01-04
Vulvovaginal candidiasis is the most common mycosis, however, the available information about antifungal susceptibilities of these yeasts is limited. To compare the gold standard fungal culture with a new molecular identification method and report the incidence of yeast species in vulvovaginitis candidosa. The authors studied 370 yeasts isolated from vulvovaginal candidiasis and identified them by phenotypic and molecular methods. The most common species was Candida albicans (85%), followed by Candida glabrata, and other Candida species. At present there are no recommendations for the evaluation of antifungal susceptibility of pathogenic fungal species occurring in vulvovaginal candidiasis and the natural antifungal resistance of the different species is known only. Matrix Assisted Laser Desorption Ionization Time of Flight identification can be used to differentiate the fluconazole resistant Candida dubliniensis and the sensitive Candida albicans strains.
Hansen, Esben H; Møller, Birger Lindberg; Kock, Gertrud R; Bünner, Camilla M; Kristensen, Charlotte; Jensen, Ole R; Okkels, Finn T; Olsen, Carl E; Motawia, Mohammed S; Hansen, Jørgen
2009-05-01
Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin beta-D-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity.
Kinetics of growth and sugar consumption in yeasts.
van Dijken, J P; Weusthuis, R A; Pronk, J T
1993-01-01
An overview is presented of the steady- and transient state kinetics of growth and formation of metabolic byproducts in yeasts. Saccharomyces cerevisiae is strongly inclined to perform alcoholic fermentation. Even under fully aerobic conditions, ethanol is produced by this yeast when sugars are present in excess. This so-called 'Crabtree effect' probably results from a multiplicity of factors, including the mode of sugar transport and the regulation of enzyme activities involved in respiration and alcoholic fermentation. The Crabtree effect in S. cerevisiae is not caused by an intrinsic inability to adjust its respiratory activity to high glycolytic fluxes. Under certain cultivation conditions, for example during growth in the presence of weak organic acids, very high respiration rates can be achieved by this yeast. S. cerevisiae is an exceptional yeast since, in contrast to most other species that are able to perform alcoholic fermentation, it can grow under strictly anaerobic conditions. 'Non-Saccharomyces' yeasts require a growth-limiting supply of oxygen (i.e. oxygen-limited growth conditions) to trigger alcoholic fermentation. However, complete absence of oxygen results in cessation of growth and therefore, ultimately, of alcoholic fermentation. Since it is very difficult to reproducibly achieve the right oxygen dosage in large-scale fermentations, non-Saccharomyces yeasts are therefore not suitable for large-scale alcoholic fermentation of sugar-containing waste streams. In these yeasts, alcoholic fermentation is also dependent on the type of sugar. For example, the facultatively fermentative yeast Candida utilis does not ferment maltose, not even under oxygen-limited growth conditions, although this disaccharide supports rapid oxidative growth.
Rijswijck, van Irma M.H.; Wolkers - Rooijackers, Judith C.M.; Abee, Tjakko; Smid, Eddy J.
2017-01-01
Increasing interest in new beer types has stimulated the search for approaches to extend the metabolic variation of brewers’ yeast. Therefore, we tested two approaches using non-conventional yeast to create a beer with lower ethanol content and a complex aroma bouquet. First, the mono-culture
Lipid raft involvement in yeast cell growth and death
Energy Technology Data Exchange (ETDEWEB)
Mollinedo, Faustino, E-mail: fmollin@usal.es [Instituto de Biología Molecular y Celular del Cáncer, Centro de Investigación del Cáncer, Consejo Superior de Investigaciones Científicas - Universidad de Salamanca, Salamanca (Spain)
2012-10-10
The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na{sup +}, K{sup +}, and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.
Lipid raft involvement in yeast cell growth and death
International Nuclear Information System (INIS)
Mollinedo, Faustino
2012-01-01
The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na + , K + , and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.
The ecology of the Drosophila-yeast mutualism in wineries
2018-01-01
The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila. PMID:29768432
Improving industrial yeast strains: exploiting natural and artificial diversity.
Steensels, Jan; Snoek, Tim; Meersman, Esther; Picca Nicolino, Martina; Voordeckers, Karin; Verstrepen, Kevin J
2014-09-01
Yeasts have been used for thousands of years to make fermented foods and beverages, such as beer, wine, sake, and bread. However, the choice for a particular yeast strain or species for a specific industrial application is often based on historical, rather than scientific grounds. Moreover, new biotechnological yeast applications, such as the production of second-generation biofuels, confront yeast with environments and challenges that differ from those encountered in traditional food fermentations. Together, this implies that there are interesting opportunities to isolate or generate yeast variants that perform better than the currently used strains. Here, we discuss the different strategies of strain selection and improvement available for both conventional and nonconventional yeasts. Exploiting the existing natural diversity and using techniques such as mutagenesis, protoplast fusion, breeding, genome shuffling and directed evolution to generate artificial diversity, or the use of genetic modification strategies to alter traits in a more targeted way, have led to the selection of superior industrial yeasts. Furthermore, recent technological advances allowed the development of high-throughput techniques, such as 'global transcription machinery engineering' (gTME), to induce genetic variation, providing a new source of yeast genetic diversity. © 2014 The Authors. FEMS Microbiology Reviews published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.
Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.
2015-04-01
Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.
Structural investigations of yeast mannans
International Nuclear Information System (INIS)
Rademacher, K.H.
1983-01-01
Cell wall mannans were isolated from 8 different Candida species and separated in oligosaccharides by partial acetolysis. After gel chromatography specific acetolysis patterns were obtained. The 13 C NMR spectra of mannans and oligosaccharides were recorded. Signals at delta = 93.1 - 105.4 were assigned to certain chemical structures. Both the spectral patterns and the acetolysis patterns of the yeast mannans can be used for the discrimination of related yeasts. (author)
Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production
Popov Stevan D.; Dodić Siniša N.; Mastilović Jasna S.; Dodić Jelena M.; Popov-Raljić Jovanka V.
2005-01-01
The waste brewer's yeast S. cerevisiae (activated and non-activated) was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positive...
PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications
International Nuclear Information System (INIS)
Baldikova, Eva; Prochazkova, Jitka; Stepanek, Miroslav; Hajduova, Jana; Pospiskova, Kristyna; Safarikova, Mirka; Safarik, Ivo
2017-01-01
A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles. - Highlights: • New types of magnetically responsive yeast biocomposites were prepared. • Recently developed PMAA-stabilized magnetic fluid was used. • Three yeast species were entrapped into magnetic chitosan gel during its formation. • All biocatalysts were efficiently employed for invert sugar formation.
PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications
Energy Technology Data Exchange (ETDEWEB)
Baldikova, Eva, E-mail: baldie@email.cz [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Applied Chemistry, Faculty of Agriculture, University of South Bohemia, Branisovska 1457, 370 05 Ceske Budejovice (Czech Republic); Prochazkova, Jitka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Stepanek, Miroslav; Hajduova, Jana [Department of Physical and Macromolecular Chemistry, Faculty of Science, Charles University, Hlavova 2030, 128 40 Prague 2 (Czech Republic); Pospiskova, Kristyna [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Safarikova, Mirka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Nanobiotechnology, Biology Centre, CAS, ISB, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Safarik, Ivo [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Biology Centre, CAS, ISB, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)
2017-04-01
A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles. - Highlights: • New types of magnetically responsive yeast biocomposites were prepared. • Recently developed PMAA-stabilized magnetic fluid was used. • Three yeast species were entrapped into magnetic chitosan gel during its formation. • All biocatalysts were efficiently employed for invert sugar formation.
Determination of the autolysis of champagne yeast by using 14C-labelled yeast
International Nuclear Information System (INIS)
Molnar, I.; Oura, E.; Suomalainen, H.
1980-01-01
The degree of autolysis of 14 C-labelled Champagne Hautvillers yeast was studied in the function of different temperatures of storage. A linear relationship was found between the length of the storage and the degree of autolysis. The rate of autolysis increased with raising the temperature of storage. The raising of the temperature by 10 deg C was followed by a 6-7% increase in the rate of autolysis. Shaking up the yeast sediment at 20-day intervals raised the rate of autolysis by 1.5-4.2%. (author)
21 CFR 73.355 - Phaffia yeast.
2010-04-01
... stabilized color additive mixture. Color additive mixtures for fish feed use made with phaffia yeast may... additive mixtures for coloring foods. (b) Specifications. Phaffia yeast shall conform to the following... § 501.4 of this chapter. (3) The presence of the color additive in salmonid fish that have been fed...
Conventional and Non-Conventional Yeasts in Beer Production
Directory of Open Access Journals (Sweden)
Angela Capece
2018-06-01
Full Text Available The quality of beer relies on the activity of fermenting yeasts, not only for their good fermentation yield-efficiency, but also for their influence on beer aroma, since most of the aromatic compounds are intermediate metabolites and by-products of yeast metabolism. Beer production is a traditional process, in which Saccharomyces is the sole microbial component, and any deviation is considered a flaw. However, nowadays the brewing sector is faced with an increasing demand for innovative products, and it is diffusing the use of uncharacterized autochthonous starter cultures, spontaneous fermentation, or non-Saccharomyces starters, which leads to the production of distinctive and unusual products. Attempts to obtain products with more complex sensory characteristics have led one to prospect for non-conventional yeasts, i.e., non-Saccharomyces yeasts. These generally are characterized by low fermentation yields and are more sensitive to ethanol stress, but they provide a distinctive aroma and flavor. Furthermore, non-conventional yeasts can be used for the production of low-alcohol/non-alcoholic and light beers. This review aims to present the main findings about the role of traditional and non-conventional yeasts in brewing, demonstrating the wide choice of available yeasts, which represents a new biotechnological approach with which to target the characteristics of beer and to produce different or even totally new beer styles.
Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra
2014-01-01
The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.
Chromosomal Aneuploidy Improves the Brewing Characteristics of Sake Yeast.
Kadowaki, Masafumi; Fujimaru, Yuki; Taguchi, Seiga; Ferdouse, Jannatul; Sawada, Kazutaka; Kimura, Yuta; Terasawa, Yohei; Agrimi, Gennaro; Anai, Toyoaki; Noguchi, Hideki; Toyoda, Atsushi; Fujiyama, Asao; Akao, Takeshi; Kitagaki, Hiroshi
2017-12-15
The effect of chromosomal aneuploidy on the brewing characteristics of brewery yeasts has not been studied. Here we report that chromosomal aneuploidy in sake brewery yeast ( Saccharomyces cerevisiae ) leads to the development of favorable brewing characteristics. We found that pyruvate-underproducing sake yeast, which produces less off-flavor diacetyl, is aneuploid and trisomic for chromosomes XI and XIV. To confirm that this phenotype is due to aneuploidy, we obtained 45 haploids with various chromosomal additions and investigated their brewing profiles. A greater number of chromosomes correlated with a decrease in pyruvate production. Especially, sake yeast haploids with extra chromosomes in addition to chromosome XI produced less pyruvate than euploids. Mitochondrion-related metabolites and intracellular oxygen species in chromosome XI aneuploids were higher than those in euploids, and this effect was canceled in their "petite" strains, suggesting that an increase in chromosomes upregulated mitochondrial activity and decreased pyruvate levels. These findings suggested that an increase in chromosome number, including chromosome XI, in sake yeast haploids leads to pyruvate underproduction through the augmentation of mitochondrial activity. This is the first report proposing that aneuploidy in brewery yeasts improves their brewing profile. IMPORTANCE Chromosomal aneuploidy has not been evaluated in development of sake brewing yeast strains. This study shows the relationship between chromosomal aneuploidy and brewing characteristics of brewery yeast strains. High concentrations of pyruvate during sake storage give rise to α-acetolactate and, in turn, to high concentrations of diacetyl, which is considered an off-flavor. It was demonstrated that pyruvate-underproducing sake yeast is trisomic for chromosome XI and XIV. Furthermore, sake yeast haploids with extra chromosomes produced reduced levels of pyruvate and showed metabolic processes characteristic of
Carotenoid accumulation in orange-pigmented Capsicum annuum fruit, regulated at multiple levels
Rodriguez-Uribe, Laura; Guzman, Ivette; Rajapakse, Wathsala; Richins, Richard D.; O’Connell, Mary A.
2012-01-01
The pericarp of Capsicum fruit is a rich dietary source of carotenoids. Accumulation of these compounds may be controlled, in part, by gene transcription of biosynthetic enzymes. The carotenoid composition in a number of orange-coloured C. annuum cultivars was determined using HPLC and compared with transcript abundances for four carotenogenic enzymes, Psy, LcyB, CrtZ-2, and Ccs determined by qRT-PCR. There were unique carotenoid profiles as well as distinct patterns of transcription of carotenogenic enzymes within the seven orange-coloured cultivars. In one cultivar, ‘Fogo’, carrying the mutant ccs-3 allele, transcripts were detected for this gene, but no CCS protein accumulated. The premature stop termination in ccs-3 prevented expression of the biosynthetic activity to synthesize the capsanthin and capsorubin forms of carotenoids. In two other orange-coloured cultivars, ‘Orange Grande’ and ‘Oriole’, both with wild-type versions of all four carotenogenic enzymes, no transcripts for Ccs were detected and no red pigments accumulated. Finally, in a third case, the orange-coloured cultivar, Canary, transcripts for all four of the wild-type carotenogenic enzymes were readily detected yet no CCS protein appeared to accumulate and no red carotenoids were synthesized. In the past, mutations in Psy and Ccs have been identified as the loci controlling colour in the fruit. Now there is evidence that a non-structural gene may control colour development in Capsicum. PMID:21948863
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Guidelines and recommendations on yeast cell death nomenclature
Directory of Open Access Journals (Sweden)
Didac Carmona-Gutierrez
2018-01-01
Full Text Available Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research.
Guidelines and recommendations on yeast cell death nomenclature
Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J.; Breitenbach, Michael; Burhans, William C.; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F.; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B.; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W.; Grant, Chris M.; Greenwood, Michael T.; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M.; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P.; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A.; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D.; Outeiro, Tiago F.; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F.; Sharon, Amir; Sigrist, Stephan J.; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M.; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B.; Tuite, Mick; Vögtle, F.-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J.; Zhao, Richard Y.; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank
2018-01-01
Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research. PMID:29354647
Effect of salt hyperosmotic stress on yeast cell viability
Directory of Open Access Journals (Sweden)
Logothetis Stelios
2007-01-01
Full Text Available During fermentation for ethanol production, yeasts are subjected to different kinds of physico-chemical stresses such as: initially high sugar concentration and low temperature; and later, increased ethanol concentrations. Such conditions trigger a series of biological responses in an effort to maintain cell cycle progress and yeast cell viability. Regarding osmostress, many studies have been focused on transcriptional activation and gene expression in laboratory strains of Saccharomyces cerevisiae. The overall aim of this present work was to further our understanding of wine yeast performance during fermentations under osmotic stress conditions. Specifically, the research work focused on the evaluation of NaCl-induced stress responses of an industrial wine yeast strain S. cerevisiae (VIN 13, particularly with regard to yeast cell growth and viability. The hypothesis was that osmostress conditions energized specific genes to enable yeast cells to survive under stressful conditions. Experiments were designed by pretreating cells with different sodium chloride concentrations (NaCl: 4%, 6% and 10% w/v growing in defined media containing D-glucose and evaluating the impact of this on yeast growth and viability. Subsequent fermentation cycles took place with increasing concentrations of D-glucose (20%, 30%, 40% w/v using salt-adapted cells as inocula. We present evidence that osmostress induced by mild salt pre-treatments resulted in beneficial influences on both cell viability and fermentation performance of an industrial wine yeast strain.
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5
De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete
Energy Technology Data Exchange (ETDEWEB)
Lundquist, K; Kirk, T K
1978-01-01
In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.
Baker's yeast: production of D- and L-3-hydroxy esters
DEFF Research Database (Denmark)
Dahl, Allan Carsten; Madsen, Jørgen Øgaard
1998-01-01
harvested while growing. In contrast, the stereoselectivity was shifted towards L-hydroxy esters when the oxo esters were added slowly to ordinary baker's yeast supplied with gluconolactone as co-substrate. The reduction rate with gluconolactone was increased by active aeration. Ethyl L-(S)-3......Baker's yeast grown under oxygen limited conditions and used in the reduction of 3-oxo esters results in a shift of the stereoselectivity of the yeast towards D-hydroxy esters as compared with ordinary baker's yeast. The highest degree of stereoselectivity was obtained with growing yeast or yeast......-hydroxybutanoate was afforded in >99% ee. Both enantiomers of ethyl 3-hydroxypentanoate, D-(R) in 96% ee and L-(S) in 93% ee, and of ethyl 4-chloro-3-hydroxybutanoate, D-(S) in 98% ee and L-(R) in 94% ee, were obtained. The results demonstrate that the stereoselectivity of baker's yeast can be controlled...
Increasing the yeast yield in alcohol fermentation
Energy Technology Data Exchange (ETDEWEB)
Pelc, A; Vamos, E; Varga, L; Gavalya, S; Dolanszky, F
1964-02-01
The yeast and ethanol yields (the latter being based on the substrate) are enhanced by adding the substrate (molasses) gradually to the suspension of inoculating yeast during the main fermentation period, passing air through the mash, ceasing both substrate addition and aeration at the end of the main period, and allowing the process to come to an end. This way 12 to 14 kg yeast (dry weight)/100 l ethanol could be obtained within 16 to 24 hours and the yeast obtained could be used as the inoculum for the next charge. For example: 11 to 16 kg yeast (or 18 to 25 l yeast suspension from the preceding charge, containing 18 to 20% dry matter) is kept in 30 to 35 l H/sub 2/SO/sub 4/ (0.74 g/100 ml) for 1 hour, diluted with H/sub 2/O and 30 kg sterile molasses to 300 l, kept at 30 to 32/sup 0/ with mild aeration for 2 hours, 1900 l 30/sup 0/ H/sub 2/O added, then 1 m/sup 3/ air/m/sup 2//hour is passed through the mixture, with the addition of 270 kg sterile molasses, and a solution of 8 kg superphosphate and 5 kg (NH/sub 4/)/sub 2/SO/sub 4/ in 100 l H/sub 2/O, the latter being added in 5 portions over 2 hours. Molasses (600 kg) is added during the main period, maintaining the pH at 5 (H/sub 2/SO/sub 4/), and the temperature at 30/sup 0/, then aeration is ceased and the mixture kept until fermentation proceeds. The 3000 l medium contains 9.6% ethanol and 1.38% yeast, respectively.
Ethanol fermentation with a flocculating yeast
Energy Technology Data Exchange (ETDEWEB)
Admassu, W; Korus, R A; Heimsch, R C
1985-08-01
A 100 cm x 5.7 cm internal diameter tower fermentor was fabricated and operated continuously for 11 months using the floc-forming yeast, Saccharomyces cerevisiae (American Type Culture Collection 4097). Steady state operation of the system was characterized at 32/sup 0/C and pH 4.0 for glucose concentrations ranging from 105 to 215 g l/sup -1/. The height of the yeast bed in the tower was maintained at 80 cm. The high yeast density, ethanol concentration and low pH prevented bacterial contamination in the reactor. The concentration profiles of glucose and ethanol within the bed were described by a dispersion model. Modeling parameters were determined for the yeast by batch kinetics and tracer experiments. The kinetic model included ethanol inhibition and substrate limitation. A tracer study with step input of D-xylose (a non-metabolizable sugar for S. cerevisiae) determined the dispersion number (D/uL=0.16) and liquid voidage (epsilonsub(L)=0.25). Measurements taken after 6 months of continuous operation indicated that there was no significant change in fermentor performance.
Actin and Endocytosis in Budding Yeast
Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly
2015-01-01
Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349
The Yeast Deletion Collection: A Decade of Functional Genomics
Giaever, Guri; Nislow, Corey
2014-01-01
The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991
Yeast Genomics for Bread, Beer, Biology, Bucks and Breath
Sakharkar, Kishore R.; Sakharkar, Meena K.
The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.
Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum
Energy Technology Data Exchange (ETDEWEB)
D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.
1999-12-01
Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.
CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.
Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria
2018-01-01
A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.
Yeast hulls: effect on spontaneous fermentation in different vinification conditions
Directory of Open Access Journals (Sweden)
Rosa López
2000-09-01
Full Text Available The effect of the addition of yeast hulls in vinification was investigated during three consecutive years. The study was carried out in the experimental winery of C.I.D.A in La Rioja (Spain with free running white grape juice of the Viura variety. Four different vinifications were studied. In two of these vinifications, stuck fermentations were detected. In all the studies, the addition of yeast hulls (yeast ghosts improved the fermentation kinetics, increasing the number of viable yeasts at the end of the exponential stage and decreasing the final content of reducing sugars. This work revealed a new effect of yeast hull addition which had not been identified previously; their selection effect on the wild yeast strain in spontaneous fermentation.
Directory of Open Access Journals (Sweden)
Elżbieta Bogusławska-Wąs
2014-08-01
Full Text Available The aim of study was to determinate enzymatic activity of yeast-like organisms - Candida lipolytica, Rhodotorula rubra, Trichosporon beigelii, Zygosaccharomyces sp. - isolated from the Szczecin Lagoon and herring salads. We have shown that lipolytic activity was higher than protcolytic for every strain tested. The lowest activity level was found out for amylolytic hydrolases. The results also demonstrated that yeast-like organisms isolated from the Szczecin Lagoon revealed much higher average enzymatic activity compared to tbe same species isolated from herring salads, excepting C. lipolytica.
Performance of baker's yeast produced using date syrup substrate ...
African Journals Online (AJOL)
Baker's yeast was produced from three selected baker's yeast strains using date syrup as a substrate at low and high flow rate compared to those produced using molasses substrates. Performance of the produced baker's yeasts on Arabic bread quality was investigated. Baking tests showed a positive relationship between ...
Triacetic acid lactone production in industrial Saccharomyces yeast strains
Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...
The yeast replicative aging model.
He, Chong; Zhou, Chuankai; Kennedy, Brian K
2018-03-08
It has been nearly three decades since the budding yeast Saccharomyces cerevisiae became a significant model organism for aging research and it has emerged as both simple and powerful. The replicative aging assay, which interrogates the number of times a "mother" cell can divide and produce "daughters", has been a stalwart in these studies, and genetic approaches have led to the identification of hundreds of genes impacting lifespan. More recently, cell biological and biochemical approaches have been developed to determine how cellular processes become altered with age. Together, the tools are in place to develop a holistic view of aging in this single-celled organism. Here, we summarize the current state of understanding of yeast replicative aging with a focus on the recent studies that shed new light on how aging pathways interact to modulate lifespan in yeast. Copyright © 2018. Published by Elsevier B.V.
New lager yeast strains generated by interspecific hybridization.
Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian
2015-05-01
The interspecific hybrid Saccharomyces pastorianus is the most commonly used yeast in brewery fermentations worldwide. Here, we generated de novo lager yeast hybrids by mating a domesticated and strongly flocculent Saccharomyces cerevisiae ale strain with the Saccharomyces eubayanus type strain. The hybrids were characterized with respect to the parent strains in a wort fermentation performed at temperatures typical for lager brewing (12 °C). The resulting beers were analysed for sugar and aroma compounds, while the yeasts were tested for their flocculation ability and α-glucoside transport capability. These hybrids inherited beneficial properties from both parent strains (cryotolerance, maltotriose utilization and strong flocculation) and showed apparent hybrid vigour, fermenting faster and producing beer with higher alcohol content (5.6 vs 4.5 % ABV) than the parents. Results suggest that interspecific hybridization is suitable for production of novel non-GM lager yeast strains with unique properties and will help in elucidating the evolutionary history of industrial lager yeast.
Hansen, Esben H.; Møller, Birger Lindberg; Kock, Gertrud R.; Bünner, Camilla M.; Kristensen, Charlotte; Jensen, Ole R.; Okkels, Finn T.; Olsen, Carl E.; Motawia, Mohammed S.; Hansen, Jørgen
2009-01-01
Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin β-d-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity. PMID:19286778
Yeast cells proliferation on various strong static magnetic fields and temperatures
International Nuclear Information System (INIS)
Otabe, E S; Kuroki, S; Nikawa, J; Matsumoto, Y; Ooba, T; Kiso, K; Hayashi, H
2009-01-01
The effect of strong magnetic fields on activities of yeast cells were investigated. Experimental yeast cells were cultured in 5 ml of YPD(Yeast extract Peptone Dextrose) for the number density of yeast cells of 5.0 ±0.2 x 10 6 /ml with various temperatures and magnetic fields up to 10 T. Since the yeast cells were placed in the center of the superconducting magnet, the effect of magnetic force due to the diamagnetism and magnetic gradient was negligibly small. The yeast suspension was opened to air and cultured in shaking condition. The number of yeast cells in the yeast suspension was counted by a counting plate with an optical microscope, and the time dependence of the number density of yeast cells was measured. The time dependence of the number density of yeast cells, ρ, of initial part is analyzed in terms of Malthus equation as given by ρ = ρo exp(kt), where k is the growth coefficient. It is found that, the growth coefficient under the magnetic field is suppressed compared with the control. The growth coefficient decreasing as increasing magnetic field and is saturated at about 5 T. On the other hand, it is found that the suppression of growth of yeast cells by the magnetic field is diminished at high temperatures.
Mazauric, Jean-Paul; Salmon, Jean-Michel
2006-05-31
In the first part of this work, the analysis of the polyphenolic compounds remaining in the wine after different contact times with yeast lees during simulation of red wine aging was undertaken. To achieve a more precise view of the wine polyphenols adsorbed on lees during red wine aging and to establish a clear balance between adsorbed and remnant polyphenol compounds, the specific analysis of the chemical composition of the adsorbed polyphenolic compounds (condensed tannins and anthocyanins) after their partial desorbtion from yeast lees by denaturation treatments was realized in the second part of the study. The total recovery of polyphenol compounds from yeast lees was not complete, since a rather important part of the initial wine colored polyphenols, especially those with a dominant blue color component, remained strongly adsorbed on yeast lees, as monitored by color tristimulus and reflectance spectra measurements. All anthocyanins were recovered at a rather high percentage (about 62%), and it was demonstrated that they were not adsorbed in relation with their sole polarity. Very few monomeric phenolic compounds were extracted from yeast lees. With the use of drastic denaturing treatments, the total recovery of condensed tannins reached 83%. Such tannins extracted from yeast lees exhibited very high polymeric size and a rather high percentage of galloylated residues by comparison with initial wine tannins, indicating that nonpolar tannins were preferentially desorbed from yeast lees by the extraction treatments.
Oxidative Stress and Programmed Cell Death in Yeast
International Nuclear Information System (INIS)
Farrugia, Gianluca; Balzan, Rena
2012-01-01
Yeasts, such as Saccharomyces cerevisiae, have long served as useful models for the study of oxidative stress, an event associated with cell death and severe human pathologies. This review will discuss oxidative stress in yeast, in terms of sources of reactive oxygen species (ROS), their molecular targets, and the metabolic responses elicited by cellular ROS accumulation. Responses of yeast to accumulated ROS include upregulation of antioxidants mediated by complex transcriptional changes, activation of pro-survival pathways such as mitophagy, and programmed cell death (PCD) which, apart from apoptosis, includes pathways such as autophagy and necrosis, a form of cell death long considered accidental and uncoordinated. The role of ROS in yeast aging will also be discussed.
Characterization of the Respiration-Induced Yeast Mitochondrial Permeability Transition Pore
Bradshaw, Patrick C.; Pfeiffer, Douglas R.
2013-01-01
When isolated mitochondria from the yeast Saccharomyces cerevisiae oxidize respiratory substrates in the absence of phosphate and ADP, the yeast mitochondrial unselective channel, also called the yeast permeability transition pore (yPTP), opens in the inner membrane dissipating the electrochemical gradient. ATP also induces yPTP opening. yPTP opening allows mannitol transport into isolated mitochondria of laboratory yeast strains, but mannitol is not readily permeable throug...
[Yeast microbiota in artisanal cheeses from Corrientes, Argentina].
Cardozo, Marina C; Fusco, Ángel J V; Carrasco, Marta S
The artisanal cheese from Corrientes (from the Spanish acronym QAC-Queso Artesanal de Corrientes/Artisanal Cheese from Corrientes) is a soft cheese elaborated with raw cow milk and an artisanal coagulant agent. Lactic bacteria contitute the main flora of this cheese although yeasts are also present in high quantities as secondary microbiota and might play a relevant role in cheese ripening. The aim of this work was to evaluate yeast occurrence during QAC elaboration and ripening, and the effect of seasonal variation. Yeasts were isolated and purified from raw materials and cheese at different ripening stagesl elaborated during the different seasons. Yeast sample counts were in the order of 10 3 - 10 7 UFC/ml o UFC/g. Ninety yeast strains were classified: 9 from milk, 28 from the coagulant agent, 10 from curd and 43 from cheese. Candida predominated in milk samples while other yeast genera had low incidence. Candida also predominated in the coagulant agent samples, followed by genera Myxozyma and Debaryomyces. The isolates obtained from cheese belonged to the same genera predominating in the coagulant agent, and showed the same order of prevalence. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Regulatory aspects of methanol metabolism in yeasts
International Nuclear Information System (INIS)
Trotsenko, Y.A.; Bystrykh, L.V.; Ubiyvovk, V.M.
1984-01-01
Formaldehyde is the first and key intermediate in the metabolism of methylotrophic yeasts since it stands at a branch point of pathways for methanol oxidation and assimilation. Methanol and, formaldehyde are toxic compounds which severely affect the growth rate, yield coefficient, etc., of yeasts. Two questions arise when considering regulation of methanol metabolism in yeasts how a nontoxic level of formaldehyde is maintained in the cell and how the formaldehyde flow is distributed into oxidation and assimilation. To answer these questions we studied the role of GSH, which spontaneously binds formaldehyde, yielding S-hydroxymethylglutathione; in vivo rates of formaldehyde dissimilation and assimilation by using [ 14 C]methanol; profiles of enzymes responsible for production and utilization of formaldehyde; and levels of metabolites affecting dissimilation and assimilation of formaldehyde. All of the experiments were carried out with the methylotrophic yeast Candida boidinii KD1. 19 refs., 4 figs., 1 tab
The impact of yeast fermentation on dough matrix properties.
Rezaei, Mohammad N; Jayaram, Vinay B; Verstrepen, Kevin J; Courtin, Christophe M
2016-08-01
Most studies on dough properties are performed on yeastless dough to exclude the complicating, time-dependent effect of yeast. Baker's yeast, however, impacts dough matrix properties during fermentation, probably through the production of primary (CO2 and ethanol) and secondary (glycerol, acetic acid and succinic acid) metabolites. The aim of this study is to obtain a better understanding of the changes in yeasted dough behavior introduced by fermentation, by investigating the impact of yeast fermentation on Farinograph dough consistency, dough spread, Kieffer rig dough extensibility and gluten agglomeration behavior in a fermented dough-batter gluten starch separation system. Results show that fermentation leads to a dough with less flow and lower extensibility that breaks more easily under stress and strain. The dough showed less elastic and more plastic deformation behavior. Gluten agglomerates were smaller for yeasted dough than for the unyeasted control. These changes probably have to be attributed to metabolites generated during fermentation. Indeed, organic acids and also ethanol in concentrations produced by yeast were previously shown to have similar effects in yeastless dough. These findings imply the high importance of yeast fermentation metabolites on dough matrix properties in industrial bread production. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Determination of the autolysis of champagne yeast by using /sup 14/C-labelled yeast
Energy Technology Data Exchange (ETDEWEB)
Molnar, I [Orszagos Szoeleszeti es Boraszati Kutatointezet, Budapest (Hungary); Oura, E; Suomalainen, H [Research Laboratories of the State Alcohol Monopoly, Helsinki (Finland)
1980-01-01
The degree of autolysis of /sup 14/C-labelled Champagne Hautvillers yeast was studied in the function of different temperatures of storage. A linear relationship was found between the length of the storage and the degree of autolysis. The rate of autolysis increased with raising the temperature of storage. The raising of the temperature by 10 deg C was followed by a 6-7% increase in the rate of autolysis. Shaking up the yeast sediment at 20-day intervals raised the rate of autolysis by 1.5-4.2%.
Nonlinear Dielectric Properties of Yeast Cells Cultured in Different Environmental Conditions
Kawanishi, Gomon; Fukuda, Naoki; Muraji, Masafumi
The harmonics of the electric current through yeast suspensions, the nonlinear dielectric properties of yeast cells, have particular patterns according to the biological activity of the cells and the measurement of these patterns is a technique for determining the activity of living cells. The concentration of glucose and oxygen in yeast culture medium influences the manifestation of fermentation or respiration of yeast cells. Measurements were made with yeast cells (Saccharomyces cerevisiae) cultured aerobically and anaerobically in sufficient glucose concentration, aerobic fermentation and anaerobic fermentation, and aerobically in limited glucose concentration, respiration. The results showed that the harmonics were barely apparent for yeast cells in aerobic fermentation and respiratory; however, cells in the anaerobic fermentation displayed substantial third and fifth harmonics. We can say that environmental condition affects the yeast cells' nonlinear properties, from another viewpoint, the measurements of the nonlinear properties are available to determine the activity of yeast cells adjusted to the conditions of their cultivation.
Diversity and killer activity of yeasts in Malaysian fermented food samples.
Lim, S L; Tay, S T
2011-08-01
The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.
21 CFR 172.325 - Bakers yeast protein.
2010-04-01
... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be...
Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.
Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas
2015-02-01
Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.
The Influence of Heating Mains on Yeast Communities in Urban Soils
Tepeeva, A. N.; Glushakova, A. M.; Kachalkin, A. V.
2018-04-01
The number and species diversity of yeasts in urban soils (urbanozems) affected by heating mains and in epiphytic yeast complexes of grasses growing above them were studied. The number of yeasts in the soil reached 103-104 CFU/g; on the plants, 107 CFU/g. Significant (by an order of magnitude) increase in the total number of soil yeasts in the zone of heating mains in comparison with the surrounding soil was found in winter period. Overall, 25 species of yeasts were isolated in our study. Yeast community of studied urbanozems was dominated by the Candida sake, an eurybiont of the temperate zone and other natural ecotopes with relatively low temperatures, but its share was minimal in the zone of heating mains. In general, the structure of soil and epiphytic yeast complexes in the zones of heating mains differed from that in the surrounding area by higher species diversity and a lower share of pigmented species among the epiphytic yeasts. The study demonstrated that the number and species structure of soil yeast communities in urban soils change significantly under the influence of the temperature factor and acquire a mosaic distribution pattern.
Distribution of yeast complexes in the profiles of different soil types
Glushakova, A. M.; Kachalkin, A. V.; Tiunov, A. V.; Chernov, I. Yu.
2017-07-01
The number and taxonomic structure of the yeast complexes were investigated in the full profiles of the soddy-podzolic soil (Central Forest State Nature Biosphere Reserve), dark gray forest soil (Kaluzhskie Zaseki Reserve), and chernozem (Privolzhskaya Forest-Steppe Reserve). In all these soils, the number of yeasts was maximal (104 CFU/g) directly under the litter; it drastically decreased with the depth. However, at the depth of 120-160 cm, the number of yeasts significantly increased in all the soils; their maximum was found in the illuvial horizon of the soddy-podzolic soil. Such a statistically significant increase in the number of yeasts at a considerable depth was found for the first time. Different groups of yeasts were present in the yeast communities of different soils. The species structure of yeast communities changed little in each soil: the same species were isolated both from the soil surface and from the depth of more than 2 m. The results showed that yeasts could be used for soil bioindication on the basis of specific yeast complexes in the profiles of different soil types rather than individual indicative species.
Dielectric modelling of cell division for budding and fission yeast
International Nuclear Information System (INIS)
Asami, Koji; Sekine, Katsuhisa
2007-01-01
The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast
Some Metabolites Act as Second Messengers in Yeast Chronological Aging
Directory of Open Access Journals (Sweden)
Karamat Mohammad
2018-03-01
Full Text Available The concentrations of some key metabolic intermediates play essential roles in regulating the longevity of the chronologically aging yeast Saccharomyces cerevisiae. These key metabolites are detected by certain ligand-specific protein sensors that respond to concentration changes of the key metabolites by altering the efficiencies of longevity-defining cellular processes. The concentrations of the key metabolites that affect yeast chronological aging are controlled spatially and temporally. Here, we analyze mechanisms through which the spatiotemporal dynamics of changes in the concentrations of the key metabolites influence yeast chronological lifespan. Our analysis indicates that a distinct set of metabolites can act as second messengers that define the pace of yeast chronological aging. Molecules that can operate both as intermediates of yeast metabolism and as second messengers of yeast chronological aging include reduced nicotinamide adenine dinucleotide phosphate (NADPH, glycerol, trehalose, hydrogen peroxide, amino acids, sphingolipids, spermidine, hydrogen sulfide, acetic acid, ethanol, free fatty acids, and diacylglycerol. We discuss several properties that these second messengers of yeast chronological aging have in common with second messengers of signal transduction. We outline how these second messengers of yeast chronological aging elicit changes in cell functionality and viability in response to changes in the nutrient, energy, stress, and proliferation status of the cell.
Glycosylceramide modifies the flavor and metabolic characteristics of sake yeast
Directory of Open Access Journals (Sweden)
Jannatul Ferdouse
2018-05-01
Full Text Available In the manufacture of sake, Japanese traditional rice wine, sake yeast is fermented with koji, which is steamed rice fermented with the non-pathogenic fungus Aspergillus oryzae. During fermentation, sake yeast requires lipids, such as unsaturated fatty acids and sterols, in addition to substances provided by koji enzymes for fermentation. However, the role of sphingolipids on the brewing characteristics of sake yeast has not been studied. In this study, we revealed that glycosylceramide, one of the sphingolipids abundant in koji, affects yeast fermentation. The addition of soy, A. oryzae, and Grifola frondosa glycosylceramide conferred a similar effect on the flavor profiles of sake yeast. In particular, the addition of A. oryzae and G. frondosa glycosylceramide were very similar in terms of the decreases in ethyl caprylate and ethyl 9-decenoate. The addition of soy glycosylceramide induced metabolic changes to sake yeast such as a decrease in glucose, increases in ethanol and glycerol and changes in several amino acids and organic acids concentrations. Tricarboxylic acid (TCA cycle, pyruvate metabolism, starch and sucrose metabolism, and glycerolipid metabolism were overrepresented in the cultures incubated with sake yeast and soy glycosylceramide. This is the first study of the effect of glycosylceramide on the flavor and metabolic profile of sake yeast.
Glycosylceramide modifies the flavor and metabolic characteristics of sake yeast.
Ferdouse, Jannatul; Yamamoto, Yuki; Taguchi, Seiga; Yoshizaki, Yumiko; Takamine, Kazunori; Kitagaki, Hiroshi
2018-01-01
In the manufacture of sake, Japanese traditional rice wine, sake yeast is fermented with koji, which is steamed rice fermented with the non-pathogenic fungus Aspergillus oryzae . During fermentation, sake yeast requires lipids, such as unsaturated fatty acids and sterols, in addition to substances provided by koji enzymes for fermentation. However, the role of sphingolipids on the brewing characteristics of sake yeast has not been studied. In this study, we revealed that glycosylceramide, one of the sphingolipids abundant in koji, affects yeast fermentation. The addition of soy, A. oryzae , and Grifola frondosa glycosylceramide conferred a similar effect on the flavor profiles of sake yeast. In particular, the addition of A. oryzae and G. frondosa glycosylceramide were very similar in terms of the decreases in ethyl caprylate and ethyl 9-decenoate. The addition of soy glycosylceramide induced metabolic changes to sake yeast such as a decrease in glucose, increases in ethanol and glycerol and changes in several amino acids and organic acids concentrations. Tricarboxylic acid (TCA) cycle, pyruvate metabolism, starch and sucrose metabolism, and glycerolipid metabolism were overrepresented in the cultures incubated with sake yeast and soy glycosylceramide. This is the first study of the effect of glycosylceramide on the flavor and metabolic profile of sake yeast.
A new methodology to obtain wine yeast strains overproducing mannoproteins.
Quirós, Manuel; Gonzalez-Ramos, Daniel; Tabera, Laura; Gonzalez, Ramon
2010-04-30
Yeast mannoproteins are highly glycosylated proteins that are covalently bound to the beta-1,3-glucan present in the yeast cell wall. Among their outstanding enological properties, yeast mannoproteins contribute to several aspects of wine quality by protecting against protein haze, reducing astringency, retaining aroma compounds and stimulating growth of lactic-acid bacteria. The development of a non-recombinant method to obtain enological yeast strains overproducing mannoproteins would therefore be very useful. Our previous experience on the genetic determinants of the release of these molecules by Saccharomyces cerevisiae has allowed us to propose a new methodology to isolate and characterize wine yeast that overproduce mannoproteins. The described methodology is based on the resistance of the killer 9 toxin produced by Williopsis saturnus, a feature linked to an altered biogenesis of the yeast cell wall. Copyright 2010 Elsevier B.V. All rights reserved.
Biodiesel generation from oleaginous yeast Rhodotorula glutinis ...
African Journals Online (AJOL)
Biodiesel generation from oleaginous yeast Rhodotorula glutinis with xylose assimilating capacity. ... Biodiesel generation from oleaginous yeast Rhodotorula glutinis with xylose assimilating capacity. C Dai, J Tao, F Xie, Y Dai, M Zhao. Abstract. This study explored a strategy to convert agricultural and forestry residues into ...
Ali, Shawkat
2014-09-19
The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.
Nuclear Magnetic Resonance Spectroscopy-Based Identification of Yeast.
Himmelreich, Uwe; Sorrell, Tania C; Daniel, Heide-Marie
2017-01-01
Rapid and robust high-throughput identification of environmental, industrial, or clinical yeast isolates is important whenever relatively large numbers of samples need to be processed in a cost-efficient way. Nuclear magnetic resonance (NMR) spectroscopy generates complex data based on metabolite profiles, chemical composition and possibly on medium consumption, which can not only be used for the assessment of metabolic pathways but also for accurate identification of yeast down to the subspecies level. Initial results on NMR based yeast identification where comparable with conventional and DNA-based identification. Potential advantages of NMR spectroscopy in mycological laboratories include not only accurate identification but also the potential of automated sample delivery, automated analysis using computer-based methods, rapid turnaround time, high throughput, and low running costs.We describe here the sample preparation, data acquisition and analysis for NMR-based yeast identification. In addition, a roadmap for the development of classification strategies is given that will result in the acquisition of a database and analysis algorithms for yeast identification in different environments.
Yeast glycolipid biosurfactants.
Jezierska, Sylwia; Claus, Silke; Van Bogaert, Inge
2017-10-25
Various yeasts, both conventional and exotic ones, are known to produce compounds useful to mankind. Ethanol is the most known of these compounds, but more complex molecules such as amphiphilic biosurfactants can also be derived from eukaryotic microorganisms at an industrially and commercially relevant scale. Among them, glycolipids are the most promising, due to their attractive properties and high product titers. Many of these compounds can be considered as secondary metabolites with a specific function for the host. Hence, a dedicated biosynthetic process enables regulation and combines pathways delivering the lipidic moiety and the hydrophilic carbohydrate part of the glycolipid. In this Review, we will discuss the biosynthetic and regulatory aspects of the yeast-derived sophorolipids, mannosylerythritol lipids, and cellobiose lipids, with special emphasis on the relation between glycolipid synthesis and the general lipid metabolism. © 2017 Federation of European Biochemical Societies.
The influence of sucrose and maltose on Saccharomyces cerevisiae yeast multiplication
Directory of Open Access Journals (Sweden)
O. I. Ponomareva
2016-01-01
Full Text Available The data on the influence of fermentable carbohydrates concentration on yeast multiplication are widely represented in the literature. This study presents the results of experiments showing an influence of sucrose and maltose concentration on Saccharomyces cerevisiae yeast multiplication. The objects of this research are bakery, beer, wine and alcohol yeast that are widely used in fermentation industry. Beet molasses and malt wort were chosen as nutrient medium for yeast breeding. Their basic sugars are mainly represented by sucrose and maltose. The concentration of sugars was 9, 12, 16 and 20%. The intensity of yeast multiplication was evaluated based on yeast cells concentration during their cultivation and the specific growth rate. Sugar concentrations causing an intensive accumulation of examined yeast strains were determined. This paper presents the experimental data that were received describing the influence of sucrose and maltose concentration on the duration of a lag phase period for different yeast strains. Specific growth rates of researched strains were determined for nutrient mediums with different glucose and maltose concentrations. It was found that the Crabtree effect, that is caused by high carbohydrates concentration in culture medium, is most pronounced when yeast cells grow on a sucrose medium. Brewer’s and baker's yeast are more adapted to high concentrations of carbohydrates. The obtained experimental data could be utilized to develop flow charts of growing a pure culture of Saccharomyces cerevisiae yeast to use at fermentation plants, including low power ones.
Vegemite Beer: yeast extract spreads as nutrient supplements to promote fermentation
Directory of Open Access Journals (Sweden)
Edward D. Kerr
2016-08-01
Full Text Available Vegemite is an iconic Australian food spread made from spent brewers’ yeast extract, which has been reported to be used as an ingredient in illegal home brewing. In this study, we tested the utility of Vegemite and the similar spread Marmite in promoting fermentation. We could not culture microorganisms from either Vegemite or Marmite, consistent with these food-grade spreads being essentially sterile. To test if the addition of Vegemite or Marmite could assist in fermentation when additional viable yeast was also present, solutions containing glucose and a range of concentrations of either Vegemite or Marmite were inoculated with brewers’ yeast. No fermentation occurred in any condition without addition of extra brewer’s yeast. Fermentation did not occur when yeast was inoculated into solutions containing only glucose, but progressed efficiently with when Vegemite or Marmite was also added. Gas Chromatography confirmed that ethanol was present at ∼3% v/v post-fermentation in all samples which contained glucose, Vegemite or Marmite, and brewers’ yeast. Trace amounts of methanol were also detected. Mass spectrometry proteomics identified abundant intracellular yeast proteins and barley proteins in Vegemite and Marmite, and abundant secreted yeast proteins from actively growing yeast in those samples to which extra brewers’ yeast had been added. We estimate that the real-world cost of home brewed “Vegemite Beer” would be very low. Our results show that Vegemite or other yeast extract spreads could provide cheap and readily available sources of nutrient supplementation to increase the efficiency of fermentation in home brewing or other settings.
Directory of Open Access Journals (Sweden)
Grażyna Końska
2014-01-01
Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.
Yeast Biomass Production in Brewery's Spent Grains Hemicellulosic Hydrolyzate
Duarte, Luís C.; Carvalheiro, Florbela; Lopes, Sónia; Neves, Ines; Gírio, Francisco M.
Yeast single-cell protein and yeast extract, in particular, are two products which have many feed, food, pharmaceutical, and biotechnological applications. However, many of these applications are limited by their market price. Specifically, the yeast extract requirements for culture media are one of the major technical hurdles to be overcome for the development of low-cost fermentation routes for several top value chemicals in a biorefinery framework. A potential biotechnical solution is the production of yeast biomass from the hemicellulosic fraction stream. The growth of three pentose-assimilating yeast cell factories, Debaryomyces hansenii, Kluyveromyces marxianus, and Pichia stipitis was compared using non-detoxified brewery's spent grains hemicellulosic hydrolyzate supplemented with mineral nutrients. The yeasts exhibited different specific growth rates, biomass productivities, and yields being D. hansenii as the yeast species that presented the best performance, assimilating all sugars and noteworthy consuming most of the hydrolyzate inhibitors. Under optimized conditions, D. hansenii displayed a maximum specific growth rate, biomass yield, and productivity of 0.34 h-1, 0.61 g g-1, and 0.56 g 1-1 h-1, respectively. The nutritional profile of D. hansenii was thoroughly evaluated, and it compares favorably to others reported in literature. It contains considerable amounts of some essential amino acids and a high ratio of unsaturated over saturated fatty acids.
Biosynthesis of polyhydroxyalkanotes in wildtype yeasts | Desuoky ...
African Journals Online (AJOL)
Biosynthesis of the biodegradable polymers polyhydroxyalkanotes (PHAs) are studied extensively in wild type and genetically modified prokaryotic cells, however the content and structure of PHA in wild type yeasts are not well documented. The purpose of this study was to screen forty yeast isolates collected from different ...
Modeling diauxic glycolytic oscillations in yeast
DEFF Research Database (Denmark)
Hald, Bjørn Olav; Sørensen, Preben Graae
2010-01-01
for investigations of central metabolism dynamics of yeast cells. We have previously proposed a model for the open system comprised of the primary fermentative reactions in yeast that quantitatively describes the oscillatory dynamics. However, this model fails to describe the transient behavior of metabolic......Glycolytic oscillations in a stirred suspension of starved yeast cells is an excellent model system for studying the dynamics of metabolic switching in living systems. In an open-flow system the oscillations can be maintained indefinitely at a constant operating point where they can....... Experimental and computational results strongly suggest that regulation of acetaldehyde explains the observed behavior. We have extended the original model with regulation of pyruvate decarboxylase, a reversible alcohol dehydrogenase, and drainage of pyruvate. Using the method of time rescaling in the extended...
Yeast genetics. A manual of methods
Energy Technology Data Exchange (ETDEWEB)
Spencer, J.F.T.; Spencer, D.M.; Bruce, I.J.
1989-01-01
This is a bench-top manual of methods needed both for classical genetics as related to yeasts, such as mating, sporulation, isolation of hybrids, microdissection of asci for the isolation of single-spore clones, as well as for mapping of genes and the construction of new strains by protoplast fusion. Special emphasis is on mutations in general, and on methods of isolating a number of important classes of mutants in particular. Basic techniques for the separation of chromosomes by electrophoresis, such as OFAGE, FIGE, and CHEF, are discussed, with detailed protocols for the first two. Furthermore, new methods, e.g. for the isolation of high molecular weight DNA from yeast, isolation of RNA, and techniques for transformation of yeasts, are also described in detail. (orig.) With 10 figs.
Probiotic Properties of Non-Saccharomyces Yeasts
DEFF Research Database (Denmark)
Smith, Ida Mosbech
to harmless luminal substances is a key feature of the intestinal immune system. In this context, dendritic cells (DCs) present in the tissues lining the human gut are central players involved in microbial sensing and shaping of appropriate adaptive immune responses. Probiotics are live microorganisms which...... when administered in adequate amounts confer a health benefit on the host. While the majority of probiotic microorganisms studied to date are lactic acid bacteria, research in yeasts with potentially beneficial influences on human health has mainly revolved around Saccharomyces boulardii. This yeast...... has shown a positive impact on disease outcome in clinical studies of inflammatory bowel disease, indicating an ability of S. boulardii to influence human immune responses underlying intestinal inflammation. Consequent to this focus on S. boulardii as the fundamental probiotic yeast, very little...
Using Microsatellites to Identify Yeast Strains in Beer
Bruke, Alexandria; Van Brocklin, Jennifer; Rivest, Jason; Prenni, Jessica E.; Ibrahim, Hend
2012-01-01
Yeast is an integral part of the brewing process and is responsible for much of the taste and characteristics of beer. During the brewing process, yeast is subject to ageing and stress factors that can result in growth inhibition, decreased genetic stability, and changes in cell membrane stability. Characterization of yeast species used in industrial fermentation (e.g. S. cerevisiae) is of great importance to the brewing industry. The objective of this study was to develop an assay to identif...
Directory of Open Access Journals (Sweden)
Olga A. Glazunova
2018-04-01
Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.
Animal vaccines based on orally presented yeast recombinants.
Shin, Min-Kyoung; Yoo, Han Sang
2013-09-13
In veterinary vaccinology, the oral route of administration is an attractive alternative compared to the commonly used parenteral route. Yeasts have a number of properties that make them potential live delivery systems for oral vaccination purposes such as their high expression levels, their GRAS status, adjuvant properties, and post-translational modification possibilities. Consequently, yeasts have been employed for the expression of heterologous genes and for the production of therapeutic proteins. Yeast-based vaccines are reviewed with regard to their ability to express and produce antigens from pathogens for veterinary use. Many of these vaccines have been shown to elicit protective immune responses following oral immunization in animals. Ultimately, yeast-based oral vaccines may offer a potential opportunity for the development of novel ideal vaccines in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.
Biodiesel generation from oleaginous yeast Rhodotorula glutinis ...
African Journals Online (AJOL)
SERVER
2007-09-19
Sep 19, 2007 ... This study explored a strategy to convert agricultural and forestry residues into microbial lipid, which could be further transformed into biodiesel. Among the 250 yeast strains screened for xylose assimilating capacity, eight oleaginous yeasts were selected by Sudan Black B test. The lipid content of these 8 ...
Yeast modulation of human dendritic cell cytokine secretion: an in vitro study.
Directory of Open Access Journals (Sweden)
Ida M Smith
Full Text Available Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The concept of individual microorganisms influencing the makeup of T cell subsets via interactions with intestinal dendritic cells (DCs appears to constitute the foundation for immunoregulatory effects of probiotics, and several studies have reported probiotic strains resulting in reduction of intestinal inflammation through modulation of DC function. Consequent to a focus on Saccharomyces boulardii as the fundamental probiotic yeast, very little is known about hundreds of non-Saccharomyces yeasts in terms of their interaction with the human gastrointestinal immune system. The aim of the present study was to evaluate 170 yeast strains representing 75 diverse species for modulation of inflammatory cytokine secretion by human DCs in vitro, as compared to cytokine responses induced by a S. boulardii reference strain with probiotic properties documented in clinical trials. Furthermore, we investigated whether cytokine inducing interactions between yeasts and human DCs are dependent upon yeast viability or rather a product of membrane interactions regardless of yeast metabolic function. We demonstrate high diversity in yeast induced cytokine profiles and employ multivariate data analysis to reveal distinct clustering of yeasts inducing similar cytokine profiles in DCs, highlighting clear species distinction within specific yeast genera. The observed differences in induced DC cytokine profiles add to the currently very limited knowledge of the cross-talk between yeasts and human immune cells and provide a foundation for selecting yeast strains for further characterization and development toward potentially novel yeast probiotics. Additionally, we present data to support a hypothesis that the interaction between yeasts and human DCs does not solely depend on yeast viability, a concept which may suggest a need for further classifications
Yeast Modulation of Human Dendritic Cell Cytokine Secretion: An In Vitro Study
Smith, Ida M.; Christensen, Jeffrey E.; Arneborg, Nils; Jespersen, Lene
2014-01-01
Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The concept of individual microorganisms influencing the makeup of T cell subsets via interactions with intestinal dendritic cells (DCs) appears to constitute the foundation for immunoregulatory effects of probiotics, and several studies have reported probiotic strains resulting in reduction of intestinal inflammation through modulation of DC function. Consequent to a focus on Saccharomyces boulardii as the fundamental probiotic yeast, very little is known about hundreds of non-Saccharomyces yeasts in terms of their interaction with the human gastrointestinal immune system. The aim of the present study was to evaluate 170 yeast strains representing 75 diverse species for modulation of inflammatory cytokine secretion by human DCs in vitro, as compared to cytokine responses induced by a S. boulardii reference strain with probiotic properties documented in clinical trials. Furthermore, we investigated whether cytokine inducing interactions between yeasts and human DCs are dependent upon yeast viability or rather a product of membrane interactions regardless of yeast metabolic function. We demonstrate high diversity in yeast induced cytokine profiles and employ multivariate data analysis to reveal distinct clustering of yeasts inducing similar cytokine profiles in DCs, highlighting clear species distinction within specific yeast genera. The observed differences in induced DC cytokine profiles add to the currently very limited knowledge of the cross-talk between yeasts and human immune cells and provide a foundation for selecting yeast strains for further characterization and development toward potentially novel yeast probiotics. Additionally, we present data to support a hypothesis that the interaction between yeasts and human DCs does not solely depend on yeast viability, a concept which may suggest a need for further classifications beyond the current
Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.
Directory of Open Access Journals (Sweden)
Yi-Cheng Guo
Full Text Available Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya. However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.
A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin
Directory of Open Access Journals (Sweden)
Zhang Tingting
2012-12-01
Full Text Available Abstract Background Yeast Saccharomyces cerevisiae is a widely-used system for protein expression. We previously showed that heat-killed whole recombinant yeast vaccine expressing mammalian myostatin can modulate myostatin function in mice, resulting in increase of body weight and muscle composition in these animals. Foreign DNA introduced into yeast cells can be lost soon unless cells are continuously cultured in selection media, which usually contain antibiotics. For cost and safety concerns, it is essential to optimize conditions to produce quality food and pharmaceutical products. Results We developed a simple but effective method to engineer a yeast strain stably expressing mammalian myostatin. This method utilized high-copy-number integration of myostatin gene into the ribosomal DNA of Saccharomyces cerevisiae. In the final step, antibiotic selection marker was removed using the Cre-LoxP system to minimize any possible side-effects for animals. The resulting yeast strain can be maintained in rich culture media and stably express mammalian myostatin for two years. Oral administration of the recombinant yeast was able to induce immune response to myostatin and modulated the body weight of mice. Conclusions Establishment of such yeast strain is a step further toward transformation of yeast cells into edible vaccine to improve meat production in farm animals and treat human muscle-wasting diseases in the future.
Eldarov, Mikhail A.; Beletsky, Alexey V.; Tanashchuk, Tatiana N.; Kishkovskaya, Svetlana A.; Ravin, Nikolai V.; Mardanov, Andrey V.
2018-01-01
Flor yeast strains represent a specialized group of Saccharomyces cerevisiae yeasts used for biological wine aging. We have sequenced the genomes of three flor strains originated from different geographic regions and used for production of sherry-like wines in Russia. According to the obtained phylogeny of 118 yeast strains, flor strains form very tight cluster adjacent to the main wine clade. SNP analysis versus available genomes of wine and flor strains revealed 2,270 genetic variants in 1,337 loci specific to flor strains. Gene ontology analysis in combination with gene content evaluation revealed a complex landscape of possibly adaptive genetic changes in flor yeast, related to genes associated with cell morphology, mitotic cell cycle, ion homeostasis, DNA repair, carbohydrate metabolism, lipid metabolism, and cell wall biogenesis. Pangenomic analysis discovered the presence of several well-known “non-reference” loci of potential industrial importance. Events of gene loss included deletions of asparaginase genes, maltose utilization locus, and FRE-FIT locus involved in iron transport. The latter in combination with a flor-yeast-specific mutation in the Aft1 transcription factor gene is likely to be responsible for the discovered phenotype of increased iron sensitivity and improved iron uptake of analyzed strains. Expansion of the coding region of the FLO11 flocullin gene and alteration of the balance between members of the FLO gene family are likely to positively affect the well-known propensity of flor strains for velum formation. Our study provides new insights in the nature of genetic variation in flor yeast strains and demonstrates that different adaptive properties of flor yeast strains could have evolved through different mechanisms of genetic variation. PMID:29867869
Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells
Energy Technology Data Exchange (ETDEWEB)
Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)
2011-02-25
Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.
Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells
International Nuclear Information System (INIS)
Tsuji, Toshikazu; Kawai-Noma, Shigeko; Pack, Chan-Gi; Terajima, Hideki; Yajima, Junichiro; Nishizaka, Takayuki; Kinjo, Masataka; Taguchi, Hideki
2011-01-01
Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.
Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura
2011-09-01
To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.
Biochemical composition of the biomass of some yeasts
Energy Technology Data Exchange (ETDEWEB)
Filippova, T.V.; Tyurina, Z.P.
1981-01-01
The biochemical composition of Rhodotorula gracilis was dependent on the culture medium. Cultivation of the yeast on molasses, starch, and plant hydrolyzates gave a high biomass yield with high protein and carbohydrate contents and relatively low nucleic acid contents. Similar results were obtained with fodder yeasts: Candida tropicalis, C. scotti, and Sporobolomyces pararoseus. There were 17 amino acids in yeast biomass. The amino acid content of R. gracilis and C. scotti was 29-30 percent and 39 percent respectively. Both species were deficient in methionine.
Yeasts: providing questions and answers for modern biology.
Dickinson, J R
2000-01-01
Yeasts are to be found in virtually every conceivable niche on this planet and are amazingly varied in their shapes ('morphologies'), life cycles, metabolic capabilities, potentials for use in industrial processes, abilities to spoil food and drink or to act as dangerous human pathogens. This review describes four very different species of yeast to illustrate some of the diversity which exists and, in the case of one of them, Saccharomyces cerevisiae (the familiar baker's or brewer's yeast), the extent of both our knowledge and ignorance.
Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D
2018-05-03
Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.
Study on ionizing radiosensitivity of respiratory deficiency yeast mutants
International Nuclear Information System (INIS)
Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei
2006-01-01
The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)
Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony
2013-06-01
Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for
The relationship between salivary histatin levels and oral yeast carriage.
Jainkittivong, A; Johnson, D A; Yeh, C K
1998-06-01
Candida species are common commensal inhabitants of the oral cavity. Human saliva contains antifungal proteins called histatins. We tested the hypothesis that oral yeast status is related to salivary histatin levels. Thirty subjects were divided into two groups based on the presence (n = 15) or absence (n = 15) of yeast on oral mucosa surfaces. Unstimulated and stimulated submandibular and sublingual and parotid saliva was collected from each subject. Salivary flow rates were measured and histatin concentrations were determined in the stimulated saliva samples. The yeast colony positive group showed lower median unstimulated parotid saliva flow rates as well as lower median concentrations of total histatins in submandibular and sublingual saliva. There was a negative correlation between yeast colony-forming units and unstimulated parotid saliva flow rates and between yeast colony-forming units and submandibular and sublingual saliva histatin concentration and secretion. The results suggest that oral yeast status may be influenced by unstimulated parotid saliva flow rates and by submandibular and sublingual histatin concentration and secretion.
Independent and additive effects of glutamic acid and methionine on yeast longevity.
Wu, Ziyun; Song, Lixia; Liu, Shao Quan; Huang, Dejian
2013-01-01
It is established that glucose restriction extends yeast chronological and replicative lifespan, but little is known about the influence of amino acids on yeast lifespan, although some amino acids were reported to delay aging in rodents. Here we show that amino acid composition greatly alters yeast chronological lifespan. We found that non-essential amino acids (to yeast) methionine and glutamic acid had the most significant impact on yeast chronological lifespan extension, restriction of methionine and/or increase of glutamic acid led to longevity that was not the result of low acetic acid production and acidification in aging media. Remarkably, low methionine, high glutamic acid and glucose restriction additively and independently extended yeast lifespan, which could not be further extended by buffering the medium (pH 6.0). Our preliminary findings using yeasts with gene deletion demonstrate that glutamic acid addition, methionine and glucose restriction prompt yeast longevity through distinct mechanisms. This study may help to fill a gap in yeast model for the fast developing view that nutrient balance is a critical factor to extend lifespan.
The ecology of insect-yeast relationships and its relevance to human industry.
Madden, Anne A; Epps, Mary Jane; Fukami, Tadashi; Irwin, Rebecca E; Sheppard, John; Sorger, D Magdalena; Dunn, Robert R
2018-03-28
Many species of yeast are integral to human society. They produce many of our foods, beverages and industrial chemicals, challenge us as pathogens, and provide models for the study of our own biology. However, few species are regularly studied and much of their ecology remains unclear, hindering the development of knowledge that is needed to improve the relationships between humans and yeasts. There is increasing evidence that insects are an essential component of ascomycetous yeast ecology. We propose a 'dispersal-encounter hypothesis' whereby yeasts are dispersed by insects between ephemeral, spatially disparate sugar resources, and insects, in turn, obtain the benefits of an honest signal from yeasts for the sugar resources. We review the relationship between yeasts and insects through three main examples: social wasps, social bees and beetles, with some additional examples from fruit flies. Ultimately, we suggest that over the next decades, consideration of these ecological and evolutionary relationships between insects and yeasts will allow prediction of where new yeast diversity is most likely to be discovered, particularly yeasts with traits of interest to human industry. © 2018 The Author(s).
Carrau, Francisco M; Medina, Karina; Farina, Laura; Boido, Eduardo; Henschke, Paul A; Dellacassa, Eduardo
2008-11-01
The contribution of yeast fermentation metabolites to the aromatic profile of wine is well documented; however, the biotechnological application of this knowledge, apart from strain selection, is still rather limited and often contradictory. Understanding and modeling the relationship between nutrient availability and the production of desirable aroma compounds by different strains must be one of the main objectives in the selection of industrial yeasts for the beverage and food industry. In order to overcome the variability in the composition of grape juices, we have used a chemically defined model medium for studying yeast physiological behavior and metabolite production in response to nitrogen supplementation so as to identify an appropriate yeast assimilable nitrogen level for strain differentiation. At low initial nitrogen concentrations, strain KU1 produced higher quantities of esters and fatty acids whereas M522 produced higher concentrations of isoacids, gamma-butyrolactone, higher alcohols and 3-methylthio-1-propanol. We propose that although strains KU1 and M522 have a similar nitrogen consumption profile, they represent useful models for the chemical characterization of wine strains in relation to wine quality. The differential production of aroma compounds by the two strains is discussed in relation to their capacity for nitrogen usage and their impact on winemaking. The results obtained here will help to develop targeted metabolic footprinting methods for the discrimination of industrial yeasts.
Fernández, Natalia V; Mestre, M Cecilia; Marchelli, Paula; Fontenla, Sonia B
2012-04-01
Nothofagus nervosa (Raulí) is a native tree species that yields valuable timber. It was overexploited in the past and is currently included in domestication and conservation programs. Several research programs have focused on the characterization of epiphytic microorganisms because it has been demonstrated that they can affect plant-pathogen interactions and/or promote plant growth. Although the microbial ecology of leaves has been well studied, less is known about microorganisms occurring on seeds and noncommercial fruits. In this work, we analyzed the yeast and yeast-like fungi present on N. nervosa fruits destined for the propagation of this species, as well as the effects of fruit preservation and seed dormancy-breaking processes on fungal diversity. Morphological and molecular methods were used, and differences between fungal communities were analyzed using a similarity index. A total of 171 isolates corresponding to 17 species were recovered, most of which belong to the phylum Ascomycota. The majority of the species develop mycelia, produce pigments and mycosporines, and these adaptation strategies are discussed. It was observed that the preservation process considerably reduced yeast and yeast-like fungal diversity. This is the first study concerning microbial communities associated with this ecologically and economically important species, and the information presented is relevant to domestication programs. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Yeast Infection Test: MedlinePlus Lab Test Information
... cheese-like discharge Painful urination Redness in the vagina Yeast infection of the penis may cause: Redness Scaling Rash ... on the location of your symptoms: If a vaginal yeast infection is suspected , your health care provider will perform ...
Directory of Open Access Journals (Sweden)
Beopoulos Athanasios
2012-01-01
Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.
Extracellular enzymatic activities and physiological profiles of yeasts colonizing fruit trees.
Molnárová, Jana; Vadkertiová, Renáta; Stratilová, Eva
2014-07-01
Yeasts form a significant and diverse part of the phyllosphere microbiota. Some yeasts that inhabit plants have been found to exhibit extracellular enzymatic activities. The aim of the present study was to investigate the ability of yeasts isolated from leaves, fruits, and blossoms of fruit trees cultivated in Southwest Slovakia to produce extracellular enzymes, and to discover whether the yeasts originating from these plant organs differ from each other in their physiological properties. In total, 92 strains belonging to 29 different species were tested for: extracellular protease, β-glucosidase, lipase, and polygalacturonase activities; fermentation abilities; the assimilation of xylose, saccharose and alcohols (methanol, ethanol, glycerol); and for growth in a medium with 33% glucose. The black yeast Aureobasidium pullulans showed the largest spectrum of activities of all the species tested. Almost 70% of the strains tested demonstrated some enzymatic activity, and more than 90% utilized one of the carbon compounds tested. Intraspecies variations were found for the species of the genera Cryptococcus and Pseudozyma. Interspecies differences of strains exhibiting some enzymatic activities and utilizing alcohols were also noted. The largest proportion of the yeasts exhibited β-glucosidase activity and assimilated alcohols independently of their origin. The highest number of strains positive for all activities tested was found among the yeasts associated with leaves. Yeasts isolated from blossoms assimilated saccharose and D-xylose the most frequently of all the yeasts tested. The majority of the fruit-inhabiting yeasts grew in the medium with higher osmotic pressure. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrothermal decomposition of yeast cells for production of proteins and amino acids
Energy Technology Data Exchange (ETDEWEB)
Lamoolphak, Wiwat [Department of Chemical Engineering, Faculty of Engineering, Chulalongkorn University, Patumwan, Payathai Road, Bangkok 10330 (Thailand); Goto, Motonobu [Department of Applied Chemistry and Biochemistry, Kumamoto University, Kumamoto 850-8555 (Japan); Sasaki, Mitsuru [Department of Applied Chemistry and Biochemistry, Kumamoto University, Kumamoto 850-8555 (Japan); Suphantharika, Manop [Department of Biotechnology, Faculty of Science, Mahidol University, Rama VI Road, Bangkok 10400 (Thailand); Muangnapoh, Chirakarn [Department of Chemical Engineering, Faculty of Engineering, Chulalongkorn University, Patumwan, Payathai Road, Bangkok 10330 (Thailand); Prommuag, Chattip [Department of Chemical Engineering, Faculty of Engineering, Chulalongkorn University, Patumwan, Payathai Road, Bangkok 10330 (Thailand); Shotipruk, Artiwan [Department of Chemical Engineering, Faculty of Engineering, Chulalongkorn University, Patumwan, Payathai Road, Bangkok 10330 (Thailand)]. E-mail: artiwan.s@chula.ac.th
2006-10-11
This study examines hydrothermal decomposition of Baker's yeast cells, used as a model for spent Brewer's yeast waste, into protein and amino acids. The reaction was carried out in a closed batch reactor at various temperatures between 100 and 250 deg. C. The reaction products were separated into water-soluble and solid residue. The results demonstrated that the amount of yeast residue decreased with increasing hydrolysis temperature. After 20 min reaction in water at 250 deg. C, 78% of yeast was decomposed. The highest amount of protein produced was also obtained at this condition and was found to be 0.16 mg/mg dry yeast. The highest amount of amino acids (0.063 mg/mg dry yeast) was found at the lowest temperature tested after 15 min. The hydrolysis product obtained at 200 deg. C was tested as a nutrient source for yeast growth. The growth of yeast cells in the culture medium containing 2 w/v% of this product was comparable to that of the cells grown in the medium containing commercial yeast extract at the same concentration. These results demonstrated the feasibility of using subcritical water to potentially decompose proteinaceous waste such as spent Brewer's yeast while recovering more useful products.
Hydrothermal decomposition of yeast cells for production of proteins and amino acids
International Nuclear Information System (INIS)
Lamoolphak, Wiwat; Goto, Motonobu; Sasaki, Mitsuru; Suphantharika, Manop; Muangnapoh, Chirakarn; Prommuag, Chattip; Shotipruk, Artiwan
2006-01-01
This study examines hydrothermal decomposition of Baker's yeast cells, used as a model for spent Brewer's yeast waste, into protein and amino acids. The reaction was carried out in a closed batch reactor at various temperatures between 100 and 250 deg. C. The reaction products were separated into water-soluble and solid residue. The results demonstrated that the amount of yeast residue decreased with increasing hydrolysis temperature. After 20 min reaction in water at 250 deg. C, 78% of yeast was decomposed. The highest amount of protein produced was also obtained at this condition and was found to be 0.16 mg/mg dry yeast. The highest amount of amino acids (0.063 mg/mg dry yeast) was found at the lowest temperature tested after 15 min. The hydrolysis product obtained at 200 deg. C was tested as a nutrient source for yeast growth. The growth of yeast cells in the culture medium containing 2 w/v% of this product was comparable to that of the cells grown in the medium containing commercial yeast extract at the same concentration. These results demonstrated the feasibility of using subcritical water to potentially decompose proteinaceous waste such as spent Brewer's yeast while recovering more useful products
Yeast biotechnology: teaching the old dog new tricks.
Mattanovich, Diethard; Sauer, Michael; Gasser, Brigitte
2014-03-06
Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature.
Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M
2006-12-14
DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.
Yeasts in foods and beverages: impact on product quality and safety.
Fleet, Graham H
2007-04-01
The role of yeasts in food and beverage production extends beyond the well-known bread, beer and wine fermentations. Molecular analytical technologies have led to a major revision of yeast taxonomy, and have facilitated the ecological study of yeasts in many other products. The mechanisms by which yeasts grow in these ecosystems and impact on product quality can now be studied at the level of gene expression. Their growth and metabolic activities are moderated by a network of strain and species interactions, including interactions with bacteria and other fungi. Some yeasts have been developed as agents for the biocontrol of food spoilage fungi, and others are being considered as novel probiotic organisms. The association of yeasts with opportunistic infections and other adverse responses in humans raises new issues in the field of food safety.
Metabolic Engineering of Oleaginous Yeasts for Production of Fuels and Chemicals
Directory of Open Access Journals (Sweden)
Shuobo Shi
2017-11-01
Full Text Available Oleaginous yeasts have been increasingly explored for production of chemicals and fuels via metabolic engineering. Particularly, there is a growing interest in using oleaginous yeasts for the synthesis of lipid-related products due to their high lipogenesis capability, robustness, and ability to utilize a variety of substrates. Most of the metabolic engineering studies in oleaginous yeasts focused on Yarrowia that already has plenty of genetic engineering tools. However, recent advances in systems biology and synthetic biology have provided new strategies and tools to engineer those oleaginous yeasts that have naturally high lipid accumulation but lack genetic tools, such as Rhodosporidium, Trichosporon, and Lipomyces. This review highlights recent accomplishments in metabolic engineering of oleaginous yeasts and recent advances in the development of genetic engineering tools in oleaginous yeasts within the last 3 years.
Checkpoint independence of most DNA replication origins in fission yeast.
Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A
2007-12-19
In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (approximately 3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in checkpoint
Checkpoint independence of most DNA replication origins in fission yeast
Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A
2007-01-01
Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in
Checkpoint independence of most DNA replication origins in fission yeast
Directory of Open Access Journals (Sweden)
Scott Donna
2007-12-01
Full Text Available Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU, which limits the pool of deoxyribonucleoside triphosphates (dNTPs and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR or cds1 (which encodes the fission yeast homologue of Chk2. Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3% behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild
Determination of tritium in wine and wine yeast samples
International Nuclear Information System (INIS)
Cotarlea, Monica-Ionela; Paunescu, Niculina; Galeriu, D.; Mocanu, N.; Margineanu, R.; Marin, G.
1997-01-01
A sensitive method for evaluating the tritium content in wine and wine yeast was applied to estimate tritium impact on the environment in the surrounding area of nuclear power plant Cernavoda, where the vineyards are part of representative agricultural ecosystem. Analytical procedures were developed to determine HTO in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractionating distillation for wine samples and azeotropic distillation followed by fractional distillation for wine yeast samples. Finally, the water samples obtained after fractional distillation were normally distilled with KMO 4 . The established procedures were successfully applied for wine and wine yeast samples from Mulfatlar harvests of the years 1995 and 1996. (authors)
Rowe, Jeffrey D; Harbertson, James F; Osborne, James P; Freitag, Michael; Lim, Juyun; Bakalinsky, Alan T
2010-02-24
Total protein and protein-associated mannan concentrations were measured, and individual proteins were identified during extraction into model wines over 9 months of aging on the yeast lees following completion of fermentations by seven wine strains of Saccharomyces cerevisiae. In aged wines, protein-associated mannan increased about 6-fold (+/-66%), while total protein only increased 2-fold (+/-20%), which resulted in a significantly greater protein-associated mannan/total protein ratio for three strains. A total of 219 proteins were identified among all wine samples taken over the entire time course. Of the 17 "long-lived" proteins detected in all 9 month samples, 13 were cell wall mannoproteins, and four were glycolytic enzymes. Most cytosolic proteins were not detected after 6 months. Native mannosylated yeast invertase was assayed for binding to wine tannin and was found to have a 10-fold lower affinity than nonglycosylated bovine serum albumin. Enrichment of mannoproteins in the aged model wines implies greater solution stability than other yeast proteins and the possibility that their contributions to wine quality may persist long after bottling.
Non-Conventional Yeast Strains Increase the Aroma Complexity of Bread
Rezaei, Mohammad Naser; Steensels, Jan; Courtin, Christophe M.; Verstrepen, Kevin J.
2016-01-01
Saccharomyces cerevisiae is routinely used yeast in food fermentations because it combines several key traits, including fermentation efficiency and production of desirable flavors. However, the dominance of S. cerevisiae in industrial fermentations limits the diversity in the aroma profiles of the end products. Hence, there is a growing interest in non-conventional yeast strains that can help generate the diversity and complexity desired in today’s diversified and consumer-driven markets. Here, we selected a set of non-conventional yeast strains to examine their potential for bread fermentation. Here, we tested ten non-conventional yeasts for bread fermentation, including two Saccharomyces species that are not currently used in bread making and 8 non-Saccharomyces strains. The results show that Torulaspora delbrueckii and Saccharomyces bayanus combine satisfactory dough fermentation with an interesting flavor profile. Sensory analysis and HS-SPME-GC-MS analysis confirmed that these strains produce aroma profiles that are very different from that produced by a commercial bakery strain. Moreover, bread produced with these yeasts was preferred by a majority of a trained sensory panel. These results demonstrate the potential of T. delbrueckii and S. bayanus as alternative yeasts for bread dough leavening, and provide a general experimental framework for the evaluation of more yeasts and bacteria. PMID:27776154
Non-Conventional Yeast Strains Increase the Aroma Complexity of Bread.
Aslankoohi, Elham; Herrera-Malaver, Beatriz; Rezaei, Mohammad Naser; Steensels, Jan; Courtin, Christophe M; Verstrepen, Kevin J
2016-01-01
Saccharomyces cerevisiae is routinely used yeast in food fermentations because it combines several key traits, including fermentation efficiency and production of desirable flavors. However, the dominance of S. cerevisiae in industrial fermentations limits the diversity in the aroma profiles of the end products. Hence, there is a growing interest in non-conventional yeast strains that can help generate the diversity and complexity desired in today's diversified and consumer-driven markets. Here, we selected a set of non-conventional yeast strains to examine their potential for bread fermentation. Here, we tested ten non-conventional yeasts for bread fermentation, including two Saccharomyces species that are not currently used in bread making and 8 non-Saccharomyces strains. The results show that Torulaspora delbrueckii and Saccharomyces bayanus combine satisfactory dough fermentation with an interesting flavor profile. Sensory analysis and HS-SPME-GC-MS analysis confirmed that these strains produce aroma profiles that are very different from that produced by a commercial bakery strain. Moreover, bread produced with these yeasts was preferred by a majority of a trained sensory panel. These results demonstrate the potential of T. delbrueckii and S. bayanus as alternative yeasts for bread dough leavening, and provide a general experimental framework for the evaluation of more yeasts and bacteria.
Non-Conventional Yeast Strains Increase the Aroma Complexity of Bread.
Directory of Open Access Journals (Sweden)
Elham Aslankoohi
Full Text Available Saccharomyces cerevisiae is routinely used yeast in food fermentations because it combines several key traits, including fermentation efficiency and production of desirable flavors. However, the dominance of S. cerevisiae in industrial fermentations limits the diversity in the aroma profiles of the end products. Hence, there is a growing interest in non-conventional yeast strains that can help generate the diversity and complexity desired in today's diversified and consumer-driven markets. Here, we selected a set of non-conventional yeast strains to examine their potential for bread fermentation. Here, we tested ten non-conventional yeasts for bread fermentation, including two Saccharomyces species that are not currently used in bread making and 8 non-Saccharomyces strains. The results show that Torulaspora delbrueckii and Saccharomyces bayanus combine satisfactory dough fermentation with an interesting flavor profile. Sensory analysis and HS-SPME-GC-MS analysis confirmed that these strains produce aroma profiles that are very different from that produced by a commercial bakery strain. Moreover, bread produced with these yeasts was preferred by a majority of a trained sensory panel. These results demonstrate the potential of T. delbrueckii and S. bayanus as alternative yeasts for bread dough leavening, and provide a general experimental framework for the evaluation of more yeasts and bacteria.
Directory of Open Access Journals (Sweden)
Paul R. Broadway
2015-08-01
Full Text Available More livestock producers are seeking natural alternatives to antibiotics and antimicrobials, and searching for supplements to enhance growth performance, and general animal health and well-being. Some of the compounds currently being utilized and studied are live yeast and yeast-based products derived from the strain Saccharomyces cerevisiae. These products have been reported to have positive effects both directly and indirectly on the immune system and its subsequent biomarkers, thereby mitigating negative effects associated with stress and disease. These yeast-based products have also been reported to simultaneously enhance growth and performance by enhancing dry matter intake (DMI and average daily gain (ADG perhaps through the establishment of a healthy gastrointestinal tract. These products may be especially useful in times of potential stress such as during birth, weaning, early lactation, and during the receiving period at the feedlot. Overall, yeast supplements appear to possess the ability to improve animal health and metabolism while decreasing morbidity, thereby enhancing profitability of these animals.
Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.
2015-01-01
The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224
Development of Yeast Populations during Processing and Ripening of Blue Veined Cheese
Directory of Open Access Journals (Sweden)
Alison M. Knox
2003-01-01
Full Text Available Varieties of blue veined cheese were analyzed regularly during different stages of manufacturing and ripening to determine the origin of contaminating the yeasts present in them, their population diversity and development until the end of the storage. Yeast diversity and development in the inner and outer core of the cheeses during ripening were also compared. Air samples revealed few if any yeasts whereas the samples in contact with the equipment and the surroundings revealed high number of yeasts, implicating it as the possible main source of post-pasteurization contamination, as very few yeasts were isolated from the milk and cheese making process itself. Samples from the inner and outer core of the maturing cheeses had typical survival curves. The number of yeasts on the outer core was about a 100-fold more than of those in the inner core. The most abundant yeasts isolated from the environment and ripening cheeses were identified as Debaryomyces hansenii, Saccharomyces cerevisiae, Torulaspora delbrueckii, Trichosporon beigelii, Candida versatilis and Cryptococcus albidus, while the yeasts Candida zeylanoides and Dekkera anomala were additionally isolated from the environment. Yeasts were present in high number, making their occurrence in blue-veined cheeses meaningful.
The yeast stands alone: the future of protein biologic production.
Love, Kerry R; Dalvie, Neil C; Love, J Christopher
2017-12-22
Yeasts are promising alternative hosts for the manufacturing of recombinant protein therapeutics because they simply and efficiently meet needs for both platform and small-market drugs. Fast accumulation of biomass and low-cost media reduce the cost-of-goods when using yeast, which in turn can enable agile, small-volume manufacturing facilities. Small, tractable yeast genomes are amenable to rapid process development, facilitating strain and product quality by design. Specifically, Pichia pastoris is becoming a widely accepted yeast for biopharmaceutical manufacturing in much of the world owing to a clean secreted product and the rapidly expanding understanding of its cell biology as a host organism. We advocate for a near term partnership spanning industry and academia to promote open source, timely development of yeast hosts. Copyright © 2017. Published by Elsevier Ltd.
Interactions between yeasts, fungicides and apple fruit russeting
Gildemacher, P.R.; Heijne, B.; Silvestri, M.; Houbraken, J.; Hoekstra, E.; Theelen, B.; Boekhout, T.
2006-01-01
The effect of inoculations with yeasts occurring on apple surfaces and fungicide treatments on the russeting of Elstar apples was studied. Captan, dithianon and a water treatment were implemented to study the interaction between the fungicides, the inoculated yeast species and Aureobasidium
Effect of heat treatment on brewer's yeast fermentation activity
Kharandiuk, Tetiana; Kosiv, Ruslana; Palianytsia, Liubov; Berezovska, Natalia
2015-01-01
The influence of temperature treatment of brewer's yeast strain Saflager W-34/70 at temperatures of -17, 20, 25, 30, 35, 40 °C on their fermentative activity was studied. It was established that the freezing of yeast leads to a decrease of fermentation activity in directly proportional to the duration way. Fermentative activity of yeast samples can be increased by 20-24% by heat treatment at 35 °C during 15-30 minutes.
Yeast species associated with the spontaneous fermentation of cider.
Suárez, Belén; Pando, Rosa; Fernández, Norman; Querol, Amparo; Rodríguez, Roberto
2018-01-01
This paper reports the influence of cider-making technology (pneumatic and traditional pressing) on the dynamics of wild yeast populations. Yeast colonies isolated from apple juice before and throughout fermentation at a cider cellar of Asturias (Spain), during two consecutive years were studied. The yeast strains were identified by restriction fragment length polymorphism analysis of the 5.8S rRNA gene and the two flanking internal transcribed sequences (ITS). The musts obtained by ...
International Nuclear Information System (INIS)
Yang, Min; Zheng, Shaokui
2014-01-01
Microbial single-cell-protein (SCP) production from high-organic-strength industrial wastewaters is considered an attractive method for both wastewater purification and resource utilization. In the last two decades, pollutant removal-oriented yeast SCP production processes, i.e., yeast treatment processes, have attracted a great deal of attention from a variety of research groups worldwide. Different from conventional SCP production processes, yeast treatment processes are characterized by higher pollutant removal rates, lower production costs, highly adaptive yeast isolates from nature, no excess nutrient supplements, and are performed under non-sterile conditions. Furthermore, yeast treatment processes are similar to bacteria-dominated conventional activated sludge processes, which offer more choices for yeast SCP production and industrial wastewater treatment. This review discusses why highly adaptive yeast species isolated from nature are used in the yeast treatment process rather than commercial SCP producers. It also describes the application of yeast treatment processes for treating high-carboxyhydrate, oil-rich and high-salinity industrial wastewater, focusing primarily on high-strength biodegradable organic substances, which usually account for the major fraction of biochemical oxygen demand. Also discussed is the biodegradation of xenobiotics, such as color (including dye and pigment) and toxic substances (including phenols, chlorophenols, polycyclic aromatic hydrocarbons, etc.), present in industrial wastewater. Based on molecular information of yeast community structures and their regulation in yeast treatment systems, we also discuss how to maintain efficient yeast species in yeast biomass and how to control bacterial and mold proliferation in yeast treatment systems. - Highlights: • Pollutant removal-oriented yeast SCP production processes offer more choices. • Highly adaptive yeast isolates replace commercial SCP producers. • Yeasts degrade
Yeast synthetic biology for the production of recombinant therapeutic proteins.
Kim, Hyunah; Yoo, Su Jin; Kang, Hyun Ah
2015-02-01
The production of recombinant therapeutic proteins is one of the fast-growing areas of molecular medicine and currently plays an important role in treatment of several diseases. Yeasts are unicellular eukaryotic microbial host cells that offer unique advantages in producing biopharmaceutical proteins. Yeasts are capable of robust growth on simple media, readily accommodate genetic modifications, and incorporate typical eukaryotic post-translational modifications. Saccharomyces cerevisiae is a traditional baker's yeast that has been used as a major host for the production of biopharmaceuticals; however, several nonconventional yeast species including Hansenula polymorpha, Pichia pastoris, and Yarrowia lipolytica have gained increasing attention as alternative hosts for the industrial production of recombinant proteins. In this review, we address the established and emerging genetic tools and host strains suitable for recombinant protein production in various yeast expression systems, particularly focusing on current efforts toward synthetic biology approaches in developing yeast cell factories for the production of therapeutic recombinant proteins. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.
Ecological structuring of yeasts associated with trees around Hamilton, Ontario, Canada.
Maganti, Harinad; Bartfai, David; Xu, Jianping
2012-02-01
This study seeks to determine the distribution and diversity of yeasts in and around the Hamilton area in Canada. In light of the increasing number of fungal infections along with rising morbidity and mortality rates, especially among the immunocompromised, understanding the diversity and distribution of yeasts in natural environments close to human habitations has become an increasingly relevant topic. In this study, we analyzed 1110 samples obtained from the hollows of trees, shrubs and avian droppings at 8 geographical sites in and around Hamilton, Ontario, Canada. A total of 88 positive yeast strains were isolated and identified belonging to 20 yeast species. Despite the relative proximity of the sampling sites, our DNA fingerprinting results showed that the yeast populations were highly heterogenous. Among the 14 tree species sampled, cedar, cottonwood and basswood hollows had relatively high yeast colonization rates. Interestingly, Candida parapsilosis was isolated almost exclusively from Pine trees only. Our results are consistent with microgeographic and ecological differentiation of yeast species in and around an urban environment. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Fay, Justin C
2012-11-01
Domesticated organisms demonstrate our capacity to influence wild species but also provide us with the opportunity to understand rapid evolution in the context of substantially altered environments and novel selective pressures. Recent advances in genetics and genomics have brought unprecedented insights into the domestication of many organisms and have opened new avenues for further improvements to be made. Yet, our ability to engineer biological systems is not without limits; genetic manipulation is often quite difficult. The budding yeast, Saccharomyces cerevisiae, is not only one of the most powerful model organisms, but is also the premier producer of fermented foods and beverages around the globe. As a model system, it entertains a hefty workforce dedicated to deciphering its genome and the function it encodes at a rich mechanistic level. As a producer, it is used to make leavened bread, and dozens of different alcoholic beverages, such as beer and wine. Yet, applying the awesome power of yeast genetics to understanding its origins and evolution requires some knowledge of its wild ancestors and the environments from which they were derived. A number of surprisingly diverse lineages of S. cerevisiae from both primeval and secondary forests in China have been discovered by Wang and his colleagues. These lineages substantially expand our knowledge of wild yeast diversity and will be a boon to elucidating the ecology, evolution and domestication of this academic and industrial workhorse.
Lifescience Database Archive (English)
Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna
The complexity and implications of yeast prion domains
2011-01-01
Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731
Yeast biotechnology: teaching the old dog new tricks
2014-01-01
Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature. PMID:24602262
Brettanomyces bruxellensis yeasts: impact on wine and winemaking.
Agnolucci, Monica; Tirelli, Antonio; Cocolin, Luca; Toffanin, Annita
2017-09-21
Yeasts belonging to the Brettanomyces/Dekkera genus are non-conventional yeasts, which affect winemaking by causing wine spoilage all over the world. This mini-review focuses on recent results concerning the presence of Brettanomyces bruxellensis throughout the wine processing chain. Here, culture-dependent and independent methods to detect this yeast on grapes and at the very early stage of wine production are encompassed. Chemical, physical and biological tools, devised for the prevention and control of such a detrimental species during winemaking are also presented. Finally, the mini-review identifies future research areas relevant to the improvement of wine safety and sensory profiles.
[Overexpression of FKS1 to improve yeast autolysis-stress].
Li, Jia; Wang, Jinjing; Li, Qi
2015-09-01
With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing.
Flux control through protein phosphorylation in yeast
DEFF Research Database (Denmark)
Chen, Yu; Nielsen, Jens
2016-01-01
Protein phosphorylation is one of the most important mechanisms regulating metabolism as it can directly modify metabolic enzymes by the addition of phosphate groups. Attributed to such a rapid and reversible mechanism, cells can adjust metabolism rapidly in response to temporal changes. The yeast...... as well as identify mechanisms underlying human metabolic diseases. Here we collect functional phosphorylation events of 41 enzymes involved in yeast metabolism and demonstrate functional mechanisms and the application of this information in metabolic engineering. From a systems biology perspective, we...... describe the development of phosphoproteomics in yeast as well as approaches to analysing the phosphoproteomics data. Finally, we focus on integrated analyses with other omics data sets and genome-scale metabolic models. Despite the advances, future studies improving both experimental technologies...
Yeast selection for fuel ethanol production in Brazil.
Basso, Luiz C; de Amorim, Henrique V; de Oliveira, Antonio J; Lopes, Mario L
2008-11-01
Brazil is one of the largest ethanol biofuel producers and exporters in the world and its production has increased steadily during the last three decades. The increasing efficiency of Brazilian ethanol plants has been evident due to the many technological contributions. As far as yeast is concerned, few publications are available regarding the industrial fermentation processes in Brazil. The present paper reports on a yeast selection program performed during the last 12 years aimed at selecting Saccharomyces cerevisiae strains suitable for fermentation of sugar cane substrates (cane juice and molasses) with cell recycle, as it is conducted in Brazilian bioethanol plants. As a result, some evidence is presented showing the positive impact of selected yeast strains in increasing ethanol yield and reducing production costs, due to their higher fermentation performance (high ethanol yield, reduced glycerol and foam formation, maintenance of high viability during recycling and very high implantation capability into industrial fermenters). Results also suggest that the great yeast biodiversity found in distillery environments could be an important source of strains. This is because during yeast cell recycling, selective pressure (an adaptive evolution) is imposed on cells, leading to strains with higher tolerance to the stressful conditions of the industrial fermentation.
Downsides and benefits of unicellularity in budding yeast
Balazsi, Gabor; Chen, Lin; Kuzdzal-Fick, Jennie
Yeast cells that do not separate after cell division form clumps. Clumping was shown to aid utilization of certain sugars, but its effects in stressful conditions are unknown. Generally speaking, what are the costs and benefits of unicellularity versus clumping multicellularity in normal and stressful conditions? To address this question, we evolved clumping yeast towards unicellularity by continuously propagating only those cells that remain suspended in liquid culture after settling. Whole-genome sequencing indicated that mutations in the AMN1 (antagonist of mitotic exit network) gene underlie the changes from clumping to unicellular phenotypes in these evolved yeast cells. Simple models predict that clumping should hinder growth in normal conditions while being protective in stress. Accordingly, we find experimentally that yeast clumps are more resistant to freeze/thaw, hydrogen peroxide, and ethanol stressors than their unicellular counterparts. On the other hand, unicellularity seems to be advantageous in normal conditions. Overall, these results reveal the downsides and benefits of unicellularity in different environmental conditions and uncover its genetic bases in yeast. This research was supported by the NIH Director's New Innovator Award Program (1DP2 OD006481-01), by NSF/IOS 1021675 and the Laufer Center for Physical & Quantitative Biology.
Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts
Czech Academy of Sciences Publication Activity Database
Pálková, Z.; Váchová, Libuše
2016-01-01
Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
Energy Technology Data Exchange (ETDEWEB)
C.A.Reddy, PI
2005-06-30
and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity
Han, Jianrong
2003-01-15
The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.
Genetic and phenotypic characteristics of baker's yeast: relevance to baking.
Randez-Gil, Francisca; Córcoles-Sáez, Isaac; Prieto, José A
2013-01-01
Yeasts rarely encounter ideal physiological conditions during their industrial life span; therefore, their ability to adapt to changing conditions determines their usefulness and applicability. This is especially true for baking strains of Saccharomyces cerevisiae. The success of this yeast in the ancient art of bread making is based on its capacity to rapidly transform carbohydrates into CO2 rather than its unusual resistance to environmental stresses. Moreover, baker's yeast must exhibit efficient respiratory metabolism during yeast manufacturing, which determines biomass yield. However, optimal growth conditions often have negative consequences in other commercially important aspects, such as fermentative power or stress tolerance. This article reviews the genetic and physiological characteristics of baking yeast strains, emphasizing the activation of regulatory mechanisms in response to carbon source and stress signaling and their importance in defining targets for strain selection and improvement.
Dietary glucose regulates yeast consumption in adult Drosophila males.
Lebreton, Sébastien; Witzgall, Peter; Olsson, Marie; Becher, Paul G
2014-01-01
The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies stopped feeding after having access to a nutritive cornmeal diet. Interestingly, dietary glucose was equally efficient as the complex cornmeal diet. In contrast, flies fed with sucralose, a non-metabolizable sweetener, behaved as if they were starved. The adipokinetic hormone and insulin-like peptides regulate metabolic processes in insects. We did not find any effect of the adipokinetic hormone pathway on this modulation. Instead, the insulin pathway was involved in these changes. Flies lacking the insulin receptor (InR) did not respond to nutrient deprivation by increasing yeast consumption. Together these results show the importance of insulin in the regulation of yeast consumption in response to starvation in adult D. melanogaster males.
A Method of Visualizing Three-Dimensional Distribution of Yeast in Bread Dough
Maeda, Tatsurou; Do, Gab-Soo; Sugiyama, Junichi; Oguchi, Kosei; Shiraga, Seizaburou; Ueda, Mitsuyoshi; Takeya, Koji; Endo, Shigeru
A novel technique was developed to monitor the change in three-dimensional (3D) distribution of yeast in frozen bread dough samples in accordance with the progress of mixing process. Application of a surface engineering technology allowed the identification of yeast in bread dough by bonding EGFP (Enhanced Green Fluorescent Protein) to the surface of yeast cells. The fluorescent yeast (a biomarker) was recognized as bright spots at the wavelength of 520 nm. A Micro-Slicer Image Processing System (MSIPS) with a fluorescence microscope was utilized to acquire cross-sectional images of frozen dough samples sliced at intervals of 1 μm. A set of successive two-dimensional images was reconstructed to analyze 3D distribution of yeast. Samples were taken from each of four normal mixing stages (i.e., pick up, clean up, development, and final stages) and also from over mixing stage. In the pick up stage yeast distribution was uneven with local areas of dense yeast. As the mixing progressed from clean up to final stages, the yeast became more evenly distributed throughout the dough sample. However, the uniformity in yeast distribution was lost in the over mixing stage possibly due to the breakdown of gluten structure within the dough sample.
The making of biodiversity across the yeast subphyllum
Goals for this research project are to determine how the functional diversity of the yeast subphylum is encoded, and to reconstruct the history of yeasts to elucidate the tempo and mode of functional diversification. The impact of this work will be to integrate discoveries within broadly disseminate...
Yeast identification in routine clinical microbiology laboratory and its clinical relevance
Directory of Open Access Journals (Sweden)
S Agarwal
2011-01-01
Full Text Available Rapid identification of yeast infections is helpful in prompt appropriate antifungal therapy. In the present study, the usefulness of chromogenic medium, slide culture technique and Vitek2 Compact (V2C has been analysed. A total of 173 clinical isolates of yeast species were included in the study. An algorithm to identify such isolates in routine clinical microbiology laboratory was prepared and followed. Chromogenic medium was able to identify Candida albicans, C. tropicalis, C. krusei, C. parapsilosis and Trichosporon asahii. Chromogenic medium was also helpful in identifying "multi-species" yeast infections. The medium was unable to provide presumptive identification of C. pelliculosa, C. utilis, C. rugosa, C. glabrata and C. hemulonii. Vitek 2 compact (V2C differentiated all pseudohypae non-producing yeast species. The algorithm followed was helpful in timely presumptive identification and final diagnosis of yeast infections, including multi-species yeast infections.
Distribution of dimorphic yeast species in commercial extra virgin olive oil.
Zullo, B A; Cioccia, G; Ciafardini, G
2010-12-01
Recent microbiological research has demonstrated the presence of a rich microflora mainly composed of yeasts in the suspended fraction of freshly produced olive oil. Some of the yeasts are considered useful as they improve the organoleptic characteristics of the oil during preservation, whereas others are considered harmful as they can damage the quality of the oil through the hydrolysis of the triglycerides. However, some dimorphic species can also be found among the unwanted yeasts present in the oil, considered to be opportunistic pathogens to man as they have often been isolated from immunocompromised hospital patients. Present research demonstrates the presence of dimorphic yeast forms in 26% of the commercial extra virgin olive oil originating from different geographical areas, where the dimorphic yeasts are represented by 3-99.5% of the total yeasts. The classified isolates belonged to the opportunistic pathogen species Candida parapsilosis and Candida guilliermondii, while among the dimorphic yeasts considered not pathogenic to man, the Candida diddensiae species was highlighted for the first time in olive oil. The majority of the studied yeast strains resulted lipase positive, and can consequently negatively influence the oil quality through the hydrolysis of the triglycerides. Furthermore, all the strains showed a high level of affinity with some organic solvents and a differing production of biofilm in "vitro" corresponded to a greater or lesser hydrophobia of their cells. Laboratory trials indicated that the dimorphic yeasts studied are sensitive towards some components of the oil among which oleic acid, linoleic acid and triolein, whereas a less inhibiting effect was observed with tricaprilin or when the total polyphenols extracted from the oil were used. The observations carried out on a scanning electron microscope (SEM), demonstrated the production of long un-branched pseudohyphae in all the tested dimorphic yeasts when cultivated on nutrient
Phosphorylation site on yeast pyruvate dehydrogenase complex
International Nuclear Information System (INIS)
Uhlinger, D.J.
1986-01-01
The pyruvate dehydrogenase complex was purified to homogeneity from baker's yeast (Saccharomyces cerevisiae). Yeast cells were disrupted in a Manton-Gaulin laboratory homogenizer. The pyruvate dehydrogenase complex was purified by fractionation with polyethylene glycol, isoelectric precipitation, ultracentrifugation and chromatography on hydroxylapatite. Final purification of the yeast pyruvate dehydrogenase complex was achieved by cation-exchange high pressure liquid chromatography (HPLC). No endogenous pyruvate dehydrogenase kinase activity was detected during the purification. However, the yeast pyruvate dehydrogenase complex was phosphorylated and inactivated with purified pyruvate dehydrogenase kinase from bovine kidney. Tryptic digestion of the 32 P-labeled complex yielded a single phosphopeptide which was purified to homogeniety. The tryptic digest was subjected to chromatography on a C-18 reverse phase HPLC column with a linear gradient of acetonitrile. Radioactive fractions were pooled, concentrated, and subjected to anion-exchange HPLC. The column was developed with a linear gradient of ammonium acetate. Final purification of the phosphopeptide was achieved by chromatography on a C-18 reverse phase HPLC column developed with a linear gradient of acetonitrile. The amino acid sequence of the homogeneous peptide was determined by manual modified Edman degradation
Energy Technology Data Exchange (ETDEWEB)
Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)
2003-07-01
Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)
Steffen, K T; Hatakka, A; Hofrichter, M
2002-10-01
Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.
Selection of oleaginous yeasts for fatty acid production.
Lamers, Dennis; van Biezen, Nick; Martens, Dirk; Peters, Linda; van de Zilver, Eric; Jacobs-van Dreumel, Nicole; Wijffels, René H; Lokman, Christien
2016-05-27
Oleaginous yeast species are an alternative for the production of lipids or triacylglycerides (TAGs). These yeasts are usually non-pathogenic and able to store TAGs ranging from 20 % to 70 % of their cell mass depending on culture conditions. TAGs originating from oleaginous yeasts can be used as the so-called second generation biofuels, which are based on non-food competing "waste carbon sources". In this study the selection of potentially new interesting oleaginous yeast strains is described. Important selection criteria were: a broad maximum temperature and pH range for growth (robustness of the strain), a broad spectrum of carbon sources that can be metabolized (preferably including C-5 sugars), a high total fatty acid content in combination with a low glycogen content and genetic accessibility. Based on these selection criteria, among 24 screened species, Schwanniomyces occidentalis (Debaromyces occidentalis) CBS2864 was selected as a promising strain for the production of high amounts of lipids.
Metabolic engineering of yeast for lignocellulosic biofuel production.
Jin, Yong-Su; Cate, Jamie Hd
2017-12-01
Production of biofuels from lignocellulosic biomass remains an unsolved challenge in industrial biotechnology. Efforts to use yeast for conversion face the question of which host organism to use, counterbalancing the ease of genetic manipulation with the promise of robust industrial phenotypes. Saccharomyces cerevisiae remains the premier host for metabolic engineering of biofuel pathways, due to its many genetic, systems and synthetic biology tools. Numerous engineering strategies for expanding substrate ranges and diversifying products of S. cerevisiae have been developed. Other yeasts generally lack these tools, yet harbor superior phenotypes that could be exploited in the harsh processes required for lignocellulosic biofuel production. These include thermotolerance, resistance to toxic compounds generated during plant biomass deconstruction, and wider carbon consumption capabilities. Although promising, these yeasts have yet to be widely exploited. By contrast, oleaginous yeasts such as Yarrowia lipolytica capable of producing high titers of lipids are rapidly advancing in terms of the tools available for their metabolic manipulation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Esther Gamero-Sandemetrio
2018-01-01
Full Text Available Several yeast species, belonging to Saccharomyces and non-Saccharomyces genera, play fundamental roles during spontaneous must grape fermentation, and recent studies have shown that mixed fermentations, co-inoculated with S. cerevisiae and non-Saccharomyces strains, can improve wine organoleptic properties. During active dry yeast (ADY production, antioxidant systems play an essential role in yeast survival and vitality as both biomass propagation and dehydration cause cellular oxidative stress and negatively affect technological performance. Mechanisms for adaptation and resistance to desiccation have been described for S. cerevisiae, but no data are available on the physiology and oxidative stress response of non-Saccharomyces wine yeasts and their potential impact on ADY production. In this study we analyzed the oxidative stress response in several non-Saccharomyces yeast species by measuring the activity of reactive oxygen species (ROS scavenging enzymes, e.g., catalase and glutathione reductase, accumulation of protective metabolites, e.g., trehalose and reduced glutathione (GSH, and lipid and protein oxidation levels. Our data suggest that non-canonical regulation of glutathione and trehalose biosynthesis could cause poor fermentative performance after ADY production, as it corroborates the corrective effect of antioxidant treatments, during biomass propagation, with both pure chemicals and food-grade argan oil.
Immobilisation increases yeast cells' resistance to dehydration-rehydration treatment.
Borovikova, Diana; Rozenfelde, Linda; Pavlovska, Ilona; Rapoport, Alexander
2014-08-20
This study was performed with the goal of revealing if the dehydration procedure used in our new immobilisation method noticeably decreases the viability of yeast cells in immobilised preparations. Various yeasts were used in this research: Saccharomyces cerevisiae cells that were rather sensitive to dehydration and had been aerobically grown in an ethanol-containing medium, a recombinant strain of S. cerevisiae grown in aerobic conditions which were completely non-resistant to dehydration and an anaerobically grown bakers' yeast strain S. cerevisiae, as well as a fairly resistant Pichia pastoris strain. Experiments performed showed that immobilisation of all these strains essentially increased their resistance to a dehydration-rehydration treatment. The increase of cells' viability (compared with control cells dehydrated in similar conditions) was from 30 to 60%. It is concluded that a new immobilisation method, which includes a dehydration stage, does not lead to an essential loss of yeast cell viability. Correspondingly, there is no risk of losing the biotechnological activities of immobilised preparations. The possibility of producing dry, active yeast preparations is shown, for those strains that are very sensitive to dehydration and which can be used in biotechnology in an immobilised form. Finally, the immobilisation approach can be used for the development of efficient methods for the storage of recombinant yeast strains. Copyright © 2014 Elsevier B.V. All rights reserved.
Spent yeast as natural source of functional food additives
Rakowska, Rita; Sadowska, Anna; Dybkowska, Ewa; Świderski, Franciszek
Spent yeasts are by-products arising from beer and wine production which over many years have been chiefly used as feed additives for livestock. They contain many valuable and bioactive substances which has thereby generated much interest in their exploitation. Up till now, the main products obtained from beer-brewing yeasts are β-glucans and yeast extracts. Other like foodstuffs include dried brewer’s yeast, where this is dried and the bitterness removed to be fit for human consumption as well as mannan-oligosaccharides hitherto used in the feed industry. β-glucans constitute the building blocks of yeast cell walls and can thus be used in human nutrition as dietary supplements or serving as food additives in functional foods. β-glucans products obtained via post-fermentation of beer also exhibit a high and multi-faceted biological activity where they improve the blood’s lipid profile, enhance immunological status and have both prebiotic and anti-oxidant properties. Yeast extracts are currently being used more and more to enhance flavour in foodstuffs, particularly for meat and its products. Depending on how autolysis is carried out, it is possible to design extracts of various meat flavours characteristic of specific meats. Many different flavour profiles can be created which may be additionally increased in combination with vegetable extracts. Within the food market, yeast extracts can appear in various guises such as liquids, pastes or powders. They all contain significant amounts of glutamic acid, 5’-GMP and 5’-IMP nucleotides together with various amino acids and peptides that act synergistically for enhancing the flavour of foodstuff products. Recent studies have demonstrated additional benefits of yeast extracts as valuable sources of amino acids and peptides which can be used in functional foods and dietary supplements. These products possess GRAS status (Generally Recognised As Safe) which thereby also adds further as to why they should be used
Conversion of defective molasses into alcohol and yeasts
Energy Technology Data Exchange (ETDEWEB)
Luchev, S.
1966-01-01
The addition of small quantities (0.05 to 0.75%) of dried malt roots, green malt roots, green malt, yeast hydrolyzate, corn extraction, and tomato juice improved the quality and accelerated the brewing process in defective molasses. Dried malt roots and yeast hydrolyzate were the least expensive preparations.
Directory of Open Access Journals (Sweden)
Shiro Yamashoji
2017-03-01
Full Text Available Membrane permeant acetaldehyde and menadione induced the synergistic reduction of toluylene blue (TB acting as non-membrane permeant redox indicator in yeast cell suspension. NADH and acetaldehyde also induced the synergistic TB reduction in permeabilized yeast cells and phosphate buffer, but menadione had no ability to promote TB reduction. The pre-incubation of acetaldehyde inhibited the above synergistic reduction of TB in intact and permeabilized yeast cell suspension. The pre-incubation of acetaldehyde might promote NADH oxidation by alcohol dehydrogenase, because acetaldehyde decreased the intracellular NAD(PH concentration. The above facts indicate that the synergistic reduction of TB is controlled by the order of addition of menadione and acetaldehyde. The synergistic reduction of TB by menadione and acetaldehyde was proportional to viable yeast cell number from 104 to 2×106 cells/ml, and this assay was applicable to cytotoxicity test. The time required for the above assay was only 2 min.
Allen, Tom W; Burpee, Leon L; Buck, James W
2004-12-01
The ability of yeasts to attach to hyphae or conidia of phytopathogenic fungi has been speculated to contribute to biocontrol activity on plant surfaces. Attachment of phylloplane yeasts to Botrytis cinerea, Rhizoctonia solani, and Sclerotinia homoeocarpa was determined using in vitro attachment assays. Yeasts were incubated for 2 d on potato dextrose agar (PDA) prior to experimentation. A total of 292 yeasts cultured on PDA were screened for their ability to attach to conidia of B. cinerea; 260 isolates (89.1%) attached to conidia forming large aggregates of cells, and 22 isolates (7.5%) weakly attached to conidia with 1 or 2 yeast cells attached to a few conidia. Ten yeasts (3.4%), including 8 isolates of Cryptococcus laurentii, 1 isolate of Cryptococcus flavescens, and an unidentified species of Cryptococcus, failed to attach to conidia. All non-attaching yeasts produced copious extracellular polysaccharide (EPS) on PDA. Seventeen yeast isolates did not attach to hyphal fragments of B. cinerea, R. solani, and S. homoeocarpa after a 1 h incubation, but attachment was observed after 24 h. Culture medium, but not culture age, significantly affected the attachment of yeast cells to conidia of B. cinerea. The 10 yeast isolates that did not attach to conidia when grown on agar did attach to conidia (20%-57% of conidia with attached yeast cells) when cultured in liquid medium. Attachment of the biocontrol yeast Rhodotorula glutinis PM4 to conidia of B. cinerea was significantly greater at 1 x 10(7) yeast cells x mL(-1) than at lower concentrations of yeast cells. The ability of yeast cells to attach to fungal conidia or hyphae appears to be a common phenotype among phylloplane yeasts.
Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.
Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert
2016-01-01
Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard
Yeast Communities of Chestnut Soils under Vineyards in Dagestan
Abdullabekova, D. A.; Magomedova, E. S.; Magomedov, G. G.; Aliverdieva, D. A.; Kachalkin, A. V.
2017-12-01
The study of yeast communities in chestnut soils (Kastanozems) under vineyards in the Republic of Dagestan made it possible to isolate 20 yeast species. Most of the yeasts under vineyards belonged to ascomycetes, among which species of the Saccharomycetaceae family (in particular, Saccharomyces cerevisiae) comprised a significant part. The obtained results indicate that the soils under vineyards keep the pool of microbial diversity and ensure preservation of many species typical for grapes. The method of enrichment culture on grape juice medium proved to be more efficient than other methods of analysis with respect to the number of isolated species and the rate of their detection. However, implementation of different techniques to study yeasts' diversity can give somewhat different results; a set of methods should be used for an integrated analysis.
The Fermentative and Aromatic Ability of Kloeckera and Hanseniaspora Yeasts
Díaz-Montaño, Dulce M.; de Jesús Ramírez Córdova, J.
Spontaneous alcoholic fermentation from grape, agave and others musts into an alcoholic beverage is usually characterized by the presence of several non-Saccharomyces yeasts. These genera yeasts are dominant in the early stages of the alcoholic fermentation. However the genera Hanseniaspora and Kloeckera may survive at a significant level during fermentation and can influence the chemical composition of the beverage. Several strains belonging to the species Kloeckera api-culata and Hanseniaspora guilliermondii have been extensively studied in relation to the formation of some metabolic compounds affecting the bouquet of the final product. Indeed some apiculate yeast showed positive oenological properties and their use in the alcoholic fermentations has been suggested to enhance the aroma and flavor profiles. The non- Saccharomyces yeasts have the capability to produce and secrete enzymes in the medium, such as β -glucosidases, which release monoterpenes derived from their glycosylated form. These compounds contribute to the higher fruit-like characteristic of final product. This chapter reviews metabolic activity of Kloeckera and Hanseniaspora yeasts in several aspects: fermentative capability, aromatic compounds production and transformation of aromatic precursor present in the must, also covers the molecular methods for identifying of the yeast
Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure
Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.
2014-05-01
Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.
Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production
Directory of Open Access Journals (Sweden)
Popov Stevan D.
2005-01-01
Full Text Available The waste brewer's yeast S. cerevisiae (activated and non-activated was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positively the quality of produced bread regarding bread volume. The volume of developed gas in dough prepared with the use of non-activated BY was not sufficient, therefore, it should not be used as fermentation agent, but only as an additive in bread production process for bread freshness preservation. Intense mixing of dough results in more compressible crumb 48 hrs after baking compared to high-speed mixing.
Occurrence and identification of yeast species in fermented liquid feed for piglets
DEFF Research Database (Denmark)
Gori, Klaus; Bjørklund, Marina Kryger; Canibe, Nuria
2011-01-01
The major objective of the present study was to investigate the occurrence and identity of yeast species in fermented liquid feed (FLF) used for feeding piglets. In total, 40 different Danish farms were included in the analysis. The preparation and composition of FLF was found to be very...... heterogeneous with high variations in both yeast counts and yeast species composition. The yeast population varied between 6.0 × 10(3) and 4.2 × 10(7) cfug(-1) with an average yeast count of 8.7 × 10(6) ± 1.1 × 10(7) cfug(-1). A total of 766 yeasts were isolated and identified by conventional and/or molecular...... typing techniques. The predominant yeast species in the FLF samples were found to be Candida milleri (58.4%), Kazachstania exigua (17.5%), Candida pararugosa (6.40%) and Kazachstania bulderi (5.09%). No clear separation between isolates of C. milleri and Candida humilis could be obtained based...
Biofuels. Altered sterol composition renders yeast thermotolerant
DEFF Research Database (Denmark)
Caspeta, Luis; Chen, Yun; Ghiaci, Payam
2014-01-01
adaptive laboratory evolution to select yeast strains with improved growth and ethanol production at ≥40°C. Sequencing of the whole genome, genome-wide gene expression, and metabolic-flux analyses revealed a change in sterol composition, from ergosterol to fecosterol, caused by mutations in the C-5 sterol......Ethanol production for use as a biofuel is mainly achieved through simultaneous saccharification and fermentation by yeast. Operating at ≥40°C would be beneficial in terms of increasing efficiency of the process and reducing costs, but yeast does not grow efficiently at those temperatures. We used...... desaturase gene, and increased expression of genes involved in sterol biosynthesis. Additionally, large chromosome III rearrangements and mutations in genes associated with DNA damage and respiration were found, but contributed less to the thermotolerant phenotype....
Conditions of activation of yeast plasma membrane ATPase.
Sychrová, H; Kotyk, A
1985-04-08
The in vivo activation of the H+-ATPase of baker's yeast plasma membrane found by Serrano in 1983 was demonstrated with D-glucose aerobically and anaerobically (as well as in a respiration-deficient mutant) and, after suitable induction, with maltose, trehalose, and galactose. The activated but not the control ATPase was sensitive to oligomycin. No activation was possible in a cell-free extract with added glucose. The ATPase was not activated in yeast protoplasts which may account for the absence of glucose-stimulated secondary active transports in these wall-less cells and provide support for a microscopic coupling between ATPase activity and these transports in yeast cells.
Co-fermentation of glucose, xylose and/or cellobiose by yeast
Jeffries, Thomas W.; Willis, Laura B.; Long, Tanya M.; Su, Yi-Kai
2013-09-10
Provided herein are methods of using yeast cells to produce ethanol by contacting a mixture comprising xylose with a Spathaspora yeast cell under conditions suitable to allow the yeast to ferment at least a portion of the xylose to ethanol. The methods allow for efficient ethanol production from hydrolysates derived from lignocellulosic material and sugar mixtures including at least xylose and glucose or xylose, glucose and cellobiose.
Probiotic properties of yeasts occurring in fermented food and beverages
DEFF Research Database (Denmark)
Jespersen, Lene
Besides being able to improve the quality and safety of many fermented food and beverages some yeasts offer a number of probiotic traits. Especially a group of yeast referred to as "Saccharomyces boulardii", though taxonomically belonging to Saccharomyces cerevisiae, has been claimed to have...... probiotic properties. Besides, yeasts naturally occurring globally in food and beverages will have traits that might have a positive impact on human health....
Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.
Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A
2017-02-01
Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Polysome Profile Analysis - Yeast
Czech Academy of Sciences Publication Activity Database
Pospíšek, M.; Valášek, Leoš Shivaya
2013-01-01
Roč. 530, č. 2013 (2013), s. 173-181 ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013
Yeast prions: structure, biology, and prion-handling systems.
Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E
2015-03-01
A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Microbial terroir in Chilean valleys: Diversity of non-conventional yeast
Directory of Open Access Journals (Sweden)
Carla eJara
2016-05-01
Full Text Available In this study, the presence of non-conventional yeast associated with vineyards located between latitudes 30ºS and 36ºS was examined, including the valleys of Limarí, Casablanca, Maipo, Colchagua, Maule and Itata. The microbial fingerprinting in each valley was examined based on the specific quantification of yeast of enological interest. Grape berries were sampled to evaluate the presence and load of non-conventional yeast with enological potential, such as Metschnikowia, Hanseniaspora, Torulaspora, Debaryomyces, Meyerozyma and Rhodotorula. These yeasts were present in all vineyards studied but with varying loads depending on the valley sampled. No identical fingerprints were observed; however, similarities and differences could be observed among the microbial profiles of each valley. A co-variation in the loads of Metschnikowia and Hanseniaspora with latitude was observed, showing high loads in the Casablanca and Itata valleys, which was coincident with the higher relative humidity or rainfall of those areas. Non-conventional yeasts were also isolated and identified after sequencing molecular markers. Potentially good aromatic properties were also screened among the isolates, resulting in the selection of mostly Metschnikowia and Hanseniaspora isolates. Finally, our results suggest that microbial terroir might be affected by climatic conditions such as relative humidity and rainfall, especially impacting the load of non-conventional yeast. In this study, the microbial fingerprint for yeast in Chilean vineyards is reported for the first time revealing an opportunity to study the contribution of this assembly of microorganisms to the final product.
Yeast Interacting Proteins Database: YFR015C, YJL137C [Yeast Interacting Proteins Database
Lifescience Database Archive (English)
Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...pression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary
Yeast 5 – an expanded reconstruction of the Saccharomyces cerevisiae metabolic network
Directory of Open Access Journals (Sweden)
Heavner Benjamin D
2012-06-01
Full Text Available Abstract Background Efforts to improve the computational reconstruction of the Saccharomyces cerevisiae biochemical reaction network and to refine the stoichiometrically constrained metabolic models that can be derived from such a reconstruction have continued since the first stoichiometrically constrained yeast genome scale metabolic model was published in 2003. Continuing this ongoing process, we have constructed an update to the Yeast Consensus Reconstruction, Yeast 5. The Yeast Consensus Reconstruction is a product of efforts to forge a community-based reconstruction emphasizing standards compliance and biochemical accuracy via evidence-based selection of reactions. It draws upon models published by a variety of independent research groups as well as information obtained from biochemical databases and primary literature. Results Yeast 5 refines the biochemical reactions included in the reconstruction, particularly reactions involved in sphingolipid metabolism; updates gene-reaction annotations; and emphasizes the distinction between reconstruction and stoichiometrically constrained model. Although it was not a primary goal, this update also improves the accuracy of model prediction of viability and auxotrophy phenotypes and increases the number of epistatic interactions. This update maintains an emphasis on standards compliance, unambiguous metabolite naming, and computer-readable annotations available through a structured document format. Additionally, we have developed MATLAB scripts to evaluate the model’s predictive accuracy and to demonstrate basic model applications such as simulating aerobic and anaerobic growth. These scripts, which provide an independent tool for evaluating the performance of various stoichiometrically constrained yeast metabolic models using flux balance analysis, are included as Additional files 1, 2 and 3. Additional file 1 Function testYeastModel.m.m. Click here for file Additional file 2 Function model
Determination of tritium in wine yeast samples
International Nuclear Information System (INIS)
Cotarlea, Monica-Ionela; Paunescu Niculina; Galeriu, D; Mocanu, N.; Margineanu, R.; Marin, G.
1998-01-01
Analytical procedures were developed to determine tritium in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractioning distillation for wine samples and azeotropic distillation/fractional distillation for wine yeast samples. Finally, the water samples were normally distilled with K MO 4 . The established procedures were successfully applied for wine and wine samples from Murfatlar harvests of the years 1995 and 1996. (authors)
Solving ethanol production problems with genetically modified yeast strains
Directory of Open Access Journals (Sweden)
A. Abreu-Cavalheiro
2013-09-01
Full Text Available The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.
Solving ethanol production problems with genetically modified yeast strains.
Abreu-Cavalheiro, A; Monteiro, G
2013-01-01
The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.
Characterization of the interaction of yeast enolase with polynucleotides.
al-Giery, A G; Brewer, J M
1992-09-23
Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.
Dietary glucose regulates yeast consumption in adult Drosophila males
Directory of Open Access Journals (Sweden)
Sebastien eLebreton
2014-12-01
Full Text Available The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies stopped feeding after having access to a nutritive cornmeal diet. Interestingly, dietary glucose was equally efficient as the complex cornmeal diet. In contrast, flies fed with sucralose, a non-metabolizable sweetener, behaved as if they were starved. The adipokinetic hormone and insulin-like peptides regulate metabolic processes in insects. We did not find any effect of the adipokinetic hormone pathway on this modulation. Instead, the insulin pathway was involved in these changes. Flies lacking the insulin receptor did not respond to nutrient deprivation by increasing yeast consumption. Together these results show the importance of insulin in the regulation of yeast consumption in response to starvation in adult D. melanogaster males.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Recent advances in the genome-wide study of DNA replication origins in yeast
Peng, Chong; Luo, Hao; Zhang, Xi; Gao, Feng
2015-01-01
DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs). Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genomes. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some non-conventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve yeast replication origins prediction. PMID:25745419
Genetically modified yeast species, and fermentation processes using genetically modified yeast
Energy Technology Data Exchange (ETDEWEB)
Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI
2014-01-07
Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.
Production of yeast extract from whey using Kluyveromyces marxianus
Directory of Open Access Journals (Sweden)
Revillion Jean P. de Palma
2003-01-01
Full Text Available The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide rich extract with K. marxianus.
[Antivirus effect of polysaccharides of brewer yeast in vitro].
Li, F; Shi, Y; Guan, X; Zhang, S; Tian, T
1998-03-01
The antivirus effect of polysaccharides of brewer yeast from yeast mud on 13 kinds of viruses including DNA and RNA virus along with their mechanisms were studied. The result showed that this effect was remarkable on the infections with poliovirus III, adenovirus III, ECHO6 virus, enterovirus 71, vesicular stomatitis virus, herpesvirus I, II, coxsackie A16 virus and coxsackie B3 virus. The polysaccharides of brewer yeast could also inhibit the development of cytopathic effect(CPE) and protect cultural cells from being infected with the above viruses.
Growth of the mycelium of different basidiomycetes on various media
International Nuclear Information System (INIS)
Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.
2008-01-01
Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)
Cadmium, ATPase-P, yeast. From transport to toxicity
International Nuclear Information System (INIS)
Gardarin, Aurelie
2007-01-01
Two projects has been developed during my PhD. One consisting in the functional study of CadA, the Cd 2+ -ATPase from Listeria monocytogenes, the other one was focused on the toxicity of cadmium and the associated response of the yeast Saccharomyces cerevisiae. This two studies used a a phenotype of sensitivity to cadmium induced by CadA expression in yeast. This phenotype was used as a screening tool to identify essential amino acids of Cd transport by CadA and to study cadmium toxicity and the corresponding yeast cellular response. CadA actively transports Cd using ATP hydrolysis as energy source. Directed mutagenesis of the membranous polar, sulphur and charged amino-acids revealed that Cd transport pathway implied four transmembrane segments (Tm) and more precisely the cysteine C 354 , C 356 and proline P 355 of the CPC motif located in Tm6, aspartate D 692 in Tm8, glutamate E 164 in Tm4 and methionine M 149 in Tm5. From our studies, 2 Cd ions would be translocated for each hydrolysis ATP. Expression of CadA in the yeast Saccharomyces cerevisiae induces an hypersensitivity to Cd. A wild type cell can grow up to 100 μm cadmium whereas CadA expressing yeast cannot grow with 1 μm cadmium in the culture medium. This cadmium sensitivity was due to the localisation of CadA in the endoplasmic reticulum membrane. Transport of cadmium in this compartment produces an accumulation of mis-folded proteins that induces the Unfolded Protein Response (UPR). As UPR also occurs in a wild type yeast exposed to low Cd concentration, one can point out endoplasmic reticulum as a extremely sensitive cellular compartment. UPR also appears as an early response to Cd as it happens far before any visible signs of toxicity. (author) [fr
Lifescience Database Archive (English)
Full Text Available y are in the reverse direction. *1 A comprehensive two-hybrid analysis to explore the yeast protein interact...s. 2000 Jan 1;28(1):73-6. *2 The yeast proteome database (YPD) and Caenorhabditis elegans proteome database (WormPD): comprehensive...000 Jan 1;28(1):73-6. *3 A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisia
[Urinary infection by Saccharomyces cerevisiae: Emerging yeast?].
Elkhihal, B; Elhalimi, M; Ghfir, B; Mostachi, A; Lyagoubi, M; Aoufi, S
2015-12-01
Saccharomyces cerevisiae is a commensal yeast of the digestive, respiratory and genito-urinary tract. It is widely used as a probiotic for the treatment of post-antibiotic diarrhea. It most often occurs in immunocompromised patients frequently causing fungemia. We report the case of an adult diabetic patient who had a urinary tract infection due to S. cerevisiae. The disease started with urination associated with urinary frequency burns without fever. The diagnosis was established by the presence of yeasts on direct examination and positivity of culture on Sabouraud-chloramphenicol three times. The auxanogramme gallery (Auxacolor BioRad(®)) allowed the identification of S. cerevisiae. The patient was put on fluconazole with good outcome. This observation points out that this is an opportunistic yeast in immunocompromised patients. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Adding Flavor to Beverages with Non-Conventional Yeasts
Directory of Open Access Journals (Sweden)
Davide Ravasio
2018-02-01
Full Text Available Fungi produce a variety of volatile organic compounds (VOCs during their primary and secondary metabolism. In the beverage industry, these volatiles contribute to the the flavor and aroma profile of the final products. We evaluated the fermentation ability and aroma profiles of non-conventional yeasts that have been associated with various food sources. A total of 60 strains were analyzed with regard to their fermentation and flavor profile. Species belonging to the genera Candida, Pichia and Wickerhamomyces separated best from lager yeast strains according to a principal component analysis taking alcohol and ester production into account. The speed of fermentation and sugar utilization were analysed for these strains. Volatile aroma-compound formation was assayed via gas chromatography. Several strains produced substantially higher amounts of aroma alcohols and esters compared to the lager yeast strain Weihenstephan 34/70. Consequently, co-fermentation of this lager yeast strain with a Wickerhamomyces anomalus strain generated an increased fruity-flavour profile. This demonstrates that mixed fermentations utilizing non-Saccharomyces cerevisiae biodiversity can enhance the flavour profiles of fermented beverages.
Studies of Saccharomyces cerevisiae and Non-Saccharomyces Yeasts during Alcoholic Fermentation
DEFF Research Database (Denmark)
Kemsawasd, Varongsiri
The early death of non-Saccharomyces yeasts during mixed culture spontaneous wine fermentation has traditionally been attributed to the lower capacity of these yeast species to withstand high levels of ethanol, low pH, and other media properties that are a part of progressing fermentation. However......, other yeast-yeast interactions, such as cell-cell contact mediated growth arrest and/or toxininduced death may also be a significant factor in the relative fragility of these non-Saccharomyces yeasts in mixed culture fermentation. In the present work we evaluate the combined roles of cell-cell contact...... and/or antimicrobial peptides on the early death of Lachancea thermotolerans during mixed culture fermentations with Saccharomyces cerevisiae. Using a specially designed double compartment fermentation system, we established that both cell-to-cell contact and antimicrobial peptides contribute...
Fission yeast mating-type switching: programmed damage and repair
DEFF Research Database (Denmark)
Egel, Richard
2005-01-01
Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...
The Slime Production by Yeasts Isolated from Subclinical Mastitic Cows
Directory of Open Access Journals (Sweden)
Süheyla Türkyılmaz
2010-01-01
Full Text Available The aim of this study was to isolate yeasts from subclinical mastitic cows and to investigate the slime production by the isolated yeasts. The material used in this study included 339 milk samples from 152 dairy cattle with subclinical mastitis. Milk was plated onto blood agar, MacConkey agar and Sabouraud dextrose agar. Forty-one samples (12.1% of total milk samples were found positive for the yeast by API 20 C AUX identification system. The isolated yeasts were classified into four genera of Candida, Trichosporon, Cryptococcus and Saccharomyces. The Candida species were following: C. krusei, C. kefyr, C. guilliermondii, C. famata, C. rugosa and C. utulis. Other yeasts were identified as Trichosporon mucoides, T. asahii, Cryptococcus laurentii, C. neoformans and Saccharomyces cerevisiae. Slime production was tested on Congo red brain heart infusion agar and evaluated according to Congo red phenomenon. Fifteen (36.6% strains were slime factor positive: seven were C. krusei, four C. kefyr, one C. guilliermondii, one C. famata, one T. asahii, and one C. laurentii. The results of the present study indicate that yeast mastitis is significant for causing economic losses and slime production is mostly found in non-albicans Candida species. Therefore, non-albicans Candida species should be examined for slime production.
Synthetic genome engineering forging new frontiers for wine yeast.
Pretorius, Isak S
2017-02-01
Over the past 15 years, the seismic shifts caused by the convergence of biomolecular, chemical, physical, mathematical, and computational sciences alongside cutting-edge developments in information technology and engineering have erupted into a new field of scientific endeavor dubbed Synthetic Biology. Recent rapid advances in high-throughput DNA sequencing and DNA synthesis techniques are enabling the design and construction of new biological parts (genes), devices (gene networks) and modules (biosynthetic pathways), and the redesign of biological systems (cells and organisms) for useful purposes. In 2014, the budding yeast Saccharomyces cerevisiae became the first eukaryotic cell to be equipped with a fully functional synthetic chromosome. This was achieved following the synthesis of the first viral (poliovirus in 2002 and bacteriophage Phi-X174 in 2003) and bacterial (Mycoplasma genitalium in 2008 and Mycoplasma mycoides in 2010) genomes, and less than two decades after revealing the full genome sequence of a laboratory (S288c in 1996) and wine (AWRI1631 in 2008) yeast strain. A large international project - the Synthetic Yeast Genome (Sc2.0) Project - is now underway to synthesize all 16 chromosomes (∼12 Mb carrying ∼6000 genes) of the sequenced S288c laboratory strain by 2018. If successful, S. cerevisiae will become the first eukaryote to cross the horizon of in silico design of complex cells through de novo synthesis, reshuffling, and editing of genomes. In the meantime, yeasts are being used as cell factories for the semi-synthetic production of high-value compounds, such as the potent antimalarial artemisinin, and food ingredients, such as resveratrol, vanillin, stevia, nootkatone, and saffron. As a continuum of previously genetically engineered industrially important yeast strains, precision genome engineering is bound to also impact the study and development of wine yeast strains supercharged with synthetic DNA. The first taste of what the future
Transcriptional Waves in the Yeast Cell Cycle
Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve; Futcher, Bruce; Leatherwood, Janet
2005-01-01
Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillat...
Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species
Marol Serhat; Yücesoy Mine
2003-01-01
Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...
Yeast replicative aging: a paradigm for defining conserved longevity interventions
Wasko, Brian M.; Kaeberlein, Matt
2013-01-01
The finite replicative life span of budding yeast mother cells was demonstrated as early as 1959, but the idea that budding yeast could be used to model aging of multicellular eukaryotes did not enter the scientific mainstream until relatively recently. Despite continued skepticism by some, there are now abundant data that several interventions capable of extending yeast replicative life span have a similar effect in multicellular eukaryotes including nematode worms, fruit flies, and rodents....
Genetically modified yeast species, and fermentation processes using genetically modified yeast
Energy Technology Data Exchange (ETDEWEB)
Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura
2017-09-12
Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.
Genetically modified yeast species, and fermentation processes using genetically modified yeast
Energy Technology Data Exchange (ETDEWEB)
Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura
2016-08-09
Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.
Genetically modified yeast species and fermentation processes using genetically modified yeast
Energy Technology Data Exchange (ETDEWEB)
Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI
2011-05-17
Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.
Genetically modified yeast species and fermentation processes using genetically modified yeast
Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI
2011-05-17
Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.
Genetically modified yeast species, and fermentation processes using genetically modified yeast
Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura
2013-05-14
Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.
Yeast biofilm colony as an orchestrated multicellular organism
Czech Academy of Sciences Publication Activity Database
Šťovíček, V.; Váchová, Libuše; Palková, Zdena
2012-01-01
Roč. 5, č. 2 (2012), s. 203-205 ISSN 1942-0889 R&D Projects: GA ČR GA204/08/0718; GA MŠk(CZ) LC531 Grant - others:GA MŠk(CZ) LC06063 Program:LC Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast biofilm * yeast cell Subject RIV: EE - Microbiology, Virology
Non-conventional yeast species for lowering ethanol content of wines
Directory of Open Access Journals (Sweden)
Maurizio eCiani
2016-05-01
Full Text Available Rising sugar content in grape must, and the concomitant increase in alcohol levels in wine, are some of the main challenges affecting the winemaking industry nowadays. Among the several alternative solutions currently under study, the use of non-conventional yeasts during fermentation holds good promise for contributing to relieve this problem. Non-Saccharomyces wine yeast species comprise a high number or species, so encompassing a wider physiological diversity than Saccharomyces cerevisiae. Indeed, the current oenological interest of these microorganisms was initially triggered by their potential positive contribution to the sensorial complexity of quality wines, through the production of aroma and other sensory-active compounds. This diversity also involves ethanol yield on sugar, one of the most invariant metabolic traits of S. cerevisiae. This review gathers recent research on non-Saccharomyces yeasts, aiming to produce wines with lower alcohol content than those from pure Saccharomyces starters. Critical aspects discussed include the selection of suitable yeast strains (considering there is a noticeable intra-species diversity for ethanol yield, as shown for other fermentation traits, identification of key environmental parameters influencing ethanol yields (including the use of controlled oxygenation conditions, and managing mixed fermentations, by either the sequential or simultaneous inoculation of S. cerevisiae and non-Saccharomyces starter cultures. The feasibility, at the industrial level, of using non-Saccharomyces yeasts for reducing alcohol levels in wine will require an improved understanding of the metabolism of these alternative yeast species, as well as of the interactions between different yeast starters during the fermentation of grape must.
Non-conventional Yeast Species for Lowering Ethanol Content of Wines
Ciani, Maurizio; Morales, Pilar; Comitini, Francesca; Tronchoni, Jordi; Canonico, Laura; Curiel, José A.; Oro, Lucia; Rodrigues, Alda J.; Gonzalez, Ramon
2016-01-01
Rising sugar content in grape must, and the concomitant increase in alcohol levels in wine, are some of the main challenges affecting the winemaking industry nowadays. Among the several alternative solutions currently under study, the use of non-conventional yeasts during fermentation holds good promise for contributing to relieve this problem. Non-Saccharomyces wine yeast species comprise a high number or species, so encompassing a wider physiological diversity than Saccharomyces cerevisiae. Indeed, the current oenological interest of these microorganisms was initially triggered by their potential positive contribution to the sensorial complexity of quality wines, through the production of aroma and other sensory-active compounds. This diversity also involves ethanol yield on sugar, one of the most invariant metabolic traits of S. cerevisiae. This review gathers recent research on non-Saccharomyces yeasts, aiming to produce wines with lower alcohol content than those from pure Saccharomyces starters. Critical aspects discussed include the selection of suitable yeast strains (considering there is a noticeable intra-species diversity for ethanol yield, as shown for other fermentation traits), identification of key environmental parameters influencing ethanol yields (including the use of controlled oxygenation conditions), and managing mixed fermentations, by either the sequential or simultaneous inoculation of S. cerevisiae and non-Saccharomyces starter cultures. The feasibility, at the industrial level, of using non-Saccharomyces yeasts for reducing alcohol levels in wine will require an improved understanding of the metabolism of these alternative yeast species, as well as of the interactions between different yeast starters during the fermentation of grape must. PMID:27199967
Kitagaki, Hiroshi; Kitamoto, Katsuhiko
2013-01-01
Sake is an alcoholic beverage of Japan, with a tradition lasting more than 1,300 years; it is produced from rice and water by fermenting with the koji mold Aspergillus oryzae and sake yeast Saccharomyces cerevisiae. Breeding research on sake yeasts was originally developed in Japan by incorporating microbiological and genetic research methodologies adopted in other scientific areas. Since the advent of a genetic paradigm, isolation of yeast mutants has been a dominant approach for the breeding of favorable sake yeasts. These sake yeasts include (a) those that do not form foams (produced by isolating a mutant that does not stick to foams, thus decreasing the cost of sake production); (b) those that do not produce urea, which leads to the formation of ethyl carbamate, a possible carcinogen (isolated by positive selection in a canavanine-, arginine-, and ornithine-containing medium); (c) those that produce an increased amount of ethyl caproate, an apple-like flavor (produced by isolating a mutant resistant to cerulenin, an inhibitor of fatty-acid synthesis); and (d) those that produce a decreased amount of pyruvate (produced by isolating a mutant resistant to an inhibitor of mitochondrial transport, thus decreasing the amount of diacetyl). Given that sake yeasts perform sexual reproduction, sporulation and mating are potent approaches for their breeding. Recently, the genome sequences of sake yeasts have been determined and made publicly accessible. By utilizing this information, the quantitative trait loci (QTLs) for the brewing characteristics of sake yeasts have been identified, which paves a way to DNA marker-assisted selection of the mated strains. Genetic engineering technologies for experimental yeast strains have recently been established by academic groups, and these technologies have also been applied to the breeding of sake yeasts. Sake yeasts whose genomes have been modified with these technologies correspond to genetically modified organisms (GMOs
Metabolic engineering of yeast for fermentative production of flavonoids
DEFF Research Database (Denmark)
Rodriguez Prado, Edith Angelica; Strucko, Tomas; Stahlhut, Steen Gustav
2017-01-01
Yeast Saccharomyces cerevisiae was engineered for de novo production of six different flavonoids (naringenin, liquiritigenin, kaempferol, resokaempferol, quercetin, and fisetin) directly from glucose, without supplementation of expensive intermediates. This required reconstruction of long...... demonstrates the potential of flavonoid-producing yeast cell factories....
Performance of baker's yeast produced using date syrup substrate ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... evaluate the effect of using Baker's yeast produced using date syrup as .... Gas production power (ml/20g dough) for baker's yeasts (LSD Test*). Incubation ... Brain (2005) indicated that a falling number value of 350 s or longer ...
Biodiversity of Yeasts During Plum Wegierka Zwykla Spontaneous Fermentation
Directory of Open Access Journals (Sweden)
Tadeusz Tuszynski
2005-01-01
Full Text Available The study comprises an analysis of the yeast microbiota that participated in the spontaneous fermentation of crushed Wegierka Zwykla plum fruit, which is the raw material for slivovitz production in the mountain region in the south of Poland. Saccharomyces cerevisiae yeast strains were differentiated by means of the killer sensitivity analysis related to a killer reference panel of 9 well-known killer yeast strains. The first phase of the fermentation was dominated by the representatives of Kloeckera apiculata and Candida pulcherrima species, which reached their maximum concentration (1.4·106 CFU/mL after 48 h of the process. Almost all yeasts isolated during the following days were classified as S. cerevisiae and the killer sensitivity analysis revealed a high population diversity of this species and the presence of 14 different strains that changed quantitatively and qualitatively throughout the fermentation period.
Divergence of iron metabolism in wild Malaysian yeast.
Lee, Hana N; Mostovoy, Yulia; Hsu, Tiffany Y; Chang, Amanda H; Brem, Rachel B
2013-12-09
Comparative genomic studies have reported widespread variation in levels of gene expression within and between species. Using these data to infer organism-level trait divergence has proven to be a key challenge in the field. We have used a wild Malaysian population of S. cerevisiae as a test bed in the search to predict and validate trait differences based on observations of regulatory variation. Malaysian yeast, when cultured in standard medium, activated regulatory programs that protect cells from the toxic effects of high iron. Malaysian yeast also showed a hyperactive regulatory response during culture in the presence of excess iron and had a unique growth defect in conditions of high iron. Molecular validation experiments pinpointed the iron metabolism factors AFT1, CCC1, and YAP5 as contributors to these molecular and cellular phenotypes; in genome-scale sequence analyses, a suite of iron toxicity response genes showed evidence for rapid protein evolution in Malaysian yeast. Our findings support a model in which iron metabolism has diverged in Malaysian yeast as a consequence of a change in selective pressure, with Malaysian alleles shifting the dynamic range of iron response to low-iron concentrations and weakening resistance to extreme iron toxicity. By dissecting the iron scarcity specialist behavior of Malaysian yeast, our work highlights the power of expression divergence as a signpost for biologically and evolutionarily relevant variation at the organismal level. Interpreting the phenotypic relevance of gene expression variation is one of the primary challenges of modern genomics.
Phenotypic and metabolic traits of commercial Saccharomyces cerevisiae yeasts.
Barbosa, Catarina; Lage, Patrícia; Vilela, Alice; Mendes-Faia, Arlete; Mendes-Ferreira, Ana
2014-01-01
Currently, pursuing yeast strains that display both a high potential fitness for alcoholic fermentation and a favorable impact on quality is a major goal in the alcoholic beverage industry. This considerable industrial interest has led to many studies characterizing the phenotypic and metabolic traits of commercial yeast populations. In this study, 20 Saccharomyces cerevisiae strains from different geographical origins exhibited high phenotypic diversity when their response to nine biotechnologically relevant conditions was examined. Next, the fermentation fitness and metabolic traits of eight selected strains with a unique phenotypic profile were evaluated in a high-sugar synthetic medium under two nitrogen regimes. Although the strains exhibited significant differences in nitrogen requirements and utilization rates, a direct relationship between nitrogen consumption, specific growth rate, cell biomass, cell viability, acetic acid and glycerol formation was only observed under high-nitrogen conditions. In contrast, the strains produced more succinic acid under the low-nitrogen regime, and a direct relationship with the final cell biomass was established. Glucose and fructose utilization patterns depended on both yeast strain and nitrogen availability. For low-nitrogen fermentation, three strains did not fully degrade the fructose. This study validates phenotypic and metabolic diversity among commercial wine yeasts and contributes new findings on the relationship between nitrogen availability, yeast cell growth and sugar utilization. We suggest that measuring nitrogen during the stationary growth phase is important because yeast cells fermentative activity is not exclusively related to population size, as previously assumed, but it is also related to the quantity of nitrogen consumed during this growth phase.
Borovikova, Diana; Teparić, Renata; Mrša, Vladimir; Rapoport, Alexander
2016-08-01
The state of anhydrobiosis is linked with the reversible delay of metabolism as a result of strong dehydration of cells, and is widely distributed in nature. A number of factors responsible for the maintenance of organisms' viability in these conditions have been revealed. This study was directed to understanding how changes in cell wall structure may influence the resistance of yeasts to dehydration-rehydration. Mutants lacking various cell wall mannoproteins were tested to address this issue. It was revealed that mutants lacking proteins belonging to two structurally and functionally unrelated groups (proteins non-covalently attached to the cell wall, and Pir proteins) possessed significantly lower cell resistance to dehydration-rehydration than the mother wild-type strain. At the same time, the absence of the GPI-anchored cell wall protein Ccw12 unexpectedly resulted in an increase of cell resistance to this treatment; this phenomenon is explained by the compensatory synthesis of chitin. The results clearly indicate that the cell wall structure/composition relates to parameters strongly influencing yeast viability during the processes of dehydration-rehydration, and that damage to cell wall proteins during yeast desiccation can be an important factor leading to cell death. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
An engineered yeast efficiently secreting penicillin.
Directory of Open Access Journals (Sweden)
Loknath Gidijala
Full Text Available This study aimed at developing an alternative host for the production of penicillin (PEN. As yet, the industrial production of this beta-lactam antibiotic is confined to the filamentous fungus Penicillium chrysogenum. As such, the yeast Hansenula polymorpha, a recognized producer of pharmaceuticals, represents an attractive alternative. Introduction of the P. chrysogenum gene encoding the non-ribosomal peptide synthetase (NRPS delta-(L-alpha-aminoadipyl-L-cysteinyl-D-valine synthetase (ACVS in H. polymorpha, resulted in the production of active ACVS enzyme, when co-expressed with the Bacillus subtilis sfp gene encoding a phosphopantetheinyl transferase that activated ACVS. This represents the first example of the functional expression of a non-ribosomal peptide synthetase in yeast. Co-expression with the P. chrysogenum genes encoding the cytosolic enzyme isopenicillin N synthase as well as the two peroxisomal enzymes isopenicillin N acyl transferase (IAT and phenylacetyl CoA ligase (PCL resulted in production of biologically active PEN, which was efficiently secreted. The amount of secreted PEN was similar to that produced by the original P. chrysogenum NRRL1951 strain (approx. 1 mg/L. PEN production was decreased over two-fold in a yeast strain lacking peroxisomes, indicating that the peroxisomal localization of IAT and PCL is important for efficient PEN production. The breakthroughs of this work enable exploration of new yeast-based cell factories for the production of (novel beta-lactam antibiotics as well as other natural and semi-synthetic peptides (e.g. immunosuppressive and cytostatic agents, whose production involves NRPS's.
An original method for producing acetaldehyde and diacetyl by yeast fermentation
Directory of Open Access Journals (Sweden)
Irina Rosca
Full Text Available Abstract In this study a natural culture medium that mimics the synthetic yeast peptone glucose medium used for yeast fermentations was designed to screen and select yeasts capable of producing high levels of diacetyl and acetaldehyde. The presence of whey powder and sodium citrate in the medium along with manganese and magnesium sulfate enhanced both biomass and aroma development. A total of 52 yeasts strains were cultivated in two different culture media, namely, yeast peptone glucose medium and yeast acetaldehyde-diacetyl medium. The initial screening of the strains was based on the qualitative reaction of the acetaldehyde with Schiff's reagent (violet color and diacetyl with Brady's reagent (yellow precipitate. The fermented culture media of 10 yeast strains were subsequently analyzed by gas chromatography to quantify the concentration of acetaldehyde and diacetyl synthesized. Total titratable acidity values indicated that a total titratable acidity of 5.5 °SH, implying culture medium at basic pH, was more favorable for the acetaldehyde biosynthesis using strain D15 (Candida lipolytica; 96.05 mg L-1 acetaldehyde while a total titratable acidity value of 7 °SH facilitated diacetyl flavor synthesis by strain D38 (Candida globosa; 3.58 mg L-1 diacetyl. Importantly, the results presented here suggest that this can be potentially used in the baking industry.
Synthetic biology stretching the realms of possibility in wine yeast research.
Jagtap, Umesh B; Jadhav, Jyoti P; Bapat, Vishwas A; Pretorius, Isak S
2017-07-03
It took several millennia to fully understand the scientific intricacies of the process through which grape juice is turned into wine. This yeast-driven fermentation process is still being perfected and advanced today. Motivated by ever-changing consumer preferences and the belief that the 'best' wine is yet to be made, numerous approaches are being pursued to improve the process of yeast fermentation and the quality of wine. Central to recent enhancements in winemaking processes and wine quality is the development of Saccharomyces cerevisiae yeast strains with improved robustness, fermentation efficiencies and sensory properties. The emerging science of Synthetic Biology - including genome engineering and DNA editing technologies - is taking yeast strain development into a totally new realm of possibility. The first example of how future wine strain development might be impacted by these new 'history-making' Synthetic Biology technologies, is the de novo production of the raspberry ketone aroma compound, 4-[4-hydroxyphenyl]butan-2-one, in a wine yeast containing a synthetic DNA cassette. This article explores how this breakthrough and the imminent outcome of the international Yeast 2.0 (or Sc2.0) project, aimed at the synthesis of the entire genome of a laboratory strain of S. cerevisiae, might accelerate the design of improved wine yeasts. Copyright © 2017 Elsevier B.V. All rights reserved.
Advances in metabolic engineering of yeast Saccharomyces cerevisiae for production of chemicals.
Borodina, Irina; Nielsen, Jens
2014-05-01
Yeast Saccharomyces cerevisiae is an important industrial host for production of enzymes, pharmaceutical and nutraceutical ingredients and recently also commodity chemicals and biofuels. Here, we review the advances in modeling and synthetic biology tools and how these tools can speed up the development of yeast cell factories. We also present an overview of metabolic engineering strategies for developing yeast strains for production of polymer monomers: lactic, succinic, and cis,cis-muconic acids. S. cerevisiae has already firmly established itself as a cell factory in industrial biotechnology and the advances in yeast strain engineering will stimulate development of novel yeast-based processes for chemicals production. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mitochondrial fission proteins regulate programmed cell death in yeast.
Fannjiang, Yihru; Cheng, Wen-Chih; Lee, Sarah J; Qi, Bing; Pevsner, Jonathan; McCaffery, J Michael; Hill, R Blake; Basañez, Gorka; Hardwick, J Marie
2004-11-15
The possibility that single-cell organisms undergo programmed cell death has been questioned in part because they lack several key components of the mammalian cell death machinery. However, yeast encode a homolog of human Drp1, a mitochondrial fission protein that was shown previously to promote mammalian cell death and the excessive mitochondrial fragmentation characteristic of apoptotic mammalian cells. In support of a primordial origin of programmed cell death involving mitochondria, we found that the Saccharomyces cerevisiae homolog of human Drp1, Dnm1, promotes mitochondrial fragmentation/degradation and cell death following treatment with several death stimuli. Two Dnm1-interacting factors also regulate yeast cell death. The WD40 repeat protein Mdv1/Net2 promotes cell death, consistent with its role in mitochondrial fission. In contrast to its fission function in healthy cells, Fis1 unexpectedly inhibits Dnm1-mediated mitochondrial fission and cysteine protease-dependent cell death in yeast. Furthermore, the ability of yeast Fis1 to inhibit mitochondrial fission and cell death can be functionally replaced by human Bcl-2 and Bcl-xL. Together, these findings indicate that yeast and mammalian cells have a conserved programmed death pathway regulated by a common molecular component, Drp1/Dnm1, that is inhibited by a Bcl-2-like function.
Influence of sodium chloride on wine yeast fermentation performance
Directory of Open Access Journals (Sweden)
Stilianos Logothetis
2010-06-01
Full Text Available Stilianos Logothetis1, Elias T Nerantzis2, Anna Gioulioti3, Tasos Kanelis2, Tataridis Panagiotis2, Graeme Walker11University of Abertay Dundee, School of Contemporary Sciences, Dundee, Scotland; 2TEI of Athens Department of Oenology and Spirit Technology, Biotechnology and Industrial Fermentations Lab Agiou Spiridonos, Athens, Greece; 3Ampeloiniki SA Industrial Park Thermi, Thessaloniki, GreeceAbstract: This paper concerns research into the influence of salt (sodium chloride on growth, viability and fermentation performance in a winemaking strain of the yeast, Saccharomyces cerevisiae. Experimental fermentations were conducted in both laboratory-scale and industrial-scale experiments. Preculturing yeasts in elevated levels of sodium chloride, or salt “preconditioning” led to improved fermentation performance. This was manifest by preconditioned yeasts having an improved capability to ferment high-sugar containing media with increased cell viability and with elevated levels of produced ethanol. Salt-preconditioning most likely influenced the stress-tolerance of yeasts by inducing the synthesis of key metabolites such as trehalose and glycerol. These compounds may act to improve cells’ ability to withstand osmostress and ethanol toxicity during fermentations of grape must. Industrial-scale trials using salt-preconditioned yeasts verified the benefit of this novel physiological cell engineering approach to practical winemaking fermentations.Keywords: salt, preconditioning, fermentation performance, Saccharomyces cerevisiae, wine
Yeast vitality during cider fermentation: assessment by energy metabolism.
Dinsdale, M G; Lloyd, D; McIntyre, P; Jarvis, B
1999-03-15
In an apple juice-based medium, an ethanol-tolerant Australian wine-yeast used for cider manufacture produced more than 10% ethanol over a 5 week period. Growth of the inoculum (10(6) organisms ml(-1)) occurred to a population of 3.1 x 10(7) ml(-1) during the first few days; at the end of the fermentation only 5 x 10(5) yeasts ml(-1) could be recovered as colony-forming units on plates. Respiratory and fermentative activities were measured by mass spectrometric measurements (O2 consumption and CO2 and ethanol production) of washed yeast suspensions taken from the cider fermentation at intervals. Both endogenous and glucose-supported energy-yielding metabolism declined, especially during the first 20 days. Levels of adenine nucleotides also showed decreases after day 1, as did adenylate energy charge, although in a prolonged (16.5 week) fermentation the lowest value calculated was 0.55. AMP was released into the medium. 31P-NMR spectra showed that by comparison with aerobically grown yeast, that from the later stages of the cider fermentation showed little polyphosphate. However, as previously concluded from studies of 'acidification power' and fluorescent oxonol dye exclusion (Dinsdale et al., 1995), repitching of yeast indicated little loss of viability despite considerable loss of vitality.
Yarrowia lipolytica: a model yeast for citric acid production.
Cavallo, Ema; Charreau, Hernán; Cerrutti, Patricia; Foresti, María Laura
2017-12-01
Every year more than 2 million tons of citric acid (CA) are produced around the world for industrial uses. Although initially extracted from citrus, the low profitability of the process and the increasing demand soon stimulated the search for more efficient methods to produce CA. Currently, most world CA demand (99%) is satisfied by fermentations with microorganisms, especially filamentous fungi and yeasts. CA production with yeasts has certain advantages over molds (e.g. higher productivity and easier cultivation), which in the last two decades have triggered a clear increase in publications and patents devoted to the use of yeasts in this field. Yarrowia lipolytica has become a model yeast that proved to be successful in different production systems. Considering the current interest evidenced in the literature, the most significant information on CA production using Y. lipolytica is summarized. The relevance on CA yields of key factors such as strains, media formulation, environmental conditions and production regimes is thoroughly discussed, with particular focus on increasing CA productivity. Besides, the possibility of tuning the mentioned variables to reduce concomitant isocitric acid production-the biggest disadvantage of using yeasts-is analyzed. Available methods for CA purification/quantification are also discussed. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
The yeast Saccharomyces cerevisiae- the main character in beer brewing.
Lodolo, Elizabeth J; Kock, Johan L F; Axcell, Barry C; Brooks, Martin
2008-11-01
Historically, mankind and yeast developed a relationship that led to the discovery of fermented beverages. Numerous inventions have led to improved technologies and capabilities to optimize fermentation technology on an industrial scale. The role of brewing yeast in the beer-making process is reviewed and its importance as the main character is highlighted. On considering the various outcomes of functions in a brewery, it has been found that these functions are focused on supporting the supply of yeast requirements for fermentation and ultimately to maintain the integrity of the product. The functions/processes include: nutrient supply to the yeast (raw material supply for brewhouse wort production); utilities (supply of water, heat and cooling); quality assurance practices (hygiene practices, microbiological integrity measures and other specifications); plant automation (vessels, pipes, pumps, valves, sensors, stirrers and centrifuges); filtration and packaging (product preservation until consumption); distribution (consumer supply); and marketing (consumer awareness). Considering this value chain of beer production and the 'bottle neck' during production, the spotlight falls on fermentation, the age-old process where yeast transforms wort into beer.
Yeast lipids can phase separate into micrometer-scale membrane domains
DEFF Research Database (Denmark)
Klose, Christian; Ejsing, Christer S; Garcia-Saez, Ana J
2010-01-01
The lipid raft concept proposes that biological membranes have the potential to form functional domains based on a selective interaction between sphingolipids and sterols. These domains seem to be involved in signal transduction and vesicular sorting of proteins and lipids. Although there is bioc......The lipid raft concept proposes that biological membranes have the potential to form functional domains based on a selective interaction between sphingolipids and sterols. These domains seem to be involved in signal transduction and vesicular sorting of proteins and lipids. Although...... there is biochemical evidence for lipid raft-dependent protein and lipid sorting in the yeast Saccharomyces cerevisiae, direct evidence for an interaction between yeast sphingolipids and the yeast sterol ergosterol, resulting in membrane domain formation, is lacking. Here we show that model membranes formed from yeast...... total lipid extracts possess an inherent self-organization potential resulting in Ld-Lo phase coexistence at physiologically relevant temperature. Analyses of lipid extracts from mutants defective in sphingolipid metabolism as well as reconstitution of purified yeast lipids in model membranes of defined...
[Susceptibility of yeasts to antifungal agents in Kaunas University of Medicine Hospital].
Skrodeniene, Erika; Dambrauskiene, Asta; Vitkauskiene, Astra
2006-01-01
The aim of this study was to determine the species of yeast and their susceptibility to antifungal agents isolated from clinical specimens of patients treated in Kaunas University of Medicine Hospital. A total of 142 yeasts isolated from various clinical specimens of patients hospitalized in Kaunas University of Medicine Hospital were included in this study. All yeasts were cultivated on Sabouraud dextrose agar and identified using either CHROM agar or API 20C AUX system. The minimum inhibitory concentrations of fluconazole, itraconazole, and amphotericin B were determined by the ATB FUNGUS 2 agar microdilution test. In all clinical specimens except blood, Candida albicans was the most frequently isolated yeast (65.5%, pyeast strains showed resistance to fluconazole. Nearly one-fourth of Candida albicans strains (24.7%) and 23.2% of all isolated yeast strains showed resistance to itraconazole. Almost all of fluconazole-resistant (93.3%) and 12.6% of fluconazole-susceptible yeast were found to be resistant to itraconazole (pyeast strains were susceptible to amphotericin B. Candida albicans strains were significantly frequently resistant to fluconazole than non-albicans Candida species (15.1% and 4.1%, respectively, pyeast isolated in Kaunas University of Medicine Hospital. There was determined that yeasts resistant to fluconazole were commonly resistant to itraconazole too. All isolated yeast strains were susceptible to amphotericin B.
Dynamical analysis of yeast protein interaction network during the sake brewing process.
Mirzarezaee, Mitra; Sadeghi, Mehdi; Araabi, Babak N
2011-12-01
Proteins interact with each other for performing essential functions of an organism. They change partners to get involved in various processes at different times or locations. Studying variations of protein interactions within a specific process would help better understand the dynamic features of the protein interactions and their functions. We studied the protein interaction network of Saccharomyces cerevisiae (yeast) during the brewing of Japanese sake. In this process, yeast cells are exposed to several stresses. Analysis of protein interaction networks of yeast during this process helps to understand how protein interactions of yeast change during the sake brewing process. We used gene expression profiles of yeast cells for this purpose. Results of our experiments revealed some characteristics and behaviors of yeast hubs and non-hubs and their dynamical changes during the brewing process. We found that just a small portion of the proteins (12.8 to 21.6%) is responsible for the functional changes of the proteins in the sake brewing process. The changes in the number of edges and hubs of the yeast protein interaction networks increase in the first stages of the process and it then decreases at the final stages.
Moreno-García, J; Coi, A L; Zara, G; García-Martínez, T; Mauricio, J C; Budroni, M
2018-03-01
Flor yeasts are Saccharomyces cerevisiae strains noted by their ability to create a type of biofilm in the air-liquid interface of some wines, known as 'flor' or 'velum', for which certain proteins play an essential role. Following a proteomic study of a flor yeast strain, we deleted the CCW14 (covalently linked cell wall protein) and YGP1 (yeast glycoprotein) genes-codifying for two cell surface glycoproteins-in a haploid flor yeast strain and we reported that both influence the weight of the biofilm as well as cell adherence (CCW14).
Functional genomics of beer-related physiological processes in yeast
Hazelwood, L.A.
2009-01-01
Since the release of the entire genome sequence of the S. cerevisiae laboratory strain S288C in 1996, many functional genomics tools have been introduced in fundamental and application-oriented yeast research. In this thesis, the applicability of functional genomics for the improvement of yeast in
Yeast Infection during Pregnancy
... disrupt the pH balance of the vagina. Common yeast infection symptoms include vaginal itching and a white, thick discharge that looks ... and Prevention. http://www.cdc.gov/std/tg2015/candidiasis.htm. Accessed Aug. 27, ... Vagina, Cervix, Toxic Shock Syndrome, Endometritis, and Salpingitis. In: ...
Screening studies of yeasts capable of utilizing petroleum fractions
Energy Technology Data Exchange (ETDEWEB)
El-Masry, H.G.; Foda, M.S.
1979-01-01
In these studies 23 yeasts cultures belonging to 10 genera of ascosporogenous, ballistosporogenous, and asporogenous yeasts, were screened with respect to their abilities of hydrocarbon utilization in synthetic media. Thus, kerosene, n-hexadecane, and wax distillate were compared as sole carbon sources in 2% final concentration. Kerosene exhibited marked inhibition on the growth of the majority of the strains, whereas active growth was observed with Debaryomyces vanrijii and many species of the genus Candida in media with n-hexadecane or wax distillate as sole source of carbon. In addition, some cultures belonging to the genera Sporobolomyces, Hansenula, Cryptococcus, and Trigonopsis could utilize some of these substrates, but to a lesser extent. Highest yield of cells and protein was obtained with Candida lipolytica NRRL 1094 in n-hexadecane medium, supplied with 0.03% yeast extract and trace element solutions. The results are discussed with respect to the possibilities of using new yeast genera, with special reference to the genus Debaryomyces, in microbial protein production.
The role of mitochondria in yeast programmed cell death
International Nuclear Information System (INIS)
Guaragnella, Nicoletta; Ždralević, Maša; Antonacci, Lucia; Passarella, Salvatore; Marra, Ersilia; Giannattasio, Sergio
2012-01-01
Mammalian apoptosis and yeast programmed cell death (PCD) share a variety of features including reactive oxygen species production, protease activity and a major role played by mitochondria. In view of this, and of the distinctive characteristics differentiating yeast and multicellular organism PCD, the mitochondrial contribution to cell death in the genetically tractable yeast Saccharomyces cerevisiae has been intensively investigated. In this mini-review we report whether and how yeast mitochondrial function and proteins belonging to oxidative phosphorylation, protein trafficking into and out of mitochondria, and mitochondrial dynamics, play a role in PCD. Since in PCD many processes take place over time, emphasis will be placed on an experimental model based on acetic acid-induced PCD (AA-PCD) which has the unique feature of having been investigated as a function of time. As will be described there are at least two AA-PCD pathways each with a multifaceted role played by mitochondrial components, in particular by cytochrome c.
Recent advances in the genome-wide study of DNA replication origins in yeast
Directory of Open Access Journals (Sweden)
Chong ePeng
2015-02-01
Full Text Available DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs. Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genome. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some nonconventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve the replication origins prediction.
Comparative evolutionary analysis of protein complexes in E. coli and yeast
Directory of Open Access Journals (Sweden)
Ranea Juan AG
2010-02-01
Full Text Available Abstract Background Proteins do not act in isolation; they frequently act together in protein complexes to carry out concerted cellular functions. The evolution of complexes is poorly understood, especially in organisms other than yeast, where little experimental data has been available. Results We generated accurate, high coverage datasets of protein complexes for E. coli and yeast in order to study differences in the evolution of complexes between these two species. We show that substantial differences exist in how complexes have evolved between these organisms. A previously proposed model of complex evolution identified complexes with cores of interacting homologues. We support findings of the relative importance of this mode of evolution in yeast, but find that it is much less common in E. coli. Additionally it is shown that those homologues which do cluster in complexes are involved in eukaryote-specific functions. Furthermore we identify correlated pairs of non-homologous domains which occur in multiple protein complexes. These were identified in both yeast and E. coli and we present evidence that these too may represent complex cores in yeast but not those of E. coli. Conclusions Our results suggest that there are differences in the way protein complexes have evolved in E. coli and yeast. Whereas some yeast complexes have evolved by recruiting paralogues, this is not apparent in E. coli. Furthermore, such complexes are involved in eukaryotic-specific functions. This implies that the increase in gene family sizes seen in eukaryotes in part reflects multiple family members being used within complexes. However, in general, in both E. coli and yeast, homologous domains are used in different complexes.
Yeast prions and human prion-like proteins: sequence features and prediction methods.
Cascarina, Sean M; Ross, Eric D
2014-06-01
Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.
Attenuation of yeast form of Paracoccidioides Brasiliensis by gamma irradiation
International Nuclear Information System (INIS)
Demicheli, Marina Cortez
2006-01-01
Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America, and currently there is no effective vaccine. The aim of this work was to attenuate the yeast form of P. brasiliensis by gamma irradiation for further studies on vaccine research. P. brasiliensis (strain Pb-18) cultures were irradiated at doses between 0.5 and 8.0 kGy. After each dose the fungal cells were plated and after 10 days the colony forming units (CFU) counted. The viability of the irradiated cells was measured using the dyes Janus green and methylene blue, and protein synthesis by incorporation of L 35 S methionine. The comparison between the antigenic profile of irradiated and control yeast was made by Western blot and the virulence evaluated by the inoculation in C 57 Bl/J6 and Balb/c mice. Morphological changes in irradiated yeast were evaluated by electronic microscopy and DNA integrity by electrophoresis in agarose gel. At 6.5 kGy the yeast lost the reproductive capacity. The viability and the incorporation of L- 35 S methionine were the same in control and up to 6.5 kGy irradiated cells, but 6.5 kGy irradiated yeast secreted 40% less proteins. The Western blot profile was clearly similar in control and 6.5 kGy irradiated yeast. No CFU could be recovered from the tissues of the mice infected with the radio attenuated yeast. At the dose of 6.5 kGy the DNA was degraded and this damage was not repaired. The transmission electronic microscopy showed significant alterations in the nucleus of the irradiated cells. The scanning electronic microscopy showed that two hours after the irradiation the cells were collapsed or presented deep folds in the surface, however these injury were reversible. We concluded that for P. brasiliensis yeast cells it was possible to find a dose in which the pathogen loses its reproductive ability and virulence, while retaining its viability, metabolic activity and the antigenic profile. (author)
Chemical genomic guided engineering of gamma-valerolactone tolerant yeast.
Bottoms, Scott; Dickinson, Quinn; McGee, Mick; Hinchman, Li; Higbee, Alan; Hebert, Alex; Serate, Jose; Xie, Dan; Zhang, Yaoping; Coon, Joshua J; Myers, Chad L; Landick, Robert; Piotrowski, Jeff S
2018-01-12
Gamma valerolactone (GVL) treatment of lignocellulosic bomass is a promising technology for degradation of biomass for biofuel production; however, GVL is toxic to fermentative microbes. Using a combination of chemical genomics with the yeast (Saccharomyces cerevisiae) deletion collection to identify sensitive and resistant mutants, and chemical proteomics to monitor protein abundance in the presence of GVL, we sought to understand the mechanism toxicity and resistance to GVL with the goal of engineering a GVL-tolerant, xylose-fermenting yeast. Chemical genomic profiling of GVL predicted that this chemical affects membranes and membrane-bound processes. We show that GVL causes rapid, dose-dependent cell permeability, and is synergistic with ethanol. Chemical genomic profiling of GVL revealed that deletion of the functionally related enzymes Pad1p and Fdc1p, which act together to decarboxylate cinnamic acid and its derivatives to vinyl forms, increases yeast tolerance to GVL. Further, overexpression of Pad1p sensitizes cells to GVL toxicity. To improve GVL tolerance, we deleted PAD1 and FDC1 in a xylose-fermenting yeast strain. The modified strain exhibited increased anaerobic growth, sugar utilization, and ethanol production in synthetic hydrolysate with 1.5% GVL, and under other conditions. Chemical proteomic profiling of the engineered strain revealed that enzymes involved in ergosterol biosynthesis were more abundant in the presence of GVL compared to the background strain. The engineered GVL strain contained greater amounts of ergosterol than the background strain. We found that GVL exerts toxicity to yeast by compromising cellular membranes, and that this toxicity is synergistic with ethanol. Deletion of PAD1 and FDC1 conferred GVL resistance to a xylose-fermenting yeast strain by increasing ergosterol accumulation in aerobically grown cells. The GVL-tolerant strain fermented sugars in the presence of GVL levels that were inhibitory to the unmodified strain
Mechanisms of uv mutagenesis in yeast and E. coli
International Nuclear Information System (INIS)
Lawrence, C.; Christensen, R.; Christensen, J.R.; O'Brien, T.
1983-01-01
Experiments investigating ultraviolet light mutagenesis in either bakers' yeast, Saccharomyces cerevisiae, or E. coli have led to the following conclusions. First, cyclobutane pyrimidine dimers cause most mutations in both organisms; pyrimidine adducts, such as PyC, can account at best for only a small proportion. 86 percent of forward mutations induced at the E. coli lacI locus can be abolished by photoreactivation under conditions which do not alter the level of recA induction. About 75 percent of the forward mutations induced at the CAN1 locus of yeast could be removed by photoreactivation, a value that lies within the range observed previously for the reversion of CYC1 alleles (60 percent - 97 percent). Second, about 10 percent of the lacI forward mutations are untargeted, a smaller fraction than found previously for cycl-91 reversion in yeast. It is not yet clear whether the two species are really different in this respect, of whether the cycl-91 reversion site is a typical of the yeast genome at large. Third, analysis of reversion frequencies of 20 mutant alleles suggests that about 10 to 25 percent of all replication errors produced by mutagenic mechanisms in uv-irradiated yeast involve additions or deletions of base-pairs, indicating that error-prone repair does not just produce substitutions. Last, the REV1 locus in yeast is concerned with the induction of frameshift mutations at some, but not all, genetic sites, just as found previously for substitution mutations. The function of the REV3 gene is more widely, though not universally, required while the function of the RAD6 gene, like that of the recA locus in E. coli, appears to be necessary for all kinds of uv mutagenesis. E coli genes comparable to REV1 and REV3 have not yet been described; conversely, there does not yet appear to be a yeast equivalent of umuC
Mechanisms of uv mutagenesis in yeast and E. coli
International Nuclear Information System (INIS)
Lawrence, C.; Christensen, R.; Christensen, J.R.; O'Brien, T.
1983-01-01
Experiments investigating ultraviolet light mutagenesis in either bakers' yeast, Saccharomyces cerevisiae, or E. coli have led to the following conclusions. First, cyclobutane pyrimidine dimers cause most mutations in both organisms; pyrimidine adducts, such as PyC, can account at best for only a small proportion. Eighty-six percent of forward mutations induced at the E. coli lacI locus can be abolished by photoreactivation under conditions which do not alter the level of recA induction. About 75 percent of the forward mutations induced at the CAN1 locus of yeast could be removed by photoreactivation, a value that lies within the range observed previously for the reversion of CYC1 alleles (60 percent - 97 percent). Second, about 10 percent of the lacI forward mutations are untargeted, a smaller fraction than found previously for cycl1-91 reversion in yeast. It is not yet clear whether the two species are really different in this respect, or whether the cyc1-91 reversion site is atypical of the yeast genome at large. Third, analysis of reversion frequencies of 20 mutant alleles suggests that about 10 - 25 percent of all replication errors produced by mutagenic mechanisms in UV-irradiated yeast involve additions or deletions of base-pairs, indicating that error-prone repair does not just produce substitutions. Last, the REV1 locus in yeast is concerned with the induction of frameshift mutations at some, but not all, genetic sites, just as found previously for substitution mutations. The function of the REV3 gene is more widely, though not universally, required while the function of the RAD6 gene, like that of the recA locus in E. coli, appears to be necessary for all kinds of UV mutagenesis. E. coli genes comparable to REV1 and REV3 have not yet been described, conversely, there does not yet appear to be a yeast equivalent of umuC. 13 references, 4 tables
Optimization of culture medium for heavy-ion irradiation bread yeast design
International Nuclear Information System (INIS)
Ma Liang; Wang Jufang; Lu Dong; Li Wenjian; Xiao Guoqing
2013-01-01
A mutant bread yeast strain with high protein content of 55% was gained by use of "1"2C"6"+ ions. The MINITAB 16.0 software, Plackett-Burman experimental design and response surface methodology were applied to optimize the culture medium for the irradiated yeast. The most important three factors which influenced the culture results were identified as glucose, magnesium sulphate and yeast extract. The path of the steepest ascent was undertaken to approach the optimal region of the three significant factors. Box-Behnken design and response surface methodology were used for the regression analysis. Finally, the optimal fermentation conditions were identified as glucose 11.03 g/L, yeast extract 6.53 g/L and magnesium sulphate 5.59 g/L by the regression analysis. It was found that the biomass of the bread yeasts reached 4.84 g/L and increased by 15% compared to original conditions. (authors)
Prion-based memory of heat stress in yeast.
Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D
2017-05-04
Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices. We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.
Beuchat, L R; Frandberg, E; Deak, T; Alzamora, S M; Chen, J; Guerrero, A S; López-Malo, A; Ohlsson, I; Olsen, M; Peinado, J M; Schnurer, J; de Siloniz, M I; Tornai-Lehoczki, J
2001-10-22
Dichloran 18% glycerol agar (DG18) was originally formulated to enumerate nonfastidious xerophilic moulds in foods containing rapidly growing Eurotium species. Some laboratories are now using DG18 as a general purpose medium for enumerating yeasts and moulds, although its performance in recovering yeasts from dry foods has not been evaluated. An interlaboratory study compared DG18 with dichloran rose bengal chloramphenicol agar (DRBC), plate count agar supplemented with chloramphenicol (PCAC), tryptone glucose yeast extract chloramphenicol agar (TGYC), acidified potato dextrose agar (APDA), and orange serum agar (OSA) for their suitability to enumerate 14 species of lyophilized yeasts. The coefficient of variation for among-laboratories repeatability within yeast was 1.39% and reproducibility of counts among laboratories was 7.1%. The order of performance of media for recovering yeasts was TGYC > PCAC = OSA > APDA > DRBC > DG 18. A second study was done to determine the combined effects of storage time and temperature on viability of yeasts and suitability of media for recovery. Higher viability was retained at -18 degrees C than at 5 degrees C or 25 degrees C for up to 42 weeks, although the difference in mean counts of yeasts stored at -18 degrees C and 25 degrees C was only 0.78 log10 cfu/ml of rehydrated suspension. TGYC was equal to PCAC and superior to the other four media in recovering yeasts stored at -18 degrees C, 5 degrees C, or 25 degrees C for up to 42 weeks. Results from both the interlaboratory study and the storage study support the use of TGYC for enumerating desiccated yeasts. DG18 is not recommended as a general purpose medium for recovering yeasts from a desiccated condition.
Genome-scale modeling of yeast: chronology, applications and critical perspectives.
Lopes, Helder; Rocha, Isabel
2017-08-01
Over the last 15 years, several genome-scale metabolic models (GSMMs) were developed for different yeast species, aiding both the elucidation of new biological processes and the shift toward a bio-based economy, through the design of in silico inspired cell factories. Here, an historical perspective of the GSMMs built over time for several yeast species is presented and the main inheritance patterns among the metabolic reconstructions are highlighted. We additionally provide a critical perspective on the overall genome-scale modeling procedure, underlining incomplete model validation and evaluation approaches and the quest for the integration of regulatory and kinetic information into yeast GSMMs. A summary of experimentally validated model-based metabolic engineering applications of yeast species is further emphasized, while the main challenges and future perspectives for the field are finally addressed. © FEMS 2017.
International Nuclear Information System (INIS)
Singh, Bhag; Gupta, Radhey S.
2006-01-01
Studies on yeast fumarase provide the main evidence for dual localization of a protein in mitochondria and cytosol by means of retrograde translocation. We have examined the subcellular targeting of yeast and human fumarase in live cells to identify factors responsible for this. The cDNAs for mature yeast or human fumarase were fused to the gene for enhanced green fluorescent protein (eGFP) and they contained, at their N-terminus, a mitochondrial targeting sequence (MTS) derived from either yeast fumarase, human fumarase, or cytochrome c oxidase subunit VIII (COX) protein. Two nuclear localization sequences (2x NLS) were also added to these constructs to facilitate detection of any cytosolic protein by its targeting to nucleus. In Cos-1 cells transfected with these constructs, human fumarase with either the native or COX MTSs was detected exclusively in mitochondria in >98% of the cells, while the remainder 1-2% of the cells showed varying amounts of nuclear labeling. In contrast, when human fumarase was fused to the yeast MTS, >50% of the cells showed nuclear labeling. Similar studies with yeast fumarase showed that with its native MTS, nuclear labeling was seen in 80-85% of the cells, but upon fusion to either human or COX MTS, nuclear labeling was observed in only 10-15% of the cells. These results provide evidence that extramitochondrial presence of yeast fumarase is mainly caused by the poor mitochondrial targeting characteristics of its MTS (but also affected by its primary sequence), and that the retrograde translocation mechanism does not play a significant role in the extramitochondrial presence of mammalian fumarase
Hybrid yeast strains capable of raising an extraordinarily broad range of dough types
Energy Technology Data Exchange (ETDEWEB)
Kowalski, S.; Zander, I.; Windisch, S.
1981-01-01
Over 200 hybrid yeast strains were screened and 11 of these found to have versatile fermentation characteristics. This paper reports the results obtained with these 11 strains compared with a commercially available strain of baker's yeast used for bread making and marketed as 'instant active dry yeast'. In contrast to bakers yeast, the hybrid strains fermented very well in yeast, hard biscuit, shortcake and heavy cake dough without prior sponge formation. The fermentation kinetics were investigated and the technical potential of such hybrid strains discussed on the basis of the fermentation kinetics.
Uranium bioprecipitation mediated by yeasts utilizing organic phosphorus substrates.
Liang, Xinjin; Csetenyi, Laszlo; Gadd, Geoffrey Michael
2016-06-01
In this research, we have demonstrated the ability of several yeast species to mediate U(VI) biomineralization through uranium phosphate biomineral formation when utilizing an organic source of phosphorus (glycerol 2-phosphate disodium salt hydrate (C3H7Na2O6P·xH2O (G2P)) or phytic acid sodium salt hydrate (C6H18O24P6·xNa(+)·yH2O (PyA))) in the presence of soluble UO2(NO3)2. The formation of meta-ankoleite (K2(UO2)2(PO4)2·6(H2O)), chernikovite ((H3O)2(UO2)2(PO4)2·6(H2O)), bassetite (Fe(++)(UO2)2(PO4)2·8(H2O)), and uramphite ((NH4)(UO2)(PO4)·3(H2O)) on cell surfaces was confirmed by X-ray diffraction in yeasts grown in a defined liquid medium amended with uranium and an organic phosphorus source, as well as in yeasts pre-grown in organic phosphorus-containing media and then subsequently exposed to UO2(NO3)2. The resulting minerals depended on the yeast species as well as physico-chemical conditions. The results obtained in this study demonstrate that phosphatase-mediated uranium biomineralization can occur in yeasts supplied with an organic phosphate substrate as sole source of phosphorus. Further understanding of yeast interactions with uranium may be relevant to development of potential treatment methods for uranium waste and utilization of organic phosphate sources and for prediction of microbial impacts on the fate of uranium in the environment.
Yeast Identification During Fermentation of Turkish Gemlik Olives.
Mujdeci, Gamze; Arévalo-Villena, María; Ozbas, Z Yesim; Briones Pérez, Ana
2018-05-01
Naturally fermented black table olives of the Gemlik variety are one of the most consumed fermented products in Turkey. The objective of this work was to identify yeast strains isolated during their natural fermentation by using Restriction Fragments Lengths Polymorphism-Polimerase Chain Reaction (RFLP-PCR) and DNA sequencing methods. The study also focused on determining the effect of regional differences on yeast microflora of naturally fermented Gemlik olives. A total of 47 yeast strains belonging to 12 different species which had been previously isolated from the natural brine of Akhisar and Iznik-Gemlik cv. olives were characterized by molecular methods. Forty-two of the tested strains could be identified by RFLP-PCR to species level. These yeast species were determined as Candida mycetangi, Candida hellenica, Candida membranaefaciens, Candida famata, Candida pelliculosa, Saccharomyces cerevisiae, and Zygosaccharomyces mrakii. Five strains were identified by DNA sequencing. These strains belonged to three different species: Aureobasidium pullulans, Kloeckera apiculate, and Cryptococcus saitoi. The most frequent species were C. famata and C. pelliculosa in both regions. This work studies the yeasts from Turkish table olives which could prove to be of importance to the food industry in that area. On the other hand, it compares identification by molecular and classical biochemical methods and offers an idea about the differences between the ecosystems of Gemlik olives in the Akhisar (AO) and Iznik (IO) regions. The study could be useful in characterizing a very important product and, in this way, could help to promote its marketing. © 2018 Institute of Food Technologists®.
Inducibility of error-prone DNA repair in yeast
International Nuclear Information System (INIS)
Siede, W.; Eckardt, F.
1984-01-01
Whereas some experimental evidence suggests that mutagenesis in yeast after treatment with DNA-damaging agents involves inducible functions, a general-acting error-prone repair activity analogous to the SOS system of Escherichia coli has not yet been demonstrated. The current literature on the problem of inducibility of mutagenic repair in yeast is reviewed with emphasis on the differences in the experimental procedures applied. (orig.)
Structural Studies of the Yeast Mitochondrial Degradosome
DEFF Research Database (Denmark)
Feddersen, Ane; Jonstrup, Anette Thyssen; Brodersen, Ditlev Egeskov
The yeast mitochondrial degradosome/exosome (mtExo) is responsible for most RNA turnover in mitochondria and has been proposed to form a central part of a mitochondrial RNA surveillance system responsible for degradation of aberrant and unprocessed RNA ([1], [2]). In contrast to the cytoplasmic...... and nuclear exosome complexes, which consist of 10-12 different nuclease subunits, the mitochondrial degradosome is composed of only two large subunits - an RNase (Dss1p) and a helicase (Suv3p), belonging the Ski2 class of DExH box RNA helicases. Both subunits are encoded on the yeast nuclear genome...... and and Suv3p from the fission yeast, Schizosaccharomyces pombe, have been cloned for heterologous expression in E. coli. Of the two, we have succeeded in purifying the 73kDa Suv3p by Ni2+-affinity chromatography followed by cleavage of the N-terminal His-tag, cation exchange, and gel filtration. Crystals...
Metallic Biosorption Using Yeasts in Continuous Systems
Directory of Open Access Journals (Sweden)
Karla Miriam Hernández Mata
2013-01-01
Full Text Available Mining effluents were found to be the main source of pollution by heavy metals of the surface water in the San Pedro River in Sonora, Mexico. The overall objective of this study was to determine the biosorption of Zn, Cu, Mn, and Fe with yeasts isolated from San Pedro River in a continuous system. The tests conducted in two reactors packed with zeolite connected in series. The first reactor was inoculated mixing two yeasts species, and the effluent of the first reactor was fed to second reactor. Subsequently, the first reactor was fed with contaminated water of San Pedro River and effluent from this was the second reactor influent. After 40 days of the experiment a reduction of 81.5% zinc, 76.5% copper, manganese 95.5%, and 99.8% of iron was obtained. These results show that the selected yeasts are capable of biosorbing zinc, copper, manganese, and iron under these conditions.
Determination of Proteinaceous Selenocysteine in Selenized Yeast
Directory of Open Access Journals (Sweden)
Katarzyna Bierla
2018-02-01
Full Text Available A method for the quantitation of proteinaceous selenocysteine (SeCys in Se-rich yeast was developed. The method is based on the reduction of the Se-Se and S-Se bridges with dithiotretiol, derivatization with iodoacetamide (carbamidomethylation, followed by HPLC-ICP MS. The chromatographic conditions were optimized for the total recovery of the proteinaceous selenocysteine, the minimum number of peaks in the chromatogram (reduction of derivatization products of other Se-species present and the baseline separation. A typical chromatogram of a proteolytic digest of selenized yeast protein consisted of up to five peaks (including SeMet, carbamidomethylated (CAM-SeCys, and Se(CAM2 identified by retention time matching with available standards and electrospray MS. Inorganic selenium non-specifically attached to proteins and selenomethionine could be quantified (in the form of Se(CAM2 along with SeCys. Selenocysteine, selenomethionine, inorganic selenium, and the water soluble-metabolite fraction accounted for the totality of selenium species in Se-rich yeast.
Functional expression of parasite drug targets and their human orthologs in yeast.
Directory of Open Access Journals (Sweden)
Elizabeth Bilsland
2011-10-01
Full Text Available The exacting nutritional requirements and complicated life cycles of parasites mean that they are not always amenable to high-throughput drug screening using automated procedures. Therefore, we have engineered the yeast Saccharomyces cerevisiae to act as a surrogate for expressing anti-parasitic targets from a range of biomedically important pathogens, to facilitate the rapid identification of new therapeutic agents.Using pyrimethamine/dihydrofolate reductase (DHFR as a model parasite drug/drug target system, we explore the potential of engineered yeast strains (expressing DHFR enzymes from Plasmodium falciparum, P. vivax, Homo sapiens, Schistosoma mansoni, Leishmania major, Trypanosoma brucei and T. cruzi to exhibit appropriate differential sensitivity to pyrimethamine. Here, we demonstrate that yeast strains (lacking the major drug efflux pump, Pdr5p expressing yeast ((ScDFR1, human ((HsDHFR, Schistosoma ((SmDHFR, and Trypanosoma ((TbDHFR and (TcDHFR DHFRs are insensitive to pyrimethamine treatment, whereas yeast strains producing Plasmodium ((PfDHFR and (PvDHFR DHFRs are hypersensitive. Reassuringly, yeast strains expressing field-verified, drug-resistant mutants of P. falciparum DHFR ((Pfdhfr(51I,59R,108N are completely insensitive to pyrimethamine, further validating our approach to drug screening. We further show the versatility of the approach by replacing yeast essential genes with other potential drug targets, namely phosphoglycerate kinases (PGKs and N-myristoyl transferases (NMTs.We have generated a number of yeast strains that can be successfully harnessed for the rapid and selective identification of urgently needed anti-parasitic agents.
Colony size measurement of the yeast gene deletion strains for functional genomics
Directory of Open Access Journals (Sweden)
Mir-Rashed Nadereh
2007-04-01
Full Text Available Abstract Background Numerous functional genomics approaches have been developed to study the model organism yeast, Saccharomyces cerevisiae, with the aim of systematically understanding the biology of the cell. Some of these techniques are based on yeast growth differences under different conditions, such as those generated by gene mutations, chemicals or both. Manual inspection of the yeast colonies that are grown under different conditions is often used as a method to detect such growth differences. Results Here, we developed a computerized image analysis system called Growth Detector (GD, to automatically acquire quantitative and comparative information for yeast colony growth. GD offers great convenience and accuracy over the currently used manual growth measurement method. It distinguishes true yeast colonies in a digital image and provides an accurate coordinate oriented map of the colony areas. Some post-processing calculations are also conducted. Using GD, we successfully detected a genetic linkage between the molecular activity of the plant-derived antifungal compound berberine and gene expression components, among other cellular processes. A novel association for the yeast mek1 gene with DNA damage repair was also identified by GD and confirmed by a plasmid repair assay. The results demonstrate the usefulness of GD for yeast functional genomics research. Conclusion GD offers significant improvement over the manual inspection method to detect relative yeast colony size differences. The speed and accuracy associated with GD makes it an ideal choice for large-scale functional genomics investigations.
Steyn-Parvé, Elizabeth P.
1962-01-01
Sodium molybdate is a powerful inhibitor of the acid yeast phosphatase in both fresh baker's yeast and dried brewer's yeast, provided that the yeast is suspended in a suitable buffer. It displays no action in citrate or phosphate buffers, but is active in acetate or maleate buffers, both at the
Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G
2009-03-01
Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.
Metals uptake by live yeast and heat-modified yeast residue
Directory of Open Access Journals (Sweden)
Geórgia Labuto
2015-07-01
Full Text Available This study evaluated the biosorption of Cd2+, Cr3+, Pb2+ and Cu2+ at pHs 3, 4, 5 and 6 for Saccharomyces cerevisiae both alive and biologically inactivated by different heating procedures (oven, autoclave or spray dry technique originated from alcohol industry. The material inactivated by autoclave (IA, at 120°C, 30 min had the best performance for metals uptake: 1.88 ± 0.07 (Cu2+, 2.22 ± 0.02 (Cr3+ and 1.57 ± 0.08 g kg-1 (Pb2+. For Cd2+; while the material inactivated by spray dry (RY presented the higher sorption capacity, 2.30 ± 0.08 g kg-1. The sorption studies showed that the biosorbent materials presented different sorption capacities and an ideal sorption pH. The sorption sites were investigated by potentiometric titration and FT-IR and showed that different heating processes used to inactivate biological samples produce materials with different characteristics and with a diverse sorption capacity due to modification of the available sorption sites. This suggests that inactivation by heating can be an alternative to improve the performance of biosorbents. The main sorption sites for each material were phenolic for live yeast (LY and carboxylic for yeast inactivated by heating in an autoclave (IA.
Molecular basis of antifungal drug resistance in yeasts
DEFF Research Database (Denmark)
Morio, Florent; Jensen, Rasmus Hare; Le Pape, Patrice
2017-01-01
Besides inherent differences in in vitro susceptibilities, clinically-relevant yeast species may acquire resistance upon exposure to most antifungal drugs used in the clinic. In recent years, major fundamental research studies have been conducted to improve our understanding of the molecular basis...... of antifungal resistance. This topic is of major interest as antifungal resistance in yeast is clearly evolving and is correlated with clinical failure. This minireview is an overview of the most recent findings about key molecular mechanisms evolving in human pathogenic yeasts, particularly Candida spp......., in the context of antifungal drug resistance. Also included are the methods currently available for in vitro antifungal susceptibility testing and for molecular detection of mutations associated with resistance. Finally, the genetic drivers of antifungal resistance are discussed in light of the spectra...
In situ rheology of yeast biofilms.
Brugnoni, Lorena I; Tarifa, María C; Lozano, Jorge E; Genovese, Diego
2014-01-01
The aim of the present work was to investigate the in situ rheological behavior of yeast biofilms growing on stainless steel under static and turbulent flow. The species used (Rhodototula mucilaginosa, Candida krusei, Candida kefyr and Candida tropicalis) were isolated from a clarified apple juice industry. The flow conditions impacted biofilm composition over time, with a predominance of C. krusei under static and turbulent flow. Likewise, structural variations occurred, with a tighter appearance under dynamic flow. Under turbulent flow there was an increase of 112 μm in biofilm thickness at 11 weeks (p < 0.001) and cell morphology was governed by hyphal structures and rounded cells. Using the in situ growth method introduced here, yeast biofilms were determined to be viscoelastic materials with a predominantly solid-like behavior, and neither this nor the G'0 values were significantly affected by the flow conditions or the growth time, and at large deformations their weak structure collapsed beyond a critical strain of about 1.5-5%. The present work could represent a starting point for developing in situ measurements of yeast rheology and contribute to a thin body of knowledge about fungal biofilm formation.
Structural differences between yeast and mammalian microtubules revealed by cryo-EM
Energy Technology Data Exchange (ETDEWEB)
Howes, Stuart C. [Univ. of California, Berkeley, CA (United States). Biophysics Graduate Group; Geyer, Elisabeth A. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biophysics; Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biochemistry; LaFrance, Benjamin [Univ. of California, Berkeley, CA (United States). Molecular and Cell Biology Graduate Program; Zhang, Rui [Univ. of California, Berkeley, CA (United States). Howard Hughes Medical Inst.; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging Division; Kellogg, Elizabeth H. [Univ. of California, Berkeley, CA (United States). Howard Hughes Medical Inst.; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging Division; Westermann, Stefan [Univ. of Duisburg-Essen, Essen (Germany). Dept. of Molecular Genetics, Center for Medical Biotechnology; Rice, Luke M. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biophysics; Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biochemistry; Nogales, Eva [Univ. of California, Berkeley, CA (United States). Howard Hughes Medical Inst.; Univ. of California, Berkeley, CA (United States). Dept. of Molecular Biology and California Inst. for Quantitative Biosciences; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging Division
2017-06-26
Microtubules are polymers of αβ-tubulin heterodimers essential for all eukaryotes. Despite sequence conservation, there are significant structural differences between microtubules assembled in vitro from mammalian or budding yeast tubulin. Yeast MTs were not observed to undergo compaction at the interdimer interface as seen for mammalian microtubules upon GTP hydrolysis. Lack of compaction might reflect slower GTP hydrolysis or a different degree of allosteric coupling in the lattice. The microtubule plus end–tracking protein Bim1 binds yeast microtubules both between αβ-tubulin heterodimers, as seen for other organisms, and within tubulin dimers, but binds mammalian tubulin only at interdimer contacts. At the concentrations used in cryo-electron microscopy, Bim1 causes the compaction of yeast microtubules and induces their rapid disassembly. In conclusion, our studies demonstrate structural differences between yeast and mammalian microtubules that likely underlie their differing polymerization dynamics. These differences may reflect adaptations to the demands of different cell size or range of physiological growth temperatures.
International Nuclear Information System (INIS)
Stevens, A.
1982-01-01
Investigations in this laboratory center on basic enzymatic reactions of RNA. Still undefined are reactions involved in the conversion of precursors of mRA (pre-mRNA) to mRNA in eukaryotes. The pre-mRNA is called heterogeneous nuclear RNA and is 2 to 6 times larger than mRNA. The conversion, called splicing, involves a removal of internal sequences called introns by endoribonuclease action followed by a rejoining of the 3'- and 5'-end fragments, called exons, by ligating activity. It has not been possible yet to study the enzymes involved in vitro. Also undefined are reactions involved in the turnover or discarding of certain of the pre-mRNA molecules. Yeast is a simple eukaryote and may be expected to have the same, but perhaps simpler, processing reactions as the higher eukaryotes. Two enzymes involved in the processing of pre-mRNA and mRNA in yeast are under investigation. Both enzymes have been partially purified from ribonucleoprotein particles of yeast. The first is a unique decapping enzyme which cleaves [ 3 H]m 7 Gppp [ 14 C]RNA-poly (A) of yeast, yielding [ 3 H]m 7 GDP and is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed. The second enzyme is an endoribonuclease which converts both the [ 3 H] and [ 14 C] labels of [ 3 H]m 7 Gppp[ 14 C]RNA-poly(A) from an oligo(dT)-cellulose bound form to an unbound, acid-insoluble form. Results show that the stimulation involves an interaction of the labeled RNA with the small nuclear RNA. The inhibition of the enzyme by ethidium bromide and its stimulation by small nuclear RNA suggest that it may be a processing ribonuclease, requiring specific double-stranded features in its substrate. The characterization of the unique decapping enzyme and endoribonuclease may help to understand reactions involved in the processing of pre-mRNA and mRNA in eukaryotes
[Onychomycosis by yeast not common in diabetics of a health center].
Imbert, J L; G Gomez, J V; Escudero, R B; Blasco, J L
2016-10-01
Mexican diabetic population frequently presents mycosis under foot hyperkeratosis; however, in another type of onychomycosis as the ones that is assumed Candida albicans is the causal agent, it is unknown the frequency, the prevalence and if another Candida species or other yeasts are found. Evaluate the frequency of yeasts causing onychomycosis in diabetic patients looked after in public institutions of health of the State of Hidalgo, Mexico, and its association with clinical epidemiological variables. An observational, descriptive and transversal study was made on 261 patients, from which one nail sample of each one was obtained, used to isolate and identify dermatophytes and yeasts; the results were statistically correlated with 24 epidemiological parameters. The clinical study was done through interrogation and by medical exploration in order to evaluate Tinea pedis and onychomycosis. Onychomycosis were caused by Candida guilliermondii, Candida parapsilosis, Candida glabrata, Candida krusei, Candida spp., Kodamaea ohmeri, Prototheca wickerhamii and unidentified yeasts. The prevalence for general onychomycosis, by dermatophytes, mixed onychomycosis and by yeasts were: 24.1, 19.5, 2.3 and 14.6%, respectively. Patients with significant probability to be diagnosed as having onychomycosis by yeasts are those wearing open shoes (2.59%); technicians and professionals (10.49%) and alcohol drinkers (3.72%). The fact that Candida albicans is not present in this study as causal agent of onychomycosis, and emerging and non-common yeasts were indeed isolated, creates new challenges. It is remarked the clinical criterion that when onychomycosis is suspected in diabetics, the diagnosis for culturing dermatophytes and yeasts should be included. Copyright © 2015 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.
The role of the yeast as probiotic in protection against liver injury ...
African Journals Online (AJOL)
Saccharomyces cerevisiae is a well known yeast used safely from ancient times in many biotechnological applications. Nowadays, there is an increasing interest in using yeast as probiotic. Dimethyl nitrosamine (DMN) has been used to induce liver fibrosis in rats. Yeast has been used side by side with the DMN to evaluate ...
New vectors in fission yeast: application for cloning the his2 gene
DEFF Research Database (Denmark)
Weilguny, D; Praetorius, M; Carr, Alan
1991-01-01
of transforming Sc. pombe ura4 strains, as well as ura 3 strains of the distantly related budding yeast Saccharomyces cerevisiae. We have used pON163 for the construction of two fission yeast genomic libraries. From these gene banks clones were isolated that were able to complement fission yeast his2 mutants...
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
Effects of a spoilage yeast from silage on in vitro ruminal fermentation.
Santos, M C; Lock, A L; Mechor, G D; Kung, L
2015-04-01
Feeding silages with high concentrations of yeasts from aerobic spoilage is often implicated as a cause of poor animal performance on dairies. Our objective was to determine if a commonly found spoilage yeast, isolated from silage, had the potential to alter in vitro ruminal fermentations. A single colony of Issatchenkia orientalis, isolated from high-moisture corn, was grown in selective medium. The yeast culture was purified and added to in vitro culture tubes containing a total mixed ration (43% concentrate, 43% corn silage, 11% alfalfa haylage, and 3% alfalfa hay on a dry matter basis), buffer, and ruminal fluid to achieve added theoretical final concentrations of 0 (CTR), 4.40 (low yeast; LY), 6.40 (medium yeast; MY), and 8.40 (high yeast; HY) log10 cfu of yeast/mL of in vitro fluid. Seven separate tubes were prepared for each treatment and each time point and incubated for 12 and 24h at 39 °C. At the end of the incubation period, samples were analyzed for pH, yeast number, neutral detergent fiber (NDF) digestibility, volatile fatty acids (VFA), and fatty acids (FA). We found that total viable yeast counts decreased for all treatments in in vitro incubations but were still relatively high (5.3 log10 cfu of yeasts/mL) for HY after 24h of incubation. Addition of HY resulted in a lower pH and higher concentration of total VFA in culture fluid compared with other treatments. Moreover, additions of MY and HY decreased in vitro NDF digestibility compared with CTR, and the effect was greatest for HY. Overall, the biohydrogenation of dietary unsaturated FA was not altered by addition of I. orientalis and decreased over time with an increase in the accumulation of saturated FA, especially palmitic and stearic acids. We conclude that addition of I. orientalis, especially at high levels, has the potential to reduce in vitro NDF digestion and alter other aspects of ruminal fermentations. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All
Yeast as a Heterologous Model System to Uncover Type III Effector Function.
Directory of Open Access Journals (Sweden)
Crina Popa
2016-02-01
Full Text Available Type III effectors (T3E are key virulence proteins that are injected by bacterial pathogens inside the cells of their host to subvert cellular processes and contribute to disease. The budding yeast Saccharomyces cerevisiae represents an important heterologous system for the functional characterisation of T3E proteins in a eukaryotic environment. Importantly, yeast contains eukaryotic processes with low redundancy and are devoid of immunity mechanisms that counteract T3Es and mask their function. Expression in yeast of effectors from both plant and animal pathogens that perturb conserved cellular processes often resulted in robust phenotypes that were exploited to elucidate effector functions, biochemical properties, and host targets. The genetic tractability of yeast and its amenability for high-throughput functional studies contributed to the success of this system that, in recent years, has been used to study over 100 effectors. Here, we provide a critical view on this body of work and describe advantages and limitations inherent to the use of yeast in T3E research. "Favourite" targets of T3Es in yeast are cytoskeleton components and small GTPases of the Rho family. We describe how mitogen-activated protein kinase (MAPK signalling, vesicle trafficking, membrane structures, and programmed cell death are also often altered by T3Es in yeast and how this reflects their function in the natural host. We describe how effector structure-function studies and analysis of candidate targeted processes or pathways can be carried out in yeast. We critically analyse technologies that have been used in yeast to assign biochemical functions to T3Es, including transcriptomics and proteomics, as well as suppressor, gain-of-function, or synthetic lethality screens. We also describe how yeast can be used to select for molecules that block T3E function in search of new antibacterial drugs with medical applications. Finally, we provide our opinion on the limitations
Yeasts from Different Habitats and Their Potential as Biocontrol Agents
Directory of Open Access Journals (Sweden)
Julia Pretscher
2018-04-01
Full Text Available Ever since plant diseases began causing losses in viticulture, the control of phytopathogenic fungi has become of vital interest for winemakers. The occurrence of novel pests, fungicide resistance, and changed consumer expectations have led to an enormous demand for novel plant protection strategies. As part of integrated protection measures, antagonistic microorganisms have been investigated to a large extent. Such microorganisms can be applied not only in conventional, but also in organic farming as biological control agents (BCA. Particularly, yeasts were found to be interesting candidates for the development of BCA. Many of these eukaryotic microorganisms are found as part of the phylloplane microflora. In this study, we assessed a set of 38 yeast isolates from different habitats, including the guts of termites, for inhibitory effects against some phytopathogenic fungi that have received less attention in earlier studies. The majority of yeasts were found to interfere with fungi infecting grapevine (Eutypa lata, Botrytis cinerea, and Roesleria subterranea, stone fruits (Monilinia fructicola, or rice (Magnaporte oryzae, as well in vitro and in model experiment on fruits. Although most yeast strains secreted glycoside hydrolases and proteases, attempts to demonstrate direct antagonistic activities of lytic enzymes failed. However, in culture filtrates of the termite yeast Papiliotrema odontotermitis OO5, a low molecular thermostable antagonistic factor was detected. Iron depletion as a BCA mechanism was confirmed for strains of Metschnikowia pulcherrima but not for other yeasts.
Directory of Open Access Journals (Sweden)
Ľuboš Harangozo
2012-02-01
Full Text Available The yeast Saccharomyces cerevisiae is the best known microorganism and therefore widely used in many branches of industry. This study aims to investigate the accumulation of three inorganic zinc salts. Our research presents the ability of this yeast to absorb zinc from liquid medium and such enriched biomass use as a potential source of microelements in animal and/or human nutrition. It was found that the addition of different zinc forms, i.e. zinc nitrate, zinc sulphate and zinc chloride in fixed concentrations of 0, 25, 50 and 100 mg.100 ml-1 did not affect the amount of dry yeast biomass yielded, i.e. 1.0 – 1.2 g of yeast cells from 100 ml of cultivation medium, while higher presence of zinc solutions caused significantly lower yield of yeast biomass. The highest amount of zinc in yeast cells was achieved when added in the form of zinc nitrate in concentration of 200 mg.100 ml-1 YPD medium. The increment of intracellular zinc was up to 18.5 mg.g-1 of yeast biomass.
Yeast identification: reassessment of assimilation tests as sole universal identifiers.
Spencer, J; Rawling, S; Stratford, M; Steels, H; Novodvorska, M; Archer, D B; Chandra, S
2011-11-01
To assess whether assimilation tests in isolation remain a valid method of identification of yeasts, when applied to a wide range of environmental and spoilage isolates. Seventy-one yeast strains were isolated from a soft drinks factory. These were identified using assimilation tests and by D1/D2 rDNA sequencing. When compared to sequencing, assimilation test identifications (MicroLog™) were 18·3% correct, a further 14·1% correct within the genus and 67·6% were incorrectly identified. The majority of the latter could be attributed to the rise in newly reported yeast species. Assimilation tests alone are unreliable as a universal means of yeast identification, because of numerous new species, variability of strains and increasing coincidence of assimilation profiles. Assimilation tests still have a useful role in the identification of common species, such as the majority of clinical isolates. It is probable, based on these results, that many yeast identifications reported in older literature are incorrect. This emphasizes the crucial need for accurate identification in present and future publications. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.
Occurrence and growth of yeasts in processed meat products - implications for potential spoilage
DEFF Research Database (Denmark)
Nielsen, Dennis Sandris; Jacobsen, Tomas; Jespersen, Lene
2008-01-01
of the processed meat products. The yeast microflora was complex with 4-12 different species isolated from the different production sites. In general, Candida zeylanoides, Debaryomyces hansenii and the newly described Candida alimentaria were found to be the dominant yeast species. In addition, three putatively......Spoilage of meat products is in general attributed to bacteria but new processing and storage techniques inhibiting growth of bacteria may provide opportunities for yeasts to dominate the microflora and cause spoilage of the product. With the aim of obtaining a deeper understanding of the potential...... role of yeast in spoilage of five different processed meat products (bacon, ham, salami and two different liver patés), yeasts were isolated, enumerated and identified during processing, in the final product and in the final product at the end of shelf life. Yeasts were isolated along the bacon...
New yeast-based approaches in production of palmitoleic acid
Czech Academy of Sciences Publication Activity Database
Kolouchová, I.; Sigler, Karel; Schreiberová, O.; Masák, J.; Řezanka, Tomáš
2015-01-01
Roč. 192, SEP 2015 (2015), s. 726-734 ISSN 0960-8524 R&D Projects: GA ČR(CZ) GAP503/11/0215; GA ČR GA14-00227S Institutional support: RVO:61388971 Keywords : Oleaginous yeasts * Non-oleaginous yeasts * Palmitoleic acid Subject RIV: EE - Microbiology, Virology Impact factor: 4.917, year: 2015
Characterisation of the nascent polypeptide-associated complex in fission yeast
DEFF Research Database (Denmark)
Andersen, Katrine M; Semple, Colin A; Hartmann-Petersen, Rasmus
2007-01-01
with other cell proteins, but has also been found to associate with DNA junctions, and to be involved in other processes including transcription regulation and mitochondrial protein import.Here, we characterize NAC in fission yeast. We find that NAC is associated with ribosomes, while a significant fraction...... defects in protein degradation. Accordingly, we find that the NAC UBA domain belongs to an ancient and distinct subgroup of the UBA family. In contrast to the situation with budding yeast, fission yeast cells devoid of NAC were not temperature sensitive. However, they displayed resistance to the amino...