WorldWideScience

Sample records for carotenogenic basidiomycetous yeasts

  1. Proteomic analysis of the carotenogenic yeast Xanthophyllomyces dendrorhous

    Directory of Open Access Journals (Sweden)

    Baeza Marcelo

    2011-06-01

    Full Text Available Abstract Background The yeast Xanthophyllomyces dendrorhous is used for the microbiological production of the antioxidant carotenoid astaxanthin. In this study, we established an optimal protocol for protein extraction and performed the first proteomic analysis of the strain ATCC 24230. Protein profiles before and during the induction of carotenogenesis were determined by two-dimensional polyacrylamide gel electrophoresis and proteins were identified by mass spectrometry. Results Among the approximately 600 observed protein spots, 131 non-redundant proteins were identified. Proteomic analyses allowed us to identify 50 differentially expressed proteins that fall into several classes with distinct expression patterns. These analyses demonstrated that enzymes related to acetyl-CoA synthesis were more abundant prior to carotenogenesis. Later, redox- and stress-related proteins were up-regulated during the induction of carotenogenesis. For the carotenoid biosynthetic enzymes mevalonate kinase and phytoene/squalene synthase, we observed higher abundance during induction and/or accumulation of carotenoids. In addition, classical antioxidant enzymes, such as catalase, glutathione peroxidase and the cytosolic superoxide dismutases, were not identified. Conclusions Our results provide an overview of potentially important carotenogenesis-related proteins, among which are proteins involved in carbohydrate and lipid biosynthetic pathways as well as several redox- and stress-related proteins. In addition, these results might indicate that X. dendrorhous accumulates astaxanthin under aerobic conditions to scavenge the reactive oxygen species (ROS generated during metabolism.

  2. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  3. Basidiomycete yeasts in the cortex of ascomycete macrolichens.

    Science.gov (United States)

    Spribille, Toby; Tuovinen, Veera; Resl, Philipp; Vanderpool, Dan; Wolinski, Heimo; Aime, M Catherine; Schneider, Kevin; Stabentheiner, Edith; Toome-Heller, Merje; Thor, Göran; Mayrhofer, Helmut; Johannesson, Hanna; McCutcheon, John P

    2016-07-29

    For over 140 years, lichens have been regarded as a symbiosis between a single fungus, usually an ascomycete, and a photosynthesizing partner. Other fungi have long been known to occur as occasional parasites or endophytes, but the one lichen-one fungus paradigm has seldom been questioned. Here we show that many common lichens are composed of the known ascomycete, the photosynthesizing partner, and, unexpectedly, specific basidiomycete yeasts. These yeasts are embedded in the cortex, and their abundance correlates with previously unexplained variations in phenotype. Basidiomycete lineages maintain close associations with specific lichen species over large geographical distances and have been found on six continents. The structurally important lichen cortex, long treated as a zone of differentiated ascomycete cells, appears to consistently contain two unrelated fungi.

  4. Molecular Characterization and Functional Analysis of Cytochrome b5 Reductase (CBR Encoding Genes from the Carotenogenic Yeast Xanthophyllomyces dendrorhous.

    Directory of Open Access Journals (Sweden)

    María Soledad Gutiérrez

    Full Text Available The eukaryotic microsomal cytochrome P450 systems consist of a cytochrome P450 enzyme (P450 and a cytochrome P450 redox partner, which generally is a cytochrome P450 reductase (CPR that supplies electrons from NADPH. However, alternative electron donors may exist such as cytochrome b5 reductase and cytochrome b5 (CBR and CYB5, respectively via, which is NADH-dependent and are also anchored to the endoplasmic reticulum. In the carotenogenic yeast Xanthophyllomyces dendrorhous, three P450-encoding genes have been described: crtS is involved in carotenogenesis and the CYP51 and CYP61 genes are both implicated in ergosterol biosynthesis. This yeast has a single CPR (encoded by the crtR gene, and a crtR- mutant does not produce astaxanthin. Considering that this mutant is viable, the existence of alternative cytochrome P450 electron donors like CBR and CYB5 could operate in this yeast. The aim of this work was to characterize the X. dendrorhous CBR encoding gene and to study its involvement in P450 reactions in ergosterol and carotenoid biosynthesis. Two CBRs genes were identified (CBR.1 and CBR.2, and deletion mutants were constructed. The two mutants and the wild-type strain showed similar sterol production, with ergosterol being the main sterol produced. The crtR- mutant strain produced a lower proportion of ergosterol than did the parental strain. These results indicate that even though one of the two CBR genes could be involved in ergosterol biosynthesis, crtR complements their absence in the cbr- mutant strains, at least for ergosterol production. The higher NADH-dependent cytochrome c reductase activity together with the higher transcript levels of CBR.1 and CYB5 in the crtR- mutant as well as the lower NADH-dependent activity in CBS-cbr.1- strongly suggest that CBR.1-CYB5 via participates as an alternative electron donor pathway for P450 enzymes involved in ergosterol biosynthesis in X. dendrorhous.

  5. Molecular Characterization and Functional Analysis of Cytochrome b5 Reductase (CBR) Encoding Genes from the Carotenogenic Yeast Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Gutiérrez, María Soledad; Rojas, María Cecilia; Sepúlveda, Dionisia; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2015-01-01

    The eukaryotic microsomal cytochrome P450 systems consist of a cytochrome P450 enzyme (P450) and a cytochrome P450 redox partner, which generally is a cytochrome P450 reductase (CPR) that supplies electrons from NADPH. However, alternative electron donors may exist such as cytochrome b5 reductase and cytochrome b5 (CBR and CYB5, respectively) via, which is NADH-dependent and are also anchored to the endoplasmic reticulum. In the carotenogenic yeast Xanthophyllomyces dendrorhous, three P450-encoding genes have been described: crtS is involved in carotenogenesis and the CYP51 and CYP61 genes are both implicated in ergosterol biosynthesis. This yeast has a single CPR (encoded by the crtR gene), and a crtR- mutant does not produce astaxanthin. Considering that this mutant is viable, the existence of alternative cytochrome P450 electron donors like CBR and CYB5 could operate in this yeast. The aim of this work was to characterize the X. dendrorhous CBR encoding gene and to study its involvement in P450 reactions in ergosterol and carotenoid biosynthesis. Two CBRs genes were identified (CBR.1 and CBR.2), and deletion mutants were constructed. The two mutants and the wild-type strain showed similar sterol production, with ergosterol being the main sterol produced. The crtR- mutant strain produced a lower proportion of ergosterol than did the parental strain. These results indicate that even though one of the two CBR genes could be involved in ergosterol biosynthesis, crtR complements their absence in the cbr- mutant strains, at least for ergosterol production. The higher NADH-dependent cytochrome c reductase activity together with the higher transcript levels of CBR.1 and CYB5 in the crtR- mutant as well as the lower NADH-dependent activity in CBS-cbr.1- strongly suggest that CBR.1-CYB5 via participates as an alternative electron donor pathway for P450 enzymes involved in ergosterol biosynthesis in X. dendrorhous.

  6. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    OpenAIRE

    Sampaio, José Paulo; Libkind, Diego; Ruffini, Alejandra; Alves, Leonor; van Broock,Maria

    2006-01-01

    Applied and Environmental Microbiology, Vol. 73, No.4 Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with ...

  7. Characterization of basidiomycetous yeasts in hypersaline soils of the Urmia Lake National Park, Iran.

    Science.gov (United States)

    Mokhtarnejad, Lachin; Arzanlou, Mahdi; Babai-Ahari, Asadollah; Di Mauro, Simone; Onofri, Andrea; Buzzini, Pietro; Turchetti, Benedetta

    2016-11-01

    Urmia Lake, located in northwest Iran, is an oligotrophic and extremely hypersaline habitat that supports diverse forms of life. Owing to its unique biodiversity and special environmental conditions, Urmia Lake National Park has been designated as one of the biosphere reserves by UNESCO. This study was aimed to characterize basidiomycetous yeasts in hypersaline soils surrounding the Urmia Lake National Park using a polyphasic combination of molecular and physiological data. Soil samples were collected from eight sites in Lake Basin and six islands insides the lake. Yeast strains were identified by sequencing the D1/D2 domains of the 26S rRNA gene. When D1/D2 domain sequencing did not resolve the identity of the species, strain identification was obtained by ITS 1 & 2 sequencing. Twenty-one species belonging to the genera Cystobasidium, Holtermanniella, Naganishia, Rhodotorula, Saitozyma, Solicoccozyma, Tausonia, Vanrija, and Vishniacozyma were identified. Solicoccozyma aeria represented the dominant species. The ability of isolates to grow at 10 and 15 % of NaCl was checked; about two-thirds of the strains grew at 10 %, while about 13 % of the isolates grew in medium with 15 % NaCl. this study is the first study on the culturable yeast diversity in hypersaline soils surrounding an Asian lake.

  8. Expression of carotenogenic genes and astaxanthin production in Xanthophyllomyces dendrorhous as a function of oxygen tension.

    Science.gov (United States)

    Wu, Wei; Lu, Mingbo; Yu, Longjiang

    2011-01-01

    This report gives an insight into the specific changes in the transcription of four key carotenogenic genes [encoding geranylgeranyl diphosphate synthase (crtE), phytoene desaturase (crtI), phytoene synthase lycopene cyclase (crtYB), and astaxanthin synthase (ast), respectively] in Xanthophyllomyces dendrorhous cultures, with regard to dissolved oxygen (DO) contents of 10%, 25%, and 40% air saturation, respectively. 25% DO proved to be the most beneficial for yeast growth, transcription of carotenogenic genes, and astaxanthin content.

  9. Rhodotorula subericola sp. nov., an anamorphic basidiomycetous yeast species isolated from bark of Quercus suber (cork oak).

    Science.gov (United States)

    Belloch, C; Villa-Carvajal, M; Alvarez-Rodríguez, M L; Coque, J J R

    2007-07-01

    Two yeasts strains, Y-31(T) and Y-20B, pertaining to a previously unknown yeast species were isolated from bark of cork oak in Spain. Physiological characterization revealed a pattern of assimilation of carbon and nitrogen compounds compatible with members of the genus Rhodotorula. From sequence analysis of the D1/D2 region of the 26S rRNA gene, Rhodotorula cycloclastica and Rhodotorula philyla were related to the unknown species. Phylogenetic reconstruction based on the D1/D2 region of the 26S rRNA gene showed that the novel species clustered in a branch together with R. cycloclastica. The name Rhodotorula subericola sp. nov. is proposed, with isolate Y-31(T) (=CECT 11976(T)=CBS 10442(T)) the type strain of this novel taxon in the Microbotryum lineage, subclass Microbotryomycetidae, class Urediniomycetes of basidiomycetous yeasts.

  10. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-02-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework.

  11. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  12. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Verwaal, R.; Wang, J.; Meijnen, J.P.; Visser, H.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2007-01-01

    To determine whether Saccharomyces cerevisiae can serve as a host for efficient carotenoid and especially ß-carotene production, carotenogenic genes from the carotenoid-producing yeast Xanthophyllomyces dendrorhous were introduced and overexpressed in S. cerevisiae. Because overexpression of these g

  13. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  14. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  15. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  16. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Verwaal, René; Wang, Jing; Meijnen, Jean-Paul; Visser, Hans; Sandmann, Gerhard; van den Berg, Johan A; van Ooyen, Albert J J

    2007-07-01

    To determine whether Saccharomyces cerevisiae can serve as a host for efficient carotenoid and especially beta-carotene production, carotenogenic genes from the carotenoid-producing yeast Xanthophyllomyces dendrorhous were introduced and overexpressed in S. cerevisiae. Because overexpression of these genes from an episomal expression vector resulted in unstable strains, the genes were integrated into genomic DNA to yield stable, carotenoid-producing S. cerevisiae cells. Furthermore, carotenoid production levels were higher in strains containing integrated carotenogenic genes. Overexpression of crtYB (which encodes a bifunctional phytoene synthase and lycopene cyclase) and crtI (phytoene desaturase) from X. dendrorhous was sufficient to enable carotenoid production. Carotenoid production levels were increased by additional overexpression of a homologous geranylgeranyl diphosphate (GGPP) synthase from S. cerevisiae that is encoded by BTS1. Combined overexpression of crtE (heterologous GGPP synthase) from X. dendrorhous with crtYB and crtI and introduction of an additional copy of a truncated 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene (tHMG1) into carotenoid-producing cells resulted in a successive increase in carotenoid production levels. The strains mentioned produced high levels of intermediates of the carotenogenic pathway and comparable low levels of the preferred end product beta-carotene, as determined by high-performance liquid chromatography. We finally succeeded in constructing an S. cerevisiae strain capable of producing high levels of beta-carotene, up to 5.9 mg/g (dry weight), which was accomplished by the introduction of an additional copy of crtI and tHMG1 into carotenoid-producing yeast cells. This transformant is promising for further development toward the biotechnological production of beta-carotene by S. cerevisiae.

  17. Ubc2, an Ortholog of the Yeast Ste50p Adaptor, Possesses a Basidiomycete-Specific Carboxy terminal Extension Essential for Pathogenicity Independent of Pheromone Response.

    Science.gov (United States)

    Proteins involved in the MAP kinase pathway controlling mating, morphogenesis and pathogenicity have been identified previously in the fungus Ustilago maydis. One of these, the Ubc2 adaptor protein, possesses a basidiomycete-specific structure. In addition to containing SAM and RA domains typical of...

  18. Cryptococcus ibericus sp. nov., Cryptococcus aciditolerans sp. nov. and Cryptococcus metallitolerans sp. nov., a new ecoclade of anamorphic basidiomycetous yeast species from an extreme environment associated with acid rock drainage in São Domingos pyrite mine, Portugal.

    Science.gov (United States)

    Gadanho, Mário; Sampaio, José Paulo

    2009-09-01

    In this report, we describe three novel asexual basidiomycetous yeast species, Cryptococcus aciditolerans sp. nov. (type strain CBS 10872T=SDY 081T), Cryptococcus ibericus sp. nov. (type strain CBS 10871T=SDY 022T) and Cryptococcus metallitolerans sp. nov. (type strain CBS 10873T=SDY 190T), which were isolated from acid rock drainage collected at the São Domingos mine in southern Portugal. Phylogenetic analysis of molecular sequence data indicated that the novel species belong to the order Filobasidiales of the class Tremellomycetes and form a well-separated clade, next to Cryptococcus gastricus and Cryptococcus gilvescens. Since the novel species also share a peculiar ecology, being able to thrive under extreme environmental conditions characterized by very low pH and high concentrations of heavy metals, we designate this combination of phylogenetic and ecological characteristics as an ecoclade.

  19. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of th

  20. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    OpenAIRE

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of the D1D2 region of the large subunit (26S) and of the ITS region of ribosomal DNA showed relationship to the Bulleromyces clade of the genus Cryptococcus (order Tremellales) with some Tremella spp. a...

  1. Systematics of the anamorphic basidiomycetous yeast genus Trichosporon Behrend with the description of the five novel species: Trichosporon vadense, T. smithiae, T. dehoogii, T. scarabaeorum and T. gamsii

    NARCIS (Netherlands)

    Middelhoven, W.J.; Scorzetti, G.; Fell, J.W.

    2004-01-01

    Phylogenetic trees of the anamorphic basichomycetous yeast genus Trichosporon Behrend, based on molecular sequence analysis of the internal transcribed spacer region and the D1/D2 region of the large subunit of ribosomal (26S) DNA, are presented. This study includes three novel species from soils, T

  2. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologically resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds.

    Science.gov (United States)

    Middelhoven, Wouter J

    2005-02-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of the D1D2 region of the large subunit (26S) and of the ITS region of ribosomal DNA showed relationship to the Bulleromyces clade of the genus Cryptococcus (order Tremellales) with some Tremella spp. as the closest relatives. A traditional morphological and physiological description of the strain is given. Data on the assimilation of some C2 compounds and polysaccharides are provided and compared with those of other type strains of novel species of the C. laurentii complex.

  3. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  4. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  5. Effect of Different Carbon Source on Expression of Carotenogenic Genes and Astaxanthin Production in Xanthophyllomyces dendrorhous

    Directory of Open Access Journals (Sweden)

    Wei Wu

    2013-10-01

    Full Text Available The present research gives an insight into astaxanthin production, as well as transcription differences of four key carotenogenic genes, in Xanthophyllomyces dendrorhous when cultured with various carbon sources and soybean oil as co-substrates. Glucose was found to be the carbon source with best culture growth and astaxanthin production and the addition of 2% (v/v soybean oil resulted in even higher astaxanthin producing. In addition, four carotenogenic genes encoding geranylgeranyl diphosphate synthase (crtE, phytoene desaturase (crtl, phytoene synthase lycopene cyclase(crtYB, and astaxanthin synthetase (ast, respectively, were demonstrated to be associated with different transcription levels under various substrates. The present study suggests the effectiveness of manipulating the metabolic regulation by using different carbon sources, in order to improve the production of astaxanthin.

  6. Plant-polysaccharide-degrading enzymes from basidiomycetes

    NARCIS (Netherlands)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P; Mäkelä, Miia R; van den Brink, J.

    2014-01-01

    SUMMARY: Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-poly

  7. Analysis of carotenogenic genes promoters and WRKY transcription factors in response to salt stress in Dunaliella bardawil

    Science.gov (United States)

    Liang, Ming-Hua; Jiang, Jian-Guo

    2017-01-01

    The unicellular alga Dunaliella bardawil is a highly salt-tolerant organism, capable of accumulating glycerol, glycine betaine and β-carotene under salt stress, and has been considered as an excellent model organism to investigate the molecular mechanisms of salt stress responses. In this study, several carotenogenic genes (DbCRTISO, DbZISO, DbLycE and DbChyB), DbBADH genes involved in glycine betaine synthesis and genes encoding probable WRKY transcription factors from D. bardawil were isolated, and promoters of DbCRTISO and DbChyB were cloned. The promoters of DbPSY, DbLycB, DbGGPS, DbCRTISO and DbChyB contained the salt-regulated element (SRE), GT1GMSCAM4, while the DbGGPS promoter has another SRE, DRECRTCOREAT. All promoters of the carotenogenic genes had light-regulated elements and W-box cis-acting elements. Most WRKY transcription factors can bind to the W-box, and play roles in abiotic stress. qRT-PCR analysis showed that salt stress up-regulated both carotenogenic genes and WRKY transcription factors. In contrast, the transcription levels of DbBADH showed minor changes. In D. bardawil, it appears that carotenoid over-accumulation allows for the long-term adaptation to salt stress, while the rapid modulation of glycine betaine biosynthesis provides an initial response. PMID:28128303

  8. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  9. Ethanol induced astaxanthin accumulation and transcriptional expression of carotenogenic genes in Haematococcus pluvialis.

    Science.gov (United States)

    Wen, Zewen; Liu, Zhiyong; Hou, Yuyong; Liu, Chenfeng; Gao, Feng; Zheng, Yubin; Chen, Fangjian

    2015-10-01

    Haematococcus pluvialis is one of the most promising natural sources of astaxanthin. However, inducing the accumulation process has become one of the primary obstacles in astaxanthin production. In this study, the effect of ethanol on astaxanthin accumulation was investigated. The results demonstrated that astaxanthin accumulation occurred with ethanol addition even under low-light conditions. The astaxanthin productivity could reach 11.26 mg L(-1) d(-1) at 3% (v/v) ethanol, which was 2.03 times of that of the control. The transcriptional expression patterns of eight carotenogenic genes were evaluated using real-time PCR. The results showed that ethanol greatly enhanced transcription of the isopentenyl diphosphate (IPP) isomerase genes (ipi-1 and ipi-2), which were responsible for isomerization reaction of IPP and dimethylallyl diphosphate (DMAPP). This finding suggests that ethanol induced astaxanthin biosynthesis was up-regulated mainly by ipi-1 and ipi-2 at transcriptional level, promoting isoprenoid synthesis and substrate supply to carotenoid formation. Thus ethanol has the potential to be used as an effective reagent to induce astaxanthin accumulation in H. pluvialis.

  10. The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.

    Science.gov (United States)

    Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-yu; Quintanilla, Rene H; Banuett, Flora

    2014-05-01

    Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi.

  11. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  12. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  13. Cryopreservation of basidiomycete strains using perlite.

    Science.gov (United States)

    Homolka, L; Lisá, L; Eichlerová, I; Nerud, F

    2001-12-01

    A new alternative method using perlite as a particulate solid carrier in the growth medium with a cryoprotectant was successfully tested for cryopreservation of several basidiomycete species from different genera (Armillaria, Pleurotus, Pluteus, Polyporus) which failed to survive or retain their properties in cryopreservation procedures routinely used in our laboratory. Frozen basidiomycete strains were kept in cryovials submerged in liquid nitrogen and were either immediately after the freezing process or after a 6-month storage thawed and checked for viability, purity and changes in growth, morphology and biochemical characteristics. All cultures survived the cryopreservation procedure and no negative effects of cryopreservation by this method have been observed after 6 months of storage in liquid nitrogen.

  14. Differential expression of carotenogenic genes, associated changes on astaxanthin production and photosynthesis features induced by JA in H. pluvialis.

    Directory of Open Access Journals (Sweden)

    Zhengquan Gao

    Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.

  15. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  16. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  17. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  18. Polyphasic identification of yeasts isolated from bark of cork oak during the manufacturing process of cork stoppers.

    Science.gov (United States)

    Villa-Carvajal, Mercedes; Coque, Juan José R; Alvarez-Rodríguez, María Luísa; Uruburu, Federico; Belloch, Carmela

    2004-05-01

    A two-step protocol was used for the identification of 52 yeasts isolated from bark of cork oak at initial stages of the manufacturing process of cork stoppers. The first step in the identification was the separation of the isolates into groups by their physiological properties and RFLPs of the ITS-5.8S rRNA gene. The second step was the sequencing of the D1/D2 domains of the 26S rRNA gene of selected isolates representing the different groups. The results revealed a predominance of basidiomycetous yeasts (11 species), while only two species represented the ascomycetous yeasts. Among the basidiomycetous yeasts, members representing the species Rhodosporidium kratochvilovae and Rhodotorula nothofagi, that have been previously isolated from plant material, were the most abundant. Yeasts pertaining to the species Debaryomyces hansenii var. fabryii, Rhodotorula mucilaginosa and Trichosporon mucoides were isolated in small numbers.

  19. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  20. Immuno-assay techniques for detecting yeasts in foods.

    Science.gov (United States)

    Middelhoven, W J; Notermans, S

    1993-06-25

    A brief literature review on immuno-assay of yeast cell wall antigens is given. Special attention is paid to extracellular, thermostable yeast antigens (EPS), which are released to the growth medium by many yeast species. The EPS of Saccharomyces cerevisiae and of Stephanoascus ciferrii (syn. Candida ciferrii) could be specifically and sensitively detected by a sandwich ELISA, using an IgG raised in rabbits immunized with the EPS of these yeasts. The EPS ELISA of three basidiomycetous yeasts tested was not specific, that of Geotrichum candidum was genus-specific but was not sensitive. The EPS of Zygosaccharomyces bailii could be detected in a highly specific competitive ELISA but not in a sandwich ELISA or in a latex agglutination test.

  1. Recognizing filamentous basidiomycetes as agents of human disease: A review

    NARCIS (Netherlands)

    Chowdhary, A.; Kathuria, S.; Agarwal, K.; Meis, J.F.G.M.

    2014-01-01

    Filamentous basidiomycetes (BM) are common environmental fungi that have recently emerged as important human pathogens, inciting a wide array of clinical manifestations that include allergic and invasive diseases. We reviewed 218 reported global cases of BM fungi. The most common etiologic agent was

  2. Yeasts and fungi occurring in ensiled whole-crop maize and other ensiled vegetable crops.

    Science.gov (United States)

    Middelhoven, W J; de Jong, I M; de Winter, M

    1990-04-01

    The yeast flora of whole-crop maize ensiled for two weeks was predominated by Candida holmii, C. lambica, C. milleri, Hansenula anomala and Saccharomyces dairensis. Inoculation with other yeast species reported in the literature to prevail in maize or wheat silages did not alter the yeast flora. At 25 or 30 degrees C the ascomycetous fermentative species found at 20 degrees C were accompanied with ascomycetous non-fermentative fungi, i.c. Exophiala jeanselmei and Verticillium psalliotae, by the non-fermentative imperfect basidiomycetous yeast Rhodotorula mucilaginosa and by the weakly fermentative imperfect ascomycetous yeast Trichosporon adeninovorans. The yeast flora of other vegetable crops, ensiled at 20 degrees C for two weeks, was predominated by the same species that prevailed in ensiled maize, provided the crop did not contain mustard oils or menthol. If these compounds occurred in the crops, the yeast flora was predominated by nonfermentative species like Candida famata, Stephanoascus ciferrii, Rhodotorula minuta, Rh. rubra and Trichosporon cutaneum.

  3. Antimicrobial activity of submerged cultures of Chilean basidiomycetes.

    Science.gov (United States)

    Aqueveque, Pedro; Anke, Timm; Saéz, Katia; Silva, Mario; Becerra, José

    2010-10-01

    This study is part of a screening program aimed at searching for bioactive metabolites from Chilean basidiomycetes. Submerged cultivation of fungal mycelia in liquid media was evaluated for antimicrobial activity. A total of 148 strains were obtained in vitro. The extracts produced from submerged cultures were evaluated against bacteria and fungi. In the primary antimicrobial assay, approximately 60% of the extracts presented positive biological activity. The highest frequencies of active strains were from the orders Agaricales (31.0%), Polyporales (20.6%), Sterales (18.3%), Boletales (11.4%), and Cortinariales (9.1%). Antifungal activity was more pronounced than antibacterial activity. Twelve extracts that exhibited strong antimicrobial activity showed minimum inhibitory concentration (MIC) values of 50 µL/mL against Bacillus brevis and 25∼50 µL/mL against Penicillium notatum and Paecilomyces variotii. The biological activity of some strains did not vary considerably, regardless of the substrate or collection site whereas, for others, it showed marked variations. Differences in antimicrobial activities observed in the different fungal genera suggested that the ability to produce bioactive compounds is not homogenously distributed among basidiomycetes. The information obtained from this study reveals that Chilean basidiomycetes are able to generate small and/or large variations in the normal pathway of compounds production. Thus, it is necessary to evaluate this biological and chemical wealth, which could be an unsuspected reservoir of new and potentially useful molecules.

  4. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-12-01

    Full Text Available ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP, which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need of eco-efficient solutions for its colored effluents. White rot basidiomycetous fungi comprise the only group of organisms known to completely degrade lignin. Ligninolytic enzymes have potential applications in a large number of fields, including the chemical, fuel, food, agricultural, paper, textile, cosmetic industrial sectors and more. This ligninolytic system of white-rot fungi is also directly involved in the degradation of various xenobiotic compounds apart from textile dyes. Their capacities to remove xenobiotic substances make them a useful tool for bioremediation purposes. This paper reviews involvement of ligninolytic enzymes of white rot basidiomycetes in the degradation of textiles dyes and xenobiotic compounds for their industrial and biotechnological applications.

  5. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment.

  6. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively.

  7. The influence of Aster x salignus Willd. Invasion on the diversity of soil yeast communities

    Science.gov (United States)

    Glushakova, A. M.; Kachalkin, A. V.; Chernov, I. Yu.

    2016-07-01

    The annual dynamics of yeast communities were studied in the soddy-podzolic soil under the thickets of Aster x salignus Willd., one of the widespread invasive plant species in central Russia. Yeast groups in the soils under continuous aster thickets were found to differ greatly from the yeast communities in the soils under the adjacent indigenous meadow vegetation. In both biotopes the same species ( Candida vartiovaarae, Candida sake, and Cryptococcus terreus) are dominants. However, in the soils under indigenous grasses, eurybiontic yeasts Rhodotorula mucilaginosa, which almost never occur in the soil under aster, are widespread. In the soil under aster, the shares of other typical epiphytic and pedobiontic yeast fungi (ascomycetic species Wickerhamomyces aniomalus, Barnettozyma californica and basidiomycetic species Cystofilobasidium macerans, Guehomyces pullulans) significantly increase. Thus, the invasion of Aster x salignus has a clear effect on soil yeast complexes reducing their taxonomic and ecological diversity.

  8. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    proteins. Several TCS proteins are highly conserved among all the basidiomycetes, and other TCS proteins appear to be specific to particular species of basidiomycetes. Moreover, some species appear to have developed a unique histidine kinase group with unusual domain architecture, the Dual-histidine...

  9. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The deduce

  10. Antarctic Yeasts: Biodiversity and Potential Applications

    Science.gov (United States)

    Shivaji, S.; Prasad, G. S.

    This review is an attempt in cataloguing the diversity of yeasts in Antarctica, highlight their biotechnological potential and understand the basis of adaptation to low temperature. As of now several psychrophilic and psychrotolerant yeasts from Antarctic soils and marine waters have been characterized with respect to their growth characteristics, ecological distribution and taxonomic significance. Interestingly most of these species belonged to basidiomycetous yeasts which as a group are known for their ability to circumvent and survive under stress conditions. Simultaneously their possible role as work horses in the biotechnological industry was recognized due to their ability to produce novel enzymes and biomolecules such as agents for the breakdown of xenobiotics, and novel pharmaceutical chemi cals. The high activity of psychrophilic enzymes at low and moderate temperatures offers potential economic benefits. As of now lipases from Pseudozyma antarctica have been extensively studied to understand their unique thermal stability at 90°C and also because of its use in the pharmaceutical, agriculture, food, cosmetics and chemical industry. A few of the other enzymes which have been studied include extracellular alpha-amylase and glucoamylase from the yeast Pseudozyma antarctica (Candida antarctica), an extra-cellular protease from Cryptococcus humicola, an aspartyl proteinase from Cryptococcus humicola, a novel extracellular subtilase from Leucosporidium antarcticum, and a xylanase from Cryptococcus adeliensis

  11. Cryptococcus friedmannii, a new species of yeast from the Antarctic

    Science.gov (United States)

    Vishniac, H. S.

    1985-01-01

    Cryptococcus friedmannii Vishniac sp. nov. from an Antarctic cryptoendolithic community is a psychrophilic basidioblastomycete characterized by cream-colored colonies of cells with smooth, layered walls, budding monopolarly, producing amylose and extracellular proteinase, utilizing nitrate and D-alanine (inter alia) as nitrogen sources and L-arabinose, arbutin, cellobiose, D-glucuronate, maltose, melezitose, salicin, soluble starch, trehalose, and D-xylose as carbon sources. This species differs from all other basidiomycetous yeasts in possessing the following combination of characters: amylose production (positive), assimilation of cellobiose (positive), D-galactose (negative), myo-inositol (negative), D-mannitol (negative), and sucrose (negative).

  12. DESTRUCTION OF XENOBIOTICS BY CULTURE FILTRATE FROM XYLOTROPHIC BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2015-12-01

    Full Text Available The article deals with the efficiency of pollutants biodegradation by xylotrophic basidiomycetes submerged cultures grown on standard glucose-peptone medium (GPM. The efficiency of pollutants biodegradation was determined by the model compound – dye Methyl Orange. The purpose of the work is screening of 19 species 81 strains xylotrophic basidiomycetes cultures on the indicator of the dye oxidative degradation efficiency and exploring the possibility of induction of this indicator by modifying the culture medium. The biodegradation efficiency was determined by following method. Assigned amount of culture filtrate (experiment or medium (control was added to the 0.001% solution of Methyl Orange in sodium acetate buffer. pH of the reaction mixture was 4.4 units. Samples were incubated at +40°C for 48 hours. Then pH of the reaction mixture was set up at 3.1 units using sodium acetate buffer and the optical density of solutions at a wavelength of 506 nm was measured. The efficiency of biodegradation was calculated by the difference of the optical density of control and experiment as a percentage. The most promising strains – F. velutipes F-1105, P. eryngii P-er, T. hirsuta Th-11 and D. quercina Dq-08 were selected. The composition of the glucose-peptone medium was modified for these strains by the introduction in the medium lignosulfonate, Tween 80, Kirk’s minerals solution and selecting the concentration of these components. According to the study for the purpose of pollutants degradation it is advisable to cultivate F. velutipes F-1105 strain on modified GPM, which further comprises at 1 l: lignosulfonate – 3.5 g; Tween 80 – 1.0 g, Kirk’s minerals solution – 70 ml; P. eryngii P-er strain – 5.0 g, 1.0 g, 70 ml; T. hirsuta Th-11 strain – 5.0 g, 1.0 g, 105 ml; and D. quercina Dq-08 strain – 6.5 g, 1.0 g, 105 ml, respectively. This allowed to increase the model compound degradation efficiency by the culture filtrate of strain F

  13. Wood-destroying Basidiomycetes, found on the elder woods in the South Urals (Orenburg Oblast, Russia

    Directory of Open Access Journals (Sweden)

    Maksim A. Safonov

    2014-09-01

    Full Text Available The article shows the results of a study of wood-destroying basidiomycetes on two species of elder trees (Alnus glutinosa, Alnus incan, growing in the South Urals (Orenburg Oblast. The comparative analysis of basidiomycetes on two species of elder trees was conducted. The reasons for structural differences of these complexes are discussed. It is consumed that the reason lies in growth conditions of the trees.

  14. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  15. Basidiomycete cryopreservation on perlite: evaluation of a new method.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2006-06-01

    A new cryopreservation method using perlite as a carrier was evaluated on a large set of mycelial cultures of basidiomycetes. The viability and some other characteristics--growth, macro- and micromorphology, and laccase production--of 442 strains were tested after 48-h and then after 3-year storage in liquid nitrogen using a perlite protocol (PP). All (100%) of them survived successfully both 48-h storage and 3-year storage in liquid nitrogen without noticeable growth and morphological changes. Also laccase production was unchanged. The viability and laccase production of a part (250) of these strains were compared with those of the strains subjected to an original agar plug protocol (OP). Using OP, 144 strains (57.6%) out of 250 survived a 3-year storage in liquid nitrogen. The results indicate that the cryopreservation protocol used significantly influences survival of the strains. Markedly better results were achieved using the PP.

  16. TOTAL ANTIOXIDANT ACTIVITY OF SOME BASIDIOMYCETES STRAINS IN GROWTH DYNAMIC

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2016-08-01

    Full Text Available The work is devoted to the study of total antioxidant activity (AOA in the growth dynamics of basidiomycetes strains in their periodic surface cultivation on glucose-peptone medium. Subjects of research are mycelium and culture filtrate (CF from 57 strains, 5 of which are belong to 5 types of Polyporales order, and 52 of which are belong to the 7 types of Agaricales order. In order to study the dynamics of growth used method for determining the weight of absolutely dry biomass accumulation (ADB. Total AOA of mycological material was evaluated by inhibition of lipid peroxidation products accumulation intensity in the model oxidation reaction of Tween-80 by air oxygen. It was found that the most productive in terms of the accumulation of ADB are strains F. velutipes F-610 and P. eryngii P-er. Lowest values of ADB accumulation recorded for strains P. ostreatus P-14 and P-192 and P. citrinopileatus P sіtr. Were selected the most productive strains of Basidiomycetes for the level of total AOA in mycelium and CF. There are strains P. eryngii P-er, P. citrinopileatus P sіtr, P. ostreatus P-035, F. hepatica Fh-08, A. cylindracea 960, P. ostreatus P-081, P-082, P-087, P. citrinopileatus P sіtr. Has not been established the dependence between the growth and the antioxidant activity of the 9- and 12-day fungal cultures. Selected producers of natural antioxidants may be used as biological agents in biotechnology.

  17. Substrate oxidation sites in versatile peroxidase and other basidiomycete peroxidases.

    Science.gov (United States)

    Ruiz-Dueñas, Francisco J; Morales, María; García, Eva; Miki, Yuta; Martínez, María Jesús; Martínez, Angel T

    2009-01-01

    Versatile peroxidase (VP) is defined by its capabilities to oxidize the typical substrates of other basidiomycete peroxidases: (i) Mn(2+), the manganese peroxidase (MnP) substrate (Mn(3+) being able to oxidize phenols and initiate lipid peroxidation reactions); (ii) veratryl alcohol (VA), the typical lignin peroxidase (LiP) substrate; and (iii) simple phenols, which are the substrates of Coprinopsis cinerea peroxidase (CIP). Crystallographic, spectroscopic, directed mutagenesis, and kinetic studies showed that these 'hybrid' properties are due to the coexistence in a single protein of different catalytic sites reminiscent of those present in the other basidiomycete peroxidase families. Crystal structures of wild and recombinant VP, and kinetics of mutated variants, revealed certain differences in its Mn-oxidation site compared with MnP. These result in efficient Mn(2+) oxidation in the presence of only two of the three acidic residues forming its binding site. On the other hand, a solvent-exposed tryptophan is the catalytically-active residue in VA oxidation, initiating an electron transfer pathway to haem (two other putative pathways were discarded by mutagenesis). Formation of a tryptophanyl radical after VP activation by peroxide was detected using electron paramagnetic resonance. This was the first time that a protein radical was directly demonstrated in a ligninolytic peroxidase. In contrast with LiP, the VP catalytic tryptophan is not beta-hydroxylated under hydrogen peroxide excess. It was also shown that the tryptophan environment affected catalysis, its modification introducing some LiP properties in VP. Moreover, some phenols and dyes are oxidized by VP at the edge of the main haem access channel, as found in CIP. Finally, the biotechnological interest of VP is discussed.

  18. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  19. Yeasts in high Arctic glaciers: the discovery of a new habitat for eukaryotic microorganisms.

    Science.gov (United States)

    Butinar, Lorena; Spencer-Martins, Isabel; Gunde-Cimerman, Nina

    2007-04-01

    Recently a new habitat for microbial life has been discovered at the base of polythermal glaciers. In ice from these subglacial environments so far only non-photosynthetic bacterial communities were discovered, but no eukaryotic microorganisms. We found high numbers of yeast cells, amounting to a maximum of 4,000 CFU ml(-1) of melt ice, in four different high Arctic glaciers. Twenty-two distinct species were isolated, including two new yeast species. Basidiomycetes predominated, among which Cryptococcus liquefaciens was the dominant species (ca. 90% of total). Other frequently occurring species were Cryptococcus albidus, Cryptococcus magnus, Cryptococcus saitoi and Rhodotorula mucilaginosa. The dominant yeast species were psychrotolerant, halotolerant, freeze-thaw resistant, unable to form mycelium, relatively small-sized and able to utilize a wide range of carbon and nitrogen sources. This is the first report on the presence of yeast populations in subglacial ice.

  20. Yeasts associated with fresh and frozen pulps of Brazilian tropical fruits.

    Science.gov (United States)

    Trindade, Rita C; Resende, Maria Aparecida; Silva, Claudia M; Rosa, Carlos A

    2002-08-01

    The occurrence of yeasts on ripe fruits and frozen pulps of pitanga (Eugenia uniflora L), mangaba (Hancornia speciosa Gom.), umbu (Spondias tuberosa Avr. Cam.), and acerola (Malpighia glaba L) was verified. The incidence of proteolytic, pectinolytic, and mycocinogenic yeasts on these communities was also determined. A total of 480 colonies was isolated and grouped in 405 different strains. These corresponded to 42 ascomycetous and 28 basidiomycetous species. Candida sorbosivorans, Pseudozyma antarctica, C. spandovensis-like, C. spandovensis, Kloeckera apis, C. parapsilosis, Rhodotorula graminis, Kluyveromyces marxianus, Cryptococcus laurentii, Metchnikowia sp (isolated only from pitanga ripe fruits), Issatchenkia occidentalis and C. krusei (isolated only from mangaba frozen pulps), were the most frequent species. The yeast communities from pitanga ripe fruits exhibited the highest frequency of species, followed by communities from acerola ripe fruits and mangaba frozen pulps. Yeast communities from frozen pulp and ripe fruits of umbu had the lowest number of species. Except the yeasts from pitanga, yeast communities from frozen pulp exhibited higher number of yeasts than ripe fruit communities. Mycocinogenic yeasts were found in all of the substrates studied except in communities from umbu ripe fruits and pitanga frozen pulps. Most of the yeasts found to produce mycocins were basidiomycetes and included P. antarctica, Cryptococcus albidus, C. bhutanensis-like, R. graminis and R. mucilaginosa-like from pitanga ripe fruits as well as black yeasts from pitanga and acerola ripe fruits. The umbu frozen pulps community had the highest frequency of proteolytic species. Yeasts able to hydrolyse casein at pH 5.0 represented 38.5% of the species isolated. Thirty-seven percent of yeast isolates were able to hydrolyse casein at pH 7.0. Pectinolytic yeasts were found in all of the communities studied, excepted for those of umbu frozen pulps. The highest frequency of

  1. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  2. Diversity of soil yeasts isolated from South Victoria Land, Antarctica

    Science.gov (United States)

    Connell, L.; Redman, R.; Craig, S.; Scorzetti, G.; Iszard, M.; Rodriguez, R.

    2008-01-01

    Unicellular fungi, commonly referred to as yeasts, were found to be components of the culturable soil fungal population in Taylor Valley, Mt. Discovery, Wright Valley, and two mountain peaks of South Victoria Land, Antarctica. Samples were taken from sites spanning a diversity of soil habitats that were not directly associated with vertebrate activity. A large proportion of yeasts isolated in this study were basidiomycetous species (89%), of which 43% may represent undescribed species, demonstrating that culturable yeasts remain incompletely described in these polar desert soils. Cryptococcus species represented the most often isolated genus (33%) followed by Leucosporidium (22%). Principle component analysis and multiple linear regression using stepwise selection was used to model the relation between abiotic variables (principle component 1 and principle component 2 scores) and yeast biodiversity (the number of species present at a given site). These analyses identified soil pH and electrical conductivity as significant predictors of yeast biodiversity. Species-specific PCR primers were designed to rapidly discriminate among the Dioszegia and Leucosporidium species collected in this study. ?? 2008 Springer Science+Business Media, LLC.

  3. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  4. Enhanced biodecolorization of reactive dyes by basidiomycetes under static conditions.

    Science.gov (United States)

    Bibi, Ismat; Bhatti, Haq Nawaz

    2012-04-01

    This study presents the biodecolorization potential of basidiomycete fungi Trametes hirsuta, Pycnoporus sp., and Irpex sp. for different reactive dyes viz. Reactive Red 120, Remazol Brilliant Blue R (RBBR), Reactive Orange G, and Reactive Orange 16 under static and shaking conditions. The screening trials revealed that T. hirsuta exhibited maximum potential (83.75 %) for biodecolorization of RBBR dye under static conditions after the fifth day of incubation. However, the rate of biodecolorization of RBBR dye by Pycnoporus sp. was much slow and reached maximum (81.25 %) after 15 days of incubation under shaking conditions. By process optimization, enhanced decolorization (91.2 %) of RBBR by T. hirsuta was achieved at pH 5.5 within 24 h using a defined salt medium amended with p-coumaric acid under static conditions. pH was found to be an important parameter for the enzymatic system involved in RBBR dye decolorization by T. hirsuta and Pycnoporus sp. Biodecolorization of RBBR dye was determined by a reduction in optical density at the wavelength of maximum absorbance (λ, 578 nm) by UV-vis spectrophotometer. The shift in maximum wavelength toward shorter/longer wavelength in UV-vis scanning spectrum revealed the degradation of RBBR dye into different transformation products.

  5. Protease activity in cockroach and basidiomycete allergen extracts.

    Science.gov (United States)

    Wongtim, S; Lehrer, S B; Salvaggio, J E; Horner, W E

    1993-01-01

    Inherent proteolytic activity was estimated in cockroach and basidiomycete extracts by quantifying acid soluble peptides that were released by incubating extracts with 1% bovine serum albumin as measured by Lowry (Sigma). Reference proteases released 740 (Proteinase K, 0.1 U), 248 (Trypsin, 1.0 U), and 533 micrograms/ml (Pronase, 0.5 U) of soluble peptides. American whole body cockroach extract (0.1 mg dry weight) released 330 micrograms/ml of soluble peptides, representing 13 trypsin equivalent units (TEU)/mg. Extracts from spores of the mushroom Pleurotus ostreatus released 230 micrograms/ml (0.9 TEU/mg) and Pleurotus cap extract released 112 micrograms/ml (0.5 TEU/mg). Mycelium of Pleurotus and the mushroom Psilocybe cubensis and spores of Psilocybe and the puffball Calvatia cyathiformis showed negligible amounts of proteolytic activity. The protease inhibitor phenylmethylsulfonyl flouride reduced the proteolytic activity of American whole body cockroach extract by 80% (@1 mM) and the inhibitor ethylene diaminetetraacetic acid inhibited the proteolytic activity of Pleurotus spores by 95% (@1 mM). Loss of allergen activity as determined by RAST inhibition and immunoprinting correlated with protease activity. Thus, in the preparation and handling of allergen extracts, one should employ conditions that minimize proteolysis.

  6. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  7. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  8. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  9. Polyphenolic substrates and dyes degradation by yeasts from 25 de Mayo/King George Island (Antarctica).

    Science.gov (United States)

    Rovati, José I; Pajot, Hipólito F; Ruberto, Lucas; Mac Cormack, Walter; Figueroa, Lucía I C

    2013-11-01

    Antarctica offers a range of extreme climatic conditions, such as low temperatures, high solar radiation and low nutrient availability, and constitutes one of the harshest environments on Earth. Despite that, it has been successfully colonized by ’cold-loving’ fungi, which play a key role in decomposition cycles in cold ecosystems. However, knowledge about the ecological role of yeasts in nutrient or organic matter recycling/mineralization remains highly fragmentary. The aim of this work was to study the yeast microbiota in samples collected on 25 de Mayo/King George Island regarding the scope of their ability to degrade polyphenolic substrates such as lignin and azo dyes. Sixty-one yeast isolates were obtained from 37 samples, including soil, rocks, wood and bones. Molecular analyses based on rDNA sequences revealed that 35 yeasts could be identified at the species level and could be classified in the genera Leucosporidiella, Rhodotorula, Cryptococcus, Bullera and Candida. Cryptococcus victoriae was by far the most ubiquitous species. In total, 33% of the yeast isolates examined showed significant activity for dye decolorization, 25% for laccase activity and 38% for ligninolytic activity. Eleven yeasts did not show positive activity in any of the assays performed and no isolates showed positive activity across all tested substrates. A high diversity of yeasts were isolated in this work, possibly including undescribed species and conspicuous Antarctic yeasts, most of them belonging to oligotrophic, slow-growing and metabolically diverse basidiomycetous genera.

  10. Yeast Lab

    OpenAIRE

    Lewis, Matt; Powell, Jim

    2016-01-01

    Yeast are grown in a small, capped ask, generating carbon dioxide which is trapped in an inverted jar full of colored water. The volume of carbon dioxide produced can either be measured directly or using time-lapse imagery on an iPad or similar. Students are then challenged to model the resulting data. From this exercise students gain greater understand- ing of ODE compartment models, parameter estimation, population dynamics and limiting factors.

  11. A case of sinobronchial allergic mycosis; possibility of basidiomycetous fungi as a causative antigen.

    Science.gov (United States)

    Ogawa, Haruhiko; Fujimura, Masaki; Takeuchi, Yasuo; Makimura, Koichi

    2011-01-01

    We herein report a case of sinobronchial allergic mycosis (SAM) caused by basidiomycetous (BM) fungi (probably Phanerochaete velutina). The patient with bronchial asthma that accompanied allergic fungal sinusitis (AFS) fulfilled all 6 criteria for diagnosing SAM. In this case, the BM fungus may act as an allergen, reacting continually in both the upper and lower respiratory tract. The antifungal drug (itraconazole 50 mg/day) seemed to achieve a partial response. Basidiomycetous fungi may attract attention because of the possibility as a causative antigen in this new clinical concept of SAM.

  12. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  13. Bandoniozyma gen. nov., a Genus of Fermentative and Non-Fermentative Tremellaceous Yeast Species

    Science.gov (United States)

    Landell, Melissa Fontes; Crestani, Juliana; Pagnocca, Fernando Carlos; Sette, Lara Durães; Passarini, Michel Rodrigo Zambrano; Rosa, Carlos Augusto; Brandão, Luciana R.; Pimenta, Raphael S.; Ribeiro, José Roberto; Garcia, Karina Marques; Lee, Ching-Fu; Suh, Sung-Oui; Péter, Gábor; Dlauchy, Dénes; Fell, Jack W.; Scorzetti, Gloria; Theelen, Bart; Vainstein, Marilene H.

    2012-01-01

    Background Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. Methodology/Principal Findings The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. Conclusions/Significance In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364T  =  DBVPG 4489T), Bandoniozyma aquatica sp. nov. (UFMG-DH4.20T  =  CBS 12527T  =  ATCC MYA-4876T), Bandoniozyma complexa sp. nov. (CBS 11570T  =  ATCC MYA-4603T  =  MA28aT), Bandoniozyma fermentans sp. nov. (CBS 12399T  =  NU7M71T  =  BCRC 23267T), Bandoniozyma glucofermentans sp. nov. (CBS 10381T  =  NRRL Y-48076T  =  ATCC MYA-4760T  =  BG 02-7-15-015A-1-1T), Bandoniozyma tunnelae sp. nov. (CBS 8024T  =  DBVPG 7000T), and Bandoniozyma visegradensis sp. nov. (CBS 12505T  =  NRRL Y-48783T  =  NCAIM Y.01952T). PMID:23056233

  14. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  15. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  16. Antitubercular Lanostane Triterpenes from Cultures of the Basidiomycete Ganoderma sp. BCC 16642.

    Science.gov (United States)

    Isaka, Masahiko; Chinthanom, Panida; Sappan, Malipan; Danwisetkanjana, Kannawat; Boonpratuang, Thitiya; Choeyklin, Rattaket

    2016-01-22

    Sixteen new lanostane triterpenoids (1-16), together with 26 known compounds (17-42), were isolated from cultures of the basidiomycete Ganoderma sp. BCC 16642. Antitubercular activities of these Ganoderma lanostanoids against Mycobacterium tuberculosis H37Ra were evaluated, and structure-activity relationships are proposed.

  17. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389.

    Science.gov (United States)

    Isaka, Masahiko; Palasarn, Somporn; Sappan, Malipan; Supothina, Sumalee; Boonpratuang, Thitiya

    2016-10-01

    Two new hirsutane sesquiterpenes, marasmiellins A (1) and B (2), were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher's method.

  18. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  19. EFFECT OF NITROGEN NUTRITION SOURCES ON CAROTENOIDS SYNTHESIS FOR SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2014-03-01

    Full Text Available The influence of certain nitrogen compounds - components of glucose-peptone medium (GPM on the accumulation of carotenoids by some strains was investigated by surface cultivating basidiomycetes. The total carotenoid content was set in acetone extracts of mycological material spectrophotometrically and calculated using the Vetshteyn formula. As the nitrogen-containing components used GPM with 9 compounds, such as peptone, DL-valine, L-asparagine, DL-serine, DL-tyrosine, L-proline, L-alanine, urea, NaNO3. The effect on the accumulation of specific compounds both in the mycelium and in the culture fluid of carotenoids by culturing certain strains of Basidiomycetes was identified. Adding to standard glucose-peptone medium peptone at 5 g/l causes an increase of carotenoid accumulation by strain L. sulphureus Ls-08, and in a concentration of 4 g/l by strains of F. hepatica Fh-18 and F. fomentarius Ff-1201. In order to increase the accumulation of carotenoids in the mycelium  we suggested to make a standard glucose-peptone medium with proline or valine for cultivating of L. sulphureus Ls- 08 strain; alanine for F. fomentarius Ff-1201 strain; proline, asparagine and serine - for strain Fh-18 of F. hepatica. The results can be implemented in further optimization of the composition of the nutrient medium for culturing strains of Basidiomycetes wich producing carotenoids. Keywords: nitrogen-containing substances, Basidiomycetes, mycelium, culture filtrate, carotenoids

  20. Basidiomycete cultures on perlite survive successfully repeated freezing and thawing in cryovials without subculturing.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2007-06-01

    Mycelial basidiomycete cultures on perlite in cryovials survived successfully three successive cycles of freezing, storage in liquid nitrogen (LN) and thawing without noticeable changes. This indicates that using perlite as a carrier for cryopreservation could in most cases overcome difficulties caused by interrupted supply of LN or electric power during the storage. Cultures on perlite can also be reused for successive inoculations.

  1. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme ß-gl

  2. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  3. First records of xylophilous Basidiomycetes (Fungi in Mondaí, Santa Catarina (Southern Brazil

    Directory of Open Access Journals (Sweden)

    Clarice Loguercio-Leite

    2008-06-01

    Full Text Available A taxonomic survey of xylophilous Basidiomycetes resulted in the identifi cation of 21 species belonging to the families Boreostereaceae Jülich (1, Ganodermataceae Donk (2, Hymenochaetaceae Imazeki & Toki (6, Meripilaceae Jülich (2, Podoscyphaceae Reid (1, Polyporaceae Fr.: Corda (8 and Schizophyllaceae Quél. (1. All species are new records for Mondaí.

  4. Yeast diversity associated with invasive Dendroctonus valens killing Pinus tabuliformis in China using culturing and molecular methods.

    Science.gov (United States)

    Lou, Qiao-Zhe; Lu, Min; Sun, Jiang-Hua

    2014-08-01

    Bark beetle-associated yeasts are much less studied than filamentous fungi, yet they are also considered to play important roles in beetle nutrition, detoxification, and chemical communication. The red turpentine beetle, Dendroctonus valens, an invasive bark beetle introduced from North America, became one of the most destructive pests in China, having killed more than 10 million Pinus tabuliformis as well as other pine species. No investigation of yeasts associated with this bark beetle in its invaded ranges has been conducted so far. The aim of this study was to assess the diversity of yeast communities in different microhabitats and during different developmental stages of Den. valens in China using culturing and denaturing gradient gel electrophoresis (DGGE) approaches and to compare the yeast flora between China and the USA. The yeast identity was confirmed by sequencing the D1/D2 domain of LSU ribosomal DNA (rDNA). In total, 21 species (13 ascomycetes and eight basidiomycetes) were detected by culturing method, and 12 species (11 ascomycetes and one basidiomycetes) were detected by molecular methods from China. The most frequent five species in China were Candida piceae (Ogataea clade), Cyberlindnera americana, Candida oregonensis (Metschnikowia clade), Candida nitratophila (Ogataea clade) and an undescribed Saccharomycopsis sp., detected by both methods. Seven species were exclusively detected by DGGE. Ca. oregonensis (Metschnikowia clade) was the most frequently detected species by DGGE method. Eight species (all were ascomycetes) from the USA were isolated; seven of those were also found in China. We found significant differences in yeast total abundance as well as community composition between different developmental stages and significant differences between the surface and the gut. The frass yeast community was more similar to that of Den. valens surface or larvae than to the community of the gut or adults. Possible functions of the yeast associates are

  5. Identification and characterization of yeasts isolated from sedimentary rocks of Union Glacier at the Antarctica.

    Science.gov (United States)

    Barahona, Salvador; Yuivar, Yassef; Socias, Gabriel; Alcaíno, Jennifer; Cifuentes, Víctor; Baeza, Marcelo

    2016-07-01

    The study of the yeasts that inhabit cold environments, such as Antarctica, is an active field of investigation oriented toward understanding their ecological roles in these ecosystems. In a great part, the interest in cold-adapted yeasts is due to several industrial and biotechnological applications that have been described for them. The aim of this work was to isolate and identify yeasts from sedimentary rock samples collected at the Union Glacier, Antarctica. Furthermore, the yeasts were physiologically characterized, including the production of metabolites of biotechnological interest. The yeasts isolated that were identified at the molecular level belonged to genera Collophora (1 isolate), Cryptococcus (2 isolates), Sporidiobolus (4 isolates), Sporobolomyces (1 isolate) and Torrubiella (2 isolates). The majority of yeasts were basidiomycetous and psychrotolerant. By cross-test assays for anti-yeast activity, it was determined that Collophora sp., Sporidiobolus salmonicolor, and Sporobolomyces roseus secreted a protein factor that kills Sporidiobolus metaroseus. The colored yeasts Sp. salmonicolor, Sp. metaroseus and Collophora sp. produced several carotenoid pigments that were identified as 2,3 dihydroxy-γ-carotene, -carotene, 4-ketotorulene, torulene β-cryptoxanthin and spirilloxanthin. Concerning analysis of mycosporines, these metabolites were only found in the yeasts Torrubiella sp. and Cryptococcus sp. T11-10-1. Furthermore, the yeasts were evaluated for the production of extracellular hydrolytic activities. Of the twelve activities analyzed, alkaline phosphatase, invertase, gelatinase, cellulase, amylase, and protease enzyme activities were detected. The yeasts Cryptococcus sp. T11-10-1 and Sporidiobolus metaroseus showed the highest number of different enzyme activities.

  6. Differential carotenoid production and gene expression in Xanthophyllomyces dendrorhous grown in a nonfermentable carbon source.

    Science.gov (United States)

    Wozniak, Aniela; Lozano, Carla; Barahona, Salvador; Niklitschek, Mauricio; Marcoleta, Andrés; Alcaíno, Jennifer; Sepulveda, Dionisia; Baeza, Marcelo; Cifuentes, Víctor

    2011-05-01

    Xanthophyllomyces dendrorhous is a basidiomycetous yeast of considerable biotechnological interest because it synthesizes astaxanthin as its main carotenoid. The carotenoid production increases when it is grown using nonfermentable compounds as the sole carbon source. This work analyzes the expression of the carotenogenic genes and their relationship with the amount and types of carotenoids produced when X. dendrorhous is grown using a nonfermentable (succinate) or a fermentable carbon source (glucose). When X. dendrorhous is grown in succinate, carotenoid production is approximately three times higher than when it is grown in glucose. Moreover, carotenoid biosynthesis occurs at the start of the growth cycle when X. dendrorhous is grown in succinate, whereas when it is grown in glucose, carotenoids are produced at the end of the exponential phase. Additionally, we observed that some carotenogenic genes, such as alternative transcripts of crtYB and crtI, are differentially expressed when the yeast is grown in these carbon sources; other genes, such as crtS, exhibit a similar pattern of expression. Our data indicate that transcriptional regulation is not sufficient to explain the differences in carotenoid production between the two culture conditions, indicating that additional regulatory mechanisms may be operating in the carotenogenic pathway of X. dendrorhous.

  7. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  8. Yeasts in malting, with special emphasis on Wickerhamomyces anomalus (synonym Pichia anomala).

    Science.gov (United States)

    Laitila, Arja; Sarlin, Tuija; Raulio, Mari; Wilhelmson, Annika; Kotaviita, Erja; Huttunen, Timo; Juvonen, Riikka

    2011-01-01

    Malted barley is a major raw material of beer, as well as distilled spirits and several food products. The production of malt (malting) exploits the biochemical reactions of a natural process, grain germination. In addition to germinating grain, the malting process includes another metabolically active component: a diverse microbial community that includes various types of bacteria and fungi. Therefore, malting can be considered as a complex ecosystem involving two metabolically active groups. Yeasts and yeast-like fungi are an important part of this ecosystem, but previously the significance of yeasts in malting has been largely underestimated. Characterization and identification of yeasts in industrial processes revealed 25 ascomycetous yeasts belonging to 10 genera, and 18 basidiomycetous yeasts belonging to 7 genera. In addition, two ascomycetous yeast-like fungi belonging to the genera Aureobasidium and Exophiala were commonly detected. Yeasts and yeast-like fungi produced extracellular hydrolytic enzymes with a potentially positive contribution to the malt enzyme spectrum. Several ascomycetous yeast strains showed strong antagonistic activity against field and storage moulds, Wickerhamomyces anomalus (synonym Pichia anomala) being the most effective species. Malting studies revealed that W. anomalus VTT C-04565 effectively restricted Fusarium growth and hydrophobin production during malting and prevented beer gushing. In order to broaden the antimicrobial spectrum and to improve malt brewhouse performance, W. anomalus could be combined with other starter cultures such as Lactobacillus plantarum. Well-characterized microbial mixtures consisting of barley and malt-derived microbes open up several possibilities to improve malt properties and to ensure the safety of the malting process.

  9. Cryopreservation of cryosensitive basidiomycete cultures by application and modification of perlite protocol.

    Science.gov (United States)

    Sato, Masanori; Sukenobe, Junji; Nakagiri, Akira

    2012-01-01

    Homolka's perlite protocol (HPP) for cryopreservation of fungal cultures was evaluated in 12 strains (7 species) of cryosensitive basidiomycete cultures maintained in NBRC culture collection by investigating viability, time to recover, and basic morphological study after freezing and storing at -80 degree C for 6 months. The viability of the fungal strains was 60 percent in Phallus hadriani and 100 percent in remaining 11 strains, indicating the efficacy of HPP method for cryopreservation of some cryosensitive basidiomycetes. The HPP method was modified by changing the addition of cryoprotectant (glycerol) from prior precultivation to post precultivation, limiting the cryoprotectant exposure time to 48 hours, and increasing the glycerol concentration from 5 percent to 12 percent. The viability of P. hadriani strain increased from 60 percent to 100 percent with the modified perlite protocol after storage at -80 degree C for 6 months.

  10. Efficient and simple electro-transformation of intact cells for the basidiomycetous fungus Pseudozyma hubeiensis

    OpenAIRE

    Konishi, Masaaki; Yoshida, Yuta; Ikarashi, Mizuki; Horiuchi, Junichi; 小西, 正朗

    2015-01-01

    Objective: An electroporation procedure for the species was investigated to develop an efficient transformation method for the basidiomycetous fungus Pseudozyma hubeiensis SY62, a strong biosurfactant-producing host. Results: A plasmid, pUXV1emgfp including green fluorescence protein as a reporter gene, was constructed to determine the transformation and expression of foreign genes. Optimal electroporation conditions achieved 44.8 transformants μg−1 plasmid competency (intact cells) without p...

  11. Aromadendrane and cyclofarnesane sesquiterpenoids from cultures of the basidiomycete Inonotus sp. BCC 23706.

    Science.gov (United States)

    Isaka, Masahiko; Yangchum, Arunrat; Supothina, Sumalee; Boonpratuang, Thitiya; Choeyklin, Rattaket; Kongsaeree, Palangpon; Prabpai, Samran

    2015-10-01

    Twelve aromadendrane sesquiterpenoids, inonotins A-L, and a previously unknown cyclofarnesane, i.e., inonofarnesane, together with two known compounds, were isolated from cultures of the wood-rotting basidiomycete Inonotus sp. BCC 23706. Inonotin I is identical to a previously reported compound with an incorrect structure. Structures of the compounds were elucidated by spectroscopic analysis and X-ray crystallography. The absolute configurations of inonotin D and inonofarnesane were determined by application of the modified Mosher's method.

  12. Alliacane sesquiterpenoids from submerged cultures of the basidiomycete Inonotus sp. BCC 22670.

    Science.gov (United States)

    Isaka, Masahiko; Sappan, Malipan; Supothina, Sumalee; Srichomthong, Kitlada; Komwijit, Somjit; Boonpratuang, Thitiya

    2017-02-04

    Nine alliacane sesquiterpenoids, inonoalliacanes A-I, were isolated from culture broth of the basidiomycete Inonotus sp. BCC 22670. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of inonoalliacane F was determined by application of the modified Mosher's method. Inonoalliacane A, the most abundant sesquiterpene constituent, exhibited moderate antibacterial activity against Bacillus cereus, whereas inonoalliacane B showed antiviral activity against herpes simplex virus type 1.

  13. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi

    OpenAIRE

    Machado,Kátia M.G.; Dácio R. Matheus; Bononi,Vera L. R.

    2005-01-01

    Remazol Brilliant Blue R (RBBR) dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%); 96 fungi showed a mycelia growth and decolorization activity stronger than the P. c...

  14. Kinesin-3 in the basidiomycete Ustilago maydis transports organelles along the entire microtubule array.

    Science.gov (United States)

    Steinberg, Gero

    2015-01-01

    The molecular motor kinesin-3 transports early endosomes along microtubules in filamentous fungi. It was reported that kinesin-3 from the ascomycete fungi Aspergillus nidulans and Neurospora crassa use a subset of post-translationally modified and more stable microtubules. Here, I show that kinesin-3 from the basidiomycete Ustilago maydis moves along all hyphal microtubules. This difference is likely due to variation in cell cycle control and associated organization of the microtubule array.

  15. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2014-03-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose. Keywords: Basidiomycetes, mycelium, culture filtrate, polyphenols, carotenoids

  16. Unexpected diversity of basidiomycetous endophytes in sapwood and leaves of Hevea.

    Science.gov (United States)

    Martin, Rachael; Gazis, Romina; Skaltsas, Demetra; Chaverri, Priscila; Hibbett, David

    2015-01-01

    Research on fungal endophytes has expanded dramatically in recent years, but little is known about the diversity and ecological roles of endophytic basidiomycetes. Here we report the analysis of 310 basidiomycetous endophytes isolated from wild and planted populations of the rubber tree genus, Hevea. Species accumulation curves were nonasymptotic, as in the majority of endophyte surveys, indicating that more sampling is needed to recover the true diversity of the community. One hundred eighteen OTUs were delimited, representing nine orders of Basidiomycota (Agaricales, Atheliales, Auriculariales, Cantharellales, Hymenochaetales, Polyporales, Russulales, Septobasidiales, Tremellales). The diversity of basidiomycetous endophytes found inhabiting wild populations of Hevea was comparable to that present in plantations. However, when samples were segregated by tissue type, sapwood of wild populations was found to contain a higher number of species than sapwood of planted trees. Seventy-five percent of isolates were members of the Polyporales, the majority in the phlebioid clade. Most of the species belong to clades known to cause a white-rot type of wood decay. Two species in the insect-associated genus Septobasidium were isolated. The most frequently isolated genera included Bjerkandera, Ceriporia, Phanerochaete, Phlebia, Rigidoporus, Tinctoporellus, Trametes (Polyporales), Peniophora, Stereum (Russulales) and Coprinellus (Agaricales), all of which have been reported as endophytes from a variety of hosts, across wide geographic locations. Literature records on the geographic distribution and host association of these genera revealed that their distribution and substrate affinity could be extended if the endophytic niche was investigated as part of fungal biodiversity surveys.

  17. Characterization of a gene coding for a putative adenosine deaminase-related growth factor by RNA interference in the basidiomycete Flammulina velutipes.

    Science.gov (United States)

    Sekiya, Shuichi; Yamada, Masato; Shibata, Kou; Okuhara, Toru; Yoshida, Masumi; Inatomi, Satoshi; Taguchi, Goro; Shimosaka, Makoto

    2013-04-01

    A full-length cDNA coding for a putative adenosine deaminase (Fv-ada) was isolated from the basidiomycete Flammulina velutipes. Fv-ada encodes a polypeptide consisting of 537 amino acid residues, which has a consensus sequence conserved among adenosine deaminase-related growth factors (ADGF) found in several metazoa, including chordates and insects. Fv-ada transcript was detected at all stages of growth in dikaryotic F. velutipes cells, with a peak at the primordial stage. Heterologous expression of Fv-ada in the yeast Pichia pastoris produced recombinant Fv-ADA that catalyzed the conversion of adenosine to inosine. Dikaryotic mycelia from F. velutipes were transformed with the binary plasmid pFungiway-Fv-ada, which was designed to suppress the expression of Fv-ada through RNA interference. The growth rates of the resulting transformants were retarded in response to the degree of suppression, indicating that Fv-ada plays an important role in the mycelial growth of F. velutipes. These results suggested that ADGF could function as growth factors in fungi, as is seen in other eukaryotes.

  18. Isolation and Characterization of a Lycopene ε-Cyclase Gene of Chlorella (Chromochloris zofingiensis. Regulation of the Carotenogenic Pathway by Nitrogen and Light

    Directory of Open Access Journals (Sweden)

    Maria Angeles Vargas

    2012-09-01

    Full Text Available The isolation and characterization of the lycopene ε-cyclase gene from the green microalga Chlorella (Chromochloris zofingiensis (Czlcy-e was performed. This gene is involved in the formation of the carotenoids α-carotene and lutein. Czlcy-e gene encoded a polypeptide of 654 amino acids. A single copy of Czlcy-e was found in C. zofingiensis. Functional analysis by heterologous complementation in Escherichia coli showed the ability of this protein to convert lycopene to δ-carotene. In addition, the regulation of the carotenogenic pathway by light and nitrogen was also studied in C. zofingiensis. High irradiance stress did not increase mRNA levels of neither lycopene β-cyclase gene (lcy-b nor lycopene ε-cyclase gene (lcy-e as compared with low irradiance conditions, whereas the transcript levels of psy, pds, chyB and bkt genes were enhanced, nevertheless triggering the synthesis of the secondary carotenoids astaxanthin, canthaxanthin and zeaxanthin and decreasing the levels of the primary carotenoids α-carotene, lutein, violaxanthin and β-carotene. Nitrogen starvation per se enhanced mRNA levels of all genes considered, except lcy-e and pds, but did not trigger the synthesis of astaxanthin, canthaxanthin nor zeaxanthin. The combined effect of both high light and nitrogen starvation stresses enhanced significantly the accumulation of these carotenoids as well as the transcript levels of bkt gene, as compared with the effect of only high irradiance stress.

  19. Clinical significance and molecular characterization of nonsporulating molds isolated from the respiratory tracts of bronchopulmonary mycosis patients with special reference to basidiomycetes.

    Science.gov (United States)

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F; Chowdhary, Anuradha

    2013-10-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger subunit (LSU) of 52 NSMs isolated from respiratory specimens. The basidiomycetes were the predominant NSMs, of which Schizophyllum commune was the most common agent in allergic bronchopulmonary mycosis (ABPM), followed by Ceriporia lacerata in invasive fungal disease. Porostereum spadiceum, Phanaerochaete stereoides, Neosartorya fischeri, and Marasmiellus palmivorus were the other molds observed. Application of ITS and LSU region sequencing identified 92% of the isolates. The antifungal susceptibility data revealed that all basidiomycetes tested were susceptible to amphotericin B and resistant to caspofungin, fluconazole, and flucytosine. Except for 3 isolates of S. commune and a solitary isolate of M. palmivorus, all basidiomycetes had low MICs for itraconazole, posaconazole, and voriconazole. Basidiomycetes were isolated from patients with ABPM, invasive pulmonary mycosis/pneumonia, or fungal balls. In addition, the majority of the basidiomycetes were isolated from patients with chronic respiratory disorders who were sensitized to one of the basidiomycetous fungi and demonstrated precipitating antibodies against the incriminating fungi, indicating an indolent tissue reaction. Thus, isolation of basidiomycetes from the lower respiratory tract could be significant, and it is important to monitor these patients in order to prevent subsequent lung damage.

  20. Yeast That Smell

    Directory of Open Access Journals (Sweden)

    Eugenia Y Xu

    2008-08-01

    Full Text Available The fundamental mechanism of olfactory receptor activation has been conserved from yeast to humans. Engineered yeast cells can smell some of the same odorants as humans can, which makes yeast an ideal model system for studying human olfaction. Furthermore, if engineered yeast cells are incorporated into sensory arrays, they can be used as biosensors or artificial noses.Keywords: Yeast, olfactory receptor, G protein-coupled receptor, biosensor, smellReceived: 31 July 2008 / Received in revised form: 6 August 2008, Accepted: 13 August 2008, Published online: 17 August 2008

  1. Prenylhydroquinone-Derived Secondary Metabolites from Cultures of the Basidiomycete Lentinus similis BCC 52578.

    Science.gov (United States)

    Isaka, Masahiko; Palasarn, Somporn; Sappana, Malipan; Srichomthong, Kitlada; Karunarathna, Samantha C; Hyde, Kevin D

    2015-08-01

    Two new prenylhydroquinone-derived compounds, Ientinospirol (1) and 1-(2,5-dihydroxyphenyl)-4-hydroxy-3-methyl-l-butanone (2), were isolated from cultures of the basidiomycete Lentinus similis BCC 52578, together with the known compounds panepoxydone (3), panepoxydione (4), isopanepoxydone (5), 2,2-dimethyl-6-hydroxy-2H-chromene (6), and (3R,4S)-3,4-dihydroxy-2,2-dimethyl-6-methoxychroman (7). Compounds 3 and 4 exhibited cytotoxicity against all cell-lines tested, while the other compounds were inactive.

  2. Anticancer properties of polysaccharides isolated from fungi of the Basidiomycetes class.

    Science.gov (United States)

    Lemieszek, Marta; Rzeski, Wojciech

    2012-01-01

    Basidiomycete mushrooms represent a valuable source of biologically active compounds with anticancer properties. This feature is primarily attributed to polysaccharides and their derivatives. The anticancer potential of polysaccharides is linked to their origin, composition and chemical structure, solubility and method of isolation. Moreover, their activity can be significantly increased by chemical modifications. Anticancer effects of polysaccharides can be expressed indirectly (immunostimulation) or directly (cell proliferation inhibition and/or apoptosis induction). Among the wide range of polysaccharides with documented anticancer properties, lentinan, polysaccharide-K (PSK) and schizophyllan deserve special attention. These polysaccharides for many years have been successfully applied in cancer treatment and their mechanism of action is the best known.

  3. A comparison of hypoglycemic activity of three species of basidiomycetes rich in vanadium.

    Science.gov (United States)

    Han, Chunchao; Liu, Tongjun

    2009-02-01

    The hypoglycemic activity of fermented mushroom of three fungi of basidiomycetes rich in vanadium was studied in this paper. Alloxan- and adrenalin-induced hyperglycemic mice were used in the study. The blood glucose and the sugar tolerance were determined. After the mice were administered (ig) with Coprinus comatus rich in vanadium, the blood glucose of alloxan-induced hyperglycemic mice decreased (p hypoglycemic effects of Coprinus comatus rich in vanadium on hyperglycemic animals are significant; it may be used as a hypoglycemic food or medicine for hyperglycemic people.

  4. Inhibition of growth and sporulation of Penicillium expansum by extracts of selected Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Teresa Florianowicz

    2014-01-01

    Full Text Available A screening of antifungal activity of 33 Basidiomycetes strains was realized with their extracts. The influence of aqueous extracts of fruit-bodies of the testeded fungi after addition of spores or hyphae of Penicillium expansum on growth and sporulation of the fitopathogen in vitro was estimated. The species: Hydnum repandum L.: Fr., Pleurotus ostreatus (Jacq.: Fr. Kummer, Coprinus comatus (Műll Fr. S.F. Gray, Coprinus atramentarius (Bull: Fr. Fr. and Lactarius turpis (Weinm. Fr. reduced the mycelial growth and inhibited sporulation of this pathogen.

  5. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  6. Antifungal activity of some metabolites of higher fungi (Basidiomycetes - an overview

    Directory of Open Access Journals (Sweden)

    Teresa Florianowicz

    2014-01-01

    Full Text Available A series of compounds of different chemical structures showing antifungal activity were isolated from higher fungi (Basidiomycetes fruit bodies. Among the microflora against which the examined metabolites showed effective activity, there are pathogenic organisms for people as well as for animals: Candida albicans, Candida tropicalis, Rhodotorula rubra, Aspergillus fumigatus and pathogens attacking plants: Penicillium chrysogenum, Botrytis cinerea, Alternaria solani, Fusarium culmorum, Trichoderma lignorum and Verticillium dahlae. Searching for fungal metabolites having antifungal activity creates possibilities of using them against a range of fungal pathogens of clinical, agronomic and environmental significance.

  7. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  8. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2014-04-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose.

  9. Molecular characterization of a lipoxygenase from the basidiomycete mushroom Pleurotus ostreatus.

    Science.gov (United States)

    Tasaki, Yuji; Toyama, Shungo; Kuribayashi, Takashi; Joh, Toshio

    2013-01-01

    The full-length cDNA of the gene PoLOX1 encoding a lipoxygenase (LOX) and its corresponding genomic DNA were isolated from the basidiomycete mushroom Pleurotus ostreatus strain H1. The deduced amino acid sequence of PoLOX1 showed similarity to a valencene dioxygenase of Pleurotus sapidus, putative LOX-like proteins from ascomycete, basidiomycete, and deuteromycete fungi, and known LOXs from plants, animals, and bacteria. PoLOX1 also contained the LOX iron-binding catalytic domain in the C-terminal region, but not the polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain, which is usually found in the N-terminal region of eukaryotic LOXs. Genomic sequence analysis revealed that PoLOX1 was interrupted by one intron, and that the promoter region included TATA and CAAT boxes. Southern blot analysis indicated that PoLOX1 is a member of a small gene family comprising highly similar genes. Northern blot analysis revealed that it is transcribed more abundantly in the stipes of the fruit bodies than in the caps.

  10. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants.

  11. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  12. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  13. Ascomycetous yeasts associated with naturally occurring fruits in a tropical rain forest.

    Science.gov (United States)

    Prada, G M; Pagnocca, F C

    1997-01-01

    Fruits from twenty different species of angiosperms were collected during the period from November, 1991 to January, 1992. Two hundred and two strains of yeasts and yeast-like fungi were isolated, of which 74% showed ascomycetic affinity. Candida was the predominant genus, followed by (in descending order of occurrence): Cryptococcus, Kloeckera, Sporobolomyces, Pichia, Hanseniaspora and Bullera. Black yeasts and other strains showing basidiomycetic affinity were also isolated. The genus Candida represented the highest number of identified species and the greatest variety of associated substrates. Among the ascomycetes and their anamorphs, 38 species were identified, with Kloeckera apiculata being the most frequent among the isolates and the one which occurred in the largest variety of substrates. Some of the biotypes designated as Candida sp. A, B, C, D, E, F, G, H, I, and Pichia sp. did not correspond to the standard species description found in the literature, and may represent new species. The strains of yeasts isolated in this study were characterized and incorporated into the Tropical Culture Collection of the Fundaao Tropical de Pesquisas e Tecnologia Andŕe Tosello, Campinas, São Paulo.

  14. Presence and changes in populations of yeasts on raw and processed poultry products stored at refrigeration temperature.

    Science.gov (United States)

    Ismail, S A; Deak, T; El-Rahman, H A; Yassien, M A; Beuchat, L R

    2000-12-05

    A study was undertaken to determine populations and profiles of yeast species on fresh and processed poultry products upon purchase from retail supermarkets and after storage at 5 degrees C until shelf life expiration, and to assess the potential role of these yeasts in product spoilage. Fifty samples representing 15 commercial raw, marinated, smoked, or roasted chicken and turkey products were analyzed. Yeast populations were determined by plating on dichloran rose bengal chloramphenicol (DRBC) agar and tryptone glucose yeast extract (TGY) agar. Proteolytic activity was determined using caseinate and gelatin agars and lipolytic activity was determined on plate count agar supplemented with tributyrin. Populations of aerobic microorganisms were also determined. Initial populations of yeasts (log10 cfu/g) ranged from less than 1 (detection limit) to 2.89, and increased by the expiration date to 0.37-5.06, indicating the presence of psychrotrophic species. Highest initial populations were detected in raw chicken breast, wings, and ground chicken, as well as in turkey necks and legs, whereas roasted chicken and turkey products contained less than 1 log10 cfu/g. During storage, yeast populations increased significantly (P sausage. Isolates (152 strains) of yeasts from poultry products consisted of 12 species. Yarrowia lipolytica and Candida zeylanoides were predominant, making up 39 and 26% of the isolates, respectively. Six different species of basidiomycetous yeasts representing 24% of the isolates were identified. Most Y. lipolytica strains showed strong proteolytic and lipolytic activities, whereas C. zeylanoides was weakly lipolytic. Results suggest that yeasts, particularly Y. lipolytica, may play a more prominent role than previously recognized in the spoilage of fresh and processed poultry stored at 5 degrees C.

  15. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  16. Novel Root-Fungus Symbiosis in Ericaceae: Sheathed Ericoid Mycorrhiza Formed by a Hitherto Undescribed Basidiomycete with Affinities to Trechisporales

    Science.gov (United States)

    Vohník, Martin; Sadowsky, Jesse J.; Kohout, Petr; Lhotáková, Zuzana; Nestby, Rolf; Kolařík, Miroslav

    2012-01-01

    Ericaceae (the heath family) are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM) fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed ‘sheathed ericoid mycorrhiza’, discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity) to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet remain

  17. The diversity and extracellular enzymatic activities of yeasts isolated from water tanks of Vriesea minarum, an endangered bromeliad species in Brazil, and the description of Occultifur brasiliensis f.a., sp. nov.

    Science.gov (United States)

    Gomes, Fátima C O; Safar, Silvana V B; Marques, Andrea R; Medeiros, Adriana O; Santos, Ana Raquel O; Carvalho, Cláudia; Lachance, Marc-André; Sampaio, José Paulo; Rosa, Carlos A

    2015-02-01

    The diversity of yeast species collected from the bromeliad tanks of Vriesea minarum, an endangered bromeliad species, and their ability to produce extracellular enzymes were studied. Water samples were collected from 30 tanks of bromeliads living in a rupestrian field site located at Serrada Piedade, Minas Gerais state, Brazil, during both the dry and rainy seasons. Thirty-six species were isolated, representing 22 basidiomycetous and 14 ascomycetous species. Occultifur sp., Cryptococcus podzolicus and Cryptococcus sp. 1 were the prevalent basidiomycetous species. The yeast-like fungus from the order Myriangiales, Candida silvae and Aureobasidium pullulans were the most frequent ascomycetous species. The diversity of the yeast communities obtained between seasons was not significantly different, but the yeast composition per bromeliad was different between seasons. These results suggest that there is significant spatial heterogeneity in the composition of populations of the yeast communities within bromeliad tanks, independent of the season. Among the 352 yeast isolates tested, 282 showed at least one enzymatic activity. Protease activity was the most widely expressed extracellular enzymatic activity, followed by xylanase, amylase, pectinase and cellulase activities. These enzymes may increase the carbon and nitrogen availability for the microbial food web in the bromeliad tank of V. minarum. Sequence analyses revealed the existence of 10 new species, indicating that bromeliad tanks are important sources of new yeasts. The novel species Occultifur brasiliensis, f.a., sp. nov., is proposed to accommodate the most frequently isolated yeast associated with V. minarum. The type strain of O. brasiliensis, f.a., sp. nov. is UFMG-CM-Y375(T) (= CBS 12687(T)). The Mycobank number is MB 809816.

  18. The yeast Golgi apparatus.

    Science.gov (United States)

    Suda, Yasuyuki; Nakano, Akihiko

    2012-04-01

    The Golgi apparatus is an organelle that has been extensively studied in the model eukaryote, yeast. Its morphology varies among yeast species; the Golgi exists as a system of dispersed cisternae in the case of the budding yeast Saccharomyces cerevisiae, whereas the Golgi cisternae in Pichia pastoris and Schizosaccharomyces pombe are organized into stacks. In spite of the different organization, the mechanism of trafficking through the Golgi apparatus is believed to be similar, involving cisternal maturation, in which the resident Golgi proteins are transported backwards while secretory cargo proteins can stay in the cisternae. Questions remain regarding the organization of the yeast Golgi, the regulatory mechanisms that underlie cisternal maturation of the Golgi and transport machinery of cargo proteins through this organelle. Studies using different yeast species have provided hints to these mechanisms.

  19. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  20. Development of Highly Efficient Transformation System of Yeast-Like Conidia of Tremella fuciformis

    Institute of Scientific and Technical Information of China (English)

    GUO Li-qiong; LIU Er-xian; WANG Jie; LIN Jun-fang

    2009-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, which is also called the blastospore by budding. The yeast-like conidia of T. fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. Thus, it is a good recipient cell for exogenous gene expression. In this study, the expression plasmid pAN7-1 (containing promoter gpd-An derived from Aspergillus nidulans and selectable marker gene hph conferring resistance to hygromycin B) and plasmid pLg-hph (containing promoter gpd-Le derived from Lentinula edodes and selectable marker gene hph) were transformed into the yeast-like conidia of T. fuciformis by PEG-mediated protoplast transformation, respectively. The primary putative transformants were selected by the sandwich screening method with the selective medium containing 50 μg mL-1 hygromycin. The putative transformantswere obtained from the primary putative transformants transferred on PDSA plates containing 100 μg mL-1 hygromycin for second round selection. Experimental results showed that the optimal concentration of PEG 4000 for mediating protoplast transformation was 25%. PCR and Southern blotting confirmed that the selectable marker gene hph was integrated effectively into the genome of the yeast-like conidia of T. fuciformis with plasmid pLg-hph transformation.Its transformation efficiency was 110 transformants per μg DNA, and the hph gene was integrated into the genome of some yeast-like conidia with plasmid pAN7-1 transformation. However, its transformation efficiency was only 9 transformants per μg DNA. The presence of hph gene in the genome of transformants after 5 generations of sub-culturing on PDSB medium was confirmed by PCR, suggesting that the foreign gene hph was stable during subculture.

  1. Cytochrome P450 monooxygenases involved in anthracene metabolism by the white-rot basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Chigu, Nomathemba Loice; Hirosue, Sinji; Nakamura, Chie; Teramoto, Hiroshi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-08-01

    Cytochrome P450 monooxygenases (P450s) involved in anthracene metabolism by the white-rot basidiomycete Phanerochaete chrysosporium were identified by comprehensive screening of both catalytic potentials and transcriptomic profiling. Functional screening of P. chrysosporium P450s (PcCYPs) revealed that 14 PcCYP species catalyze stepwise conversion of anthracene to anthraquinone via intermediate formation of anthrone. Moreover, transcriptomic profiling explored using a complementary DNA microarray system demonstrated that 12 PcCYPs are up-regulated in response to exogenous addition of anthracene. Among the up-regulated PcCYPs, five species showed catalytic activity against anthracene. Based upon both catalytic and transcriptional properties, these five species are most likely to play major roles in anthracene metabolic processes in vivo. Thus, the combination of functional screening and a microarray system may provide a novel strategy for obtaining a thorough understanding of the catalytic functions and biological impacts of PcCYPs.

  2. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  3. Chamigrane Sesquiterpenes from a Basidiomycetous Endophytic Fungus XG8D Associated with Thai Mangrove Xylocarpus granatum

    Science.gov (United States)

    Choodej, Siwattra; Teerawatananond, Thapong; Mitsunaga, Tohru; Pudhom, Khanitha

    2016-01-01

    Six new chamigrane sesquiterpenes, merulinols A‒F (1‒6), and four known metabolites (7‒10) were isolated from the culture of the basidiomycetous fungus XG8D, a mangrove-derived endophyte. Their structures were elucidated mainly by 1D and 2D NMR, while the structures of 1 and 2 were further confirmed by single-crystal X-ray diffraction analysis. The in vitro cytotoxicity of all compounds was evaluated against three human cancer cell lines, MCF-7, Hep-G2, and KATO-3. Compounds 3 and 4 selectively displayed cytotoxicity against KATO-3 cells with IC50 values of 35.0 and 25.3 μM, respectively. PMID:27428984

  4. Chamigrane Sesquiterpenes from a Basidiomycetous Endophytic Fungus XG8D Associated with Thai Mangrove Xylocarpus granatum

    Directory of Open Access Journals (Sweden)

    Siwattra Choodej

    2016-07-01

    Full Text Available Six new chamigrane sesquiterpenes, merulinols A‒F (1‒6, and four known metabolites (7‒10 were isolated from the culture of the basidiomycetous fungus XG8D, a mangrove-derived endophyte. Their structures were elucidated mainly by 1D and 2D NMR, while the structures of 1 and 2 were further confirmed by single-crystal X-ray diffraction analysis. The in vitro cytotoxicity of all compounds was evaluated against three human cancer cell lines, MCF-7, Hep-G2, and KATO-3. Compounds 3 and 4 selectively displayed cytotoxicity against KATO-3 cells with IC50 values of 35.0 and 25.3 μM, respectively.

  5. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  6. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  7. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  8. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Science.gov (United States)

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  9. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  10. Vaginal Yeast Infections

    Science.gov (United States)

    ... infection caused by a type of fungus called candida albicans . Yeast infections usually happen in warm, moist parts of the body, like the mouth, or vagina. We all have candida in our bodies, but usually it's kept in ...

  11. Modeling brewers' yeast flocculation

    Science.gov (United States)

    van Hamersveld EH; van der Lans RG; Caulet; Luyben

    1998-02-01

    Flocculation of yeast cells occurs during the fermentation of beer. Partway through the fermentation the cells become flocculent and start to form flocs. If the environmental conditions, such as medium composition and fluid velocities in the tank, are optimal, the flocs will grow in size large enough to settle. After settling of the main part of the yeast the green beer is left, containing only a small amount of yeast necessary for rest conversions during the next process step, the lagering. The physical process of flocculation is a dynamic equilibrium of floc formation and floc breakup resulting in a bimodal size distribution containing single cells and flocs. The floc size distribution and the single cell amount were measured under the different conditions that occur during full scale fermentation. Influences on flocculation such as floc strength, specific power input, and total number of yeast cells in suspension were studied. A flocculation model was developed, and the measured data used for validation. Yeast floc formation can be described with the collision theory assuming a constant collision efficiency. The breakup of flocs appears to occur mainly via two mechanisms, the splitting of flocs and the erosion of yeast cells from the floc surface. The splitting rate determines the average floc size and the erosion rate determines the number of single cells. Regarding the size of the flocs with respect to the scale of turbulence, only the viscous subrange needs to be considered. With the model, the floc size distribution and the number of single cells can be predicted at a certain point during the fermentation. For this, the bond strength between the cells, the fractal dimension of the yeast, the specific power input in the tank and the number of yeast cells that are in suspension in the tank have to be known. Copyright 1998 John Wiley & Sons, Inc.

  12. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  13. Forces in yeast flocculation.

    Science.gov (United States)

    El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Vincent, Stéphane P; Abellán Flos, Marta; Hols, Pascal; Lipke, Peter N; Dufrêne, Yves F

    2015-02-07

    In the baker's yeast Saccharomyces cerevisiae, cell-cell adhesion ("flocculation") is conferred by a family of lectin-like proteins known as the flocculin (Flo) proteins. Knowledge of the adhesive and mechanical properties of flocculins is important for understanding the mechanisms of yeast adhesion, and may help controlling yeast behaviour in biotechnology. We use single-molecule and single-cell atomic force microscopy (AFM) to explore the nanoscale forces engaged in yeast flocculation, focusing on the role of Flo1 as a prototype of flocculins. Using AFM tips labelled with mannose, we detect single flocculins on Flo1-expressing cells, showing they are widely exposed on the cell surface. When subjected to force, individual Flo1 proteins display two distinct force responses, i.e. weak lectin binding forces and strong unfolding forces reflecting the force-induced extension of hydrophobic tandem repeats. We demonstrate that cell-cell adhesion bonds also involve multiple weak lectin interactions together with strong unfolding forces, both associated with Flo1 molecules. Single-molecule and single-cell data correlate with microscale cell adhesion behaviour, suggesting strongly that Flo1 mechanics is critical for yeast flocculation. These results favour a model in which not only weak lectin-sugar interactions are involved in yeast flocculation but also strong hydrophobic interactions resulting from protein unfolding.

  14. Bioprospection of cold-adapted yeasts with biotechnological potential from Antarctica.

    Science.gov (United States)

    Martorell, María Martha; Ruberto, Lucas Adolfo Mauro; Fernández, Pablo Marcelo; Castellanos de Figueroa, Lucía Inés; Mac Cormack, Walter Patricio

    2017-03-08

    The aim of this study was to investigate the ability to produce extracellular hydrolytic enzymes at low temperature of yeasts isolated from 25 de Mayo island, Antarctica, and to identify those exhibiting one or more of the evaluated enzymatic activities. A total of 105 yeast isolates were obtained from different samples and 66 were identified. They belonged to 12 basidiomycetous and four ascomycetous genera. Most of the isolates were ascribed to the genera Cryptococcus, Mrakia, Cystobasidium, Rhodotorula, Gueomyces, Phenoliferia, Leucosporidium, and Pichia. Results from enzymes production at low temperatures revealed that the Antarctic environment contains metabolically diverse cultivable yeasts, which represent potential tools for biotechnological applications. While most the isolates proved to produce 2-4 of the investigated exoenzymes, two of them evidenced the six evaluated enzymatic activities: Pichia caribbica and Guehomyces pullulans, which were characterized as psycrotolerant and psycrophilic, respectively. In addition, P. caribbica could assimilate several n-alkanes and diesel fuel. The enzyme production profile and hydrocarbons assimilation capacity, combined with its high level of biomass production and the extended exponential growth phase make P. caribbica a promising tool for cold environments biotechnological purposes in the field of cold-enzymes production and oil spills bioremediation as well.

  15. The contribution of moulds and yeasts to the fermentation of 'agbelima' cassava dough.

    Science.gov (United States)

    Amoa-Awua, W K; Frisvad, J C; Sefa-Dedeh, S; Jakobsen, M

    1997-09-01

    Agbelima, a fermented cassava meal widely consumed in Ghana, Togo and Benin, is produced by fermenting grated cassava with one of several types of traditional cassava dough inoculum. During fermentation a smooth textured sour dough is produced, the toxicity of cassava is reduced and there is a build up of volatile aroma compounds. Four types of inocula were included in the present investigation. In one type moulds were found to form a dominant part of the microbiota, the species present being Penicillium sclerotiorum, P. citrinum, P. nodulum, Geotrichum candidum and a basidiomycete. All these moulds were found to possess cellulase activity which was responsible for the hydrolysis of cassava tuber cellulose during fermentation leading to a breakdown of the coarse texture of cassava dough. The yeasts Candida krusei, C. tropicalis and Zygosaccharomyces spp. were present in high numbers in the four types of inocula including the moudly inoculum. The yeasts C. tropicalis and some strains of Zygosaccharomyces, all of which possessed cellulase activity, were also found to contribute to the modification of cassava texture during fermentation. All yeasts and moulds exhibited linamarase activity and were therefore capable of breaking down the cyanogenic glucosides present in cassava.

  16. Structural Variation (SV Markers in the Basidiomycete Volvariella volvacea and Their Application in the Construction of a Genetic Map

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2015-07-01

    Full Text Available Molecular markers and genetic maps are useful tools in genetic studies. Novel molecular markers and their applications have been developed in recent years. With the recent advancements in sequencing technology, the genomic sequences of an increasingly great number of fungi have become available. A novel type of molecular marker was developed to construct the first reported linkage map of the edible and economically important basidiomycete Volvariella volvacea by using 104 structural variation (SV markers that are based on the genomic sequences. Because of the special and simple life cycle in basidiomycete, SV markers can be effectively developed by genomic comparison and tested in single spore isolates (SSIs. This stable, convenient and rapidly developed marker may assist in the construction of genetic maps and facilitate genomic research for other species of fungi.

  17. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  18. Systematic Identification and Evolutionary Analysis of Catalytically Versatile Cytochrome P450 Monooxygenase Families Enriched in Model Basidiomycete Fungi

    OpenAIRE

    Khajamohiddin Syed; Karabo Shale; Nataraj Sekhar Pagadala; Jack Tuszynski

    2014-01-01

    Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s) in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to id...

  19. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    OpenAIRE

    Fedotov O. V.; Voloshko T.E.

    2013-01-01

    A method for obtaining of enzyme preparations of enzyme preparations (EP) of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfat...

  20. Versatile applications of the culinary-medicinal mushroom Mycoleptodonoides aitchisonii (Berk.) Maas G. (Higher Basidiomycetes): a review.

    Science.gov (United States)

    Chandrasekaran, Gayathri; Oh, Deuk-Sil; Shin, Hyun-Jae

    2012-01-01

    Higher Basidiomycetes medicinal mushroom Mycoleptodonoides aitchisonii has become attractive as a natural health product because of its antihypertensive effects on human health. Moreover, the food industry is especially interested in the preparation of the nutritional tonic of this mushroom. Various studies on this mushroom have shown that it has antidiabetic, antihypertensive, and antioxidant effects. The aim of this review is to report the present findings from studies on this mushroom and to discuss its future prospects.

  1. Better One-Eyed than Blind--Challenges and Opportunities of Biomass Measurement During Solid-State Fermentation of Basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-01-01

    Filamentous fungi, especially basidiomycetes, produce a wide range of metabolites, many of which have potential biotechnological and industrial applications. Solid-state fermentation (SSF) is very suitable for the cultivation of basidiomycetes since it mimics the natural habitat of these fungi. Some of the major advantages of SSF are the robustness of the process, the use of low-cost residual materials as substrates, and the reduced usage of water. However, monitoring key variables is difficult, which makes process control a challenge. Specifically, it is very difficult to determine the biomass during SSF process involving basidiomycetes. This is problematic, as the biomass is normally a key variable in mass and energy balance equations. Further, the success of fungal SSF processes is often evaluated, in part, based on the growth of the fungus. Direct determination of the dry weight of biomass is impossible and indirect quantification techniques must be used. Over the years, various determination techniques have been developed for the quantification of fungal biomass in SSF processes. The current review gives an overview of various direct and indirect biomass determination methods, discussing their advantages and disadvantages.

  2. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  3. Mapping yeast transcriptional networks.

    Science.gov (United States)

    Hughes, Timothy R; de Boer, Carl G

    2013-09-01

    The term "transcriptional network" refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms.

  4. [Fructose transporter in yeasts].

    Science.gov (United States)

    Lazar, Zbigniew; Dobrowolski, Adam; Robak, Małgorzata

    2014-01-01

    Study of hexoses transporter started with discovery of galactose permease in Saccharomyces cerevisiae. Glucose, fructose and mannose assimilation is assumed by numerous proteins encoded by different genes. To date over 20 hexoses transporters, belonging to Sugar Porter family and to Major Facilitator Superfamily, were known. Genome sequence analysis of Candida glabrata, Kluyveromyces lactis, Yarrowia lipolytica, S. cerevisaie and Debaryomyces hansenii reveled potential presence of 17-48 sugar porter proteins. Glucose transporters in S. cerevisiae have been already characterized. In this paper, hexoses transporters, responsible for assimilation of fructose by cells, are presented and compared. Fructose specific transporter are described for yeasts: Zygosaccharomyces rouxii, Zygosaccharomyces bailli, K. lactis, Saccharomyces pastorianus, S. cerevisiae winemaking strain and for fungus Botritys cinerea and human (Glut5p). Among six yeasts transporters, five are fructose specific, acting by facilitated diffusion or proton symport. Yeasts monosaccharides transporter studies allow understanding of sugars uptake and metabolism important aspects, even in higher eukaryotes cells.

  5. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  6. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

    2010-12-07

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

  7. The temperature dependance of photoinhibition in the tropical basidiomycete lichen Cora pavonia E. Fries.

    Science.gov (United States)

    Coxson, D S

    1987-09-01

    The response of net photosynthesis (NP) and dark respiration to periods of high insolation exposure was examined in the tropical basidiomycete lichen Cora pavonia. Photoinhibition of NP proved quite dependant on temperature. Rates of light saturated NP were severely impaired immediately after pretreatment high light exposure at temperatures of 10, 20 and 40°C, while similar exposure at 30°C resulted in only minimal photoinhibition. Apparent quantum yield proved an even more sensitive indicator of photoinhibition, reduced in all temperature treatments, although inhibition was again greatest at low and high temperatures. Concurrent exposure to reduced O2 tensions during high light exposure mitigated some of the deleterious effects of high light exposure at 10 and 20°C, suggesting an interaction of O2 with the inactivation of photosynthetic function. This represents the first reported instance of light dependant chilling stress in lichens, and may be an important limitation on the distribution of this and other tropical lichen species. This narrow range of temperatures within which thalli of C. pavonia can withstand periods of high insolation exposure coincides with that faced by hydrated thalli during rare periods of high insolation exposure within the cloud/shroud zone on La Soufrière, and points to the necessity of considering periods of atypical or unusual climatic events when interpreting patterns of net photosynthetic response, both in tropical and in north temperate lichen species.

  8. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    Science.gov (United States)

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  9. Injury-induced biosynthesis of methyl-branched polyene pigments in a white-rotting basidiomycete.

    Science.gov (United States)

    Schwenk, Daniel; Nett, Markus; Dahse, Hans-Martin; Horn, Uwe; Blanchette, Robert A; Hoffmeister, Dirk

    2014-12-26

    A stereaceous basidiomycete was investigated with regard to its capacity to produce yellow pigments after physical injury of the mycelium. Two pigments were isolated from mycelial extracts, and their structures were elucidated by ESIMS and one- and two-dimensional NMR methods. The structures were identified as the previously undescribed polyenes (3Z,5E,7E,9E,11E,13Z,15E,17E)-18-methyl-19-oxoicosa-3,5,7,9,11,13,15,17-octaenoic acid (1) and (3E,5Z,7E,9E,11E,13E,15Z,17E,19E)-20-methyl-21-oxodocosa-3,5,7,9,11,13,15,17,19-nonaenoic acid (2). Stable-isotope feeding with [1-(13)C]acetate and l-[methyl-(13)C]methionine demonstrated a polyketide backbone and that the introduction of the sole methyl branch is most likely S-adenosyl-l-methionine-dependent. Dose-dependent inhibition of Drosophila melanogaster larval development was observed with both polyenes in concentrations between 12.5 and 100 μM. GI50 values for 1 and 2 against HUVEC (K-562 cells) were 71.6 and 17.4 μM (15.4 and 1.1 μM), respectively, whereas CC50 values for HeLa cells were virtually identical (44.1 and 45.1 μM).

  10. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  11. Proteolytic activities in yeast.

    Science.gov (United States)

    Saheki, T; Holzer, H

    1975-03-28

    Studies on the mechanism and time course of the activation of proteinases A (EC 3.4.23.8), B (EC 3.4.22.9) and C (EC 3.4.12.--) in crude yeast extracts at pH 5.1 and 25 degrees C showed that the increase in proteinase B activity is paralleled with the disappearance of proteinase B inhibitor. Addition of purified proteinase A to fresh crude extracts accelerates the inactivation of the proteinase B inhibitor and the appearance of maximal activities of proteinases B and C. The decrease of proteinase B inhibitor activity and the increase of proteinase B activity are markedly retarded by the addition of pepstatin. Because 10-minus 7 M pepstatin completely inhibits proteinase A without affecting proteinase B activity, this is another indication for the role of proteinase A during the activation of proteinase B. Whereas extracts of yeast grown on minimal medium reached maximal activation of proteinases B and C after 20 h of incubation at pH 5.1 and 25 degrees C, extracts of yeast grown on complete medium had to be incubated for about 100 h. In the latter case, the addition of proteinas A results in maximal activation of proteinases B and C and disappearance of proteinase B inhibitor activity only after 10--20 h of incubation. With the optimal conditions, the maximal activities of proteinases A, B and C, as well as of the proteinase B inhibitor, were determined in crude extracts of yeast that had been grown batchwise for different lengths of time either on minimal or on complete medium. Upon incubation, all three proteinases were activated by several times their initial activity. This reflects the existence of proteolytically degradable inhibitors of the three proteinases and together with the above mentioned observations it demonstrates that the "activation" of yeast proteinases A, B and C upon incubation results from the proteolytic digestion of inhibitors rather than from activation of inactive zymogens by limited proteolysis.

  12. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  13. Highly efficient transformation of intact yeast-like conidium cells of Tremella fuciformin by electroporation

    Institute of Scientific and Technical Information of China (English)

    GUO LiQiong; LIU Yong; ZHAO ShuXian; LIU ErXian; LIU JunFang

    2008-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, also called the blastospore by budding. The yeast-like conidia of T. Fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. So it is a good recipient cell for exogenous gone expression. In this study, two expression vectors pGIg-gfp containing gpd-GI promoter and gfp gone and pGIg-hph containing gpd-GI promoter and hph gone were constructed. The lowest sensitive concentration of hygromycin for the blastospore was determined on three types of media. Our ex-perimenta showed that the lowest sensitive concentration of hygromycin for the blastospore was 5 μg/mL on MA medium. The intact blastospores were transformed with the expression vector pGIg-hph by electroporation. The putative transformants were obtained by the MA selective medium. Experi-mental results showed that the most effective parameters for the electroporation of intact blastospores were obtained by using STM buffer, 1.0×108 cells/mL of blastospores, 200 μL in transformation volume, 6 μg plasmid, 2.0 kV/cm of electric pulse voltage, stillness culturing on MB liquid medium for 48 h after electroporation. In these transformation conditions, the efficiency reached 277 colonies/μg DNA. With the optimal parameters. The putative co-transformants were obtained by the MA selective medium. Eight randomly selected colonies from the vast putative co-transformants were analyzed by PCR de-tection and Southern blotting. The experiments showed that the gfp was integrated into the genomes of three transformants. The co-transformation efficiency was 37.5%. Green fluorescence was observed under laser scanning confocal microscope in these gfp positive transformants. This indicates that the exogenous gfp can be expressed effectively in the yeast-like conidia of T. Fuciformis.

  14. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  15. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  16. Mapping Yeast Transcriptional Networks

    OpenAIRE

    Hughes, Timothy R; de Boer, Carl G.

    2013-01-01

    The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face....

  17. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry.

  18. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period.

  19. Trinitrotoluene and mandarin peels selectively affect lignin-modifying enzyme production in white-rot basidiomycetes.

    Science.gov (United States)

    Kachlishvili, Eva; Asatiani, Mikheil; Kobakhidze, Aza; Elisashvili, Vladimir

    2016-01-01

    Five white-rot basidiomycetes (WRB) species have been evaluated for their potential to tolerate and to degrade 0.2 mM 2, 4, 6-trinitrotoluene (TNT) as well as to produce laccase and manganese peroxidase (MnP) in presence of this xenobiotic. The tested fungal strains produced laccase in both glycerol and mandarin peels-containing media, whereas in the glycerol-containing medium only Cerrena unicolor strains and Trametes versicolor BCC 775 secreted MnP. Replacement of glycerol by milled mandarin peels 3- to 45-fold increased laccase activity, promoted C. unicolor strains and T. versicolor MnP secretion and induced this enzyme production by Fomes fomentarius BCC 38 and Funalia trogii BCC 146. Differential response of the WRB strains to the TNT addition was observed. In particular, laccase activity of C. unicolor increased 2- to 3-fold in both media whereas no stimulation of the laccase production was revealed in cultivation of F. fomentarius. TNT practically did not affect the MnP activity. Two strains of C. unicolor followed by T. versicolor producing laccase and MnP almost completely removed 0.2 mM TNT from the synthetic medium. Increase of TNT concentration from 0 to 0.4 mM in the mandarin peels-based medium and from 0 to 0.3 mM in the glycerol-containing medium stimulated C. unicolor BCC 300 laccase production from 92.4 to 240.7 U/ml and from 17.1 to 48.6 U/ml, respectively. This strain has been resistant to the TNT high concentration and has ability to remove 85 % of initial 0.3 mM TNT content during 6 days of the submerged cultivation.

  20. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  1. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  2. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  3. Genomics and the making of yeast biodiversity

    Science.gov (United States)

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces ...

  4. Ethanol tolerance in yeasts.

    Science.gov (United States)

    Casey, G P; Ingledew, W M

    1986-01-01

    It is now certain that the inherent ethanol tolerance of the Saccharomyces strain used is not the prime factor regulating the level of ethanol that can be produced in a high sugar brewing, wine, sake, or distillery fermentation. In fact, in terms of the maximum concentration that these yeasts can produce under batch (16 to 17% [v/v]) or fed-batch conditions, there is clearly no difference in ethanol tolerance. This is not to say, however, that under defined conditions there is no difference in ethanol tolerance among different Saccharomyces yeasts. This property, although a genetic determinant, is clearly influenced by many factors (carbohydrate level, wort nutrition, temperature, osmotic pressure/water activity, and substrate concentration), and each yeast strain reacts to each factor differently. This will indeed lead to differences in measured tolerance. Thus, it is extremely important that each of these be taken into consideration when determining "tolerance" for a particular set of fermentation conditions. The manner in which each alcohol-related industry has evolved is now known to have played a major role in determining traditional thinking on ethanol tolerance in Saccharomyces yeasts. It is interesting to speculate on how different our thinking on ethanol tolerance would be today if sake fermentations had not evolved with successive mashing and simultaneous saccharification and fermentation of rice carbohydrate, if distillers' worts were clarified prior to fermentation but brewers' wort were not, and if grape skins with their associated unsaturated lipids had not been an integral part of red wine musts. The time is now ripe for ethanol-related industries to take advantage of these findings to improve the economies of production. In the authors' opinion, breweries could produce higher alcohol beers if oxygenation (leading to unsaturated lipids) and "usable" nitrogen source levels were increased in high gravity worts. White wine fermentations could also, if

  5. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  6. Yeast two-hybrid screen.

    Science.gov (United States)

    Makuch, Lauren

    2014-01-01

    Yeast two-hybrid is a method for screening large numbers of gene products (encoded by cDNA libraries) for their ability to interact with a protein of interest. This system can also be used for characterizing and manipulating candidate protein: protein interactions. Interactions between proteins are monitored by the growth of yeast plated on selective media.

  7. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  8. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  9. Bioprotective Role of Yeasts

    Directory of Open Access Journals (Sweden)

    Serena Muccilli

    2015-10-01

    Full Text Available The yeasts constitute a large group of microorganisms characterized by the ability to grow and survive in different and stressful conditions and then to colonize a wide range of environmental and human ecosystems. The competitive traits against other microorganisms have attracted increasing attention from scientists, who proposed their successful application as bioprotective agents in the agricultural, food and medical sectors. These antagonistic activities rely on the competition for nutrients, production and tolerance of high concentrations of ethanol, as well as the synthesis of a large class of antimicrobial compounds, known as killer toxins, which showed clearly a large spectrum of activity against food spoilage microorganisms, but also against plant, animal and human pathogens. This review describes the antimicrobial mechanisms involved in the antagonistic activity, their applications in the processed and unprocessed food sectors, as well as the future perspectives in the development of new bio-drugs, which may overcome the limitations connected to conventional antimicrobial and drug resistance.

  10. BIOSYNTHESIS OF YEAST CAROTENOIDS

    Science.gov (United States)

    Simpson, Kenneth L.; Nakayama, T. O. M.; Chichester, C. O.

    1964-01-01

    Simpson, Kenneth L. (University of California, Davis), T. O. M. Nakayama, and C. O. Chichester. Biosynthesis of yeast carotenoids. J. Bacteriol. 88:1688–1694. 1964.—The biosynthesis of carotenoids was followed in Rhodotorula glutinis and in a new strain, 62-506. The treatment of the growing cultures by methylheptenone, or ionone, vapors permitted observations of the intermediates in the biosynthetic pathway. On the basis of concentration changes and accumulation in blocked pathways, the sequence of carotenoid formation is postulated as phytoene, phytofluene, ζ-carotene, neurosporene, β-zeacarotene, γ-carotene, torulin, a C40 aldehyde, and torularhodin. Torulin and torularhodin were established as the main carotenoids of 62-506. PMID:14240958

  11. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  12. Yeasts: from genetics to biotechnology.

    Science.gov (United States)

    Russo, S; Berkovitz Siman-Tov, R; Poli, G

    1995-01-01

    Yeasts have been known and used in food and alcoholic fermentations ever since the Neolithic Age. In more recent times, on the basis of their peculiar features and history, yeasts have become very important experimental models in both microbiological and genetic research, as well as the main characters in many fermentative production processes. In the last 40 years, advances in molecular biology and genetic engineering have made possible not only the genetic selection of organisms, but also the genetic modification of some of them, especially the simplest of them, such as bacteria and yeasts. These discoveries have led to the availability of new yeast strains fit to fulfill requests of industrial production and fermentation. Moreover, genetically modified and transformed yeasts have been constructed that are able to produce large amounts of biologically active proteins and enzymes. Thus, recombinant yeasts make it easier to produce drugs, biologically active products, diagnostics, and vaccines, by inexpensive and relatively simple techniques. Yeasts are going to become more and more important in the "biotechnological revolution" by virtue of both their features and their very long and safe use in human nutrition and industry.

  13. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  14. 21 CFR 172.896 - Dried yeasts.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dried yeasts. 172.896 Section 172.896 Food and... Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis) may be safely used in food provided the total folic...

  15. Trichosporon porosum comb. nov., an anarmorphoc basidiomycetous yeast inhabiting soil, related to the loubieri/laibachii group of species that assimilate hemicelluloses and phenolic compounds

    NARCIS (Netherlands)

    Middelhoven, W.J.; Scorzetti, G.; Fell, J.W.

    2001-01-01

    Several isolates representing the genus Trichosporon were collected over a 6-year period from soils in The Netherlands. Based on classical growth tests with carbon and nitrogen compounds these were identical. Three of these (CBS 8396, CBS 8397 and CBS 8522) were subjected to molecular analysis of th

  16. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  17. Metabolism of pyrene by the basidiomycete crinipellis stipitaria and identification of pyrenequinones and their hydroxylated precursors in strain JK375

    Energy Technology Data Exchange (ETDEWEB)

    Lambert, M.; Kremer, S.; Anke, H.; Sterner, O. (Univ. of Lund (Sweden))

    1994-10-01

    The metabolism of pyrene, a polycyclic aromatic hydrocarbon, by submerged cultures of the basidiomycete Crinipellis stipitaria was studied. After incubation for 68 h at 25[degrees]C in a 20-liter fermentor with complex medium and 20 mg of pyrene per liter, five metabolites were detected. The compounds were isolated by preparative high-performance liquid chromatography on RP18 and DIOL gels. By, UV, infrared, and [sup 1]H nuclear magnetic resonance spectroscopy and mass spectrometry, 1-hydroxypyrene, 1,6-dihydroxypyrene, 1,8-dihydroxypyrene, 1,6-pyrenequinone, and 1,8-pyrenequinone were identified 1,6- and 1,8-dihydroxypyrene were obtained from fungal cultures for the first time. The formation of these metabolites was confirmed by investigations with [4,5,9,10-[sup 14]C]pyrene. 29 refs., 2 figs., 2 tabs.

  18. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  19. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes.

    Science.gov (United States)

    Gomes, Eleni; Aguiar, Ana Paula; Carvalho, Caio César; Bonfá, Maricy Raquel B; da Silva, Roberto; Boscolo, Mauricio

    2009-01-01

    Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF) using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL(-1)) and Lentinus sp produced the highest activities of manganese peroxidase (MnP) and lignin peroxidase (LiP) (7 and 8 U mL(-1), respectively), when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60ºC while the peroxidases presented maximum activity at temperatures of 30 to 55ºC. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.

  20. Applications of yeast flocculation in biotechnological processes

    OpenAIRE

    Domingues, Lucília; Vicente, A.A.; Lima, Nelson; Teixeira, J. A.

    2000-01-01

    A review on the main aspects associated with yeast flocculation and its application in biotechnological processes is presented. This subject is addressed following three main aspects – the basics of yeast flocculation, the development of “new” flocculating yeast strains and bioreactor development. In what concerns the basics of yeast flocculation, the state of the art on the most relevant aspects of mechanism, physiology and genetics of yeast flocculation is reported. The const...

  1. Marine Yeasts and Their Applications in Mariculture

    Institute of Scientific and Technical Information of China (English)

    CHI Zhenming; LIU Zhiqiang; GAO Lingmei; GONG Fang; MA Chunling; WANG Xianghong; LI Haifeng

    2006-01-01

    The terrestrial yeasts have been receiving great attention in science and industry for over one hundred years because they can produce many kinds of bioactive substances. However, little is known about the bioactive substances of marine yeasts. In recent years, it has been found that marine yeasts have wide applications in mariculture and other fields.Therefore, marine yeasts, the bioactive substances from them and the applications of marine yeasts themselves and the bioactive substances they produced are reviewed in this paper.

  2. Assimilation of nitrate by yeasts.

    Science.gov (United States)

    Siverio, José M

    2002-08-01

    Nitrate assimilation has received much attention in filamentous fungi and plants but not so much in yeasts. Recently the availability of classical genetic and molecular biology tools for the yeast Hansenula polymorpha has allowed the advance of the study of this metabolic pathway in yeasts. The genes YNT1, YNR1 and YNI1, encoding respectively nitrate transport, nitrate reductase and nitrite reductase, have been cloned, as well as two other genes encoding transcriptional regulatory factors. All these genes lie closely together in a cluster. Transcriptional regulation is the main regulatory mechanism that controls the levels of the enzymes involved in nitrate metabolism although other mechanisms may also be operative. The process involved in the sensing and signalling of the presence of nitrate in the medium is not well understood. In this article the current state of the studies of nitrate assimilation in yeasts as well as possible venues for future research are reviewed.

  3. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  4. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a...

  5. Engineering antibodies by yeast display.

    Science.gov (United States)

    Boder, Eric T; Raeeszadeh-Sarmazdeh, Maryam; Price, J Vincent

    2012-10-15

    Since its first application to antibody engineering 15 years ago, yeast display technology has been developed into a highly potent tool for both affinity maturing lead molecules and isolating novel antibodies and antibody-like species. Robust approaches to the creation of diversity, construction of yeast libraries, and library screening or selection have been elaborated, improving the quality of engineered molecules and certainty of success in an antibody engineering campaign and positioning yeast display as one of the premier antibody engineering technologies currently in use. Here, we summarize the history of antibody engineering by yeast surface display, approaches used in its application, and a number of examples highlighting the utility of this method for antibody engineering.

  6. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    Dominika M Wloch-Salamon

    2014-04-01

    Social theory has provided a useful framework for research with microorganisms. Here I describe the advantages and possible risks of using a well-known model organism, the unicellular yeast Saccharomyces cerevisiae, for sociobiological research. I discuss the problems connected with clear classification of yeast behaviour based on the fitness-based Hamilton paradigm. Relevant traits include different types of communities, production of flocculins, invertase and toxins, and the presence of apoptosis.

  7. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  8. Red Yeast Rice

    Science.gov (United States)

    Nguyen, Thu; Karl, Mitchell; Santini, Antonello

    2017-01-01

    Red yeast rice (RYR), produced by the fermentation of the Monascus purpureus mold, has been used for a long time in Asian cuisine and traditional medicine. It consists of multiple bioactive substances, including monacolins, which potentially can be used as a nutraceutical. Monacolin K, which is chemically identical to lovastatin, has been recognized as responsible for the cholesterol-reducing effect of this compound. While the European Food Safety Authority maintains that the use of monacolin K from RYR preparations of at least 10 mg can produce a normal blood cholesterol level, the United States Food and Drug Administration considers monacolin K, due to its similarity with lovastatin, an unapproved drug, and therefore marketing of products that label the monacolin content is prohibited. This mini-review summarizes the benefit of RYR in hyperlipidemia, maintains RYR use as a food, and addresses the importance of regulation regarding RYR and the need for clinical data and clear label information for consumers with reference to a toxin-free, non-augmented, standardized amount of monacolins. PMID:28257063

  9. Red Yeast Rice

    Directory of Open Access Journals (Sweden)

    Thu Nguyen

    2017-03-01

    Full Text Available Red yeast rice (RYR, produced by the fermentation of the Monascus purpureus mold, has been used for a long time in Asian cuisine and traditional medicine. It consists of multiple bioactive substances, including monacolins, which potentially can be used as a nutraceutical. Monacolin K, which is chemically identical to lovastatin, has been recognized as responsible for the cholesterolreducing effect of this compound. While the European Food Safety Authority maintains that the use of monacolin K from RYR preparations of at least 10 mg can produce a normal blood cholesterol level, the United States Food and Drug Administration considers monacolin K, due to its similarity with lovastatin, an unapproved drug, and therefore marketing of products that label the monacolin content is prohibited. This mini-review summarizes the benefit of RYR in hyperlipidemia, maintains RYR use as a food, and addresses the importance of regulation regarding RYR and the need for clinical data and clear label information for consumers with reference to a toxin-free, nonaugmented, standardized amount of monacolins.

  10. Clinical Significance and Molecular Characterization of Nonsporulating Molds Isolated from the Respiratory Tracts of Bronchopulmonary Mycosis Patients with Special Reference to Basidiomycetes

    OpenAIRE

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F.; Chowdhary, Anuradha

    2013-01-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger sub...

  11. Basidioascus persicus sp. nov., a yeast-like species of the order Geminibasidiales isolated from soil.

    Science.gov (United States)

    Nasr, Shaghayegh; Soudi, Mohammad Reza; Nasrabadi, Seyyedeh Maryam Zamanzadeh; Nikou, Mahdi Moshtaghi; Salmanian, Ali Hatef; Nguyen, Hai D T

    2014-09-01

    A novel species of basidiomycetes was isolated from kitchen garden soil in Shahryar city, Tehran province, Iran. Molecular and conventional methods were employed to identify and classify this single isolate. Morphologically, the isolate was considered yeast-like with hyaline and oval cells reproducing by monopolar budding, forming ballistoconidia, hyphae, arthroconidia and didymospores. Basidia and basidiospores resembling those produced by Basidioascus species were observed. Sequencing and Bayesian phylogenetic analysis of rRNA genes and the internal transcribed spacer region revealed its sister relationship to described species of the genus Basidioascus. Assimilation and fermentation tests, cell-wall carbohydrate analysis and enzyme activity tests were performed to provide insight into the metabolism of the isolate. Based on morphology, physiology and phylogeny of rRNA gene sequences, the isolate was shown to represent a novel species of the genus Basidioascus, described as Basidioascus persicus sp. nov. (holotype IBRC P1010180(T) = ex-type IBRC M30078(T) = isotype CBS 12808(T)). The MycoBank number of the novel species is MB 804703. An emended description of the genus Basidioascus is also provided.

  12. Efficient screening for astaxanthin-overproducing mutants of the yeast Xanthophyllomyces dendrorhous by flow cytometry.

    Science.gov (United States)

    Ukibe, Ken; Katsuragi, Tohoru; Tani, Yoshiki; Takagi, Hiroshi

    2008-09-01

    Astaxanthin possesses higher antioxidant activity than other carotenoids and, for this and other reasons, has great commercial potential for use in the aquaculture, pharmaceutical, and food industries. The basidiomycetous yeast Xanthophyllomyces dendrorhous is one of the best natural producers of astaxanthin, but wild-type cells accumulate only a small amount of astaxanthin. In this study, we developed an efficient flow cytometry method to screen for astaxanthin-overproducing mutants of X. dendrorhous. We first examined the relationship between cellular astaxanthin content and the intensity of fluorescence emitted from the cell. Although the fluorescence emission maximum of astaxanthin dissolved in acetone occurred at 570 nm, intracellular astaxanthin content correlated better with emission at around 675 nm in different X. dendrorhous strains. Using this emission wavelength, we screened cells mutagenized with ethyl methanesulfonate and successfully isolated mutants that produced 1.5-3.8-fold more astaxanthin than parent cells. This method enabled us to obtain overproducers five times more efficient than conventional screening from plate culture.

  13. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions.

  14. Wood and humus decay strategies by white-rot basidiomycetes correlate with two different dye decolorization and enzyme secretion patterns on agar plates.

    Science.gov (United States)

    Barrasa, José M; Blanco, María N; Esteve-Raventós, Fernando; Altés, Alberto; Checa, Julia; Martínez, Angel T; Ruiz-Dueñas, Francisco J

    2014-11-01

    During several forays for ligninolytic fungi in different Spanish native forests, 35 white-rot basidiomycetes growing on dead wood (16 species from 12 genera) and leaf litter (19 species from 10 genera) were selected for their ability to decolorize two recalcitrant aromatic dyes (Reactive Blue 38 and Reactive Black 5) added to malt extract agar medium. In this study, two dye decolorization patterns were observed and correlated with two ecophysiological groups (wood and humus white-rot basidiomycetes) and three taxonomical groups (orders Polyporales, Hymenochaetales and Agaricales). Depending on the above groups, different decolorization zones were observed on the dye-containing plates, being restricted to the colony area or extending to the surrounding medium, which suggested two different decay strategies. These two strategies were related to the ability to secrete peroxidases and laccases inside (white-rot wood Polyporales, Hymenochaetales and Agaricales) and outside (white-rot humus Agaricales) of the fungal colony, as revealed by enzymatic tests performed directly on the agar plates. Similar oxidoreductases production patterns were observed when fungi were grown in the absence of dyes, although the set of enzyme released was different. All these results suggest that the decolorization patterns observed could be related with the existence of two decay strategies developed by white-rot basidiomycetes adapted to wood and leaf litter decay in the field.

  15. Enrichment of perforate septal pore caps from the basidiomycetous fungus Rhizoctonia solani by combined use of French press, isopycnic centrifugation, and Triton X-100.

    Science.gov (United States)

    van Driel, Kenneth G A; van Peer, Arend F; Wösten, Han A B; Verkleij, Arie J; Boekhout, Teun; Müller, Wally H

    2007-12-01

    Septal pore caps occur in many filamentous basidiomycetes located at both sides of the dolipore septum and are at their base connected to the endoplasmic reticulum. The septal pore cap ultrastructure has been described extensively by the use of electron microscopy, but its composition and function are not yet known. To enable biochemical and functional analyses in the future, we here describe an enrichment method for perforate septal pore caps from Rhizoctonia solani. Our method is based on the combined use of French press and isopycnic centrifugation, using a discontinuous sucrose gradient followed by a treatment with Triton X-100. Enrichment was monitored by the use of scanning electron microscopy and transmission electron microscopy. Using the same isolation method, smaller septal pore caps were isolated from two other basidiomycetes as well. Furthermore, we showed pore-occluding material co-purified with the septal pore caps. This observation supports the hypothesis that septal pore caps play a key role in the plugging process of the septal pores in filamentous basidiomycetes.

  16. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  17. Yeast Genetics and Biotechnological Applications

    Science.gov (United States)

    Mishra, Saroj; Baranwal, Richa

    Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

  18. Highly efficient transformation of intact yeast-like conidium cells of Tremella fuciformis by electroporation

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, also called the blastospore by budding. The yeast-like conidia of T. fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. So it is a good recipient cell for exogenous gene expression. In this study, two expression vectors pGlg-gfp containing gpd-Gl promoter and gfp gene and pGlg-hph containing gpd-Gl promoter and hph gene were constructed. The lowest sensitive concentration of hygromycin for the blastospore was determined on three types of media. Our ex- periments showed that the lowest sensitive concentration of hygromycin for the blastospore was 5 μg/mL on MA medium. The intact blastospores were transformed with the expression vector pGlg-hph by electroporation. The putative transformants were obtained by the MA selective medium. Experi- mental results showed that the most effective parameters for the electroporation of intact blastospores were obtained by using STM buffer, 1.0×108 cells/mL of blastospores, 200 μL in transformation volume, 6 μg plasmid, 2.0 kV/cm of electric pulse voltage, stillness culturing on MB liquid medium for 48 h after electroporation. In these transformation conditions, the efficiency reached 277 colonies/μg DNA. Co-transformation of plasmid pGlg-gfp and pGlg-hph with ratio of 1:1 was performed by electroporation with the optimal parameters. The putative co-transformants were obtained by the MA selective medium. Eight randomly selected colonies from the vast putative co-transformants were analyzed by PCR de- tection and Southern blotting. The experiments showed that the gfp was integrated into the genomes of three transformants. The co-transformation efficiency was 37.5%. Green fluorescence was observed under laser scanning confocal microscope in these gfp positive transformants. This indicates that the exogenous gfp can be expressed effectively in the yeast-like conidia of T. fuciformis.

  19. Heterologous carotenoid production in Saccharomyces cerevisiae induces the pleiotropic drug resistance stress response

    NARCIS (Netherlands)

    Verwaal, R.; Jiang, Y.; Wang, J.; Daran, J.M.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2010-01-01

    To obtain insight into the genome-wide transcriptional response of heterologous carotenoid production in Saccharomyces cerevisiae, the transcriptome of two different S. cerevisiae strains overexpressing carotenogenic genes from the yeast Xanthophyllomyces dendrorhous grown in carbon-limited chemosta

  20. Emulsifying activity of hydrocarbonoclastic marine yeasts

    Digital Repository Service at National Institute of Oceanography (India)

    Gupta, R.

    Marine yeast growth on four petroleum hydrocarbons induced the production of extracellular emulsifying agents (biosurfactants). Out of the 17 marine yeast isolates tested, 7 isolates, i.e., Candida parapsilosis, C. cantarelli, C. membranae...

  1. Shuffling Yeast Gene Expression Data

    CERN Document Server

    Bilke, S

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent cell clock is identified. The capability of the algorithm to extract information about signal flow in the regulatory network underlying the expression patterns is demonstrated.

  2. Advances in yeast genome engineering.

    Science.gov (United States)

    David, Florian; Siewers, Verena

    2015-02-01

    Genome engineering based on homologous recombination has been applied to yeast for many years. However, the growing importance of yeast as a cell factory in metabolic engineering and chassis in synthetic biology demands methods for fast and efficient introduction of multiple targeted changes such as gene knockouts and introduction of multistep metabolic pathways. In this review, we summarize recent improvements of existing genome engineering methods, the development of novel techniques, for example for advanced genome redesign and evolution, and the importance of endonucleases as genome engineering tools.

  3. 21 CFR 73.355 - Phaffia yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Phaffia yeast. 73.355 Section 73.355 Food and... ADDITIVES EXEMPT FROM CERTIFICATION Foods § 73.355 Phaffia yeast. (a) Identity. (1) The color additive phaffia yeast consists of the killed, dried cells of a nonpathogenic and nontoxicogenic strain of...

  4. Comparative Evaluation of the BD Phoenix Yeast ID Panel and Remel RapID Yeast Plus System for Yeast Identification

    OpenAIRE

    Michelle L. Grant; Shobha Parajuli; Raquel Deleon-Gonsalves; Raghava Potula; Truant, Allan L.

    2016-01-01

    Becton Dickinson Phoenix Yeast ID Panel was compared to the Remel RapID Yeast Plus System using 150 recent clinical yeast isolates and the API 20C AUX system to resolve discrepant results. The concordance rate between the Yeast ID Panel and the RapID Yeast Plus System (without arbitration) was 93.3% with 97.3% (146/150) and 95.3% (143/150) of the isolates correctly identified by the Becton Dickinson Phoenix and the Remel RapID, respectively, with arbitration.

  5. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  6. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process.

  7. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-01-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense. PMID:27616058

  8. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities.

  9. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O.V.

    2013-04-01

    Full Text Available A method for obtaining of enzyme preparations of enzyme preparations (EP of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfate at 40-70% saturation of peroxidases and 80% of saturation - for catalase. These solutions protein fractions was further purified by dialysis and gel filtration on Molselekt granules G-50 and G-75. The enzyme solution was subjected to freeze-drying. The individual characteristics of the enzyme preparations were found. The individual characteristics of the enzyme preparations are the activity of enzymes, the protein content and amino-acid composition of enzyme preparations. It was established that strain F. velutipes F-vv was an active producer of intracellular and strain of A. cylindracea 167 was an active producer of extracellular peroxidase. The strains of P. ostreatus P-01 and P-208 were the active producers of extracellular catalase, and the strainsof F. hepatica Fh-08 were active producers of intracellular catalase. The developed methods for producing of enzymes catalase and peroxidase preparations of extra-and intracellular origin provided new antioxidant enzymes, which have their own properties and application prospects in various sectors of industry and science research.

  10. Molecular cloning and heterologous expression in Pichia pastoris of X-prolyl-dipeptidyl aminopeptidase from basidiomycete Ustilago maydis.

    Science.gov (United States)

    Juárez-Montiel, Margarita; Ibarra, J Antonio; Chávez-Camarillo, Griselda; Hernández-Rodríguez, César; Villa-Tanaca, Lourdes

    2014-03-01

    Dipeptidyl aminopeptidases are enzymes involved in the posttranslational control of bioactive peptides. Here we identified the gene dapUm in Ustilago maydis by homology with other fungal dipeptidyl aminopeptidases. Analysis of the dapUm-deduced amino acid sequence indicated that it encodes for membrane-type serine protease with a characteristic prolyl oligopeptidase catalytic motif triad: Ser, Asp, His. In order to overexpress the DapUm, the gene encoding for it was cloned and transformed into Pichia. Using this system, we observed a ∼ 125-kDa recombinant protein with an optimal enzymatic activity at pH 6.0 and at 40 °C for the Ala-Pro-p-nitroanilide substrate and an experimental pH of 6.9. U. maydis DapUm was specifically inhibited by phenylmethylsulfonyl fluoride and Pefabloc, confirming the presence of a serine residue in the active site. To our knowledge, this study is the first report on the cloning and expression of a DPP IV dipeptidyl aminopeptidase from a basidiomycete organism. Moreover, the use of recombinant DapUm will allow us to further study and characterize this enzyme, in addition to testing chemical compounds for pharmaceutical purposes.

  11. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  12. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  13. Black yeasts in cold habitats

    NARCIS (Netherlands)

    Selbmann, L.; de Hoog, G.S.; Zucconi, L.; Isola, D.; Onofri, S.; Buzzini, B.; Margesin, E.

    2014-01-01

    Black yeasts have already been known since the end of the nineteenth century, but for a number of reasons, only few workers were familiar with them. That was since recently, until the wealth of biodiversity, stunning ecologies and potential applications have become apparent. Some remote and extreme

  14. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  15. Yeast as factory and factotum.

    Science.gov (United States)

    Dixon, B

    2000-02-01

    After centuries of vigorous activity in making fine wines, beers and breads, Saccharomyces cerevisiae is now acquiring a rich new portfolio of skills, bestowed by genetic manipulation. As shown in a recent shop-window of research supported by the European Commission, yeasts will soon be benefiting industries as diverse as fish farming, pharmaceuticals and laundering.

  16. The wine and beer yeast Dekkera bruxellensis.

    Science.gov (United States)

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history.

  17. Two-component signal transduction in Agaricus bisporus: a comparative genomic analysis with other basidiomycetes through the web-based tool BASID2CS.

    Science.gov (United States)

    Lavín, José L; García-Yoldi, Alberto; Ramírez, Lucía; Pisabarro, Antonio G; Oguiza, José A

    2013-06-01

    Two-component systems (TCSs) are signal transduction mechanisms present in many eukaryotes, including fungi that play essential roles in the regulation of several cellular functions and responses. In this study, we carry out a genomic analysis of the TCS proteins in two varieties of the white button mushroom Agaricus bisporus. The genomes of both A. bisporus varieties contain eight genes coding for TCS proteins, which include four hybrid Histidine Kinases (HKs), a single histidine-containing phosphotransfer (HPt) protein and three Response Regulators (RRs). Comparison of the TCS proteins among A. bisporus and the sequenced basidiomycetes showed a conserved core complement of five TCS proteins including the Tco1/Nik1 hybrid HK, HPt protein and Ssk1, Skn7 and Rim15-like RRs. In addition, Dual-HKs, unusual hybrid HKs with 2 HK and 2 RR domains, are absent in A. bisporus and are limited to various species of basidiomycetes. Differential expression analysis showed no significant up- or down-regulation of the Agaricus TCS genes in the conditions/tissue analyzed with the exception of the Skn7-like RR gene (Agabi_varbisH97_2|198669) that is significantly up-regulated on compost compared to cultured mycelia. Furthermore, the pipeline web server BASID2CS (http://bioinformatics.unavarra.es:1000/B2CS/BASID2CS.htm) has been specifically designed for the identification, classification and functional annotation of putative TCS proteins from any predicted proteome of basidiomycetes using a combination of several bioinformatic approaches.

  18. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes

    OpenAIRE

    Jorge Álvarez-Cervantes; Gerardo Díaz-Godínez; Yuridia Mercado-Flores; Vijai Kumar Gupta; Miguel Angel Anducho-Reyes

    2016-01-01

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to...

  19. Surplus yeast tank failing catastrophically

    DEFF Research Database (Denmark)

    Hedlund, Frank Huess

    2016-01-01

    GOOD REASON FOR CAUTION I A large surplus yeast tank shot into the air leaving the floor plate and the contents behind. Although not designed for overpressure, the tank was kept at “very slight overpressure” to suppress nuisance foaming. The brewery was unaware of the hazards of compressed air. T....... The accident described in this article serves to illustrate that care should be taken if a tank originally designed for atmospheric pressure is modified to operate at slight overpressure.......GOOD REASON FOR CAUTION I A large surplus yeast tank shot into the air leaving the floor plate and the contents behind. Although not designed for overpressure, the tank was kept at “very slight overpressure” to suppress nuisance foaming. The brewery was unaware of the hazards of compressed air...

  20. Mycotoxins - prevention and decontamination by yeasts.

    Science.gov (United States)

    Pfliegler, Walter P; Pusztahelyi, Tünde; Pócsi, István

    2015-07-01

    The application of yeasts has great potential in reducing the economic damage caused by toxigenic fungi in the agriculture. Some yeasts may act as biocontrol agents inhibiting the growth of filamentous fungi. These species may also gain importance in the preservation of agricultural products and in the reduction of their mycotoxin contamination, yet the extent of mycotoxin production in the presence of biocontrol agents is relatively less understood. The application of yeasts in various technological processes may have a direct inhibitory effect on the toxin production of certain molds, which is independent of their growth suppressing effect. Furthermore, several yeast species are capable of accumulating mycotoxins from agricultural products, thereby effectively decontaminating them. Probiotic yeasts or products containing yeast cell wall are also applied to counteract mycotoxicosis in livestock. Several yeast strains are also able to degrade toxins to less-toxic or even non-toxic substances. This intensively researched field would greatly benefit from a deeper knowledge on the genetic and molecular basis of toxin degradation. Moreover, yeasts and their biotechnologically important enzymes may exhibit sensitivity to certain mycotoxins, thereby mounting a considerable problem for the biotechnological industry. It is noted that yeasts are generally regarded as safe; however, there are reports of toxin degrading species that may cause human fungal infections. The aspects of yeast-mycotoxin relations with a brief consideration of strain improvement strategies and genetic modification for improved detoxifying properties and/or mycotoxin resistance are reviewed here.

  1. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  2. Tracer studies of nitrogen assimilation in yeast.

    Science.gov (United States)

    ABRAMS, R; HAMMARSTEN, E

    1949-01-01

    By using N(15) as a tracer the assimilation of ammonia by the yeast, Torulopsis utilis, has been studied. It has been shown that: 1. There was no measurable incorporation of N in the protein or polynucleotide purine of carbon-starved yeast. 2. When ammonia is added to nitrogen-starved yeast there is a long lag period before division begins during which the yeast rapidly synthesizes protein, this process being accompanied by a turnover of polynucleotide purine. There was no significant dilution of the N(15)H(4) (+) of the medium by ordinary NH(4) (+). 3. When yeast containing N(15) is allowed to divide and grow in ordinary ammonia, the total amount of N(15) in the yeast remains constant. The dicarboxylic amino acids are most diluted, while arginine and nucleic acid guanine are not diluted at all.

  3. [Metabolomics analysis of taxadiene producing yeasts].

    Science.gov (United States)

    Yan, Huifang; Ding, Mingzhu; Yuan, Yingjin

    2014-02-01

    In order to study the inherent difference among terpenes producing yeasts from the point of metabolomics, we selected taxadiene producing yeasts as the model system. The changes of cellular metabolites during fermentation log phase of artificial functional yeasts were determined using metabolomics methods. The results represented that compared to W303-1A as a blank control, the metabolites in glycolysis, tricarboxylic acid cycle (TCA) cycle and several amino acids were influenced. And due to the changes of metabolites, the growth of cells was inhibited to a certain extent. Among the metabolites identified, citric acid content in taxadiene producing yeasts changed the most, the decreasing amplitude reached 90% or more. Therefore, citric acid can be a marker metabolite for the future study of artificial functional yeasts. The metabolomics analysis of taxadiene producing yeasts can provide more information in further studies on optimization of terpenes production in heterologous chassis.

  4. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  5. Beer brewing using a fusant between a sake yeast and a brewer's yeast.

    Science.gov (United States)

    Mukai, N; Nishimori, C; Fujishige, I W; Mizuno, A; Takahashi, T; Sato, K

    2001-01-01

    Beer brewing using a fusant between a sake yeast (a lysine auxotrophic mutant of sake yeast K-14) and a brewer's yeast (a respiratory-deficient mutant of the top fermentation yeast NCYC1333) was performed to take advantage of the beneficial characteristics of sake yeasts, i.e., the high productivity of esters, high tolerance to ethanol, and high osmotolerance. The fusant (F-32) obtained was different from the parental yeasts regarding, for example, the assimilation of carbon sources and tolerance to ethanol. A brewing trial with the fusant was carried out using a 100-l pilot-scale plant. The fusant fermented wort more rapidly than the parental brewer's yeast. However, the sedimentation capacity of the fusant was relatively low. The beer brewed using the fusant contained more ethanol and esters compared to that brewed using the parental brewer's yeast. The fusant also obtained osmotolerance in the fermentation of maltose and fermented high-gravity wort well.

  6. Assembly of eukaryotic algal chromosomes in yeast

    OpenAIRE

    Karas, Bogumil J.; Molparia, Bhuvan; Jablanovic, Jelena; Hermann, Wolfgang J; Lin, Ying-Chi; Dupont, Christopher L.; Tagwerker, Christian; Yonemoto, Isaac T.; Noskov, Vladimir N.; Chuang, Ray-Yuan; Allen, Andrew E; Glass, John I.; Hutchison, Clyde A; Smith, Hamilton O; Venter, J Craig

    2013-01-01

    Background Synthetic genomic approaches offer unique opportunities to use powerful yeast and Escherichia coli genetic systems to assemble and modify chromosome-sized molecules before returning the modified DNA to the target host. For example, the entire 1 Mb Mycoplasma mycoides chromosome can be stably maintained and manipulated in yeast before being transplanted back into recipient cells. We have previously demonstrated that cloning in yeast of large (> ~ 150 kb), high G + C (55%) prokaryoti...

  7. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from Ra-226 from <0.3 to 1.0 ± 0.5 Bq kg(-1) F.W., and K-40 from 56.4 ± 3.0 to 759.0 ± 28.3 Bq kg(-1) F.W. The analysis of the results supported that the bioaccumulation of the studied natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied.

  8. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes.

  9. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  10. C- and N-catabolic utilization of tricarboxylic acid cycle-related amino acids by Scheffersomyces stipitis and other yeasts.

    Science.gov (United States)

    Freese, Stefan; Vogts, Tanja; Speer, Falk; Schäfer, Bernd; Passoth, Volkmar; Klinner, Ulrich

    2011-05-01

    Scheffersomyces stipitis and the closely related yeast Candida shehatae assimilated the L-amino acids glutamate, aspartate and proline as both carbon and nitrogen sole sources. We also found this rarely investigated ability in ascomycetous species such as Candida glabrata, C. reukaufii, C. utilis, Debaryomyces hansenii, Kluyveromyces lactis, K. marxianus, Candida albicans, L. elongisporus, Meyerozyma guilliermondii, C. maltosa, Pichia capsulata and Yarrowia lipolytica and in basidiomycetous species such as Rhodotorula rubra and Trichosporon beigelii. Glutamate was a very efficient carbon source for Sc. stipitis, which enabled a high biomass yield/mole, although the growth rate was lower when compared to growth on glucose medium. The cells secreted waste ammonium during growth on glutamate alone. In Sc. stipitis cultures grown in glucose medium containing glutamate as the nitrogen source the biomass yield was maximal, and ethanol concentration and specific ethanol formation rate were significantly higher than in glucose medium containing ammonium as the nitrogen source. Mainly C-assimilation of glutamate but also N-assimilation in glucose-containing medium correlated with enhanced activity of the NAD-dependent glutamate dehydrogenase 2 (GDH2). A Δgdh2 disruptant was unable to utilize glutamate as either a carbon or a nitrogen source; moreover, this disruptant was also unable to utilize aspartate as a carbon source. The mutation was complemented by retransformation of the GDH2 ORF into the Δgdh2 strain. The results show that Gdh2p plays a dual role in Sc. stipitis as both C- and N-catabolic enzyme, which indicates its role as an interface between the carbon and nitrogen metabolism of this yeast.

  11. Biofuels. Altered sterol composition renders yeast thermotolerant

    DEFF Research Database (Denmark)

    Caspeta, Luis; Chen, Yun; Ghiaci, Payam;

    2014-01-01

    Ethanol production for use as a biofuel is mainly achieved through simultaneous saccharification and fermentation by yeast. Operating at ≥40°C would be beneficial in terms of increasing efficiency of the process and reducing costs, but yeast does not grow efficiently at those temperatures. We use...

  12. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics.

  13. The wine and beer yeast Dekkera bruxellensis

    Science.gov (United States)

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-01-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd. PMID:24932634

  14. Yeast cell factories on the horizon

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2015-01-01

    For thousands of years, yeast has been used for making beer, bread, and wine. In modern times, it has become a commercial workhorse for producing fuels, chemicals, and pharmaceuticals such as insulin, human serum albumin, and vaccines against hepatitis virus and human papillomavirus. Yeast has al...

  15. Growth requirements of san francisco sour dough yeasts and bakers' yeast.

    Science.gov (United States)

    Henry, N

    1976-03-01

    The growth requirements of several yeasts isolated from San Francisco sour dough mother sponges were compared with those of bakers' yeast. The sour dough yeasts studied were one strain of Saccharomyces uvarum, one strain of S. inusitatus, and four strains of S. exiguus. S. inusitatus was the only yeast found to have an amino acid requirement, namely, methionine. All of the yeasts had an absolute requirement for pantothenic acid and a partial requirement for biotin. Inositol was stimulatory to all except bakers' yeast. All strains of S. exiguus required niacin and thiamine. Interestingly, S. inusitatus, the only yeast that required methionine, also needed folic acid. For optimal growth of S. exiguus in a molasses medium, supplementation with thiamine was required.

  16. Genetic constitution of industrial yeast.

    Science.gov (United States)

    Benítez, T; Martínez, P; Codón, A C

    1996-09-01

    Saccharomyces cerevisiae industrial yeast strains are highly heterogeneous. These industrial strains, including bakers', wine, brewing and distillers', have been compared with respect to their DNA content, number and size of chromosomes, homologies between their genes and those of laboratory strains, and restriction fragment lengths of their mitDNA. A high variability, and the presence of multigenic families, were observed in some industrial yeast groups. The occurrence or the lack of chromosomal polymorphism, as well as the presence of multiple copies of some genes, could be related to a selective process occurring under specific industrial conditions. This polymorphism is generated by reorganization events, that take place mainly during meiosis and are mediated by repetitive Y' and Ty elements. These elements give rise to ectopic and asymmetric recombination and to gene conversion. The polymorphism displayed by the mitDNA could also result from specific industrial conditions. However, in enological strains the selective process is masked by the mutagenic effect that ethanol exerts on this DNA.

  17. Comet assay on tetraploid yeast cells

    DEFF Research Database (Denmark)

    Rank, Jette; Syberg, Kristian; Jensen, Klara

    2009-01-01

    Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from...... three municipal treatment plants were tested for their effect on the yeast-cell DNA. The main problem with using yeast in the comet assay is the necessity to degrade the cell wall. This was achieved by using Zymolase 100 T twice during the procedure, since Zymolase 20 T did not open the cell wall....... Analytical problems that arose due to the small amount of DNA in the yeast nuclei in haploid and diploid cells, which contain 13 Mbp and 26 Mbp DNA per cell, respectively, were solved by using tetraploid yeast cells (52 Mbp) instead. DNA damage was shown after exposure to H2O2 and acrylamide. The lowest dose...

  18. Ceramide Accumulation in Yeast Yarrowia lipolitica

    Institute of Scientific and Technical Information of China (English)

    周全; 陈国强

    2005-01-01

    Ceramides are a class of lipid molecules widely distributed in eukaryotic cells in small amount. To investigate the possibility of ceramide production by yeast, a yeast strain Yarrowia lipolitica was grown under different conditions including changing carbon/nitrogen ratio, and serine concentration, dissolved oxygen and presence of ethanol. It was found that increased dissolved oxygen supply increased the ceramide content in the yeast 2.5 fold of its normal control level. Ethanol treatment could also enhance ceramide accumulation by 3.3 fold compared with the control although the cell growth was negatively affected. Cellular redox potential was shown to affect ceramide accumulation by the yeast. This was possibly related to the cellular reactive oxygen species presented in the yeast.

  19. Modeling competition between yeast strains

    Science.gov (United States)

    de Gee, Maarten; van Mourik, Hilda; de Visser, Arjan; Molenaar, Jaap

    2016-04-01

    We investigate toxin interference competition between S. cerevisiae colonies grown on a solid medium. In vivo experiments show that the outcome of this competition depends strongly on nutrient availability and cell densities. Here we present a new model for S. cerevisiae colonies, calculating the local height and composition of the colonies. The model simulates yeast colonies that show a good fit to experimental data. Simulations of colonies that start out with a homogeneous mixture of toxin producing and toxin sensitive cells can display remarkable pattern formation, depending on the initial ratio of the strains. Simulations in which the toxin producing and toxin sensitive species start at nearby positions clearly show that toxin production is advantageous.

  20. Accelerating Yeast Prion Biology using Droplet Microfluidics

    Science.gov (United States)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  1. Decolorization of mixtures of different reactive textile dyes by the white-rot basidiomycete Phanerochaete sordida and inhibitory effect of polyvinyl alcohol.

    Science.gov (United States)

    Harazono, Koichi; Nakamura, Kazunori

    2005-03-01

    We tried to decolorize mixtures of four reactive textile dyes, including azo and anthraquinone dyes, by a white-rot basidiomycete Phanerochaete sordida. P. sordida decolorized dye mixtures (200 mg l-1 each) by 90% within 48 h in nitrogen-limited glucose-ammonium media. Decolorization of dye mixtures needed Mn2+ and Tween 80 in the media. Manganese peroxidase (MnP) played a major role in dye decolorization by P. sordida. Decolorization of dye mixtures by P. sordida was partially inhibited by polyvinyl alcohol (PVA) that wastewaters from textile industries often contain. This was caused by an inhibitory effect of PVA on the decolorization of Reactive Red 120 (RR120) with MnP reaction system. Second addition of Tween 80 to the reaction mixtures in the presence of PVA improved the decolorization of RR120. These results suggest that PVA could interfere with lipid peroxidation or subsequent attack to the dye.

  2. Fungicides affect the production of extracellular mucilaginous material (ECMM) and the peripheral growth unit (PGU) in two wood-rotting basidiomycetes.

    Science.gov (United States)

    Vesentini, Damiano; Dickinson, David J; Murphy, Richard J

    2006-10-01

    This study shows the effect of two fungicides on the production of extracellular mucilaginous material (ECMM) in two wood-rotting basidiomycetes and identifies a mechanism that might be responsible for the variation observed. Increasing concentrations of the fungicides copper sulphate (CuSO4) and cyproconazole in the growth medium increased the proportion of ECMM in the biomass of Trametes versicolor and Gloeophyllum trabeum. These fungicides also caused a reduction in the length of the peripheral growth unit (PGU) of the mycelia leading to a more highly branched morphology and a larger number of hyphal tips, the sites for active secretion of ECMM, per unit length of mycelium. It is postulated that both in T. versicolor and G. trabeum this change in growth leads to the increases observed in the proportion of ECMM in the total biomass. The implications of these results are discussed with a view to a potential protective role of ECMM against stress and toxic environments.

  3. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  4. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes.

    Science.gov (United States)

    Álvarez-Cervantes, Jorge; Díaz-Godínez, Gerardo; Mercado-Flores, Yuridia; Gupta, Vijai Kumar; Anducho-Reyes, Miguel Angel

    2016-04-04

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to determine that the proteins under study were classified into the GH10 and GH11 families, based on the regions of highly conserved amino acids, 233-318 and 180-193 respectively, where glutamate residues are responsible for the catalysis.

  5. 21 CFR 172.325 - Bakers yeast protein.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast protein. 172.325 Section 172.325 Food... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be safely used in food in accordance with the following conditions: (a) Bakers yeast protein is...

  6. 21 CFR 172.590 - Yeast-malt sprout extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived...

  7. 21 CFR 184.1983 - Bakers yeast extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b)...

  8. Pseudoporphyria associated with consumption of brewers' yeast.

    Science.gov (United States)

    Lim, C K; Rideout, J M; Peters, T J

    1984-06-01

    A case of pseudoporphyria associated with excessive consumption of brewers ' yeast was studied. Detailed analysis of the yeast tablets by high performance liquid chromatography showed the presence of dicarboxylic deuteroporphyrin , mesoporphyrin, and protoporphyrin; coproporphyrin I and III isomers; and uroporphyrin I and III isomers. The faecal porphyrin concentration of the patient taking yeast tablets was significantly increased, resembling the excretion pattern in variegate porphyria. Any patient showing an unusual porphyrin excretion pattern on high performance liquid chromatography should be investigated for a possible dietary cause.

  9. Corning and Kroger turn whey to yeast

    Energy Technology Data Exchange (ETDEWEB)

    1981-11-16

    It is reported that Corning and Kroger intend to build a 35,000 sq. ft. plant in Winchester, Ky., that will turn whey into bakers' yeast. The plant will convert whey from Kroger's dairies into bakers' yeast, supplying about 60% of the yeast needed for nine Kroger bakeries. It will also produce syrups and whey protein concentrate for use in other food processing activities. In addition to making useful products, the project will convert the whey to glucose and galactose. The protein component of the whey will be concentrated and used in various foods and feeds.

  10. YeastWeb: a workset-centric web resource for gene family analysis in yeast

    Directory of Open Access Journals (Sweden)

    Bao Haihua

    2010-07-01

    Full Text Available Abstract Background Currently, a number of yeast genomes with different physiological features have been sequenced and annotated, which provides invaluable information to investigate yeast genetics, evolutionary mechanism, structure and function of gene families. Description YeastWeb is a novel database created to provide access to gene families derived from the available yeast genomes by assigning the genes into putative families. It has many useful features that complement existing databases, such as SGD, CYGD and Génolevures: 1 Detailed computational annotation was conducted with each entry with InterProScan, EMBOSS and functional/pathway databases, such as GO, COG and KEGG; 2 A well established user-friendly environment was created to allow users to retrieve the annotated genes and gene families using functional classification browser, keyword search or similarity-based search; 3 Workset offers users many powerful functions to manage the retrieved data efficiently, associate the individual items easily and save the intermediate results conveniently; 4 A series of comparative genomics and molecular evolution analysis tools are neatly implemented to allow users to view multiple sequence alignments and phylogenetic tree of gene families. At present, YeastWeb holds the gene families clustered from various MCL inflation values from a total of 13 available yeast genomes. Conclusions Given the great interest in yeast research, YeastWeb has the potential to become a useful resource for the scientific community of yeast biologists and related researchers investigating the evolutionary relationship of yeast gene families. YeastWeb is available at http://centre.bioinformatics.zj.cn/Yeast/.

  11. Cyanohydrin reactions enhance glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Nielsen, Astrid Gram; Tortzen, Christian;

    2015-01-01

    Synchronous metabolic oscillations can be induced in yeast by addition of glucose and removal of extracellular acetaldehyde (ACAx). Compared to other means of ACAx removal, cyanide robustly induces oscillations, indicating additional cyanide reactions besides ACA to lactonitrile conversion. Here...

  12. Continuous ethanol fermentation by beer yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kida, Kenji; Morimura, Shigeru; Shima, Noriyuki; Asano, Shinichi; Yamadaki, Motozumi; Miyazawa, Toshiki

    1987-01-25

    Cooked and uncooked continuous fermentation tests and a bench-scale continuous fermentation test were carried out using a flocculating yeast, beer yeast IFO-2018, and using molasses of various origin. Heat of fermentation was measured at the same time. High productivity was found in a non-cooking continuous fermentation, but lowering of a flocculating ability was a problem. A theoretical equation for calculating the heat of fermentation was introduced and its adaptability was examined. The continuous fermentation unit was a single tank type using a tower type fermentor. The fermentor had a capacity of 0.7 l actual volume, made of glass, and consisted of the two parts, a flowing part and a precipitation/separation part. The yeast used was Saccharomyces crevisiae IFO-2018 in comparison with such yeast as S. cerevisiae IFO-0224 and S. cervisiae EP-1. (7 figs,3 tabs,21 refs)

  13. Structure and function of yeast alcohol dehydrogenase

    Directory of Open Access Journals (Sweden)

    VLADIMIR LESKOVAC

    2000-04-01

    Full Text Available 1. Introduction 2. Isoenzymes of YADH 3. Substrate specificity 4. Kinetic mechanism 5. Primary structure 6. The active site 7. Mutations in the yeast enzyme 8. Chemical mechanism 9. Binding of coenzymes 10. Hydride transfer

  14. Structure and function of yeast alcohol dehydrogenase

    OpenAIRE

    VLADIMIR LESKOVAC; SVETLANA TRIVIC

    2000-01-01

    1. Introduction 2. Isoenzymes of YADH 3. Substrate specificity 4. Kinetic mechanism 5. Primary structure 6. The active site 7. Mutations in the yeast enzyme 8. Chemical mechanism 9. Binding of coenzymes 10. Hydride transfer

  15. Monitoring Air Quality with Leaf Yeasts.

    Science.gov (United States)

    Richardson, D. H. S.; And Others

    1985-01-01

    Proposes that leaf yeast serve as quick, inexpensive, and effective techniques for monitoring air quality. Outlines procedures and provides suggestions for data analysis. Includes results from sample school groups who employed this technique. (ML)

  16. Genomic Evolution of the Ascomycete Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.

  17. Physiological and environmental control of yeast prions.

    Science.gov (United States)

    Chernova, Tatiana A; Wilkinson, Keith D; Chernoff, Yury O

    2014-03-01

    Prions are self-perpetuating protein isoforms that cause fatal and incurable neurodegenerative disease in mammals. Recent evidence indicates that a majority of human proteins involved in amyloid and neural inclusion disorders possess at least some prion properties. In lower eukaryotes, such as yeast, prions act as epigenetic elements, which increase phenotypic diversity by altering a range of cellular processes. While some yeast prions are clearly pathogenic, it is also postulated that prion formation could be beneficial in variable environmental conditions. Yeast and mammalian prions have similar molecular properties. Crucial cellular factors and conditions influencing prion formation and propagation were uncovered in the yeast models. Stress-related chaperones, protein quality control deposits, degradation pathways, and cytoskeletal networks control prion formation and propagation in yeast. Environmental stresses trigger prion formation and loss, supposedly acting via influencing intracellular concentrations of the prion-inducing proteins, and/or by localizing prionogenic proteins to the prion induction sites via heterologous ancillary helpers. Physiological and environmental modulation of yeast prions points to new opportunities for pharmacological intervention and/or prophylactic measures targeting general cellular systems rather than the properties of individual amyloids and prions.

  18. Revaluation of Waste Yeast from Beer Production

    Directory of Open Access Journals (Sweden)

    Nicoleta Suruceanu

    2013-11-01

    Full Text Available Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, identification and quantification of xanthohumol by HPLC method. Waste yeast from brewery pilot plant of USAMV Cluj Napoca it was dried by atomization and the powder was analyzed on xanthohumol content by HPLC method. For quantification a calibration curve it was used. The process of drying by atomisation lead to a powder product. It was used malt dextrin powder for stabilisation. The final product it was encapsulated. The xanthohumol content of powdered yeast it was 1.94 µg/ml. In conclusion the slurry yeast from beer production it is an important source of prenylflavonoids compounds.

  19. Novel brewing yeast hybrids: creation and application.

    Science.gov (United States)

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2017-01-01

    The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.

  20. Yeast communities in a natural tequila fermentation.

    Science.gov (United States)

    Lachance, M A

    1995-08-01

    Fresh and cooked agave, Drosophila spp., processing equipment, agave molasses, agave extract, and fermenting must at a traditional tequila distillery (Herradura, Amatitan, Jalisco, México) were studied to gain insight on the origin of yeasts involved in a natural tequila fermentations. Five yeast communities were identified. (1) Fresh agave contained a diverse mycobiota dominated by Clavispora lusitaniae and an endemic species, Metschnikowia agaveae. (2) Drosophila spp. from around or inside the distillery yielded typical fruit yeasts, in particular Hanseniaspora spp., Pichia kluyveri, and Candida krusei. (3) Schizosaccharomyces pombe prevailed in molasses. (4) Cooked agave and extract had a considerable diversity of species, but included Saccharomyces cerevisiae. (5) Fermenting juice underwent a gradual reduction in yeast heterogeneity. Torulaspora delbrueckii, Kluyveromyces marxianus, and Hanseniaspora spp. progressively ceded the way to S. cerevisiae, Zygosaccharomyces bailii, Candida milleri, and Brettanomyces spp. With the exception of Pichia membranaefaciens, which was shared by all communities, little overlap existed. That separation was even more manifest when species were divided into distinguishable biotypes based on morphology or physiology. It is concluded that crushing equipment and must holding tanks are the main source of significant inoculum for the fermentation process. Drosophila species appear to serve as internal vectors. Proximity to fruit trees probably contributes to maintaining a substantial Drosophila community, but the yeasts found in the distillery exhibit very little similarity to those found in adjacent vegetation. Interactions involving killer toxins had no apparent direct effects on the yeast community structure.

  1. Flor Yeast: New Perspectives Beyond Wine Aging

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  2. Flor yeast: new perspectives beyond wine ageing

    Directory of Open Access Journals (Sweden)

    Jean-luc eLegras

    2016-04-01

    Full Text Available The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the ageing of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air-liquid biofilm on the wine surface, which is also known as the velum or flor. This behaviour is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodelling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilisation within a fungal hyphae framework, will be discussed.

  3. Boolean model of Yeast Apoptosis as a tool to study yeast and human apoptotic regulations

    Directory of Open Access Journals (Sweden)

    Laleh eKazemzadeh

    2012-12-01

    Full Text Available Programmed cell death (PCD is an essential cellular mechanism that is evolutionary conserved, mediated through various pathways and acts by integrating different stimuli. Many diseases such as neurodegenerative diseases and cancers are found to be caused by, or associated with, regulations in the cell death pathways. Yeast Saccharomyces cerevisiae, is a unicellular eukaryotic organism that shares with human cells components and pathways of the PCD and is therefore used as a model organism. Boolean modelling is becoming promising approach to capture qualitative behaviour and describe essential properties of such complex networks. Here we present large literature-based and to our knowledge first Boolean model that combines pathways leading to apoptosis (a type of PCD in yeast. Analysis of the yeast model confirmed experimental findings of anti-apoptotic role of Bir1p and pro-apoptotic role of Stm1p and revealed activation of the stress protein kinase Hog proposing the maximal level of activation upon heat stress. In addition we extended the yeast model and created an in silico humanized yeast in which human pro- and anti-apoptotic regulators Bcl-2 family and Valosin-contain protein (VCP are included in the model. We showed that accumulation of Bax in in silico humanized yeast shows apoptotic markers and that VCP is essential target of Akt Signaling. The presented Boolean model provides comprehensive description of yeast apoptosis network behaviour. Extended model of humanized yeast gives new insights of how complex human disease like neurodegenration can initially be tested.

  4. NetPhosYeast: prediction of protein phosphorylation sites in yeast

    DEFF Research Database (Denmark)

    Ingrell, C.R.; Miller, Martin Lee; Jensen, O.N.;

    2007-01-01

    sites compared to those in humans, suggesting the need for an yeast-specific phosphorylation site predictor. NetPhosYeast achieves a correlation coefficient close to 0.75 with a sensitivity of 0.84 and specificity of 0.90 and outperforms existing predictors in the identification of phosphorylation sites...

  5. Antimycotic activity of 4-thioisosteres of flavonoids towards yeast and yeast-like microorganisms.

    Science.gov (United States)

    Buzzini, Pietro; Menichetti, Stefano; Pagliuca, Chiara; Viglianisi, Caterina; Branda, Eva; Turchetti, Benedetta

    2008-07-01

    Different substituted methoxy- and hydroxy-4-thioisosteres of flavonoids were prepared and their in vitro antimycotic activity towards yeast (Candida spp., Clavispora spp., Cryptococcus spp., Filobasidiella spp., Issatchenkia spp., Pichia spp., Kluyveromyces spp., Saccharomyces spp. and Yarrowia spp.) and yeast-like (Prototheca spp.) microorganisms was tested. Further insights in the biological activities of these antioxidant, oestrogenic and antimicrobial biomimetic derivatives were obtained.

  6. Yeast Interacting Proteins Database: YDR357C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available izes to the endosome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assa...ome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with this pr

  7. Yeast Interacting Proteins Database: YEL005C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available endosome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with th...protein localizes to the endosome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay

  8. YeastIP: a database for identification and phylogeny of Saccharomycotina yeasts.

    Science.gov (United States)

    Weiss, Stéphanie; Samson, Franck; Navarro, David; Casaregola, Serge

    2013-02-01

    With the advances in sequencing techniques, identification of ascomycetous yeasts to the species level and phylogeny reconstruction increasingly require curated and updated taxonomic information. A specific database with nucleotide sequences of the most common markers used for yeast taxonomy and phylogeny and a user-friendly interface allowing identification, taxonomy and phylogeny of yeasts species was developed. By 1 September 2012, the YeastIP database contained all the described Saccharomycotina species for which sequences used for taxonomy and phylogeny, such as D1/D2 rDNA and ITS, are available. The database interface was developed to provide a maximum of relevant information and data mining tools, including the following features: (1) the blast n program for the sequences of the YeastIP database; (2) easy retrieval of selected sequences; (3) display of the available markers for each selected group of species; and (4) a tool to concatenate marker sequences, including those provided by the user. The concatenation tool allows phylogeny reconstruction through a direct link to the Phylogeny.fr platform. YeastIP is thus a unique database in that it provides taxonomic information and guides users in their taxonomic analyses. YeastIP facilitates multigenic analysis to encourage good practice in ascomycetous yeast phylogeny (URL: http://genome.jouy.inra.fr/yeastip.).

  9. Yeast Interacting Proteins Database: YPR083W, YMR294W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available Rows with this bait as bait (1) Rows with this bait as prey (0) YMR294W JNM1 Component of the yeast dynactin...as prey (0) Prey ORF YMR294W Prey gene name JNM1 Prey description Component of the yeast dynactin complex, c

  10. Boolean Model of Yeast Apoptosis as a Tool to Study Yeast and Human Apoptotic Regulations

    Science.gov (United States)

    Kazemzadeh, Laleh; Cvijovic, Marija; Petranovic, Dina

    2012-01-01

    Programmed cell death (PCD) is an essential cellular mechanism that is evolutionary conserved, mediated through various pathways and acts by integrating different stimuli. Many diseases such as neurodegenerative diseases and cancers are found to be caused by, or associated with, regulations in the cell death pathways. Yeast Saccharomyces cerevisiae, is a unicellular eukaryotic organism that shares with human cells components and pathways of the PCD and is therefore used as a model organism. Boolean modeling is becoming promising approach to capture qualitative behavior and describe essential properties of such complex networks. Here we present large literature-based and to our knowledge first Boolean model that combines pathways leading to apoptosis (a type of PCD) in yeast. Analysis of the yeast model confirmed experimental findings of anti-apoptotic role of Bir1p and pro-apoptotic role of Stm1p and revealed activation of the stress protein kinase Hog proposing the maximal level of activation upon heat stress. In addition we extended the yeast model and created an in silico humanized yeast in which human pro- and anti-apoptotic regulators Bcl-2 family and Valosin-contain protein (VCP) are included in the model. We showed that accumulation of Bax in silico humanized yeast shows apoptotic markers and that VCP is essential target of Akt Signaling. The presented Boolean model provides comprehensive description of yeast apoptosis network behavior. Extended model of humanized yeast gives new insights of how complex human disease like neurodegeneration can initially be tested. PMID:23233838

  11. Yeast Interacting Proteins Database: YFR015C, YFR015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...ression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary ...tion, nitrogen starvation, environmental stress, and entry into stationary phase Rows with this bait as bait..., the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental

  12. Terroir of yeasts? – Application of FTIR spectroscopy and molecular methods for strain typing of yeasts

    Directory of Open Access Journals (Sweden)

    Gerhards Daniel

    2015-01-01

    Full Text Available The site specific influence on wine (Terroir is an often by wine producers, consumers and scientists discussed topic in the world of wine. A study on grapes and (spontaneous fermentations from six different vineyards was done to investigate the biodiversity of yeasts and to answer the question if there is a terroir of yeast and how it could be influenced. Randomly isolated yeasts were identified by FTIR-spectroscopy and molecular methods on species and strain level. Vineyard specific yeast floras would be observed but they are not such important as expected. Only a few overlapping strain patterns would be identified during both vintages. The yeast flora of the winery had a huge impact on the spontaneous fermentations, but is not really constant and influenced by different factors from outside.

  13. Molecular Cloning and Optimization for High Level Expression of Cold-Adapted Serine Protease from Antarctic Yeast Glaciozyma antarctica PI12

    Directory of Open Access Journals (Sweden)

    Norsyuhada Alias

    2014-01-01

    Full Text Available Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE strategy with an open reading frame (ORF of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml was obtained from P. pastoris GS115 host (GpPro2 at 20°C after 72 hours of postinduction time with 0.5% (v/v of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa.

  14. Baker's yeast: production of D- and L-3-hydroxy esters

    DEFF Research Database (Denmark)

    Dahl, Allan Carsten; Madsen, Jørgen Øgaard

    1998-01-01

    Baker's yeast grown under oxygen limited conditions and used in the reduction of 3-oxo esters results in a shift of the stereoselectivity of the yeast towards D-hydroxy esters as compared with ordinary baker's yeast. The highest degree of stereoselectivity was obtained with growing yeast or yeast...... harvested while growing. In contrast, the stereoselectivity was shifted towards L-hydroxy esters when the oxo esters were added slowly to ordinary baker's yeast supplied with gluconolactone as co-substrate. The reduction rate with gluconolactone was increased by active aeration. Ethyl L-(S)-3...

  15. Mutational analysis of yeast profilin.

    Science.gov (United States)

    Haarer, B K; Petzold, A S; Brown, S S

    1993-12-01

    We have mutated two regions within the yeast profilin gene in an effort to functionally dissect the roles of actin and phosphatidylinositol 4,5-bisphosphate (PIP2) binding in profilin function. A series of truncations was carried out at the C terminus of profilin, a region that has been implicated in actin binding. Removal of the last three amino acids nearly eliminated the ability of profilin to bind polyproline in vitro but had no dramatic in vivo effects. Thus, the extreme C terminus is implicated in polyproline binding, but the physiological relevance of this interaction is called into question. More extensive truncation, of up to eight amino acids, had in vivo effects of increasing severity and resulted in changes in conformation and expression level of the mutant profilins. However, the ability of these mutants to bind actin in vitro was not eliminated, suggesting that this region cannot be solely responsible for actin binding. We also mutagenized a region of profilin that we hypothesized might be involved in PIP2 binding. Alteration of basic amino acids in this region produced mutant profilins that functioned well in vivo. Many of these mutants, however, were unable to suppress the loss of adenylate cyclase-associated protein (Cap/Srv2p [A. Vojtek, B. Haarer, J. Field, J. Gerst, T. D. Pollard, S. S. Brown, and M. Wigler, Cell 66:497-505, 1991]), indicating that a defect could be demonstrated in vivo. In vitro assays demonstrated that the inability to suppress loss of Cap/Srv2p correlated with a defect in the interaction with actin, independently of whether PIP2 binding was reduced. Since our earlier studies of Acanthamoeba profilins suggested the importance of PIP2 binding for suppression, we conclude that both activities are implicated and that an interplay between PIP2 binding and actin binding may be important for profilin function.

  16. Yeast flocculation: what brewers should know.

    Science.gov (United States)

    Verstrepen, K J; Derdelinckx, G; Verachtert, H; Delvaux, F R

    2003-05-01

    For many industrial applications in which the yeast Saccharomyces cerevisiae is used, e.g. beer, wine and alcohol production, appropriate flocculation behaviour is certainly one of the most important characteristics of a good production strain. Yeast flocculation is a very complex process that depends on the expression of specific flocculation genes such as FLO1, FLO5, FLO8 and FLO11. The transcriptional activity of the flocculation genes is influenced by the nutritional status of the yeast cells as well as other stress factors. Flocculation is also controlled by factors that affect cell wall composition or morphology. This implies that, during industrial fermentation processes, flocculation is affected by numerous parameters such as nutrient conditions, dissolved oxygen, pH, fermentation temperature, and yeast handling and storage conditions. Theoretically, rational use of these parameters offers the possibility of gaining control over the flocculation process. However, flocculation is a very strain-specific phenomenon, making it difficult to predict specific responses. In addition, certain genes involved in flocculation are extremely variable, causing frequent changes in the flocculation profile of some strains. Therefore, both a profound knowledge of flocculation theory as well as close monitoring and characterisation of the production strain are essential in order to gain maximal control over flocculation. In this review, the various parameters that influence flocculation in real-scale brewing are critically discussed. However, many of the conclusions will also be useful in various other industrial processes where control over yeast flocculation is desirable.

  17. Yeasts associated with Sardinian ewe's dairy products.

    Science.gov (United States)

    Cosentino, S; Fadda, M E; Deplano, M; Mulargia, A F; Palmas, F

    2001-09-19

    In the present work, the occurrence of yeasts in different types of typical Sardinian ewe's cheeses (32 samples of pecorino, 32 of caciotta, 40 of feta, 56 of ricotta) was determined. For the strains isolated the following properties were studied: proteolytic and lipolytic activities, the ability to grow at different temperatures, different concentrations of salt, and to assimilate and/or ferment compounds like lactate, citrate, lactose, glucose, galactose, lactic acid. Of 160 samples analysed, 76.2% yielded growth of yeasts. Yeast counts showed a certain variability among the samples. The highest levels were observed in caciotta and feta cheeses. A total of 281 strains belonging to 16 genera and 25 species were identified. In general, Debaryomyces hansenii was the dominant species, representing 28.8% of the total isolates. Other frequently appearing species were Geotrichum candidum, Kluyveromyces lactis and K. marxianus. Other genera encountered were Pichia, Candida, Dekkera, Yarrowia and Rhodotorula. With regard to the biochemical and technological properties of the yeasts, only K. lactis, K. marxianus and Dek. anomala assimilated and fermented lactose, whereas the majority of the species assimilated lactic acid. The assimilation of citrate was a characteristic of D. hansenii, R. rubra and Y. lipolytica. On the whole, the yeasts were weakly proteolytic while lipolytic activity was present in several species. A high percentage of strains showed a certain tolerance to low temperatures while only some strains of D. hansenii and K. lactis were able to grow at a 10% NaCl concentration.

  18. Isolation and characterization of oenological yeast.

    Directory of Open Access Journals (Sweden)

    Fatbardha Lamce

    2013-12-01

    Full Text Available Alcoholic fermentation is carried out by all microorganisms presented in must, which vary by technological characteristics of interest to oenology. So far, in Albania the fermentation is spontaneous and not directed, resulting in an absence of a standard product. The object of the present study is the isolation, identification and determination of yeasts, isolated in different phases of fermentation of musts from different varieties of grapes, with the purpose of selecting autochthonous yeasts for a directed fermentation. In the present study were isolated 14 strains, with P.D.A. and Y.M.A. mediums. After isolation, purity controls were made to the strains through cultivation and re-cultivation of them in Petri dish, and also, by running a stereomicroscopic and microscopic examination. Classification and identification of yeast strains in genus and species were based on macro-morphological characteristics of the colonies. Then, morphological characteristics of the cell were observed as an important taxonomic indicator. For the determination of the physiological and biochemical characteristics of yeasts, the assimilation of sugars and the fermenting ability of yeast were used. At the end were isolated and identified 9 strains of the genus Saccharomyces, 1 strain of the genus Schizosaccharomyces, 2 strains of the genus Brettanomyces, 2 strains of the genus Kloeckera. These will serve to further work towards their selection based on their fermenting technological characteristics.

  19. Yeast fuel cell: Application for desalination

    Science.gov (United States)

    Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

    2016-02-01

    Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

  20. Radiodiagnosis of yeast alveolitis (a clinicoexperimental study)

    Energy Technology Data Exchange (ETDEWEB)

    Amosov, I.S.; Smirnov, V.A.

    A clinicoroetgenological study was made of 115 workers engaged in yeast production for different periods of time. Disorders of respiration biomechanics were revealed depending on the period of service. These data were obtained as a result of the use of roentgenopneumopolygraphy. An experimental study was conducted to establish the nature of lesions in the bronchopulmonary system in allergic alveolitis. The effect of finely divided yeast dust on the bronchopulmonary system was studied on 132 guinea-pigs usinq microbronchography and morphological examination. As a result of the study it has been established that during the inhalation of yeast dust, noticeable dystrophy of the bronchi develops, the sizes of alveoli enlarge and part of them undergo emphysematous distension with rupture of the interalveolar septa. In the course of the study, it has been shown that yeast alveolitis develops after many years of work. The clinical symptoms are non-specific and insignificant. X-ray and morphological changes are followed by the physical manifestations of yeast alveolitis.

  1. Extension of yeast chronological lifespan by methylamine.

    Directory of Open Access Journals (Sweden)

    Sanjeev Kumar

    Full Text Available BACKGROUND: Chronological aging of yeast cells is commonly used as a model for aging of human post-mitotic cells. The yeast Saccharomyces cerevisiae grown on glucose in the presence of ammonium sulphate is mainly used in yeast aging research. We have analyzed chronological aging of the yeast Hansenula polymorpha grown at conditions that require primary peroxisome metabolism for growth. METHODOLOGY/PRINCIPAL FINDINGS: The chronological lifespan of H. polymorpha is strongly enhanced when cells are grown on methanol or ethanol, metabolized by peroxisome enzymes, relative to growth on glucose that does not require peroxisomes. The short lifespan of H. polymorpha on glucose is mainly due to medium acidification, whereas most likely ROS do not play an important role. Growth of cells on methanol/methylamine instead of methanol/ammonium sulphate resulted in further lifespan enhancement. This was unrelated to medium acidification. We show that oxidation of methylamine by peroxisomal amine oxidase at carbon starvation conditions is responsible for lifespan extension. The methylamine oxidation product formaldehyde is further oxidized resulting in NADH generation, which contributes to increased ATP generation and reduction of ROS levels in the stationary phase. CONCLUSION/SIGNIFICANCE: We conclude that primary peroxisome metabolism enhanced chronological lifespan of H. polymorpha. Moreover, the possibility to generate NADH at carbon starvation conditions by an organic nitrogen source supports further extension of the lifespan of the cell. Consequently, the interpretation of CLS analyses in yeast should include possible effects on the energy status of the cell.

  2. Chemotyping of yeast mutants using robotics.

    Science.gov (United States)

    Rieger, K J; El-Alama, M; Stein, G; Bradshaw, C; Slonimski, P P; Maundrell, K

    1999-07-01

    By now, the EUROFAN programme for the functional analysis of genes from the yeast genome has attained its cruising speed. Indeed, several hundreds of yeast mutants with no phenotype as tested by growth on standard media and no significant sequence similarity to proteins of known function are available through the efforts of various laboratories. Based on the methodology initiated during the pilot project on yeast chromosome III (Yeast 13, 1547-1562, 1997) we adapted it to High Throughput Screening (HTS), using robotics. The first 100 different gene deletions from EUROSCARF, constructed in an FY1679 strain background, were run against a collection of about 300 inhibitors. Many of these inhibitors have not been reported until now to interfere in vivo with growth of Saccharomyces cerevisiae. In the present paper we provide a list of novel growth conditions and a compilation of 49 yeast deletants (from chromosomes II, IV, VII, X, XIV, XV) corresponding to 58% of the analysed genes, with at least one clear and stringent phenotype. The majority of these deletants are sensitive to one or two compounds (monotropic phenotype) while a distinct subclass of deletants displays a hyper-pleiotropic phenotype with sensitivities to a dozen or more compounds. Therefore, chemotyping of unknown genes with a large spectrum of drugs opens new vistas for a more in-depth functional analysis and a more precise definition of molecular targets.

  3. Identification of a 14-3-3 protein from Lentinus edodes that interacts with CAP (adenylyl cyclase-associated protein), and conservation of this interaction in fission yeast.

    Science.gov (United States)

    Zhou, G L; Yamamoto, T; Ozoe, F; Yano, D; Tanaka, K; Matsuda, H; Kawamukai, M

    2000-01-01

    We previously identified a gene encoding a CAP (adenylyl cyclase-associated protein) homologue from the edible Basidiomycete Lentinus edodes. To further discover the cellular functions of the CAP protein, we searched for CAP-interacting proteins using a yeast two-hybrid system. Among the candidates thus obtained, many clones encoded the C-terminal half of an L. edodes 14-3-3 homologue (designated cip3). Southern blot analysis indicated that L. edodes contains only one 14-3-3 gene. Overexpression of the L. edodes 14-3-3 protein in the fission yeast Schizosaccharomyces pombe rad24 null cells complemented the loss of endogenous 14-3-3 protein functions in cell morphology and UV sensitivity, suggesting functional conservation of 14-3-3 proteins between L. edodes and S. pombe. The interaction between L. edodes CAP and 14-3-3 protein was restricted to the N-terminal domain of CAP and was confirmed by in vitro co-precipitation. Results from both the two-hybrid system and in vivo co-precipitation experiments showed the conservation of this interaction in S. pombe. The observation that a 14-3-3 protein interacts with the N-terminal portion of CAP but not with full-length CAP in L. edodes and S. pombe suggests that the C-terminal region of CAP may have a negative effect on the interaction between CAP and 14-3-3 proteins, and 14-3-3 proteins may play a role in regulation of CAP function.

  4. Antimicrobial effect of the Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes) and its main compounds.

    Science.gov (United States)

    Vazirian, Mahdi; Faramarzi, Mohammad Ali; Ebrahimi, Seyed Esmaeil Sadat; Esfahani, Hamid Reza Monsef; Samadi, Nasrin; Hosseini, Seyed Aboulfazl; Asghari, Ali; Manayi, Azadeh; Mousazadeh, Ali; Asef, Mohammad Reza; Habibi, Emran; Amanzadeh, Yaghoub

    2014-01-01

    Mushrooms are considered one of the richest sources of natural antibiotics, and various species of them inhibit the growth of a wide diversity of microorganisms. Ganoderma lucidum, a well-known medicinal mushroom. has many pharmacological and biological activities including an antimicrobial effect, although few studies have investigated the antibacterial and antifungal effects of its purified compounds. The chemical structure of the purified compounds from the hexane fraction was elucidated as ergosta-7,22-dien-3β-yl acetate, ergosta-5,7,22-trien-3β-yl acetate (isopyrocalciferol acetate), ergosta-7,22-dien-3-one, ergosta-7,22-dien-3β-ol, and ergosta-5,7,22-trien-3β-ol (ergostrol). In addition, the structure of ganodermadiol was demonstrated after purification from the chloroform fraction. The fractions inhibited Gram-positive bacteria and yeast, with minimum inhibitory concentration values of 6.25 mg/mL, but were ineffective against Gram-negative bacteria in the tested concentrations. The results were comparable for isolated compounds, whereas the mixture of ergosta-7,22-dien-3β-yl acetate and isopyrocalciferol acetate was weakly effective against Escherichia coli (minimum inhibitory concentration, 10 mg/mL). It could be assumed that the antimicrobial effect of crude fractions is the consequence of mixing triterpenoid and steroid compounds.

  5. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  6. Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.

    Science.gov (United States)

    Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena

    2012-12-01

    Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.

  7. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell

    Directory of Open Access Journals (Sweden)

    Yumei Luo

    2015-01-01

    Full Text Available The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C; knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells.

  8. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell.

    Science.gov (United States)

    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan

    2015-01-01

    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells.

  9. Modeling diauxic glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Sørensen, Preben Graae

    2010-01-01

    switching in a closed-system experiment by feeding the yeast suspension with a glucose pulse-notably the initial NADH spike and final NADH rise. Another object of this study is to gain insight into the secondary low-flux metabolic pathways by feeding starved yeast cells with various metabolites......Glycolytic oscillations in a stirred suspension of starved yeast cells is an excellent model system for studying the dynamics of metabolic switching in living systems. In an open-flow system the oscillations can be maintained indefinitely at a constant operating point where they can...... be characterized quantitatively by experimental quenching and bifurcation analysis. In this article, we use these methods to show that the dynamics of oscillations in a closed system is a simple transient version of the open-system dynamics. Thus, easy-setup closed-system experiments are also useful...

  10. Complete biosynthesis of opioids in yeast.

    Science.gov (United States)

    Galanie, Stephanie; Thodey, Kate; Trenchard, Isis J; Filsinger Interrante, Maria; Smolke, Christina D

    2015-09-04

    Opioids are the primary drugs used in Western medicine for pain management and palliative care. Farming of opium poppies remains the sole source of these essential medicines, despite diverse market demands and uncertainty in crop yields due to weather, climate change, and pests. We engineered yeast to produce the selected opioid compounds thebaine and hydrocodone starting from sugar. All work was conducted in a laboratory that is permitted and secured for work with controlled substances. We combined enzyme discovery, enzyme engineering, and pathway and strain optimization to realize full opiate biosynthesis in yeast. The resulting opioid biosynthesis strains required the expression of 21 (thebaine) and 23 (hydrocodone) enzyme activities from plants, mammals, bacteria, and yeast itself. This is a proof of principle, and major hurdles remain before optimization and scale-up could be achieved. Open discussions of options for governing this technology are also needed in order to responsibly realize alternative supplies for these medically relevant compounds.

  11. Degradation of 5-hydroxymethylfurfural during yeast fermentation.

    Science.gov (United States)

    Akıllıoglu, Halise Gül; Mogol, Burçe Ataç; Gökmen, Vural

    2011-12-01

    5-Hydroxymethyl furfural (HMF) may occur in malt in high quantities depending on roasting conditions. However, the HMF content of different types of beers is relatively low, indicating its potential for degradation during fermentation. This study investigates the degradation kinetics of HMF in wort during fermentation by Saccharomyces cerevisiae. The results indicated that HMF decreased exponentially as fermentation progressed. The first-order degradation rate of HMF was 0.693 × 10(-2) and 1.397 × 10(-2)min(-1) for wort and sweet wort, respectively, indicating that sugar enhances the activity of yeasts. In wort, HMF was converted into hydroxymethyl furfuryl alcohol by yeasts with a high yield (79-84% conversion). Glucose and fructose were utilised more rapidly by the yeasts in dark roasted malt than in pale malt (pfermentation medium increases this activity.

  12. Metallic Biosorption Using Yeasts in Continuous Systems

    Directory of Open Access Journals (Sweden)

    Karla Miriam Hernández Mata

    2013-01-01

    Full Text Available Mining effluents were found to be the main source of pollution by heavy metals of the surface water in the San Pedro River in Sonora, Mexico. The overall objective of this study was to determine the biosorption of Zn, Cu, Mn, and Fe with yeasts isolated from San Pedro River in a continuous system. The tests conducted in two reactors packed with zeolite connected in series. The first reactor was inoculated mixing two yeasts species, and the effluent of the first reactor was fed to second reactor. Subsequently, the first reactor was fed with contaminated water of San Pedro River and effluent from this was the second reactor influent. After 40 days of the experiment a reduction of 81.5% zinc, 76.5% copper, manganese 95.5%, and 99.8% of iron was obtained. These results show that the selected yeasts are capable of biosorbing zinc, copper, manganese, and iron under these conditions.

  13. Probiotic Properties of Non-Saccharomyces Yeasts

    DEFF Research Database (Denmark)

    Smith, Ida Mosbech

    to harmless luminal substances is a key feature of the intestinal immune system. In this context, dendritic cells (DCs) present in the tissues lining the human gut are central players involved in microbial sensing and shaping of appropriate adaptive immune responses. Probiotics are live microorganisms which...... when administered in adequate amounts confer a health benefit on the host. While the majority of probiotic microorganisms studied to date are lactic acid bacteria, research in yeasts with potentially beneficial influences on human health has mainly revolved around Saccharomyces boulardii. This yeast...... has shown a positive impact on disease outcome in clinical studies of inflammatory bowel disease, indicating an ability of S. boulardii to influence human immune responses underlying intestinal inflammation. Consequent to this focus on S. boulardii as the fundamental probiotic yeast, very little...

  14. Fission Yeast Cell Cycle Synchronization Methods.

    Science.gov (United States)

    Tormos-Pérez, Marta; Pérez-Hidalgo, Livia; Moreno, Sergio

    2016-01-01

    Fission yeast cells can be synchronized by cell cycle arrest and release or by size selection. Cell cycle arrest synchronization is based on the block and release of temperature-sensitive cell cycle mutants or treatment with drugs. The most widely used approaches are cdc10-129 for G1; hydroxyurea (HU) for early S-phase; cdc25-22 for G2, and nda3-KM311 for mitosis. Cells can also be synchronized by size selection using centrifugal elutriation or a lactose gradient. Here we describe the methods most commonly used to synchronize fission yeast cells.

  15. Genetic diversity of the yeast Candida utilis.

    Science.gov (United States)

    Stoltenburg, R; Klinner, U; Ritzerfeld, P; Zimmermann, M; Emeis, C C

    1992-12-01

    The electrophoretic karyotypes and some mtDNA restriction fragment patterns of 13 strains of Candida utilis and one strain of Hansenula jadinii were compared. PFGE separations revealed remarkable chromosome length polymorphisms between two groups of strains suggesting that perhaps they do not belong to the same species. However, all strains had the same or similar EcoRI, HindIII and BamHI mtDNA restriction patterns. The mtDNA genomes had an average size range of 55 kb. These results support the supposition that C. utilis is a yeast with a highly variable electrophoretic karyotype as already known for another imperfect yeast species, Candida albicans.

  16. Evaluation of fungichrom 1: A new yeast identification system

    OpenAIRE

    Umabala P; Satheeshkumar T; Lakshmi V

    2002-01-01

    Advances in anti-fungal therapy necessitate the need for accurate identification of fungi especially yeasts to their species level for more effective management. Unlike the time consuming conventional methods of yeast identification using fermentation and assimilation patterns of various carbohydrates, the new commercialized yeast identification systems are simpler, rapid and are particularly easy to interpret. In our study, a new colorimetric yeast identification system-Fungichrom 1(Internat...

  17. 21 CFR 573.750 - Pichia pastoris dried yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Pichia pastoris dried yeast. 573.750 Section 573... Food Additive Listing § 573.750 Pichia pastoris dried yeast. (a) Identity. The food additive Pichia pastoris dried yeast may be used in feed formulations of broiler chickens as a source of protein not...

  18. Adhesive interactions between medically important yeasts and bacteria

    NARCIS (Netherlands)

    Millsap, KW; van der Mei, HC; Busscher, HJ; Bos, R.R.M.

    1998-01-01

    Yeasts are being increasingly identified as important organisms in human infections. Adhesive interactions between yeasts and bacteria may contribute to yeast retention al body sites. Methods for studying adhesive interactions between bacterial strains are well known, and range from simple macroscop

  19. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi.

  20. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies.

  1. Effect of growth substrate, method of fermentation, and nitrogen source on lignocellulose-degrading enzymes production by white-rot basidiomycetes.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Penninckx, Michel

    2008-11-01

    The exploration of seven physiologically different white rot fungi potential to produce cellulase, xylanase, laccase, and manganese peroxidase (MnP) showed that the enzyme yield and their ratio in enzyme preparations significantly depends on the fungus species, lignocellulosic growth substrate, and cultivation method. The fruit residues were appropriate growth substrates for the production of hydrolytic enzymes and laccase. The highest endoglucanase (111 U ml(-1)) and xylanase (135 U ml(-1)) activities were revealed in submerged fermentation (SF) of banana peels by Pycnoporus coccineus. In the same cultivation conditions Cerrena maxima accumulated the highest level of laccase activity (7,620 U l(-1)). The lignified materials (wheat straw and tree leaves) appeared to be appropriate for the MnP secretion by majority basidiomycetes. With few exceptions, SF favored to hydrolases and laccase production by fungi tested whereas SSF was appropriate for the MnP accumulation. Thus, the Coriolopsis polyzona hydrolases activity increased more than threefold, while laccase yield increased 15-fold when tree leaves were undergone to SF instead SSF. The supplementation of nitrogen to the control medium seemed to have a negative effect on all enzyme production in SSF of wheat straw and tree leaves by Pleurotus ostreatus. In SF peptone and ammonium containing salts significantly increased C. polyzona and Trametes versicolor hydrolases and laccase yields. However, in most cases the supplementation of media with additional nitrogen lowered the fungi specific enzyme activities. Especially strong repression of T. versicolor MnP production was revealed.

  2. Comparative Performance of the RapID Yeast Plus System and the API 20C AUX Clinical Yeast System

    OpenAIRE

    Smith, Michael B; Dunklee, Daisy; Vu, Hangna; Woods, Gail L.

    1999-01-01

    The performance of the RapID Yeast Plus System (Innovative Diagnostic Systems, Norcross, Ga.), a 4-h micropanel using single-substrate enzymatic test reactions, was compared with that of the API 20C AUX Clinical Yeast System (bioMerieux Vitek, Hazelwood, Mo.), a 48- to 72-h carbohydrate assimilation panel. Two hundred twenty-five yeasts, yeast-like fungi, and algae, comprising 28 species and including 30 isolates of Cryptococcus neoformans, an important pathogen not tested in appreciable numb...

  3. Fission yeast meets a legend in Kobe: report of the Eighth International Fission Yeast Meeting.

    Science.gov (United States)

    Asakawa, Haruhiko; Yamamoto, Takaharu G; Hiraoka, Yasushi

    2015-12-01

    The Eighth International Fission Yeast Meeting, which was held at Ikuta Shrine Hall in Kobe, Japan, from 21 to 26 June 2015, was attended by 327 fission yeast researchers from 25 countries (190 overseas and 137 domestic participants). At this meeting, 124 talks were held and 145 posters were presented. In addition, newly developed database tools were introduced to the community during a workshop. Researchers shared cutting-edge knowledge across broad fields of study, ranging from molecules to evolution, derived from the superior model organism commonly used within the fission yeast community. Intensive discussions and constructive suggestions generated in this meeting will surely advance the understanding of complex biological systems in fission yeast, extending to general eukaryotes.

  4. Dynamic changes in brewing yeast cells in culture revealed by statistical analyses of yeast morphological data.

    Science.gov (United States)

    Ohnuki, Shinsuke; Enomoto, Kenichi; Yoshimoto, Hiroyuki; Ohya, Yoshikazu

    2014-03-01

    The vitality of brewing yeasts has been used to monitor their physiological state during fermentation. To investigate the fermentation process, we used the image processing software, CalMorph, which generates morphological data on yeast mother cells and bud shape, nuclear shape and location, and actin distribution. We found that 248 parameters changed significantly during fermentation. Successive use of principal component analysis (PCA) revealed several important features of yeast, providing insight into the dynamic changes in the yeast population. First, PCA indicated that much of the observed variability in the experiment was summarized in just two components: a change with a peak and a change over time. Second, PCA indicated the independent and important morphological features responsible for dynamic changes: budding ratio, nucleus position, neck position, and actin organization. Thus, the large amount of data provided by imaging analysis can be used to monitor the fermentation processes involved in beer and bioethanol production.

  5. Yeast Interacting Proteins Database: YFR015C, YLR258W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into statio

  6. Arachidonic acid metabolites in pathogenic yeasts

    Directory of Open Access Journals (Sweden)

    Ells Ruan

    2012-08-01

    Full Text Available Abstract Although most of what is known about the biology and function of arachidonic acid metabolites comes from the study of mammalian biology, these compounds can also be produced by lower eukaryotes, including yeasts and other fungi. It is also in this group of organisms that the least is known about the metabolic pathways leading to the production of these compounds as well as the functions of these compounds in the biology of fungi and yeasts. This review will deal with the discovery of oxylipins from polyunsaturated fatty acids, and more specifically the arachidonic acid derived eicosanoids, such as 3-hydroxy eicosatetraenoic acid, prostaglandin F2α and prostaglandin E2, in yeasts starting in the early 1990s. This review will also focus on what is known about the metabolic pathways and/or proteins involved in the production of these compounds in pathogenic yeasts. The possible roles of these compounds in the biology, including the pathology, of these organisms will be discussed.

  7. Ethanol tolerance of immobilized brewers' yeast cells.

    Science.gov (United States)

    Norton, S; Watson, K; D'Amore, T

    1995-04-01

    A method based on the survival of yeast cells subjected to an ethanol or heat shock was utilized to compare the stress resistance of free and carrageenan-immobilized yeast cells. Results demonstrated a significant increase of yeast survival against ethanol for immobilized cells as compared to free cells, while no marked difference in heat resistance was observed. When entrapped cells were released by mechanical disruption of the gel beads and submitted to the same ethanol stress, they exhibited a lower survival rate than entrapped cells, but a similar or slightly higher survival rate than free cells. The incidence of ethanol- or heat-induced respiratory-deficient mutants of entrapped cells was equivalent to that of control or non-stressed cells (1.3 +/- 0.5%) whereas ethanol- and heat-shocked free and released cells exhibited between 4.4% and 10.9% average incidence of respiration-deficient mutants. It was concluded that the carrageenan gel matrix provided a protection against ethanol, and that entrapped cells returned to normal physiological behaviour as soon as they were released. The cell growth rate was a significant factor in the resistance of yeast to high ethanol concentrations. The optimum conditions to obtain reliable and reproducible results involved the use of slow-growing cells after exhaustion of the sugar substrate.

  8. Yeast improves resistance to environmental challenges

    Science.gov (United States)

    Alphamune™, a yeast extract antibiotic alternative, was added at either 1 lb/ton or 2 lb/ton to a turkey starter diet. Two trials were conducted to evaluate the effects of Alphamune™ on gut maturation of 7 and 21 day old poults. Sections from the mid-point of the duodenum, jejunum and ileum of each ...

  9. An Engineered Yeast Efficiently Secreting Penicillin

    NARCIS (Netherlands)

    Gidijala, Loknath; Kiel, Jan A. K. W.; Douma, Rutger D.; Seifar, Reza M.; van Gulik, Walter M.; Bovenberg, Roel A. L.; Veenhuis, Marten; van der Klei, Ida J.

    2009-01-01

    This study aimed at developing an alternative host for the production of penicillin ( PEN). As yet, the industrial production of this beta(-)lactam antibiotic is confined to the filamentous fungus Penicillium chrysogenum. As such, the yeast Hansenula polymorpha, a recognized producer of pharmaceutic

  10. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  11. UBA domain containing proteins in fission yeast

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Semple, Colin A M; Ponting, Chris P;

    2003-01-01

    characterised on both the functional and structural levels. One example of a widespread ubiquitin binding module is the ubiquitin associated (UBA) domain. Here, we discuss the approximately 15 UBA domain containing proteins encoded in the relatively small genome of the fission yeast Schizosaccharomyces pombe...

  12. Catalytic site interactions in yeast OMP synthase

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Barr, Eric W.; Jensen, Kaj Frank;

    2014-01-01

    45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal...

  13. Functional differences in yeast protein disulfide isomerases

    DEFF Research Database (Denmark)

    Nørgaard, P; Westphal, V; Tachibana, C;

    2001-01-01

    PDI1 is the essential gene encoding protein disulfide isomerase in yeast. The Saccharomyces cerevisiae genome, however, contains four other nonessential genes with homology to PDI1: MPD1, MPD2, EUG1, and EPS1. We have investigated the effects of simultaneous deletions of these genes. In several...

  14. Resurrecting ancestral alcohol dehydrogenases from yeast.

    Science.gov (United States)

    Thomson, J Michael; Gaucher, Eric A; Burgan, Michelle F; De Kee, Danny W; Li, Tang; Aris, John P; Benner, Steven A

    2005-06-01

    Modern yeast living in fleshy fruits rapidly convert sugars into bulk ethanol through pyruvate. Pyruvate loses carbon dioxide to produce acetaldehyde, which is reduced by alcohol dehydrogenase 1 (Adh1) to ethanol, which accumulates. Yeast later consumes the accumulated ethanol, exploiting Adh2, an Adh1 homolog differing by 24 (of 348) amino acids. As many microorganisms cannot grow in ethanol, accumulated ethanol may help yeast defend resources in the fruit. We report here the resurrection of the last common ancestor of Adh1 and Adh2, called Adh(A). The kinetic behavior of Adh(A) suggests that the ancestor was optimized to make (not consume) ethanol. This is consistent with the hypothesis that before the Adh1-Adh2 duplication, yeast did not accumulate ethanol for later consumption but rather used Adh(A) to recycle NADH generated in the glycolytic pathway. Silent nucleotide dating suggests that the Adh1-Adh2 duplication occurred near the time of duplication of several other proteins involved in the accumulation of ethanol, possibly in the Cretaceous age when fleshy fruits arose. These results help to connect the chemical behavior of these enzymes through systems analysis to a time of global ecosystem change, a small but useful step towards a planetary systems biology.

  15. Uncommon opportunistic yeast bloodstream infections from Qatar

    NARCIS (Netherlands)

    Taj-Aldeen, S.J.; AbdulWahab, A.; Kolecka, A.; Deshmukh, A.; Meis, J.F.G.M.; Boekhout, T.

    2014-01-01

    Eleven uncommon yeast species that are associated with high mortality rates irrespective of antifungal therapy were isolated from 17/187 (201 episodes) pediatric and elderly patients with fungemia from Qatar. The samples were taken over a 6-year period (January 2004-December 2010). Isolated species

  16. Effect of yeast storage temperature and flour composition on fermentative activities of baker's yeast

    Directory of Open Access Journals (Sweden)

    Pejin Dušanka J.

    2009-01-01

    Full Text Available Baker's yeast is a set of living cells of Saccharomyces cerevisiae. It contains around 70-72% of water, 42-45% of proteins, around 40% of carbohydrates, around 7.5% of lipids (based on dry matter, and vitamin B-complex. On the basis of yeast cell analysis it can be concluded that yeast is a complex biological system which changes in time. The intensity of the changes depends on temperature. Yeast sample was stored at 4°C i 24°C for 12 days. During storage at 4°C, the content of total carbohydrates decreased from 48.81% to 37.50% (dry matter, whereas carbohydrate loss ranged from 40.81% to 29.28% at 24°C. The content of trehalose was 12.33% in the yeast sample stored at 4°C and 0.24% at 24°C. Loss of fermentative activity was 81.76% in the sample stored at 24°C for 12 days. The composition of five samples of 1st category flour was investigated. It was found that flours containing more reducing sugars and maltose enable higher fermentation activities. The flours with higher ash content (in the range 0.5-0.94% had higher contents of phytic acid. Higher ash and phytic contents in flour increased the yeast fermentative efficiency. In bakery industry, a range of ingredients has been applied to improve the product's quality such as surface active substances (emulsifiers, enzymes, sugars and fats. In the paper, the effect of some ingredients added to dough (margarine, saccharose, sodium chloride and malted barley on the yeast fermentative activity was studied. The mentioned ingredients were added to dough at different doses: 0.5, 1.0, 1.5 and 2.0%, flour basis. It was found that the investigated ingredients affected the fermentative activity of yeast and improved the bread quality.

  17. Yeast Interacting Proteins Database: YMR294W, YLL049W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YMR294W JNM1 Component of the yeast dynactin complex, consisting of Nip100p, Jnm1p,... for nuclear migration; null mutant shows a reduced affinity for the alcian blue dye...M1 Bait description Component of the yeast dynactin complex, consisting of Nip100...nknown function; required for nuclear migration; null mutant shows a reduced affinity for the alcian blue dye

  18. Seed yeast cultivation for salad oil manufacturing wastewater treatment

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The mixture of five yeast strains obtained from soil could remove about 85% TOC of oil-rich wastewater in batch test.While the highest MLSS was obtained at an N:C of 1:5, the oil removal decreased with the increase of N:C during yeast sludge cultivation. Ammonium chloride was the best nitrogen source for yeast cultivation from the viewpoint of yeast growth and oil utilization. An ammonia concentration of over 1300 mg l-1 led to mass death of yeast at a pH of 5. The ammonia concentration should be controlled at a level of 1000 mg l-1 or lower.

  19. Evaluation of fungichrom 1: A new yeast identification system

    Directory of Open Access Journals (Sweden)

    Umabala P

    2002-01-01

    Full Text Available Advances in anti-fungal therapy necessitate the need for accurate identification of fungi especially yeasts to their species level for more effective management. Unlike the time consuming conventional methods of yeast identification using fermentation and assimilation patterns of various carbohydrates, the new commercialized yeast identification systems are simpler, rapid and are particularly easy to interpret. In our study, a new colorimetric yeast identification system-Fungichrom 1(International microbio, Signes, France was evaluated against the conventional method to identify 50 clinical isolates of yeasts belonging to the genera -Candida, Cryptococcus, Geotrichum. 96% agreement was found between the two methods.

  20. Evaluation of Fungichrom 1: a new yeast identification system.

    Science.gov (United States)

    Umabala, P; Satheeshkumar, T; Lakshmi, V

    2002-01-01

    Advances in anti-fungal therapy necessitate the need for accurate identification of fungi especially yeasts to their species level for more effective management. Unlike the time consuming conventional methods of yeast identification using fermentation and assimilation patterns of various carbohydrates, the new commercialized yeast identification systems are simpler, rapid and are particularly easy to interpret. In our study, a new colorimetric yeast identification system-Fungichrom 1(International microbio, Signes, France) was evaluated against the conventional method to identify 50 clinical isolates of yeasts belonging to the genera -Candida, Cryptococcus, Geotrichum. 96% agreement was found between the two methods.

  1. Inventions on baker's yeast strains and specialty ingredients.

    Science.gov (United States)

    Gélinas, Pierre

    2009-06-01

    Baker's yeast is one of the oldest food microbial starters. Between 1927 and 2008, 165 inventions on more than 337 baker's yeast strains were patented. The first generation of patented yeast strains claimed improved biomass yield at the yeast plant, higher gassing power in dough or better survival to drying to prepare active dry baker's yeast. Especially between 1980 and 1995, a major interest was given to strains for multiple bakery applications such as dough with variable sugar content and stored at refrigeration (cold) or freezing temperatures. During the same period, genetically engineered yeast strains became very popular but did not find applications in the baking industry. Since year 2000, patented baker's yeast strains claimed aroma, anti-moulding or nutritive properties to better meet the needs of the baking industry. In addition to patents on yeast strains, 47 patents were issued on baker's yeast specialty ingredients for niche markets. This review shows that patents on baker's yeast with improved characteristics such as aromatic or nutritive properties have regularly been issued since the 1920's. Overall, it also confirms recent interest for a very wide range of tailored-made yeast-based ingredients for bakery applications.

  2. Application of hybrid yeasts for molasses fermentation during the production of alcohol and bakers' yeast

    Energy Technology Data Exchange (ETDEWEB)

    Raev, Z.A.; Kovalenko, A.D.; Korobkova, L.A.; Sadovnikova, T.A.; Bespalaya, M.K.

    1973-01-01

    Various hybrids of brewers yeasts were studied and their technological properties established. It was shown that hybrid 75 was suitable for increasing alcohol yields from molasses. Hybrid 112 was suitable for increasing the maltase activity of bakers' yeast. Efficient exploitation of the above properties of yeast hybrids may be achieved in a 2 stage molasses fermentation process developed at the Ukrainian Res. Inst. of Distillery Ind. The method is based on 2-stage yeast addition: strain B yeasts in the 1st stage and an appropriate hybrid in the second.

  3. Ability of RapID Yeast Plus System to identify 304 clinically significant yeasts within 5 hours.

    OpenAIRE

    Kitch, T T; Jacobs, M R; McGinnis, M R; Appelbaum, P C

    1996-01-01

    The RapID Yeast Plus System (Innovative Diagnostic Systems, Norcross, Ga.) is a qualitative micromethod that uses conventional and chromogenic substrates for the identification of medically important yeasts. The ability of the RapID Yeast Plus system to accurately identify 304 clinical yeast isolates within 5 h was evaluated. The RapID Yeast Plus method correctly identified 286 (94.1%) of strains to the species level without the need for additional tests. A further 12 strains (3.9%) were clas...

  4. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  5. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    OpenAIRE

    García Torres Angélica María; Torres Sáe Rodrigo Gonzalo

    2003-01-01

    La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de ést...

  6. Genetics and breeding of brewers yeast

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson-Tillgren, T.; Gjermansen, C.; Petersen, J.G.L.; Holmberg, S.; Kielland-Brandt, M.C.

    1984-01-01

    Yeasts, used for beer production, can be divided into two groups, top fermenters and bottom fermenters and Saccharomyces carlsbergensis has been chosen as the name for the bottom fermenting yeasts which are used in lager beer production. The key for the analysis of the chromosomes of Saccharomyces carlsbergensis was provided by the discovery that single chromosomes of meiotic segregants of these strains can be transferred to genetically marked Saccharomyces cerevisiae strains and subsequently analyzed by tetrad analysis and molecular hybridization. It is proposed that Saccharomyces carlsbergensis is composed of two rather divergent genotypes. Breeding can be accomplished by cross breeding and mutagenesis and possibly by introducing in vitro modified cloned genes into meiotic segregants of Saccharomyces carlsbergensis.

  7. Synchronization of the Budding Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Foltman, Magdalena; Molist, Iago; Sanchez-Diaz, Alberto

    2016-01-01

    A number of model organisms have provided the basis for our understanding of the eukaryotic cell cycle. These model organisms are generally much easier to manipulate than mammalian cells and as such provide amenable tools for extensive genetic and biochemical analysis. One of the most common model organisms used to study the cell cycle is the budding yeast Saccharomyces cerevisiae. This model provides the ability to synchronise cells efficiently at different stages of the cell cycle, which in turn opens up the possibility for extensive and detailed study of mechanisms regulating the eukaryotic cell cycle. Here, we describe methods in which budding yeast cells are arrested at a particular phase of the cell cycle and then released from the block, permitting the study of molecular mechanisms that drive the progression through the cell cycle.

  8. Structural Studies of the Yeast Mitochondrial Degradosome

    DEFF Research Database (Denmark)

    Feddersen, Ane; Jonstrup, Anette Thyssen; Brodersen, Ditlev Egeskov

    The yeast mitochondrial degradosome/exosome (mtExo) is responsible for most RNA turnover in mitochondria and has been proposed to form a central part of a mitochondrial RNA surveillance system responsible for degradation of aberrant and unprocessed RNA ([1], [2]). In contrast to the cytoplasmic...... and nuclear exosome complexes, which consist of 10-12 different nuclease subunits, the mitochondrial degradosome is composed of only two large subunits - an RNase (Dss1p) and a helicase (Suv3p), belonging the Ski2 class of DExH box RNA helicases. Both subunits are encoded on the yeast nuclear genome...... and imported to the mitochondrial matrix posttranslationally. In an effort to understand the complex mechanisms underlying control of RNA turnover and surveillance in eukaryotic organisms, we are studying the structure of the mitochondrial degradosome as a model system for the more complex exosomes. Dss1p...

  9. Microcompartments within the yeast plasma membrane.

    Science.gov (United States)

    Merzendorfer, Hans; Heinisch, Jürgen J

    2013-02-01

    Recent research in cell biology makes it increasingly clear that the classical concept of compartmentation of eukaryotic cells into different organelles performing distinct functions has to be extended by microcompartmentation, i.e., the dynamic interaction of proteins, sugars, and lipids at a suborganellar level, which contributes significantly to a proper physiology. As different membrane compartments (MCs) have been described in the yeast plasma membrane, such as those defined by Can1 and Pma1 (MCCs and MCPs), Saccharomyces cerevisiae can serve as a model organism, which is amenable to genetic, biochemical, and microscopic studies. In this review, we compare the specialized microcompartment of the yeast bud neck with other plasma membrane substructures, focusing on eisosomes, cell wall integrity-sensing units, and chitin-synthesizing complexes. Together, they ensure a proper cell division at the end of mitosis, an intricately regulated process, which is essential for the survival and proliferation not only of fungal, but of all eukaryotic cells.

  10. Effect of Yeast : Saccharomyces cerevisiae and Marine Yeast as probiotic supplement on performance of poultry

    Directory of Open Access Journals (Sweden)

    I Putu Kompiang

    2002-03-01

    Full Text Available An experiment had been conducted to evaluate the effect of marine yeast and Saccharomyces cerevisiae (Sc as probiotic supplement on poultry performance. Marine yeast isolated from rotten sea-weed and commercial Saccharomyces cerevisiae were used. Evaluation was conducted by comparing performance of broiler chicken supplemented with marine yeast or Sc, which were given through drinking water (5 ml/l to negative control (feed without antibiotic growth promotor/GPA, positive control (feed with GPA, and reference commercial probiotic. Forty DOC broiler birds were used for each treatment, divided into 4 replicates (10 birds/replicate and raised in wire cages for 5 weeks. Body weight and feed consumption were measured weekly and mortality was recorded during the trial. The results showed that there were no significant difference on the birds performance among marine yeast, Sc, positive control and probiotic reference control treatments. However their effects on bird performance were better (P<0.05 than treatment of negative control. It is concluded that marine yeast or Saccharomyces cerevisiae could replace the function of antibiotic as a growth promotant.

  11. Telomere behavior in a hybrid yeast

    Institute of Scientific and Technical Information of China (English)

    Ona C Martin; Christopher G De Sevo; Benjamin Z Guo; Douglas E Koshland; Maiterya J Dunham; Yixian Zheng

    2009-01-01

    @@ Dear Editor, Telomeres and the protein/RNA complexes involved in maintaining them are rapidly evolving systems across eukaryotes.Using two Saccharomyces species, among S.cerevisiae and S.bayanus, we provide evidence that the telomere systems of these two closely related yeasts have evolved significantly apart and that the gene in one spe-cies cannot maintain the set-point of telomere length of the other soecies in the hybrid.

  12. An engineered yeast efficiently secreting penicillin.

    Directory of Open Access Journals (Sweden)

    Loknath Gidijala

    Full Text Available This study aimed at developing an alternative host for the production of penicillin (PEN. As yet, the industrial production of this beta-lactam antibiotic is confined to the filamentous fungus Penicillium chrysogenum. As such, the yeast Hansenula polymorpha, a recognized producer of pharmaceuticals, represents an attractive alternative. Introduction of the P. chrysogenum gene encoding the non-ribosomal peptide synthetase (NRPS delta-(L-alpha-aminoadipyl-L-cysteinyl-D-valine synthetase (ACVS in H. polymorpha, resulted in the production of active ACVS enzyme, when co-expressed with the Bacillus subtilis sfp gene encoding a phosphopantetheinyl transferase that activated ACVS. This represents the first example of the functional expression of a non-ribosomal peptide synthetase in yeast. Co-expression with the P. chrysogenum genes encoding the cytosolic enzyme isopenicillin N synthase as well as the two peroxisomal enzymes isopenicillin N acyl transferase (IAT and phenylacetyl CoA ligase (PCL resulted in production of biologically active PEN, which was efficiently secreted. The amount of secreted PEN was similar to that produced by the original P. chrysogenum NRRL1951 strain (approx. 1 mg/L. PEN production was decreased over two-fold in a yeast strain lacking peroxisomes, indicating that the peroxisomal localization of IAT and PCL is important for efficient PEN production. The breakthroughs of this work enable exploration of new yeast-based cell factories for the production of (novel beta-lactam antibiotics as well as other natural and semi-synthetic peptides (e.g. immunosuppressive and cytostatic agents, whose production involves NRPS's.

  13. An engineered yeast efficiently secreting penicillin.

    Science.gov (United States)

    Gidijala, Loknath; Kiel, Jan A K W; Douma, Rutger D; Seifar, Reza M; van Gulik, Walter M; Bovenberg, Roel A L; Veenhuis, Marten; van der Klei, Ida J

    2009-12-15

    This study aimed at developing an alternative host for the production of penicillin (PEN). As yet, the industrial production of this beta-lactam antibiotic is confined to the filamentous fungus Penicillium chrysogenum. As such, the yeast Hansenula polymorpha, a recognized producer of pharmaceuticals, represents an attractive alternative. Introduction of the P. chrysogenum gene encoding the non-ribosomal peptide synthetase (NRPS) delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase (ACVS) in H. polymorpha, resulted in the production of active ACVS enzyme, when co-expressed with the Bacillus subtilis sfp gene encoding a phosphopantetheinyl transferase that activated ACVS. This represents the first example of the functional expression of a non-ribosomal peptide synthetase in yeast. Co-expression with the P. chrysogenum genes encoding the cytosolic enzyme isopenicillin N synthase as well as the two peroxisomal enzymes isopenicillin N acyl transferase (IAT) and phenylacetyl CoA ligase (PCL) resulted in production of biologically active PEN, which was efficiently secreted. The amount of secreted PEN was similar to that produced by the original P. chrysogenum NRRL1951 strain (approx. 1 mg/L). PEN production was decreased over two-fold in a yeast strain lacking peroxisomes, indicating that the peroxisomal localization of IAT and PCL is important for efficient PEN production. The breakthroughs of this work enable exploration of new yeast-based cell factories for the production of (novel) beta-lactam antibiotics as well as other natural and semi-synthetic peptides (e.g. immunosuppressive and cytostatic agents), whose production involves NRPS's.

  14. Secretion of invertase in mitotic yeast cells.

    OpenAIRE

    Makarow, M

    1988-01-01

    In mammalian cells intracellular transport is inhibited during mitosis. Here we show that in the yeast Saccharomyces cerevisiae secretion continues uninterrupted during mitosis. S. cerevisiae cells were arrested in mitosis by treating wild-type cells with the microtubule-inhibitor nocodazole, or by incubating a temperature-sensitive cell division cycle mutant (cdc16) at the restrictive temperature. Secretion of invertase into the periplasmic space was equally efficient in mitotic and in unsyn...

  15. Strategies for identifying new prions in yeast

    OpenAIRE

    MacLea, Kyle S.; Ross, Eric D.

    2011-01-01

    The unexpected discovery of two prions, [URE3] and [PSI+], in Saccharomyces cerevisiae led to questions about how many other proteins could undergo similar prion-based structural conversions. However, [URE3] and [PSI+] were discovered by serendipity in genetic screens. Cataloging the full range of prions in yeast or in other organisms will therefore require more systematic search methods. Taking advantage of some of the unique features of prions, various researchers have developed bioinformat...

  16. Dissection and design of yeast prions.

    OpenAIRE

    Osherovich, Lev Z.; Cox, Brian S; Tuite, Mick F; Weissman, Jonathan S.

    2004-01-01

    Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids). Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p) to examine the requirements for prion formation and inheritance. In both proteins, ...

  17. Multipurpose Transposon-Insertion Libraries in Yeast.

    Science.gov (United States)

    Kumar, Anuj

    2016-06-01

    Libraries of transposon-insertion alleles constitute powerful and versatile tools for large-scale analysis of yeast gene function. Transposon-insertion libraries are constructed most simply through mutagenesis of a plasmid-based genomic DNA library; modification of the mutagenizing transposon by incorporation of yeast selectable markers, recombination sites, and an epitope tag enables the application of insertion alleles for phenotypic screening and protein localization. In particular, yeast genomic DNA libraries have been mutagenized with modified bacterial transposons carrying the URA3 marker, lox recombination sites, and sequence encoding multiple copies of the hemagglutinin (HA) epitope. Mutagenesis with these transposons has yielded a large resource of insertion alleles affecting nearly 4000 yeast genes in total. Through well-established protocols, these insertion libraries can be introduced into the desired strain backgrounds and the resulting insertional mutants can be screened or systematically analyzed. Relative to alternative methods of UV irradiation or chemical mutagenesis, transposon-insertion alleles can be easily identified by PCR-based approaches or high-throughput sequencing. Transposon-insertion libraries also provide a cost-effective alternative to targeted deletion approaches, although, in contrast to start-codon to stop-codon deletions, insertion alleles might not represent true null-mutants. For protein-localization studies, transposon-insertion alleles can provide encoded epitope tags in-frame with internal codons; in many cases, these transposon-encoded epitope tags can provide a more accurate localization for proteins in which terminal sequences are crucial for intracellular targeting. Thus, overall, transposon-insertion libraries can be used quickly and economically and have a particular utility in screening for desired phenotypes and localization patterns in nonstandard genetic backgrounds.

  18. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

    OpenAIRE

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of...

  19. Physiology of yeasts in alcoholic fermentation processes

    OpenAIRE

    Guimarães, Pedro M. R.

    2008-01-01

    Tese de Doutoramento em Engenharia Química e Biológica This thesis is focused on physiological aspects of the yeasts used in two alcoholic fermentation processes: primary brewing fermentation and fermentation of lactose (particularly lactose derived from cheese whey) to ethanol by recombinant Saccharomyces cerevisiae flocculent strains. The brewing fermentation is probably the most extensively studied alcoholic fermentation process. Nevertheless, developments in brewing tech...

  20. How do yeast sense mitochondrial dysfunction?

    Directory of Open Access Journals (Sweden)

    Dmitry A. Knorre

    2016-09-01

    Full Text Available Apart from energy transformation, mitochondria play important signaling roles. In yeast, mitochondrial signaling relies on several molecular cascades. However, it is not clear how a cell detects a particular mitochondrial malfunction. The problem is that there are many possible manifestations of mitochondrial dysfunction. For example, exposure to the specific antibiotics can either decrease (inhibitors of respiratory chain or increase (inhibitors of ATP-synthase mitochondrial transmembrane potential. Moreover, even in the absence of the dysfunctions, a cell needs feedback from mitochondria to coordinate mitochondrial biogenesis and/or removal by mitophagy during the division cycle. To cope with the complexity, only a limited set of compounds is monitored by yeast cells to estimate mitochondrial functionality. The known examples of such compounds are ATP, reactive oxygen species, intermediates of amino acids synthesis, short peptides, Fe-S clusters and heme, and also the precursor proteins which fail to be imported by mitochondria. On one hand, the levels of these molecules depend not only on mitochondria. On the other hand, these substances are recognized by the cytosolic sensors which transmit the signals to the nucleus leading to general, as opposed to mitochondria-specific, transcriptional response. Therefore, we argue that both ways of mitochondria-to-nucleus communication in yeast are mostly (if not completely unspecific, are mediated by the cytosolic signaling machinery and strongly depend on cellular metabolic state.

  1. Comparative genomics of biotechnologically important yeasts.

    Science.gov (United States)

    Riley, Robert; Haridas, Sajeet; Wolfe, Kenneth H; Lopes, Mariana R; Hittinger, Chris Todd; Göker, Markus; Salamov, Asaf A; Wisecaver, Jennifer H; Long, Tanya M; Calvey, Christopher H; Aerts, Andrea L; Barry, Kerrie W; Choi, Cindy; Clum, Alicia; Coughlan, Aisling Y; Deshpande, Shweta; Douglass, Alexander P; Hanson, Sara J; Klenk, Hans-Peter; LaButti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lipzen, Anna M; Meier-Kolthoff, Jan P; Ohm, Robin A; Otillar, Robert P; Pangilinan, Jasmyn L; Peng, Yi; Rokas, Antonis; Rosa, Carlos A; Scheuner, Carmen; Sibirny, Andriy A; Slot, Jason C; Stielow, J Benjamin; Sun, Hui; Kurtzman, Cletus P; Blackwell, Meredith; Grigoriev, Igor V; Jeffries, Thomas W

    2016-08-30

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the clade sister to the known CUG-Ser clade. Our well-resolved yeast phylogeny shows that some traits, such as methylotrophy, are restricted to single clades, whereas others, such as l-rhamnose utilization, have patchy phylogenetic distributions. Gene clusters, with variable organization and distribution, encode many pathways of interest. Genomics can predict some biochemical traits precisely, but the genomic basis of others, such as xylose utilization, remains unresolved. Our data also provide insight into early evolution of ascomycetes. We document the loss of H3K9me2/3 heterochromatin, the origin of ascomycete mating-type switching, and panascomycete synteny at the MAT locus. These data and analyses will facilitate the engineering of efficient biosynthetic and degradative pathways and gateways for genomic manipulation.

  2. Role of yeasts in table olive production.

    Science.gov (United States)

    Arroyo-López, F N; Querol, A; Bautista-Gallego, J; Garrido-Fernández, A

    2008-12-10

    Table olives are a traditional fermented vegetable of the Mediterranean countries, but their production and consumption are now spread all around the world. Yeasts can play a double role in this food. They are present throughout the fermentative process and it is generally accepted that they can produce compounds with important organoleptic attributes determining the quality and flavour of the final product. However, yeasts can also be spoilage microorganisms in olive fermentation/storage and packing causing gas pockets, swollen containers, cloudy brines and off-flavours and off-odours. Candida boidinii, Debaryomyces hansenii, Pichia anomala, P. membranifaciens, Rhodotorula glutinis and Saccharomyces cerevisiae are species isolated with a high frequency from olive processes. Scarce information is still available about the ecology, biochemistry and molecular biology of these important microorganisms in table olives. A wider knowledge about these aspects could facilitate the possible application of yeasts as a starter culture, due to their ability to produce aromatic compounds, antioxidants, enzymes, and improve the growth of lactic acid bacteria.

  3. YeastMed: an XML-Based System for Biological Data Integration of Yeast

    CERN Document Server

    Briache, Abdelaali; Kerzazi, Amine; Navas-Delgado, Ismael; Montes, Jose F Aldana; Hassani, Badr D Rossi; Lairini, Khalid

    2010-01-01

    A key goal of bioinformatics is to create database systems and software platforms capable of storing and analysing large sets of biological data. Hundreds of biological databases are now available and provide access to huge amount of biological data. SGD, Yeastract, CYGD-MIPS, BioGrid and PhosphoGrid are five of the most visited databases by the yeast community. These sources provide complementary data on biological entities. Biologists are brought systematically to query these data sources in order to analyse the results of their experiments. Because of the heterogeneity of these sources, querying them separately and then manually combining the returned result is a complex and laborious task. To provide transparent and simultaneous access to these sources, we have developed a mediator-based system called YeastMed. In this paper, we present YeastMed focusing on its architecture.

  4. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    Science.gov (United States)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  5. Cell surface engineering of yeast for applications in white biotechnology.

    Science.gov (United States)

    Kuroda, Kouichi; Ueda, Mitsuyoshi

    2011-01-01

    Cell surface engineering is a promising strategy for the molecular breeding of whole-cell biocatalysts. By using this strategy, yeasts can be constructed by the cell surface display of functional proteins; these yeasts are referred to as arming yeasts. Because reactions using arming yeasts as whole-cell biocatalysts occur on the cell surface, materials that cannot enter the cell can be used as reaction substrates. Numerous arming yeasts have therefore been constructed for a wide range of uses such as biofuel production, synthesis of valuable chemicals, adsorption or degradation of environmental pollutants, recovery of rare metal ions, and biosensors. Here, we review the science of yeast cell surface modification as well as current applications and future opportunities.

  6. Genetic aspects of targeted insertion mutagenesis in yeasts.

    Science.gov (United States)

    Klinner, U; Schäfer, B

    2004-05-01

    Targeted insertion mutagenesis is a main molecular tool of yeast science initially applied in Saccharomyces cerevisiae. The method was extended to fission yeast Schizosaccharomyces pombe and to "non-conventional" yeast species, which show specific properties of special interest to both basic and applied research. Consequently, the behaviour of such non-Saccharomyces yeasts is reviewed against the background of the knowledge of targeted insertion mutagenesis in S. cerevisiae. Data of homologous integration efficiencies obtained with circular, ends-in or ends-out vectors in several yeasts are compared. We follow details of targeted insertion mutagenesis in order to recognize possible rate-limiting steps. The route of the vector to the target and possible mechanisms of its integration into chromosomal genes are considered. Specific features of some yeast species are discussed. In addition, similar approaches based on homologous recombination that have been established for the mitochondrial genome of S. cerevisiae are described.

  7. The complexity and implications of yeast prion domains

    OpenAIRE

    Du, Zhiqiang

    2011-01-01

    Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are genera...

  8. Effects of Li+ and PEG on DNA uptake in yeast

    Institute of Scientific and Technical Information of China (English)

    CHEN Ping; LIU Huihui; ZHANG Zhiling; PANG Daiwen; XIE Zhixiong; ZHENG Huzhi; LU Zhexue; TONG Hua

    2005-01-01

    @@ DNA uptake of Saccharomyces cerevisiae known as genetic transformation was firstly described by Oppenoorth in 1960[1], and now the most commonly used efficient protocol for yeast transformation makes use of PEG and Li+, which works well for most laboratory strains and is suitable for high-efficiency transformation of plasmid DNA[2-4]. However, it is still unknown how plasmid DNA enters yeast cells and what roles Li+ and PEG play on DNA uptake in yeast cells until now.

  9. Mediated Electrochemical Measurements of Intracellular Catabolic Activities of Yeast Cells

    Institute of Scientific and Technical Information of China (English)

    Jin Sheng ZHAO; Zhen Yu YANG; Yao LU; Zheng Yu YANG

    2005-01-01

    Coupling with the dual mediator system menadione/ferricyanide, microelectrode voltammetric measurements were undertaken to detect the ferrocyanide accumulations arising from the mediated reduction of ferricyanide by yeast cells. The results indicate that the dual mediator system menadione/ferricyanide could be used as a probe to detect cellular catabolic activities in yeast cells and the electrochemical response has a positive relationship with the specific growth rate of yeast cells.

  10. Probiotic properties of yeasts occurring in fermented food and beverages

    DEFF Research Database (Denmark)

    Jespersen, Lene

    Besides being able to improve the quality and safety of many fermented food and beverages some yeasts offer a number of probiotic traits. Especially a group of yeast referred to as "Saccharomyces boulardii", though taxonomically belonging to Saccharomyces cerevisiae, has been claimed to have...... probiotic properties. Besides, yeasts naturally occurring globally in food and beverages will have traits that might have a positive impact on human health....

  11. Identification of yeasts present in sour fermented foods and fodders.

    Science.gov (United States)

    Middelhoven, Wouter J

    2002-07-01

    This paper deals with rapid methods for identification of 50 yeast species frequently isolated from foods and fodders that underwent a lactic acid fermentation. However, many yeast species present in olive brine, alpechin, and other olive products were not treated. The methods required for identification include light microscopy, physiological growth tests (ID32C system of BioMérieux), assimilation of nitrate and of ethylamine as sole nitrogen sources, vitamin requirement, and maximum growth temperature. An identification key to treated yeast species is provided. In another table characteristics of all yeast species treated are listed.

  12. [Novel bioconversion systems using a yeast molecular display system].

    Science.gov (United States)

    Shibasaki, Seiji

    2010-11-01

    The budding yeast Saccharomyces cerevisiae has been used for the process of fermentation as well as for studies in biochemistry and molecular biology as a eukaryotic model cell or tool for the analysis of gene functions. Thus, yeast is essential in industries and researches. Yeast cells have a cell wall, which is one characteristic that helps distinguish yeast cells from other eukaryotic cells such as mammalian cells. We have developed a molecular display system using the protein of the yeast cell wall as an anchor for foreign proteins. Yeast cells have been designed for use in sensing and metal adsorption, and have been used in vaccines and for screening novel proteins. Currently, yeast is used not only as a tool for analyzing gene or protein function but also in molecular display technology. The phage display system, which is at the forefront of molecular display technologies, is a powerful tool for screening ligands bound to a target molecule and for analyzing protein-protein interactions; however, in some cases, eukaryotic proteins are not easily expressed by this system. On the other hand, yeast cells have the ability to express eukaryotic proteins and proliferate; thus, these cells display various proteins. Yeast cells are more appropriate for white biotechnology. In this review, displays of enzymes that are important in bioconversion, such as lipases and β-glucosidases, are going to be introduced.

  13. Aboveground Deadwood Deposition Supports Development of Soil Yeasts

    Directory of Open Access Journals (Sweden)

    Thorsten Wehde

    2012-12-01

    Full Text Available Unicellular saprobic fungi (yeasts inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil-borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon. Unlike soils underneath logs, yeast communities in adjacent areas harbored a considerable number of transient (phylloplane-related yeasts reaching 30% of the total yeast quantity. We showed that distinguishing autochthonous community members and species transient in soils is essential to estimate appropriate effects of environmental factors on soil fungi. Furthermore, a better understanding of species niches is crucial for analyses of culture-independent data, and may hint to the discovery of unifying patterns of microbial species distribution.

  14. A study of yeast carriage on hands of hospital personnel.

    Science.gov (United States)

    Kumar, S; Batra, R

    2000-01-01

    The present study was conducted by culture with a modified broth wash technique to examine the frequency of yeast carriage on the hands of 60 nurses and 35 nonnursing hospital employees. Seventy two percent of the nurses and 80% of the nonnurses were harbouring yeast on their hands. Candida spp. were isolated in 57% on of nurses and 34% of nonnurses. Ninety percent of nurses working in nursing home care unit (NHCU), 50% working in intensive care unit (ICU) and 75% working in outpatient department (OPD) carried yeasts on their hands. Only 80% of nonnurses staff harboured yeasts on their hands.

  15. Yeast Interacting Proteins Database: YGR013W, YKL012W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available st specific, no metazoan counterpart Rows with this bait as bait (1) Rows with this bait as prey (0) YKL012W...U71 Bait description Component of U1 snRNP required for mRNA splicing via spliceosome; yeast specific, no metazoan counter

  16. Yeast Interacting Proteins Database: YDR311W, YMR294W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available Rows with this bait as prey (0) YMR294W JNM1 Component of the yeast dynactin complex, consisting of Nip100p...ows with this bait as prey Rows with this bait as prey (0) Prey ORF YMR294W Prey gene name JNM1 Prey description Component of the ye

  17. Yeast Interacting Proteins Database: YOL069W, YMR294W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available inetochore clustering Rows with this bait as bait (3) Rows with this bait as prey (0) YMR294W JNM1 Component of the ye...ene name JNM1 Prey description Component of the yeast dynactin complex, consisting of Nip100p, Jnm1p, and Ar

  18. Yeast Interacting Proteins Database: YBR288C, YGR261C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available bait (1) Rows with this bait as prey (0) YGR261C APL6 Beta3-like subunit of the yeast AP-3 complex; functio...rey (0) Prey ORF YGR261C Prey gene name APL6 Prey description Beta3-like subunit of the ye

  19. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Science.gov (United States)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2013-05-14

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  20. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2016-08-09

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  1. Studying Functions of All Yeast Genes Simultaneously

    Science.gov (United States)

    Stolc, Viktor; Eason, Robert G.; Poumand, Nader; Herman, Zelek S.; Davis, Ronald W.; Anthony Kevin; Jejelowo, Olufisayo

    2006-01-01

    A method of studying the functions of all the genes of a given species of microorganism simultaneously has been developed in experiments on Saccharomyces cerevisiae (commonly known as baker's or brewer's yeast). It is already known that many yeast genes perform functions similar to those of corresponding human genes; therefore, by facilitating understanding of yeast genes, the method may ultimately also contribute to the knowledge needed to treat some diseases in humans. Because of the complexity of the method and the highly specialized nature of the underlying knowledge, it is possible to give only a brief and sketchy summary here. The method involves the use of unique synthetic deoxyribonucleic acid (DNA) sequences that are denoted as DNA bar codes because of their utility as molecular labels. The method also involves the disruption of gene functions through deletion of genes. Saccharomyces cerevisiae is a particularly powerful experimental system in that multiple deletion strains easily can be pooled for parallel growth assays. Individual deletion strains recently have been created for 5,918 open reading frames, representing nearly all of the estimated 6,000 genetic loci of Saccharomyces cerevisiae. Tagging of each deletion strain with one or two unique 20-nucleotide sequences enables identification of genes affected by specific growth conditions, without prior knowledge of gene functions. Hybridization of bar-code DNA to oligonucleotide arrays can be used to measure the growth rate of each strain over several cell-division generations. The growth rate thus measured serves as an index of the fitness of the strain.

  2. Crystal structure of yeast Sco1

    Energy Technology Data Exchange (ETDEWEB)

    Abajian, Carnie; Rosenzweig, Amy C. (NWU)

    2010-03-05

    The Sco family of proteins are involved in the assembly of the dinuclear CuA site in cytochrome c oxidase (COX), the terminal enzyme in aerobic respiration. These proteins, which are found in both eukaryotes and prokaryotes, are characterized by a conserved CXXXC sequence motif that binds copper ions and that has also been proposed to perform a thiol:disulfide oxidoreductase function. The crystal structures of Saccharomyces cerevisiae apo Sco1 (apo-ySco1) and Sco1 in the presence of copper ions (Cu-ySco1) were determined to 1.8- and 2.3-{angstrom} resolutions, respectively. Yeast Sco1 exhibits a thioredoxin-like fold, similar to that observed for human Sco1 and a homolog from Bacillus subtilis. The Cu-ySco1 structure, obtained by soaking apo-ySco1 crystals in copper ions, reveals an unexpected copper-binding site involving Cys181 and Cys216, cysteine residues present in ySco1 but not in other homologs. The conserved CXXXC cysteines, Cys148 and Cys152, can undergo redox chemistry in the crystal. An essential histidine residue, His239, is located on a highly flexible loop, denoted the Sco loop, and can adopt positions proximal to both pairs of cysteines. Interactions between ySco1 and its partner proteins yeast Cox17 and yeast COX2 are likely to occur via complementary electrostatic surfaces. This high-resolution model of a eukaryotic Sco protein provides new insight into Sco copper binding and function.

  3. How does yeast respond to pressure?

    Directory of Open Access Journals (Sweden)

    P.M.B. Fernandes

    2005-08-01

    Full Text Available The brewing and baking yeast Saccharomyces cerevisiae has been used as a model for stress response studies of eukaryotic cells. In this review we focus on the effect of high hydrostatic pressure (HHP on S. cerevisiae. HHP exerts a broad effect on yeast cells characteristic of common stresses, mainly associated with protein alteration and lipid bilayer phase transition. Like most stresses, pressure induces cell cycle arrest. Below 50 MPa (500 atm yeast cell morphology is unaffected whereas above 220 MPa wild-type cells are killed. S. cerevisiae cells can acquire barotolerance if they are pretreated with a sublethal stress due to temperature, ethanol, hydrogen peroxide, or pressure. Nevertheless, pressure only leads to protection against severe stress if, after pressure pretreatment, the cells are also re-incubated at room pressure. We attribute this effect to the inhibition of the protein synthesis apparatus under HHP. The global genome expression analysis of S. cerevisiae cells submitted to HHP revealed a stress response profile. The majority of the up-regulated genes are involved in stress defense and carbohydrate metabolism while most repressed genes belong to the cell cycle progression and protein synthesis categories. However, the signaling pathway involved in the pressure response is still to be elucidated. Nitric oxide, a signaling molecule involved in the regulation of a large number of cellular functions, confers baroprotection. Furthermore, S. cerevisiae cells in the early exponential phase submitted to 50-MPa pressure show induction of the expression level of the nitric oxide synthase inducible isoform. As pressure becomes an important biotechnological tool, studies concerning this kind of stress in microorganisms are imperative.

  4. Detection and identification of wild yeasts in lager breweries.

    Science.gov (United States)

    van der Aa Kühle, A; Jespersen, L

    1998-09-08

    Wild yeasts were detected in 41 out of 101 brewery yeast samples investigated using six different selective principles. Malt extract, yeast extract, glucose, peptone (MYGP) agar supplemented with 195 ppm CuSO4 was found to be the most effective selective principle, detecting wild yeasts in 80% of the contaminated samples. Both Saccharomyces and non-Saccharomyces wild yeasts were detected on this medium. Lysine medium, crystal violet medium and incubation of non-selective media at 37 degrees C detected wild yeasts in 46-56% of the contaminated samples. On using actidione medium, only 20% of the wild yeasts were detected. The combined use of MYGP supplemented with 195 ppm CuSO4 and one of the other selective principles did not improve the recovery of the wild yeasts. The wild yeasts found consisted of Saccharomyces cerevisiae (57%), Pichia spp. (28%) and Candida spp. (15%). Using the API ID 32 C kit, 35 different assimilation profiles were obtained for the 124 wild yeast isolates investigated. All isolates were capable of glucose assimilation, whereas only 79% of the isolates assimilated saccharose, 75% maltose, 70% galactose, 65% raffinose and 65% lactate. Lactose, inositol, rhamnose and glucuronate were not assimilated by any of the isolates. The differences in assimilation pattern did not reflect any differences in recovery by the selective principles investigated. The majority of the wild yeast isolates investigated were capable of growth in wort and beer, indicating their possible role as spoilage organisms. The Sacch. cerevisiae isolates were found to be the most hazardous, with some isolates being capable of extensive growth in bottled beer within seventeen days at ambient temperature.

  5. Taxonomy Icon Data: Budding yeast [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available Budding yeast Saccharomyces cerevisiae Saccharomyces_cerevisiae_L.png Saccharomyces_cerevisiae_NL.png Saccha...romyces_cerevisiae_S.png Saccharomyces_cerevisiae_NS.png http://biosciencedbc.jp/ta...xonomy_icon/icon.cgi?i=Saccharomyces+cerevisiae&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Saccharomyces...+cerevisiae&t=NL http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Saccharomyces...+cerevisiae&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Saccharomyces+cerevisiae&t=NS http://togodb.biosciencedbc.jp/togodb/view/taxonomy_icon_comment_en?species_id=216 ...

  6. In situ rheology of yeast biofilms.

    Science.gov (United States)

    Brugnoni, Lorena I; Tarifa, María C; Lozano, Jorge E; Genovese, Diego

    2014-01-01

    The aim of the present work was to investigate the in situ rheological behavior of yeast biofilms growing on stainless steel under static and turbulent flow. The species used (Rhodototula mucilaginosa, Candida krusei, Candida kefyr and Candida tropicalis) were isolated from a clarified apple juice industry. The flow conditions impacted biofilm composition over time, with a predominance of C. krusei under static and turbulent flow. Likewise, structural variations occurred, with a tighter appearance under dynamic flow. Under turbulent flow there was an increase of 112 μm in biofilm thickness at 11 weeks (p rheology and contribute to a thin body of knowledge about fungal biofilm formation.

  7. Biodegradation of reactive textile dyes by basidiomycetous fungi from brazilian ecosystems Biodegradação de corantes têxteis reativos fungos basidiomicetos do ecossistema brasileiro

    Directory of Open Access Journals (Sweden)

    Kátia M.G. Machado

    2006-12-01

    Full Text Available The potential of Trametes villosa and Pycnoporus sanguineus to decolorize reactive textile dyes used for cotton manufacturing in the State of Minas Gerais, Brazil, was evaluated. Growth and decolorization halos were determined on malt extract agar containing 0.002g L-1 of the dye. T. villosa decolorized all 28 of the tested dyes while P. sanguineus decolorized only 9. The effect of culture conditions (shaking and dye and nitrogen concentration on the degradation of Drimaren Brilliant Blue dye was evaluated during growth of the fungi in liquid synthetic medium. Shaking favored degradation and decolorization was not repressed by nitrogen. In pure culture, T. villosa and P. sanguineus decolorized synthetic effluent consisting of a mixture of 10 dyes. Higher decolorization of the synthetic effluent was observed when a mixed culture of the two fungi was used. This study demonstrated differences between tropical basidiomycete species in terms of their ability to degrade reactive dyes, and reinforces the potential of this group of fungi for the decolorization of textile effluents.O potencial de Trametes villosa e Pycnoporus sanguineus de descolorir corantes têxteis reativos utilizados na manufatura de algodão no estado de Minas Gerais foi avaliado. Halos de crescimento e descoloração foram determinados em agar extrato malte (MEA com 0,002g L-1 do corante. T. villosa descoloriu os 28 corantes testados e P. sanguineus apenas 9. A influência de condições de cultivo (agitação, concentração de corante e concentração de nitrogênio na degradação do corante azul brilhante Drimaren foi avaliada durante crescimento dos fungos em meio líquido sintético. Agitação favoreceu a degradação e não foi observada repressão da descoloração pelo nitrogênio. Em cultura pura, T. villosa e P. sanguineus descoloriram efluente sintético constituído por uma mistura de dez corantes. Maior descoloração do efluente sintético foi observada no cultivo

  8. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants.

  9. MAGNETIC FIELD EFFECT ON YEAST SACCHAROMYCES CEREVIISIIAE ACTIVITY AT GRAPE MUST FERMENTATION

    OpenAIRE

    Bayraktar, V.

    2013-01-01

    Treatment of yeast cultures using magnetic fields enables us to gain a better understanding of the magnetic fields’ action on enzyme activity and the fluctuation of macroand micro-element concentrations within yeast cultures. For this purpose, the two following groups of yeast were studied: laboratory yeast cultures isolated from regional grape must and commercial yeast cultures that are commonly used in the wine industry. Both yeast groups were biochemically tested with and without magnetic ...

  10. Surface Modifying Substances that Reduce Apparent Yeast Cell Hydrophobicity

    Directory of Open Access Journals (Sweden)

    Lisa Colling

    2005-01-01

    Full Text Available Conclusions. Several commercially available compounds were able to block binding of styrene microspheres to yeast. Some of the binding activity appeared to be attributable to mannose-containing surface components. These findings have implications for formulating therapeutic products that might block yeast binding to tissues.

  11. Functional genomics of beer-related physiological processes in yeast

    NARCIS (Netherlands)

    Hazelwood, L.A.

    2009-01-01

    Since the release of the entire genome sequence of the S. cerevisiae laboratory strain S288C in 1996, many functional genomics tools have been introduced in fundamental and application-oriented yeast research. In this thesis, the applicability of functional genomics for the improvement of yeast in b

  12. The making of biodiversity across the yeast subphyllum

    Science.gov (United States)

    Goals for this research project are to determine how the functional diversity of the yeast subphylum is encoded, and to reconstruct the history of yeasts to elucidate the tempo and mode of functional diversification. The impact of this work will be to integrate discoveries within broadly disseminate...

  13. Determination of adenosine triphosphate in yeast and blood

    NARCIS (Netherlands)

    Steyn-Parvé, Elizabeth P.

    1953-01-01

    A method is described for the determination of ATP in yeast and blood, in which use is made of the decomposition of ATP by myosin adenosinetriphosphatase. ATP is extracted without injury by one minute's boiling at pH 2.5 to 3. Yeast extracts contain myokinase. To destroy this enzyme they are treat

  14. Efficient expression of the yeast metallothionein gene in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Berka, T.; Shatzman, A.; Zimmerman, J.; Strickler, J.; Rosenberg, M.

    1988-01-01

    The yeast metallothionein gene CUP1 was cloned into a bacterial expression system to achieve efficient, controlled expression of the stable, unprocessed protein product. The Escherichia coli-synthesized yeast metallothionein bound copper, cadmium, zinc, indicating that the protein was functional. Furthermore, E. coli cells expressing CUP1 acquired a new, inducible ability to selectively sequester heavy metal ions from the growth medium.

  15. Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

    Science.gov (United States)

    Deutch, Charles E.; Marshall, Pamela A.

    2008-01-01

    In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

  16. Molecular identification of uncommon clinical yeast species in Iran

    Directory of Open Access Journals (Sweden)

    Ladan Karimi

    2015-03-01

    Conclusion: We identified several rare clinical isolates selected from a big collection at the species level by ITS-sequencing. As the list of yeast species as opportunistic human fungal infections is increasing dramatically, and many isolates remain unidentified using conventional methods, more sensitive and specific advanced approaches help us to clarify the aspects of microbial epidemiology of the yeast infections.

  17. [Yeasts in domestic animals: species identification and susceptibility to antifungals].

    Science.gov (United States)

    Hamal, Petr; Koukalová, Dagmar

    2010-02-01

    Yeasts frequently colonize various kinds of domestic animals, but may also cause serious diseases. The aim of this study was to identify yeast isolates collected from dogs, cows and pigs, and to determine their in vitro antifungal susceptibility. Fifty-six yeast isolates from dogs (n = 24), cows (n = 20), and pigs (n = 12) were investigated. Appearance of colonies grown on Sabouraud agar, micromorphology on rice agar, as well as assimilation and fermentation of various carbon and nitrogen sources were evaluated. Susceptibility to six antifungals (flucytosine, amphotericin B, miconazole, ketoconazole, itraconazole and fluconazole) was determined semiquantitatively using the commercially available Fungitest kit (Bio-Rad Laboratories). Ten yeast species were identified in dogs with relatively even distribution. On the other hand, cow and pig were clearly dominated by Candida krusei (from 7 species) and Candida rugosa (from 5 species), respectively. Further, most of yeast isolates exhibited good susceptibility to the antifungals tested particularly to amphotericin B, ketoconazole and itraconazole. Based on results, it can be concluded that significant differences in the species spectrum and distribution were documented between groups of yeasts from dogs, cows and pigs. This is probably due to different environmental conditions and the endogenous origin of the yeast isolates. Mostly good susceptibility to systemic antifungals should positively influence the therapy of diseases caused by yeasts in veterinary medicine.

  18. Identification of Yeasts Present in Sour Fermented Foods and Fodder

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2002-01-01

    This paper deals with rapid methods for identification of 50 yeast species frequently isolated from foods and fodders that underwent a lactic acid fermentation. However, many yeast species present in olive brine, alpechin, and other olive products were not treated. The methods required for identific

  19. Using Microsatellites to Identify Yeast Strains in Beer

    Science.gov (United States)

    Bruke, Alexandria; Van Brocklin, Jennifer; Rivest, Jason; Prenni, Jessica E.; Ibrahim, Hend

    2012-01-01

    Yeast is an integral part of the brewing process and is responsible for much of the taste and characteristics of beer. During the brewing process, yeast is subject to ageing and stress factors that can result in growth inhibition, decreased genetic stability, and changes in cell membrane stability. Characterization of yeast species used in industrial fermentation (e.g. S. cerevisiae) is of great importance to the brewing industry. The objective of this study was to develop an assay to identify yeast strains commonly used in the production of beer. Six microsatellite regions of DNA (comprised of AAT) were used as sequence tagged site markers (STR) to identify and compare yeast samples and to determine strain within a species. Labeled primers ScATT (1-6) targeting these six microsatellite regions were designed using 6-FAM, VIC, NED and PET 5′-fluorescent labels. The six regions were amplified, in a single reaction, from extracted yeast genomic DNA using a modified multiplex-PCR protocol and the labeled PCR products were analyzed on an ABI 3130xl Genetic Analyzer. Using this approach 6 STR markers were amplified in a single multiplex reaction from a commercially utilized yeast strain provided by Odell Brewing. Different alleles were distinguished based on the size of each STR and the labeling fluorophore. The procedures developed in this study will provide an invaluable tool for the quality control of yeast strains in the brewing industry.

  20. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall betwe

  1. How do yeast cells become tolerant to high ethanol concentrations?

    DEFF Research Database (Denmark)

    Snoek, Tim; Verstrepen, Kevin J.; Voordeckers, Karin

    2016-01-01

    The brewer’s yeast Saccharomyces cerevisiae displays a much higher ethanol tolerance compared to most other organisms, and it is therefore commonly used for the industrial production of bioethanol and alcoholic beverages. However, the genetic determinants underlying this yeast’s exceptional ethan...... and challenges involved in obtaining superior industrial yeasts with improved ethanol tolerance....

  2. Effect of salt hyperosmotic stress on yeast cell viability

    Directory of Open Access Journals (Sweden)

    Logothetis Stelios

    2007-01-01

    Full Text Available During fermentation for ethanol production, yeasts are subjected to different kinds of physico-chemical stresses such as: initially high sugar concentration and low temperature; and later, increased ethanol concentrations. Such conditions trigger a series of biological responses in an effort to maintain cell cycle progress and yeast cell viability. Regarding osmostress, many studies have been focused on transcriptional activation and gene expression in laboratory strains of Saccharomyces cerevisiae. The overall aim of this present work was to further our understanding of wine yeast performance during fermentations under osmotic stress conditions. Specifically, the research work focused on the evaluation of NaCl-induced stress responses of an industrial wine yeast strain S. cerevisiae (VIN 13, particularly with regard to yeast cell growth and viability. The hypothesis was that osmostress conditions energized specific genes to enable yeast cells to survive under stressful conditions. Experiments were designed by pretreating cells with different sodium chloride concentrations (NaCl: 4%, 6% and 10% w/v growing in defined media containing D-glucose and evaluating the impact of this on yeast growth and viability. Subsequent fermentation cycles took place with increasing concentrations of D-glucose (20%, 30%, 40% w/v using salt-adapted cells as inocula. We present evidence that osmostress induced by mild salt pre-treatments resulted in beneficial influences on both cell viability and fermentation performance of an industrial wine yeast strain.

  3. Interactions between yeasts, fungicides and apple fruit russeting

    NARCIS (Netherlands)

    Gildemacher, P.R.; Heijne, B.; Silvestri, M.; Houbraken, J.; Hoekstra, E.; Theelen, B.; Boekhout, T.

    2006-01-01

    The effect of inoculations with yeasts occurring on apple surfaces and fungicide treatments on the russeting of Elstar apples was studied. Captan, dithianon and a water treatment were implemented to study the interaction between the fungicides, the inoculated yeast species and Aureobasidium pullulan

  4. Extrinsic allergic alveolitis after exposure to the yeast Rhodotorula rubra.

    Science.gov (United States)

    Siersted, H C; Gravesen, S

    1993-05-01

    A case of extrinsic allergic alveolitis following exposure to the red yeast Rhodotorula rubra is reported--to our knowledge, for the first time. Extensive growth of the yeast in the patient's environment was demonstrated, explaining an elevated titer of Rhodotorula-specific precipitating antibodies in his serum. A bronchial provocation test confirmed the diagnosis.

  5. Occurrence and function of yeasts in Asian indigenous fermented foods

    NARCIS (Netherlands)

    Aidoo, K.E.; Nout, M.J.R.; Sarkar, P.K.

    2006-01-01

    In the Asian region, indigenous fermented foods are important in daily life. In many of these foods, yeasts are predominant and functional during the fermentation. The diversity of foods in which yeasts predominate ranges from leavened bread-like products such as nan and idli, to alcoholic beverages

  6. Specialist nectar-yeasts decline with urbanization in Berlin

    Science.gov (United States)

    Wehner, Jeannine; Mittelbach, Moritz; Rillig, Matthias C.; Verbruggen, Erik

    2017-01-01

    Nectar yeasts are common inhabitants of insect-pollinated flowers but factors determining their distribution are not well understood. We studied the influence of host identity, environmental factors related to pollution/urbanization, and the distance to a target beehive on local distribution of nectar yeasts within Robinia pseudoacacia L. and Tilia tomentosa Moench in Berlin, Germany. Nectar samples of six individuals per species were collected at seven sites in a 2 km radius from each target beehive and plated on YM-Agar to visualise the different morphotypes, which were then identified by sequencing a section of the 26S rDNA gene. Multivariate linear models were used to analyze the effects of all investigated factors on yeast occurrence per tree. Yeast distribution was mainly driven by host identity. The influence of the environmental factors (NO2, height of construction, soil sealing) strongly depended on the radius around the tree, similar to the distance of the sampled beehive. Incidence of specialist nectar-borne yeast species decreased with increasing pollution/urbanization index. Given that specialist yeast species gave way to generalist yeasts that have a reduced dependency on pollinators for between-flower dispersal, our results indicate that increased urbanization may restrict the movement of nectar-specialized yeasts, via limitations of pollinator foraging behavior. PMID:28358006

  7. An overview of macroautophagy in yeast.

    Science.gov (United States)

    Wen, Xin; Klionsky, Daniel J

    2016-05-08

    Macroautophagy is an evolutionarily conserved dynamic pathway that functions primarily in a degradative manner. A basal level of macroautophagy occurs constitutively, but this process can be further induced in response to various types of stress including starvation, hypoxia and hormonal stimuli. The general principle behind macroautophagy is that cytoplasmic contents can be sequestered within a transient double-membrane organelle, an autophagosome, which subsequently fuses with a lysosome or vacuole (in mammals, or yeast and plants, respectively), allowing for degradation of the cargo followed by recycling of the resulting macromolecules. Through this basic mechanism, macroautophagy has a critical role in cellular homeostasis; however, either insufficient or excessive macroautophagy can seriously compromise cell physiology, and thus, it needs to be properly regulated. In fact, a wide range of diseases are associated with dysregulation of macroautophagy. There has been substantial progress in understanding the regulation and molecular mechanisms of macroautophagy in different organisms; however, many questions concerning some of the most fundamental aspects of macroautophagy remain unresolved. In this review, we summarize current knowledge about macroautophagy mainly in yeast, including the mechanism of autophagosome biogenesis, the function of the core macroautophagic machinery, the regulation of macroautophagy and the process of cargo recognition in selective macroautophagy, with the goal of providing insights into some of the key unanswered questions in this field.

  8. Parameters affecting methanol utilization by yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Foda, M.S.; El-Masry, H.G.

    1981-01-01

    Screening of 28 yeast cultures, representing 22 species of various yeasts, with respect to their capabilities to assimilate methanol, has shown that this property was mostly found in certain species of the two genera Hansenula and Candida. When methanol was used as a sole carbon source for a methanol-adapted strain of Hansenula polymorpha, a linear yield response could be obtained with increasing alcohol up to 2% concentration. The amount of inoculum proved to be the decisive factor in determining a priori the ability of the organism to grow at 6% methanol as final concentration. The optimum pH values for growth ranged between 4.5-5.5 with no growth at pH 6.5 or higher. A marked growth stimulation was obtained when the medium was supplied with phosphate up to 0.08 M as final concentration. Within the nitrogen sources tested, corn steep liquor concentrate gave the highest yield of cells. The significance of the obtained results are discussed with reference to feasibilities of application.

  9. Yeast lipid metabolism at a glance.

    Science.gov (United States)

    Klug, Lisa; Daum, Günther

    2014-05-01

    During the last decades, lipids have gained much attention due to their involvement in health and disease. Lipids are required for the formation of membranes and contribute to many different processes such as cell signaling, energy supply, and cell death. Various organelles such as the endoplasmic reticulum, mitochondria, peroxisomes, and lipid droplets are involved in lipid metabolism. The yeast Saccharomyces cerevisiae has become a reliable model organism to study biochemistry, molecular biology, and cell biology of lipids. The availability of mutants bearing defects in lipid metabolic pathways and the ease of manipulation by culture conditions facilitated these investigations. Here, we summarize the current knowledge about lipid metabolism in yeast. We grouped this large topic into three sections dealing with (1) fatty acids; (2) membrane lipids; and (3) storage lipids. Fatty acids serve as building blocks for the synthesis of membrane lipids (phospholipids, sphingolipids) and storage lipids (triacylglycerols, steryl esters). Phospholipids, sterols, and sphingolipids are essential components of cellular membranes. Recent investigations addressing lipid synthesis, degradation, and storage as well as regulatory aspects are presented. The role of enzymes governing important steps of the different lipid metabolic pathways is described. Finally, the link between lipid metabolic and dynamic processes is discussed.

  10. Perchlorate Reduction by Yeast for Mars Exploration

    Science.gov (United States)

    Sharma, Alaisha

    2015-01-01

    Martian soil contains high levels (0.6 percentage by mass) of calcium perchlorate (Ca(ClO4)2), which readily dissociates into calcium and the perchlorate ion (ClO4-) in water. Even in trace amounts, perchlorates are toxic to humans and have been implicated in thyroid dysfunction. Devising methods to lessen perchlorate contamination is crucial to minimizing the health risks associated with human exploration and colonization of Mars. We designed a perchlorate reduction pathway, which sequentially reduces perchlorate to chloride (Cl-) and oxygen (O2), for implementation in the yeast Saccharomyces cerevisiae. Using genes obtained from perchlorate reducing bacteria Azospira oryzae and Dechloromonas aromatica, we plan to assemble this pathway directly within S. cerevisiae through recombinational cloning. A perchlorate reduction pathway would enable S. cerevisiae to lower perchlorate levels and produce oxygen, which may be harvested or used directly by S. cerevisiae for aerobic growth and compound synthesis. Moreover, using perchlorate as an external electron acceptor could improve the efficiency of redox-imbalanced production pathways in yeast. Although several perchlorate reducing bacteria have been identified and utilized in water treatment systems on Earth, the widespread use of S. cerevisiae as a synthetic biology platform justifies the development of a perchlorate reducing strain for implementation on Mars.

  11. The natural history of yeast prions.

    Science.gov (United States)

    Tuite, Mick F

    2013-01-01

    Although prions were first discovered through their link to severe brain degenerative diseases in animals, the emergence of prions as regulators of the phenotype of the yeast Saccharomyces cerevisiae and the filamentous fungus Podospora anserina has revealed a new facet of prion biology. In most cases, fungal prions are carried without apparent detriment to the host cell, representing a novel form of epigenetic inheritance. This raises the question of whether or not yeast prions are beneficial survival factors or actually gives rise to a "disease state" that is selected against in nature. To date, most studies on the impact of fungal prions have focused on laboratory-cultivated "domesticated" strains of S. cerevisiae. At least eight prions have now been described in this species, each with the potential to impact on a wide range of cellular processes. The discovery of prions in nondomesticated strains of S. cerevisiae and P. anserina has confirmed that prions are not simply an artifact of "domestication" of this species. In this review, I describe what we currently know about the phenotypic impact of fungal prions. I then describe how the interplay between host genotype and the prion-mediated changes can generate a wide array of phenotypic diversity. How such prion-generated diversity may be of benefit to the host in survival in a fluctuating, often hazardous environment is then outlined. Prion research has now entered a new phase in which we must now consider their biological function and evolutionary significance in the natural world.

  12. Thermodynamic study of yeast phosphoglycerate kinase.

    Science.gov (United States)

    Hu, C Q; Sturtevant, J M

    1987-01-13

    Enthalpies of binding of MgADP, MgATP, and 3-phosphoglycerate to yeast phosphoglycerate kinase have been determined by flow calorimetry at 9.95-32.00 degrees C. Combination of these data with published dissociation constants [Scopes, R.K. (1978) Eur. J. Biochem. 91, 119-129] yielded the following thermodynamic parameters for the binding of 3-phosphoglycerate at 25 degrees C: delta Go = -6.76 +/- 0.11 kcal mol-1, delta H = 3.74 +/- 0.08 kcal mol-1, delta So = 35.2 +/- 0.6 cal K-1 mol-1, and delta Cp = 0.12 +/- 0.32 kcal K-1 mol-1. The thermal unfolding of phosphoglycerate kinase in the absence and presence of the ligands listed above was studied by differential scanning calorimetry. The temperature of half-completion, t 1/2, of the denaturation and the denaturational enthalpy are increased by the binding of the ligands, the increase in t 1/2 being a manifestation of Le Chatelier's principle and that in enthalpy reflecting the enthalpy of dissociation of the ligand. Only one denaturational peak was observed under all conditions, and in contrast with the case of yeast hexokinase [Takahashi, K., Casey, J.L., & Sturtevant, J.M. (1981) Biochemistry 20, 4693-4697], no definitive evidence for the unfolding of more than one domain was obtained.

  13. Optimization of Fermentation Condition of Yeast Culture

    Institute of Scientific and Technical Information of China (English)

    WANG Qiuju; XU Li; CUI Yizhe

    2008-01-01

    Culture condition of every phase for fermentation of yeast culture was studied, and its solid and liquid conditions of elaboration were optimized to improve the total counts of living cells.Results showed that microzyme grew best at 30℃ when solid fermented,and the count of the living cells reached the tiptop with pH 5.5.The count of Candida tropicalis could reach 137.96×109 cfu·g-1,the count of Saccharomyces cerevisia could reach 134.62×109 cfu·g-1;the best liquid fermentation condition for cell-wall broken was 50℃ for 28 h,the rate of cell-wall broken could reach 80% at least;the rate of vitamin loss in yeast could be the minimun, the loss rate of vitamin B1 in Candida tropicalis and Saccharomyces cerevisiae was 8.71% and 19.54% respectively, the loss rate of vitamin B2 was 19.39% and 13.18%,respectively,and the loss rate of vitamin B6 was 6.3% and 3.04%,respectively.

  14. Isolation and Identification of Yeasts from Tibet Kefir

    Directory of Open Access Journals (Sweden)

    Yun Li

    2015-02-01

    Full Text Available The occurrence and distribution of yeasts in Tibet kefir were investigated in this study. Five samples of Tibetan kefir from Tibet and surrounding areas were collected for yeast isolation. Based on physiological, biochemical characteristics and molecular identification results, eight species of yeast were isolated and identified from Tibet kefir, including Saccharomyces cerevisiae, Pichia fermentans, Debaryomyces hansenii, Rhodotorula mucilaginosa, Candida zeylanoide, Candida parapsilosis, Kluyveromyces marxianus and Kazachstania unispora. Among the test samples, K. marxianus, Ka. unispora and P. fermentans were the highest three species in frequency of occurrence of yeast isolates. C. zeylanoides, C. parapsilosis and R. mucilaginosa were first found the occurrence in Tibet kefir. The results provided new information of yeast composition and biodiversity of Tibet kefir.

  15. Stabilization and encapsulation of photosensitive resveratrol within yeast cell.

    Science.gov (United States)

    Shi, Guorong; Rao, Liqun; Yu, Huazhong; Xiang, Hua; Yang, Hua; Ji, Runa

    2008-02-12

    The photosensitive resveratrol was successfully encapsulated in yeast cells for the first time, as characterized by FT-IR spectra, fluorescence and confocal micrographs of the yeast cells, resveratrol and microcapsules. The release characteristic of the obtained yeast-encapsulated resveratrol in simulated gastric fluid was evaluated, and its storage stability as a powder was investigated at 25 degrees C/75% relative humidity (RH), 25 degrees C/90% RH and 60 degrees C under the laboratory fluorescent lighting conditions (ca. 300 lx) or in the dark. Also, the scavenging capacity of yeast-encapsulated resveratrol on DPPH radical was compared with that of non-encapsulated resveratrol. It could be demonstrated clearly that no chemical changes occurred during the encapsulation. Besides, the DPPH radical-scavenging activity increased after the encapsulation. In addition, the yeast-encapsulated resveratrol exhibited good stability, and its bioavailability was enhanced as a result of increased solubility of resveratrol and sustained releasing.

  16. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  17. Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production

    Directory of Open Access Journals (Sweden)

    Popov Stevan D.

    2005-01-01

    Full Text Available The waste brewer's yeast S. cerevisiae (activated and non-activated was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positively the quality of produced bread regarding bread volume. The volume of developed gas in dough prepared with the use of non-activated BY was not sufficient, therefore, it should not be used as fermentation agent, but only as an additive in bread production process for bread freshness preservation. Intense mixing of dough results in more compressible crumb 48 hrs after baking compared to high-speed mixing.

  18. Yeast systems for the commercial production of heterologous proteins.

    Science.gov (United States)

    Buckholz, R G; Gleeson, M A

    1991-11-01

    Yeasts are attractive hosts for the production of heterologous proteins. Unlike prokaryotic systems, their eukaryotic subcellular organization enables them to carry out many of the post-translational folding, processing and modification events required to produce "authentic" and bioactive mammalian proteins. In addition, they retain the advantages of a unicellular microorganism, with respect to rapid growth and ease of genetic manipulation. The vast majority of yeast expression work has focused on the well-characterized baker's yeast Saccharomyces cerevisiae. However, with the development of DNA transformation technologies, a growing number of non-Saccharomyces yeasts are becoming available as hosts for recombinant polypeptide production. These include Hansenula polymorpha, Kluyveromyces lactis, Pichia pastoris, Schizosaccharomyces pombe, Schwanniomyces occidentalis and Yarrowia lipolytica. The performance of these alternative yeast expression systems is reviewed here relative to S. cerevisiae, and the advantages and limitations of these systems are discussed.

  19. Yeast identification in the clinical microbiology laboratory: phenotypical methods.

    Science.gov (United States)

    Freydiere, A M; Guinet, R; Boiron, P

    2001-02-01

    Emerging yeast pathogens are favoured by increasing numbers of immunocompromised patients and by certain current medical practices. These yeasts differ in their antifungal drug susceptibilities, and rapid species identification is imperative. A large variety of methods have been developed with the aim of facilitating rapid, accurate yeast identification. Significant recent commercial introductions have included species-specific direct enzymatic colour tests, differential chromogenic isolation plates, direct immunological tests, and enhanced manual and automated biochemical and enzymatic panels. Chromogenic isolation media demonstrate better detection rates of yeasts in mixed cultures than traditional media, and allow the direct identification of Candida albicans by means of colony colour. Comparative evaluation of rapid methods for C. albicans identification, including the germ tube test, shows that chromogenic media may be economically advantageous. Accurate tests for single species include the Bichrolatex Albicans and Krusei Color tests, both immunologically based, as well as the Remel Rapid Trehalose Assimilation Broth for C. glabrata. Among broad-spectrum tests, the RapID Yeast Plus system gives same-day identification of clinical yeasts, but performance depends on inoculum density and geographic isolate source. The API 20 C AUX system is considered a reference method, but newer systems such as Auxacolor and Fungichrom are as accurate and are more convenient. Among automated systems, the ID 32 C strip, the Vitek Yeast Biochemical Card and the Vitek 2 ID-YST system correctly identify >93% of common yeasts, but the ID-YST is the most accurate with uncommon yeasts, including C. dubliniensis. Spectroscopic methods such as Fourier transformed-infrared spectroscopy offer potential advantages for the future. Overall, the advantages of rapid yeast identification methods include relative simplicity and low cost. For all rapid methods, meticulous, standardized

  20. Lipid raft involvement in yeast cell growth and death.

    Science.gov (United States)

    Mollinedo, Faustino

    2012-01-01

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na(+), K(+), and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  1. Lipid raft involvement in yeast cell growth and death

    Directory of Open Access Journals (Sweden)

    Faustino eMollinedo

    2012-10-01

    Full Text Available The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Crytococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na+, K+ and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  2. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    Directory of Open Access Journals (Sweden)

    Jennifer R Bellon

    Full Text Available Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade, has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  3. [Diversity and genetic stability of yeast flocculation caused by variation of tandem repeats in yeast flocculin genes].

    Science.gov (United States)

    Yue, Feng; Guo, Xuena; He, Xiuping; Zhang, Borun

    2013-07-01

    Yeast flocculation is described as a reversible, asexual and calcium dependent process, in which cells adhere to form flocs by interaction of specific cell surface proteins named flocculins on yeast cells with mannose residues present on the cell wall of adjacent yeast cells. Yeast flocculation provides a very economical and convenient pathway for separation of yeast cells from the fermentation broth or removal of heavy metal ions from effluent. A large number of tandem repeats have been found in genes encoding flocculins, which not only have great regulatory effect on the structure and function of flocculins, generating the diversity of flocculation characteristics, but lead to genetic instability in flocculation as well for driving slippage and recombination reactions within and between FLO genes. Here, the research progress in effect of variation of tandem repeats in FLO genes on flocculation characteristics and genetic stability were reviewed to direct and promote the controllable application of flocculation in industrial fermentation process and environmental remediation.

  4. Anhydrobiosis in yeast: cell wall mannoproteins are important for yeast Saccharomyces cerevisiae resistance to dehydration.

    Science.gov (United States)

    Borovikova, Diana; Teparić, Renata; Mrša, Vladimir; Rapoport, Alexander

    2016-08-01

    The state of anhydrobiosis is linked with the reversible delay of metabolism as a result of strong dehydration of cells, and is widely distributed in nature. A number of factors responsible for the maintenance of organisms' viability in these conditions have been revealed. This study was directed to understanding how changes in cell wall structure may influence the resistance of yeasts to dehydration-rehydration. Mutants lacking various cell wall mannoproteins were tested to address this issue. It was revealed that mutants lacking proteins belonging to two structurally and functionally unrelated groups (proteins non-covalently attached to the cell wall, and Pir proteins) possessed significantly lower cell resistance to dehydration-rehydration than the mother wild-type strain. At the same time, the absence of the GPI-anchored cell wall protein Ccw12 unexpectedly resulted in an increase of cell resistance to this treatment; this phenomenon is explained by the compensatory synthesis of chitin. The results clearly indicate that the cell wall structure/composition relates to parameters strongly influencing yeast viability during the processes of dehydration-rehydration, and that damage to cell wall proteins during yeast desiccation can be an important factor leading to cell death. Copyright © 2016 John Wiley & Sons, Ltd.

  5. Biocavity laser spectroscopy of genetically altered yeast cells and isolated yeast mitochondria

    Science.gov (United States)

    Gourley, Paul L.; Hendricks, Judy K.; McDonald, Anthony E.; Copeland, R. Guild; Naviaux, Robert K.; Yaffe, Michael P.

    2006-02-01

    We report an analysis of 2 yeast cell mutants using biocavity laser spectroscopy. The two yeast strains differed only by the presence or absence of mitochondrial DNA. Strain 104 is a wild-type (ρ +) strain of the baker's yeast, Saccharomyces cerevisiae. Strain 110 was derived from strain 104 by removal of its mitochondrial DNA (mtDNA). Removal of mtDNA causes strain 110 to grow as a "petite" (ρ -), named because it forms small colonies (of fewer cells because it grows more slowly) on agar plates supplemented with a variety of different carbon sources. The absence of mitochondrial DNA results in the complete loss of all the mtDNA-encoded proteins and RNAs, and loss of the pigmented, heme-containing cytochromes a and b. These cells have mitochondria, but the mitochondria lack the normal respiratory chain complexes I, III, IV, and V. Complex II is preserved because its subunits are encoded by genes located in nuclear DNA. The frequency distributions of the peak shifts produced by wild-type and petite cells and mitochondria show striking differences in the symmetry and patterns of the distributions. Wild-type ρ + cells (104) and mitochondria produced nearly symmetric, Gaussian distributions. The ρ - cells (110) and mitochondria showed striking asymmetry and skew that appeared to follow a Poisson distribution.

  6. Organic growth factor requirements of some yeasts.

    Science.gov (United States)

    Madan, M; Gulati, N

    1980-01-01

    Some sporogenous yeasts (Brettanomyces bruxellensis, Debaryomyces hansenii, Hansenula ciferrii, Hansenula polymorpha, Pichia polymorpha, Saccharomycopsis guttulata, and Saccharomyces chevalieri), isolated from various fruits have been examined for their organic growth factor requisites. H. ciferrii was completely deficient in thiamine, biotin, inositol, riboflavin, niacin, and partially deficient in pantothenic acid. It required an external supply of 0.1-1.0 ppm thiamine, 0.01-0.1 ppm biotin, 10.0 ppm inositol, 0.10 ppm niacin and riboflavin for its optimum growth. H. polymorpha showed partial deficiency only in xanthine. P. polymorpha gave indications of partial deficiencies in thiamine and biotin. S. guttulata was completely deficient in biotin, and partially deficient in adenine sulphate. It required 0.01 ppm biotin for optimum growth. S chevalieri was completely deficient in pyridoxine and partially deficient in thiamine. It required 0.1 ppm pyridoxine for maximum growth. D. hansenii and B bruxellensis were auxoautotrophic for the various growth factors studied.

  7. Combinatorial Regulation in Yeast Transcription Networks

    Science.gov (United States)

    Li, Hao

    2006-03-01

    Yeast has evolved a complex network to regulate its transcriptional program in response to changes in environment. It is quite common that in response to an external stimulus, several transcription factors will be activated and they work in combinations to control different subsets of genes in the genome. We are interested in how the promoters of genes are designed to integrate signals from multiple transcription factors and what are the functional and evolutionary constraints. To answer how, we have developed a number of computational algorithms to systematically map the binding sites and target genes of transcription factors using sequence and gene expression data. To analyze the functional constraints, we have employed mechanistic models to study the dynamic behavior of genes regulated by multiple factors. We have also developed methods to trace the evolution of transcriptional networks via comparative analysis of multiple species.

  8. Yeast prions: Paramutation at the protein level?

    Science.gov (United States)

    Tuite, Mick F

    2015-08-01

    Prions are proteins that have the potential to refold into a novel conformation that templates the conversion of like molecules to the altered infectious form. In the yeast Saccharomyces cerevisiae, trans-generational epigenetic inheritance can be mediated by a number of structurally and functionally diverse prions. Prionogenesis can confer both loss-of-function and gain-of-function properties to the prion protein and this in turn can have a major impact on host phenotype, short-term adaptation and evolution of new traits. Prionogenesis shares a number of properties in common with paramutation and can be considered as a mitotically and meiotically heritable change in protein conformation induced by trans-interactions between homologous proteins.

  9. Stability of immobilized yeast alcohol dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Ooshima, H.; Genko, Y.; Harano, Y.

    1981-12-01

    The effects of substrate on stabilities of native (NA) and three kinds of immobilized yeast alcohol dehydrogenase (IMA), namely PGA (the carrier; porous glass), SEA (agarose gel) prepared covalently, and AMA (anion-exchange resin) prepared ionically, were studied. The following results were obtained. 1) The deactivations of NA and IMA free from the substrate or in the presence of ethanol obey the first-order kinetics, whereas, in the presence of butyraldehyde, their deactivation behaviors are explained on the basis of coexistence of two components of YADHs, namely the labile E1 and the comparatively stable E2, with different first-order deactivation constants. (2) A few attempts for stabilization of IMA were carried out from the viewpoint of the effects of crosslinkages among the subunits of YADH for PGA and the multibonding between the carrier and enzyme for SEA. The former is effective for the stabilization, whereas the latter is not. (Refs. 19).

  10. Production of high concentrations of yeast

    Energy Technology Data Exchange (ETDEWEB)

    1981-11-10

    A microbe is aerobically cultured using O/sub 2/ or a gas rich in O/sub 2/. The grown cells are washed, concentrated and a portion of the cells used as a seed culture. Thus, Saccharomyces cerevisiae (bakers' yeast) was cultured in a jar fermentor by flow down system maintaining the dissolved O/sub 2/ at 2-5 mg/L; volume of the initial medium containing 30% glucose was 350 mL and the initial washed cell concentration was 50 g dry cells/L. After 12 hours of cultivation, the volume of the medium increased to 750 mL and the cell concentration rose to 102 g dry cells/L; the yield was 49% with respect to glucose. The cells were washed and the cultivation was repeated by use of the washed cells; cell concentration reached 105 g dry cells/L.

  11. Phyllosphere yeasts rapidly break down biodegradable plastics.

    Science.gov (United States)

    Kitamoto, Hiroko K; Shinozaki, Yukiko; Cao, Xiao-Hong; Morita, Tomotake; Konishi, Masaaki; Tago, Kanako; Kajiwara, Hideyuki; Koitabashi, Motoo; Yoshida, Shigenobu; Watanabe, Takashi; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Tsushima, Seiya

    2011-11-29

    The use of biodegradable plastics can reduce the accumulation of environmentally persistent plastic wastes. The rate of degradation of biodegradable plastics depends on environmental conditions and is highly variable. Techniques for achieving more consistent degradation are needed. However, only a few microorganisms involved in the degradation process have been isolated so far from the environment. Here, we show that Pseudozyma spp. yeasts, which are common in the phyllosphere and are easily isolated from plant surfaces, displayed strong degradation activity on films made from poly-butylene succinate or poly-butylene succinate-co-adipate. Strains of P. antarctica isolated from leaves and husks of paddy rice displayed strong degradation activity on these films at 30°C. The type strain, P. antarctica JCM 10317, and Pseudozyma spp. strains from phyllosphere secreted a biodegradable plastic-degrading enzyme with a molecular mass of about 22 kDa. Reliable source of biodegradable plastic-degrading microorganisms are now in our hands.

  12. Import of proteins into isolated yeast mitochondria.

    Science.gov (United States)

    Peleh, Valentina; Ramesh, Ajay; Herrmann, Johannes M

    2015-01-01

    Mitochondria are essential organelles of eukaryotic cells. The vast majority of mitochondrial proteins is encoded within the nuclear genome and translocated into various mitochondrial compartments after translation in the cytosol as preproteins. Even in rather primitive eukaryotes like yeasts, there are 700-1,000 different proteins that need to be recognized in the cytosol, directed to the protein translocases in the two mitochondrial membranes and sorted to their appropriate mitochondrial subcompartment. In vitro reconstituted import systems have proved to be important tools to study these processes in detail. Using isolated mitochondria and radioactively labeled precursor proteins, it was possible to identify several import machineries and pathways consisting of a large number of components during the last few decades.

  13. Development of Industrial Yeast Platform Strains

    DEFF Research Database (Denmark)

    Bergdahl, Basti; Dato, Laura; Förster, Jochen

    2014-01-01

    frequently encounter high substrate concentrations, low pH, high temperatures and various inhibitory compounds originating either from the raw material used or from cellular metabolism. The aim of this research project is to develop robust platform strains of Saccharomyces cerevisiae based on industrial...... screening of the 36 industrial and laboratory yeast strains. In addition, progress in the development of molecular biology methods for generating the new strains will be presented.......Most of the current metabolic engineering projects are carried out using laboratory strains as the starting host. Although such strains are easily manipulated genetically, their robustness does not always meet the requirements set by industrial fermentation conditions. In such conditions, the cells...

  14. Genetic and physiological variants of yeast selected from palm wine.

    Science.gov (United States)

    Ezeronye, O U; Okerentugba, P O

    2001-01-01

    Genetic screening of 1200-palm wine yeasts lead to the selection of fourteen isolates with various genetic and physiological properties. Nine of the isolates were identified as Saccharamyces species, three as Candida species, one as Schizosaccharomyces species and one as Kluyveromyces species. Five of the isolates were wild type parents, two were respiratory deficient mutants (rho) and nine were auxotrophic mutants. Four isolates were heterozygous diploid (alphaa) and two were homozygous diploid (aa/alphaalpha) for the mating a mating types were further identified on mating with type loci. Four Mat alpha and four Mat a types were further identified on mating with standard haploid yeast strains. Forty-five percent sporulated on starvation medium producing tetrads. Fifty-two percent of the four-spored asci contained four viable spores. Maximum specific growth rate [micromax] of the fourteen isolates range from 0.13-0.26, five isolates were able to utilize exogenous nitrate for growth. Percentage alcohol production range between 5.8-8.8% for palm wine yeast, 8.5% for bakers' yeast and 10.4% for brewers yeast. The palm wine yeast were more tolerant to exogenous alcohol but had a low alcohol productivity. Hybridization enhanced alcohol productivity and tolerance in the palm wine yeasts.

  15. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  16. Yeast Biomass Production in Brewery's Spent Grains Hemicellulosic Hydrolyzate

    Science.gov (United States)

    Duarte, Luís C.; Carvalheiro, Florbela; Lopes, Sónia; Neves, Ines; Gírio, Francisco M.

    Yeast single-cell protein and yeast extract, in particular, are two products which have many feed, food, pharmaceutical, and biotechnological applications. However, many of these applications are limited by their market price. Specifically, the yeast extract requirements for culture media are one of the major technical hurdles to be overcome for the development of low-cost fermentation routes for several top value chemicals in a biorefinery framework. A potential biotechnical solution is the production of yeast biomass from the hemicellulosic fraction stream. The growth of three pentose-assimilating yeast cell factories, Debaryomyces hansenii, Kluyveromyces marxianus, and Pichia stipitis was compared using non-detoxified brewery's spent grains hemicellulosic hydrolyzate supplemented with mineral nutrients. The yeasts exhibited different specific growth rates, biomass productivities, and yields being D. hansenii as the yeast species that presented the best performance, assimilating all sugars and noteworthy consuming most of the hydrolyzate inhibitors. Under optimized conditions, D. hansenii displayed a maximum specific growth rate, biomass yield, and productivity of 0.34 h-1, 0.61 g g-1, and 0.56 g 1-1 h-1, respectively. The nutritional profile of D. hansenii was thoroughly evaluated, and it compares favorably to others reported in literature. It contains considerable amounts of some essential amino acids and a high ratio of unsaturated over saturated fatty acids.

  17. Potential Application of Yeast β-Glucans in Food Industry

    Directory of Open Access Journals (Sweden)

    Vesna Zechner-krpan

    2009-12-01

    Full Text Available Different β-glucans are found in a variety of natural sources such as bacteria, yeast, algae, mushrooms, barley and oat. They have potential use in medicine and pharmacy, food, cosmetic and chemical industries, in veterinary medicine and feed production. The use of different β-glucans in food industry and their main characteristics important for food production are described in this paper. This review focuses on beneficial properties and application of β-glucans isolated from different yeasts, especially those that are considered as waste from brewing industry. Spent brewer’s yeast, a by-product of beer production, could be used as a raw-material for isolation of β-glucan. In spite of the fact that large quantities of brewer’s yeast are used as a feedstuff , certain quantities are still treated as a liquid waste. β-Glucan is one of the compounds that can achieve a greater commercial value than the brewer’s yeast itself and maximize the total profitability of the brewing process. β-Glucan isolated from spent brewer’s yeast possesses properties that are benefi cial for food production. Therefore, the use of spent brewer’s yeast for isolation of β-glucan intended for food industry would represent a payable technological and economical choice for breweries.

  18. Yeast responses to stresses associated with industrial brewery handling.

    Science.gov (United States)

    Gibson, Brian R; Lawrence, Stephen J; Leclaire, Jessica P R; Powell, Chris D; Smart, Katherine A

    2007-09-01

    During brewery handling, production strains of yeast must respond to fluctuations in dissolved oxygen concentration, pH, osmolarity, ethanol concentration, nutrient supply and temperature. Fermentation performance of brewing yeast strains is dependent on their ability to adapt to these changes, particularly during batch brewery fermentation which involves the recycling (repitching) of a single yeast culture (slurry) over a number of fermentations (generations). Modern practices, such as the use of high-gravity worts and preparation of dried yeast for use as an inoculum, have increased the magnitude of the stresses to which the cell is subjected. The ability of yeast to respond effectively to these conditions is essential not only for beer production but also for maintaining the fermentation fitness of yeast for use in subsequent fermentations. During brewery handling, cells inhabit a complex environment and our understanding of stress responses under such conditions is limited. The advent of techniques capable of determining genomic and proteomic changes within the cell is likely vastly to improve our knowledge of yeast stress responses during industrial brewery handling.

  19. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  20. Medicinal and antimicrobial role of the oyster culinary-medicinal mushroom Pleurotus ostreatus (higher Basidiomycetes) cultivated on banana agrowastes in India.

    Science.gov (United States)

    Kunjadia, Prashant D; Nagee, Anju; Pandya, Parth Y; Mukhopadhyaya, Pratap N; Sanghvi, Gaurav V; Dave, Gaurav S

    2014-01-01

    Oyster mushrooms, species of the genus Pleurotus, are recognized for producing secondary metabolites with important medicinal properties. Investigations were carried out to evaluate the antioxidative and antimicrobial properties of the edible mushroom Pleurotus ostreatus (MTCC142) extracts cultivated on banana agrowastes. Ethanolic extracts showed antimicrobial activities against gram-positive and gram-negative bacteria, and their in vitro antifungal activities against all fungi tested revealed a promising role. Qualitative phytochemical analysis of Pleurotus grown on yeast dextrose broth and banana agrowaste confirmed the presence of steroids, cardiac glycosides, terpenoids, and alkaloids, whereas ethanolic extract after 40 days exhibited a phenol concentration of 521.67 µg/mL in banana waste compared to 155 µg/mL in yeast dextrose broth. The minimum inhibitory concentration of ethanolic extracts ranged from 19.74 to 56.84 mg/mL and 35.53 to 102.31 mg/mL in solid-state and submerged grown mycelium extracts, respectively, after 40 days. Moreover, banana agrowaste could be a significant economic source for the production of the oyster mushroom P. ostreatus. The nutritive, medicinal, and antimicrobial properties of P. ostreatus can be used to develop a new nutraceutical formulation; it can also be used as an additive to routine and fast food.

  1. The manometric determination of thiamine pyrophosphate and the inhibition of the acid yeast phosphatase

    NARCIS (Netherlands)

    Steyn-Parvé, Elizabeth P.

    1962-01-01

    Sodium molybdate is a powerful inhibitor of the acid yeast phosphatase in both fresh baker's yeast and dried brewer's yeast, provided that the yeast is suspended in a suitable buffer. It displays no action in citrate or phosphate buffers, but is active in acetate or maleate buffers, both at the opti

  2. Yeasts isolated from clinical samples of AIDS patients

    Directory of Open Access Journals (Sweden)

    Neves Rejane Pereira

    2002-01-01

    Full Text Available In order to investigate yeasts in oropharyngeal secretion, urine, sputum and inguinal scales from AIDS patients, clinical samples were collected from one hundred patients interned in the Infectious and Parasitic Diseases Sector of the Hospital das Clínicas of the Universidade Federal de Pernambuco and in Hospital Universitário Osvaldo Cruz of the Universidade de Pernambuco. Yeasts were isolated from seventy-two out of one hundred and eight clinical samples. The isolated yeasts were: Candida albicans (sixty-two isolates, Candida tropicalis (four isolates, Candida glabrata (two isolates, Candida parapsilosis (two isolates, Candida krusei (one isolate and Trichosporon pullulans (one isolate.

  3. Production of yeast extract from whey using Kluyveromyces marxianus

    Directory of Open Access Journals (Sweden)

    Revillion Jean P. de Palma

    2003-01-01

    Full Text Available The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide rich extract with K. marxianus.

  4. Estrogen Receptor Agonists and Antagonists in the Yeast Estrogen Bioassay.

    Science.gov (United States)

    Wang, Si; Bovee, Toine F H

    2016-01-01

    Cell-based bioassays can be used to predict the eventual biological activity of a substance on a living organism. In vitro reporter gene bioassays are based on recombinant vertebrate cell lines or yeast strains and especially the latter are easy-to-handle, cheap, and fast. Moreover, yeast cells do not express estrogen, androgen, progesterone or glucocorticoid receptors, and are thus powerful tools in the development of specific reporter gene systems that are devoid of crosstalk from other hormone pathways. This chapter describes our experience with an in-house developed RIKILT yeast estrogen bioassay for testing estrogen receptor agonists and antagonists, focusing on the applicability of the latter.

  5. Evaluation of the Quantum II yeast identification system.

    OpenAIRE

    Kiehn, T E; Edwards, F F; Tom, D; LIEBERMAN, G; Bernard, E M; Armstrong, D.

    1985-01-01

    We compared three methods for identifying clinical yeast isolates: Abbott Quantum II, API 20C, and a modified BBL Minitek system. The API 20C and modified Minitek systems agreed on the identification of 243 of 245 yeasts (99.2%). The Quantum II system correctly identified 197 (80.4%), incorrectly identified 19 (7.8%), and did not identify 29 (11.8%) of the yeasts. Most of the misidentifications with the Quantum II occurred because assimilation or biochemical results were false-positive. Sixte...

  6. Mediated amperometry reveals different modes of yeast responses to sugars.

    Science.gov (United States)

    Garjonyte, Rasa; Melvydas, Vytautas; Malinauskas, Albertas

    2016-02-01

    Menadione-mediated amperometry at carbon paste electrodes modified with various yeasts (Saccharomyces cerevisiae, Candida pulcherrima, Pichia guilliermondii and Debaryomyces hansenii) was employed to monitor redox activity inside the yeast cells induced by glucose, fructose, sucrose, maltose or galactose. Continuous measurements revealed distinct modes (transient or gradually increasing) of the current development during the first 2 to 3 min after subjection to glucose, fructose and sucrose at electrodes containing S. cerevisiae and non-Saccharomyces strains. Different modes (increasing or decreasing) of the current development after yeast subjection to galactose at electrodes with S. cerevisiae or D. hansenii and at electrodes with C. pulcherrima and P. guilliermondii suggested different mechanisms of galactose assimilation.

  7. Characterization of Septin Ultrastructure in Budding Yeast Using Electron Tomography

    Science.gov (United States)

    Bertin, Aurélie; Nogales, Eva

    2015-01-01

    Summary Septins are essential for the completion of cytokinesis. In budding yeast, Saccharomyces cerevisiae, septins are located at the bud neck during mitosis and are closely connected to the inner plasma membrane. In vitro, yeast septins have been shown to self-assemble into a variety of filamentous structures, including rods, paired filaments, bundles and rings [1–3]. Using electron tomography of freeze-substituted section and cryo-electron tomography of frozen sections, we determined the three dimensional organization of the septin cytoskeleton in dividing budding yeast with molecular resolution [4,5]. Here we describe the detailed procedures used for our characterization of the septin cellular ultrastructure. PMID:26519309

  8. Media composition influences yeast one- and two-hybrid results

    Directory of Open Access Journals (Sweden)

    Gonzalez Kim L

    2011-08-01

    Full Text Available Abstract Although yeast two-hybrid experiments are commonly used to identify protein interactions, the frequent occurrence of false negatives and false positives hampers data interpretation. Using both yeast one-hybrid and two-hybrid experiments, we have identified potential sources of these problems: the media preparation protocol and the source of the yeast nitrogen base may not only impact signal range but also effect whether a result appears positive or negative. While altering media preparation may optimize signal differences for individual experiments, media preparation must be reported in detail to replicate studies and accurately compare results from different experiments.

  9. Occurrence and function of yeasts in Asian indigenous fermented foods.

    Science.gov (United States)

    Aidoo, Kofi E; Nout, M J Rob; Sarkar, Prabir K

    2006-01-01

    In the Asian region, indigenous fermented foods are important in daily life. In many of these foods, yeasts are predominant and functional during the fermentation. The diversity of foods in which yeasts predominate ranges from leavened bread-like products such as nan and idli, to alcoholic beverages such as rice and palm wines, and condiments such as papads and soy sauce. Although several products are obtained by natural fermentation, the use of traditional starter cultures is widespread. This minireview focuses on the diversity and functionality of yeasts in these products, and on opportunities for research and development.

  10. Transcription reactions of yeast RNA polymerase II in vitro

    Institute of Scientific and Technical Information of China (English)

    赵宇; 敖世洲

    1995-01-01

    The transcription reactions in vitro of yeast ADHl and PHO5 gene promoters are investigated by means of a yeast crude nuclear extract. Using specific RNA probes, the transcription products of these 2 promoters have been first obtained. A low concentration of α-amanitin is highly inhibitory. The transcription of the PHO5 gene was initiated in vitro at or near the sites used in vim. The transcription products increase with the amount of the template and reach the maximum at certain concentrations of the template. The deletion of the yeast promoter sequences abolishes the reaction.

  11. Construction of a large synthetic human Fab antibody library on yeast cell surface by optimized yeast mating.

    Science.gov (United States)

    Baek, Du-San; Kim, Yong-Sung

    2014-03-28

    Yeast surface-displayed antibody libraries provide an efficient and quantitative screening resource for given antigens, but suffer from typically modest library sizes owing to low yeast transformation efficiency. Yeast mating is an attractive method for overcoming the limit of yeast transformation to construct a large, combinatorial antibody library, but the optimal conditions have not been reported. Here, we report a large synthetic human Fab (antigen binding fragment) yeast surface-displayed library generated by stepwise optimization of yeast mating conditions. We first constructed HC (heavy chain) and LC (light chain) libraries, where all of the six CDRs (complementarity-determining regions) of the variable domains were diversified mimicking the human germline antibody repertoires by degenerate codons, onto single frameworks of VH3-23 and Vkappa1-16 germline sequences, in two haploid cells of opposite mating types. Yeast mating conditions were optimized in the order of cell density, media pH, and cell growth phase, yielding a mating efficiency of ~58% between the two haploid cells carrying HC and LC libraries. We constructed two combinatorial Fab libraries with CDR-H3 of 9 or 11 residues in length with colony diversities of more than 10(9) by one round of yeast mating between the two haploid HC and LC libraries, with modest diversity sizes of ~10(7). The synthetic human Fab yeast-displayed libraries exhibited relative amino acid compositions in each position of the six CDRs that were very similar to those of the designed repertoires, suggesting that they are a promising source for human Fab antibody screening.

  12. Oxygen Consumption by Postfermentation Wine Yeast Lees: Factors Affecting Its Rate and Extent under Oenological Conditions

    OpenAIRE

    Schneider, Volker; Müller, Jonas; Schmidt, Dominik

    2016-01-01

    Postfermentation wine yeast lees show antioxidant properties based on their ability to consume dissolved oxygen. The oxygen consumption capacity of suspended yeast lees obtained after fermentations with six commercial active dry yeast strains was investigated in model, white and red wines using fluorescence-based oxygen sensors operating in a nondestructive way. In model solution, the oxygen consumption rate of yeast lees was shown to depend on their amount, yeast strain, sulfur dioxide and t...

  13. 21 CFR 172.898 - Bakers yeast glycan.

    Science.gov (United States)

    2010-04-01

    ...) Less than 10,000 organisms/gram by aerobic plate count. (2) Less than 10 yeasts and molds/gram. (3... used or intended for use in the following foods when standards of identity established under...

  14. Dissecting principles governing actin assembly using yeast extracts.

    Science.gov (United States)

    Michelot, Alphée; Drubin, David G

    2014-01-01

    In this chapter, we describe recent protocols that we have developed to trigger actin assembly and actin-based motility in yeast cell extracts. Our method allows for the fast preparation of yeast extracts that are competent in dynamic assembly of distinct actin filament structures of biologically appropriate protein composition. Compared to previous extract-based systems using other eukaryotic cell types, yeast provides a unique advantage for combining reconstituted assays with the preparation of extracts from genetically modified yeast strains. We present a global strategy for dissecting the functions of individual proteins, where the activities of the proteins are analyzed in systems of variable complexity, ranging from simple mixtures of pure proteins to the full complexity of a cell's cytoplasm.

  15. A contribution to the knowledge of yeasts in Olsztyn lakes

    Directory of Open Access Journals (Sweden)

    Maria Dynowska

    2014-08-01

    Full Text Available Yeasts species have been analysed from Skanda and Kartowo Lakes. Their presence reflects poor sanitary stale of the lakes, with Skanda Lake particulary affected by the process of eutrophication.

  16. RAPD analysis : a rapid technique for differentation of spoilage yeasts

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Vossen, J.M.B.M. van der; Hofstra, H.; Huis in 't Veld, J.H.J.

    1994-01-01

    Techniques for the identification of the spoilage yeasts Saccharomyces cerevisiae and members of the Zygosaccharomyces genus from food and beverages sources were evaluated. The use of identification systems based on physiological characteristics resulted often in incomplete identification or misiden

  17. Biodiversity of brewery yeast strains and their fermentative activities.

    Science.gov (United States)

    Berlowska, Joanna; Kregiel, Dorota; Rajkowska, Katarzyna

    2015-01-01

    We investigated the genetic, biochemical, fermentative and physiological characteristics of brewery yeast strains and performed a hierarchical cluster analysis to evaluate their similarity. We used five different ale and lager yeast strains, originating from different European breweries and deposited at the National Collection of Yeast Cultures (UK). Ale and lager strains exhibited different genomic properties, but their assimilation profiles and pyruvate decarboxylase activities corresponded to their species classifications. The activity of another enzyme, succinate dehydrogenase, varied between different brewing strains. Our results confirmed that ATP and glycogen content, and the activity of the key metabolic enzymes succinate dehydrogenase and pyruvate decarboxylase, may be good general indicators of cell viability. However, the genetic properties, physiology and fermentation capacity of different brewery yeasts are unique to individual strains.

  18. Domestication and Divergence of Saccharomyces cerevisiae Beer Yeasts.

    Science.gov (United States)

    Gallone, Brigida; Steensels, Jan; Prahl, Troels; Soriaga, Leah; Saels, Veerle; Herrera-Malaver, Beatriz; Merlevede, Adriaan; Roncoroni, Miguel; Voordeckers, Karin; Miraglia, Loren; Teiling, Clotilde; Steffy, Brian; Taylor, Maryann; Schwartz, Ariel; Richardson, Toby; White, Christopher; Baele, Guy; Maere, Steven; Verstrepen, Kevin J

    2016-09-01

    Whereas domestication of livestock, pets, and crops is well documented, it is still unclear to what extent microbes associated with the production of food have also undergone human selection and where the plethora of industrial strains originates from. Here, we present the genomes and phenomes of 157 industrial Saccharomyces cerevisiae yeasts. Our analyses reveal that today's industrial yeasts can be divided into five sublineages that are genetically and phenotypically separated from wild strains and originate from only a few ancestors through complex patterns of domestication and local divergence. Large-scale phenotyping and genome analysis further show strong industry-specific selection for stress tolerance, sugar utilization, and flavor production, while the sexual cycle and other phenotypes related to survival in nature show decay, particularly in beer yeasts. Together, these results shed light on the origins, evolutionary history, and phenotypic diversity of industrial yeasts and provide a resource for further selection of superior strains. PAPERCLIP.

  19. Black yeast-like fungi in skin and nail

    DEFF Research Database (Denmark)

    Saunte, D M; Tarazooie, B; Arendrup, M C

    2011-01-01

    Black yeast-like fungi are rarely reported from superficial infections. We noticed a consistent prevalence of these organisms as single isolations from mycological routine specimens. To investigate the prevalence of black yeast-like fungi in skin, hair and nail specimens and to discuss the probab......Black yeast-like fungi are rarely reported from superficial infections. We noticed a consistent prevalence of these organisms as single isolations from mycological routine specimens. To investigate the prevalence of black yeast-like fungi in skin, hair and nail specimens and to discuss...... prevalent species were Phialophora europaea (n = 29), Coniosporium epidermidis (n = 12), Ochroconis cf. humicola (n = 6) and Cladophialophora boppii (n = 4). These are not common saprobes and thus less likely to be coincidental colonizers. In 10/30 cases, discolouration of nail/skin had been noticed...

  20. Production of biopharmaceutical proteins by yeast: Advances through metabolic engineering

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2013-01-01

    Production of recombinant proteins for use as pharmaceuticals, so-called biopharmaceuticals, is a multi-billion dollar industry. Many different cell factories are used for the production of biopharmaceuticals, but the yeast Saccharomyces cerevisiae is an important cell factory as it is used...... for production of several large volume products. Insulin and insulin analogs are by far the dominating biopharmaceuticals produced by yeast, and this will increase as the global insulin market is expected to grow from USD12B in 2011 to more than USD32B by 2018. Other important biopharmaceuticals produced...... by yeast are human serum albumin, hepatitis vaccines and virus like particles used for vaccination against human papillomavirus. Here is given a brief overview of biopharmaceutical production by yeast and it is discussed how the secretory pathway can be engineered to ensure more efficient protein...

  1. [Overexpression of FKS1 to improve yeast autolysis-stress].

    Science.gov (United States)

    Li, Jia; Wang, Jinjing; Li, Qi

    2015-09-01

    With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing.

  2. Opportunistic yeast infections: candidiasis, cryptococcosis, trichosporonosis and geotrichosis.

    Science.gov (United States)

    Vázquez-González, Denisse; Perusquía-Ortiz, Ana María; Hundeiker, Max; Bonifaz, Alexandro

    2013-05-01

    Opportunistic yeast infections are diseases caused by fungi which normally are saprophytic and do not cause disease in humans or animals. The prevalence of these diseases has been increasing due to immunosuppressive, corticosteroid, and long-term antibiotic treatment following organ transplantation or after serious metabolic, hematological, or immunological diseases. We review epidemiological, clinical, diagnostic, and therapeutic aspects of the four "big" opportunistic yeast infections: candidiasis, cryptococcosis, trichosporonosis, and geotrichosis.

  3. [Studies on the assimilation of inorganic selenium by yeast].

    Science.gov (United States)

    Xie, L; Ouyang, Z; Xie, X

    1990-02-01

    In the process of assimilation of inorganic selenium by yeast to the organic-selenium, some rules on the relation of the kinds of culture medium, concentration of sodium selenite and methionine to the total selenium and selenomethionine content in the yeast formed have been found; and a new, accurate procedure--modified acid hydrolysis-ion exchange chromatography for determining the content of seleno-amino acid in biological materials has been established.

  4. Occurrence and Diversity of Marine Yeasts in Antarctica Environments

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xue; HUA Mingxia; SONG Chunli; CHI Zhenming

    2012-01-01

    A total of 28 yeast strains were obtained from the sea sediment of Antarctica.According to the results of routine identification and molecular characterization,the strains belonged to species of Yarrowia lipolytica,Debaryomyces hansenii,Rhodotorula slooffiae,Rhodotorula mucilaginosa,Sporidiobolus salmonicolor,Aureobasidium pullulans,Mrakia frigida and Guehomyces pullulans,respectively.The Antarctica yeasts have wide potential applications in biotechnology,for some of them can produce β-galactosidase and killer toxins.

  5. Exon structure requirements for yeast tRNA ligase

    Institute of Scientific and Technical Information of China (English)

    刘建华; 金由辛; 王德宝

    1997-01-01

    Different nucleotides were introduced into nucleotides 32, 37 and 38 of yeast tRNAphe precursors via oligonucleotide directed mutations. Pre-tRNAs were prepared using T7-transcription in vitro and spliced with the purified yeast tRNA endonuclease and tRNA ligase. It is demonstrated that tRNA ligase activities will be inhibited by the 5’-double-stranded end of 3’-halves.

  6. Prion Diseases of Yeast: Amyloid Structure and Biology

    OpenAIRE

    Reed B Wickner; Edskes, Herman K.; Kryndushkin, Dmitry; McGlinchey, Ryan; Bateman, David; Kelly, Amy

    2011-01-01

    Prion “variants” or “strains” are prions with the identical protein sequence, but different characteristics of the prion infection: e.g. different incubation period for scrapie strains or different phenotype intensity for yeast prion variants. We have shown that infectious amyloids of the yeast prions [PSI+], [URE3] and [PIN+] each have an in-register parallel β-sheet architecture. Moreover, we have pointed out that this amyloid architecture can explain how one protein can faithfully transmit...

  7. Prevalence of Yeasts in English Full Blood Mares

    OpenAIRE

    Różański, Paweł; Ślaska, Brygida; Różańska, Dorota

    2013-01-01

    The aim of the study was a quantitative and qualitative analysis of microflora, presentation of current data about prevalence of the microflora on the skin and mucous membranes, and determination of its possible effect on reproduction of English full blood horses bred in Poland. The material for analyses was sampled from the skin and mucous membranes (385 samples) of 55 English full blood mares. Taking into account reproduction traits, the mares were classified into three groups. Six yeast-li...

  8. Bioprospection of yeasts as biocontrol agents against phytopathogenic molds

    Directory of Open Access Journals (Sweden)

    Márcia Maria Rosa-Magri

    2011-02-01

    Full Text Available Yeasts isolated from sugar cane and maize rhizosphere, leaves and stalks were screened against the phytopathogenic molds Colletotrichum sublineolum and Colletotrichum graminicola, both causal agents of the anthracnose disease in sorghum and maize, respectively. Strains identified as Torulaspora globosa and Candida intermedia were able to inhibit the mold growth, with the first species also exhibiting killer activity. No previous report on the application and potentiality of these yeasts as biocontrol agents were found neither the killer phenotype in Torulaspora globosa.

  9. Bioprospection of yeasts as biocontrol agents against phytopathogenic molds

    OpenAIRE

    Márcia Maria Rosa-Magri; Sâmia Maria Tauk-Tornisielo; Sandra Regina Ceccato-Antonini

    2011-01-01

    Yeasts isolated from sugar cane and maize rhizosphere, leaves and stalks were screened against the phytopathogenic molds Colletotrichum sublineolum and Colletotrichum graminicola, both causal agents of the anthracnose disease in sorghum and maize, respectively. Strains identified as Torulaspora globosa and Candida intermedia were able to inhibit the mold growth, with the first species also exhibiting killer activity. No previous report on the application and potentiality of these yeasts as bi...

  10. New insight into translation during yeast programmed cell death

    OpenAIRE

    Silva, Maria Alexandra Oliveira da

    2012-01-01

    Tese de doutoramento em Ciências da Saúde Global mRNA translation impairment has been described during the course of apoptosis in both mammalian and yeast. Nevertheless, the molecular pathways modulating translation during different scenarios of yeast apoptosis are still largely unexplored. Here we show by polysome profile analysis an impairment in capdependent translation initiation, correlated with alterations in translation machinery, such as the decrease in eIF4A levels ...

  11. Bacterial and yeast counts in Brazilian commodities and spices

    Directory of Open Access Journals (Sweden)

    Freire Francisco das Chagas Oliveira

    2002-01-01

    Full Text Available A total of thirteen genera of bacteria and two genera of yeasts were detected in surface sterilized and unsterilized Brazilian commodities and spices such as cashew kernels, Brazil nut kernels, black and white pepper. The genus Bacillus with eight species was by far the most common. The yeasts isolated were Pichia sp., P. guillermondii and Rhodotorula sp. Bacillus cereus, Salmonella typhimurium and Staphylococcus aureus were detected in cashew and Brazil nut kernels.

  12. Yeast expression proteomics by high-resolution mass spectrometry

    DEFF Research Database (Denmark)

    Walther, Tobias C; Olsen, Jesper Velgaard; Mann, Matthias

    2010-01-01

    -translational controls contribute majorly to regulation of protein abundance, for example in heat shock stress response. The development of new sample preparation methods, high-resolution mass spectrometry and novel bioinfomatic tools close this gap and allow the global quantitation of the yeast proteome under different...... conditions. Here, we provide background information on proteomics by mass-spectrometry and describe the practice of a comprehensive yeast proteome analysis....

  13. The influence of exogenous nutrients on the abundance of yeasts on the phylloplane of turfgrass.

    Science.gov (United States)

    Nix-Stohr, Shannon; Burpee, Leon L; Buck, James W

    2008-01-01

    Four experiments were conducted to assess the effect of foliar applications of various nutrient solutions on the phylloplane yeast community of tall fescue (Festuca arundinacea Schreb.). In the first three experiments, increasing concentrations of sucrose (2-16%), yeast extract (0.5-2.5%), and sucrose plus yeast extract (2.5-18.5% total) were applied and the yeast colony forming units (cfu) enumerated 14 h later by dilution plating. Significant positive linear relationships were observed between the number of yeast cfu and applications of both yeast extract and sucrose plus yeast extract. Foliar applications of sucrose alone had no significant effect on yeast community abundance, indicating that phylloplane yeasts of turfgrass are not limited by the amount or availability of carbohydrates. In the fourth experiment, five different solutions were applied to tall fescue to investigate the response of the yeast community to organic and inorganic nitrogen sources. Tryptone or yeast extract, both with considerable amino acid composition, significantly increased the yeast population, while yeast nitrogen base (with or without amino acids) and ammonium sulfate had no affect on yeast abundance. These results suggest that organic nitrogen stimulate yeast community growth and development on the phylloplane of tall fescue, while carbohydrates, inorganic nitrogen, and non-nitrogenous nutrients have little positive effect.

  14. Investigation of zinc biosorption by brewer's yeast cells

    Directory of Open Access Journals (Sweden)

    Dodić Siniša N.

    2005-01-01

    Full Text Available The highest amount of zinc (= 90% is bound after 3 hrs of contact at low initial (total concentrations of zinc in suspension of yeast, 10-100 mg/l at 10-30°C. The equilibrium between bound and free zinc ions is established after 6 hrs of contact time, independently on the total zinc concentration in yeast milk. No bigger changes of content of zinc bound to brewer's yeast cells was determined at temperatures 10°C and 30°C. 40% of bound zinc in the equilibrium state is bound during the first 15 min of contact of zinc ions and brewer's yeast cells at all initial (total zinc concentrations in suspension of yeast both at 10°C and 30°C. The "KEKAM" equation can be used for the description of kinetics of zinc biosorption by waste brewer's yeast cells, for the ranges of zinc concentration 10-100 mg/l at 30°C (mean correlation coefficient 0,96 and 60,0-100 mg/l at 10°C (mean correlation coefficient 0,95.

  15. The Fermentative and Aromatic Ability of Kloeckera and Hanseniaspora Yeasts

    Science.gov (United States)

    Díaz-Montaño, Dulce M.; de Jesús Ramírez Córdova, J.

    Spontaneous alcoholic fermentation from grape, agave and others musts into an alcoholic beverage is usually characterized by the presence of several non-Saccharomyces yeasts. These genera yeasts are dominant in the early stages of the alcoholic fermentation. However the genera Hanseniaspora and Kloeckera may survive at a significant level during fermentation and can influence the chemical composition of the beverage. Several strains belonging to the species Kloeckera api-culata and Hanseniaspora guilliermondii have been extensively studied in relation to the formation of some metabolic compounds affecting the bouquet of the final product. Indeed some apiculate yeast showed positive oenological properties and their use in the alcoholic fermentations has been suggested to enhance the aroma and flavor profiles. The non- Saccharomyces yeasts have the capability to produce and secrete enzymes in the medium, such as β -glucosidases, which release monoterpenes derived from their glycosylated form. These compounds contribute to the higher fruit-like characteristic of final product. This chapter reviews metabolic activity of Kloeckera and Hanseniaspora yeasts in several aspects: fermentative capability, aromatic compounds production and transformation of aromatic precursor present in the must, also covers the molecular methods for identifying of the yeast

  16. Association between Grape Yeast Communities and the Vineyard Ecosystems

    Science.gov (United States)

    Drumonde-Neves, João; Lima, Teresa; Schuller, Dorit; Pais, Célia

    2017-01-01

    The grape yeast biota from several wine-producing areas, with distinct soil types and grapevine training systems, was assessed on five islands of Azores Archipelago, and differences in yeast communities composition associated with the geographic origin of the grapes were explored. Fifty-seven grape samples belonging to the Vitis vinifera grapevine cultivars Verdelho dos Açores (Verdelho), Arinto da Terceira (Arinto) and Terrantez do Pico (Terrantez) were collected in two consecutive years and 40 spontaneous fermentations were achieved. A total of 1710 yeast isolates were obtained from freshly crushed grapes and 1200 from final stage of fermentations. Twenty-eight species were identified, Hanseniaspura uvarum, Pichia terricola and Metschnikowia pulcherrima being the three most representative species isolated. Candida carpophila was encountered for the first time as an inhabitant of grape or wine-associated environments. In both sampling years, a higher proportion of H. uvarum in fresh grapes from Verdelho cultivar was observed, in comparison with Arinto cultivar. Qualitatively significant differences were found among yeast communities from several locations on five islands of the Archipelago, particularly in locations with distinctive agro-ecological compositions. Our results are in agreement with the statement that grape-associated microbial biogeography is non-randomly associated with interactions of climate, soil, cultivar, and vine training systems in vineyard ecosystems. Our observations strongly support a possible linkage between grape yeast and wine typicality, reinforcing the statement that different viticultural terroirs harbor distinctive yeast biota, in particular in vineyards with very distinctive environmental conditions. PMID:28085916

  17. Determination of Yeasts Antimicrobial Activity in Milk and Meat Products

    Directory of Open Access Journals (Sweden)

    L.B. Roostita

    2011-12-01

    Full Text Available The research was arranged to isolate yeasts from livestock products and then the yeasts antimicrobial activity was tested towards putrefaction and pathogenic bacteria. Yeasts isolated from livestock products using Malt Extract Agar (MEA, the total yeasts population counted with using total plate count method, antimicrobial activity tested using diffusion methods against Pseudomonas aerugenes, Staphylococcus aureus and Escherichia coli and then the chosen isolate identified with using 18s RNA method. The results have shown that the total yeasts population on pasteurized cow’s milk were 1.2×106 cfu/g, fruit yoghurt 5.4×106 cfu/g, lamb meat 1×105 cfu/g, beef 1×105 cfu/g and beef sausages 1×106 cfu/g total yeasts population. Fruit yoghurt isolate shown the best antimicrobial activity with 35 mm clear zone diameter against Pseudomonas aerugenes, 8 mm clear zone diameter against Staphylococcus aureus and 10 mm clear zone diameter against Escherichia coli. The 18 s RNA test shown that fruit yoghurt isolate was 100% (FR3-F primer and 99% (FR3-R primer identical with Candida parapsilosis.

  18. Biochemical characterization and growth patterns of new yeast isolates.

    Science.gov (United States)

    Djegui, Kadjogbé Y; Gachomo, Emma W; Hounhouigan, Djidjoho J; Kayodé, Adéchola P P; Kotchoni, Simeon O

    2014-08-01

    African sorghum opaque beers play a vital role in the diet of millions of consumers. In the current study we investigated the growth profiles of yeast strains isolated from kpete-kpete, a traditional starter used to produce tchoukoutou, an opaque sorghum beer in Benin. 10 yeast strains were isolated from sorghum beer starters and cultivated under both liquid and solid media for phenotypic growth characterization. All yeast isolates were able to grow both on solid and liquid media. Based on their growth profiles, the isolates were clustered into three groups: (i) the aggressive growth pattern (30%), (ii) the moderate growth pattern (50%), and (iii) the slow growth pattern (20%). Based on gene expression pattern, absorbance (A(600 nm)) and diameter of growth in both liquid and solid media respectively, yeast strains YK34, YK15 and YK48 were clustered in the first group, and referred to as the most aggressive growth strains, followed by group 2 (YK24, YK5, YK12, YK20, YK2) and group 3 (YK37, YK41). This growth pattern was confirmed by Invertase gene expression profiling of the yeasts showing group 1 with high level of Invertase gene expression followed by group 2 and group 3 respectively. Our results suggest that YK34, YK15 and YK48 and YK2 yeast strains constitute the best candidates in fermentation of sorghum beer production based on growth rate and assimilation of carbon and nitrogen sources.

  19. Production of intracellular enzymes by enzymatic treatment of yeast

    Energy Technology Data Exchange (ETDEWEB)

    Zomer, E.; Er-El, Z.; Rokem, J.S.

    1987-01-01

    Enzymatic extraction of intracellular enzymes from various yeasts by glucanase was investigated. Favourable conditions for lysis and release of intracellular enzymes were established. The effects of yeast concentration, growth phase of yeast, storage temperature and pretreatment of yeast were studied. The yeasts investigated can be divided into two groups. The first, Kluyveromyces lactis, Saccharomyces cerevisiae, Saccharomyces oviformis, Torulopsis glabrata, Hansenula polymorpha and local bakers' yeast, lysed relatively easily (70-80% of the cells), especially when cells from the logarithmic growth phase were treated. The second, Candida utilis and Candida vini, were more susceptible to lysis (40-50%) when cells were taken from the stationary phase. Release of two enzymes, glycerol kinase from Candida utilis grown on glycerol and formate dehydrogenase from Torulopsis glabrata grown on methanol was examined. The highest specific activities were obtained by incubating the cells with glucanase for 1.5 hours at 37 degrees C. Inactivation of the released enzyme was relatively low. After 12 hours of enzymatic treatment at 28 degrees C glycerol kinase maintained about 50%, and formate dehydrogenase over 80%, of the original activities. (Refs. 12).

  20. Psychrophilic yeasts in glacial environments of Alpine glaciers.

    Science.gov (United States)

    Turchetti, Benedetta; Buzzini, Pietro; Goretti, Marta; Branda, Eva; Diolaiuti, Guglielmina; D'Agata, Carlo; Smiraglia, Claudio; Vaughan-Martini, Ann

    2008-01-01

    The presence of psychrophilic yeasts in supra- and subglacial sediments, ice and meltwater collected from two glaciers of the Italian Alps (Forni and Sforzellina-Ortles-Cevedale group) was investigated. After incubation at 4 degrees C, subglacial sediments contained from 1.3 x 10(3) to 9.6 x 10(3) CFU of yeasts g(-1). The number of yeast cells in supraglacial sediments was c. 10-100-fold lower. A significant proportion of isolated yeasts exhibited one or more extracellular enzymatic activities (starch-degrading, lipolytic, esterolytic, proteolytic and pectinolytic activity) at 4 degrees C. Selected isolates were able to grow at 2 degrees C under laboratory-simulated in situ conditions. In all, 106 isolated yeasts were identified by MSP-PCR fingerprinting and 26S rRNA gene sequencing of the D1/D2 region as belonging to 10 species: Aureobasidium pullulans, Cryptococcus gilvescens (over 50% of the total), Cryptococcus terricolus, Mrakia gelida, Naganishia globosa, Rhodotorula glacialis, Rhodotorula psychrophenolica, Rhodotorula bacarum, Rhodotorula creatinivora and Rhodotorula laryngis. Four strains, all belonging to a new yeast species, yet to be described, were also isolated.

  1. Yeast diversity on grapes in two German wine growing regions.

    Science.gov (United States)

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-01

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples.

  2. Comparison of RapID Yeast Plus System with API 20C System for Identification of Common, New, and Emerging Yeast Pathogens

    OpenAIRE

    Espinel-Ingroff, A; Stockman, L.; Roberts, G.; Pincus, D; Pollack, J; Marler, J.

    1998-01-01

    The ability to identify yeast isolates by the new enzymatic RapID Yeast Plus System was compared to the ability to identify yeast isolates by the API 20C system. A total of 447 yeast isolates representing Blastoschizomyces capitatus, 17 Candida spp., 5 Cryptococcus spp., Geotrichum spp., 2 Hanseniaspora spp., Hansenula anomala, Hansenula wingei, 3 Rhodotorula spp., Saccharomyces cerevisiae, Sporobolomyces salmonicolor, Trichosporon beigelii, and 2 Prototheca spp. were evaluated. Also, five qu...

  3. Yeasts and yeast-like fungal contaminants of water used for domestic purposes in Jos, Nigeria

    Directory of Open Access Journals (Sweden)

    Grace Mebi Ayanbimpe

    2013-01-01

    Full Text Available Water used for domestic purposes is ideally required to be free from contaminants. Various contaminants have frequently affected the quality of such water. Water samples were obtained from 150 sources including 72 wells, 60 streams, 17 taps, and one borehole, randomly selected from five residential areas in Jos, Nigeria. Structured questionnaires and one-to- one interview was used to obtain information on features of location and use of facilities in each area. Eighty (53.3% water sources were contaminated, predominantly wells (70.8%. The locations (identified in code with the highest number of contaminated sources were AGO (60.0%, GBU (56.7% and FGD (56.7%. AGD and FGD also had the highest ratio of households to one water source (25:1. Eighty- two fungi were isolated, predominantly Candida tropicalis (23.2%, Candida lipolytica (10.9% and Rhodotorula sp (9.7%. Candida lipolytica was the highest (42.9% contaminant in tap water. Rhodotorula sp was found in all types of water sources sampled. Type of water source had a significant effect (P<0.05 on the presence of some fungi in the water. The residential area (Location had a significant effect on contamination of water sources by some yeasts. Water sources for domestic use in Jos are contaminated by yeasts and yeast-like fungi. Frequency of use, exposure of the facility to dirt, and contaminations of surroundings contribute to the occurrence of fungi in water sources and, by implication, the prevalence of fungal infections.

  4. In vitro antifungal activity of fluconazole and voriconazole against non-Candida yeasts and yeast-like fungi clinical isolates.

    Science.gov (United States)

    Mandras, Narcisa; Roana, Janira; Scalas, Daniela; Fucale, Giacomo; Allizond, Valeria; Banche, Giuliana; Barbui, Anna; Li Vigni, Nicolò; Newell, Vance A; Cuffini, Anna Maria; Tullio, Vivian

    2015-10-01

    The risk of opportunistic infections caused by non-Candida yeasts and yeast-like fungi is increasingly common, mainly in immunocompromised patients. Appropriate first-line therapy has not been defined and standardized, mainly due to the low number of cases reported. To improve empirical treatment guidelines, we describe the susceptibility profile to fluconazole and voriconazole of 176 non-Candida yeasts and yeast-like fungi collected from hospitals in Piedmont, North West Italy from January 2009 to December 2013. The results showed that most isolates are susceptible to voriconazole (94%), but less susceptible to fluconazole (78%), suggesting that voriconazole could be used as first-line therapy in infections caused by these fungi.

  5. Yeast Interacting Proteins Database: YLL049W, YMR294W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ant shows a reduced affinity for the alcian blue dye suggesting a decreased net negative charge of the cell ...surface Rows with this bait as bait (3) Rows with this bait as prey (1) YMR294W JNM1 Component of the yeast ... null mutant shows a reduced affinity for the alcian blue dye suggesting a decreased net negative charge of ...s with this bait as prey (1) Prey ORF YMR294W Prey gene name JNM1 Prey description Component of the ye

  6. Prevalence of candida and non-candida yeasts isolated from patients with yeast fungal infections in Tehran labs

    Directory of Open Access Journals (Sweden)

    Hashemi SJ

    2011-04-01

    Full Text Available "n 800x600 Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Background: Infections caused by opportunistic yeasts such as Candida species, Trichosporon, Rhodotorula and Saccharomyces have increased in immunocompromis-ed patients and their identification is crucial as intrinsic and acquired resistance of some yeast species to antifungal agents are on the rise. The aim of this study was to identify the organisms to the species level in order to suggest accurate and effective antifungal therapies."n"nMethods: In this study that carried out in Tehran, Iran in 2009, 200 patients with yeast infection were medically examined and clinical specimens were prepared for direct examination and culture on Sabouraud dextrose agar. Subsequently, the isolated yeast colonies were identified using various tests including culture on Corn Meal agar with Tween 80, CHROMagar Candida and casein agar. For the definite identification of organisms some biochemical tests were done based on carbohydrate assimilation by RapID Yeast Plus System kit, and, finally, a molecular method, PCR-RFLP, using Hpa II enzyme, was performed for the remaining unknown yeast species."n"nResults: A total of 211 yeast isolates were identified in 200 patients with yeast infections. The most frequent isolated yeasts were Candida albicans, 124 (58.77%, followed by Candida parapsilosis, 36 (17.06%, Candida tropicalis, 17 (8.06%, Candida glabrata, 13 (6.16%, Candida krusei, 8 (3.79%, Candida guilliermondii, 2 (0.96%, Trichosporon, 3 (1.14%, Rhodotorula, 1 (0.47%, Saccaromyces cerevisiae, 1 (0.47% and other

  7. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    OpenAIRE

    Machado,Kátia M.G.; Dácio R. Matheus; Bononi,Vera L. R.

    2005-01-01

    Remazol Brilliant Blue R (RBBR) dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%); 96 fungi showed a mycelia growth and decolorization activity stronger than the P. c...

  8. Computational Modeling of Lipid Metabolism in Yeast

    Directory of Open Access Journals (Sweden)

    Vera Schützhold

    2016-09-01

    Full Text Available Lipid metabolism is essential for all major cell functions and has recently gained increasing attention in research and health studies. However, mathematical modeling by means of classical approaches such as stoichiometric networks and ordinary differential equation systems has not yet provided satisfactory insights, due to the complexity of lipid metabolism characterized by many different species with only slight differences and by promiscuous multifunctional enzymes.Here, we present a object-oriented stochastic model approach as a way to cope with the complex lipid metabolic network. While all lipid species are treated objects in the model, they can be modified by the respective converting reactions based on reaction rules, a hybrid method that integrates benefits of agent-based and classical stochastic simulation. This approach allows to follow the dynamics of all lipid species with different fatty acids, different degrees of saturation and different headgroups over time and to analyze the effect of parameter changes, potential mutations in the catalyzing enzymes or provision of different precursors. Applied to yeast metabolism during one cell cycle period, we could analyze the distribution of all lipids to the various membranes in time-dependent manner.The presented approach allows to efficiently treat the complexity of cellular lipid metabolism and to derive conclusions on the time- and location-dependent distributions of lipid species and their properties such as saturation. It is widely applicable, easily extendable and will provide further insights in healthy and diseased states of cell metabolism.

  9. The Cell Biology of Fission Yeast Septation.

    Science.gov (United States)

    García Cortés, Juan C; Ramos, Mariona; Osumi, Masako; Pérez, Pilar; Ribas, Juan Carlos

    2016-09-01

    In animal cells, cytokinesis requires the formation of a cleavage furrow that divides the cell into two daughter cells. Furrow formation is achieved by constriction of an actomyosin ring that invaginates the plasma membrane. However, fungal cells contain a rigid extracellular cell wall surrounding the plasma membrane; thus, fungal cytokinesis also requires the formation of a special septum wall structure between the dividing cells. The septum biosynthesis must be strictly coordinated with the deposition of new plasma membrane material and actomyosin ring closure and must occur in such a way that no breach in the cell wall occurs at any time. Because of the high turgor pressure in the fungal cell, even a minor local defect might lead to cell lysis and death. Here we review our knowledge of the septum structure in the fission yeast Schizosaccharomyces pombe and of the recent advances in our understanding of the relationship between septum biosynthesis and actomyosin ring constriction and how the two collaborate to build a cross-walled septum able to support the high turgor pressure of the cell. In addition, we discuss the importance of the septum biosynthesis for the steady ingression of the cleavage furrow.

  10. A unified model for yeast transcript definition.

    Science.gov (United States)

    de Boer, Carl G; van Bakel, Harm; Tsui, Kyle; Li, Joyce; Morris, Quaid D; Nislow, Corey; Greenblatt, Jack F; Hughes, Timothy R

    2014-01-01

    Identifying genes in the genomic context is central to a cell's ability to interpret the genome. Yet, in general, the signals used to define eukaryotic genes are poorly described. Here, we derived simple classifiers that identify where transcription will initiate and terminate using nucleic acid sequence features detectable by the yeast cell, which we integrate into a Unified Model (UM) that models transcription as a whole. The cis-elements that denote where transcription initiates function primarily through nucleosome depletion, and, using a synthetic promoter system, we show that most of these elements are sufficient to initiate transcription in vivo. Hrp1 binding sites are the major characteristic of terminators; these binding sites are often clustered in terminator regions and can terminate transcription bidirectionally. The UM predicts global transcript structure by modeling transcription of the genome using a hidden Markov model whose emissions are the outputs of the initiation and termination classifiers. We validated the novel predictions of the UM with available RNA-seq data and tested it further by directly comparing the transcript structure predicted by the model to the transcription generated by the cell for synthetic DNA segments of random design. We show that the UM identifies transcription start sites more accurately than the initiation classifier alone, indicating that the relative arrangement of promoter and terminator elements influences their function. Our model presents a concrete description of how the cell defines transcript units, explains the existence of nongenic transcripts, and provides insight into genome evolution.

  11. Modular assembly of yeast cytochrome oxidase.

    Science.gov (United States)

    McStay, Gavin P; Su, Chen Hsien; Tzagoloff, Alexander

    2013-02-01

    Previous studies of yeast cytochrome oxidase (COX) biogenesis identified Cox1p, one of the three mitochondrially encoded core subunits, in two high-molecular weight complexes combined with regulatory/assembly factors essential for expression of this subunit. In the present study we use pulse-chase labeling experiments in conjunction with isolated mitochondria to identify new Cox1p intermediates and place them in an ordered pathway. Our results indicate that before its assimilation into COX, Cox1p transitions through five intermediates that are differentiated by their compositions of accessory factors and of two of the eight imported subunits. We propose a model of COX biogenesis in which Cox1p and the two other mitochondrial gene products, Cox2p and Cox3p, constitute independent assembly modules, each with its own complement of subunits. Unlike their bacterial counterparts, which are composed only of the individual core subunits, the final sequence in which the mitochondrial modules associate to form the holoenzyme may have been conserved during evolution.

  12. Mechanical feedback stabilizes budding yeast morphogenesis

    Science.gov (United States)

    Banavar, Samhita; Trogdon, Michael; Petzold, Linda; Campas, Otger

    Walled cells have the ability to remodel their shape while sustaining an internal turgor pressure that can reach values up to 10 atmospheres. This requires a tight and simultaneous regulation of cell wall assembly and mechanochemistry, but the underlying mechanisms by which this is achieved remain unclear. Using the growth of mating projections in budding yeast (S. cerevisiae) as a motivating example, we have developed a theoretical description that couples the mechanics of cell wall expansion and assembly via a mechanical feedback. In the absence of a mechanical feedback, cell morphogenesis is inherently unstable. The presence of a mechanical feedback stabilizes changes in cell shape and growth, and provides a mechanism to prevent cell lysis in a wide range of conditions. We solve for the dynamics of the system and obtain the different dynamical regimes. In particular, we show that several parameters affect the stability of growth, including the strength of mechanical feedback in the system. Finally, we compare our results to existing experimental data.

  13. Pulsatile dynamics in the yeast proteome.

    Science.gov (United States)

    Dalal, Chiraj K; Cai, Long; Lin, Yihan; Rahbar, Kasra; Elowitz, Michael B

    2014-09-22

    The activation of transcription factors in response to environmental conditions is fundamental to cellular regulation. Recent work has revealed that some transcription factors are activated in stochastic pulses of nuclear localization, rather than at a constant level, even in a constant environment [1-12]. In such cases, signals control the mean activity of the transcription factor by modulating the frequency, duration, or amplitude of these pulses. Although specific pulsatile transcription factors have been identified in diverse cell types, it has remained unclear how prevalent pulsing is within the cell, how variable pulsing behaviors are between genes, and whether pulsing is specific to transcriptional regulators or is employed more broadly. To address these issues, we performed a proteome-wide movie-based screen to systematically identify localization-based pulsing behaviors in Saccharomyces cerevisiae. The screen examined all genes in a previously developed fluorescent protein fusion library of 4,159 strains [13] in multiple media conditions. This approach revealed stochastic pulsing in ten proteins, all transcription factors. In each case, pulse dynamics were heterogeneous and unsynchronized among cells in clonal populations. Pulsing is the only dynamic localization behavior that we observed, and it tends to occur in pairs of paralogous and redundant proteins. Taken together, these results suggest that pulsatile dynamics play a pervasive role in yeast and may be similarly prevalent in other eukaryotic species.

  14. Electrochemical regulation of budding yeast polarity.

    Directory of Open Access Journals (Sweden)

    Armin Haupt

    2014-12-01

    Full Text Available Cells are naturally surrounded by organized electrical signals in the form of local ion fluxes, membrane potential, and electric fields (EFs at their surface. Although the contribution of electrochemical elements to cell polarity and migration is beginning to be appreciated, underlying mechanisms are not known. Here we show that an exogenous EF can orient cell polarization in budding yeast (Saccharomyces cerevisiae cells, directing the growth of mating projections towards sites of hyperpolarized membrane potential, while directing bud emergence in the opposite direction, towards sites of depolarized potential. Using an optogenetic approach, we demonstrate that a local change in membrane potential triggered by light is sufficient to direct cell polarization. Screens for mutants with altered EF responses identify genes involved in transducing electrochemical signals to the polarity machinery. Membrane potential, which is regulated by the potassium transporter Trk1p, is required for polarity orientation during mating and EF response. Membrane potential may regulate membrane charges through negatively charged phosphatidylserines (PSs, which act to position the Cdc42p-based polarity machinery. These studies thus define an electrochemical pathway that directs the orientation of cell polarization.

  15. Metals uptake by live yeast and heat-modified yeast residue

    Directory of Open Access Journals (Sweden)

    Geórgia Labuto

    2015-07-01

    Full Text Available This study evaluated the biosorption of Cd2+, Cr3+, Pb2+ and Cu2+ at pHs 3, 4, 5 and 6 for Saccharomyces cerevisiae both alive and biologically inactivated by different heating procedures (oven, autoclave or spray dry technique originated from alcohol industry. The material inactivated by autoclave (IA, at 120°C, 30 min had the best performance for metals uptake: 1.88 ± 0.07 (Cu2+, 2.22 ± 0.02 (Cr3+ and 1.57 ± 0.08 g kg-1 (Pb2+. For Cd2+; while the material inactivated by spray dry (RY presented the higher sorption capacity, 2.30 ± 0.08 g kg-1. The sorption studies showed that the biosorbent materials presented different sorption capacities and an ideal sorption pH. The sorption sites were investigated by potentiometric titration and FT-IR and showed that different heating processes used to inactivate biological samples produce materials with different characteristics and with a diverse sorption capacity due to modification of the available sorption sites. This suggests that inactivation by heating can be an alternative to improve the performance of biosorbents. The main sorption sites for each material were phenolic for live yeast (LY and carboxylic for yeast inactivated by heating in an autoclave (IA.

  16. Solving ethanol production problems with genetically modified yeast strains

    Directory of Open Access Journals (Sweden)

    A. Abreu-Cavalheiro

    2013-09-01

    Full Text Available The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.

  17. Mechanisms of uv mutagenesis in yeast and E. coli

    Energy Technology Data Exchange (ETDEWEB)

    Lawrence, C.; Christensen, R.; Christensen, J.R.; O' Brien, T.

    1983-01-01

    Experiments investigating ultraviolet light mutagenesis in either bakers' yeast, Saccharomyces cerevisiae, or E. coli have led to the following conclusions. First, cyclobutane pyrimidine dimers cause most mutations in both organisms; pyrimidine adducts, such as PyC, can account at best for only a small proportion. 86 percent of forward mutations induced at the E. coli lacI locus can be abolished by photoreactivation under conditions which do not alter the level of recA induction. About 75 percent of the forward mutations induced at the CAN1 locus of yeast could be removed by photoreactivation, a value that lies within the range observed previously for the reversion of CYC1 alleles (60 percent - 97 percent). Second, about 10 percent of the lacI forward mutations are untargeted, a smaller fraction than found previously for cycl-91 reversion in yeast. It is not yet clear whether the two species are really different in this respect, of whether the cycl-91 reversion site is a typical of the yeast genome at large. Third, analysis of reversion frequencies of 20 mutant alleles suggests that about 10 to 25 percent of all replication errors produced by mutagenic mechanisms in uv-irradiated yeast involve additions or deletions of base-pairs, indicating that error-prone repair does not just produce substitutions. Last, the REV1 locus in yeast is concerned with the induction of frameshift mutations at some, but not all, genetic sites, just as found previously for substitution mutations. The function of the REV3 gene is more widely, though not universally, required while the function of the RAD6 gene, like that of the recA locus in E. coli, appears to be necessary for all kinds of uv mutagenesis. E coli genes comparable to REV1 and REV3 have not yet been described; conversely, there does not yet appear to be a yeast equivalent of umuC.

  18. Analysis of Arabidopsis glutathione-transferases in yeast.

    Science.gov (United States)

    Krajewski, Matthias P; Kanawati, Basem; Fekete, Agnes; Kowalski, Natalie; Schmitt-Kopplin, Philippe; Grill, Erwin

    2013-07-01

    The genome of Arabidopsis thaliana encodes 54 functional glutathione transferases (GSTs), classified in seven clades. Although plant GSTs have been implicated in the detoxification of xenobiotics, such as herbicides, extensive redundancy within this large gene family impedes a functional analysis in planta. In this study, a GST-deficient yeast strain was established as a system for analyzing plant GSTs that allows screening for GST substrates and identifying substrate preferences within the plant GST family. To this end, five yeast genes encoding GSTs and GST-related proteins were simultaneously disrupted. The resulting yeast quintuple mutant showed a strongly reduced conjugation of the GST substrates 1-chloro-2,4-dinitrobenzene (CDNB) and 4-chloro-7-nitro-2,1,3-benzoxadiazole (NBD-Cl). Consistently, the quintuple mutant was hypersensitive to CDNB, and this phenotype was complemented by the inducible expression of Arabidopsis GSTs. The conjugating activity of the plant GSTs was assessed by in vitro enzymatic assays and via analysis of exposed yeast cells. The formation of glutathione adducts with dinitrobenzene was unequivocally verified by stable isotope labeling and subsequent accurate ultrahigh-resolution mass spectrometry (ICR-FTMS). Analysis of Arabidopsis GSTs encompassing six clades and 42 members demonstrated functional expression in yeast by using CDNB and NBD-Cl as model substrates. Subsequently, the established yeast system was explored for its potential to screen the Arabidopsis GST family for conjugation of the fungicide anilazine. Thirty Arabidopsis GSTs were identified that conferred increased levels of glutathionylated anilazine. Efficient anilazine conjugation was observed in the presence of the phi, tau, and theta clade GSTs including AtGSTF2, AtGSTF4, AtGSTF6, AtGSTF8, AtGSTF10, and AtGSTT2, none of which had previously been known to contribute to fungicide detoxification. ICR-FTMS analysis of yeast extracts allowed the simultaneous detection and

  19. Ochratoxin A in brewer's yeast used as food supplement.

    Science.gov (United States)

    Gottschalk, Christoph; Biermaier, Barbara; Gross, Madeleine; Schwaiger, Karin; Gareis, Manfred

    2016-02-01

    Brewer's yeasts are rich in vitamins of the B-group and contain other nutritive factors; therefore, they are recommended as valuable food supplements for people with special dietary requirements like pregnant women, children, and adolescents, or for people with high physical activity. Additionally, certain strains of brewer's yeast are known to be capable of adsorbing xenobiotics such as mycotoxins. Because of that, these yeasts are regarded as having positive effects in food, beverage, and feed technology. Their potential to bind mycotoxins such as ochratoxin A (OTA), however, can subsequently lead to a contamination of such brewer's yeasts used as food supplements. In the present study, we analyzed 46 samples of brewer's yeasts for the occurrence of OTA by HPLC with fluorescence detector (HPLC-FLD) and for confirmatory measurements by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Nearly 90% of the samples were contaminated with OTA, the levels ranging from the limit of detection (LOD, 0.01 μg/kg) to 4.2 μg/kg. The mean and median levels of contamination were 0.49 and 0.27 μg/kg, respectively. Based on these results, the additional weekly OTA exposure by regularly consuming such supplements was assessed. Depending on different subpopulations (adults, children) and levels of contamination used for calculation, the additional OTA intake via brewer's yeast products ranged from 9.3% (mean case) to 114% (worst case) of the published mean weekly OTA intake in Germany (adults 279.3 ng, children 195.3 ng). At present, maximum levels for OTA in nutritional supplements like brewer's yeast do not exist. Based on our results, however, it is recommended that producers of these dietary supplements should include mycotoxin analyses in ongoing and future self-monitoring programs and in product quality checks.

  20. Intermembrane space proteome of yeast mitochondria.

    Science.gov (United States)

    Vögtle, F-Nora; Burkhart, Julia M; Rao, Sanjana; Gerbeth, Carolin; Hinrichs, Jens; Martinou, Jean-Claude; Chacinska, Agnieszka; Sickmann, Albert; Zahedi, René P; Meisinger, Chris

    2012-12-01

    The intermembrane space (IMS) represents the smallest subcompartment of mitochondria. Nevertheless, it plays important roles in the transport and modification of proteins, lipids, and metal ions and in the regulation and assembly of the respiratory chain complexes. Moreover, it is involved in many redox processes and coordinates key steps in programmed cell death. A comprehensive profiling of IMS proteins has not been performed so far. We have established a method that uses the proapoptotic protein Bax to release IMS proteins from isolated mitochondria, and we profiled the protein composition of this compartment. Using stable isotope-labeled mitochondria from Saccharomyces cerevisiae, we were able to measure specific Bax-dependent protein release and distinguish between quantitatively released IMS proteins and the background efflux of matrix proteins. From the known 31 soluble IMS proteins, 29 proteins were reproducibly identified, corresponding to a coverage of >90%. In addition, we found 20 novel intermembrane space proteins, out of which 10 had not been localized to mitochondria before. Many of these novel IMS proteins have unknown functions or have been reported to play a role in redox regulation. We confirmed IMS localization for 15 proteins using in organello import, protease accessibility upon osmotic swelling, and Bax-release assays. Moreover, we identified two novel mitochondrial proteins, Ymr244c-a (Coa6) and Ybl107c (Mic23), as substrates of the MIA import pathway that have unusual cysteine motifs and found the protein phosphatase Ptc5 to be a novel substrate of the inner membrane protease (IMP). For Coa6 we discovered a role as a novel assembly factor of the cytochrome c oxidase complex. We present here the first and comprehensive proteome of IMS proteins of yeast mitochondria with 51 proteins in total. The IMS proteome will serve as a valuable source for further studies on the role of the IMS in cell life and death.

  1. Characterizing yeast promoters used in Kluyveromyces marxianus.

    Science.gov (United States)

    Yang, Chun; Hu, Shenglin; Zhu, Songli; Wang, Dongmei; Gao, Xiaolian; Hong, Jiong

    2015-10-01

    Fermentation at higher temperatures can potentially reduce the cooling cost in large-scale fermentation and reduce the contamination risk. Thus, the thermotolerant yeast, Kluyveromyces marxianus, which can grow and ferment at elevated temperatures, is a promising biotechnological tool for future applications. However, the promoters used in K. marxianus are not well characterized, especially at elevated temperatures, which is important in efficient metabolic pathway construction. In this study, six constitutive promoters (P(TDH3), P(PGK), and P(ADH1) from both Saccharomyces cerevisiae and K. marxianus) were evaluated in K. marxianus through the heterologous expression of the KlLAC4, GUSA, and SH BLE genes at various temperatures, with various carbon sources and oxygen conditions. The expression was evaluated at the transcription and protein level using real-time PCR and protein activity determination to eliminate the effect of heterologous protein stability. While the transcription of all the promoters decreased at higher temperatures, the order of their promoting strength at various temperatures with glucose as the carbon source was P(KmPGK) > P(KmTDH3) > P(ScPGK) > P(ScTDH3) > P(KmADH1) > P(ScADH1). When glycerol or xylose was supplied as the carbon source at 42 °C, the order of promoter strength was P(KmPGK) > P(ScPGK) > P(KmADH1) > P(ScADH1) > P(ScTDH3) > P(KmTDH3). The promoter activity of P TDH3 decreased significantly, while the promoter activity of both of the P(ADH1) promoters increased. Oxygen conditions had non-significant effect. The results of this study provide important information for fine-tuned pathway construction for the metabolic engineering of K. marxianus.

  2. Ethanol production using nuclear petite yeast mutants

    Energy Technology Data Exchange (ETDEWEB)

    Hutter, A.; Oliver, S.G. [Department of Biomolecular Sciences, UMIST, Manchester (United Kingdom)

    1998-12-31

    Two respiratory-deficient nuclear petites, FY23{Delta}pet191 and FY23{Delta}cox5a, of the yeast Saccharomyces cerevisiae were generated using polymerase-chain-reaction-mediated gene disruption, and their respective ethanol tolerance and productivity assessed and compared to those of the parental grande, FY23WT, and a mitochondrial petite, FY23{rho}{sup 0}. Batch culture studies demonstrated that the parental strain was the most tolerant to exogenously added ethanol with an inhibition constant. K{sub i}, of 2.3% (w/v) and a specific rate of ethanol production, q{sub p}, of 0.90 g ethanol g dry cells{sup -1} h{sup -1}. FY23{rho}{sup 0} was the most sensitive to ethanol, exhibiting a K{sub i} of 1.71% (w/v) and q{sub p} of 0.87 g ethanol g dry cells{sup -1} h{sup -1}. Analyses of the ethanol tolerance of the nuclear petites demonstrate that functional mitochondria are essential for maintaining tolerance to the toxin with the 100% respiratory-deficient nuclear petite, FY23{Delta}pet191, having a K{sub i} of 2.14% (w/v) and the 85% respiratory-deficient FY23{Delta}cox5a, having a K{sub i} of 1.94% (w/v). The retention of ethanol tolerance in the nuclear petites as compared to that of FY23{rho}{sup 0} is mirrored by the ethanol productivities of these nuclear mutants, being respectively 43% and 30% higher than that of the respiratory-sufficient parent strain. This demonstrates that, because of their respiratory deficiency, the nuclear petites are not subject of the Pasteur effect and so exhibit higher rates of fermentation. (orig.)

  3. Ability of RapID Yeast Plus System to identify 304 clinically significant yeasts within 5 hours.

    Science.gov (United States)

    Kitch, T T; Jacobs, M R; McGinnis, M R; Appelbaum, P C

    1996-05-01

    The RapID Yeast Plus System (Innovative Diagnostic Systems, Norcross, Ga.) is a qualitative micromethod that uses conventional and chromogenic substrates for the identification of medically important yeasts. The ability of the RapID Yeast Plus system to accurately identify 304 clinical yeast isolates within 5 h was evaluated. The RapID Yeast Plus method correctly identified 286 (94.1%) of strains to the species level without the need for additional tests. A further 12 strains (3.9%) were classified as correct to the genus level or to a low-probability identification with two or more possibilities. In these latter cases, additional tests were required to delineate the correct identification. Organisms in the latter group comprised Candida parapsilosis (n = 1), Candida tropicalis (n = 1), Candida ciferrii (n = 1), Candida guilliermondii (n = 2), Candida humicola (n = 1), Candida kefyr (n = 1), Cryptococcus neoformans (n = 1), and Rhodotorula rubra (n = 4). Six strains (2.0%) were misidentified or did not yield codes in the manufacturer's database. These included one Candida utilis (identified as Candida famata/Candida guilliermondii), one Trichosporon beigelii (identified as Cryptococcus neoformans), one Candida diddensiae (identified as Candida albicans), one Candida membranaefaciens (identified as Candida parapsilosis), one Candida norvegensis (identified as Candida zeylanoides), and one Candida catenulata (no code) isolate; the last four strains are not included in the firm's current database. The RapID Yeast Plus system yielded excellent results and may be recommended for use in the routine laboratory for accurate same-day identification of clinically significant yeasts.

  4. Oxygen requirements of yeasts. [Saccharomyces cerevisiae; Candida tropicalis

    Energy Technology Data Exchange (ETDEWEB)

    Visser, W.; Scheffers, W.A.; Batenburg-Van Der Vegte, W.H.; Van Dijken, J.P. (Delft Univ. of Technology (Netherlands))

    1990-12-01

    Type species of 75 yeast genera were examined for their ability to grow anaerobically in complex and mineral media. To define anaerobic conditions, we added a redox indicator, resazurin, to the media to determine low redox potentials. All strains tested were capable of fermenting glucose to ethanol in oxygen-limited shake-flask cultures, even those of species generally regarded as nonfermentative. However, only 23% of the yeast species tested grew under anaerobic conditions. A comparative study with a number of selected strains revealed that Saccharomyces cerevisiae stands out as a yeast capable of rapid growth at low redox potentials. Other yeasts, such as Torulaspora delbrueckii and Candida tropicalis, grew poorly ({mu}{sub max}, 0.03 and 0.05 h{sup {minus}1}, respectively) under anaerobic conditions in mineral medium supplemented with Tween 80 and ergosterol. The latter organisms grew rapidly under oxygen limitation and then displayed a high rate of alcoholic fermentation. It can be concluded that these yeasts have hitherto-unidentified oxygen requirements for growth.

  5. Technological properties of bakers' yeasts in durum wheat semolina dough.

    Science.gov (United States)

    Giannone, Virgilio; Longo, Chiara; Damigella, Arcangelo; Raspagliesi, Domenico; Spina, Alfio; Palumbo, Massimo

    2010-04-01

    Properties of 13 Saccharomyces cerevisiae strains isolated from different sources (traditional sourdoughs, industrial baking yeasts etc.) were studied in dough produced with durum wheat (Sicilian semolina, variety Mongibello). Durum wheat semolina and durum wheat flour are products prepared from grain of durum wheat (Triticum durum Desf.) by grinding or milling processes in which the bran and germ are essentially removed and the remainder is comminuted to a suitable degree of fineness. Acidification and leavening properties of the dough were evaluated. Strains isolated from traditional sourdoughs (DSM PST18864, DSM PST18865 and DSM PST18866) showed higher leavening power, valuable after the first and second hours of fermentation, than commercial baking yeasts. In particular the strain DSM PST 18865 has also been successfully tested in bakery companies for the improvement of production processes. Baking and staling tests were carried out on five yeast strains to evaluate their fermentation ability directly and their resistance to the staling process. Amplified fragment length polymorphism (fAFLP) was used to investigate genetic variations in the yeast strains. This study showed an appreciable biodiversity in the microbial populations of both wild and commercial yeast strains.

  6. Systems Biology for Mapping Genotype-Phenotype Relations in Yeast

    KAUST Repository

    Nielsen, Jens

    2016-01-25

    The yeast Saccharomyces cerevisiae is widely used for production of fuels, chemicals, pharmaceuticals and materials. Through metabolic engineering of this yeast a number of novel new industrial processes have been developed over the last 10 years. Besides its wide industrial use, S. cerevisiae serves as an eukaryal model organism, and many systems biology tools have therefore been developed for this organism. Among these genome-scale metabolic models have shown to be most successful as they easy integrate with omics data and at the same time have been shown to have excellent predictive power. Despite our extensive knowledge of yeast metabolism and its regulation we are still facing challenges when we want to engineer complex traits, such as improved tolerance to toxic metabolites like butanol and elevated temperatures or when we want to engineer the highly complex protein secretory pathway. In this presentation it will be demonstrated how we can combine directed evolution with systems biology analysis to identify novel targets for rational design-build-test of yeast strains that have improved phenotypic properties. In this lecture an overview of systems biology of yeast will be presented together with examples of how genome-scale metabolic modeling can be used for prediction of cellular growth at different conditions. Examples will also be given on how adaptive laboratory evolution can be used for identifying targets for improving tolerance towards butanol, increased temperature and low pH and for improving secretion of heterologous proteins.

  7. Immobilized yeast bioreactor systems for continuous beer fermentation

    Science.gov (United States)

    Tata; Bower; Bromberg; Duncombe; Fehring; Lau; Ryder; Stassi

    1999-01-01

    Two different types of immobilized yeast bioreactors were examined for continuous fermentation of high-gravity worts. One of these is a fluidized bed reactor (FBR) that employs porous glass beads for yeast immobilization. The second system is a loop reactor containing a porous silicon carbide cartridge (SCCR) for immobilizing the yeast cells. Although there was some residual fermentable sugar in the SCCR system product, nearly complete attenuation of the wort sugars was achieved in either of the systems when operated as a two-stage process. Fermentation could be completed in these systems in only half the time required for a conventional batch process. Both the systems showed similar kinetics of extract consumption, and therefore similar volumetric productivity. As compared to the batch fermentation, total fusel alcohols were lower; total esters, while variable, were generally higher. The yeast biomass production was similar to that in a conventional fermentation process. As would be expected in an accelerated fermentation system, the levels of vicinal diketones (VDKs) were higher. To remove the VDKs, the young beer was heat-treated to convert the VDK precursors and processed through a packed bed immobilized yeast bioreactor for VDK assimilation. The finished product from the FBR system was found to be quite acceptable from a flavor perspective, albeit different from the product from a conventional batch process. Significantly shortened fermentation times demonstrate the feasibility of this technology for beer production.

  8. Performance of dairy females fed dried yeast from sugar cane

    Directory of Open Access Journals (Sweden)

    Marcia de Oliveira Franco

    2016-05-01

    Full Text Available This study was performed in order to evaluate the effect of dried yeast from sugar cane when replacing soybean meal in dairy heifers’ diets. Twenty-four heifers, with an initial body weight (BW of 178 kg, were distributed in a completely randomized design. The treatments were four levels of inclusion of dried yeast from sugar cane replacing to soybean meal (0, 33, 67 and 100% on a dry matter (DM basis. While there was no difference in DM, neutral detergent fiber (NDF, metabolizable energy or roughage intakes, the intakes of non-fiber carbohydrates and concentrate were increased. The crude protein intake decreased according to the dried yeast from sugar cane when replacing soybean meal. The digestibility coefficients of DM and NDF showed no difference. Replacement of soybean meal with dried yeast from sugar cane had no effect on performance, because average daily gain and body measurements studied were similar for all animals and inclusion levels. Soybean meal can be completely replaced with dried yeast from sugar cane in diets for growing dairy heifers without restrictions; this will not affect the intake, digestibility, physical development of animals or metabolization of protein compounds.

  9. Phenol degradation and heavy metal tolerance of Antarctic yeasts.

    Science.gov (United States)

    Fernández, Pablo Marcelo; Martorell, María Martha; Blaser, Mariana G; Ruberto, Lucas Adolfo Mauro; de Figueroa, Lucía Inés Castellanos; Mac Cormack, Walter Patricio

    2017-03-07

    In cold environments, biodegradation of organic pollutants and heavy metal bio-conversion requires the activity of cold-adapted or cold-tolerant microorganisms. In this work, the ability to utilize phenol, methanol and n-hexadecane as C source, the tolerance to different heavy metals and growth from 5 to 30 °C were evaluated in cold-adapted yeasts isolated from Antarctica. Fifty-nine percent of the yeasts were classified as psychrotolerant as they could grow in all the range of temperature tested, while the other 41% were classified as psychrophilic as they only grew below 25 °C. In the assimilation tests, 32, 78, and 13% of the yeasts could utilize phenol, n-hexadecane, and methanol as C source, respectively, but only 6% could assimilate the three C sources evaluated. In relation to heavy metals ions, 55, 68, and 80% were tolerant to 1 mM of Cr(VI), Cd(II), and Cu(II), respectively. Approximately a half of the isolates tolerated all of them. Most of the selected yeasts belong to genera previously reported as common for Antarctic soils, but several other genera were also isolated, which contribute to the knowledge of this cold environment mycodiversity. The tolerance to heavy metals of the phenol-degrading cold-adapted yeasts illustrated that the strains could be valuable as inoculant for cold wastewater treatment in extremely cold environments.

  10. Yeast prions: structure, biology, and prion-handling systems.

    Science.gov (United States)

    Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E

    2015-03-01

    A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants.

  11. Influence of sodium chloride on wine yeast fermentation performance

    Directory of Open Access Journals (Sweden)

    Stilianos Logothetis

    2010-06-01

    Full Text Available Stilianos Logothetis1, Elias T Nerantzis2, Anna Gioulioti3, Tasos Kanelis2, Tataridis Panagiotis2, Graeme Walker11University of Abertay Dundee, School of Contemporary Sciences, Dundee, Scotland; 2TEI of Athens Department of Oenology and Spirit Technology, Biotechnology and Industrial Fermentations Lab Agiou Spiridonos, Athens, Greece; 3Ampeloiniki SA Industrial Park Thermi, Thessaloniki, GreeceAbstract: This paper concerns research into the influence of salt (sodium chloride on growth, viability and fermentation performance in a winemaking strain of the yeast, Saccharomyces cerevisiae. Experimental fermentations were conducted in both laboratory-scale and industrial-scale experiments. Preculturing yeasts in elevated levels of sodium chloride, or salt “preconditioning” led to improved fermentation performance. This was manifest by preconditioned yeasts having an improved capability to ferment high-sugar containing media with increased cell viability and with elevated levels of produced ethanol. Salt-preconditioning most likely influenced the stress-tolerance of yeasts by inducing the synthesis of key metabolites such as trehalose and glycerol. These compounds may act to improve cells’ ability to withstand osmostress and ethanol toxicity during fermentations of grape must. Industrial-scale trials using salt-preconditioned yeasts verified the benefit of this novel physiological cell engineering approach to practical winemaking fermentations.Keywords: salt, preconditioning, fermentation performance, Saccharomyces cerevisiae, wine

  12. Yeast selection for fuel ethanol production in Brazil.

    Science.gov (United States)

    Basso, Luiz C; de Amorim, Henrique V; de Oliveira, Antonio J; Lopes, Mario L

    2008-11-01

    Brazil is one of the largest ethanol biofuel producers and exporters in the world and its production has increased steadily during the last three decades. The increasing efficiency of Brazilian ethanol plants has been evident due to the many technological contributions. As far as yeast is concerned, few publications are available regarding the industrial fermentation processes in Brazil. The present paper reports on a yeast selection program performed during the last 12 years aimed at selecting Saccharomyces cerevisiae strains suitable for fermentation of sugar cane substrates (cane juice and molasses) with cell recycle, as it is conducted in Brazilian bioethanol plants. As a result, some evidence is presented showing the positive impact of selected yeast strains in increasing ethanol yield and reducing production costs, due to their higher fermentation performance (high ethanol yield, reduced glycerol and foam formation, maintenance of high viability during recycling and very high implantation capability into industrial fermenters). Results also suggest that the great yeast biodiversity found in distillery environments could be an important source of strains. This is because during yeast cell recycling, selective pressure (an adaptive evolution) is imposed on cells, leading to strains with higher tolerance to the stressful conditions of the industrial fermentation.

  13. Cellular and molecular effects of yeast probiotics on cancer.

    Science.gov (United States)

    Saber, Amir; Alipour, Beitollah; Faghfoori, Zeinab; Yari Khosroushahi, Ahmad

    2017-02-01

    The cancer is one of the main causes of human deaths worldwide. The exact mechanisms of initiation and progression of malignancies are not clear yet, but there is a common agreement about the role of colonic microbiota in the etiology of different cancers. Probiotics have been examined for their anti-cancer effects, and different mechanisms have been suggested about their antitumor functions. Nonpathogenic yeasts, as members of probiotics family, can be effective on gut microbiota dysbiosis. Generally safe yeasts have shown so many beneficial effects on human health. Probiotic yeasts influence physiology, metabolism, and immune homeostasis in the colon and contribute to cancer treatment due to possessing anti-inflammatory, anti-proliferative and anti-cancer properties. This study reviews some of the health-beneficial effects of probiotic yeasts and their biological substances like folic acid and β-glucan on cancer and focuses on the possible cellular and molecular mechanisms of probiotic yeasts such as influencing pathogenic bacteria, inactivation of carcinogenic compounds, especially those derived from food, improvement of intestinal barrier function, modulation of immune responses, antitoxic function, apoptosis, and anti-proliferative effects.

  14. Yeasts in table olive processing: desirable or spoilage microorganisms?

    Science.gov (United States)

    Arroyo-López, F N; Romero-Gil, V; Bautista-Gallego, J; Rodríguez-Gómez, F; Jiménez-Díaz, R; García-García, P; Querol, A; Garrido-Fernández, A

    2012-11-01

    Yeasts are unicellular eukaryotic microorganisms isolated from many foods, and are commonly found in table olive processing where they can play a double role. On one hand, these microorganisms can produce spoilage of fruits due to the production of bad odours and flavours, the accumulation of CO(2) leading to swollen containers, the clouding of brines, the softening of fruits and the degradation of lactic acid, which is especially harmful during table olive storage and packaging. But on the other hand, fortunately, yeasts also possess desirable biochemical activities (lipase, esterase, β-glucosidase, catalase, production of killer factors, etc.) with important technological applications in this fermented vegetable. Recently, the probiotic potential of olive yeasts has begun to be evaluated because many species are able to resist the passage through the gastrointestinal tract and show beneficial effects on the host. In this way, yeasts may improve consumers' health by decreasing cholesterol levels, inhibiting pathogens, degrading non assimilated compounds, producing antioxidants and vitamins, adhering to intestinal cells or by maintaining epithelial barrier integrity. Many yeast species, usually also found in table olive processing, such as Wicherhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens and Kluyveromyces lactis, have been reported to exhibit some of these properties. Thus, the selection of the most appropriate strains to be used as starters, alone or in combination with lactic acid bacteria, is a promising research line to develop in a near future which might improve the added value of the commercialized product.

  15. Recent advances in yeast organelle and membrane proteomics.

    Science.gov (United States)

    Premsler, Thomas; Zahedi, René Peiman; Lewandrowski, Urs; Sickmann, Albert

    2009-10-01

    Yeast proteome research comprises two different aspects: with respect to systemic fungal infections (fungemias), invasive candidiasis, for instance by Candida albicans, is among the most common causes of morbidity and mortality particularly in the expanding population of immunocompromised patients, which rises a high medical and pharmaceutical interest in this facultative pathogenic organism. Apart from its clinical relevance, yeast research moreover provides an indispensable source of knowledge regarding fundamental biochemical processes of eukaryotic cells. In this context, the budding yeast Saccharomyces cerevisiae is, in addition to its multiple industrial applications, one of the most extensively used microorganisms and serves as the best understood eukaryotic model system so far. Consequently, numerous studies have focused on gaining insight into the yeast proteome, with protein MS providing a very efficient technology to cope with this task since it enables both protein identification and differential quantification of cellular material. In this review we present an overview of recent advances in yeast organelle and membrane proteomics focusing on the cell wall, plasma membrane, mitochondria and vacuole.

  16. The yeast Saccharomyces cerevisiae- the main character in beer brewing.

    Science.gov (United States)

    Lodolo, Elizabeth J; Kock, Johan L F; Axcell, Barry C; Brooks, Martin

    2008-11-01

    Historically, mankind and yeast developed a relationship that led to the discovery of fermented beverages. Numerous inventions have led to improved technologies and capabilities to optimize fermentation technology on an industrial scale. The role of brewing yeast in the beer-making process is reviewed and its importance as the main character is highlighted. On considering the various outcomes of functions in a brewery, it has been found that these functions are focused on supporting the supply of yeast requirements for fermentation and ultimately to maintain the integrity of the product. The functions/processes include: nutrient supply to the yeast (raw material supply for brewhouse wort production); utilities (supply of water, heat and cooling); quality assurance practices (hygiene practices, microbiological integrity measures and other specifications); plant automation (vessels, pipes, pumps, valves, sensors, stirrers and centrifuges); filtration and packaging (product preservation until consumption); distribution (consumer supply); and marketing (consumer awareness). Considering this value chain of beer production and the 'bottle neck' during production, the spotlight falls on fermentation, the age-old process where yeast transforms wort into beer.

  17. Isolation and identification of a riboflavin producer yeast from Nectarine

    Directory of Open Access Journals (Sweden)

    Roya Daneshazari

    2014-07-01

    Full Text Available   Introduction : Many microorganisms like fungi , bacteria and yeasts, have a natural ability to produce vitamins included vitamin B2 or riboflavin. In this regard, the present study was performed to isolation and screening for riboflavin producing yeasts from various sources of soil, leaf and fruit s.   Materials and method s: samples of leaf , soil and fruits were prepared for the presence of yeasts and by its ability to produce riboflavin . After purification and enrichment of samples , in order to assay riboflavin production, spectrometry , thin layer chromatography and high performance liquid chromatography were used . Finally, the best selected isolate was identified using conventional morphological , biochemical and molecular techniques .   Results : In this study , 26 yeast strains were isolated from environmental samples, that 6 isolates showed the ability to produce riboflavin . Identification results of the best selected isolate by biochemical and phenotypic characteristics revealed that this isolate is related to Clavispora lusitaniae and considering isolation of it from nectarine, has named it Clavispora lusitaniae strain N3 (Gene accession no: JQ586258 .   Discussion and conclusion : Although only one of the six producing strains was studied and identified , observation of ability to produce among 23% of strains showed necessity for further investigation. And according to the result of absence of viewing report about production by investigated strain, it can be said that Iran has potentiality for isolation of yeasts and is capable of producing riboflavin.

  18. Genome sequence of the lager brewing yeast, an interspecies hybrid.

    Science.gov (United States)

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-04-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production.

  19. DNA sequence analysis of newly formed telomeres in yeast.

    Science.gov (United States)

    Wang, S S; Pluta, A F; Zakian, V A

    1989-01-01

    A plasmid can be maintained in linear form in baker's yeast if it bears telomeric sequences at each end. Linear plasmids bearing cloned telomeric C4A4 repeats at one end (test end) and a natural DNA terminus with approximately 300 bps of C4A2 repeats at the other or control end were introduced by transformation into yeast. Test-end termini of 28 to 112 bps supported telomere formation. During telomere formation, C4A2 repeats were often transferred to test-end termini. To determine in greater detail the fate of test-end sequences on these plasmids after propagation in yeast, test-end telomeres were subcloned into E. coli and sequenced. DNA sequencing established a number of points about the molecular events involved in telomere formation in yeast. The results suggest that there are at least two mechanisms for telomere formation in yeast. One is mediated by a recombination event that requires neither a long stretch of homology nor the RAD52 gene product. The other mechanism is by addition of C1-3A repeats to the termini of linear DNA molecules. The telomeric sequence required to support C1-3A addition need not be at the very end of a molecule for telomere formation.

  20. Table wine from tropical fruits utilizing natural yeast isolates.

    Science.gov (United States)

    Baidya, Dipak; Chakraborty, Ivi; Saha, Jayanta

    2016-03-01

    An attempt was made to utilize few widely available tropical fruits to develop wine with the objective of comparing the fermentation efficiency (along with progress in fermentation) of two efficient yeast isolates with commercially available strain. Fruit wine from juices of fully ripe mango, jackfruit and pineapple alone and in blended combinations of all three fruit juice (2: 1: 2) was prepared using two different yeasts (Y4 and Y7) isolated from natural plain date palm juice and one standard Saccharomyces cerevisiae (MTCC-170) collected from IMTECH, Chandigar. Juices were extracted by using pectinase enzyme at 0.15-0.20 % of pulp. Changes in °Brix, titratable acid content, pH, total viable yeast count were recorded and rate of fermentation, sugar use efficiency were determined at every 24-hour interval up to the completion (6 days after inoculation) of fermentation. Considering all the quality parameter as well as fermentation efficiency, yeast isolate Y7 was found superior followed by Y4 as fermenting agent and pineapple juice as sole substrate found to be the most suitable medium for production of wine followed by fruit juice blending. In interpreting the efficacy of fruit and yeast in combination, pineapple juice inoculated with Y7 found to be the best in reducing the degree Brix to its lowest from initial 24 degree.