WorldWideScience

Sample records for carotenogenic basidiomycetous yeasts

  1. Fatty acid composition of cold-adapted carotenogenic basidiomycetous yeasts Composición de ácidos grasos de levaduras carotenogénicas

    Directory of Open Access Journals (Sweden)

    D. Libkind

    2008-12-01

    Full Text Available We studied fatty acids (FAs profiles in six carotenoid-producing yeast species isolated from temperate aquatic environments in Patagonia. Total FAs ranged from 2 to 15% of dry biomass. Linoleic, oleic, palmitic and α-linolenic acids were the major FAs constituents, which accounted for as much as 40%, 34%, 13% and 9% of total FAs, respectively. The proportion of each FA varied markedly depending on the taxonomic affiliation of the yeast species and on the culture media used. The high percentage of polyunsaturated fatty acids (PUFAs found in Patagonian yeasts, in comparison to other yeasts, is indicative of their cold-adapted metabolism. Our results suggest that Patagonian yeasts may be considered an interesting source of essential PUFAs.Se estudiaron los ácidos grasos de seis especies de levaduras productoras de carotenoides aisladas de ambientes acuáticos templados de la Patagonia. El contenido total de ácidos grasos fluctuó entre 2 y 15% de la biomasa seca. Los ácidos linoleico, oleico, palmítico y α-linolénico fueron los mayoritarios y contribuyeron en un 40%, 34%, 13% y 9% al total de ácidos grasos, respectivamente. La proporción de cada ácido graso varió de modo considerable según la filiación taxonómica de la especie y el medio de cultivo utilizado. El alto porcentaje de ácidos grasos poliinsaturados (PUFA observado en las levaduras patagónicas, en comparación con levaduras de otros orígenes, es indicativo de un metabolismo adaptado al frío. Nuestros resultados sugieren que las levaduras patagónicas pueden ser consideradas una fuente interesante de PUFA esenciales.

  2. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described.

  3. Production of volatile organic sulfur compounds (VOSCs) by basidiomycetous yeasts.

    Science.gov (United States)

    Buzzini, Pietro; Romano, Sergio; Turchetti, Benedetta; Vaughan, Ann; Pagnoni, Ugo Maria; Davoli, Paolo

    2005-02-01

    Thirty-seven basidiomycetous yeasts belonging to 30 species of seven genera were grown on media containing l-cysteine or l-methionine as sole nitrogen sources with the objective of evaluating volatile organic sulfur compound (VOSC) production. The headspace of yeast cultures was analyzed by the solid-phase microextraction (SPME) sampling method, and volatile compounds were quantified and identified by GC-MS techniques. Ten strains assimilating L-methionine produced the following VOSCs: 3-(methylthio)-1-propanol, methanethiol, S-methyl thioacetate, dimethyl disulfide, dimethyl trisulfide, allyl methyl sulphide and 4,5-dihydro-3(2H)-thiophenone. Production was amyl alcohol) and esters (ethyl acetate, ethyl propionate, n-propyl acetate, isobutyl acetate, n-propyl propionate, n-butyl acetate, isoamyl acetate, amyl acetate, isoamyl propionate, amyl propionate and 2-phenylmethyl acetate) were also sporadically produced. This is the first report of VOSCs production by basidiomycetous yeasts. Consequently, basidiomycetous yeasts may be considered an interesting new group of microbial VOSCs producers for the flavor industry.

  4. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  5. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  6. [A new species of psychrophilic basidiomycetes yeast Leucosporidium fasciculatum sp. Nov].

    Science.gov (United States)

    Bab'eva, I P; Lisichkina, G A

    2000-01-01

    A psychrophilic yeast with a basidiomycetous developmental cycle and properties corresponding to the genus Leucosporidium Fell et al. was isolated from the fruiting body of the edible spring mushroom Gyromitra esculenta Pers. picked near Moscow. However, the isolate differed from all Leucosporidium species described to date in a number of characteristics. The results of the study of the developmental cycle and of the cultural, morphological, physiological, and biochemical properties of the new isolate, strain KBP Y-3696, allow it to be assigned to a new species of the genus Leucosporidium.

  7. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  8. Identification of novel genes in the carotenogenic and oleaginous yeast Rhodotorula toruloides through genome-wide insertional mutagenesis.

    Science.gov (United States)

    Liu, Yanbin; Koh, Chong Mei John; Yap, Sihui Amy; Du, Minge; Hlaing, Mya Myintzu; Ji, Lianghui

    2018-02-21

    Rhodotorula toruloides is an outstanding producer of lipids and carotenoids. Currently, information on the key metabolic pathways and their molecular basis of regulation remains scarce, severely limiting efforts to engineer it as an industrial host. We have adapted Agrobacterium tumefaciens-mediated transformation (ATMT) as a gene-tagging tool for the identification of novel genes in R. toruloides. Multiple factors affecting transformation efficiency in several species in the Pucciniomycotina subphylum were optimized. The Agrobacterium transfer DNA (T-DNA) showed predominantly single-copy chromosomal integrations in R. toruloides, which were trackable by high efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR). To demonstrate the application of random T-DNA insertions for strain improvement and gene hunting, 3 T-DNA insertional libraries were screened against cerulenin, nile red and tetrazolium violet respectively, resulting in the identification of 22 mutants with obvious phenotypes in fatty acid or lipid metabolism. Similarly, 5 carotenoid biosynthetic mutants were obtained through visual screening of the transformants. To further validate the gene tagging strategy, one of the carotenoid production mutants, RAM5, was analyzed in detail. The mutant had a T-DNA inserted at the putative phytoene desaturase gene CAR1. Deletion of CAR1 by homologous recombination led to a phenotype similar to RAM5 and it could be genetically complemented by re-introduction of the wild-type CAR1 genome sequence. T-DNA insertional mutagenesis is an efficient forward genetic tool for gene discovery in R. toruloides and related oleaginous yeast species. It is also valuable for metabolic engineering in these hosts. Further analysis of the 27 mutants identified in this study should augment our knowledge of the lipid and carotenoid biosynthesis, which may be exploited for oil and isoprenoid metabolic engineering.

  9. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol.

  10. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    OpenAIRE

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2006-01-01

    Applied and Environmental Microbiology, Vol. 73, No.4 Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with ...

  11. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids

    OpenAIRE

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P.?antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P.?antarctica for industri...

  12. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-04-04

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications.

  13. Indole-3-acetic acid biosynthetic pathways in the basidiomycetous yeast Rhodosporidium paludigenum.

    Science.gov (United States)

    Nutaratat, Pumin; Srisuk, Nantana; Arunrattiyakorn, Panarat; Limtong, Savitree

    2016-07-01

    Microorganisms produce plant growth regulators, such as auxins, cytokinins and gibberellins, to promote plant growth. Auxins are a group of compounds with an indole ring that have a positive effect on plant growth. Indole-3-acetic acid (IAA) is a plant growth hormone classified as an indole derivative of the auxin family. IAA biosynthesis pathways have been reported and widely studied in several groups of bacteria. Only a few studies on IAA biosynthesis pathways have been conducted in yeast. This study aimed to investigate IAA biosynthesis pathways in a basidiomycetous yeast (Rhodosporidium paludigenum DMKU-RP301). Investigations were performed both with and without a tryptophan supplement. Indole compound intermediates were detected by gas chromatography-mass spectrometry. Indole-3-lactic acid and indole-3-ethanol were found as a result of the enzymatic reduction of indole-3-pyruvic acid and indole-3-acetaldehyde, in IAA biosynthesis via an indole-3-pyruvic acid pathway. In addition, we also found indole-3-pyruvic acid in culture supernatants determined by high-performance liquid chromatography. Identification of tryptophan aminotransferase activity supports indole-3-pyruvic acid-routed IAA biosynthesis in R. paludigenum DMKU-RP301. We hence concluded that R. paludigenum DMKU-RP301 produces IAA through an indole-3-pyruvic acid pathway.

  14. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs.

  15. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-06-27

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence.

  16. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids

    OpenAIRE

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence.

  17. Biogeography, Host Specificity, and Molecular Phylogeny of the Basidiomycetous Yeast Phaffia rhodozyma and Its Sexual Form, Xanthophyllomyces dendrorhous▿

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-01-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework. PMID:17189439

  18. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Libkind, Diego; Ruffini, Alejandra; van Broock, Maria; Alves, Leonor; Sampaio, José Paulo

    2007-02-01

    Phaffia rhodozyma (sexual form, Xanthophyllomyces dendrorhous) is a basidiomycetous yeast that has been found in tree exudates in the Northern Hemisphere at high altitudes and latitudes. This yeast produces astaxanthin, a carotenoid pigment with biotechnological importance because it is used in aquaculture for fish pigmentation. We isolated X. dendrorhous from the Southern Hemisphere (Patagonia, Argentina), where it was associated with fruiting bodies of Cyttaria hariotii, an ascomycetous parasite of Nothofagus trees. We compared internal transcribed spacer (ITS)-based phylogenies of P. rhodozyma and its tree host (Betulaceae, Corneaceae, Fagaceae, and Nothofagaceae) and found them to be generally concordant, suggesting that different yeast lineages colonize different trees and providing an explanation for the phylogenetic distance observed between the type strains of P. rhodozyma and X. dendrorhous. We hypothesize that the association of Xanthophyllomyces with Cyttaria derives from a previous association of the yeast with Nothofagus, and the sister relationship between Nothofagaceae and Betulaceae plus Fagaceae correlates with the phylogeny of X. dendrorhous strains originating from these three plant families. The two most basal strains of X. dendrorhous are those isolated from Cornus, an ancestral genus in the phylogenetic analysis of the host trees. Thus, we question previous conclusions that P. rhodozyma and X. dendrorhous represent different species since the polymorphisms detected in the ITS and intergenic spacer sequences can be attributed to intraspecific variation associated with host specificity. Our study provides a deeper understanding of Phaffia biogeography, ecology, and molecular phylogeny. Such knowledge is essential for the comprehension of many aspects of the biology of this organism and will facilitate the study of astaxanthin production within an evolutionary and ecological framework.

  19. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  20. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  1. Cryptococcus spencermartinsiae sp. nov., a basidiomycetous yeast isolated from glacial waters and apple fruits

    NARCIS (Netherlands)

    de Garcia, V.; Brizzio, S.; Russo, G.; Rosa, C.A.; Boekhout, T.; Theelen, B.J.F.; Libkind, D.; van Broock, M.

    2010-01-01

    Seven strains representing a novel yeast species belonging to the genus Cryptococcus were isolated from different substrates from Patagonia Argentina and The Netherlands. Three strains were isolates from a meltwater river draining from the Frias glacier at Mount Tronador situated in Nahuel Huapi

  2. Cryptococcus spencermartinsiae sp. nov., a basidiomycetous yeast isolated from glacial waters and apple fruits.

    Science.gov (United States)

    de García, Virginia; Brizzio, Silvia; Russo, Gabriel; Rosa, Carlos A; Boekhout, Teun; Theelen, Bart; Libkind, Diego; van Broock, María

    2010-03-01

    Seven strains representing a novel yeast species belonging to the genus Cryptococcus were isolated from different substrates from Patagonia, Argentina, and The Netherlands. Three strains were isolated from a meltwater river draining from the Frias glacier at Mount Tronador situated in Nahuel Huapi National Park (Patagonia) and four were isolated from apple surfaces in Randwijk, The Netherlands. Analysis of the D1/D2 large-subunit rRNA gene and ITS region sequences indicated that these strains represent a single species that is distinct from other species of the Tremellales clade. The name Cryptococcus spencermartinsiae sp. nov. is proposed to accommodate these strains. The type strain is CRUB 1230(T) (=CBS 10760(T) =DBVPG 8010(T)).

  3. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  4. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  5. Cryptococcus yokohamensis sp. nov., a basidiomycetous yeast isolated from trees and a Queensland koala kept in a Japanese zoological park.

    Science.gov (United States)

    Alshahni, Mohamed Mahdi; Makimura, Koichi; Satoh, Kazuo; Nishiyama, Yayoi; Kido, Nobuhide; Sawada, Takuo

    2011-12-01

    Three strains were isolated from the nostrils of a koala and the surrounding environment in a Japanese zoological park. Sequence analysis of the nuclear rDNA internal transcribed spacer (ITS) region and the large subunit rDNA D1/D2 domains in addition to physiological and morphological studies indicated that the isolates represent a single novel species belonging to the basidiomycetous genus Cryptococcus (Tremellales, Tremellomycetes, Agaricomycotina). Phylogenetic analysis based on D1/D2 and ITS regions revealed that the novel species belongs to the Fuciformis clade. The name Cryptococcus yokohamensis sp. nov. is proposed to accommodate these isolates with strain JCM 16989(T) (=TIMM 10001(T)=CBS 11776(T)=DSM 23671(T)) as the type strain.

  6. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. Copyright © 2010 John Wiley & Sons, Ltd.

  7. Enhanced production of a diastereomer type of mannosylerythritol lipid-B by the basidiomycetous yeast Pseudozyma tsukubaensis expressing lipase genes from Pseudozyma antarctica.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2017-12-01

    Basidiomycetous yeasts in the genus Pseudozyma are known to produce extracellular glycolipids called mannosylerythritol lipids (MELs). Pseudozyma tsukubaensis produces a large amount of MEL-B using olive oil as the sole carbon source (> 70 g/L production). The MEL-B produced by P. tsukubaensis is a diastereomer type of MEL-B, which consists of 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol as a sugar moiety, in contrast to the conventional type of MELs produced by P. antarctica, which contain 4-O-β-D mannopyranosyl-(2S,3R)-erythritol. In this study, we attempted to increase the production of the diastereomer type of MEL-B in P. tsukubaensis 1E5 by introducing the genes encoding two lipases, PaLIPAp (PaLIPA) and PaLIPBp (PaLIPB) from P. antarctica T-34. Strain 1E5 expressing PaLIPA exhibited higher lipase activity than the strain possessing an empty vector, which was used as a negative control. Strains of 1E5 expressing PaLIPA or PaLIPB showed 1.9- and 1.6-fold higher MEL-B production than the negative control strain, respectively, and oil consumption was also accelerated by the introduction of these lipase genes. MEL-B production was estimated using time course analysis in the recombinant strains. Strain 1E5 expressing PaLIPA produced 37.0 ± 1.2 g/L of MEL-B within 4 days of cultivation, whereas the strain expressing an empty vector produced 22.1 ± 7.5 g/L in this time. Overexpression of PaLIPA increased MEL-B production by P. tsukubaensis strain 1E5 from olive oil as carbon source by more than 1.7-fold.

  8. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants.

  9. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  10. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  11. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast.

  12. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs.

  13. [Antiviral properties of basidiomycetes metabolites].

    Science.gov (United States)

    Avtonomova, A V; Krasnopolskaya, L M

    2014-01-01

    The data on the antiviral action of the Ganoderma lucidum, Lentinus edodes, Grifola frondosa, Agaricus brasiliensis and other basidiomycetes metabolites are summurized. The metabolites of these species of basidiomycetes exhibit a direct antiviral effect on herpes simplex virus types I and II, human immunodeficiency virus (HIV), hepatitis B virus, vesicular stomatitis virus, influenza virus, Epstein-Barr virus, and others. Moreover, metabolites of basidiomycetes increased antiviral immunity.

  14. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  15. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M.D.

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  16. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  17. Genetic polymorphism in eight Chilean strains of the carotenogenic microalga Dunaliella salina Teodoresco (Chlorophyta

    Directory of Open Access Journals (Sweden)

    PATRICIA I GOMEZ

    2001-01-01

    Full Text Available Eight Chilean strains of Dunaliella salina obtained within a restricted geographic range, but exhibiting a high variability in their morphology, rate of growth and carotenogenic capacity, were analyzed by Random Amplified Polymorphic DNA (RAPD-PCR. Twenty of the 50 random primers (D, P, OPA and OPD series that were tested amplified reproducible bands and were useful for comparative analysis of the strains. Of 107 polymorphic genetic markers, 49 were strain-specific. A great genetic variability was found among the strains in spite of their geographic proximity. In addition, phenetic analysis of the data showed close agreement between the morpho-physiological attributes and the genetic diversity of the strains

  18. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  19. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  20. Screening of medicinal higher Basidiomycetes mushrooms from Turkey for lovastatin production.

    Science.gov (United States)

    Atli, Burcu; Yamac, Mustafa

    2012-01-01

    As a first attempt, a study was carried out to test for lovastatin production ability in local higher Basidiomycetes mushroom isolates from Turkey. An extended screening was performed for lovastatin production in yeast lactose agar medium, among a total of 136 macrofungi isolates from the Basidiomycetes Culture Collection of Eskisehir Osmangazi University. Lovastatin production was evaluated by disc diffusion method and was also confirmed by TLC and HPLC. Only six isolates were found to be lovastatin producers. The highest production of lovastatin was obtained from the extracts from Omphalotus olearius OBCC 2002 and Pleurotus ostreatus OBCC 1031. The lovastatin amount produced by commercial strains, Aspergillus terreus NRRL 255 (7.0 mg/L) and Penicillium citrinum NRRL 1841 (7.0 mg/L), was nearly comparable to the amount produced by Pleurotus ostreatus OBCC 1031 (5.8 mg/L) and Omphalotus olearius OBCC 2002 (4 mg/L).

  1. Identification of novel genes in the carotenogenic and oleaginous yeast Rhodotorula toruloides through genome-wide insertional mutagenesis

    OpenAIRE

    Liu, Yanbin; Koh, Chong Mei John; Yap, Sihui Amy; Du, Minge; Hlaing, Mya Myintzu; Ji, Lianghui

    2018-01-01

    Background Rhodotorula toruloides is an outstanding producer of lipids and carotenoids. Currently, information on the key metabolic pathways and their molecular basis of regulation remains scarce, severely limiting efforts to engineer it as an industrial host. Results We have adapted Agrobacterium tumefaciens-mediated transformation (ATMT) as a gene-tagging tool for the identification of novel genes in R. toruloides. Multiple factors affecting transformation efficiency in several species in t...

  2. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  3. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  4. Differential expression of carotenogenic genes, associated changes on astaxanthin production and photosynthesis features induced by JA in H. pluvialis.

    Directory of Open Access Journals (Sweden)

    Zhengquan Gao

    Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.

  5. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  6. CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.

    Science.gov (United States)

    Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria

    2018-01-01

    A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.

  7. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  8. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  9. ACTIVE PRODUCERS OF PEROXIDASE BASIDIOMYCETES STRAINS SCREENING

    Directory of Open Access Journals (Sweden)

    T. E. Voloshko

    2013-10-01

    Full Text Available The paper is devoted to the analysis of the research data peroxidase activity of the strains of xylotrophic basidiomycetes in the dynamics of the growth. The objects of study were 57 strains, 5 of which belongs to 5 species of the order Polyporales, and 52 of which belongs to 7 species of the order Agaricales. In order to search for active producers of peroxidase the strains were cultured by the surface method in a liquid glucosepeptone medium. The accumulation of oven-dry biomass was determined by the weight method. The content of soluble protein and peroxidase activity were determined by the spectrophotometry. The studies set the level of accumulation of oven-dry biomass and peroxidase activity of the strains in 9 and 12 days of growth. The results allowed selecting the strains, which are characterized by high levels of peroxidase activity in mycelium and in the culture filtrate, including Agrocybe cylindracea 167, Pleurotus ostreatus Р-кл, Agrocybe cylindracea 960 and 218. These strains which are active producers of peroxidase may be used in the enzyme preparations obtaining technology.

  10. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  11. Overwintering of vineyard yeasts: survival of interacting yeast communities in grapes mummified on vines

    Directory of Open Access Journals (Sweden)

    Matthias eSipiczki

    2016-02-01

    Full Text Available The conversion of grape must into wine involves the development and succession of yeast populations differing in species composition. The initial population is formed by vineyard strains which are washed into the must from the crushed grapes and then completed with yeasts coming from the cellar environment. As the origin and natural habitat of the vineyard yeasts are not fully understood, this study addresses the possibility that grape yeasts can be preserved in berries left behind on vines at harvest until the spring of the next year. These berries become mummified during the winter on the vines. To investigate whether yeasts can survive in these overwintering grapes, mummified berries were collected in 16 localities in the Tokaj wine region (Hungary-Slovakia in early March. The collected berries were rehydrated to recover viable yeasts by plating samples onto agar plates. For the detection of minority species which would not be detected by direct plating, an enrichment step repressing the propagation of alcohol-sensitive yeasts was also included in the process. The morphological, physiological and molecular analysis identified 13 basidiomycetous and 23 ascomycetous species including fermentative yeasts of wine-making relevance among the 3879 isolates. The presence of viable strains of these species demonstrates that the grapes mummified on the vine can serve as a safe reservoir of yeasts, and may contribute to the maintenance of grape-colonizing yeast populations in the vineyard over years, parallel with other vectors and habitats. All basidiomycetous species were known phylloplane yeasts. Three Hanseniaspora species and pigmented Metschnikowia strains were the most frequent ascomycetes. Other fermentative yeasts of wine-making relevance were detected only in the enrichment cultures. Saccharomyces (S. paradoxus, S. cerevisiae and S. uvarum were recovered from 13 % of the samples. No Candida zemplinina was found. The isolates with Aureobasidium

  12. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  13. Draft Genome Sequence of the Yeast Pseudozyma antarctica Type Strain JCM10317, a Producer of the Glycolipid Biosurfactants, Mannosylerythritol Lipids

    OpenAIRE

    Saika, Azusa; Koike, Hideaki; Hori, Tomoyuki; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai; Morita, Tomotake

    2014-01-01

    The basidiomycetous yeast Pseudozyma antarctica is known as a producer of industrial enzymes and the extracellular glycolipids, mannosylerythritol lipids. Here, we report the draft genome sequence of the type strain JCM10317. The draft genome assembly has a size of 18.1 Mb and a G+C content of 60.9%, and it consists of 197 scaffolds.

  14. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  15. Biosynthetic Machinery of Diterpene Pleuromutilin Isolated from Basidiomycete Fungi.

    Science.gov (United States)

    Yamane, Momoka; Minami, Atsushi; Liu, Chengwei; Ozaki, Taro; Takeuchi, Ichiro; Tsukagoshi, Tae; Tokiwano, Tetsuo; Gomi, Katsuya; Oikawa, Hideaki

    2017-12-05

    The diterpene pleuromutilin is a ribosome-targeting antibiotic isolated from basidiomycete fungi, such as Clitopilus pseudo-pinsitus. The functional characterization of all biosynthetic enzymes involved in pleuromutilin biosynthesis is reported and a biosynthetic pathway proposed. In vitro enzymatic reactions and mutational analysis revealed that a labdane-related diterpene synthase, Ple3, catalyzed two rounds of cyclization from geranylgeranyl diphosphate to premutilin possessing a characteristic 5-6-8-tricyclic carbon skeleton. Biotransformation experiments utilizing Aspergillus oryzae transformants possessing modification enzyme genes allowed the biosynthetic pathway from premutilin to pleuromutilin to be proposed. The present study sets the stage for the enzymatic synthesis of natural products isolated from basidiomycete fungi, which are a prolific source of structurally diverse and biologically active terpenoids. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Volatile organic components from fresh non-edible Basidiomycetes fungi.

    Science.gov (United States)

    Piovano, Marisa; Garbarino, Juan A; Sánchez, Elizabeth; Young, Manuel E

    2009-12-01

    The compounds responsible for the characteristic odor of eight fresh non-edible Basidiomycetes fungi were evaluated. The volatile organic compounds from the fresh samples present in the headspace of a sealed vial were determined by solid-phase microextraction gas chromatography-mass spectrometry, using a PDMS/DVB fiber. A total of twenty-eight components were identified, the most frequent being 1-octen-3-ol and 3-octanone.

  17. Antimicrobial activity of submerged cultures of Chilean basidiomycetes.

    Science.gov (United States)

    Aqueveque, Pedro; Anke, Timm; Saéz, Katia; Silva, Mario; Becerra, José

    2010-10-01

    This study is part of a screening program aimed at searching for bioactive metabolites from Chilean basidiomycetes. Submerged cultivation of fungal mycelia in liquid media was evaluated for antimicrobial activity. A total of 148 strains were obtained in vitro. The extracts produced from submerged cultures were evaluated against bacteria and fungi. In the primary antimicrobial assay, approximately 60% of the extracts presented positive biological activity. The highest frequencies of active strains were from the orders Agaricales (31.0%), Polyporales (20.6%), Sterales (18.3%), Boletales (11.4%), and Cortinariales (9.1%). Antifungal activity was more pronounced than antibacterial activity. Twelve extracts that exhibited strong antimicrobial activity showed minimum inhibitory concentration (MIC) values of 50 µL/mL against Bacillus brevis and 25∼50 µL/mL against Penicillium notatum and Paecilomyces variotii. The biological activity of some strains did not vary considerably, regardless of the substrate or collection site whereas, for others, it showed marked variations. Differences in antimicrobial activities observed in the different fungal genera suggested that the ability to produce bioactive compounds is not homogenously distributed among basidiomycetes. The information obtained from this study reveals that Chilean basidiomycetes are able to generate small and/or large variations in the normal pathway of compounds production. Thus, it is necessary to evaluate this biological and chemical wealth, which could be an unsuspected reservoir of new and potentially useful molecules. © Georg Thieme Verlag KG Stuttgart · New York.

  18. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively.

  19. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site.

  20. The yeast flora of some decaying mushrooms on trunks of living trees

    OpenAIRE

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

  1. Tremulane sesquiterpenes from cultures of the basidiomycete Irpex lacteus.

    Science.gov (United States)

    Ding, Jian-Hai; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2018-03-01

    Five new tremulane sesquiterpenes, named irlactins F-J (1-5), were isolated from cultures of the basidiomycete Irpex lacteus together with two known analogues (6 and 7). Structures and relative configurations of compounds 1-5 were elucidated by spectroscopic data analysis. Compund 4 exhibited moderate cytotoxicities on HL-60, SMMC-7721, A-549, MCF-7, and SW480 cells with IC 50 values of 16.23, 20.40, 25.55, 19.05, and 18.58μM, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. A minimal growth medium for the basidiomycetePleurotus sapidusfor metabolic flux analysis.

    Science.gov (United States)

    Fraatz, Marco A; Naeve, Stefanie; Hausherr, Vanessa; Zorn, Holger; Blank, Lars M

    2014-01-01

    Pleurotus sapidus secretes a huge enzymatic repertoire including hydrolytic and oxidative enzymes and is an example for higher basidiomycetes being interesting for biotechnology. The complex growth media used for submerged cultivation limit basic physiological analyses of this group of organisms. Using undefined growth media, only little insights into the operation of central carbon metabolism and biomass formation, i.e. , the interplay of catabolic and anabolic pathways, can be gained. The development of a chemically defined growth medium allowed rapid growth of P. sapidus in submerged cultures. As P. sapidus grew extremely slow in salt medium, the co-utilization of amino acids using 13 C-labelled glucose was investigated by gas chromatography-mass spectrometry (GC-MS) analysis. While some amino acids were synthesized up to 90% in vivo from glucose ( e.g., alanine), asparagine and/or aspartate were predominantly taken up from the medium. With this information in hand, a defined yeast free salt medium containing aspartate and ammonium nitrate as a nitrogen source was developed. The observed growth rates of P. sapidus were well comparable with those previously published for complex media. Importantly, fast growth could be observed for 4 days at least, up to cell wet weights (CWW) of 400 g L -1 . The chemically defined medium was used to carry out a 13 C-based metabolic flux analysis, and the in vivo reactions rates in the central carbon metabolism of P. sapidus were investigated. The results revealed a highly respiratory metabolism with high fluxes through the pentose phosphate pathway and TCA cycle. The presented chemically defined growth medium enables researchers to study the metabolism of P. sapidus , significantly enlarging the analytical capabilities. Detailed studies on the production of extracellular enzymes and of secondary metabolites of P. sapidus may be designed based on the reported data.

  4. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  5. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM SCHIZOPHYLLUM COMMUNE

    Directory of Open Access Journals (Sweden)

    А.С. Бухало

    2012-10-01

    Full Text Available  The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes Schizophyllum commune in a surface and submerged culture. 21 strains of S. commune were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains on agar mediums were shown the following enzymes: amylase, caseinase, gelatinase, polygalacturonase, pectattranselyminase, urease, lipase, cellulase, laccase and peroxydase. The demonstration of oxidizing enzymes of laccase and peroxydase depended on composition of medium. The estimation of presence and level of activity of endo-1,4-b-glucanase, exoglucanase and monophenolmonooxygenase at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of strain 1760 S. commune.

  6. TOTAL ANTIOXIDANT ACTIVITY OF SOME BASIDIOMYCETES STRAINS IN GROWTH DYNAMIC

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2016-08-01

    Full Text Available The work is devoted to the study of total antioxidant activity (AOA in the growth dynamics of basidiomycetes strains in their periodic surface cultivation on glucose-peptone medium. Subjects of research are mycelium and culture filtrate (CF from 57 strains, 5 of which are belong to 5 types of Polyporales order, and 52 of which are belong to the 7 types of Agaricales order. In order to study the dynamics of growth used method for determining the weight of absolutely dry biomass accumulation (ADB. Total AOA of mycological material was evaluated by inhibition of lipid peroxidation products accumulation intensity in the model oxidation reaction of Tween-80 by air oxygen. It was found that the most productive in terms of the accumulation of ADB are strains F. velutipes F-610 and P. eryngii P-er. Lowest values of ADB accumulation recorded for strains P. ostreatus P-14 and P-192 and P. citrinopileatus P sіtr. Were selected the most productive strains of Basidiomycetes for the level of total AOA in mycelium and CF. There are strains P. eryngii P-er, P. citrinopileatus P sіtr, P. ostreatus P-035, F. hepatica Fh-08, A. cylindracea 960, P. ostreatus P-081, P-082, P-087, P. citrinopileatus P sіtr. Has not been established the dependence between the growth and the antioxidant activity of the 9- and 12-day fungal cultures. Selected producers of natural antioxidants may be used as biological agents in biotechnology.

  7. Draft Genome Sequence of the Yeast Pseudozyma antarctica Type Strain JCM10317, a Producer of the Glycolipid Biosurfactants, Mannosylerythritol Lipids.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Hori, Tomoyuki; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai; Morita, Tomotake

    2014-09-25

    The basidiomycetous yeast Pseudozyma antarctica is known as a producer of industrial enzymes and the extracellular glycolipids, mannosylerythritol lipids. Here, we report the draft genome sequence of the type strain JCM10317. The draft genome assembly has a size of 18.1 Mb and a G+C content of 60.9%, and it consists of 197 scaffolds. Copyright © 2014 Saika et al.

  8. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  9. Biotransformation of coal derived humic acids by Basidiomycetes

    Science.gov (United States)

    Klein, O. I.; Kulikova, N. A.; Stepanova, E. V.; Koroleva, O. V.

    2009-04-01

    Introduction Low energetic coals and wastes of coal industry are promising sources for biologically active compounds including humic acids (HA). Aside from evident advantages of biocatalytic approaches for coal slime conversion such as environmental safety and cost efficiency they also could be used for the improving of HAs biological activity [1, 2]. The aim of the present study was to provide molecular characterization of the HAs formed during biotransformation of coal slime by Basidiomycetes under different cultivation conditions. Materials and methods Biotransformation of brown coal from Solncevskoe deposit (Sakhalin, Russia) was performed by liquid surface cultivation of pure culture Coriolus hirsutus 075 (Wulf. Ex. Fr.) Quel. with rich (contained glucose as a carbon source) and poor (without readily available carbon source) nutrition medium. After 30 days of cultivation coal HAs were separated by alkaline extraction followed by dialysis desalting and drying at 50C. HAs derived were characterized using size-exclusion chromatography, Fourier transformed infrared (FTIR) and 13C NMR spectroscopy. Results and discussion Molecular weight distribution of HA was not significantly affected by Basidiomycetes under all cultivation conditions studied in comparison to HAs extracted from non-conversed coal. FTIR spectra of HA obtained were typical for HAs. Biotransformation of coal did not result in appearance of new functional groups. The exception was observed under rich media conditions where absorbance at 1700 cm-1 was determined related to carbonyl groups of carboxyl and ketonic fragments. Therefore, the revealed phenomena could be explained with additional formation of the above carbonyl groups in the course of biotransformation process. Quantification of 13C NMR spectra revealed decrease of aromatic structures in HA extracted from coal after biotransformation under poor media conditions. Also a significant increase in carboxylic fragments content was observed. So

  10. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  11. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  12. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  13. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  14. COMPARATIVE CHARACTERISTICS OF BASIDIOMYCETES — PRODUCERS OF CATALASE

    Directory of Open Access Journals (Sweden)

    T. E. Voloshko

    2013-06-01

    Full Text Available The dynamics of growth and catalase activity of 57 strains of basidiomycetes were investigated. Glucose-peptone medium was used for surface cultivation of fungi. The objects of study were 57 strains, 5 of which belongs to 5 species of the order Polyporales, and others do to 7 species of the order Agaricales. The weight measurement to estimate accumulation of absolutely dry biomass was used to study growth rates. The spectrophotometric methods were used for determination of catalase activity and protein content in mycelium and culture filtrate. The specific catalase activity was calculated based on this data. The levels of biomass accumulation and catalase activity of the strains on the 9-th and 12-th days of cultivation and ability of the most fungi to synthesize mainly extracellular catalase were determined. Individual variability of the strains was shown. The results allowed selecting the strains — active producers of catalase, including F. velutipes F-2 and P. ostreatus R-208, which are perspective for use in biotechnology of enzyme preparations.

  15. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  17. Skin test reactivity of allergic subjects to basidiomycetes' crude extracts in a tropical environment.

    Science.gov (United States)

    Rivera-Mariani, Félix E; Nazario-Jiménez, Sylvette; López-Malpica, Fernando; Bolaños-Rosero, Benjamín

    2011-11-01

    Fungal allergies can be detected by the skin prick test with extracts of the organisms, but not all fungi, including the basidiomycetes, are being examined. We determined the level of sensitization to basidiomycetes in allergic subjects and compared their reactivity to commercial extracts commonly used to detect allergies. Crude spore extracts of the basidiomycetes Ganoderma applanatum, Chlorophyllum molybdites, and Pleurotus ostreatus, which are known to release numerous spores, were examined along with commercial extracts on 33 subjects with asthma, allergic or non-allergic rhinitis. Overall, affected subjects showed the highest reactivity to mites (36%), followed by Ganoderma applanatum (30%), grass (27%) Chlorophyllum molybdites (12%) and Pleurotus ostreatus (12%). Allergic rhinitis patients were most reactive to mites (58%), grass (42%), Ganoderma applanatum (25%), Penicillium spp. (25%), and cat (17%). Those with asthma primarily responded to mites (44%), Ganoderma applanatum (44%), grass (33%), and Pleurotus ostreatus (22%). IgE levels correlated with positive basidiomycetes extracts. This finding, coupled with higher reactivity to basidiospores as compared to mitospores, and the similar sensitivities of patients to G. applanatum and mites, suggest that basidiomycetes are important allergen sources in the tropics.

  18. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  19. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  20. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  1. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  2. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Science.gov (United States)

    Valente, Patricia; Boekhout, Teun; Landell, Melissa Fontes; Crestani, Juliana; Pagnocca, Fernando Carlos; Sette, Lara Durães; Passarini, Michel Rodrigo Zambrano; Rosa, Carlos Augusto; Brandão, Luciana R; Pimenta, Raphael S; Ribeiro, José Roberto; Garcia, Karina Marques; Lee, Ching-Fu; Suh, Sung-Oui; Péter, Gábor; Dlauchy, Dénes; Fell, Jack W; Scorzetti, Gloria; Theelen, Bart; Vainstein, Marilene H

    2012-01-01

    Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T)  =  DBVPG 4489(T)), Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T)  =  CBS 12527(T)  =  ATCC MYA-4876(T)), Bandoniozyma complexa sp. nov. (CBS 11570(T)  =  ATCC MYA-4603(T)  =  MA28a(T)), Bandoniozyma fermentans sp. nov. (CBS 12399(T)  =  NU7M71(T)  =  BCRC 23267(T)), Bandoniozyma glucofermentans sp. nov. (CBS 10381(T)  =  NRRL Y-48076(T)  =  ATCC MYA-4760(T)  =  BG 02-7-15-015A-1-1(T)), Bandoniozyma tunnelae sp. nov. (CBS 8024(T)  =  DBVPG 7000(T)), and Bandoniozyma visegradensis sp. nov. (CBS 12505(T)  =  NRRL Y-48783(T)  =  NCAIM Y.01952(T)).

  3. Improving production of laccase from novel basidiomycete with ...

    African Journals Online (AJOL)

    Three variables (sucrose, MgSO4 and CuSO4) were found to affect laccase production significantly by P-B screening. B-B design with three-factor at three levers was performed to explain the combined effects of the three medium constituents. The optimum medium consisted of sucrose (4.26 g/L), yeast powder (15 g/L), ...

  4. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  5. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  6. Processive endoglucanase active in crystalline cellulose hydrolysis by the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2005-01-01

    Brown rot basidiomycetes have long been thought to lack the processive cellulases that release soluble sugars from crystalline cellulose. On the other hand, these fungi remove all of the cellulose, both crystalline and amorphous, from wood when they degrade it. To resolve this discrepancy, we grew Gloeophyllum trabeum on microcrystalline cellulose (Avicel) and purified...

  7. Significant levels of extracellular reactive oxygen species produced by brown rot basidiomycetes on cellulose

    Science.gov (United States)

    Roni Cohen; Kenneth A. Jensen; Carl J. Houtman; Kenneth E. Hammel

    2002-01-01

    It is often proposed that brown rot basidiomycetes use extracellular reactive oxygen species (ROS) to accomplish the initial depolymerization of cellulose in wood, but little evidence has been presented to show that the fungi produce these oxidants in physiologically relevant quantities. We used [14C]phenethyl polyacrylate as a radical trap to estimate extracellular...

  8. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  9. Occurrence of wood-and root- rot basidiomycetes on trees in Bayero ...

    African Journals Online (AJOL)

    Several death and decays or rots of tropical trees are as result of infection caused by wood and root rot 'parasitic basidiomycetes. In the present study, survey of parasitic homobasidiomycetes causing wood and root rot on woody trees in Bayero University, Kano (two campuses) was carried out between April – September ...

  10. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  11. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  12. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  13. A Highly Diastereoselective Oxidant Contributes to Ligninolysis by the White Rot Basidiomycete Ceriporiopsis subvermispora

    Science.gov (United States)

    Daniel J. Yelle; Alexander N. Kapich; Carl J. Houtman; Fachuang Lu; Vitaliy I. Timokhin; Raymond C. Fort Jr.; John Ralph; Kenneth E. Hammel

    2014-01-01

    The white rot basidiomycete Ceriporiopsis subvermispora delignifies wood selectively and has potential biotechnological applications. Its ability to remove lignin before the substrate porosity has increased enough to admit enzymes suggests that small diffusible oxidants contribute to delignification. A key question is whether these unidentified...

  14. Five novel Candida species in insect-associated yeast clades isolated from Neuroptera and other insects.

    Science.gov (United States)

    Nguyen, Nhu H; Suh, Sung-Oui; Blackwell, Meredith

    2007-01-01

    Ascomycete yeasts are found commonly in the guts of basidioma-feeding beetles but little is known about their occurrence in the gut of other insects. In this study we isolated 95 yeasts from the gut of adult insects in five neuropteran families (Neuroptera: Corydalidae, Chrysopidae, Ascalaphidae, Mantispidae and Hemerobiidae) and a roach (Blattodea: Blattidae). Based on DNA sequence comparisons and other taxonomic characteristics, they were identified as more than 15 species of Saccharomycetes as well as occasional Cryptococcus-like basidiomycete yeasts. Yeast species such as Lachancea fermentati, Lachancea thermotolerans and Hanseniaspora vineae were isolated repeatedly from the gut of three species of corydalids, suggesting a close association of these species and their insect hosts. Among the yeasts isolated in this study 12 were identified as five novel Candida species that occurred in three phylogenetically distinct clades. Molecular phylogenetic analyses showed that Candida chauliodes sp. nov. (NRRL Y-27909T) and Candida corydali sp. nov. (NRRL Y-27910T) were sister taxa in the Candida albicans/ Lodderomyces elongisporus clade. Candida dosseyi sp. nov. (NRRL Y-27950T) and Candida blattae sp. nov. (NRRL Y-27698T) were sister taxa in the Candida intermedia clade. Candida ascalaphidarum sp. nov. (NRRL Y-27908T) fell on a basal branch in a clade containing Candida membranifaciens and many other insect-associated species. Descriptions of these novel yeast species are provided as well as discussion of their ecology in relation to their insect hosts.

  15. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  16. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  17. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  18. Four new spiroaxane sesquiterpenes and one new rosenonolactone derivative from cultures of Basidiomycete Trametes versicolor.

    Science.gov (United States)

    Wang, Su-Rui; Zhang, Ling; Chen, He-Ping; Li, Zheng-Hui; Dong, Ze-Jun; Wei, Kun; Liu, Ji-Kai

    2015-09-01

    Four new spiroaxane sesquiterpenes, tramspiroins A-D (1-4), one new rosenonolactone 15,16-acetonide (5), and the known drimane sesquiterpenes isodrimenediol (6) and funatrol D (7) have been isolated from the cultures of Basidiomycete Trametes versicolor. The structures of new compounds were elucidated by means of spectroscopic methods. Compounds 1-7 were investigated for their cytotoxicities against five human cancer cell lines. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Identification of a Gene Cluster for Biosynthesis of Mannosylerythritol Lipids in the Basidiomycetous Fungus Ustilago maydis

    OpenAIRE

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A.; Kämper, Jörg; Bölker, Michael

    2006-01-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose exp...

  20. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2014-03-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose. Keywords: Basidiomycetes, mycelium, culture filtrate, polyphenols, carotenoids

  1. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  2. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  3. Red Yeast Rice: An Introduction

    Science.gov (United States)

    ... Yeast Rice For More Information Key References Acknowledgments © asian-ingredients Red yeast rice is a traditional Chinese ... products varies depending on the yeast strains and culture conditions used to manufacture them. The strains and ...

  4. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... that the minimum number of genes from each species that need to be compared to produce a reliable phylogeny is about 20. Yeast has also become an attractive model to study speciation in eukaryotes, especially to understand molecular mechanisms behind the establishment of reproductive isolation. Comparison...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  5. Clinical significance and molecular characterization of nonsporulating molds isolated from the respiratory tracts of bronchopulmonary mycosis patients with special reference to basidiomycetes.

    Science.gov (United States)

    Singh, Pradeep Kumar; Kathuria, Shallu; Agarwal, Kshitij; Gaur, Shailendra Nath; Meis, Jacques F; Chowdhary, Anuradha

    2013-10-01

    Nonsporulating molds (NSMs), especially basidiomycetes, have predominantly been reported as human pathogens responsible for allergic and invasive disease. Their conventional identification is problematic, as many isolates remain sterile in culture. Thus, inconclusive culture reports might adversely affect treatment decisions. The clinical significance of NSMs in pulmonary mycoses is poorly understood. We sequenced the internal transcribed spacer (ITS) region and D1/D2 domain of the larger subunit (LSU) of 52 NSMs isolated from respiratory specimens. The basidiomycetes were the predominant NSMs, of which Schizophyllum commune was the most common agent in allergic bronchopulmonary mycosis (ABPM), followed by Ceriporia lacerata in invasive fungal disease. Porostereum spadiceum, Phanaerochaete stereoides, Neosartorya fischeri, and Marasmiellus palmivorus were the other molds observed. Application of ITS and LSU region sequencing identified 92% of the isolates. The antifungal susceptibility data revealed that all basidiomycetes tested were susceptible to amphotericin B and resistant to caspofungin, fluconazole, and flucytosine. Except for 3 isolates of S. commune and a solitary isolate of M. palmivorus, all basidiomycetes had low MICs for itraconazole, posaconazole, and voriconazole. Basidiomycetes were isolated from patients with ABPM, invasive pulmonary mycosis/pneumonia, or fungal balls. In addition, the majority of the basidiomycetes were isolated from patients with chronic respiratory disorders who were sensitized to one of the basidiomycetous fungi and demonstrated precipitating antibodies against the incriminating fungi, indicating an indolent tissue reaction. Thus, isolation of basidiomycetes from the lower respiratory tract could be significant, and it is important to monitor these patients in order to prevent subsequent lung damage.

  6. Two cases of atopic cough successfully treated by oral cleansing with amphotericin B: Relationship with Basidiomycetes detected from pharyngeal swab

    Directory of Open Access Journals (Sweden)

    Haruhiko Ogawa

    2004-01-01

    Full Text Available We report herein two cases of atopic cough in which Basidiomycetes was detected from pharyngeal swabs and in which gargling with amphotericin B was efficacious. One case is a 38-year-old woman and the other is a 54-year-old woman. Both patients visited Ishikawa ken Saiseikai Kanazawa Hospital for the diagnosis and treatment of isolated severe non-productive cough. They did not have bronchial hyperresponsiveness to methacholine or heightened bronchomotor tone. Bronchodilator therapy was not effective for their coughing. Basidiomycetes was isolated from pharyngeal swabs in both cases. Oral cleansing with amphotericin B at 300 mg/day for approximately 2 weeks was effective in treating the severe coughs. This is the first report concerning the effectiveness of oral cleansing with amphotericin B for atopic cough, in which Basidiomycetes was detected from pharyngeal swabs.

  7. Candida spencermartinsiae sp. nov., Candida taylorii sp. nov. and Pseudozyma abaconensis sp. nov., novel yeasts from mangrove and coral reef ecosystems.

    Science.gov (United States)

    Statzell-Tallman, Adele; Scorzetti, Gloria; Fell, Jack W

    2010-08-01

    Three species of yeasts are taxonomically described for strains isolated from marine environments. Candida spencermartinsiae sp. nov. (type strain CBS 10894T =NRRL Y-48663T) and Candida taylorii sp. nov. (type strain CBS 8508T =NRRL Y-27213T) are anamorphic ascomycetous yeasts in a phylogenetic cluster of marine yeasts in the Debaryomyces/Lodderomyces clade of the Saccharomycetales. The two species were isolated from multiple locations among coral reefs and mangrove habitats. Pseudozyma abaconensis sp. nov. (type strain CBS 8380T =NRRL Y-17380T) is an anamorphic basidiomycete that is related to the smut fungi of the genus Ustilago in the Ustilaginales. P. abaconensis was collected from waters adjacent to a coral reef.

  8. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  9. EFFECTS OF MICROELEMENTS ON THE CAROTENOID SYNTHESIS BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-08-01

    Full Text Available The effect of microelements on growth and accumulation of carotenoids highly productive strains of basidiomycetes at surface cultivation on glucose-peptone medium was investigated. The objects of research are 3 wood destroying strain. There are Laetiporus sulphureus (Bull. Murrill Ls-08, Fomes fomentarius (L. Fr. Ff-1201 from the order Polyporales and Fistulina hepatica (Schaeff. Sibth Fh-18 from the order Agaricales. Research materials are strains mycelium and culture filtrate (CF. Absolutely dry biomass (ADB mycelium was determined by the gravimetric method, the content of carotenoids was determined by spectrophotometric method in acetone extracts of the Vetshteyn formula. Established individual influence of microelements on the accumulation of biomass and carotenoids of basidiomycetes strains. The possibility of the regulation of these processes by introducing into the glucose-peptone medium of various Fe, Cu, Zn, Ni and Mn sulphate. So, the best to increase the intensity of the growth processes and the accumulation of carotenoids strain of L. sulphureus Ls-08 is an experimental environment which includes Zn sulfate in a concentration of 8 mmol/L. To induce the accumulation of ADB and carotenoids in the mycelium and CF of strain F fomentarius Ff-1201 making in is expedient Mn sulfate in a concentration of 1.6 mmol/L. To improve carotenogenesis of F. hepatica Fh-18 strain expedient entry in GPM Mn sulphate at concentration of 8 mmol/L. These allow to optimize the concentration of microelements in nutrient medium for the cultivation of carotenoids high-producing strains of Basidiomycetes.

  10. Unexpected diversity of basidiomycetous endophytes in sapwood and leaves of Hevea.

    Science.gov (United States)

    Martin, Rachael; Gazis, Romina; Skaltsas, Demetra; Chaverri, Priscila; Hibbett, David

    2015-01-01

    Research on fungal endophytes has expanded dramatically in recent years, but little is known about the diversity and ecological roles of endophytic basidiomycetes. Here we report the analysis of 310 basidiomycetous endophytes isolated from wild and planted populations of the rubber tree genus, Hevea. Species accumulation curves were nonasymptotic, as in the majority of endophyte surveys, indicating that more sampling is needed to recover the true diversity of the community. One hundred eighteen OTUs were delimited, representing nine orders of Basidiomycota (Agaricales, Atheliales, Auriculariales, Cantharellales, Hymenochaetales, Polyporales, Russulales, Septobasidiales, Tremellales). The diversity of basidiomycetous endophytes found inhabiting wild populations of Hevea was comparable to that present in plantations. However, when samples were segregated by tissue type, sapwood of wild populations was found to contain a higher number of species than sapwood of planted trees. Seventy-five percent of isolates were members of the Polyporales, the majority in the phlebioid clade. Most of the species belong to clades known to cause a white-rot type of wood decay. Two species in the insect-associated genus Septobasidium were isolated. The most frequently isolated genera included Bjerkandera, Ceriporia, Phanerochaete, Phlebia, Rigidoporus, Tinctoporellus, Trametes (Polyporales), Peniophora, Stereum (Russulales) and Coprinellus (Agaricales), all of which have been reported as endophytes from a variety of hosts, across wide geographic locations. Literature records on the geographic distribution and host association of these genera revealed that their distribution and substrate affinity could be extended if the endophytic niche was investigated as part of fungal biodiversity surveys. © 2015 by The Mycological Society of America.

  11. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  12. Fragmentation of human IgG by a new protease isolated from the basidiomycete Armillaria mellea.

    Science.gov (United States)

    Hunneyball, I M; Stanworth, D R

    1975-01-01

    Digestion of human IgG by a new lysine-specific protease, isolated from the basidiomycete Armillaria mellea, produced Fc and Fab fragments similar to those produced by papain digestion of the same molecule. Digestion appeared to be restricted to a single cleavage point within the hinge region of the IgG molecule. Myeloma proteins of IgG1, IgG3 and IgG4 subclasses were found to be digested at an extremely rapid rate whereas IgG2 myeloma proteins appeared to be resistant to digestion by this enzyme. Images FIG. 2 FIG. 6 PMID:1201861

  13. Aethiopinolones A–E, New Pregnenolone Type Steroids from the East African Basidiomycete Fomitiporia aethiopica

    Directory of Open Access Journals (Sweden)

    Clara Chepkirui

    2018-02-01

    Full Text Available A mycelial culture of the Kenyan basidiomycete Fomitiporia aethiopica was fermented on rice and the cultures were extracted with methanol. Subsequent HPLC profiling and preparative chromatography of its crude extract led to the isolation of five previously undescribed pregnenolone type triterpenes 1–5, for which we propose the trivial name aethiopinolones A–E. The chemical structures of the aethiopinolones were determined by extensive 1D- and 2D-NMR, and HRMS data analysis. The compounds exhibited moderate cytotoxic effects against various human cancer cell lines, but they were found devoid of significant nematicidal and antimicrobial activities.

  14. Role of plants in the vegetative and reproductive growth of saprobic basidiomycetous ground fungi.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2008-11-01

    Non-symbiotic microorganisms engineered or expensively selected to degrade xenobiotic hydrocarbons or modify heavy-metal uptake of plants in soil remediations die back after their introduction into the target soils. Mycelia of saprobic basidiomycetes were therefore inoculated into soil samples of 1 l in glass vessels to record mycelial growth and reproduction in the immediate rhizosphere of up to 11 herbaceous plant species, or to study their responses to the separate volatiles from whole plant swards or their root balls whose emanations had been collected in 1.5-l plastic bags fixed to the glass vessels. Excess CO2 was controlled with NaOH solution. Volatiles from root balls of parsley and pea but not wheat, from unplanted soils, from the fungus-permeated, unplanted substrate soil itself, and from the rooting soil of whole wheat sward increased mycelial densities in Clitocybe sp. more than in Agaricus macrocarpus and indicated thus a higher nutrient state of the mycelia. Organic volatiles proved therefore to be a significant carbon source for certain basidiomycetes in poor natural soils. The contemporary decline in the number of basidiocarp initials to 0 to 36% in both fungi relative to the unplanted and aerated controls was caused by volatiles from rooted and unplanted soil and pointed thus to their ecological role as antibiotics, fumigants, toxins, and hormonal compounds. Aqueous extracts from root balls of wheat stimulated mycelial density and fruiting in A. macrocarpus contemporarily because of their contents in soil-derived macronutrients. They suppressed once more fruiting in the more sensitive Clitocybe sp. by active agents in the aqueous phase. Within plant rhizospheres, densities of Clitocybe sp. mycelia were stimulated in the presence of alfalfa, carrot, red clover, ryegrass, and spinach, whereas those of A. macrocarpus were halved by 7 of 10 plant species including alfalfa, red clover, ryegrass, and spinach. Mycelia of A. macrocarpus may thereby have

  15. [Penicillium-inhibiting yeasts].

    Science.gov (United States)

    Benítez Ahrendts, M R; Carrillo, L

    2004-01-01

    The objective of this work was to establish the in vitro and in vivo inhibition of post-harvest pathogenic moulds by yeasts in order to make a biocontrol product. Post-harvest pathogenic moulds Penicillium digitatum, P. italicum, P. ulaiense, Phyllosticta sp., Galactomyces geotrichum and yeasts belonging to genera Brettanomyces, Candida, Cryptococcus, Kloeckera, Pichia, Rhodotorula were isolated from citrus fruits. Some yeasts strains were also isolated from other sources. The yeasts were identified by their macro and micro-morphology and physiological tests. The in vitro and in vivo activities against P. digitatum or P. ulaiense were different. Candida cantarellii and one strain of Pichia subpelliculosa produced a significant reduction of the lesion area caused by the pathogenic moulds P. digitatum and P. ulaiense, and could be used in a biocontrol product formulation.

  16. Forces in yeast flocculation

    Science.gov (United States)

    El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Vincent, Stéphane P.; Abellán Flos, Marta; Hols, Pascal; Lipke, Peter N.; Dufrêne, Yves F.

    2015-01-01

    In the baker's yeast Saccharomyces cerevisiae, cell-cell adhesion (``flocculation'') is conferred by a family of lectin-like proteins known as the flocculin (Flo) proteins. Knowledge of the adhesive and mechanical properties of flocculins is important for understanding the mechanisms of yeast adhesion, and may help controlling yeast behaviour in biotechnology. We use single-molecule and single-cell atomic force microscopy (AFM) to explore the nanoscale forces engaged in yeast flocculation, focusing on the role of Flo1 as a prototype of flocculins. Using AFM tips labelled with mannose, we detect single flocculins on Flo1-expressing cells, showing they are widely exposed on the cell surface. When subjected to force, individual Flo1 proteins display two distinct force responses, i.e. weak lectin binding forces and strong unfolding forces reflecting the force-induced extension of hydrophobic tandem repeats. We demonstrate that cell-cell adhesion bonds also involve multiple weak lectin interactions together with strong unfolding forces, both associated with Flo1 molecules. Single-molecule and single-cell data correlate with microscale cell adhesion behaviour, suggesting strongly that Flo1 mechanics is critical for yeast flocculation. These results favour a model in which not only weak lectin-sugar interactions are involved in yeast flocculation but also strong hydrophobic interactions resulting from protein unfolding.

  17. An improved high-throughput Nile red fluorescence assay for estimating intracellular lipids in a variety of yeast species

    Science.gov (United States)

    Sitepu, I.R.; Ignatia, L.; Franz, A. K.; Wong, D. M.; Faulina, S.A.; Tsui, M.; Kanti, A.; Boundy-Mills, K.

    2012-01-01

    A rapid and inexpensive method for estimating lipid content of yeasts is needed for screening large numbers of yeasts samples. Nile red is a fluorescent lipophilic dye used for detection and quantification of intracellular lipid droplets in various biological system including algae, yeasts and filamentous fungi. However, a published assay for yeast is affected by variable diffusion across the cell membrane, and variation in the time required to reach maximal fluorescence emission. In this study, parameters that may influence the emission were varied to determine optimal assay conditions. An improved assay with a high-throughput capability was developed that includes the addition of dimethyl sulfoxide (DMSO) solvent to improve cell permeability, elimination of the washing step, the reduction of Nile red concentration, kinetic readings rather than single time-point reading, and utilization of a black 96-well microplate. The improved method was validated by comparison to gravimetric determination of lipid content of a broad variety of ascomycete and basidiomycete yeast species. PMID:22985718

  18. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  19. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  20. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  1. REGULATION OF THE SYNTHESIS OF POLYPHENOLIC SUBSTANCES BY SOME BASIDIOMYCETES STRAINS

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2014-04-01

    Full Text Available The effect of specific carbon-containing compounds as additional components glucose-peptone medium (GPM, the intensity of the polyphenolic substances and carotenoids synthesis by some strains was investigated by surface cultivating basidiomycetes. The total content of polyphenolic substances set out in alcoholic extracts of the modified procedure by Folin-Chokalteu and in acetone carotenoids extracts of mycological material by spectrophotometric method and calculated by Vetshteyn formula. In GPM we used 13 carbonaceous components compounds belonging to mono-, oligo- and polysaccharides and carboxylic acids The effect of the 13 carbon-containing compounds on the accumulation of biomass, carotenoids and polyphenols Basidiomycetes strains L. sulphureus Ls-08, F. fomentarius Ff-1201 and F. hepatica Fh-18 was identified. For the purpose of inducing the synthesis of carotenoids by strains Ls-08 and Fh-18 may recommend changes in the standard GPS by fructose, and for strain Ff-1201 by sucrose. In order to induce synthesis of polyphenols strains Ff-1201 and Fh-18 to make appropriate standard GPS by mannose and for strain Ls-08 by sucrose.

  2. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions.

  3. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  4. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  5. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  6. Yeasts associated with Manteca.

    Science.gov (United States)

    Suzzi, Giovanna; Schirone, Maria; Martuscelli, Maria; Gatti, Monica; Fornasari, Maria Emanuela; Neviani, Erasmo

    2003-04-01

    Manteca is a traditional milk product of southern Italy produced from whey deriving from Caciocavallo Podolico cheese-making. This study was undertaken to obtain more information about the microbiological properties of this product and particularly about the presence, metabolic activities, and technological significance of the different yeast species naturally occurring in Manteca. High numbers of yeasts were counted after 7 days ripening (10(4)-10(5) cfu g(-1)) and then decreased to 10(2) at the end. A total of 179 isolates were identified and studied for their phenotypic and genotypic characteristics. The most frequently encountered species were Trichosporon asahii (45), Candida parapsilosis (33), Rhodotorula mucilaginosa (32), Candida inconspicua (29). Some of these yeasts showed lipolytic activity (32 strains) and proteolytic activity (29 strains), NaCl resistance up to 10% and growth up to 45 degrees C (42 strains). Biogenic amines were formed by proteolytic strains, in particular phenylethylamine, putrescine and spermidine. Spermidine was produced by all the yeasts tested in this work, but only Trichosporon produced a great quantity of this compound. Histamine was not detectable. Caseinolytic activity was common to almost all strains, corresponding to the ability to efficiently split off amino-terminal amino acids. The highest and most constant activity expressed by all species was X-prolyl-dipeptidyl aminopeptidase. The findings suggest that the presence of yeasts may play a significant role in justifying interactions with lactic acid bacteria, and consequently with their metabolic activity in the definition of the peculiar characteristics of Manteca cheese.

  7. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  8. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  9. Miscellaneous lanostane triterpenoids with cytotoxicities from fruiting bodies of the basidiomycete Stereum sp.

    Science.gov (United States)

    Yao, Jian-Neng; Chen, Lin; Chen, He-Ping; Zhao, Zhen-Zhu; Zhang, Shuai-Bing; Huang, Ying; Tang, Yang; Isaka, Masahiko; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2018-03-01

    Ten new highly oxygenated lanostane triterpenoids, stereinones A-J (1-10), were isolated from the fruiting bodies of the basidiomycete Stereum sp. Compounds 3 and 4 are structurally characterized as intact lanostane-type triterpenoids containing unusual 1,2-diketone functionality at C-11 and C-12, while compound 10 is a 24-methylene-lanostane. The structures of these new compounds were established based on detailed 1D and 2D NMR spectroscopic analyses, along with quantum chemical NMR calculations. All isolates were evaluated for their in vitro cytotoxicities against five human tumor cell lines (including HL-60, A-549, SMMC-7721, MCF-7, and SW480 cell lines). Compound 4 showed moderate cytotoxic activities against tumor cell lines SMMC-7721 and SW480 with IC 50 values of 9.1 and 9.8μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Cloning and Sequence Analysis of the Cellobiohydrolase I Genes from Some Basidiomycetes

    Science.gov (United States)

    Maharachchikumbura, Sajeewa S. N.; Wongkham, Shannaphimon; Sysouphanthong, Phongeun; Phookamsak, Rungtiwa; Hyde, Kevin D.

    2012-01-01

    Genes encoding the cellobiohydrolase enzyme (CBHI), designated as cbhI, were isolated from the basidiomycetes Auricularia fuscosuccinea, Pleurotus giganteus, P. eryngii, P. ostreatus, and P. sajor-caju. Initially, the fungal genomic DNA was extracted using a modified cetyltrimethyl ammonium bromide (CTAB) protocol and used as a DNA template. The cbhI genes were then amplified and cloned using the pGEM-T Easy Vector Systems. The sizes of these PCR amplicons were between 700~800 bp. The DNA sequences obtained were similar showing high identity to the cbhI gene family. These cbhI genes were partial consisting of three coding regions and two introns. The deduced amino acid sequences exhibited significant similarity to those of fungal CBHI enzymes belonging to glycosyl hydrolase family 7. PMID:22870052

  11. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  12. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  13. Polysome Profile Analysis - Yeast

    Czech Academy of Sciences Publication Activity Database

    Pospíšek, M.; Valášek, Leoš Shivaya

    2013-01-01

    Roč. 530, č. 2013 (2013), s. 173-181 ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013

  14. [Evaluation of mass spectrometry for the identification of clinically interesting yeasts].

    Science.gov (United States)

    Galán, Fátima; García-Agudo, Lidia; Guerrero, Inmaculada; Marín, Pilar; García-Tapia, Ana; García-Martos, Pedro; Rodríguez-Iglesias, Manuel

    2015-01-01

    Identification of yeasts is based on morphological, biochemical and nutritional characteristics, and using molecular methods. Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, a new method for the identification of microorganisms, has demonstrated to be very useful. The aim of this study is to evaluate this new method in the identification of yeasts. A total of 600 strains of yeasts isolated from clinical specimens belonging to 9 genera and 43 species were tested. Identification was made by sequencing of the ITS regions of ribosomal DNA, assimilation of carbon compounds (ID 32C), and mass spectrometry on a Microflex spectrometer (Bruker Daltonics GmbH, Germany). A total of 569 strains (94.8%) were identified to species level by ID 32C, and 580 (96.7%) by MALDI-TOF. Concordance between both methods was observed for 553 strains (92.2%), with 100% in clinically relevant species: C. albicans, C. glabrata, C. parapsilosis, C. tropicalis, and almost 100% in C. krusei. MALDI-TOF identified species requiring molecular methods: Candida dubliniensis, C. nivariensis, C. metapsilosis and C. orthopsilosis. Some irregularities were observed in the identification of arthroconidia yeast and basidiomycetes. MALDI-TOF is a rapid, effective and economic method, which enables the identification of most clinically important yeasts and the differentiation of closely related species. It would be desirable to include more species in its database to expand its performance. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  15. Proteolytic activities in yeast.

    Science.gov (United States)

    Saheki, T; Holzer, H

    1975-03-28

    Studies on the mechanism and time course of the activation of proteinases A (EC 3.4.23.8), B (EC 3.4.22.9) and C (EC 3.4.12.--) in crude yeast extracts at pH 5.1 and 25 degrees C showed that the increase in proteinase B activity is paralleled with the disappearance of proteinase B inhibitor. Addition of purified proteinase A to fresh crude extracts accelerates the inactivation of the proteinase B inhibitor and the appearance of maximal activities of proteinases B and C. The decrease of proteinase B inhibitor activity and the increase of proteinase B activity are markedly retarded by the addition of pepstatin. Because 10-minus 7 M pepstatin completely inhibits proteinase A without affecting proteinase B activity, this is another indication for the role of proteinase A during the activation of proteinase B. Whereas extracts of yeast grown on minimal medium reached maximal activation of proteinases B and C after 20 h of incubation at pH 5.1 and 25 degrees C, extracts of yeast grown on complete medium had to be incubated for about 100 h. In the latter case, the addition of proteinas A results in maximal activation of proteinases B and C and disappearance of proteinase B inhibitor activity only after 10--20 h of incubation. With the optimal conditions, the maximal activities of proteinases A, B and C, as well as of the proteinase B inhibitor, were determined in crude extracts of yeast that had been grown batchwise for different lengths of time either on minimal or on complete medium. Upon incubation, all three proteinases were activated by several times their initial activity. This reflects the existence of proteolytically degradable inhibitors of the three proteinases and together with the above mentioned observations it demonstrates that the "activation" of yeast proteinases A, B and C upon incubation results from the proteolytic digestion of inhibitors rather than from activation of inactive zymogens by limited proteolysis.

  16. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  17. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  18. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  19. Yeast ecology of Kombucha fermentation.

    Science.gov (United States)

    Teoh, Ai Leng; Heard, Gillian; Cox, Julian

    2004-09-01

    Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.

  20. Flavour-active wine yeasts.

    Science.gov (United States)

    Cordente, Antonio G; Curtin, Christopher D; Varela, Cristian; Pretorius, Isak S

    2012-11-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can influence wine style. This review explores recent progress towards understanding the range of 'flavour phenotypes' that wine yeast exhibit, and how this knowledge has been used to develop novel flavour-active yeasts. In addition, emerging opportunities to augment these phenotypes by engineering yeast to produce so-called grape varietal compounds, such as monoterpenoids, will be discussed.

  1. Genetically engineered yeast

    DEFF Research Database (Denmark)

    2014-01-01

    A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate semialde......A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate...... semialdehyde. The yeast may also express a 3-hydroxyisobutyrate dehydrogenase (HIBADH) and a 3-hydroxypropanoate dehydrogenase (3-HPDH) and aspartate 1-decarboxylase. Additionally the yeast may express pyruvate carboxylase and aspartate aminotransferase....

  2. Yeast glycolipid biosurfactants.

    Science.gov (United States)

    Jezierska, Sylwia; Claus, Silke; Van Bogaert, Inge

    2017-10-25

    Various yeasts, both conventional and exotic ones, are known to produce compounds useful to mankind. Ethanol is the most known of these compounds, but more complex molecules such as amphiphilic biosurfactants can also be derived from eukaryotic microorganisms at an industrially and commercially relevant scale. Among them, glycolipids are the most promising, due to their attractive properties and high product titers. Many of these compounds can be considered as secondary metabolites with a specific function for the host. Hence, a dedicated biosynthetic process enables regulation and combines pathways delivering the lipidic moiety and the hydrophilic carbohydrate part of the glycolipid. In this Review, we will discuss the biosynthetic and regulatory aspects of the yeast-derived sophorolipids, mannosylerythritol lipids, and cellobiose lipids, with special emphasis on the relation between glycolipid synthesis and the general lipid metabolism. © 2017 Federation of European Biochemical Societies.

  3. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  4. Leaf extracts of Casearia sylvestris and Casearia decandra affect growth and production of ligninolytic enzymes in wood decay basidiomycetes

    OpenAIRE

    Bento, Thiara Siqueira; Torres, Luce Maria Brandão; Fialho, Mauricio Batista; Bononi, Vera Lúcia Ramos

    2016-01-01

    ABSTRACT White-rot basidiomycetes are able to deteriorate wood products and be pathogenic to living trees, requiring, thus requiring control. The tropical flora is an important source of eco-friendly antifungal compounds; however, the knowledge on how leaf extracts affect the fungal physiology is limited. Therefore, in the present work we investigated the influence of ethanolic leaf extracts of Casearia sylvestris and C. decandra at 0.1 mg mL-1 on the production of ligninolytic enzymes by Tra...

  5. VOLATILE COMPOUNDS IN THE AROMA OF THREE SPECIES OF WOOD-ROTTING BASIDIOMYCETES AND THEIR ANTIFUNGAL POTENTIAL

    OpenAIRE

    Cristiana Virginia PETRE; Alin Constantin DÎRȚU; Marius NICULAUA; Cătălin TĂNASE

    2017-01-01

    This study aims to determine the volatile organic compounds synthesized by three species of wood-rotting basidiomycetes: Coriolopsis gallica, Megacollybia platyphylla and Lentinus arcularius and test their antifungal potential. The species were cultivated on liquid media and kept for 25 days at 25 °C. The surface cultures were then homogenized, filtrated and extracted using solid-phase extraction and analyzed by GC-MS. The volatile compounds identified were mainly alcohols, ketones, aldehydes...

  6. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  7. Accumulation of cellobiose lipids under nitrogen-limiting conditions by two ustilaginomycetous yeasts, Pseudozyma aphidis and Pseudozyma hubeiensis.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2013-02-01

    Some basidiomycetous yeast strains extracellularly produce cellobiose lipids (CLs), glycolipid biosurfactants which have strong fungicidal activity. The representative CL producer Ustilago maydis produces CLs together with the other glycolipids, mannosylerythritol lipids (MELs); the preference of the two glycolipids is affected considerably by the nitrogen source. To develop new CL producers, 12 MEL producers were cultured under the nitrogen-limited conditions. Pseudozyma aphidis and Pseudozyma. hubeiensis were characterized as new CL producers. CL production was induced on three strains, P. aphidis, Pseudozyma graminicola, and P. hubeiensis under these conditions. The putative homologous genes of U. maydis cyp1, which encodes a P450 monooxygenase, essential for CL biosynthesis, were partially amplified from their genomic DNA. The nucleotide sequences of the gene fragments from P. hubeiensis and P. aphidis shared identities with U. maydis cyp1 of 99% and 78%, respectively. Furthermore, all of the deduced translation products are tightly clustered in the phylogenic tree of the monooxygenase. These results suggest that the genes involved with CL biosynthesis must be widely distributed in the basidiomycetous fungi as well as the MEL biosynthesis genes, and thus, the genus Pseudozyma has great potential as a biosurfactant producer. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. Yeasts in Hevea brasiliensis Latex.

    Science.gov (United States)

    Glushakova, A M; Kachalkin, A V; Maksimova, I A; Chernov, I Yu

    2016-07-01

    Yeast abundance and species diversity in the latex of caoutchouc tree Hevea brasiliensis (Willd. ex Juss.) M611. Arg., on its green leaves, and in soil below the plant Was studied. The yeasts present in the fresh latex in concentrations of up to 5.5 log(CFU/g) were almost exclusively represented by the species Candida heveicola, which was previously isolated from Hevea latex in China. In the course of natural modification of the latex yeast diversity increased, while yeast abundance decreased. The yeasts of thickened and solidified latex were represented by typical epiphytic and ubiquitous species: Kodamea ohmeri, Debaryomyces hansenii, Rhodotorula mucilaginosa, and synanthropic species Candida parapsilosis and Cutaneotrichosporon arbori- formis. The role of yeasts in latex modification at the initial stages of succession and their probable role in de- velopment of antifungal activity in the latex are discussed.

  9. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  10. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  11. Flavour-active wine yeasts

    OpenAIRE

    Cordente, Antonio G.; Curtin, Christopher D.; Varela, Cristian; Pretorius, Isak S.

    2012-01-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can infl...

  12. Current awareness on yeast.

    Science.gov (United States)

    2002-02-01

    In order to keep subscribers up-to-date with the latest developments in their field, this current awareness service is provided by John Wiley & Sons and contains newly-published material on yeasts. Each bibliography is divided into 10 sections. 1 Books, Reviews & Symposia; 2 General; 3 Biochemistry; 4 Biotechnology; 5 Cell Biology; 6 Gene Expression; 7 Genetics; 8 Physiology; 9 Medical Mycology; 10 Recombinant DNA Technology. Within each section, articles are listed in alphabetical order with respect to author. If, in the preceding period, no publications are located relevant to any one of these headings, that section will be omitted. (3 weeks journals - search completed 5th. Dec. 2001)

  13. Kojic acid-mediated damage responses induce mycelial regeneration in the basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available Mechanical damage can induce fruiting body production in fungi. In this study, the antioxidant kojic acid (KA was found to enhance injured mycelial regeneration and increase fruiting body production in Hypsizygus marmoreus. KA reduced the level of reactive oxygen species (ROS, which are harmful to mycelia when excessively generated by mechanical damage. Moreover, KA increased catalase and superoxide dismutase activities and glutathione and ascorbic acid contents by up-regulating antioxidant gene expression. These results suggest that KA promotes mycelial regeneration in response to damage by activating a "stress signal" and enhances the ability of H. marmoreus to resist oxidative damage by invoking the antioxidant system. In addition, KA increased the content of extracellular ATP, which serves as a "stress signal" in response to injury, and modulated ROS signaling, decreasing NADPH oxidase gene expression and ROS levels in the mycelial-regeneration stage. KA treatment also up-regulated the MAPK, Ca2+ and oxylipin pathways, suggesting their involvement in the damage response. Furthermore, laccase and cellulase activities were stimulated by KA at different developmental stages. These results demonstrate that KA regulates gene expression and activates pathways for mycelial wound healing, regeneration of damaged mycelia and reproductive structure formation in the basidiomycete H. marmoreus.

  14. Veratryl alcohol oxidases from the lignin-degrading basidiomycete Pleurotus sajor-caju.

    Science.gov (United States)

    Bourbonnais, R; Paice, M G

    1988-01-01

    The basidiomycete Pleurotus sajor-caju mineralizes ring-14C-labelled lignin (dehydrogenative polymer) when grown in mycological broth. Under these conditions, two veratryl alcohol oxidase (VAO) enzymes were found in the culture medium. They oxidized a number of aromatic alcohols to aldehydes and reduced O2 to H2O2. The enzymes were purified by ion-exchange and gel-permeation chromatography. The final step of purification on Mono Q resolved the activity into two peaks (VAO I and VAO II). Both enzymes had the same Mr, approx. 71,000, but their isoelectric points differed slightly, 3.8 for VAO I and 4.0 for VAO II. Their amino acid compositions were similar except for aspartic acid/asparagine and glycine. Both enzymes are glycoproteins and contain flavin prosthetic groups. Their pH optima were around 5, and kinetic constants and specificities were similar. 4-Methoxybenzyl alcohol was oxidized the most rapidly, followed by veratryl alcohol. Not all aromatic alcohols were oxidized, neither were non-aromatic alcohols. Cinnamyl alcohol was oxidized at the gamma position. The VAO enzymes thus represent a significantly different route for veratryl alcohol oxidation from that catalysed by the previously found lignin peroxidases from Phanerochaete chrysosporium. The role of the oxidases in biodegradation might be to produce H2O2 during oxidation of lignin fragments. Images Fig. 3. PMID:3060110

  15. Therapeutic effects of substances occurring in higher Basidiomycetes mushrooms: a modern perspective.

    Science.gov (United States)

    Wasser, S P; Weis, A L

    1999-01-01

    This review highlights some of the recently isolated and identified substances of higher Basidiomycetes mushrooms origin that express promising antitumor, immune modulating, cardiovascular and hypercholesterolemia, antiviral, antibacterial, and antiparasitic effects. Medicinal mushrooms have a long history of use in folk medicine. In particular, mushrooms useful against cancers of the stomach, esophagus, lungs, etc. are known in China, Russia, Japan, Korea, as well as the U.S.A. and Canada. There are about 200 species of mushrooms that have been found to markedly inhibit the growth of different kinds of tumors. Searching for new antitumor and other medicinal substances from mushrooms and to study the medicinal value of these mushrooms have become a matter of great significance. However, most of the mushroom origin antitumor substances have not been clearly defined. Several antitumor polysaccharides such as hetero-beta-glucans and their protein complexes (e.g., xyloglucans and acidic beta-glucan-containing uronic acid), as well as dietary fibers, lectins, and terpenoids have been isolated from medicinal mushrooms. In Japan, Russia, China, and the U.S.A. several different polysaccharide antitumor agents have been developed from the fruiting body, mycelia, and culture medium of various medicinal mushrooms (Lentinus edodes, Ganoderma lucidum, Schizophyllum commune, Trametes versicolor, Inonotus obliquus, and Flammulina velutipes). Both cellular components and secondary metabolites of a large number of mushrooms have been shown to effect the immune system of the host and therefore could be used to treat a variety of disease states.

  16. Genetic diversity of ectomycorrhizal Basidiomycetes from African and Indian tropical rain forests.

    Science.gov (United States)

    Riviere, Taiana; Diedhiou, Abdallah G; Diabate, Moussa; Senthilarasu, G; Natarajan, K; Verbeken, Annemieke; Buyck, Bart; Dreyfus, Bernard; Bena, Gilles; Ba, Amadou M

    2007-07-01

    Ectomycorrhizal (ECM) fungi have a worldwide distribution. However, the ecology of tropical ECM fungi is poorly documented, limiting our understanding of the symbiotic associations between tropical plants and fungi. ECM Basidiomycete diversity was investigated for the first time in two tropical rain forests in Africa (Western Upper Guinea) and in Asia (Western Ghats, India), using a fragment of the mitochondrial large subunit rRNA gene to type 140 sporocarps and 54 ectomycorrhizas. To evaluate taxonomic diversity, phylogenetic analyses were performed, and 40 sequences included from identified European specimens were used as taxonomic benchmarks. Five clades were recovered corresponding to six taxonomic groups: boletoids, sclerodermatoids, russuloids, thelephoroids, and a clade grouping the Amanitaceae and Tricholomataceae families. Our results revealed that the Russulaceae species display a great diversity with several putative new species, especially in Guinea. Other taxonomic issues at family/section levels are also briefly discussed. This study provides preliminary insights into taxonomic diversity, ECM status, and biogeographic patterns of ECM fungi in tropical two rain forest ecosystems, which appear to be as diverse as in temperate and boreal forests.

  17. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. Copyright © 2012 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  18. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  19. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  20. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis.

  1. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  2. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    ... yeast Saccharomyces cerevisiae, for sociobiological research. I discuss the problems connected with clear classification of yeast behaviour based on the fitness-based Hamilton paradigm. Relevant traits include different types of communities, production of flocculins, invertase and toxins, and the presence of apoptosis.

  3. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  4. Production of Food Grade Yeasts

    Directory of Open Access Journals (Sweden)

    Argyro Bekatorou

    2006-01-01

    Full Text Available Yeasts have been known to humans for thousands of years as they have been used in traditional fermentation processes like wine, beer and bread making. Today, yeasts are also used as alternative sources of high nutritional value proteins, enzymes and vitamins, and have numerous applications in the health food industry as food additives, conditioners and flavouring agents, for the production of microbiology media and extracts, as well as livestock feeds. Modern scientific advances allow the isolation, construction and industrial production of new yeast strains to satisfy the specific demands of the food industry. Types of commercial food grade yeasts, industrial production processes and raw materials are highlighted. Aspects of yeast metabolism, with respect to carbohydrate utilization, nutritional aspects and recent research advances are also discussed.

  5. Evolutionary History of Ascomyceteous Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Haridas, Sajeet; Riley, Robert; Salamov, Asaf; Goker, Markus; Klenk, Hans-Peter; Kurtzman, Cletus P.; Blackwell, Meredith; Grigoriev, Igor; Jeffries, Thomas W.

    2014-06-06

    Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.

  6. Biocontrol of Alternaria alternata on cherry tomato fruit by use of marine yeast Rhodosporidium paludigenum Fell & Tallman.

    Science.gov (United States)

    Wang, Yifei; Bao, Yihong; Shen, Danhong; Feng, Wu; Yu, Ting; Zhang, Jia; Zheng, Xiao Dong

    2008-04-30

    The basidiomycetous yeast Rhodosporidium paludigenum Fell & Tallman isolated from the south of East China Sea was evaluated for its activity in reducing postharvest decay of cherry tomatoes caused by Alternaria alternata in vitro and in vivo tests. The results showed that washed cell suspension of R. paludigenum provided better control of A. alternata than any other treatment, while the autoclaved cell culture failed to provide protection against the pathogen. The concentration of antagonist had significant effect on biocontrol effectiveness in vivo: when the concentration of the washed yeast cell suspension was used at 1 x 10(9)cells/ml, the percentage rate of black rot of cherry tomato fruit was only 37%, which was remarkably lower than that treated with water (the control) after 5days of incubation at 25 degrees C. Furthermore, a great biocontrol efficacy of R. paludigenum was observed when it was applied prior to inoculation with A. alternata: the longer the incubation time of R. paludigenum, the lower disease incidence would be. However, there was little efficacy when R. paludigenum was applied after A. alternata inoculation. In addition, on the wounds of cherry tomato, it was observed that R. paludigenum grew rapidly increasing 50-fold during the first 12h at 25 degrees C. To the best of our knowledge, this is a first report concerning that the marine yeast R. paludigenum could be used as a biocontrol agent of postharvest fungal disease.

  7. Highly cold-active pectinases under wine-like conditions from non-Saccharomyces yeasts for enzymatic production during winemaking.

    Science.gov (United States)

    Merín, M G; Morata de Ambrosini, V I

    2015-05-01

    The influence of oenological factors on cold-active pectinases from 15 preselected indigenous yeasts belonging to Aureobasidium pullulans, Filobasidium capsuligenum, Rhodotorula dairenensis, Cryptococcus saitoi and Saccharomyces cerevisiae was investigated. Pectinolytic enzymes were constitutive or partially constitutive; and high glucose concentration (200 g l(-1) ) did not affect or increased pectinase production at 12°C and pH 3·5 (up to 113·9 U mg(-1) ) only in A. pullulans strains. SO2 (120 mg l(-1) ) slightly affected the growth of A. pullulans strains but did not affect pectinase production levels. Ethanol (15%) barely affected pectinase activity of A. pullulans strains but diminished relative activity to 12-79% of basidiomycetous yeasts. Moreover, non-Saccharomyces strains showed promising properties of oenological interest. This study demonstrates that cold-active pectinases from some A. pullulans strains were able to remain active at glucose, ethanol and SO2 concentrations usually found in vinification, and suggests their potential use as processing aids for low-temperature winemaking. Nowadays, there is increasing interest in low-temperature winemaking. Nevertheless, commercial oenological pectinases, produced by fungi, are rarely active at low temperatures. Cold-active pectinases that are stable under vinification conditions are needed. This study indicated that cold-active and acid-tolerant pectinases from non-Saccharomcyes yeasts were able to remain active at glucose, ethanol and SO2 concentrations usually found in winemaking. Furthermore, not only are these yeasts a source of cold-active pectinases, but the yeasts themselves are also potential adjunct cultures for oenology to produce these enzymes during cold-winemaking. © 2015 The Society for Applied Microbiology.

  8. Genetic study on yeast

    International Nuclear Information System (INIS)

    Mortimer, R.K.

    1981-01-01

    Research during the past year has moved ahead on several fronts. A major compilation of all the genetic mapping data for the yeast Saccharomyces cerevisiae has been completed. The map describes the location of over 300 genes on 17 chromosomes. A report on this work will appear in Microbiological Reviews in December 1980. Recombinant DNA procedures have been introduced into the experiments and RAD52 (one of the genes involved in recombination and repair damage), has been successfully cloned. This clone will be used to determine the gene product. Diploid cells homozygous for RAD52 have exceptionally high frequencies of mitotic loss of chromosomes. This loss is stimulated by ionizing radiation. This effect is a very significant finding. The effect has also been seen with certain other RAD mutants

  9. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  10. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  11. Lager Yeast Comes of Age

    Science.gov (United States)

    2014-01-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  12. Yeasts: From genetics to biotechnology

    Energy Technology Data Exchange (ETDEWEB)

    Russo, S.; Poli, G. [Univ. of Milan (Italy); Siman-Tov, R.B. [Univ. of Jerusalem, Rehovot (Israel)

    1995-12-31

    Yeasts have been known and used in food and alcoholic fermentations ever since the Neolithic Age. In more recent times, on the basis of their peculiar features and history, yeasts have become very important experimental models in both microbiological and genetic research, as well as the main characters in many fermentative production processes. In the last 40 years, advances in molecular biology and genetic engineering have made possible not only the genetic selection of organisms, but also the genetic modification of some of them, especially the simplest of them, such as bacteria and yeasts. These discoveries have led to the availability of new yeast strains fit to fulfill requests of industrial production and fermentation. Moreover, genetically modified and transformed yeasts have been constructed that are able to produce large amounts of biologically active proteins and enzymes. Thus, recombinant yeasts make it easier to produce drugs, biologically active products, diagnostics, and vaccines, by inexpensive and relatively simple techniques. Yeasts are going to become more and more important in the {open_quotes}biotechnological revolution{close_quotes} by virtue of both their features and their very long and safe use in human nutrition and industry. 175 refs., 4 figs., 6 tabs.

  13. Condition of the prooxidant-antioxidant system of some strains of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    O. V. Fedotov

    2017-02-01

    Full Text Available The article deals with the calculation and comparison indications of the condition of the prooxidant-antioxidant system (PAS of strains of Basidiomycetes under periodic surface cultivation on a glucose-peptone medium. The research material consisted of the mycelium and culture filtrate (CF from 57 strains, 52 of them belonging to 7 species of the order Agaricales and 5 belonging to 5 species of the order Polyporales. The intensity of the processes of lipid peroxidation was determined by a modified spectrophotometric method for contents of active products to thiobarbituric acid. Total antioxidant activity (АОА of the mycological material was evaluated by intensity of inhibition from accumulated products of lipid peroxide oxidation (LPO in a model reaction of oxidation by Twin-80 oxygen of the air. From the data obtained, indicators of prooxidant activity (POA, indicators of reserve of substrate peroxidation (SPO and the balance coefficient of the prooxidant-antioxidant system (CbPАS were calculated. It was established that strains of Basidiomycetes are characterized by significant predominance of prooxidant activity characteristic of PAS in the culture filtrate in comparison with the mycelium indicator. The highest values of POA in the Culture Filtrate were observed on the 12-th day of cultivation for the strain Р-089 genus Pleurotus and strain Gl-2 genus Ganoderma, and for the mycelium on the 9-th day of cultivation for the strains Р-сіtr, Р-089, Р-er and Р-082 of the genus Pleurotus. There is a direct dependence between the indicators of POA in the CF and mycelium for each strain, this dependence and level of indication do not reflect their systematic placement. We distinguished a more significant prevalence of indicators of reserve of substrates peroxidation of mycelium for most strains, than for such indicators with CF The highest value of reserve SPO of mycelium was recorded for strains Р-447, Р-998, Р-039, Р-94, Р-2175,

  14. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  15. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  16. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  17. The production and analysis of carotenoid preparations from some strains of xylotrophic Basidiomycetes

    Directory of Open Access Journals (Sweden)

    A. K. Velygodska

    2016-07-01

    Full Text Available The aim of the study was selection of optimal conditions for obtaining carotenoid drugs of mycelium origin from the basidiomycete strains Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18 and the study of antibacterial and total antioxidant activity of these compounds. The strains were surface grown on a glucose-peptone medium modified for each producer. The homogenized pigments of the mycelium strains were extracted with ethanol and the solvent was separated under vacuum at 60 ºC. The absorption spectra of the carotenoid drugs were recorded for alcoholic solutions at 350–500 nm. The antibacterial activity of the carotenoids was determined by the agar diffusion method, and the total antioxidant activity was determined by the DPPH-method. It was found that the optimum temperature for carotenoid extraction is 60 °C. The absorption spectra of carotenoid drugs showed three peaks in 420, 450 and 470 nm. These results respond to the β-carotene absorption spectra. The highest antioxidant activity was noted for carotenoid drugs from F. hepatica Fh-18 and L. sulphureus Ls-08 strains obtained at an extraction temperature of 40 and 60 °C respectively. The antibacterial activity of carotenoid drugs against the test cultures was not species dependent. Carotenoid drugs with a 20% concentrate obtained from the L. sulphureus Ls-08 strain had the highest antibacterial activity against the test cultures Staphylococcus aureus and Escherichia coli. Carotenoids from the mycelium of F. hepatica Fh-18 had the highest antibacterial activity against the test culture Candida albicans. Extraction temperature of 60 °C is optimal for mycelial yield of carotenoids from the studied strains. All preparations of carotenoids exhibited antibacterial activity against the test microorganism cultures. The carotenoid drugs obtained at 40 and 60 °C from the strains F. hepatica Fh-18 and L. sulphureus Ls-08 respectively showed the highest

  18. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  19. Identification of medically relevant species of arthroconidial yeasts by use of matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    Science.gov (United States)

    Kolecka, Anna; Khayhan, Kantarawee; Groenewald, Marizeth; Theelen, Bart; Arabatzis, Michael; Velegraki, Aristea; Kostrzewa, Markus; Mares, Mihai; Taj-Aldeen, Saad J; Boekhout, Teun

    2013-08-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) was used for an extensive identification study of arthroconidial yeasts, using 85 reference strains from the CBS-KNAW yeast collection and 134 clinical isolates collected from medical centers in Qatar, Greece, and Romania. The test set included 72 strains of ascomycetous yeasts (Galactomyces, Geotrichum, Saprochaete, and Magnusiomyces spp.) and 147 strains of basidiomycetous yeasts (Trichosporon and Guehomyces spp.). With minimal preparation time, MALDI-TOF MS proved to be an excellent diagnostic tool that provided reliable identification of most (98%) of the tested strains to the species level, with good discriminatory power. The majority of strains were correctly identified at the species level with good scores (>2.0) and seven of the tested strains with log score values between 1.7 and 2.0. The MALDI-TOF MS results obtained were consistent with validated internal transcribed spacer (ITS) and/or large subunit (LSU) ribosomal DNA sequencing results. Expanding the mass spectrum database by increasing the number of reference strains for closely related species, including those of nonclinical origin, should enhance the usefulness of MALDI-TOF MS-based diagnostic analysis of these arthroconidial fungi in medical and other laboratories.

  20. Identification of Medically Relevant Species of Arthroconidial Yeasts by Use of Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry

    Science.gov (United States)

    Kolecka, Anna; Khayhan, Kantarawee; Groenewald, Marizeth; Theelen, Bart; Arabatzis, Michael; Velegraki, Aristea; Kostrzewa, Markus; Mares, Mihai; Taj-Aldeen, Saad J.

    2013-01-01

    Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) was used for an extensive identification study of arthroconidial yeasts, using 85 reference strains from the CBS-KNAW yeast collection and 134 clinical isolates collected from medical centers in Qatar, Greece, and Romania. The test set included 72 strains of ascomycetous yeasts (Galactomyces, Geotrichum, Saprochaete, and Magnusiomyces spp.) and 147 strains of basidiomycetous yeasts (Trichosporon and Guehomyces spp.). With minimal preparation time, MALDI-TOF MS proved to be an excellent diagnostic tool that provided reliable identification of most (98%) of the tested strains to the species level, with good discriminatory power. The majority of strains were correctly identified at the species level with good scores (>2.0) and seven of the tested strains with log score values between 1.7 and 2.0. The MALDI-TOF MS results obtained were consistent with validated internal transcribed spacer (ITS) and/or large subunit (LSU) ribosomal DNA sequencing results. Expanding the mass spectrum database by increasing the number of reference strains for closely related species, including those of nonclinical origin, should enhance the usefulness of MALDI-TOF MS-based diagnostic analysis of these arthroconidial fungi in medical and other laboratories. PMID:23678074

  1. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  2. Extension of Yeast Chronological Lifespan by Methylamine

    NARCIS (Netherlands)

    Kumar, Sanjeev; Lefevre, Sophie D.; Veenhuis, Marten; van der Klei, Ida J.

    2012-01-01

    Background: Chronological aging of yeast cells is commonly used as a model for aging of human post-mitotic cells. The yeast Saccharomyces cerevisiae grown on glucose in the presence of ammonium sulphate is mainly used in yeast aging research. We have analyzed chronological aging of the yeast

  3. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

    Directory of Open Access Journals (Sweden)

    De Lucia Marzia

    2010-09-01

    Full Text Available Abstract Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1, lipid/biomass (68% and lipid/glucose yields (16%. Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils.

  4. Indole-3-acetic acid production by newly isolated red yeast Rhodosporidium paludigenum.

    Science.gov (United States)

    Nutaratat, Pumin; Amsri, Weerawan; Srisuk, Nantana; Arunrattiyakorn, Panarat; Limtong, Savitree

    2015-01-01

    Indole 3-acetic acid (IAA) is the principal hormone which regulates various developmental and physiological processes in plants. IAA production is considered as a key trait for supporting plant growth. Hence, in this study, production of indole-3-acetic acid (IAA) by a basidiomycetous red yeast Rhodosporidium paludigenum DMKU-RP301 (AB920314) was investigated and improved by the optimization of the culture medium and culture conditions using one factor at a time (OFAT) and response surface methodology (RSM). The study considered the effects of incubation time, carbon and nitrogen sources, growth factor, tryptophan, temperature, shaking speed, NaCl and pH, on the production of IAA. The results showed that all the factors studied, except NaCl, affected IAA production by R. paludigenum DMKU-RP301. Maximum IAA production of 1,623.9 mg/l was obtained as a result of the studies using RSM. The optimal medium and growth conditions observed in this study resulted in an increase of IAA production by a factor of up to 5.0 compared to the unoptimized condition, i.e. when yeast extract peptone dextrose (YPD) broth supplemented with 0.1% l-tryptophan was used as the production medium. The production of IAA was then scaled up in a 2-l stirred tank fermenter, and the maximum IAA of 1,627.1 mg/l was obtained. This experiment indicated that the obtained optimal medium and condition (pH and temperature) from shaking flask production can be used for the production of IAA in a larger size production. In addition, the present research is the first to report on the optimization of IAA production by the yeast Rhodosporidium.

  5. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  6. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  7. Probiotic Yeasts and Their Properties

    Directory of Open Access Journals (Sweden)

    Hatice Yıldıran

    2017-10-01

    Full Text Available Probiotics are a group of organism those confer health benefit to consumers. There are lots of studies about health benefits of probiotic treatments. The more commonly used probiotic bacteria are bifidobacteria and lactic acid bacteria, such as lactobacilli, lactococci and streptococci. Microorganisms that are probiotic to humans also include yeasts, bacilli and enterococci. Probiotic yeasts have become a field of interest to scientists in recent years. Several previous studies showed that members of Saccharomyces genus can possess anti-bacterial and probiotic properties. Saccharomyces boulardii is non-pathogenic yeast used for many years as a probiotic agent to prevent or treat a variety of human gastrointestinal disorders. S. boulardii is commonly used in lyophilized form especially in the pharmaceutical industry. In this review, information about the probiotics, properties of probiotic yeasts, their usage fields is provided and the results of researches in this area has been presented.

  8. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Modeling Huntington disease in yeast

    Science.gov (United States)

    Mason, Robert P

    2011-01-01

    Yeast have been extensively used to model aspects of protein folding diseases, yielding novel mechanistic insights and identifying promising candidate therapeutic targets. In particular, the neurodegenerative disorder Huntington disease (HD), which is caused by the abnormal expansion of a polyglutamine tract in the huntingtin (htt) protein, has been widely studied in yeast. This work has led to the identification of several promising therapeutic targets and compounds that have been validated in mammalian cells, Drosophila and rodent models of HD. Here we discuss the development of yeast models of mutant htt toxicity and misfolding, as well as the mechanistic insights gleaned from this simple model. The role of yeast prions in the toxicity/misfolding of mutant htt is also highlighted. Furthermore, we provide an overview of the application of HD yeast models in both genetic and chemical screens, and the fruitful results obtained from these approaches. Finally, we discuss the future of yeast in neurodegenerative research, in the context of HD and other diseases. PMID:22052350

  10. Oral yeast colonization throughout pregnancy.

    Science.gov (United States)

    Rio, R; Simões-Silva, L; Garro, S; Silva, M-J; Azevedo, Á; Sampaio-Maia, B

    2017-03-01

    Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with non-pregnant women. The oral yeast colonization was assessed in saliva of 30 pregnant and non-pregnant women longitudinally over a 6-months period. Demographic information was collected, a non-invasive intra-oral examination was performed and saliva flow and pH were determined. Pregnant and non-pregnant groups were similar regarding age and level of education. Saliva flow rate did not differ, but saliva pH was lower in pregnant than in non-pregnant women. Oral yeast prevalence was higher in pregnant than in non-pregnant women, either in the first or in the third trimester, but did not attain statistical significance. In individuals colonized with yeast, the total yeast quantification (Log10CFU/mL) increase from the 1st to the 3rd trimester in pregnant women, but not in non-pregnant women. Pregnancy may favour oral yeast growth that may be associated with an acidic oral environment.

  11. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  12. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  13. Metabolic regulation of yeast

    Science.gov (United States)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  14. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  15. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta

    Science.gov (United States)

    Dongsheng Wei; Carl J. Houtman; Alexander N. Kapich; Christopher G. Hunt; Daniel Cullen; Kenneth E. Hammel

    2010-01-01

    Brown rot basidiomycetes initiate wood decay by producing extracellular reactive oxygen species that depolymerize the structural polysaccharides of lignocellulose. Secreted fungal hydroquinones are considered one contributor because they have been shown to reduce Fe3+, thus generating perhydroxyl radicals and Fe2+, which...

  16. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  17. Purification and Characterization of a Trehalose Synthase from the Basidiomycete Grifola frondosa

    Science.gov (United States)

    Saito, Koki; Kase, Toshiya; Takahashi, Eiichi; Takahashi, Eisaku; Horinouchi, Sueharu

    1998-01-01

    A trehalose synthase (TSase) that catalyzes the synthesis of trehalose from d-glucose and α-d-glucose 1-phosphate (α-d-glucose 1-P) was detected in a basidiomycete, Grifola frondosa. TSase was purified 106-fold to homogeneity with 36% recovery by ammonium sulfate precipitation and several steps of column chromatography. The native enzyme appears to be a dimer since it has apparent molecular masses of 120 kDa, as determined by gel filtration column chromatography, and 60 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Although TSase catalyzed the phosphorolysis of trehalose to d-glucose and α-d-glucose 1-P, in addition to the synthesis of trehalose from the two substrates, the TSase equilibrium strongly favors trehalose synthesis. The optimum temperatures for phosphorolysis and synthesis of trehalose were 32.5 to 35°C and 35 to 37.5°C, respectively. The optimum pHs for these reactions were 6.5 and 6.5 to 6.8, respectively. The substrate specificity of TSase was very strict: among eight disaccharides examined, only trehalose was phosphorolyzed, and only α-d-glucose 1-P served as a donor substrate with d-glucose as the acceptor in trehalose synthesis. Two efficient enzymatic systems for the synthesis of trehalose from sucrose were identified. In system I, the α-d-glucose 1-P liberated by 1.05 U of sucrose phosphorylase was linked with d-glucose by 1.05 U of TSase, generating trehalose at the initial synthesis rate of 18 mmol/h in a final yield of 90 mol% under optimum conditions (300 mM each sucrose and glucose, 20 mM inorganic phosphate, 37.5°C, and pH 6.5). In system II, we added 1.05 U of glucose isomerase and 20 mM MgSO4 to the reaction mixture of system I to convert fructose, a by-product of the sucrose phosphorylase reaction, into glucose. This system generated trehalose at the synthesis rate of 4.5 mmol/h in the same final yield. PMID:9797287

  18. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  19. Genomics and Transcriptomics Analyses of the Oil-Accumulating Basidiomycete Yeast Trichosporon oleaginosus : Insights into Substrate Utilization and Alternative Evolutionary Trajectories of Fungal Mating Systems

    NARCIS (Netherlands)

    Kourist, Robert; Bracharz, Felix; Lorenzen, Jan; Kracht, Octavia N; Chovatia, Mansi; Daum, Chris; Deshpande, Shweta; Lipzen, Anna; Nolan, Matt; Ohm, Robin A; Grigoriev, Igor V; Sun, Sheng; Heitman, Joseph; Brück, Thomas; Nowrousian, Minou

    2015-01-01

    UNLABELLED: Microbial fermentation of agro-industrial waste holds great potential for reducing the environmental impact associated with the production of lipids for industrial purposes from plant biomass. However, the chemical complexity of many residues currently prevents efficient conversion into

  20. Nuclear Transport of Yeast Proteasomes

    Directory of Open Access Journals (Sweden)

    Cordula Enenkel

    2014-10-01

    Full Text Available Proteasomes are conserved protease complexes enriched in the nuclei of dividing yeast cells, a major site for protein degradation. If yeast cells do not proliferate and transit to quiescence, metabolic changes result in the dissociation of proteasomes into proteolytic core and regulatory complexes and their sequestration into motile cytosolic proteasome storage granuli. These granuli rapidly clear with the resumption of growth, releasing the stored proteasomes, which relocalize back to the nucleus to promote cell cycle progression. Here, I report on three models of how proteasomes are transported from the cytoplasm into the nucleus of yeast cells. The first model applies for dividing yeast and is based on the canonical pathway using classical nuclear localization sequences of proteasomal subcomplexes and the classical import receptor importin/karyopherin αβ. The second model applies for quiescent yeast cells, which resume growth and use Blm10, a HEAT-like repeat protein structurally related to karyopherin β, for nuclear import of proteasome core particles. In the third model, the fully-assembled proteasome is imported into the nucleus. Our still marginal knowledge about proteasome dynamics will inspire the discussion on how protein degradation by proteasomes may be regulated in different cellular compartments of dividing and quiescent eukaryotic cells.

  1. Sorption of grape proanthocyanidins and wine polyphenols by yeasts, inactivated yeasts, and yeast cell walls.

    Science.gov (United States)

    Mekoue Nguela, J; Sieczkowski, N; Roi, S; Vernhet, A

    2015-01-21

    Inactivated yeast fractions (IYFs) can be used in enology to improve the stability and mouthfeel of red wines. However, information concerning the mechanisms involved and the impact of the IYF characteristics is scarce. Adsorption isotherms were used to investigate interactions between grape proanthocyanidin fractions (PAs) or wine polyphenols (WP) and a commercial yeast strain (Y), the inactivated yeast (IY), the yeast submitted to autolyzis and inactivation (A-IY), and the cell walls obtained by mechanical disruption (CW). High affinity isotherms and high adsorption capacities were observed for grape PAs and whole cells (Y, IY, and A-IY). Affinity and adsorbed amount were lower with wine PAs, due to chemical changes occurring during winemaking. By contrast to whole cells, grape PAs and WP adsorption on CW remained very low. This raises the issue of the part played by cell walls in the interactions between yeast and proanthocyanidins and suggests the passage of the latter through the wall pores and their interaction with the plasma membrane.

  2. Chromatin and Transcription in Yeast

    Science.gov (United States)

    Rando, Oliver J.; Winston, Fred

    2012-01-01

    Understanding the mechanisms by which chromatin structure controls eukaryotic transcription has been an intense area of investigation for the past 25 years. Many of the key discoveries that created the foundation for this field came from studies of Saccharomyces cerevisiae, including the discovery of the role of chromatin in transcriptional silencing, as well as the discovery of chromatin-remodeling factors and histone modification activities. Since that time, studies in yeast have continued to contribute in leading ways. This review article summarizes the large body of yeast studies in this field. PMID:22345607

  3. Emulsifying activity of hydrocarbonoclastic marine yeasts

    Digital Repository Service at National Institute of Oceanography (India)

    Gupta, R.

    Marine yeast growth on four petroleum hydrocarbons induced the production of extracellular emulsifying agents (biosurfactants). Out of the 17 marine yeast isolates tested, 7 isolates, i.e., Candida parapsilosis, C. cantarelli, C. membranae...

  4. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  5. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  6. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  7. De novo transcriptome sequencing and comprehensive analysis of the heat stress response genes in the basidiomycetes fungus Ganoderma lucidum.

    Science.gov (United States)

    Tan, Xiaoyan; Sun, Junshe; Ning, Huijuan; Qin, Zifang; Miao, Yuxin; Sun, Tian; Zhang, Xiuqing

    2018-03-29

    Ganoderma lucidum is a valuable basidiomycete with numerous pharmacological compounds, which is widely consumed throughout China. We previously found that the polysaccharide content of Ganoderma lucidum fruiting bodies could be significantly improved by 45.63% with treatment of 42 °C heat stress (HS) for 2 h. To further investigate genes involved in HS response and explore the mechanisms of HS regulating the carbohydrate metabolism in Ganoderma lucidum, high-throughput RNA-Seq was conducted to analyse the difference between control and heat-treated mycelia at transcriptome level. We sequenced six cDNA libraries with three from control group (mycelia cultivated at 28 °C) and three from heat-treated group (mycelia subjected to 42 °C for 2 h). A total of 99,899 transcripts were generated using Trinity method and 59,136 unigenes were annotated by seven public databases. Among them, 2790 genes were identified to be differential expressed genes (DEGs) under HS condition, which included 1991 up-regulated and 799 down-regulated. 176 DEGs were then manually classified into five main responsive-related categories according to their putative functions and possible metabolic pathways. These groups include stress resistance-related factors; protein assembly, transportation and degradation; signal transduction; carbohydrate metabolism and energy provision-related process; other related functions, suggesting that a series of metabolic pathways in Ganoderma lucidum are activated by HS and the response mechanism involves a complex molecular network which needs further study. Remarkably, 48 DEGs were found to regulate carbohydrate metabolism, both in carbohydrate hydrolysis for energy provision and polysaccharide synthesis. In summary, this comprehensive transcriptome analysis will provide enlarged resource for further investigation into the molecular mechanisms of basidiomycete under HS condition. Copyright © 2017. Published by Elsevier B.V.

  8. Yeast as factory and factotum.

    Science.gov (United States)

    Dixon, B

    2000-02-01

    After centuries of vigorous activity in making fine wines, beers and breads, Saccharomyces cerevisiae is now acquiring a rich new portfolio of skills, bestowed by genetic manipulation. As shown in a recent shop-window of research supported by the European Commission, yeasts will soon be benefiting industries as diverse as fish farming, pharmaceuticals and laundering.

  9. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    2014-03-15

    Mar 15, 2014 ... media (figure 2). On solid substrates exposed to air, cells that do not produce flocculins will develop nonadhesive colonies, such as seen for the ..... Programmed cell death. Escherichia coli, protozoa, bacteria, slime moulds. Yeast apoptosis (Madeo et al. 1997; Honigberg 2011). Communication via.

  10. Surplus yeast tank failing catastrophically

    DEFF Research Database (Denmark)

    Hedlund, Frank Huess

    2016-01-01

    GOOD REASON FOR CAUTION I A large surplus yeast tank shot into the air leaving the floor plate and the contents behind. Although not designed for overpressure, the tank was kept at “very slight overpressure” to suppress nuisance foaming. The brewery was unaware of the hazards of compressed air...

  11. Yeast genomics on food flavours

    NARCIS (Netherlands)

    Schoondermark-Stolk, Sung Ah

    2005-01-01

    The appearance and concentration of the fusel alcohol 3-methyl-1-butanol is important for the flavour of fermented foods. 3-Methyl-1-butanol is formed by yeast during the conversion of L-leucine. Identification of the enzymes and genes involved in the formation of 3-methyl-1-butanol is a major

  12. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    2014-03-15

    Mar 15, 2014 ... Social theory has provided a useful framework for research with microorganisms. Here I describe the advantages and possible risks of using a well-known model organism, the unicellular yeast Saccharomyces cerevisiae, for sociobio- logical research. I discuss the problems connected with clear ...

  13. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  14. Genomic insights into the atopic eczema-associated skin commensal yeast Malassezia sympodialis.

    Science.gov (United States)

    Gioti, Anastasia; Nystedt, Björn; Li, Wenjun; Xu, Jun; Andersson, Anna; Averette, Anna F; Münch, Karin; Wang, Xuying; Kappauf, Catharine; Kingsbury, Joanne M; Kraak, Bart; Walker, Louise A; Johansson, Henrik J; Holm, Tina; Lehtiö, Janne; Stajich, Jason E; Mieczkowski, Piotr; Kahmann, Regine; Kennell, John C; Cardenas, Maria E; Lundeberg, Joakim; Saunders, Charles W; Boekhout, Teun; Dawson, Thomas L; Munro, Carol A; de Groot, Piet W J; Butler, Geraldine; Heitman, Joseph; Scheynius, Annika

    2013-01-22

    Malassezia commensal yeasts are associated with a number of skin disorders, such as atopic eczema/dermatitis and dandruff, and they also can cause systemic infections. Here we describe the 7.67-Mbp genome of Malassezia sympodialis, a species associated with atopic eczema, and contrast its genome repertoire with that of Malassezia globosa, associated with dandruff, as well as those of other closely related fungi. Ninety percent of the predicted M. sympodialis protein coding genes were experimentally verified by mass spectrometry at the protein level. We identified a relatively limited number of genes related to lipid biosynthesis, and both species lack the fatty acid synthase gene, in line with the known requirement of these yeasts to assimilate lipids from the host. Malassezia species do not appear to have many cell wall-localized glycosylphosphatidylinositol (GPI) proteins and lack other cell wall proteins previously identified in other fungi. This is surprising given that in other fungi these proteins have been shown to mediate interactions (e.g., adhesion and biofilm formation) with the host. The genome revealed a complex evolutionary history for an allergen of unknown function, Mala s 7, shown to be encoded by a member of an amplified gene family of secreted proteins. Based on genetic and biochemical studies with the basidiomycete human fungal pathogen Cryptococcus neoformans, we characterized the allergen Mala s 6 as the cytoplasmic cyclophilin A. We further present evidence that M. sympodialis may have the capacity to undergo sexual reproduction and present a model for a pseudobipolar mating system that allows limited recombination between two linked MAT loci. Malassezia commensal yeasts are associated with a number of skin disorders. The previously published genome of M. globosa provided some of the first insights into Malassezia biology and its involvement in dandruff. Here, we present the genome of M. sympodialis, frequently isolated from patients with

  15. Endoplasmic reticulum involvement in yeast cell death

    International Nuclear Information System (INIS)

    Nicanor Austriaco, O.

    2012-01-01

    Yeast cells undergo programed cell death (PCD) with characteristic markers associated with apoptosis in mammalian cells including chromatin breakage, nuclear fragmentation, reactive oxygen species generation, and metacaspase activation. Though significant research has focused on mitochondrial involvement in this phenomenon, more recent work with both Saccharomyces cerevisiae and Schizosaccharomyces pombe has also implicated the endoplasmic reticulum (ER) in yeast PCD. This minireview provides an overview of ER stress-associated cell death (ER-SAD) in yeast. It begins with a description of ER structure and function in yeast before moving to a discussion of ER-SAD in both mammalian and yeast cells. Three examples of yeast cell death associated with the ER will be highlighted here including inositol starvation, lipid toxicity, and the inhibition of N-glycosylation. It closes by suggesting ways to further examine the involvement of the ER in yeast cell death.

  16. Heterologous carotenoid production in Saccharomyces cerevisiae induces the pleiotropic drug resistance stress response

    NARCIS (Netherlands)

    Verwaal, R.; Jiang, Y.; Wang, J.; Daran, J.M.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2010-01-01

    To obtain insight into the genome-wide transcriptional response of heterologous carotenoid production in Saccharomyces cerevisiae, the transcriptome of two different S. cerevisiae strains overexpressing carotenogenic genes from the yeast Xanthophyllomyces dendrorhous grown in carbon-limited

  17. Stone-Eating Fungi: Mechanisms in Bioweathering and the Potential Role of Laccases in Black Slate Degradation With the Basidiomycete Schizophyllum commune.

    Science.gov (United States)

    Kirtzel, Julia; Siegel, Daniela; Krause, Katrin; Kothe, Erika

    2017-01-01

    Many enzymes, such as laccases, are involved in the saprotrophic lifestyle of fungi and the effects of those may be linked to enhanced bioweathering on stone surfaces. To test this hypothesis, we studied the decomposition of kerogen-enriched lithologies, especially with black slate containing up to 20% of C org . Indeed, a formation of ditches with attached hyphal material could be observed. To address enzymes involved, proteomics was performed and one group of enzymes, the multicopper oxidase family members of laccases, was specifically investigated. A role in bioweathering of rocks containing high contents of organic carbon in the form of kerogen could be shown using the basidiomycete Schizophyllum commune, a white rot fungus that has been used as a model organism to study the role of filamentous basidiomycete fungi in bioweathering of black slate. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  19. Yeast Isolation for Bioethanol Production

    Directory of Open Access Journals (Sweden)

    EKA RURIANI

    2012-09-01

    Full Text Available We have isolated 12 yeast isolates from five different rotten fruits by using a yeast glucose chloramphenicol agar (YGCA medium supplemented with tetracycline. From pre-screening assay, four isolates exhibited higher substrate (glucose-xylose consumption efficiency in the reaction tube fermentation compared to Saccharomyces cerevisiae dan Saccharomyces ellipsoids as the reference strains. Based on the fermentation process in gooseneck flasks, we observed that two isolates (K and SB showed high fermentation efficiency both in sole glucose and mixed glucose-xylose substrate. Moreover, isolates K and SB produced relatively identical level of ethanol concentration compared to the reference strains. Isolates H and MP could only produce high levels of ethanol in glucose fermentation, while only half of that amount of ethanol was detected in glucose-xylose fermentation. Isolate K and SB were identified as Pichia kudriavzeevii (100% based on large sub unit (LSU ribosomal DNA D1/D2 region.

  20. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  1. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  2. Biopharmaceutical discovery and production in yeast.

    Science.gov (United States)

    Meehl, Michael A; Stadheim, Terrance A

    2014-12-01

    The selection of an expression platform for recombinant biopharmaceuticals is often centered upon suitable product titers and critical quality attributes, including post-translational modifications. Although notable differences between microbial, yeast, plant, and mammalian host systems exist, recent advances have greatly mitigated any inherent liabilities of yeasts. Yeast expression platforms are important to both the supply of marketed biopharmaceuticals and the pipelines of novel therapeutics. In this review, recent advances in yeast-based expression of biopharmaceuticals will be discussed. The advantages of using glycoengineered yeast as a production host and in the discovery space will be illustrated. These advancements, in turn, are transforming yeast platforms from simple production systems to key technological assets in the discovery and selection of biopharmaceutical lead candidates. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Revaluation of Waste Yeast from Beer Production

    OpenAIRE

    Nicoleta Suruceanu; Sonia Socaci; Teodora Coldea; Elena Mudura

    2013-01-01

    Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, ident...

  4. QUALITY ANALYSIS OF THE YEAST SACCHAROMYCES CEREVISIAE

    OpenAIRE

    Adelya Marselovna Ermakova* , Elena Evgenievna Zinurova , Ramil Raisovich Levashov , Zamira Shamilovna Mingaleeva , Olga Alekseevna Reshetnik

    2017-01-01

    Yeast, as a part of the recipe mass, must have high fermentation activity, and also have the ability to expand under anaerobic conditions, and to adapt quickly to a changing nutrient medium, in order to obtain high-quality bakery products. Preliminary activation of the pressed bakery yeast allows to shorten the duration of the technological process for the production of bakery products, and to reduce the cost of the final product. The experiments on the preliminary activation of yeast were co...

  5. Fatty acid profiles of polar and neutral lipids of ten species of higher basidiomycetes indigenous to eastern Canada.

    Science.gov (United States)

    Pedneault, Karine; Angers, Paul; Gosselin, André; Tweddell, Russell J

    2008-12-01

    Neutral and polar lipid contents of ten species of edible mushrooms indigenous to Eastern Canada belonging to the families Agaricaceae, Amanitaceae, Boletaceae, Coprinaceae, Ganodermataceae, and Lycoperdaceae were analysed. The total lipid content of the species analysed ranged from 3.1% (Ganoderma applanatum) to 16% (w/w) d.w. (Amanita vaginata) and averaged 8.6% (w/w) d.w. Polar lipids accounted for more than 50% of the total lipids in most species and differences were observed between neutral and polar lipid contents according to the species analysed. In both lipid fractions, high proportions of unsaturated fatty acids (FAs) ranging from 62.7 to 82.3% (polar lipids) and 59.8 to 82.5% (neutral lipids) of the total FAs were observed. Analysis of FA profiles showed that both neutral and polar lipids were mainly composed of linoleic (18:2 Delta9c,12c), oleic (18:1 Delta9c), and palmitic (16:0) acids. Significant differences (P<0.05) in the contents of specific FAs were observed between mushroom species. Among the 44 FAs detected in the species analysed, the occurrence of cis-11-heptadecenoic (17:1 Delta11c) acid is reported for the first time in basidiomycetes, while elaidic acid (18:1 Delta9t) is reported for the first time in fungi.

  6. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  7. Degradation of C60 Fullerol by White-Rot Basidiomycete Fungi: Implications for Environmental Release of Nanomaterials

    Science.gov (United States)

    Schreiner, K. M.; Filley, T. R.; Bolskar, R. D.; Blanchette, R. A.

    2008-12-01

    Industrially produced carbon-based nanomaterials, including fullerenes and fullerols, will be introduced into the environment in increasing amounts over the next century. Oxygenated fullerenes are likely to be produced in the environment through both biotic and abiotic weathering, and yet the environmental fate of compounds like hydroxylated fullerenes are almost unknown. This study examines the ability of two white rot basidiomycete fungi (Phlebia tremellosa and Trametes versicolor) to metabolize and degrade 13C-labeled C60 fullerol. Both of these fungi were shown to degrade fullerol to CO2 both in the presence of wood tissue and without, and incorporate trace amounts of the carbon into fungal biomass. Absorbance data also indicate that a significant portion of the original fullerol was broken down into small molecular weight metabolites. Phlebia tremellosa proved to be, in general, more aggressive towards fullerol degradation than Trametes versicolor. These findings represent the report of fungal degradation of this important nanomaterial and also provide valuable information about the possible environmental fates of this compound.

  8. VOLATILE COMPOUNDS IN THE AROMA OF THREE SPECIES OF WOOD-ROTTING BASIDIOMYCETES AND THEIR ANTIFUNGAL POTENTIAL

    Directory of Open Access Journals (Sweden)

    Cristiana Virginia PETRE

    2017-12-01

    Full Text Available This study aims to determine the volatile organic compounds synthesized by three species of wood-rotting basidiomycetes: Coriolopsis gallica, Megacollybia platyphylla and Lentinus arcularius and test their antifungal potential. The species were cultivated on liquid media and kept for 25 days at 25 °C. The surface cultures were then homogenized, filtrated and extracted using solid-phase extraction and analyzed by GC-MS. The volatile compounds identified were mainly alcohols, ketones, aldehydes and terpenes. The most common volatiles identified in the experiment are: 1-octen-3-ol, 3-hexanol, 3-methyl-1-butanol, 3-octanone, 2-hexanone, benzaldehyde, and limonene. The volatiles metabolites of these species were tested for their antifungal activity using the bi-compartmented Petri dishes method against two species of plant pathogenic fungi: Fusarium solani and Sclerotinia sclerotiorum, on three media. The volatiles produced by Coriolopsis gallica showed the highest antifungal potential against the phytopathogens. The results revealed the importance of media composition in the synthesis of antifungal volatile compounds.

  9. Spatial mapping of extracellular oxidant production by a white rot basidiomycete on wood reveals details of ligninolytic mechanism.

    Science.gov (United States)

    Hunt, Christopher G; Houtman, Carl J; Jones, Don C; Kitin, Peter; Korripally, Premsagar; Hammel, Kenneth E

    2013-03-01

    Oxidative cleavage of the recalcitrant plant polymer lignin is a crucial step in global carbon cycling, and is accomplished most efficiently by fungi that cause white rot of wood. These basidiomycetes secrete many enzymes and metabolites with proposed ligninolytic roles, and it is not clear whether all of these agents are physiologically important during attack on natural lignocellulosic substrates. One new approach to this problem is to infer properties of ligninolytic oxidants from their spatial distribution relative to the fungus on the lignocellulose. We grew Phanerochaete chrysosporium on wood sections in the presence of oxidant-sensing beads based on the ratiometric fluorescent dye BODIPY 581/591. The beads, having fixed locations relative to the fungal hyphae, enabled spatial mapping of cumulative extracellular oxidant distributions by confocal fluorescence microscopy. The results showed that oxidation gradients occurred around the hyphae, and data analysis using a mathematical reaction-diffusion model indicated that the dominant oxidant during incipient white rot had a half-life under 0.1 s. The best available hypothesis is that this oxidant is the cation radical of the secreted P. chrysosporium metabolite veratryl alcohol. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  10. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  11. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  12. YMDB: the Yeast Metabolome Database

    Science.gov (United States)

    Jewison, Timothy; Knox, Craig; Neveu, Vanessa; Djoumbou, Yannick; Guo, An Chi; Lee, Jacqueline; Liu, Philip; Mandal, Rupasri; Krishnamurthy, Ram; Sinelnikov, Igor; Wilson, Michael; Wishart, David S.

    2012-01-01

    The Yeast Metabolome Database (YMDB, http://www.ymdb.ca) is a richly annotated ‘metabolomic’ database containing detailed information about the metabolome of Saccharomyces cerevisiae. Modeled closely after the Human Metabolome Database, the YMDB contains >2000 metabolites with links to 995 different genes/proteins, including enzymes and transporters. The information in YMDB has been gathered from hundreds of books, journal articles and electronic databases. In addition to its comprehensive literature-derived data, the YMDB also contains an extensive collection of experimental intracellular and extracellular metabolite concentration data compiled from detailed Mass Spectrometry (MS) and Nuclear Magnetic Resonance (NMR) metabolomic analyses performed in our lab. This is further supplemented with thousands of NMR and MS spectra collected on pure, reference yeast metabolites. Each metabolite entry in the YMDB contains an average of 80 separate data fields including comprehensive compound description, names and synonyms, structural information, physico-chemical data, reference NMR and MS spectra, intracellular/extracellular concentrations, growth conditions and substrates, pathway information, enzyme data, gene/protein sequence data, as well as numerous hyperlinks to images, references and other public databases. Extensive searching, relational querying and data browsing tools are also provided that support text, chemical structure, spectral, molecular weight and gene/protein sequence queries. Because of S. cervesiae's importance as a model organism for biologists and as a biofactory for industry, we believe this kind of database could have considerable appeal not only to metabolomics researchers, but also to yeast biologists, systems biologists, the industrial fermentation industry, as well as the beer, wine and spirit industry. PMID:22064855

  13. Adhesive interactions between medically important yeasts and bacteria

    NARCIS (Netherlands)

    Millsap, KW; van der Mei, HC; Busscher, HJ; Bos, R.R.M.

    Yeasts are being increasingly identified as important organisms in human infections. Adhesive interactions between yeasts and bacteria may contribute to yeast retention al body sites. Methods for studying adhesive interactions between bacterial strains are well known, and range from simple

  14. Cryopreservation of Filamentous Micromycetes and Yeasts Using Perlite

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Kubátová, A.; Váňová, M.; Janderová, B.; Nerud, František

    2007-01-01

    Roč. 51, č. 2 (2007), s. 153-157 ISSN 0015-5632 R&D Projects: GA MŠk(CZ) 0021620828 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje Keywords : cryopreservation * perlite * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  15. Virgin olive oil yeasts: A review.

    Science.gov (United States)

    Ciafardini, Gino; Zullo, Biagi Angelo

    2018-04-01

    This review summarizes current knowledge on virgin olive oil yeasts. Newly produced olive oil contains solid particles and micro drops of vegetation water in which yeasts reproduce to become the typical microbiota of olive oil. To date, about seventeen yeast species have been isolated from different types of olive oils and their by-products, of which six species have been identified as new species. Certain yeast species contribute greatly to improving the sensorial characteristics of the newly produced olive oil, whereas other species are considered harmful as they can damage the oil quality through the production of unpleasant flavors and triacylglycerol hydrolysis. Studies carried out in certain yeast strains have demonstrated the presence of defects in olive oil treated with Candida adriatica, Nakazawaea wickerhamii and Candida diddensiae specific strains, while other olive oil samples treated with other Candida diddensiae strains were defect-free after four months of storage and categorized as extra virgin. A new acetic acid producing yeast species, namely, Brettanomyces acidodurans sp. nov., which was recently isolated from olive oil, could be implicated in the wine-vinegary defect of the product. Other aspects related to the activity of the lipase-producing yeasts and the survival of the yeast species in the flavored olive oils are also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Biodiesel generation from oleaginous yeast Rhodotorula glutinis ...

    African Journals Online (AJOL)

    SERVER

    2007-09-19

    Sep 19, 2007 ... This study explored a strategy to convert agricultural and forestry residues into microbial lipid, which could be further transformed into biodiesel. Among the 250 yeast strains screened for xylose assimilating capacity, eight oleaginous yeasts were selected by Sudan Black B test. The lipid content of these 8 ...

  17. yeast transformation of Mucor circinelloides Tieghe

    African Journals Online (AJOL)

    GRACE

    2006-05-02

    May 2, 2006 ... enhanced growth by 32.95, 65.07 and 63.82%, respectively, over control mean growth. Proliferating yeast cells induced from .... Table 2. A nested model analysis of variance of growth data of induced yeast cells of M. ..... Pullman B (ed) Frontiers in Physicochemical Biology. New York: Academic Press. p.

  18. Yeasts in sustainable bioethanol production: A review.

    Science.gov (United States)

    Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis

    2017-07-01

    Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

  19. Exobiopolymer from polyhydroxyalkanoate-producing transgenic yeast

    African Journals Online (AJOL)

    Recently, the wild type yeast Kloeckera sp. strain KY1 was equipped in their cytoplasm with the phaABC operon containing genes phbA, phbB and phbC of the PHA biosynthetic pathway of Ralstonia eutropha. Unpredicted, resulted transgenic yeast strain KY1/PHA was able to synthesize another exopolymer beside the ...

  20. Biosynthesis of polyhydroxyalkanotes in wildtype yeasts | Desuoky ...

    African Journals Online (AJOL)

    Biosynthesis of the biodegradable polymers polyhydroxyalkanotes (PHAs) are studied extensively in wild type and genetically modified prokaryotic cells, however the content and structure of PHA in wild type yeasts are not well documented. The purpose of this study was to screen forty yeast isolates collected from different ...

  1. Comparative genomics of biotechnologically important yeasts

    NARCIS (Netherlands)

    Riley, Robert; Haridas, Sajeet; Wolfe, Kenneth H; Lopes, Mariana R; Hittinger, Chris Todd; Göker, Markus; Salamov, Asaf A; Wisecaver, Jennifer H; Long, Tanya M; Calvey, Christopher H; Aerts, Andrea L; Barry, Kerrie W; Choi, Cindy; Clum, Alicia; Coughlan, Aisling Y; Deshpande, Shweta; Douglass, Alexander P; Hanson, Sara J; Klenk, Hans-Peter; LaButti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lipzen, Anna M; Meier-Kolthoff, Jan P; Ohm, Robin A; Otillar, Robert P; Pangilinan, Jasmyn L; Peng, Yi; Rokas, Antonis; Rosa, Carlos A; Scheuner, Carmen; Sibirny, Andriy A; Slot, Jason C; Stielow, J Benjamin; Sun, Hui; Kurtzman, Cletus P; Blackwell, Meredith; Grigoriev, Igor V; Jeffries, Thomas W

    2016-01-01

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the

  2. Yeast (Saccharomyces cereveresiae) Supplementation In High ...

    African Journals Online (AJOL)

    A four-week trial to assess the impact of yeast supplementation on the performance characteristics of broiler starters fed high levels of rice bran with or without yeast addition, was conducted using two hundred and forty day old broilers of the Bova nera strain. The chicks were divided into 15 groups of 16 chicks each.

  3. Measurement of yeast invertase during alcoholic fermentation

    Energy Technology Data Exchange (ETDEWEB)

    Naudin, O.; Boudarel, M.J.; Ramirez, A.

    1986-01-01

    In continuous alcoholic fermentation of molasses by Saccharomyces cerevisiae, it is important but difficult to know the variation of yeast physiological state with time, so as to maintain maximum yeast productivity. We decided to quantify invertase activity, for which there are few if any appropriate methods (Vitolo and Borzani, Analytical Biochemistry 130, 469-470, 1983). 1 reference.

  4. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  5. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  6. Purification, characterization and cDNA cloning of an endo-exonuclease from the basidiomycete fungus Armillaria mellea.

    Science.gov (United States)

    Healy, V; Doonan, S; McCarthy, T V

    1999-01-01

    We have purified an endo-exonuclease from the fruiting body of the basidiomycete fungus Armillaria mellea by using an ethanol fractionation step, followed by two rounds of column chromatography. The enzyme had an apparent molecular mass of 17500 Da and was shown to exist as a monomer by gel-filtration analysis. The nuclease was active on both double-stranded and single-stranded DNA but not on RNA. It was optimally active at pH8.5 and also exhibited a significant degree of thermostability. Three bivalent metal ions, Mg2+, Co2+ and Mn2+, acted as cofactors in the catalysis. It was also inhibited by high salt concentrations: activity was completely abolished at 150 mM NaCl. The nuclease possessed both endonuclease activity on supercoiled DNA and a 3'-5' (but not a 5'-3') exonuclease activity. It generated 5'-phosphomonoesters on its products that, after a prolonged incubation, were hydrolysed to a mixture of free mononucleotides and small oligonucleotides ranging in size from two to eight bases. Elucidation of its N-terminal amino acid sequence permitted the cDNA cloning of the A. mellea nuclease via a PCR-based approach. Peptide mapping of the purified enzyme generated patterns consistent with the amino acid sequence coded for by the cloned cDNA. A BLAST search of the SwissProt database revealed that A. mellea nuclease shared significant amino acid similarity with two nucleases from Bacillus subtilis, suggesting that the three might constitute a distinct class of nucleolytic enzymes. PMID:10215611

  7. Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.

    Science.gov (United States)

    Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo

    2016-10-24

    Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Engineering alcohol tolerance in yeast

    Science.gov (United States)

    Lam, Felix H.; Ghaderi, Adel; Fink, Gerald R.; Stephanopoulos, Gregory

    2015-01-01

    Ethanol toxicity in yeast Saccharomyces cerevisiae limits titer and productivity in the industrial production of transportation bioethanol. We show that strengthening the opposing potassium and proton electrochemical membrane gradients is a mechanism that enhances general resistance to multiple alcohols. Elevation of extracellular potassium and pH physically bolster these gradients, increasing tolerance to higher alcohols and ethanol fermentation in commercial and laboratory strains (including a xylose-fermenting strain) under industrial-like conditions. Production per cell remains largely unchanged with improvements deriving from heightened population viability. Likewise, up-regulation of the potassium and proton pumps in the laboratory strain enhances performance to levels exceeding industrial strains. Although genetically complex, alcohol tolerance can thus be dominated by a single cellular process, one controlled by a major physicochemical component but amenable to biological augmentation. PMID:25278607

  9. Yeast-based biosensors: design and applications.

    Science.gov (United States)

    Adeniran, Adebola; Sherer, Michael; Tyo, Keith E J

    2015-02-01

    Yeast-based biosensing (YBB) is an exciting research area, as many studies have demonstrated the use of yeasts to accurately detect specific molecules. Biosensors incorporating various yeasts have been reported to detect an incredibly large range of molecules including but not limited to odorants, metals, intracellular metabolites, carcinogens, lactate, alcohols, and sugars. We review the detection strategies available for different types of analytes, as well as the wide range of output methods that have been incorporated with yeast biosensors. We group biosensors into two categories: those that are dependent upon transcription of a gene to report the detection of a desired molecule and those that are independent of this reporting mechanism. Transcription-dependent biosensors frequently depend on heterologous expression of sensing elements from non-yeast organisms, a strategy that has greatly expanded the range of molecules available for detection by YBBs. Transcription-independent biosensors circumvent the problem of sensing difficult-to-detect analytes by instead relying on yeast metabolism to generate easily detected molecules when the analyte is present. The use of yeast as the sensing element in biosensors has proven to be successful and continues to hold great promise for a variety of applications. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  10. Yeast cell factories on the horizon

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2015-01-01

    been engineered to make chemicals at industrial scale (e.g., succinic acid, lactic acid, resveratrol) and advanced biofuels (e.g., isobutanol) (1). On page 1095 of this issue, Galanie et al. (2) demonstrate that yeast can now be engineered to produce opioids (2), a major class of compounds used...... for treating severe pain. Their study represents a tour de force in the metabolic engineering of yeast, as it involved the expression of genes for more than 20 enzymatic activities from plants, mammals, bacteria, and yeast itself. It clearly represents a breakthrough advance for making complex natural products...

  11. 21 CFR 184.1983 - Bakers yeast extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b) The...

  12. 21 CFR 172.325 - Bakers yeast protein.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast protein. 172.325 Section 172.325 Food... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be safely used in food in accordance with the following conditions: (a) Bakers yeast protein is the...

  13. Immobilization of yeast cells by radiation-induced polymerization

    International Nuclear Information System (INIS)

    Fujimura, T.; Kaetsu, I.

    1982-01-01

    Radiation-induced polymerization method was applied to the immobilization of yeast cells. The effects of irradiation, cooling and monomer, which are neccessary for polymerization, were recovered completely by subsequent aerobical incubation of yeast cells. The ethanol productive in immobilized yeast cells increased with the increase of aerobical incubation period. The growth of yeast cells in immobilized yeast cells was indicated. The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. (orig.)

  14. YeastWeb: a workset-centric web resource for gene family analysis in yeast

    Directory of Open Access Journals (Sweden)

    Bao Haihua

    2010-07-01

    Full Text Available Abstract Background Currently, a number of yeast genomes with different physiological features have been sequenced and annotated, which provides invaluable information to investigate yeast genetics, evolutionary mechanism, structure and function of gene families. Description YeastWeb is a novel database created to provide access to gene families derived from the available yeast genomes by assigning the genes into putative families. It has many useful features that complement existing databases, such as SGD, CYGD and Génolevures: 1 Detailed computational annotation was conducted with each entry with InterProScan, EMBOSS and functional/pathway databases, such as GO, COG and KEGG; 2 A well established user-friendly environment was created to allow users to retrieve the annotated genes and gene families using functional classification browser, keyword search or similarity-based search; 3 Workset offers users many powerful functions to manage the retrieved data efficiently, associate the individual items easily and save the intermediate results conveniently; 4 A series of comparative genomics and molecular evolution analysis tools are neatly implemented to allow users to view multiple sequence alignments and phylogenetic tree of gene families. At present, YeastWeb holds the gene families clustered from various MCL inflation values from a total of 13 available yeast genomes. Conclusions Given the great interest in yeast research, YeastWeb has the potential to become a useful resource for the scientific community of yeast biologists and related researchers investigating the evolutionary relationship of yeast gene families. YeastWeb is available at http://centre.bioinformatics.zj.cn/Yeast/.

  15. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  16. Fatty acids from oleaginous yeasts and yeast-like fungi and their potential applications.

    Science.gov (United States)

    Xue, Si-Jia; Chi, Zhe; Zhang, Yu; Li, Yan-Feng; Liu, Guang-Lei; Jiang, Hong; Hu, Zhong; Chi, Zhen-Ming

    2018-02-01

    Oleaginous yeasts, fatty acids biosynthesis and regulation in the oleaginous yeasts and the fatty acids from the oleaginous yeasts and their applications are reviewed in this article. Oleaginous yeasts such as Rhodosporidium toruloides, Yarrowia lipolytica, Rhodotorula mucilaginosa, and Aureobasidium melanogenum, which can accumulate over 50% lipid of their cell dry weight, have many advantages over other oleaginous microorganisms. The fatty acids from the oleaginous yeasts have many potential applications. Many oleaginous yeasts have now been genetically modified to over-produce fatty acids and their derivatives. The most important features of the oleaginous yeasts are that they have special enzymatic systems for enhanced biosynthesis and regulation of fatty acids in their lipid particles. Recently, some oleaginous yeasts such as R. toruloides have been found to have a unique fatty acids synthetase and other oleaginous yeasts such as A. melanogenum have a unique highly reducing polyketide synthase (HR-PKS) involved in the biosynthesis of hydroxyl fatty acids. It is necessary to further enhance lipid biosynthesis using metabolic engineering and explore new applications of fatty acids in biotechnology.

  17. Propagation of Mammalian Prions in Yeast

    National Research Council Canada - National Science Library

    Harris, David A

    2006-01-01

    ...: the budding yeast Saccharomyces cerevisiae. This unicellular organism offers a number of potential advantages for the study of prion biology, including rapid generation time, ease of culturing, and facile genetics...

  18. Genomic Evolution of the Ascomycete Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.

  19. Comet assay on tetraploid yeast cells

    DEFF Research Database (Denmark)

    Rank, Jette; Syberg, Kristian; Jensen, Klara

    2009-01-01

    Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from....... Analytical problems that arose due to the small amount of DNA in the yeast nuclei in haploid and diploid cells, which contain 13 Mbp and 26 Mbp DNA per cell, respectively, were solved by using tetraploid yeast cells (52 Mbp) instead. DNA damage was shown after exposure to H2O2 and acrylamide. The lowest dose...... causing significant DNA damage was 20 μM for H2O2 and 200 mg/l for acrylamide. Tertiary-treated wastewater from the outlets of three municipal wastewater-treatment plants was tested, but did not cause DNA damage. Even though it is possible to produce comets with tetraploid yeast cells, the amount of DNA...

  20. Cyanohydrin reactions enhance glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Nielsen, Astrid Gram; Tortzen, Christian

    2015-01-01

    Synchronous metabolic oscillations can be induced in yeast by addition of glucose and removal of extracellular acetaldehyde (ACAx). Compared to other means of ACAx removal, cyanide robustly induces oscillations, indicating additional cyanide reactions besides ACA to lactonitrile conversion. Here...

  1. Production Of Extracellular Enzymes By Some Soil Yeasts

    OpenAIRE

    Falih, A. M. [عبد الله مساعد خلف الفالح

    1997-01-01

    This study investigated the ability of soil yeasts, Geotrichum candidum, Geotrichum capitatum and Williopsis californica to produce extracellular enzymes (amylase, cellulase and protease) in vitro compared with that of a laboratory strain of Saccharomyces cerevisiae. It appears that the soil yeasts studied here were less amylolytic yeasts except the yeast G. candidum, which was highly effective at extracellular amylase production. The soil yeast W. californica was an average producer of cellu...

  2. Isolation and identification of radiation resistant yeasts from sea water

    International Nuclear Information System (INIS)

    Park, Jong Cheon; Jeong, Yong Uk; Kim, Du Hong; Jo, Eun A

    2011-12-01

    This study was conducted to isolate radiation-resistant yeasts from sea water for development of application technology of radiation-resistant microorganism. · Isolation of 656 yeasts from sea water and selection of 2 radiation-resistant yeasts (D 10 value >3) · Identification of isolated yeasts as Filobasidium elegans sharing 99% sequence similarity · Characterization of isolated yeast with ability to repair of the DNA damage and membrane integrity to irradiation

  3. Determination of tritium in wine yeast samples

    International Nuclear Information System (INIS)

    Cotarlea, Monica-Ionela; Paunescu Niculina; Galeriu, D; Mocanu, N.; Margineanu, R.; Marin, G.

    1998-01-01

    Analytical procedures were developed to determine tritium in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractioning distillation for wine samples and azeotropic distillation/fractional distillation for wine yeast samples. Finally, the water samples were normally distilled with K MO 4 . The established procedures were successfully applied for wine and wine samples from Murfatlar harvests of the years 1995 and 1996. (authors)

  4. OPTIMIZATION OF YEAST FOR ETHANOL PRODUCTION

    OpenAIRE

    Taghizadeh Ghassem; Delbari Azam Sadat; Kulkarni D. K.

    2012-01-01

    The production of pure ethanol apparently begins in the 12-14th century. Improvements in the distillation process with the condensation of vapors of lower boiling liquids. Ethanol is produced commercially by chemical synthesis or biosynthesis. High ethanol producing yeast exhibits rapid metabolic activity and a high fermentation rate with high product output in less time.Yeasts were isolated from Corn, Curd, Grapes, Water 1, Water 2, and Paneer. Isolation was done on MGYP (Malt Extract Glucos...

  5. Live Cell Imaging in Fission Yeast.

    Science.gov (United States)

    Mulvihill, Daniel P

    2017-10-03

    Live cell imaging complements the array of biochemical and molecular genetic approaches to provide a comprehensive insight into functional dependencies and molecular interactions in fission yeast. Fluorescent proteins and vital dyes reveal dynamic changes in the spatial distribution of organelles and the proteome and how each alters in response to changes in environmental and genetic composition. This introduction discusses key issues and basic image analysis for live cell imaging of fission yeast. © 2017 Cold Spring Harbor Laboratory Press.

  6. Yeast proteins that recognize nuclear localization sequences

    OpenAIRE

    1989-01-01

    A variety of peptides can mediate the localization of proteins to the nucleus. We have identified yeast proteins of 70 and 59 kD that bind to nuclear localization peptides of SV-40 T antigen, Xenopus nucleoplasmin, and the yeast proteins Ga14 and histone H2B. These proteins are assayed by the binding of peptide-albumin conjugates to proteins immobilized on nitrocellulose filters. These binding proteins fractionate with nuclei and are extractable with salt but not detergent. Radiolabeled pepti...

  7. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  8. Flor Yeast: New Perspectives Beyond Wine Aging

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  9. Radiodiagnosis of yeast alveolits (a clinicoexperimental study)

    International Nuclear Information System (INIS)

    Amosov, I.S.; Smirnov, V.A.

    1984-01-01

    A clinicoroetgenological study was made of 115 workers engaged in the yeast production for different periods of time. Disorders of the respiration biomechanics were revealed depending on the period of service. These data were obtained as a result of the use of roentgenopneumopolygraphy. An experimental study was conducted to establish the nature of lesions in the bronchopulmonary system in allergic alveolitis. The effect of finely divided yeast dust on the bronchopulmonary system was studied on 132 guinea-pigs usinq microbronchography and morphological examination. As a result of the study it has been established that during the inhalation of yeast dust, notnceable dystrophy of the bronchi develops, the sizes of alveoli enlarge and part of them undergo emphysematous distension with the rupture of the interalveolar septa. In the course of the study, it has been shown that yeast dust is little agreessive, yeast alveolitis develops after many years of work. The clinical symptoms are non-specific and insignificant. X-ray and morphological changes are followed by the physical manifestations of yeast alveolitis

  10. Novel brewing yeast hybrids: creation and application.

    Science.gov (United States)

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2017-01-01

    The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.

  11. Revaluation of Waste Yeast from Beer Production

    Directory of Open Access Journals (Sweden)

    Nicoleta Suruceanu

    2013-11-01

    Full Text Available Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, identification and quantification of xanthohumol by HPLC method. Waste yeast from brewery pilot plant of USAMV Cluj Napoca it was dried by atomization and the powder was analyzed on xanthohumol content by HPLC method. For quantification a calibration curve it was used. The process of drying by atomisation lead to a powder product. It was used malt dextrin powder for stabilisation. The final product it was encapsulated. The xanthohumol content of powdered yeast it was 1.94 µg/ml. In conclusion the slurry yeast from beer production it is an important source of prenylflavonoids compounds.

  12. Spermidine cures yeast of prions

    Directory of Open Access Journals (Sweden)

    Shaun H. Speldewinde

    2015-12-01

    Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN­+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.

  13. Malassezia yeasts and pityriasis versicolor.

    Science.gov (United States)

    Crespo-Erchiga, Vicente; Florencio, Vicente Delgado

    2006-04-01

    To analyze the relationships among different Malassezia species and pityriasis versicolor, the only human disease in which the etiologic role of these fungi is fully accepted (although the species implicated remains a matter of discussion). Since 1996, after the taxonomic revision of the genus, a limited number of papers analyzing the role of the different Malassezia species in pityriasis versicolor have been published or were the subject of presentations in congresses; there were only four in the past year. This paper discusses the results of these works, comparing them with results of the authors' most recent study in this field, conducted over the past 16 months. Most of the studies published thus far now show that Malassezia globosa is the predominant species found in the lesions of pityriasis versicolor, at least in temperate climates. The authors' recent findings confirm these results. The etiologic role of M. globosa in pityriasis versicolor is based, even more than on its isolation in a high percentage of cultures, on its identification by direct microscopy as typical globose yeast cells producing pseudohyphae in almost 100% of cases. The confirmation of the pathogenic role of this species in pityriasis versicolor could help in understanding these conditions, which are still unclear, which promote its transformation from the saprophytic stage present in healthy skin to the parasitic one, and could also help in selecting the best therapeutic measures.

  14. Yeast Interacting Proteins Database: YFR015C, YFR015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...ression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary ...tion, nitrogen starvation, environmental stress, and entry into stationary phase Rows with this bait as bait..., the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental

  15. Differences between flocculating yeast and regular industrial yeast in transcription and metabolite profiling during ethanol fermentation

    Directory of Open Access Journals (Sweden)

    Lili Li

    2017-03-01

    Full Text Available Objectives: To improve ethanolic fermentation performance of self-flocculating yeast, difference between a flocculating yeast strain and a regular industrial yeast strain was analyzed by transcriptional and metabolic approaches. Results: The number of down-regulated (industrial yeast YIC10 vs. flocculating yeast GIM2.71 and up-regulated genes were 4503 and 228, respectively. It is the economic regulation for YIC10 that non-essential genes were down-regulated, and cells put more “energy” into growth and ethanol production. Hexose transport and phosphorylation were not the limiting-steps in ethanol fermentation for GIM2.71 compared to YIC10, whereas the reaction of 1,3-disphosphoglycerate to 3-phosphoglycerate, the decarboxylation of pyruvate to acetaldehyde and its subsequent reduction to ethanol were the most limiting steps. GIM2.71 had stronger stress response than non-flocculating yeast and much more carbohydrate was distributed to other bypass, such as glycerol, acetate and trehalose synthesis. Conclusions: Differences between flocculating yeast and regular industrial yeast in transcription and metabolite profiling will provide clues for improving the fermentation performance of GIM2.71.

  16. Terroir of yeasts? – Application of FTIR spectroscopy and molecular methods for strain typing of yeasts

    Directory of Open Access Journals (Sweden)

    Gerhards Daniel

    2015-01-01

    Full Text Available The site specific influence on wine (Terroir is an often by wine producers, consumers and scientists discussed topic in the world of wine. A study on grapes and (spontaneous fermentations from six different vineyards was done to investigate the biodiversity of yeasts and to answer the question if there is a terroir of yeast and how it could be influenced. Randomly isolated yeasts were identified by FTIR-spectroscopy and molecular methods on species and strain level. Vineyard specific yeast floras would be observed but they are not such important as expected. Only a few overlapping strain patterns would be identified during both vintages. The yeast flora of the winery had a huge impact on the spontaneous fermentations, but is not really constant and influenced by different factors from outside.

  17. Protein patterns of yeast during sporulation

    International Nuclear Information System (INIS)

    Litske Petersen, J.G.; Kielland-Brandt, M.C.; Nilsson-Tillgren, T.

    1979-01-01

    High resolution two-dimensional gel electrophoresis was used to study protein synthesis during synchronous meiosis and ascospore formation of Saccharomyces cerevisiae. The stained protein patterns of samples harvested at any stage between meiotic prophase and the four-spore stage in two sporulating strains showed the same approximately 250 polypeptides. Of these only a few seemed to increase or decrease in concentration during sporulation. The characteristic pattern of sporulating yeast was identical to the pattern of glucose-grown staitonary yeast cells adapted to respiration. The latter type of cells readily initiates meiosis when transferred to sporulation medium. This pattern differed from the protein patterns of exponentially growing cells in glucose or acetate presporulation medium. Five major proteins in stationary and sporulating yeast cells were not detected in either type of exponential culture. Two-dimensional autoradiograms of [ 35 S]methionine-labelled yeast proteins revealed that some proteins were preferentially labelled during sporulation, while other proteins were labelled at later stages. These patterns differed from the auroradiograms of exponentially growing yeast cells in glucose presporulation medium in a number of spots. No differences were observed when stained gels or autoradiograms of sporulating cultures and non-sporulating strains in sporulation medium were compared. (author)

  18. Paradigms and pitfalls of yeast longevity research.

    Science.gov (United States)

    Sinclair, David A

    2002-04-30

    Over the past 10 years, considerable progress has been made in the yeast aging field. Multiple lines of evidence indicate that a cause of yeast aging stems from the inherent instability of repeated ribosomal DNA (rDNA). Over 16 yeast longevity genes have now been identified and the majority of these have been found to affect rDNA silencing or stability. Environmental conditions such as calorie restriction have been shown to modulate this mode of aging via Sir2, an NAD-dependent histone deacetylase (HDAC) that binds at the rDNA locus. Although this mechanism of aging appears to be yeast-specific, the longevity function of Sir2 is conserved in at least one multicellular organism, Caenorhabditis elegans (C. elegans). These findings are consistent with the idea that aging is a by-product of natural selection but longevity regulation is a highly adaptive trait. Characterizing this and other mechanisms of yeast aging should help identify additional components of longevity pathways in higher organisms.

  19. Yeast fuel cell: Application for desalination

    Science.gov (United States)

    Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

    2016-02-01

    Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

  20. Extension of yeast chronological lifespan by methylamine.

    Directory of Open Access Journals (Sweden)

    Sanjeev Kumar

    Full Text Available BACKGROUND: Chronological aging of yeast cells is commonly used as a model for aging of human post-mitotic cells. The yeast Saccharomyces cerevisiae grown on glucose in the presence of ammonium sulphate is mainly used in yeast aging research. We have analyzed chronological aging of the yeast Hansenula polymorpha grown at conditions that require primary peroxisome metabolism for growth. METHODOLOGY/PRINCIPAL FINDINGS: The chronological lifespan of H. polymorpha is strongly enhanced when cells are grown on methanol or ethanol, metabolized by peroxisome enzymes, relative to growth on glucose that does not require peroxisomes. The short lifespan of H. polymorpha on glucose is mainly due to medium acidification, whereas most likely ROS do not play an important role. Growth of cells on methanol/methylamine instead of methanol/ammonium sulphate resulted in further lifespan enhancement. This was unrelated to medium acidification. We show that oxidation of methylamine by peroxisomal amine oxidase at carbon starvation conditions is responsible for lifespan extension. The methylamine oxidation product formaldehyde is further oxidized resulting in NADH generation, which contributes to increased ATP generation and reduction of ROS levels in the stationary phase. CONCLUSION/SIGNIFICANCE: We conclude that primary peroxisome metabolism enhanced chronological lifespan of H. polymorpha. Moreover, the possibility to generate NADH at carbon starvation conditions by an organic nitrogen source supports further extension of the lifespan of the cell. Consequently, the interpretation of CLS analyses in yeast should include possible effects on the energy status of the cell.

  1. Ectomycorrhizas in vitro between Tricholoma matsutake, a basidiomycete that associates with Pinaceae, and Betula platyphylla var. japonica, an early-successional birch species, in cool-temperate forests.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Maruyama, Tsuyoshi; Neda, Hitoshi

    2015-04-01

    Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates with Pinaceae in the Northern Hemisphere and produces prized "matsutake" mushrooms. We questioned whether the symbiont could associate with a birch that is an early-successional species in boreal, cool-temperate, or subalpine forests. In the present study, we demonstrated that T. matsutake can form typical ectomycorrhizas with Betula platyphylla var. japonica; the associations included a Hartig net and a thin but distinct fungal sheath, as well as the rhizospheric mycelial aggregate "shiro" that is required for fruiting in nature. The in vitro shiro also emitted a characteristic aroma. This is the first report of an ectomycorrhizal formation between T. matsutake and a deciduous broad-leaved tree in the boreal or cool-temperate zones that T. matsutake naturally inhabits.

  2. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  3. Traceability of Asian Matsutake, Specialty Mushrooms Produced by the Ectomycorrhizal Basidiomycete Tricholoma matsutake, on the Basis of Retroelement-Based DNA Markers▿

    Science.gov (United States)

    Murata, Hitoshi; Babasaki, Katsuhiko; Saegusa, Tomoki; Takemoto, Kenji; Yamada, Akiyoshi; Ohta, Akira

    2008-01-01

    The ectomycorrhizal basidiomycete Tricholoma matsutake produces commercially valuable fruit bodies, matsutake, in forests. Here we report a PCR system targeting retroelement integration sites to differentiate among individual Asian isolates of T. matsutake based on their geographical origins, such as Japan, the area of South Korea through North Korea, the northeastern provinces of China, and the area of the southwestern provinces of China through Bhutan. The overall misjudgment rate of the analytical system was approximately 5% based on 95 samples of T. matsutake examined including those from cultures and from commodities. We also provide evidence that T. matsutake isolates grown throughout the Far East, including the northeastern provinces of China, are closely related to each other while distinct from those in the area of the southwestern provinces of China through Bhutan. The method allows us to trace back geographical origins of Asian matsutake, thus contributing to food safety, appropriate tariffs, and proper price setting. PMID:18281433

  4. Biofuels. Altered sterol composition renders yeast thermotolerant

    DEFF Research Database (Denmark)

    Caspeta, Luis; Chen, Yun; Ghiaci, Payam

    2014-01-01

    Ethanol production for use as a biofuel is mainly achieved through simultaneous saccharification and fermentation by yeast. Operating at ≥40°C would be beneficial in terms of increasing efficiency of the process and reducing costs, but yeast does not grow efficiently at those temperatures. We used...... adaptive laboratory evolution to select yeast strains with improved growth and ethanol production at ≥40°C. Sequencing of the whole genome, genome-wide gene expression, and metabolic-flux analyses revealed a change in sterol composition, from ergosterol to fecosterol, caused by mutations in the C-5 sterol...... desaturase gene, and increased expression of genes involved in sterol biosynthesis. Additionally, large chromosome III rearrangements and mutations in genes associated with DNA damage and respiration were found, but contributed less to the thermotolerant phenotype....

  5. Structural Studies of the Yeast Mitochondrial Degradosome

    DEFF Research Database (Denmark)

    Feddersen, Ane; Jonstrup, Anette Thyssen; Brodersen, Ditlev Egeskov

    The yeast mitochondrial degradosome/exosome (mtExo) is responsible for most RNA turnover in mitochondria and has been proposed to form a central part of a mitochondrial RNA surveillance system responsible for degradation of aberrant and unprocessed RNA ([1], [2]). In contrast to the cytoplasmic...... and nuclear exosome complexes, which consist of 10-12 different nuclease subunits, the mitochondrial degradosome is composed of only two large subunits - an RNase (Dss1p) and a helicase (Suv3p), belonging the Ski2 class of DExH box RNA helicases. Both subunits are encoded on the yeast nuclear genome...... and and Suv3p from the fission yeast, Schizosaccharomyces pombe, have been cloned for heterologous expression in E. coli. Of the two, we have succeeded in purifying the 73kDa Suv3p by Ni2+-affinity chromatography followed by cleavage of the N-terminal His-tag, cation exchange, and gel filtration. Crystals...

  6. Flux control through protein phosphorylation in yeast

    DEFF Research Database (Denmark)

    Chen, Yu; Nielsen, Jens

    2016-01-01

    Protein phosphorylation is one of the most important mechanisms regulating metabolism as it can directly modify metabolic enzymes by the addition of phosphate groups. Attributed to such a rapid and reversible mechanism, cells can adjust metabolism rapidly in response to temporal changes. The yeast...... as well as identify mechanisms underlying human metabolic diseases. Here we collect functional phosphorylation events of 41 enzymes involved in yeast metabolism and demonstrate functional mechanisms and the application of this information in metabolic engineering. From a systems biology perspective, we...... describe the development of phosphoproteomics in yeast as well as approaches to analysing the phosphoproteomics data. Finally, we focus on integrated analyses with other omics data sets and genome-scale metabolic models. Despite the advances, future studies improving both experimental technologies...

  7. Yeast interactions in inoculated wine fermentation

    Directory of Open Access Journals (Sweden)

    Maurizio eCiani

    2016-04-01

    Full Text Available The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the different yeasts composing the starter culture can led the stability of the final product and the analytical and aromatic profile. In the present review, we will discuss the recent developments regarding yeast interactions in pure and in mixed fermentation, focusing on the influence of interactions on growth and dominance in the process.

  8. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell

    Directory of Open Access Journals (Sweden)

    Yumei Luo

    2015-01-01

    Full Text Available The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C; knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells.

  9. Autophagy: one more Nobel Prize for yeast

    Directory of Open Access Journals (Sweden)

    Andreas Zimmermann

    2016-12-01

    Full Text Available The recent announcement of the 2016 Nobel Prize in Physiology or Medicine, awarded to Yoshinori Ohsumi for the discoveries of mechanisms governing autophagy, underscores the importance of intracellular degradation and recycling. At the same time, it further cements yeast, in which this field decisively developed, as a prolific model organism. Here we provide a quick historical overview that mirrors both the importance of autophagy as a conserved and essential process for cellular life and death as well as the crucial role of yeast in its mechanistic characterization.

  10. YIDB: the Yeast Intron DataBase

    OpenAIRE

    Lopez, Pascal J.; Séraphin, Bertrand

    2000-01-01

    The Yeast Intron DataBase (YIDB) contains currently available information about all introns encoded in the nuclear and mitochondrial genomes of the yeast Saccharomyces cerevisiae. Introns are divided according to their mechanism of excision: group I and group II introns, pre-mRNA introns, tRNA introns and the HAC1 intron. Information about the host genome, the type of RNA in which they are inserted and their primary structure are provided together with references. For nuclear pre-mRNA introns...

  11. Analysis of RNA metabolism in fission yeast

    DEFF Research Database (Denmark)

    Wise, Jo Ann; Nielsen, Olaf

    2017-01-01

    Here we focus on the biogenesis and function of messenger RNA (mRNA) in fission yeast cells. Following a general introduction that also briefly touches on other classes of RNA, we provide an overview of methods used to analyze mRNAs throughout their life cycles.......Here we focus on the biogenesis and function of messenger RNA (mRNA) in fission yeast cells. Following a general introduction that also briefly touches on other classes of RNA, we provide an overview of methods used to analyze mRNAs throughout their life cycles....

  12. ISOLATION OF PROTEOLYTIC PSYCHROTROPHIC YEASTS FROM FRESH RAW SEAFOODS

    NARCIS (Netherlands)

    KOBATAKE, M; KREGERVANRIJ, NJW; PLACIDO, MTLC; VANUDEN, N

    A total of 103 cultures of yeasts were isolated from seven kinds of fresh raw seafoods. The isolates comprised six genera, Candida, Cryptococcus, Debaryomyces. Rhodotorula, Sterigmatomyces and Trichosporon, and included 21 different species. All the isolates were psychrotrophic yeasts. Proteolytic

  13. Occurrence of Killer Yeast Strains in Fruit and Berry Wine Yeast Populations

    Directory of Open Access Journals (Sweden)

    Gintare Gulbiniene

    2004-01-01

    Full Text Available Apple, cranberry, chokeberry and Lithuanian red grape wine yeast populations were used for the determination of killer yeast occurrence. According to the tests of the killer characteristics and immunity the isolated strains were divided into seven groups. In this work the activity of killer toxins purified from some typical strains was evaluated. The analysed strains produced different amounts of active killer toxin and some of them possessed new industrially significant killer properties. Total dsRNA extractions in 11 killer strains of yeast isolated from spontaneous fermentations revealed that the molecular basis of the killer phenomenon was not only dsRNAs, but also unidentified genetic determinants.

  14. Phosphate Solubilization in Vitro By Some Soil Yeasts

    OpenAIRE

    Al-Falih, Abdullah M.

    2005-01-01

    Soil yeasts including, Candida tropicalis, Geotrichum capitatum, Geotrichum candidum, Rhodotorula minuta and Rhodotorula rubra were isolated from soils of Saudi Arabia. The ability of these soil yeasts to solubilize insoluble calcium phosphate Ca3(POfi2 in vitro was investigated. An incubation study was conducted to determine the role of selected soil yeasts on the solubilization of insoluble calcium phosphate. The largest amount of phosphate @5 Stglml) was formed by the yeast of G. capita...

  15. Improving industrial yeast strains: exploiting natural and artificial diversity

    OpenAIRE

    Steensels, Jan; Snoek, Tim; Meersman, Esther; Nicolino, Martina Picca; Voordeckers, Karin; Verstrepen, Kevin J

    2014-01-01

    Yeasts have been used for thousands of years to make fermented foods and beverages, such as beer, wine, sake, and bread. However, the choice for a particular yeast strain or species for a specific industrial application is often based on historical, rather than scientific grounds. Moreover, new biotechnological yeast applications, such as the production of second-generation biofuels, confront yeast with environments and challenges that differ from those encountered in traditional food ferment...

  16. Effect of increasing growth temperature on yeast fermentation ...

    African Journals Online (AJOL)

    The effect of increasing growth temperature on yeast fermentation was studied at approximately 5 oC intervals over a range of 18 – 37 oC, using one strain each of ale, lager and wine yeast. The ale and wine yeasts grew at all the temperatures tested, but lager yeast failed to grow at 37 oC. All these strains gave lower ...

  17. Performance of baker's yeast produced using date syrup substrate ...

    African Journals Online (AJOL)

    Baker's yeast was produced from three selected baker's yeast strains using date syrup as a substrate at low and high flow rate compared to those produced using molasses substrates. Performance of the produced baker's yeasts on Arabic bread quality was investigated. Baking tests showed a positive relationship between ...

  18. Effects of chlorine and temperature on yeasts isolatedfrom a soft ...

    African Journals Online (AJOL)

    Yeasts isolated from sugar and filling valves in a bottling process were exposed to different chlorine concentrations and various high temperatures. It was found that growth of yeasts decreased with increase in chlorine concentration. The maximum chlorine concentration that inhibited both types of yeasts was 60mg/l while ...

  19. Guidelines and recommendations on yeast cell death nomenclature

    NARCIS (Netherlands)

    Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J; Breitenbach, Michael; Burhans, William C; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W; Grant, Chris M; Greenwood, Michael T; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D; Outeiro, Tiago F; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F; Sharon, Amir; Sigrist, Stephan J; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B; Tuite, Mick; Vögtle, F-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J; Zhao, Richard Y; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

    2018-01-01

    Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cel-lular demise. However, the investigation of yeast cell death is a relatively young field, and a widely

  20. Bright stable luminescent yeast using bacterial luciferase as a sensor.

    NARCIS (Netherlands)

    Szittner, R; Jansen, G.; Thomas, DY; Meighen, E

    2003-01-01

    24h while luminescence of yeast with decanal decayed to less than 0.01% of that with Z-9-tetradecenal after 2min. Moreover, yeast survived in 0.5% (v/v) Z-9-tetradecenal while 0.005% (v/v) decanal was lethal. Luminescence of yeast (+luxAB) was also stimulated 100-fold by transformation with the

  1. Effect of yeast extract and chitosan on shoot proliferation ...

    African Journals Online (AJOL)

    This paper reported the effect of yeast extract and chitosan with combination of yeast extract on the growth and morphological changes and production of phenolics in the in vitro plantlets of Curcuma mangga. Yeast extract did not show any effect on the biomass and shoot proliferation of in vitro plantlets. However, the ...

  2. The significance of peroxisomes in methanol metabolism in methylotrophic yeast

    NARCIS (Netherlands)

    Klei, Ida J. van der; Yurimoto, Hiroya; Sakai, Yasuyoshi; Veenhuis, Marten

    2006-01-01

    The capacity to use methanol as sole source of carbon and energy is restricted to relatively few yeast species. This may be related to the low efficiency of methanol metabolism in yeast, relative to that of prokaryotes. This contribution describes the details of methanol metabolism in yeast and

  3. Molecular Cloning and Optimization for High Level Expression of Cold-Adapted Serine Protease from Antarctic Yeast Glaciozyma antarctica PI12

    Directory of Open Access Journals (Sweden)

    Norsyuhada Alias

    2014-01-01

    Full Text Available Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE strategy with an open reading frame (ORF of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml was obtained from P. pastoris GS115 host (GpPro2 at 20°C after 72 hours of postinduction time with 0.5% (v/v of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa.

  4. Yeast Interacting Proteins Database: YFR015C, YLR258W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into statio

  5. Optimization of yeast ( Saccharomyces cerevisiae ) RNA isolation ...

    African Journals Online (AJOL)

    Quality of the starting RNA is indispensably important for obtaining highly reproducible quantitative polymerase chain reaction (qPCR) and microarray results for all organisms as well as S. cerevisiae. Isolating RNA from yeast cells with a maximum quality was especially critical since these cells were rich in polysaccharides ...

  6. Extraction of proteins from yeast cell wall

    African Journals Online (AJOL)

    USER

    2010-05-24

    May 24, 2010 ... Figure 2. The UV absorption spectrum of extracted proteins. Startup Foundation of Chongqing Normal University (No. 07XLB025), and Natural Science Foundation Project of. CQ CSTC (No. CSTC, 2009BB5238) China. REFERENCES. Cabib E, Roh DH, Schmidt M, Crotti LB, Varma A (2001). The yeast cell.

  7. Vaginal yeast infections in diabetic women

    African Journals Online (AJOL)

    no correlation between genital or oral yeast and random blood glucose levels was noted. In addition the role of. C. glabrata in genital infections remains unclear. The findings presented in this study argue against empirical antifungal therapy of diabetic patients presenr- ing with genital symptoms for twO reasons. Firstly, as.

  8. Caprolactam waste liquor degradation by various yeasts.

    Science.gov (United States)

    Johnson, V; Patel, S J; Patel, K A; Mehta, M H

    1994-09-01

    Waste liquor from caprolactam manufacture contains many mono- and di-carboxylic acids. Of four yeasts tested, Yarrowia lipolytica DS-1 was the best at decreasing Chemical Oxygen Demand values, by up to 60% with 50 and 100 g waste liquor/after 48 h. Caproic, butyric and valeric acids were utilized most easily. Adipic acid was not decreased below 13% (w/v).

  9. Characteristics of fermentation yeast isolated from traditional ...

    African Journals Online (AJOL)

    Indigenous honey wine, known locally as ogol, was collected in a village of the Majangir ethnic group in Southwest Ethiopia, and the procedure for ogol fermentation was investigated. A fermentation yeast was first isolated from ogol and identified as being a strain of the genus Saccharomyces cerevisiae. Honey wine made ...

  10. Localization of some phosphatases in yeast

    NARCIS (Netherlands)

    Tonino, G.J.M.; Steyn-Parvé, Elizabeth P.

    1963-01-01

    1. 1. The localization of some phosphatases has been studied in yeast cells that were either fragmented by shaking intact cells with glass beads or by hypotonic or isotonic disruption of protoplasts prepared from intact cells. 2. 2. The non-specific acid phosphatase with optimum activity at pH

  11. Conditional response to stress in yeast

    NARCIS (Netherlands)

    Siderius, M.H.; Mager, W.H.

    2003-01-01

    All living cells respond to sudden, adverse changes in their environment by evoking a stress response. Here we focus mainly on the response of the model eukaryotic organism Saccharomyces cerevisiae (baker's yeast) to an increase in external osmolarity. We summarize data demonstrating that stress

  12. Arachidonic acid metabolites in pathogenic yeasts

    Directory of Open Access Journals (Sweden)

    Ells Ruan

    2012-08-01

    Full Text Available Abstract Although most of what is known about the biology and function of arachidonic acid metabolites comes from the study of mammalian biology, these compounds can also be produced by lower eukaryotes, including yeasts and other fungi. It is also in this group of organisms that the least is known about the metabolic pathways leading to the production of these compounds as well as the functions of these compounds in the biology of fungi and yeasts. This review will deal with the discovery of oxylipins from polyunsaturated fatty acids, and more specifically the arachidonic acid derived eicosanoids, such as 3-hydroxy eicosatetraenoic acid, prostaglandin F2α and prostaglandin E2, in yeasts starting in the early 1990s. This review will also focus on what is known about the metabolic pathways and/or proteins involved in the production of these compounds in pathogenic yeasts. The possible roles of these compounds in the biology, including the pathology, of these organisms will be discussed.

  13. Functional differences in yeast protein disulfide isomerases

    DEFF Research Database (Denmark)

    Nørgaard, P; Westphal, V; Tachibana, C

    2001-01-01

    PDI1 is the essential gene encoding protein disulfide isomerase in yeast. The Saccharomyces cerevisiae genome, however, contains four other nonessential genes with homology to PDI1: MPD1, MPD2, EUG1, and EPS1. We have investigated the effects of simultaneous deletions of these genes. In several...

  14. Catalytic site interactions in yeast OMP synthase

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Barr, Eric W.; Jensen, Kaj Frank

    2014-01-01

    45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal...

  15. UBA domain containing proteins in fission yeast

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Semple, Colin A M; Ponting, Chris P

    2003-01-01

    characterised on both the functional and structural levels. One example of a widespread ubiquitin binding module is the ubiquitin associated (UBA) domain. Here, we discuss the approximately 15 UBA domain containing proteins encoded in the relatively small genome of the fission yeast Schizosaccharomyces pombe...

  16. ( Saccharomyces Cerevisiae ) with Brewers Yeast by Protoplast ...

    African Journals Online (AJOL)

    Haploid auxotrophic strains of Saccharomyces cerevisiae were selected from palm wine and propagated by protoplast fusion with Brewers yeast. Fusion resulted in an increase in both ethanol production and tolerance against exogenous ethanol. Mean fusion frequencies obtained for a mating types ranged between 8 x ...

  17. Modeling diauxic glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Sørensen, Preben Graae

    2010-01-01

    Glycolytic oscillations in a stirred suspension of starved yeast cells is an excellent model system for studying the dynamics of metabolic switching in living systems. In an open-flow system the oscillations can be maintained indefinitely at a constant operating point where they can be characteri...

  18. Yeast metabolic engineering for hemicellulosic ethanol production

    Science.gov (United States)

    Jennifer Van Vleet; Thomas W. Jeffries

    2009-01-01

    Efficient fermentation of hemicellulosic sugars is critical for the bioconversion of lignocellulosics to ethanol. Efficient sugar uptake through the heterologous expression of yeast and fungal xylose/glucose transporters can improve fermentation if other metabolic steps are not rate limiting. Rectification of cofactor imbalances through heterologous expression of...

  19. Hybridization of Palm Wine Yeasts ( Saccharomyces Cerevisiae ...

    African Journals Online (AJOL)

    Haploid auxotrophic strains of Saccharomyces cerevisiae were selected from palm wine and propagated by protoplast fusion with Brewers yeast. Fusion resulted in an increase in both ethanol production and tolerance against exogenous ethanol. Mean fusion frequencies obtained for a mating types ranged between 8 x ...

  20. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  1. Regulations of sugar transporters: insights from yeast

    Czech Academy of Sciences Publication Activity Database

    Horák, Jaroslav

    2013-01-01

    Roč. 59, 1-2 (2013), s. 1-31 ISSN 0172-8083 R&D Projects: GA ČR(CZ) GAP503/10/0307 Institutional support: RVO:67985823 Keywords : sugar transporter * yeast * glucose signaling * sensing Subject RIV: EE - Microbiology, Virology Impact factor: 1.712, year: 2013

  2. Development of a sufficient and effective procedure for transformation of an oleaginous yeast, Rhodosporidium toruloides DMKU3-TK16.

    Science.gov (United States)

    Tsai, Yung-Yu; Ohashi, Takao; Kanazawa, Takenori; Polburee, Pirapan; Misaki, Ryo; Limtong, Savitree; Fujiyama, Kazuhito

    2017-05-01

    Rhodosporidium toruloides DMKU3-TK16 (TK16), a basidiomycetous yeast isolated in Thailand, can produce a large amount of oil corresponding to approximately 70 % of its dry cell weight. However, lack of a sufficient and efficient transformation method makes further genetic manipulation of this organism difficult. We here developed a new transformation system for R. toruloides using a lithium acetate method with the Sh ble gene as a selective marker under the control of the R. toruloides ATCC 10657 GPD1 promoter. A linear DNA fragment containing the Sh ble gene expression cassette was integrated into the genome, and its integration was confirmed by colony PCR and Southern blot. Then, we further optimized the parameters affecting the transformation efficiency, such as the amount of linear DNA, the growth phase, the incubation time in the transformation mixture, the heat shock treatment temperature, the addition of DMSO and carrier DNA, and the recovery incubation time. With the developed method, the transformation efficiency of approximately 25 transformants/μg DNA was achieved. Compared with the initial trial, transformation efficiency was enhanced 417-fold. We further demonstrated the heterologous production of EGFP in TK16 by microscopic observation and immunoblot analysis, and use the technique to disrupt the endogenous URA3 gene. The newly developed method is thus simple and time saving, making it useful for efficient introduction of an exogenous gene into R. toruloides strains. Accordingly, this new practical approach should facilitate the molecular manipulation, such as target gene introduction and deletion, of TK16 and other R. toruloides strains as a major source of biodiesel.

  3. The Role of Magnesium and Calcium in Governing Yeast Agglomeration

    Directory of Open Access Journals (Sweden)

    Rosslyn M. Birch

    2002-01-01

    Full Text Available »Grit« formation by agglomerating cells of baker’s yeast is an idiosyncratic phenomenon of irreversible cellular aggregation that is detrimental to yeast quality. Agglomeration results in failure of rehydrated dried yeast to evenly resuspend and has economic consequences for both yeast manufacturers and bakers. Several environmental factors are implicated in governing yeast agglomeration, but no significant differences between 'gritty' and 'non-gritty' yeast in terms of cell hydrophobicity or flocculence have been reported. In this study, analysis of cellular metal ions has revealed high levels of calcium in 'gritty' strains of Saccharomyces cerevisiae, which suggests that calcium ions may positively influence agglomeration. In contrast, it was found that cellular magnesium levels were higher in 'non-gritty' yeast. Furthermore, by increasing magnesium concentrations in molasses yeast growth media, a reduction in cellular calcium was observed and this concomitantly reduced the tendency of cells to agglomerate and form grit. Magnesium thus acted antagonistically against calcium-induced agglomeration, possibly by blocking calcium binding to yeast cell surface receptors. Results suggested that yeast agglomeration and metal ion bioavailability were inextricably linked and the findings are discussed in relation to possible measures of alleviating cellular agglomeration in the production of baker’s yeast.

  4. Between science and industry-applied yeast research.

    Science.gov (United States)

    Korhola, Matti

    2018-03-01

    I was fortunate to enter yeast research at the Alko Research Laboratories with a strong tradition in yeast biochemistry and physiology studies. At the same time in the 1980s there was a fundamental or paradigm change in molecular biology research with discoveries in DNA sequencing and other analytical and physical techniques for studying macromolecules and cells. Since that time biotechnological research has expanded the traditional fermentation industries to efficient production of industrial and other enzymes and specialty chemicals. Our efforts were directed towards improving the industrial production organisms: minerals enriched yeasts (Se, Cr, Zn) and high glutathione content yeast, baker´s, distiller´s, sour dough and wine yeasts, and the fungal Trichoderma reesei platform for enzyme production. I am grateful for the trust of my colleagues in several leadership positions at the Alko Research Laboratories, Yeast Industry Platform and at the international yeast community.

  5. Baker's yeast: production of D- and L-3-hydroxy esters

    DEFF Research Database (Denmark)

    Dahl, Allan Carsten; Madsen, Jørgen Øgaard

    1998-01-01

    Baker's yeast grown under oxygen limited conditions and used in the reduction of 3-oxo esters results in a shift of the stereoselectivity of the yeast towards D-hydroxy esters as compared with ordinary baker's yeast. The highest degree of stereoselectivity was obtained with growing yeast or yeast...... harvested while growing. In contrast, the stereoselectivity was shifted towards L-hydroxy esters when the oxo esters were added slowly to ordinary baker's yeast supplied with gluconolactone as co-substrate. The reduction rate with gluconolactone was increased by active aeration. Ethyl L-(S)-3......-hydroxybutanoate was afforded in >99% ee. Both enantiomers of ethyl 3-hydroxypentanoate, D-(R) in 96% ee and L-(S) in 93% ee, and of ethyl 4-chloro-3-hydroxybutanoate, D-(S) in 98% ee and L-(R) in 94% ee, were obtained. The results demonstrate that the stereoselectivity of baker's yeast can be controlled...

  6. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  7. Armillaridin, a Honey Medicinal Mushroom, Armillaria mellea (Higher Basidiomycetes) Component, Inhibits Differentiation and Activation of Human Macrophages.

    Science.gov (United States)

    Liu, Tsang-Pai; Chen, Chien-Chih; Shiao, Pei-Yu; Shieh, Hui-Ru; Chen, Yu-Yawn; Chen, Yu-Jen

    2015-01-01

    Armillaridin (AM) is an aromatic ester compound isolated from honey medicinal mushroom, Armillaria mellea, which has anti-cancer potential. This study was designed to examine the effects of AM on differentiation and activation macrophages, the major ontogeny of innate immunity. Macrophages were derived from CD14+ monocytes which were sorted from human peripheral blood mononuclear cells. Cell viability was assessed by trypan blue exclusion test. Cells were stained with Liu's dye for observation of morphology. Expression of surface antigens was examined by flow cytometric analysis. Phagocytosis and generation of reactive oxygen species (ROS), as functional assays, were evaluated by counting engulfed yeasts and DCFH-DA reaction. The viability of macrophages was not significantly reduced by AM. AM at nontoxic concentrations markedly increased cytoplasmic vacuoles. The expression of surface CD14, CD16, CD36, and HLA-DR was suppressed. The phagocytosis function, but not ROS production, of macrophages was inhibited by AM. Armillaridin could inhibit the differentiation and activation of human macrophages. It may have potential to be developed as a biological response modifier for inflammatory diseases.

  8. [Invasive yeast infections in neutropenic patients].

    Science.gov (United States)

    Ruiz Camps, Isabel; Jarque, Isidro

    2016-01-01

    Invasive fungal diseases caused by yeasts still play an important role in the morbidity and mortality in neutropenic patients with haematological malignancies. Although the overall incidence of invasive candidiasis has decreased due to widespread use of antifungal prophylaxis, the incidence of non-Candida albicans Candida species is increasing compared with that of C.albicans, and mortality of invasive candidiasis continues to be high. In addition, there has been an increase in invasive infections caused by an array of uncommon yeasts, including species of the genus Malassezia, Rhodotorula, Trichosporon and Saprochaete, characterised by their resistance to echinocandins and poor prognosis. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Raman microspectroscopy of the yeast vacuoles

    Czech Academy of Sciences Publication Activity Database

    Bednárová, Lucie; Gregorová, Š.; Bauerová, Václava; Hrušková-Heidingsfeldová, Olga; Palacký, J.; Mojzeš, P.

    2014-01-01

    Roč. 21, č. 1 (2014), s. 15 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /12./. 13.03.2014-15.03.2014, Nové Hrady] R&D Projects: GA ČR GAP208/10/0376 Institutional support: RVO:61388963 Keywords : Raman microspectroscopy * yeast vacuoles Subject RIV: CF - Physical ; Theoretical Chemistry

  10. Raman Microspectroscopy of the Yeast Vacuoles

    Czech Academy of Sciences Publication Activity Database

    Bednárová, Lucie; Palacký, J.; Bauerová, Václava; Hrušková-Heidingsfeldová, Olga; Pichová, Iva; Mojzeš, P.

    2012-01-01

    Roč. 27, 5-6 (2012), s. 503-507 ISSN 0712-4813 R&D Projects: GA ČR GAP208/10/0376; GA ČR GA310/09/1945 Institutional research plan: CEZ:AV0Z40550506 Keywords : Raman microspectroscopy * living cell * yeast * vacuole * chemical composition * polyphospate * Candida albicans Subject RIV: CE - Biochemistry Impact factor: 0.530, year: 2012

  11. Development of Industrial Yeast Platform Strains

    DEFF Research Database (Denmark)

    Bergdahl, Basti; Dato, Laura; Förster, Jochen

    2014-01-01

    Most of the current metabolic engineering projects are carried out using laboratory strains as the starting host. Although such strains are easily manipulated genetically, their robustness does not always meet the requirements set by industrial fermentation conditions. In such conditions, the cel...... screening of the 36 industrial and laboratory yeast strains. In addition, progress in the development of molecular biology methods for generating the new strains will be presented....

  12. Ammonia Signaling in Yeast Colony Formation

    Czech Academy of Sciences Publication Activity Database

    Palková, Z.; Váchová, Libuše

    2003-01-01

    Roč. 225, - (2003), s. 229-272 ISSN 0074-7696 R&D Projects: GA ČR GA204/02/0650 Grant - others:GA of Charles University(CZ) 141/2001/B-BIO/PrF and EMBO YIP for ZP Institutional research plan: CEZ:MSM 113100003 Keywords : yeast colonies * ammonia * ammonium Subject RIV: EE - Microbiology, Virology Impact factor: 4.286, year: 2003

  13. An engineered yeast efficiently secreting penicillin.

    Directory of Open Access Journals (Sweden)

    Loknath Gidijala

    Full Text Available This study aimed at developing an alternative host for the production of penicillin (PEN. As yet, the industrial production of this beta-lactam antibiotic is confined to the filamentous fungus Penicillium chrysogenum. As such, the yeast Hansenula polymorpha, a recognized producer of pharmaceuticals, represents an attractive alternative. Introduction of the P. chrysogenum gene encoding the non-ribosomal peptide synthetase (NRPS delta-(L-alpha-aminoadipyl-L-cysteinyl-D-valine synthetase (ACVS in H. polymorpha, resulted in the production of active ACVS enzyme, when co-expressed with the Bacillus subtilis sfp gene encoding a phosphopantetheinyl transferase that activated ACVS. This represents the first example of the functional expression of a non-ribosomal peptide synthetase in yeast. Co-expression with the P. chrysogenum genes encoding the cytosolic enzyme isopenicillin N synthase as well as the two peroxisomal enzymes isopenicillin N acyl transferase (IAT and phenylacetyl CoA ligase (PCL resulted in production of biologically active PEN, which was efficiently secreted. The amount of secreted PEN was similar to that produced by the original P. chrysogenum NRRL1951 strain (approx. 1 mg/L. PEN production was decreased over two-fold in a yeast strain lacking peroxisomes, indicating that the peroxisomal localization of IAT and PCL is important for efficient PEN production. The breakthroughs of this work enable exploration of new yeast-based cell factories for the production of (novel beta-lactam antibiotics as well as other natural and semi-synthetic peptides (e.g. immunosuppressive and cytostatic agents, whose production involves NRPS's.

  14. De novo biosynthesis of vanillin in fission yeast (Schizosaccharomyces pombe) and baker's yeast (Saccharomyces cerevisiae).

    Science.gov (United States)

    Hansen, Esben H; Møller, Birger Lindberg; Kock, Gertrud R; Bünner, Camilla M; Kristensen, Charlotte; Jensen, Ole R; Okkels, Finn T; Olsen, Carl E; Motawia, Mohammed S; Hansen, Jørgen

    2009-05-01

    Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin beta-D-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity.

  15. Effect of Yeast : Saccharomyces cerevisiae and Marine Yeast as probiotic supplement on performance of poultry

    Directory of Open Access Journals (Sweden)

    I Putu Kompiang

    2002-03-01

    Full Text Available An experiment had been conducted to evaluate the effect of marine yeast and Saccharomyces cerevisiae (Sc as probiotic supplement on poultry performance. Marine yeast isolated from rotten sea-weed and commercial Saccharomyces cerevisiae were used. Evaluation was conducted by comparing performance of broiler chicken supplemented with marine yeast or Sc, which were given through drinking water (5 ml/l to negative control (feed without antibiotic growth promotor/GPA, positive control (feed with GPA, and reference commercial probiotic. Forty DOC broiler birds were used for each treatment, divided into 4 replicates (10 birds/replicate and raised in wire cages for 5 weeks. Body weight and feed consumption were measured weekly and mortality was recorded during the trial. The results showed that there were no significant difference on the birds performance among marine yeast, Sc, positive control and probiotic reference control treatments. However their effects on bird performance were better (P<0.05 than treatment of negative control. It is concluded that marine yeast or Saccharomyces cerevisiae could replace the function of antibiotic as a growth promotant.

  16. Made for Each Other: Ascomycete Yeasts and Insects.

    Science.gov (United States)

    Blackwell, Meredith

    2017-06-01

    Fungi and insects live together in the same habitats, and many species of both groups rely on each other for success. Insects, the most successful animals on Earth, cannot produce sterols, essential vitamins, and many enzymes; fungi, often yeast-like in growth form, make up for these deficits. Fungi, however, require constantly replenished substrates because they consume the previous ones, and insects, sometimes lured by volatile fungal compounds, carry fungi directly to a similar, but fresh, habitat. Yeasts associated with insects include Ascomycota (Saccharomycotina, Pezizomycotina) and a few Basidiomycota. Beetles, homopterans, and flies are important associates of fungi, and in turn the insects carry yeasts in pits, specialized external pouches, and modified gut pockets. Some yeasts undergo sexual reproduction within the insect gut, where the genetic diversity of the population is increased, while others, well suited to their stable environment, may never mate. The range of interactions extends from dispersal of yeasts on the surface of insects (e.g., cactus- Drosophila -yeast and ephemeral flower communities, ambrosia beetles, yeasts with holdfasts) to extremely specialized associations of organisms that can no longer exist independently, as in the case of yeast-like symbionts of planthoppers. In a few cases yeast-like fungus-insect associations threaten butterflies and other species with extinction. Technical advances improve discovery and identification of the fungi but also inform our understanding of the evolution of yeast-insect symbioses, although there is much more to learn.

  17. Sonocatalytic treatment of baker's yeast effluent

    Directory of Open Access Journals (Sweden)

    E. Yılmaz

    2017-03-01

    Full Text Available Baker's yeast effluent is a major source of pollution with a high organic load and dark colour. It can be treated by using advanced oxidation processes (AOPs. AOPs, such as ultrasonic irradiation, are ambient temperature processes involving the generation of free radicals. We have investigated sonocatalytic treatment of baker's yeast effluent by using ultrasound. TiO2–ZnO composites were used as sonocatalysts to increase the efficiency of the ultrasonic irradiation. The TiO2/ZnO composite was prepared by two different methods. Ultrasonic irradiation or mechanical stirring was used to prepare the TiO2–ZnO composite, and an ultrasonic homogenizer with a 20 kHz frequency was used to treat the baker's yeast effluent. We studied the effects of several parameters, including the molar ratio of TiO2/ZnO, calcination temperature, calcination time and catalyst amount, on the sonocatalytic treatment of the effluent. According to the results, the decolorization rate was 25% when using the composite TiO2/ZnO prepared at a 4:1 molar ratio and treated at 700 °C for 60 min, and the optimum catalyst amount was 0.15 g/l.

  18. Synthetic Genetic Arrays: Automation of Yeast Genetics.

    Science.gov (United States)

    Kuzmin, Elena; Costanzo, Michael; Andrews, Brenda; Boone, Charles

    2016-04-01

    Genome-sequencing efforts have led to great strides in the annotation of protein-coding genes and other genomic elements. The current challenge is to understand the functional role of each gene and how genes work together to modulate cellular processes. Genetic interactions define phenotypic relationships between genes and reveal the functional organization of a cell. Synthetic genetic array (SGA) methodology automates yeast genetics and enables large-scale and systematic mapping of genetic interaction networks in the budding yeast,Saccharomyces cerevisiae SGA facilitates construction of an output array of double mutants from an input array of single mutants through a series of replica pinning steps. Subsequent analysis of genetic interactions from SGA-derived mutants relies on accurate quantification of colony size, which serves as a proxy for fitness. Since its development, SGA has given rise to a variety of other experimental approaches for functional profiling of the yeast genome and has been applied in a multitude of other contexts, such as genome-wide screens for synthetic dosage lethality and integration with high-content screening for systematic assessment of morphology defects. SGA-like strategies can also be implemented similarly in a number of other cell types and organisms, includingSchizosaccharomyces pombe,Escherichia coli, Caenorhabditis elegans, and human cancer cell lines. The genetic networks emerging from these studies not only generate functional wiring diagrams but may also play a key role in our understanding of the complex relationship between genotype and phenotype. © 2016 Cold Spring Harbor Laboratory Press.

  19. How do yeast sense mitochondrial dysfunction?

    Directory of Open Access Journals (Sweden)

    Dmitry A. Knorre

    2016-09-01

    Full Text Available Apart from energy transformation, mitochondria play important signaling roles. In yeast, mitochondrial signaling relies on several molecular cascades. However, it is not clear how a cell detects a particular mitochondrial malfunction. The problem is that there are many possible manifestations of mitochondrial dysfunction. For example, exposure to the specific antibiotics can either decrease (inhibitors of respiratory chain or increase (inhibitors of ATP-synthase mitochondrial transmembrane potential. Moreover, even in the absence of the dysfunctions, a cell needs feedback from mitochondria to coordinate mitochondrial biogenesis and/or removal by mitophagy during the division cycle. To cope with the complexity, only a limited set of compounds is monitored by yeast cells to estimate mitochondrial functionality. The known examples of such compounds are ATP, reactive oxygen species, intermediates of amino acids synthesis, short peptides, Fe-S clusters and heme, and also the precursor proteins which fail to be imported by mitochondria. On one hand, the levels of these molecules depend not only on mitochondria. On the other hand, these substances are recognized by the cytosolic sensors which transmit the signals to the nucleus leading to general, as opposed to mitochondria-specific, transcriptional response. Therefore, we argue that both ways of mitochondria-to-nucleus communication in yeast are mostly (if not completely unspecific, are mediated by the cytosolic signaling machinery and strongly depend on cellular metabolic state.

  20. Determination of Proteinaceous Selenocysteine in Selenized Yeast

    Directory of Open Access Journals (Sweden)

    Katarzyna Bierla

    2018-02-01

    Full Text Available A method for the quantitation of proteinaceous selenocysteine (SeCys in Se-rich yeast was developed. The method is based on the reduction of the Se-Se and S-Se bridges with dithiotretiol, derivatization with iodoacetamide (carbamidomethylation, followed by HPLC-ICP MS. The chromatographic conditions were optimized for the total recovery of the proteinaceous selenocysteine, the minimum number of peaks in the chromatogram (reduction of derivatization products of other Se-species present and the baseline separation. A typical chromatogram of a proteolytic digest of selenized yeast protein consisted of up to five peaks (including SeMet, carbamidomethylated (CAM-SeCys, and Se(CAM2 identified by retention time matching with available standards and electrospray MS. Inorganic selenium non-specifically attached to proteins and selenomethionine could be quantified (in the form of Se(CAM2 along with SeCys. Selenocysteine, selenomethionine, inorganic selenium, and the water soluble-metabolite fraction accounted for the totality of selenium species in Se-rich yeast.

  1. Dicarbanonaborates in yeast respiration and membrane transport.

    Science.gov (United States)

    Kotyk, A; Lapathitis, G

    1997-04-01

    Two derivatives of carborates, sodium 5,6-dichloro-7,8-dicarbanonaborate (CB-Cl) and sodium 5-mercapto-7,8-dicarbanonaborate (CB-SH) were found to inhibit endogenous as well as glucose-induced respiration of the yeast Saccharomyces cerevisiae. Both substances slightly increased endogenous acid production, were neutral toward H(+)-ATPase-associated acidification but pronouncedly inhibited the K(+)-stimulated acidification. The same effects were observed also with an ATPase-deficient mutant of the yeast. The ATP-hydrolyzing activity of yeast plasma membranes in vitro was severely reduced. The membrane potential was substantially increased toward more negative values. The H(+)-symporting uptake of glutamic acid was considerably decreased, that of adenine was diminished much less. The effects of the dicarbanonaborates are obviously pleiotropic but their inhibition of ATP hydrolysis and of uptake of H(+)-symported substances, on the one hand, and absolute lack of effect on ATPase-catalyzed acidification, on the other, pose an unresolved problem.

  2. Yeast-insect associations: It takes guts.

    Science.gov (United States)

    Stefanini, Irene

    2018-01-23

    Insects interact with microorganisms in several situations, ranging from the accidental interaction to locate attractive food or the acquisition of essential nutrients missing in the main food source. Despite a wealth of studies recently focused on bacteria, the interactions between insects and yeasts have relevant implications for both of the parties involved. The insect intestine shows several structural and physiological differences among species, but it is generally a hostile environment for many microorganisms, selecting against the most sensitive and at the same time guaranteeing a less competitive environment to resistant ones. An intensive characterization of the interactions between yeasts and insects has highlighted their relevance not only for attraction to food but also for the insect's development and behaviour. Conversely, some yeasts have been shown to benefit from interactions with insects, in some cases by being carried among different environments. In addition, the insect intestine may provide a place to reside for prolonged periods and possibly mate or generate sexual forms able to mate once back in the external environments. YEA-May-17-0084.R3. Copyright © 2018 John Wiley & Sons, Ltd.

  3. [Mitochondria inheritance in yeast saccharomyces cerevisiae].

    Science.gov (United States)

    Fizikova, A Iu

    2011-01-01

    The review is devoted to the main mechanisms of mitochondria inheritance in yeast Saccharonmyces cerevisiae. The genetic mechanisms of functionally active mitochondria inheritance in eukaryotic cells is one of the most relevant in modem researches. A great number of genetic diseases are associated with mitochondria dysfunction. Plasticity of eukaryotic cell metabolism according to the environmental changes is ensured by adequate mitochondria functioning by means of ATP synthesis coordination, reactive oxygen species accumulation, apoptosis regulation and is an important factor of cell adaptation to stress. Mitochondria participation in important for cell vitality processes masters the presence of accurate mechanisms of mitochondria functions regulation according to environment fluctuations. The mechanisms of mitochondria division and distribution are highly conserved. Baker yeast S. cerevisiae is an ideal model object for mitochondria researches due to energetic metabolism lability, ability to switch over respiration to fermentation, and petite-positive phenotype. Correction of metabolism according to the environmental changes is necessary for cell vitality. The influence of respiratory, carbon, amino acid and phosphate metabolism on mitochondria functions was shown. As far as the mechanisms that stabilize functions of mitochondria and mtDNA are highly conserve, we can project yeast regularities on higher eukaryotes systems. This makes it possible to approximate understanding the etiology and pathogenesis of a great number of human diseases.

  4. Effects of yeast immobilization on bioethanol production.

    Science.gov (United States)

    Borovikova, Diana; Scherbaka, Rita; Patmalnieks, Aloizijs; Rapoport, Alexander

    2014-01-01

    The current study evaluated a newer method, which includes a dehydration step, of immobilizing Saccharomyces cerevisiae L-77 and S. cerevisiae L-73 onto hydroxylapatite and chamotte ceramic supports. The efficiency of cell immobilization on chamotte was significantly higher than hydroxylapatite. Immobilized yeast preparations were investigated for their ethanol-producing capabilities. The glucose concentration in a fermentation medium was 100 mg/mL. Immobilized preparations produced the same amount of ethanol (48 ± 0.5 mg/mL) as free cells after 36 H of fermentation. During the early stages of fermentation, immobilized yeast cells produced ethanol at a higher rate than free cells. Yeast preparations immobilized on both supports (hydroxylapatite and chamotte) were successfully used in six sequential batch fermentations without any loss of activity. The chamotte support was more stable in the fermentation medium during these six cycles of ethanol production. In addition to the high level of ethanol produced by cells immobilized on chamotte, the stability of this support and its low cost make it a promising material for biotechnologies associated with ethanol production. © 2013 International Union of Biochemistry and Molecular Biology, Inc.

  5. Stress in recombinant protein producing yeasts.

    Science.gov (United States)

    Mattanovich, Diethard; Gasser, Brigitte; Hohenblum, Hubertus; Sauer, Michael

    2004-09-30

    It is well established today that heterologous overexpression of proteins is connected with different stress reactions. The expression of a foreign protein at a high level may either directly limit other cellular processes by competing for their substrates, or indirectly interfere with metabolism, if their manufacture is blocked, thus inducing a stress reaction of the cell. Especially the unfolded protein response (UPR) in Saccharomyces cerevisiae (as well as some other yeasts) is well documented, and its role for the limitation of expression levels is discussed. One potential consequence of endoplasmatic reticulum folding limitations is the ER associated protein degradation (ERAD) involving retrotranslocation and decay in the cytosol. High cell density fermentation, the typical process design for recombinant yeasts, exerts growth conditions that deviate far from the natural environment of the cells. Thus, different environmental stresses may be exerted on the host. High osmolarity, low pH and low temperature are typical stress factors. Whereas the molecular pathways of stress responses are well characterized, there is a lack of knowledge concerning the impact of stress responses on industrial production processes. Accordingly, most metabolic engineering approaches conducted so far target at the improvement of protein folding and secretion, whereas only few examples of cell engineering against general stress sensitivity were published. Apart from discussing well-documented stress reactions of yeasts in the context of heterologous protein production, some more speculative topics like quorum sensing and apoptosis are addressed.

  6. Taming wild yeast: potential of conventional and nonconventional yeasts in industrial fermentations.

    Science.gov (United States)

    Steensels, Jan; Verstrepen, Kevin J

    2014-01-01

    Yeasts are the main driving force behind several industrial food fermentation processes, including the production of beer, wine, sake, bread, and chocolate. Historically, these processes developed from uncontrolled, spontaneous fermentation reactions that rely on a complex mixture of microbes present in the environment. Because such spontaneous processes are generally inconsistent and inefficient and often lead to the formation of off-flavors, most of today's industrial production utilizes defined starter cultures, often consisting of a specific domesticated strain of Saccharomyces cerevisiae, S. bayanus, or S. pastorianus. Although this practice greatly improved process consistency, efficiency, and overall quality, it also limited the sensorial complexity of the end product. In this review, we discuss how Saccharomyces yeasts were domesticated to become the main workhorse of food fermentations, and we investigate the potential and selection of nonconventional yeasts that are often found in spontaneous fermentations, such as Brettanomyces, Hanseniaspora, and Pichia spp.

  7. Not your ordinary yeast: non-Saccharomyces yeasts in wine production uncovered.

    Science.gov (United States)

    Jolly, Neil P; Varela, Cristian; Pretorius, Isak S

    2014-03-01

    Saccharomyces cerevisiae and grape juice are 'natural companions' and make a happy wine marriage. However, this relationship can be enriched by allowing 'wild' non-Saccharomyces yeast to participate in a sequential manner in the early phases of grape must fermentation. However, such a triangular relationship is complex and can only be taken to 'the next level' if there are no spoilage yeast present and if the 'wine yeast' - S. cerevisiae - is able to exert its dominance in time to successfully complete the alcoholic fermentation. Winemakers apply various 'matchmaking' strategies (e.g. cellar hygiene, pH, SO2 , temperature and nutrient management) to keep 'spoilers' (e.g. Dekkera bruxellensis) at bay, and allow 'compatible' wild yeast (e.g. Torulaspora delbrueckii, Pichia kluyveri, Lachancea thermotolerans and Candida/Metschnikowia pulcherrima) to harmonize with potent S. cerevisiae wine yeast and bring the best out in wine. Mismatching can lead to a 'two is company, three is a crowd' scenario. More than 40 of the 1500 known yeast species have been isolated from grape must. In this article, we review the specific flavour-active characteristics of those non-Saccharomyces species that might play a positive role in both spontaneous and inoculated wine ferments. We seek to present 'single-species' and 'multi-species' ferments in a new light and a new context, and we raise important questions about the direction of mixed-fermentation research to address market trends regarding so-called 'natural' wines. This review also highlights that, despite the fact that most frontier research and technological developments are often focussed primarily on S. cerevisiae, non-Saccharomyces research can benefit from the techniques and knowledge developed by research on the former. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  8. Biosorption of nickel by yeasts in an osmotically unsuitable environment

    Energy Technology Data Exchange (ETDEWEB)

    Breierova, Emilia; Kovarova, Annamaria [SAS, Bratislava (Slovakia). Inst. of Chemistry; Certik, Milan [SUT, Bratislava (Slovakia). Dept. of Biochemical Technology; Gregor, Tomas [Mendel Univ. of Agriculture and Forestry, Brno (Czech Republic)

    2008-11-15

    The tolerance, sorption of nickel(II) ions, and changes in the production and composition of exopolymers of eight yeast strains grown under nickel presence with/without NaCl were studied. Strains of Pichia anomala and Candida maltosa known as the most resistant yeasts against nickel tolerated up to 3 mm Ni{sup 2+}. NaCl addition decreased both the resistance ofthe yeast strains toward nickel ions and the sorption of metal ions into cells. All yeasts absorbed nickel predominantly into exopolymers (glycoproteins) and on the surface of cells. However, while the amount of polysaccharide moieties of exoglycoproteins of most of the resistant yeasts was induced by stress conditions, the ratio polysaccharide/protein in the exopolymers remained unchanged in the sensitive species Cystofilobasidium. The exopolymer composition might play a key role in yeast adaptation to stress conditions caused by heavy metal ions. (orig.)

  9. Immunochemotherapy of transplanted KMT-17 tumor in WKA rats by combination of cyclophosphamide and immunostimulatory protein-bound polysaccharide isolated from basidiomycetes.

    Science.gov (United States)

    Akiyama, J; Kawamura, T; Gotohda, E; Yamada, Y; Hosokawa, M; Kodama, T; Kobayashi, H

    1977-09-01

    Protein-bound polysaccharide Kureha (PS-K) isolated from Basidiomycetes was used in combination with cyclophosphamide (CY) for the treatment of a 3-methylcholanthrene- induced KMT-17 fibrosarcoma in WKA/Mk rats. A single administration of PS-K exhibited no inhibitory effect on the growth of s.c.-inoculated KMT-17 tumor at any timing and dose. However, PS-K exhibited a marked antitumor effect when it was combined with CY. The effect of PS-K dependend on the combination timing of PS-K and CY; a marked antitumor effect was observed when PS-K was administered before CY but not if it was given after CY or before tumor inoculation. When PS-K was administered on Day 1 followed by CY on Day 3, the highest survival rate of 78.5% (11 of 14) was obtained. Delayed hypersensitivity response of rats to KMT-17 was investigat ed by radioisotopic footpad assay. On Day 12, the hypersensitivity response in rats treated with PS-K on Day 1 and CY on Day 3 was significantly higher than that in nontreated rats, indicating an enhanced specific immunity to KMT-17 possibly resulting in a marked antitumor effect.

  10. Enhancement of Ganoderic Acid Accumulation by Overexpression of an N-Terminally Truncated 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Gene in the Basidiomycete Ganoderma lucidum

    Science.gov (United States)

    Xu, Jun-Wei; Xu, Yi-Ning

    2012-01-01

    Ganoderic acids produced by Ganoderma lucidum, a well-known traditional Chinese medicinal mushroom, exhibit antitumor and antimetastasis activities. Genetic modification of G. lucidum is difficult but critical for the enhancement of cellular accumulation of ganoderic acids. In this study, a homologous genetic transformation system for G. lucidum was developed for the first time using mutated sdhB, encoding the iron-sulfur protein subunit of succinate dehydrogenase, as a selection marker. The truncated G. lucidum gene encoding the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) was overexpressed by using the Agrobacterium tumefaciens-mediated transformation system. The results showed that the mutated sdhB successfully conferred carboxin resistance upon transformation. Most of the integrated transfer DNA (T-DNA) appeared as a single copy in the genome. Moreover, deregulated constitutive overexpression of the HMGR gene led to a 2-fold increase in ganoderic acid content. It also increased the accumulation of intermediates (squalene and lanosterol) and the upregulation of downstream genes such as those of farnesyl pyrophosphate synthase, squalene synthase, and lanosterol synthase. This study demonstrates that transgenic basidiomycete G. lucidum is a promising system to achieve metabolic engineering of the ganoderic acid pathway. PMID:22941092

  11. Determination of the autolysis of champagne yeast by using 14C-labelled yeast

    International Nuclear Information System (INIS)

    Molnar, I.; Oura, E.; Suomalainen, H.

    1980-01-01

    The degree of autolysis of 14 C-labelled Champagne Hautvillers yeast was studied in the function of different temperatures of storage. A linear relationship was found between the length of the storage and the degree of autolysis. The rate of autolysis increased with raising the temperature of storage. The raising of the temperature by 10 deg C was followed by a 6-7% increase in the rate of autolysis. Shaking up the yeast sediment at 20-day intervals raised the rate of autolysis by 1.5-4.2%. (author)

  12. Probiotic properties of yeasts occurring in fermented food and beverages

    DEFF Research Database (Denmark)

    Jespersen, Lene

    Besides being able to improve the quality and safety of many fermented food and beverages some yeasts offer a number of probiotic traits. Especially a group of yeast referred to as "Saccharomyces boulardii", though taxonomically belonging to Saccharomyces cerevisiae, has been claimed to have...... probiotic properties. Besides, yeasts naturally occurring globally in food and beverages will have traits that might have a positive impact on human health....

  13. Red Yeast Rice Preparations: Are They Suitable Substitutions for Statins?

    Science.gov (United States)

    Dujovne, Carlos A

    2017-10-01

    Red yeast rice, a commercially available food supplement known to reduce serum cholesterol, has been repeatedly advocated as alternative therapy for hypercholesterolemic patients that refuse statins, cannot tolerate statin therapy's side effects, or request a "naturopathic" medicine. Red yeast rice contains a fungus (Monascus purpureus), which was utilized in the original production of lovastatin (MEVACOR, Merck & Co, Whitehouse Station, NJ), the first marketed pharmaceutical statin, and is chemically identical to such product. Their identical properties account for the similarity in therapeutic and side effects of red yeast rice and lovastatin. The red yeast rice ingredient that blocks cholesterol production is monacolin K. Because red yeast rice preparations have large variability in monacolin K content, predicting or understanding dose-related efficacy and side-effect risks of red yeast rice is practically impossible. The lipid-regulating potency of red yeast rice in commercial preparations was found to be extensively different according to the number or concentration of monacolin K they possess. Furthermore, more than one type of monacolin was found in different preparations (or batches) of red yeast rice. Other ingredients found in red yeast rice are also known to be potentially toxic. The US Food and Drug Administration issued warnings to consumers in 2007 and in 2013 against taking red yeast rice products due to the lack of assurance about its efficacy, safety, and lack of standardized preparation methods. This article discusses my clinical trial results with red yeast rice, reviews the literature on its therapeutic and side effects, and discusses why red yeast rice is not an acceptable substitution for statins. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Study on ionizing radiosensitivity of respiratory deficiency yeast mutants

    International Nuclear Information System (INIS)

    Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei

    2006-01-01

    The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)

  15. Dietary glucose regulates yeast consumption in adult Drosophila males

    OpenAIRE

    Lebreton, S?bastien; Witzgall, Peter; Olsson, Marie; Becher, Paul G.

    2014-01-01

    The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies ...

  16. Comparison of Yeast Growth in Mesquite Wood Hydrolysate

    OpenAIRE

    Stanlake, Gary J.

    1986-01-01

    Hot-water extracts of mesquite (Prosopis glandulosa) wood were assayed for their total carbohydrate, reducing sugar, and glucose content. These hydrolysates were then used as complete media for yeast growth. A total of 10 strains of yeasts were evaluated for their biomass production in the mesquite wood hydrolysates. Levels of utilizable carbohydrate proved to be the limiting factor for yeast growth in the hydrolysates.

  17. The responses of lager brewing yeast to low temperatures

    OpenAIRE

    Somani, Abhishek

    2013-01-01

    The removal of yeast biomass (cropping) at the end of fermentation to inoculate a subsequent fermentation (serial-repitching) is common practice in the brewing industry. Between successive fermentations cropped yeast is stored as a slurry in cooled storage vessels under anaerobic conditions until required for subsequent use. Maintenance of yeast quality during storage is critical for subsequent fermentation performance. An assumption is made in brewing that all strains benefit from storage at...

  18. Extracellular protease from the antarctic yeast Candida humicola.

    OpenAIRE

    Ray, M K; Devi, K U; Kumar, G S; Shivaji, S

    1992-01-01

    The psychrotrophic, dimorphic yeast Candida humicola, isolated from Antarctic soil, secretes an acidic protease into the medium. The secretion of this protease by C. humicola was found to be dependent on the composition of the medium. In YPD or yeast nitrogen base medium containing either amino acids or ammonium sulfate as the nitrogen source, the activity of the protease in the medium was low (basal level). However, when yeast nitrogen base medium was depleted of amino acids or ammonium sulf...

  19. Black yeast-like fungi in skin and nail

    DEFF Research Database (Denmark)

    Saunte, D M; Tarazooie, B; Arendrup, M C

    2011-01-01

    the probability of these species to be involved in disease. Slow-growing black yeast-like fungi in routine specimens were prospectively collected and identified. A questionnaire regarding patient information was sent to physicians regarding black yeast-like fungus positive patients. A total of 20 746...... dermatological specimens were examined by culture. Black yeast-like fungi accounted for 2.2% (n = 108) of the positive cultures. Only 31.0% of the samples, culture positive for black yeast-like fungi were direct microscopy positive when compared with overall 68.8% of the culture positive specimens. The most...

  20. Adsorption of egg albumin onto methylated yeast biomass

    OpenAIRE

    Seki, Hideshi; Suzuki, Akira; Maruyama, Hideo

    2004-01-01

    A new biosorbent, methylated yeast (MeYE), was prepared for the adsorptive separation of proteins from aqueous solutions. Yeast was methylated in a 0.1 M HCl methyl alcohol solution at room temperature. About 80% of the carboxylic groups of yeast could be methylated within 9 h. The adsorption of egg albumin to MeYE was studied to evaluate the protein adsorption ability of MeYE. At near neutral pH, egg albumin was scarcely adsorbed to unmethylated yeast and the adsorption amount of egg albumin...

  1. Biosorption of uranium by two kinds of yeasts

    International Nuclear Information System (INIS)

    Liu Wenjuan; Xu Weichang; Wang Baoe

    2003-01-01

    The biosorption of Uranium on two kinds of yeasts from aqueous solution and the effects of the experimental conditions on the biosorption and the effects of various pretreatment procedures are investigated. The experimental results show that the yeasts are an efficient bio-sorbent, by which 99% U in aqueous solution can be adsorbed. The adsorption capacity of the yeasts is more than 162.5 mgU/g. The relationship between concentration of U in aqueous solutions and adsorption capacity of U can be described by the Langmuir and Freundlich adsorption equation. The uranium adsorbed by the yeasts can be desorbed easily by 0.1 mol/LNaHCO 3

  2. Media for preservative resistant yeasts: a collaborative study.

    Science.gov (United States)

    Hocking, A D

    1996-04-01

    An international collaborative study was carried out to determine the most effective medium for selective isolation and enumeration of preservative resistant yeasts. Such a medium should prevent the growth of other yeasts such as Saccharomyces cerevisiae that are tolerant to lower levels of commonly used food preservatives, and sensitive yeasts such as Rhodotorula species. The study compared two non-selective media that are in common use for cultivation of yeasts from foods, Malt Extract agar (MEA) and Tryptone Glucose Yeast extract agar (TGY) with media made selective for preservative resistant yeasts by addition of 0.5% acetic acid to these two basal media (MEAA and TGYA). A fifth medium, Zygosaccharomyces bailii medium (ZBM) was also included in the study. These media were compared for their efficacy in selective isolation and enumeration of the preservative resistant yeasts Zygosaccharomyces bailii, Schizosaccharomyces pombe and Pichia membranaefaciens. MEA and TGY without acetic acid were used as control, non-selective media, and Rhodotorula glutinis was the preservative sensitive control culture. Seven laboratories in six countries took part in the study. Of the non-selective media, TGY generally gave the highest counts, and TGY amended with 0.5% acetic acid (TGYA) was the best medium for recovery of all three preservative-resistant yeasts. ZBM was found to be selective for Z. bailii, but counts of this yeast on ZBM were significantly lower than on TGYA. R. glutinis did not grow on any of the selective media.

  3. Aboveground Deadwood Deposition Supports Development of Soil Yeasts

    Directory of Open Access Journals (Sweden)

    Thorsten Wehde

    2012-12-01

    Full Text Available Unicellular saprobic fungi (yeasts inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil-borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon. Unlike soils underneath logs, yeast communities in adjacent areas harbored a considerable number of transient (phylloplane-related yeasts reaching 30% of the total yeast quantity. We showed that distinguishing autochthonous community members and species transient in soils is essential to estimate appropriate effects of environmental factors on soil fungi. Furthermore, a better understanding of species niches is crucial for analyses of culture-independent data, and may hint to the discovery of unifying patterns of microbial species distribution.

  4. Variation in yeast mitochondrial activity associated with asci.

    Science.gov (United States)

    Swart, Chantel W; van Wyk, Pieter W J; Pohl, Carolina H; Kock, Johan L F

    2008-07-01

    An increase in mitochondrial membrane potential (DeltaPsim) and mitochondrially produced 3-hydroxy (3-OH) oxylipins was experienced in asci of the nonfermentative yeasts Galactomyces reessii and Lipomyces starkeyi and the fermentative yeasts Pichia farinosa and Schizosaccharomyces octosporus. Strikingly, asci of Zygosaccharomyces bailii showed no increase in mitochondrial activity (DeltaPsim and oxylipin production). As expected, oxygen deprivation only inhibited ascus formation in those yeasts with increased ascus mitochondrial activity. We conclude that ascus formation in yeasts is not always dependent on mitochondrial activity. In this case, fermentation may provide enough energy for ascus formation in Z. bailii.

  5. Specificity of transmembrane protein palmitoylation in yeast.

    Directory of Open Access Journals (Sweden)

    Ayelén González Montoro

    Full Text Available Many proteins are modified after their synthesis, by the addition of a lipid molecule to one or more cysteine residues, through a thioester bond. This modification is called S-acylation, and more commonly palmitoylation. This reaction is carried out by a family of enzymes, called palmitoyltransferases (PATs, characterized by the presence of a conserved 50- aminoacids domain called "Asp-His-His-Cys- Cysteine Rich Domain" (DHHC-CRD. There are 7 members of this family in the yeast Saccharomyces cerevisiae, and each of these proteins is thought to be responsible for the palmitoylation of a subset of substrates. Substrate specificity of PATs, however, is not yet fully understood. Several yeast PATs seem to have overlapping specificity, and it has been proposed that the machinery responsible for palmitoylating peripheral membrane proteins in mammalian cells, lacks specificity altogether.Here we investigate the specificity of transmembrane protein palmitoylation in S. cerevisiae, which is carried out predominantly by two PATs, Swf1 and Pfa4. We show that palmitoylation of transmembrane substrates requires dedicated PATs, since other yeast PATs are mostly unable to perform Swf1 or Pfa4 functions, even when overexpressed. Furthermore, we find that Swf1 is highly specific for its substrates, as it is unable to substitute for other PATs. To identify where Swf1 specificity lies, we carried out a bioinformatics survey to identify amino acids responsible for the determination of specificity or Specificity Determination Positions (SDPs and showed experimentally, that mutation of the two best SDP candidates, A145 and K148, results in complete and partial loss of function, respectively. These residues are located within the conserved catalytic DHHC domain suggesting that it could also be involved in the determination of specificity. Finally, we show that modifying the position of the cysteines in Tlg1, a Swf1 substrate, results in lack of palmitoylation, as

  6. How does yeast respond to pressure?

    Directory of Open Access Journals (Sweden)

    Fernandes P.M.B.

    2005-01-01

    Full Text Available The brewing and baking yeast Saccharomyces cerevisiae has been used as a model for stress response studies of eukaryotic cells. In this review we focus on the effect of high hydrostatic pressure (HHP on S. cerevisiae. HHP exerts a broad effect on yeast cells characteristic of common stresses, mainly associated with protein alteration and lipid bilayer phase transition. Like most stresses, pressure induces cell cycle arrest. Below 50 MPa (500 atm yeast cell morphology is unaffected whereas above 220 MPa wild-type cells are killed. S. cerevisiae cells can acquire barotolerance if they are pretreated with a sublethal stress due to temperature, ethanol, hydrogen peroxide, or pressure. Nevertheless, pressure only leads to protection against severe stress if, after pressure pretreatment, the cells are also re-incubated at room pressure. We attribute this effect to the inhibition of the protein synthesis apparatus under HHP. The global genome expression analysis of S. cerevisiae cells submitted to HHP revealed a stress response profile. The majority of the up-regulated genes are involved in stress defense and carbohydrate metabolism while most repressed genes belong to the cell cycle progression and protein synthesis categories. However, the signaling pathway involved in the pressure response is still to be elucidated. Nitric oxide, a signaling molecule involved in the regulation of a large number of cellular functions, confers baroprotection. Furthermore, S. cerevisiae cells in the early exponential phase submitted to 50-MPa pressure show induction of the expression level of the nitric oxide synthase inducible isoform. As pressure becomes an important biotechnological tool, studies concerning this kind of stress in microorganisms are imperative.

  7. Population FBA predicts metabolic phenotypes in yeast.

    Directory of Open Access Journals (Sweden)

    Piyush Labhsetwar

    2017-09-01

    Full Text Available Using protein counts sampled from single cell proteomics distributions to constrain fluxes through a genome-scale model of metabolism, Population flux balance analysis (Population FBA successfully described metabolic heterogeneity in a population of independent Escherichia coli cells growing in a defined medium. We extend the methodology to account for correlations in protein expression arising from the co-regulation of genes and apply it to study the growth of independent Saccharomyces cerevisiae cells in two different growth media. We find the partitioning of flux between fermentation and respiration predicted by our model agrees with recent 13C fluxomics experiments, and that our model largely recovers the Crabtree effect (the experimentally known bias among certain yeast species toward fermentation with the production of ethanol even in the presence of oxygen, while FBA without proteomics constraints predicts respirative metabolism almost exclusively. The comparisons to the 13C study showed improvement upon inclusion of the correlations and motivated a technique to systematically identify inconsistent kinetic parameters in the literature. The minor secretion fluxes for glycerol and acetate are underestimated by our method, which indicate a need for further refinements to the metabolic model. For yeast cells grown in synthetic defined (SD medium, the calculated broad distribution of growth rates matches experimental observations from single cell studies, and we characterize several metabolic phenotypes within our modeled populations that make use of diverse pathways. Fast growing yeast cells are predicted to perform significant amount of respiration, use serine-glycine cycle and produce ethanol in mitochondria as opposed to slow growing cells. We use a genetic algorithm to determine the proteomics constraints necessary to reproduce the growth rate distributions seen experimentally. We find that a core set of 51 constraints are essential but

  8. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts

    Czech Academy of Sciences Publication Activity Database

    Pálková, Z.; Váchová, Libuše

    2016-01-01

    Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016

  9. Utilization of spent brewer’s yeast Saccharomyces cerevisiae for the production of yeast enzymatic hydrolysate

    Directory of Open Access Journals (Sweden)

    M Bayarjargal

    2014-09-01

    Full Text Available Spent brewer’s yeast (Saccharomyces cerevisiae is a rich source of protein, vitamins and widely used as a raw material for production of food supplements. The autolysis and enzymatic treatment of spent brewer’s yeast using Pancreatin (2.5% and Flavourzyme (2.5% were performed at 45 °C and 50 °C, respectively. The autolysis and hydrolysis processes were evaluated by determining a soluble solids, soluble protein concentration and α-amino nitrogen content in a reaction mixture. The yield of pancreatic digest and α-amino nitrogen content was high in comparison with autolysis and Flavourzyme treatment. The total solids recovery in dry Yeast hydrolysate was about 50%, a protein and α-amino nitrogen content was 55.9 and 4.8%, respectively. These results show the possibility of utilizing the spent brewer’s yeast as hydrolysate using hydrolytic enzymes and use it as a food supplement after biological experiments.DOI: http://dx.doi.org/10.5564/mjc.v12i0.179 Mongolian Journal of Chemistry Vol.12 2011: 88-91

  10. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2017-09-12

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  11. Studies on the yeast nucleus : III. Properties of a deoxyribonucleoprotein complex derived from yeast

    NARCIS (Netherlands)

    Vliet, P.C. van der; Tonino, G.J.M.; Rozijn, Th.H.

    1969-01-01

    1. A deoxyribonucleoprotein complex was isolated from Saccharomyces cerevisiae. It is composed of 36% DNA, 4% RNA and 60% protein. About 70% of the protein is acid-extractable. The complex sediments as a single band with a s°20,w of 27 S. 2. The yeast deoxyribonucleoprotein shows a biphasic melting

  12. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2016-08-09

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  13. Genetically modified yeast species and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2011-05-17

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  14. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2014-01-07

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  15. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2013-05-14

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  16. In situ rheology of yeast biofilms.

    Science.gov (United States)

    Brugnoni, Lorena I; Tarifa, María C; Lozano, Jorge E; Genovese, Diego

    2014-01-01

    The aim of the present work was to investigate the in situ rheological behavior of yeast biofilms growing on stainless steel under static and turbulent flow. The species used (Rhodototula mucilaginosa, Candida krusei, Candida kefyr and Candida tropicalis) were isolated from a clarified apple juice industry. The flow conditions impacted biofilm composition over time, with a predominance of C. krusei under static and turbulent flow. Likewise, structural variations occurred, with a tighter appearance under dynamic flow. Under turbulent flow there was an increase of 112 μm in biofilm thickness at 11 weeks (p rheology and contribute to a thin body of knowledge about fungal biofilm formation.

  17. Levaduras inhibidoras de Penicillium Inhibitory Penicillium yeasts

    Directory of Open Access Journals (Sweden)

    M.R. Benítez Ahrendts

    2004-12-01

    Full Text Available El objetivo de este trabajo fue determinar la acción inhibitoria in vitro e in vivo de algunas cepas de levaduras de la zona citrícola jujeña sobre el crecimiento de los mohos patógenos post-cosecha y seleccionarlas para elaborar un producto de biocontrol. Se aislaron de frutos cítricos cepas de los mohos patógenos post-cosecha Penicillium digitatum, P. italicum,P. ulaiense, Phyllosticta sp. y Galactomyces geotrichum, así como de levaduras saprófítas de los géneros Brettanomyces, Candida, Cryptococcus, Kloeckera, Pichia y Rhodotorula. También se obtuvieron algunas levaduras de otras fuentes. Se identificaron las levaduras por las características macro y micromorfológicas y las pruebas fisiológicas. La actividad in vitro e in vivo de las diferentes cepas fue diferente según se enfrentaran a P. digitatum o P. ulaiense. Candida cantarellii y una cepa de Pichia subpelliculosa produjeron una reducción significativa del área de las lesiones provocadas por estas especies de Penicillium, y podrían ser empleadas en la formulación de un producto para biocontrol.The objective of this work was to establish the in vitro and in vivo inhibition of post-harvest pathogenic moulds by yeasts in order to make a biocontrol product. Post-harvest pathogenic moulds Penicillium digitatumP. italicum, P. ulaiense, Phyllosticta sp., Galactomyces geotrichum and yeasts belonging to genera Brettanomyces, Candida, Cryptococcus, Kloeckera,Pichia, Rhodotorula were isolated from citrus fruits. Some yeasts strains were also isolated from other sources. The yeasts were identified by their macro and micro-morphology and physiological tests. The in vitro and in vivo activities against P. digitatum or P. ulaiense were different. Candida cantarellii and one strain of Pichia subpelliculosa produced a significant reduction of the lesion area caused by the pathogenic moulds P. digitatum and P. ulaiense, and could be used in a biocontrol product formulation.

  18. Alteration of yeast activity by gamma radiation

    International Nuclear Information System (INIS)

    Chacharkar, M.P.; Tak, B.B.; Bhati, J.

    1996-01-01

    Yeast is an important component in microbe based industrial technologies. Due to the techno-economic reasons, the fermentation technique has acquired renewed interest. The effect of γ-radiation on the fermentation reaction has been investigated. The studies show that exposure of the fermentation mixture to γ-radiation at 5 kGy enhance alcohol production, whereas irradiation at higher doses, viz., 10 kGy and 25 kGy caused a considerable reduction in the alcohol yield. Therefore, low dose irradiation of fermentation mixtures can be applied for increasing the alcohol production by about 25%. (author). 13 refs., 1 fig

  19. De Novo Biosynthesis of Vanillin in Fission Yeast (Schizosaccharomyces pombe) and Baker's Yeast (Saccharomyces cerevisiae) ▿

    Science.gov (United States)

    Hansen, Esben H.; Møller, Birger Lindberg; Kock, Gertrud R.; Bünner, Camilla M.; Kristensen, Charlotte; Jensen, Ole R.; Okkels, Finn T.; Olsen, Carl E.; Motawia, Mohammed S.; Hansen, Jørgen

    2009-01-01

    Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin β-d-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity. PMID:19286778

  20. Yeast lipid metabolism at a glance.

    Science.gov (United States)

    Klug, Lisa; Daum, Günther

    2014-05-01

    During the last decades, lipids have gained much attention due to their involvement in health and disease. Lipids are required for the formation of membranes and contribute to many different processes such as cell signaling, energy supply, and cell death. Various organelles such as the endoplasmic reticulum, mitochondria, peroxisomes, and lipid droplets are involved in lipid metabolism. The yeast Saccharomyces cerevisiae has become a reliable model organism to study biochemistry, molecular biology, and cell biology of lipids. The availability of mutants bearing defects in lipid metabolic pathways and the ease of manipulation by culture conditions facilitated these investigations. Here, we summarize the current knowledge about lipid metabolism in yeast. We grouped this large topic into three sections dealing with (1) fatty acids; (2) membrane lipids; and (3) storage lipids. Fatty acids serve as building blocks for the synthesis of membrane lipids (phospholipids, sphingolipids) and storage lipids (triacylglycerols, steryl esters). Phospholipids, sterols, and sphingolipids are essential components of cellular membranes. Recent investigations addressing lipid synthesis, degradation, and storage as well as regulatory aspects are presented. The role of enzymes governing important steps of the different lipid metabolic pathways is described. Finally, the link between lipid metabolic and dynamic processes is discussed. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  1. Yeast ABC transporters in lipid trafficking.

    Science.gov (United States)

    Prasad, Rajendra; Khandelwal, Nitesh Kumar; Banerjee, Atanu

    2016-08-01

    Throughout its evolution, the ATP-binding cassette (ABC) transporter superfamily has experienced a rapid expansion in its substrate repertoire and functions. Of the diverse functions that these pumps offer, their drug transport properties have attracted considerable attention primarily owing to their clinical significance. Despite this fact, emerging evidence suggests that physiological substrates of transporters also affect the overall functioning of an organism. Lipids, as substrates of ABC transporters, constitute one feature found in all representative groups of the living kingdom. Due to the importance of lipid species in the cellular physiology of an organism, their proper distribution within cells is crucial. This fact is well exemplified by the vast number of medical conditions that have been caused as a result of perturbations in ABC transporter-mediated lipid transport in higher organisms. In yeasts, apart from providing transport functions, ABC transporters also coordinate regulatory networks with lipids. This review focuses on yeast ABC transporters involved in the transport of lipids and briefly discusses the integration of their regulatory network with that of the lipid species. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Thermotolerant yeasts and application for ethanol production

    Directory of Open Access Journals (Sweden)

    To-on, N.

    2007-07-01

    Full Text Available A total of 70 thermotolerant yeast strains were isolated at 40oC from 145 samples including fruit, leaves, flowers, soils and oil-palm fruits. Six isolates showed maximum growth at 40oC within 18 h. Three isolates (MIY1, MIY48 and MIY57 were selected based on their ability to ferment glucose and sucrose rapidly (24 h and showed the maximum temperature for growth at 42oC but it was good at 40oC. MIY57 produced 4.6% (v/v ethanol at 40oC from a medium containing 15% glucose. The optimum cultivation conditions for growth and ethanol production of MIY57 was 5% inoculum into the fermentation medium containing 15% glucose and 1% yeast extract with initial pH of 4.5 on a shaking incubator at 150 rpm at 40oC. MIY57, under these conditions, produced maximum ethanol of 5.0% (v/v after 48 h incubation while S. cerevisiae TISTR 5048 produced only 3.7% (v/v. Maximum cell dry weight was 7.2 g/L (at 18 h, again much higher than that of S. cerevisiae TISTR 5048 (4.1 g/L. Based on morphological, physiological and molecular studies, this strain (MIY57 was identified as Saccharomyces cerevisiae.

  3. Perchlorate Reduction by Yeast for Mars Exploration

    Science.gov (United States)

    Sharma, Alaisha

    2015-01-01

    Martian soil contains high levels (0.6 percentage by mass) of calcium perchlorate (Ca(ClO4)2), which readily dissociates into calcium and the perchlorate ion (ClO4-) in water. Even in trace amounts, perchlorates are toxic to humans and have been implicated in thyroid dysfunction. Devising methods to lessen perchlorate contamination is crucial to minimizing the health risks associated with human exploration and colonization of Mars. We designed a perchlorate reduction pathway, which sequentially reduces perchlorate to chloride (Cl-) and oxygen (O2), for implementation in the yeast Saccharomyces cerevisiae. Using genes obtained from perchlorate reducing bacteria Azospira oryzae and Dechloromonas aromatica, we plan to assemble this pathway directly within S. cerevisiae through recombinational cloning. A perchlorate reduction pathway would enable S. cerevisiae to lower perchlorate levels and produce oxygen, which may be harvested or used directly by S. cerevisiae for aerobic growth and compound synthesis. Moreover, using perchlorate as an external electron acceptor could improve the efficiency of redox-imbalanced production pathways in yeast. Although several perchlorate reducing bacteria have been identified and utilized in water treatment systems on Earth, the widespread use of S. cerevisiae as a synthetic biology platform justifies the development of a perchlorate reducing strain for implementation on Mars.

  4. Parameters affecting methanol utilization by yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Foda, M.S.; El-Masry, H.G.

    1981-01-01

    Screening of 28 yeast cultures, representing 22 species of various yeasts, with respect to their capabilities to assimilate methanol, has shown that this property was mostly found in certain species of the two genera Hansenula and Candida. When methanol was used as a sole carbon source for a methanol-adapted strain of Hansenula polymorpha, a linear yield response could be obtained with increasing alcohol up to 2% concentration. The amount of inoculum proved to be the decisive factor in determining a priori the ability of the organism to grow at 6% methanol as final concentration. The optimum pH values for growth ranged between 4.5-5.5 with no growth at pH 6.5 or higher. A marked growth stimulation was obtained when the medium was supplied with phosphate up to 0.08 M as final concentration. Within the nitrogen sources tested, corn steep liquor concentrate gave the highest yield of cells. The significance of the obtained results are discussed with reference to feasibilities of application.

  5. Analysis of volatiles from irradiated yeast extract

    International Nuclear Information System (INIS)

    Liao Tao; Li Xin; Zu Xiaoyan; Chen Yuxia; Geng Shengrong

    2013-01-01

    The method for determination volatiles from irradiated yeast extract (YE) using headspace solid phase microextraction (HS-SPME) and gas chromatography-mass spectrometry (GC-MS) was developed in this paper. The extraction conditions were optimized with reference to the peak area and number of volatiles as aldehyde, ketone, alcohol, acid, ester and sulfur compounds. The optimized conditions of HS-SPME for volatiles in irradiated YE were: divinyl benzene/Carboxen/polydimethylsiloxane (DVB/CAR/PDMS) fiber, extration time 40 min, extraction temperature 40℃. The volatiles from YE irradiated by 0-19.8 kGy were detected using HS-SPME coupled with GC-MS. The results showed that only 15 volatiles were detected from no irradiated YE and main compounds were acetic acid, 2, 3-butanediol and 1-hexanol, 2-ethyl-. There were 40 volatiles detected from irradiated YE and the main compounds were acetic acid, phenylethyl alcohol, heptanal and nonanal. Compare to no irradiated yeast extract, the aldehyde, ketone, alkene and disulfide, dimethyl were produced by irradiating process. (authors)

  6. Evaluation of yeast single cell protein (SCP) diets on growth ...

    African Journals Online (AJOL)

    An investigation was carried out on the possibility of replacing fishmeal with graded levels of yeast single cell protein (SCP; 10, 20, 30, 40 and 50%) in ... that the 50% yeast SCP fed fish had the highest percentage of body protein (55.35%), but with a lower amount of fat at the end of the feeding trial compared to the control.

  7. Vaginal yeast infections in diabetic women | Peer | South African ...

    African Journals Online (AJOL)

    Yeasts were isolated from the vaginas of 35,5% of patients and were more common in the symptomatic group (48,0%) than the asymptomatic group (25,4%; P < 0,(5). Candida albicans ... C. glabrata (Torulopsis glabrata) was the COmDlonest yeast species isolated (50,0%), with C. albicans the next most frequent (36,1%).

  8. Evaluation Of Soursop Wine Produced With Baker's Yeast ...

    African Journals Online (AJOL)

    Evaluation Of Soursop Wine Produced With Baker's Yeast ( Saccharomyces cerevisae ) ... Journal of Agriculture and Food Sciences ... Soursop pulp was fermented for wine production using baker's yeast (S. cerevisiae) and the wine produced was evaluated using some wine quality parameters (pH, Titrable acidity (TA), ...

  9. Influence of catalyst (Yeast) on the Biomethanization of Selected ...

    African Journals Online (AJOL)

    acer

    ABSTRACT: Yeast catalyzed the rate of biomethanization of waste materials and rate at which it alter the reaction rate has been determined. It was observed that addition of yeast improved the quality and quantity of biogas generated and also fastened the acid and methane forming stages during biomethanization.

  10. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall

  11. Occurrence of Killer Yeasts in Leaf-Cutting Ant Nests

    NARCIS (Netherlands)

    Carreiro, S.C.; Pagnocca, F.C.; Bacci Jr., M.; Bueno, O.C.; Hebling, M.J.A.; Middelhoven, W.J.

    2002-01-01

    Killer activity was screened in 99 yeast strains isolated from the nests of the leaf-cutting ant Atta sexdens against 6 standard sensitive strains, as well as against each other. Among this yeast community killer activity was widespread since 77 strains (78 %) were able to kill or inhibit the growth

  12. Effect of extracellular calcium chloride on sporangiospore-yeast ...

    African Journals Online (AJOL)

    User

    2011-05-16

    May 16, 2011 ... signalling elements in many eukaryotes, and participate in stimulating the induction and proliferation of yeast cells from ... influx/efflux of materials into the cell that triggered the induction and subsequent proliferation of yeast cells. To examine this ..... achieving rapid growth and product formation. Therefore,.

  13. Yeast contamination potential in a carbonated soft drink industry ...

    African Journals Online (AJOL)

    Components of the filling valve in a gravity filling machine namely, tulip rubber, spreader rubber and vent tube were analyzed for yeasts using the membrane filtration method. After 5 days incubation, it was found that the tulip rubber had the highest yeast count of 9 cfu/20mls while the vent tube had the least count of 5 ...

  14. The making of biodiversity across the yeast subphyllum

    Science.gov (United States)

    Goals for this research project are to determine how the functional diversity of the yeast subphylum is encoded, and to reconstruct the history of yeasts to elucidate the tempo and mode of functional diversification. The impact of this work will be to integrate discoveries within broadly disseminate...

  15. Occurrence and function of yeasts in Asian indigenous fermented foods

    NARCIS (Netherlands)

    Aidoo, K.E.; Nout, M.J.R.; Sarkar, P.K.

    2006-01-01

    In the Asian region, indigenous fermented foods are important in daily life. In many of these foods, yeasts are predominant and functional during the fermentation. The diversity of foods in which yeasts predominate ranges from leavened bread-like products such as nan and idli, to alcoholic beverages

  16. Functional genomics of beer-related physiological processes in yeast

    NARCIS (Netherlands)

    Hazelwood, L.A.

    2009-01-01

    Since the release of the entire genome sequence of the S. cerevisiae laboratory strain S288C in 1996, many functional genomics tools have been introduced in fundamental and application-oriented yeast research. In this thesis, the applicability of functional genomics for the improvement of yeast in

  17. Production of ethanol and polyethanol by yeasts isolated from date ...

    African Journals Online (AJOL)

    Linda

    microbiologically (Mayer, 1991; Chandrasekaran, 1997), especially by yeasts that have a very important metabolic potential. In this regard, this study was done to isolate yeasts from this waste and select the best candidate(s) for the production of these metabolites using sugars dates or glucose, fructose and sucrose.

  18. Identification of Yeasts Present in Sour Fermented Foods and Fodder

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2002-01-01

    This paper deals with rapid methods for identification of 50 yeast species frequently isolated from foods and fodders that underwent a lactic acid fermentation. However, many yeast species present in olive brine, alpechin, and other olive products were not treated. The methods required for

  19. Some Metabolites Act as Second Messengers in Yeast Chronological Aging

    Directory of Open Access Journals (Sweden)

    Karamat Mohammad

    2018-03-01

    Full Text Available The concentrations of some key metabolic intermediates play essential roles in regulating the longevity of the chronologically aging yeast Saccharomyces cerevisiae. These key metabolites are detected by certain ligand-specific protein sensors that respond to concentration changes of the key metabolites by altering the efficiencies of longevity-defining cellular processes. The concentrations of the key metabolites that affect yeast chronological aging are controlled spatially and temporally. Here, we analyze mechanisms through which the spatiotemporal dynamics of changes in the concentrations of the key metabolites influence yeast chronological lifespan. Our analysis indicates that a distinct set of metabolites can act as second messengers that define the pace of yeast chronological aging. Molecules that can operate both as intermediates of yeast metabolism and as second messengers of yeast chronological aging include reduced nicotinamide adenine dinucleotide phosphate (NADPH, glycerol, trehalose, hydrogen peroxide, amino acids, sphingolipids, spermidine, hydrogen sulfide, acetic acid, ethanol, free fatty acids, and diacylglycerol. We discuss several properties that these second messengers of yeast chronological aging have in common with second messengers of signal transduction. We outline how these second messengers of yeast chronological aging elicit changes in cell functionality and viability in response to changes in the nutrient, energy, stress, and proliferation status of the cell.

  20. Molecular identification of uncommon clinical yeast species in Iran

    Directory of Open Access Journals (Sweden)

    Ladan Karimi

    2015-03-01

    Conclusion: We identified several rare clinical isolates selected from a big collection at the species level by ITS-sequencing. As the list of yeast species as opportunistic human fungal infections is increasing dramatically, and many isolates remain unidentified using conventional methods, more sensitive and specific advanced approaches help us to clarify the aspects of microbial epidemiology of the yeast infections.

  1. Construction of yeast surface-displayed cDNA libraries.

    Science.gov (United States)

    Bidlingmaier, Scott; Liu, Bin

    2011-01-01

    Using yeast display, heterologous protein fragments can be efficiently displayed at high copy levels on the Saccharomyces cerevisiae cell wall. Yeast display can be used to screen large expressed protein libraries for proteins or protein fragments with specific binding properties. Recently, yeast surface-displayed cDNA libraries have been constructed and used to identify proteins that bind to various target molecules such as peptides, small molecules, and antibodies. Because yeast protein expression pathways are similar to those found in mammalian cells, human protein fragments displayed on the yeast cell wall are likely to be properly folded and functional. Coupled with fluorescence-activated cell sorting, yeast surface-displayed cDNA libraries potentially allow the selection of protein fragments or domains with affinity for any soluble molecule that can be fluorescently detected. In this report, we describe protocols for the construction and validation of yeast surface-displayed cDNA libraries using preexisting yeast two-hybrid cDNA libraries as a starting point.

  2. Effects of millet malt wort on brewer's yeast | Damisa | Nigerian ...

    African Journals Online (AJOL)

    The effect of Pearl Millet, Penniserum americanum (L), malt won obtained by modified infusion method of mashmg was investigated on the brewers yeast, Saccharomyces uvarum, growth and fermentation performance. Bud formation in the yeast was observed nine hows into the initiation of. the fermentation process which ...

  3. Exploring the Ubiquitin-Proteasome Protein Degradation Pathway in Yeast

    Science.gov (United States)

    Will, Tamara J.; McWatters, Melissa K.; McQuade, Kristi L.

    2006-01-01

    This article describes an undergraduate biochemistry laboratory investigating the ubiquitin-proteasome pathway in yeast. In this exercise, the enzyme beta-galactosidase (beta-gal) is expressed in yeast under the control of a stress response promoter. Following exposure to heat stress to induce beta-gal expression, cycloheximide is added to halt…

  4. Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

    Science.gov (United States)

    Deutch, Charles E.; Marshall, Pamela A.

    2008-01-01

    In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

  5. How do yeast cells become tolerant to high ethanol concentrations?

    DEFF Research Database (Denmark)

    Snoek, Tim; Verstrepen, Kevin J.; Voordeckers, Karin

    2016-01-01

    The brewer’s yeast Saccharomyces cerevisiae displays a much higher ethanol tolerance compared to most other organisms, and it is therefore commonly used for the industrial production of bioethanol and alcoholic beverages. However, the genetic determinants underlying this yeast’s exceptional ethanol...... and challenges involved in obtaining superior industrial yeasts with improved ethanol tolerance....

  6. Isolation and characterization of some dominant yeast strains for ...

    African Journals Online (AJOL)

    The current study was initiated to isolate and characterize yeasts from wet Arabica coffee processing wastes for bioethanol production. Yeast isolates were collected from wet Arabica coffee processing effluent 1, effluent 2, effluent 3, pulp 1 and pulp 2. They were screened and characterized for ethanol production following ...

  7. Influence of catalyst (Yeast) on the Biomethanization of Selected ...

    African Journals Online (AJOL)

    Yeast catalyzed the rate of biomethanization of waste materials and rate at which it alter the reaction rate has been determined. It was observed that addition of yeast improved the quality and quantity of biogas generated and also fastened the acid and methane forming stages during biomethanization. The volumes of ...

  8. Anti-yeast activity of extracts and fractions from Uvariodendron ...

    African Journals Online (AJOL)

    The resistance to available antifungals highlights the urgent need for innovative drugs to treat yeasts infections. This study aimed at evaluating the activity of extracts and fractions from Uvariodendron calophyllum against pathogenic yeasts. The ethanolic and aqueous extracts obtained by maceration were liquidliquid- ...

  9. Yeast Contamination Potential in a Carbonated Soft Drink Industry ...

    African Journals Online (AJOL)

    MICHAEL

    ABSTRACT: Components of the filling valve in a gravity filling machine namely, tulip rubber, spreader rubber and vent tube were analyzed for yeasts using the membrane filtration method. After 5 days incubation, it was found that the tulip rubber had the highest yeast count of 9 cfu/20mls while the vent tube had the least.

  10. Effect of salt hyperosmotic stress on yeast cell viability

    Directory of Open Access Journals (Sweden)

    Logothetis Stelios

    2007-01-01

    Full Text Available During fermentation for ethanol production, yeasts are subjected to different kinds of physico-chemical stresses such as: initially high sugar concentration and low temperature; and later, increased ethanol concentrations. Such conditions trigger a series of biological responses in an effort to maintain cell cycle progress and yeast cell viability. Regarding osmostress, many studies have been focused on transcriptional activation and gene expression in laboratory strains of Saccharomyces cerevisiae. The overall aim of this present work was to further our understanding of wine yeast performance during fermentations under osmotic stress conditions. Specifically, the research work focused on the evaluation of NaCl-induced stress responses of an industrial wine yeast strain S. cerevisiae (VIN 13, particularly with regard to yeast cell growth and viability. The hypothesis was that osmostress conditions energized specific genes to enable yeast cells to survive under stressful conditions. Experiments were designed by pretreating cells with different sodium chloride concentrations (NaCl: 4%, 6% and 10% w/v growing in defined media containing D-glucose and evaluating the impact of this on yeast growth and viability. Subsequent fermentation cycles took place with increasing concentrations of D-glucose (20%, 30%, 40% w/v using salt-adapted cells as inocula. We present evidence that osmostress induced by mild salt pre-treatments resulted in beneficial influences on both cell viability and fermentation performance of an industrial wine yeast strain.

  11. New yeast-based approaches in production of palmitoleic acid

    Czech Academy of Sciences Publication Activity Database

    Kolouchová, I.; Sigler, Karel; Schreiberová, O.; Masák, J.; Řezanka, Tomáš

    2015-01-01

    Roč. 192, SEP 2015 (2015), s. 726-734 ISSN 0960-8524 R&D Projects: GA ČR(CZ) GAP503/11/0215; GA ČR GA14-00227S Institutional support: RVO:61388971 Keywords : Oleaginous yeasts * Non-oleaginous yeasts * Palmitoleic acid Subject RIV: EE - Microbiology, Virology Impact factor: 4.917, year: 2015

  12. Trehalose biosynthesis enhancement for six yeast strains under pressurized culture.

    Science.gov (United States)

    Qiao, Changsheng; Jia, Shiru; Dai, Yujie; Wang, Rui; Sun, Aiyou

    2010-01-01

    Six yeast strains of the commercial brewing yeasts CICC1391 and CICC1471, the commercial baker yeasts CICC1339 and CICC1447, and the commercial alcohol yeasts CICC1286 and CICC1291 have been cultured under 1.0 MPa of pressure with N(2) and CO(2) as pressure media. The concentration of intracellular trehalose and the activity of trehalose synthases complex have been measured. Also, the morphology changes of yeast cells have been observed by scanning electronic microscope. There was a positive correlation between the activity of trehalose synthase complex and the concentration of intracellular trehalose; and there was a negative correlation between the activity of trehalose synthase complex and the viability of yeast strains. Having been cultured for 3 h at high pressure of 1.0 MPa, the concentration of intracellular trehalose and the activity of trehalose synthases complex were improved by 50.1% to 116.4% and 45.2% to 219.1%, respectively, compared to those of atmospheric pressure culture. Under high pressure, many wrinkles appeared on the membrane surface of yeast cells. It has been found that yeasts are more sensitive to high pressure for having more and sharper wrinkles on their cell membranes.

  13. A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin

    Directory of Open Access Journals (Sweden)

    Zhang Tingting

    2012-12-01

    Full Text Available Abstract Background Yeast Saccharomyces cerevisiae is a widely-used system for protein expression. We previously showed that heat-killed whole recombinant yeast vaccine expressing mammalian myostatin can modulate myostatin function in mice, resulting in increase of body weight and muscle composition in these animals. Foreign DNA introduced into yeast cells can be lost soon unless cells are continuously cultured in selection media, which usually contain antibiotics. For cost and safety concerns, it is essential to optimize conditions to produce quality food and pharmaceutical products. Results We developed a simple but effective method to engineer a yeast strain stably expressing mammalian myostatin. This method utilized high-copy-number integration of myostatin gene into the ribosomal DNA of Saccharomyces cerevisiae. In the final step, antibiotic selection marker was removed using the Cre-LoxP system to minimize any possible side-effects for animals. The resulting yeast strain can be maintained in rich culture media and stably express mammalian myostatin for two years. Oral administration of the recombinant yeast was able to induce immune response to myostatin and modulated the body weight of mice. Conclusions Establishment of such yeast strain is a step further toward transformation of yeast cells into edible vaccine to improve meat production in farm animals and treat human muscle-wasting diseases in the future.

  14. Quality evaluation of some commercial baker's yeasts in Nigeria ...

    African Journals Online (AJOL)

    55.8 to161.6mlh g , respectively. Bread baked from different baker's yeasts were not significantly different (p>0.05) in their crumb structure and texture. However, significant differences were found in terms of crust color, loaf symmetry and overall acceptability. The staling rate of bread samples correlated positively with yeast's ...

  15. Industrial relevance of chromosomal copy number variation in Saccharomyces yeasts

    NARCIS (Netherlands)

    Gorter de Vries, A.R.; Pronk, J.T.; Daran, J.G.

    2017-01-01

    Chromosomal copy number variation (CCNV) plays a key role in evolution and health of eukaryotes. The unicellular yeast Saccharomyces cerevisiae is an important model for studying the generation, physiological impact, and evolutionary significance of CCNV. Fundamental studies of this yeast have

  16. The Use of HIS6 Gene as a Selectable Marker for Yeast Vector

    Directory of Open Access Journals (Sweden)

    IMADEARTIKA

    2009-03-01

    Full Text Available The yeast Saccharomyces cerevisiae HIS6 gene has been shown to be functional as a selectable marker for selecting and maintaining a yeast vector in yeast S. cerevisiae host cells. The yeast HIS6 gene encodes an enzyme involved in the yeast histidine biosynthesis. The yeast HIS6 gene was cloned into a yeast expression vector. The resultant recombinant plasmid was introduced into yeast host cells defective in endogenous HIS6 gene. The functionality of the HIS6 gene as a selectable marker was tested by growing transformed cells on selective minimum medium lacking histidine supplementation.

  17. PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

    Energy Technology Data Exchange (ETDEWEB)

    Baldikova, Eva, E-mail: baldie@email.cz [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Applied Chemistry, Faculty of Agriculture, University of South Bohemia, Branisovska 1457, 370 05 Ceske Budejovice (Czech Republic); Prochazkova, Jitka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Stepanek, Miroslav; Hajduova, Jana [Department of Physical and Macromolecular Chemistry, Faculty of Science, Charles University, Hlavova 2030, 128 40 Prague 2 (Czech Republic); Pospiskova, Kristyna [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Safarikova, Mirka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Nanobiotechnology, Biology Centre, CAS, ISB, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Safarik, Ivo [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Biology Centre, CAS, ISB, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)

    2017-04-01

    A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles. - Highlights: • New types of magnetically responsive yeast biocomposites were prepared. • Recently developed PMAA-stabilized magnetic fluid was used. • Three yeast species were entrapped into magnetic chitosan gel during its formation. • All biocatalysts were efficiently employed for invert sugar formation.

  18. Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production

    Directory of Open Access Journals (Sweden)

    Popov Stevan D.

    2005-01-01

    Full Text Available The waste brewer's yeast S. cerevisiae (activated and non-activated was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positively the quality of produced bread regarding bread volume. The volume of developed gas in dough prepared with the use of non-activated BY was not sufficient, therefore, it should not be used as fermentation agent, but only as an additive in bread production process for bread freshness preservation. Intense mixing of dough results in more compressible crumb 48 hrs after baking compared to high-speed mixing.

  19. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  20. Producción de enzimas lignolíticas por Basidiomycetes mediante la técnica de fermentación en sustrato sólido

    OpenAIRE

    García Torres Angélica María; Torres Sáe Rodrigo Gonzalo

    2003-01-01

    La fermentación en sustrato sólido tiene amplias aplicaciones industriales; actualmente, las enzimas son emplea­das principalmente para la obtención de lácteos, edulcolorantes, fármacos, alimentos, licores, detergentes, etc. La degradación enzimática de la lignina es llevada a cabo por la acción de los hongos del género Basidiomycetes mediante un proceso no-específico y oxidativo de tres tipos diferentes de enzimas: Lacasa, Lignina-peroxidasa y Manganeso-peroxidasa; la no-especificidad de ést...

  1. Laccase and its role in production of extracellular reactive oxygen species during wood decay by the brown rot basidiomycete Postia placenta.

    Science.gov (United States)

    Wei, Dongsheng; Houtman, Carl J; Kapich, Alexander N; Hunt, Christopher G; Cullen, Daniel; Hammel, Kenneth E

    2010-04-01

    Brown rot basidiomycetes initiate wood decay by producing extracellular reactive oxygen species that depolymerize the structural polysaccharides of lignocellulose. Secreted fungal hydroquinones are considered one contributor because they have been shown to reduce Fe(3+), thus generating perhydroxyl radicals and Fe(2+), which subsequently react further to produce biodegradative hydroxyl radicals. However, many brown rot fungi also secrete high levels of oxalate, which chelates Fe(3+) tightly, making it unreactive with hydroquinones. For hydroquinone-driven hydroxyl radical production to contribute in this environment, an alternative mechanism to oxidize hydroquinones is required. We show here that aspen wood undergoing decay by the oxalate producer Postia placenta contained both 2,5-dimethoxyhydroquinone and laccase activity. Mass spectrometric analysis of proteins extracted from the wood identified a putative laccase (Joint Genome Institute P. placenta protein identification number 111314), and heterologous expression of the corresponding gene confirmed this assignment. Ultrafiltration experiments with liquid pressed from the biodegrading wood showed that a high-molecular-weight component was required for it to oxidize 2,5-dimethoxyhydroquinone rapidly and that this component was replaceable by P. placenta laccase. The purified laccase oxidized 2,5-dimethoxyhydroquinone with a second-order rate constant near 10(4) M(-1) s(-1), and measurements of the H(2)O(2) produced indicated that approximately one perhydroxyl radical was generated per hydroquinone supplied. Using these values and a previously developed computer model, we estimate that the quantity of reactive oxygen species produced by P. placenta laccase in wood is large enough that it likely contributes to incipient decay.

  2. Analysis of the Basidiomycete Coprinopsis cinerea reveals conservation of the core meiotic expression program over half a billion years of evolution.

    Directory of Open Access Journals (Sweden)

    Claire Burns

    2010-09-01

    Full Text Available Coprinopsis cinerea (also known as Coprinus cinereus is a multicellular basidiomycete mushroom particularly suited to the study of meiosis due to its synchronous meiotic development and prolonged prophase. We examined the 15-hour meiotic transcriptional program of C. cinerea, encompassing time points prior to haploid nuclear fusion though tetrad formation, using a 70-mer oligonucleotide microarray. As with other organisms, a large proportion (∼20% of genes are differentially regulated during this developmental process, with successive waves of transcription apparent in nine transcriptional clusters, including one enriched for meiotic functions. C. cinerea and the fungi Saccharomyces cerevisiae and Schizosaccharomyces pombe diverged ∼500-900 million years ago, permitting a comparison of transcriptional programs across a broad evolutionary time scale. Previous studies of S. cerevisiae and S. pombe compared genes that were induced upon entry into meiosis; inclusion of C. cinerea data indicates that meiotic genes are more conserved in their patterns of induction across species than genes not known to be meiotic. In addition, we found that meiotic genes are significantly more conserved in their transcript profiles than genes not known to be meiotic, which indicates a remarkable conservation of the meiotic process across evolutionarily distant organisms. Overall, meiotic function genes are more conserved in both induction and transcript profile than genes not known to be meiotic. However, of 50 meiotic function genes that were co-induced in all three species, 41 transcript profiles were well-correlated in at least two of the three species, but only a single gene (rad50 exhibited coordinated induction and well-correlated transcript profiles in all three species, indicating that co-induction does not necessarily predict correlated expression or vice versa. Differences may reflect differences in meiotic mechanisms or new roles for paralogs

  3. Lipid raft involvement in yeast cell growth and death

    Directory of Open Access Journals (Sweden)

    Faustino eMollinedo

    2012-10-01

    Full Text Available The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Crytococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na+, K+ and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  4. Lipid raft involvement in yeast cell growth and death

    International Nuclear Information System (INIS)

    Mollinedo, Faustino

    2012-01-01

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na + , K + , and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  5. Antimicrobial activity of yeasts against some pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Gamal Younis

    2017-08-01

    Full Text Available Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR for detection of khs (kievitone hydratase and pelA (pectate degrading enzyme genes. Results: The recovery rate of yeasts from sausage was 20% (2/10 followed by kareish cheese, processed cheese, and butter 10% (1/10 each as well as raw milk 9% (9/100, and fruit yoghurt 30% (6/20. Different yeast species were recovered, namely, Candida kefyr (5 isolates, Saccharomyces cerevisiae (4 isolates, Candida intermedia (3 isolates, Candida tropicalis (2 isolates, Candida lusitaniae (2 isolates, and Candida krusei (1 isolate. khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food.

  6. Introducing a New Breed of Wine Yeast: Interspecific Hybridisation between a Commercial Saccharomyces cerevisiae Wine Yeast and Saccharomyces mikatae

    Science.gov (United States)

    Bellon, Jennifer R.; Schmid, Frank; Capone, Dimitra L.; Dunn, Barbara L.; Chambers, Paul J.

    2013-01-01

    Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment. PMID:23614011

  7. Performance of non-conventional yeasts in co-culture with brewers’ yeast for steering ethanol and aroma production

    NARCIS (Netherlands)

    Rijswijck, van Irma M.H.; Wolkers - Rooijackers, Judith C.M.; Abee, Tjakko; Smid, Eddy J.

    2017-01-01

    Increasing interest in new beer types has stimulated the search for approaches to extend the metabolic variation of brewers’ yeast. Therefore, we tested two approaches using non-conventional yeast to create a beer with lower ethanol content and a complex aroma bouquet. First, the mono-culture

  8. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    Directory of Open Access Journals (Sweden)

    Jennifer R Bellon

    Full Text Available Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade, has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  9. Beneficial properties of probiotic yeast Saccharomyces boulardii

    Directory of Open Access Journals (Sweden)

    Tomičić Zorica M.

    2016-01-01

    Full Text Available Saccharomyces boulardii is unique probiotic and biotherapeutic yeast, known to survive in gastric acidity and it is not adversely affected or inhibited by antibiotics or does not alter or adversely affect the normal microbiota. S. boulardii has been utilized worldwide as a probiotic supplement to support gastrointestinal health. The multiple mechanisms of action of S. boulardii and its properties may explain its efficacy and beneficial effects in acute and chronic gastrointestinal diseases that have been confirmed by clinical trials. Caution should be taken in patients with risk factors for adverse events. Its potential application in various dairy foods could offer an alternative probiotic product to people suffering from antibiotic-associated diarrhea. This review discusses the evidence for efficacy and safety of S. boulardii as a probiotic for the prevention and therapy of gastrointestinal disorders in humans.

  10. Biofuels. Engineering alcohol tolerance in yeast.

    Science.gov (United States)

    Lam, Felix H; Ghaderi, Adel; Fink, Gerald R; Stephanopoulos, Gregory

    2014-10-03

    Ethanol toxicity in the yeast Saccharomyces cerevisiae limits titer and productivity in the industrial production of transportation bioethanol. We show that strengthening the opposing potassium and proton electrochemical membrane gradients is a mechanism that enhances general resistance to multiple alcohols. The elevation of extracellular potassium and pH physically bolsters these gradients, increasing tolerance to higher alcohols and ethanol fermentation in commercial and laboratory strains (including a xylose-fermenting strain) under industrial-like conditions. Production per cell remains largely unchanged, with improvements deriving from heightened population viability. Likewise, up-regulation of the potassium and proton pumps in the laboratory strain enhances performance to levels exceeding those of industrial strains. Although genetically complex, alcohol tolerance can thus be dominated by a single cellular process, one controlled by a major physicochemical component but amenable to biological augmentation. Copyright © 2014, American Association for the Advancement of Science.

  11. Debaryomyces hansenii: An Osmotolerant and Halotolerant Yeast

    Science.gov (United States)

    Aggarwal, Monika; Mondal, Alok K.

    The yeast Debaryomyces hansenii which was isolated from saline environments such as sea water, concentrated brines, salty food, is one of the most halotolerant species. It can grow in media containing as high as 4 M NaCl, while the growth of Saccharomyces cerevisiae is limited in media with more than 1.7 M NaCl. This species is very important for food industry as it is used for surface ripening of cheese and meat products. In the recent past, there is growing interest in understanding the molecular mechanisms of high halotolerance exhibited by D. hansenii. Availability of genome sequence of D. hansenii has opened up new vistas in this direction

  12. Hybridization of halotolerant yeast for alcohol fermentation

    International Nuclear Information System (INIS)

    Limtong, S.

    1991-01-01

    Attempt have been made to construct a new yeast strain from alcohol fermenting strains and salt tolerant strains. It is anticipated that the new yeast strain will be able to ferment alcohol in molasses mash with high salinity, up to 3% of NaCl. Another characteristics is its ability to tolerate up to 40 C temperature which is desirable for alcohol fermentation in tropical countries. Commercial and wild strains of Saccharomyces cerevisiae were screened for their fermenting ability and strain SC90, 191 TJ3, and AM12 were selected as parental strains for fusion among themselves and with other halo tolerant species. Halo tolerant strains selected at 5% NaCl in molasses mash were tentatively identified as Torulopsis grabrata, T. candida, T. Bovina and S. Rouxii whereas all of those strains selected at 17% NaCl were Citeromyces sp. It was found that fusant TA73 derived from wild strain and sake fermenting strain performed best among 4,087 fusants investigated. This fusant fermented much better than their parental strains when salt concentrations were increased to 5 and 7% NaCl. Experiment was carried out in fermentor, 1.5 liter working volume using molasses mash with 3% NaCl and temperature was controlled at 35 degree C. Fermentation rate of TA73, TJ3 and AM12 were 2.17, 1.50 and 1.87 g/L/hr respectively, Maximum ethanol concentration obtained were 7.6, 6.7 and 7.4% by weight after 60 and 78 hours respectively. Other fusants derived from fusion of Saccharomyces cerevisiae with other halo tolerant species were mostly inferior to their parental strains and only 7 fusants were slightly better than parental strains. (author)

  13. S-adenosylmethionine decarboxylase from baker's yeast.

    Science.gov (United States)

    Pösö, H; Sinervirta, R; Jänne, J

    1975-01-01

    1. S-Adenosyl-L-methionine decarboxylase (S-adenosyl-L-methionine carboxy-lyase, EC 4.1.1.50) was purified more than 1100-fold from extracts of Saccharomyces cerevisiae by affinity chromatography on columns of Sepharose containing covalently bound methylglyoxal bis(guanylhydrazone) (1,1'[(methylethanediylidene)dinitrilo]diguanidine) [Pegg, (1974) Biochem J. 141, 581-583]. The final preparation appeared to be homogeneous on polyacrylamide-gel electrophoresis at pH 8.4. 2. S-Adenosylmethionine decarboxylase activity was completely separated from spermidine synthase activity [5'-deoxyadenosyl-(5'),3-aminopropyl-(1),methylsulphonium-salt-putrescine 3-aminopropyltransferase, EC 2.5.1.16] during the purification procedure. 3. Adenosylmethionine decarboxylase activity from crude extracts of baker's yeast was stimulated by putrescine, 1,3-diamino-propane, cadaverine (1,5-diaminopentane) and spermidine; however, the purified enzyme, although still stimulated by the diamines, was completely insensitive to spermidine. 4. Adenosylmethionine decarboxylase has an apparent Km value of 0.09 mM for adenosylmethionine in the presence of saturating concentrations of putrescine. The omission of putrescine resulted in a five-fold increase in the apparent Km value for adenosylmethionine. 5. The apparent Ka value for putrescine, as the activator of the reaction, was 0.012 mM. 6. Methylglyoxal bis(guanylhydrazone) and S-methyladenosylhomocysteamine (decarboxylated adenosylmethionine) were powerful inhibitors of the enzyme. 7. Adenosylmethionine decarboxylase from baker's yeast was inhibited by a number of conventional carbonyl reagents, but in no case could the inhibition be reversed with exogenous pyridoxal 5'-phosphate. PMID:1108876

  14. Unsuspected pyocyanin effect in yeast under anaerobiosis.

    Science.gov (United States)

    Barakat, Rana; Goubet, Isabelle; Manon, Stephen; Berges, Thierry; Rosenfeld, Eric

    2014-02-01

    The blue-green phenazine, Pyocyanin (PYO), is a well-known virulence factor produced by Pseudomonas aeruginosa, notably during cystic fibrosis lung infections. It is toxic to both eukaryotic and bacterial cells and several mechanisms, including the induction of oxidative stress, have been postulated. However, the mechanism of PYO toxicity under the physiological conditions of oxygen limitation that are encountered by P. aeruginosa and by target organisms in vivo remains unclear. In this study, wild-type and mutant strains of the yeast Saccharomyces cerevisiae were used as an effective eukaryotic model to determine the toxicity of PYO (100-500 μmol/L) under key growth conditions. Under respiro-fermentative conditions (with glucose as substrate), WT strains and certain H2 O2 -hypersensitive strains showed a low-toxic response to PYO. Under respiratory conditions (with glycerol as substrate) all the strains tested were significantly more sensitive to PYO. Four antioxidants were tested but only N-acetylcysteine was capable of partially counteracting PYO toxicity. PYO did not appear to affect short-term respiratory O2 uptake, but it did seem to interfere with cyanide-poisoned mitochondria through a complex III-dependent mechanism. Therefore, a combination of oxidative stress and respiration disturbance could partly explain aerobic PYO toxicity. Surprisingly, the toxic effects of PYO were more significant under anaerobic conditions. More pronounced effects were observed in several strains including a 'petite' strain lacking mitochondrial DNA, strains with increased or decreased levels of ABC transporters, and strains deficient in DNA damage repair. Therefore, even though PYO is toxic for actively respiring cells, O2 may indirectly protect the cells from the higher anaerobic-linked toxicity of PYO. The increased sensitivity to PYO under anaerobic conditions is not unique to S. cerevisiae and was also observed in another yeast, Candida albicans. © 2013 The Authors

  15. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  16. Oxidative stress and antioxidant response in a thermotolerant yeast.

    Science.gov (United States)

    Mejía-Barajas, Jorge A; Montoya-Pérez, Rocío; Salgado-Garciglia, Rafael; Aguilera-Aguirre, Leopoldo; Cortés-Rojo, Christian; Mejía-Zepeda, Ricardo; Arellano-Plaza, Melchor; Saavedra-Molina, Alfredo

    Stress tolerance is a key attribute that must be considered when using yeast cells for industrial applications. High temperature is one factor that can cause stress in yeast. High environmental temperature in particular may exert a natural selection pressure to evolve yeasts into thermotolerant strains. In the present study, three yeasts (Saccharomyces cerevisiae, MC4, and Kluyveromyces marxianus, OFF1 and SLP1) isolated from hot environments were exposed to increased temperatures and were then compared with a laboratory yeast strain. Their resistance to high temperature, oxidative stress, and antioxidant response were evaluated, along with the fatty acid composition of their cell membranes. The SLP1 strain showed a higher specific growth rate, biomass yield, and biomass volumetric productivity while also showing lower duplication time, reactive oxygen species (ROS) production, and lipid peroxidation. In addition, the SLP1 strain demonstrated more catalase activity after temperature was increased, and this strain also showed membranes enriched in saturated fatty acids. It is concluded that the SLP1 yeast strain is a thermotolerant yeast with less oxidative stress and a greater antioxidant response. Therefore, this strain could be used for fermentation at high temperatures. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  17. Oxidative stress and antioxidant response in a thermotolerant yeast

    Directory of Open Access Journals (Sweden)

    Jorge A. Mejía-Barajas

    Full Text Available Abstract Stress tolerance is a key attribute that must be considered when using yeast cells for industrial applications. High temperature is one factor that can cause stress in yeast. High environmental temperature in particular may exert a natural selection pressure to evolve yeasts into thermotolerant strains. In the present study, three yeasts (Saccharomyces cerevisiae, MC4, and Kluyveromyces marxianus, OFF1 and SLP1 isolated from hot environments were exposed to increased temperatures and were then compared with a laboratory yeast strain. Their resistance to high temperature, oxidative stress, and antioxidant response were evaluated, along with the fatty acid composition of their cell membranes. The SLP1 strain showed a higher specific growth rate, biomass yield, and biomass volumetric productivity while also showing lower duplication time, reactive oxygen species (ROS production, and lipid peroxidation. In addition, the SLP1 strain demonstrated more catalase activity after temperature was increased, and this strain also showed membranes enriched in saturated fatty acids. It is concluded that the SLP1 yeast strain is a thermotolerant yeast with less oxidative stress and a greater antioxidant response. Therefore, this strain could be used for fermentation at high temperatures.

  18. Zinc, Copper and Manganese Enrichment in Yeast Saccharomyces cerevisae

    Directory of Open Access Journals (Sweden)

    Vesna Stehlik-Tomas

    2004-01-01

    Full Text Available The aim of the present work was to study the incorporation of some microelements in the yeast Saccharomyces cerevisiae and its impact on the physiological state of the yeast cells during the alcoholic fermentation. The cultivations were performed on molasses medium in anaerobic (thermostat and semiaerobic (shaker conditions, with and without the addition of zinc, copper and manganese sulphate (0.1 g/L of each at 30 °C and different pH values of the medium (3.5–6.0 for 8 h. The addition of the mentioned salts in molasses medium enhanced the yield of the yeast biomass up to 30 % in semiaerobic conditions, but the ethanol yield was changed very little. On the other hand, in anaerobic conditions the yields of the yeast biomass were increased up to 10 % and alcohol yield up to 20 %. After the fermentations were performed, the concentration of metal ions in yeast cells was determined. Different values were achieved depending on the used growth conditions. The highest amount of Zn ions in dry matter (700 μg/g was incorporated in the yeast biomass under anaerobic conditions. In contrast, the incorporation of Cu and Mn was preferred in semiaerobic conditions and the highest value of Cu2+ ions in dry matter (1100 μg/g and Mn2+ in dry matter (300 μg/g in yeast biomass were obtained. Optimal pH for all ion incorporations was between 4 and 5.

  19. The yeast spectrum of the 'tea fungus Kombucha'.

    Science.gov (United States)

    Mayser, P; Fromme, S; Leitzmann, C; Gründer, K

    1995-01-01

    The tea fungus 'Kombucha' is a symbiosis of Acetobacter, including Acetobacter xylinum as a characteristic species, and various yeasts. A characteristic yeast species or genus has not yet been identified. Kombucha is mainly cultivated in sugared black tea to produce a slightly acidulous effervescent beverage that is said to have several curative effects. In addition to sugar, the beverage contains small amounts of alcohol and various acids, including acetic acid, gluconic acid and lactic acid, as well as some antibiotic substances. To characterize the yeast spectrum with special consideration given to facultatively pathogenic yeasts, two commercially available specimens of tea fungus and 32 from private households in Germany were analysed by micromorphological and biochemical methods. Yeasts of the genera Brettanomyces, Zygosaccharomyces and Saccharomyces were identified in 56%, 29% and 26% respectively. The species Saccharomycodes ludwigii and Candida kefyr were only demonstrated in isolated cases. Furthermore, the tests revealed pellicle-forming yeasts such as Candida krusei or Issatchenkia orientalis/occidentalis as well as species of the apiculatus yeasts (Kloeckera, Hanseniaspora). Thus, the genus Brettanomyces may be a typical group of yeasts that are especially adapted to the environment of the tea fungus. However, to investigate further the beneficial effects of tea fungus, a spectrum of the other typical genera must be defined. Only three specimens showed definite contaminations. In one case, no yeasts could be isolated because of massive contamination with Penicillium spp. In the remaining two samples (from one household), Candida albicans was demonstrated. The low rate of contamination might be explained by protective mechanisms, such as formation of organic acids and antibiotic substances. Thus, subjects with a healthy metabolism do not need to be advised against cultivating Kombucha. However, those suffering from immunosuppression should preferably

  20. Gut yeast communities in Larus michahellis from various breeding colonies.

    Science.gov (United States)

    Al-Yasiri, Mohammed Hashim; Normand, Anne-Cécile; Piarroux, Renaud; Ranque, Stéphane; Mauffrey, Jean-François

    2017-06-01

    Yellow-legged gulls have been reported to carry antibiotic-resistant Enterobacteriaceae; however, the gut mycobiota of these birds has not yet been described. In this study, we analyzed the gut yeast communities in five yellow-legged gull breeding colonies along the Mediterranean littoral in southern France. Gull fecal samples were inoculated onto four types of culture media, including one supplemented with itraconazole. Yeast species richness, abundance, and diversity were estimated, and factorial analysis was used to highlight correspondences between breeding colonies. Yeast grew in 113 of 177 cultures, and 17 distinct yeast species were identified. The most frequent species were Candida krusei (53.5%), Galactomyces geotrichum (44.1%), C. glabrata (40.9%), C. albicans (20.5%), and Saccharomyces cerevisiae (18.1%). Gut yeast community structure in the gulls at both Pierre-Blanche Lagoon (PB) and Frioul Archipelago (F) were characterized by greater species richness and diversity than in those at the two cities of La Grande-Motte (GM) and Palavas-les-Flots (PF) as well as Riou Archipelago (R). Gulls in these latter three sites probably share a similar type of anthropogenic diet. Notably, the proportion of anthropic yeast species, including C. albicans and C. glabrata, in the gull mycobiota increased with gull colony synanthropy. Antifungal resistance was found in each of the five most frequent yeast species. We found that the gut yeast communities of these yellow-legged gulls include antifungal-resistant human pathogens. Further studies should assess the public health impact of these common synanthropic seabirds, which represent a reservoir and disseminator of drug-resistant human pathogenic yeast into the environment. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Brettanomyces bruxellensis yeasts: impact on wine and winemaking.

    Science.gov (United States)

    Agnolucci, Monica; Tirelli, Antonio; Cocolin, Luca; Toffanin, Annita

    2017-09-21

    Yeasts belonging to the Brettanomyces/Dekkera genus are non-conventional yeasts, which affect winemaking by causing wine spoilage all over the world. This mini-review focuses on recent results concerning the presence of Brettanomyces bruxellensis throughout the wine processing chain. Here, culture-dependent and independent methods to detect this yeast on grapes and at the very early stage of wine production are encompassed. Chemical, physical and biological tools, devised for the prevention and control of such a detrimental species during winemaking are also presented. Finally, the mini-review identifies future research areas relevant to the improvement of wine safety and sensory profiles.

  2. PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

    Science.gov (United States)

    Baldikova, Eva; Prochazkova, Jitka; Stepanek, Miroslav; Hajduova, Jana; Pospiskova, Kristyna; Safarikova, Mirka; Safarik, Ivo

    2017-04-01

    A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles.

  3. Formulation and evaluation of dried yeast tablets using different techniques.

    Science.gov (United States)

    Al-Mohizea, Abdullah M; Ahmed, Mahrous O; Al-jenoobi, Fahad I; Mahrous, Gamal M; Abdel-Rahman, Aly A

    2007-08-01

    The aim of this study was to prepare and evaluate dried yeast tablets using both direct compression and dry granulation techniques in comparison with the conventional wet granulation as well as commercial product. Wet granulation technique is not favorable for producing the yeast tablets due to the problems of color darkening and the reduction of the fermentation power of the yeast as a result of the early start of the fermentation process due to the presence of moisture. Twenty six formulae of dried yeast tablets were prepared and evaluated. Certain directly compressible vehicles were employed for preparing these tablets. The quality control tests (weight uniformity, friability, disintegration time and hardness) of the prepared dried yeast tablets were performed according to B.P. 1998 limits. All batches of the prepared tablets complied with the B.P. limits of weight uniformity. Moreover, small values of friability % (1% or less) were obtained for all batches of dried yeast tablets with acceptable hardness values, indicating good mechanical properties which can withstand handling. On the other hand, not all batches complied with the limit of disintegration test which may be attributed to various formulation component variables. Therefore, four disintegrating agents were investigated for their disintegrating effect. It was found that the method of preparation, whether it is direct compression, dry granulation or wet granulation, has an effect on disintegration time of these dried yeast tablets and short disintegration times were obtained for some of the formulae. The shortest disintegration time was obtained with those tablets prepared by direct compression among the other techniques. Therefore, the direct compression is considered the best technique for preparation of dried yeast tablets and the best formula (which showed shorter disintegration time and better organoleptic properties than the available commercial yeast tablets) was chosen. Drug content for dried

  4. Yeast biotechnology: teaching the old dog new tricks

    Science.gov (United States)

    2014-01-01

    Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature. PMID:24602262

  5. Metabolic engineering of yeast for fermentative production of flavonoids

    DEFF Research Database (Denmark)

    Rodriguez Prado, Edith Angelica; Strucko, Tomas; Stahlhut, Steen Gustav

    2017-01-01

    Yeast Saccharomyces cerevisiae was engineered for de novo production of six different flavonoids (naringenin, liquiritigenin, kaempferol, resokaempferol, quercetin, and fisetin) directly from glucose, without supplementation of expensive intermediates. This required reconstruction of long...... biosynthetic pathways, comprising up to eight heterologous genes from plants. The obtained titers of kaempferol 26.57±2.66mgL-1 and quercetin 20.38±2.57mgL-1 exceed the previously reported titers in yeast. This is also the first report of de novo biosynthesis of resokaempferol and fisetin in yeast. The work...

  6. Evolutionary biology through the lens of budding yeast comparative genomics.

    Science.gov (United States)

    Marsit, Souhir; Leducq, Jean-Baptiste; Durand, Éléonore; Marchant, Axelle; Filteau, Marie; Landry, Christian R

    2017-10-01

    The budding yeast Saccharomyces cerevisiae is a highly advanced model system for studying genetics, cell biology and systems biology. Over the past decade, the application of high-throughput sequencing technologies to this species has contributed to this yeast also becoming an important model for evolutionary genomics. Indeed, comparative genomic analyses of laboratory, wild and domesticated yeast populations are providing unprecedented detail about many of the processes that govern evolution, including long-term processes, such as reproductive isolation and speciation, and short-term processes, such as adaptation to natural and domestication-related environments.

  7. Production of yeast extract from whey using Kluyveromyces marxianus

    Directory of Open Access Journals (Sweden)

    Revillion Jean P. de Palma

    2003-01-01

    Full Text Available The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide rich extract with K. marxianus.

  8. The complex and dynamic genomes of industrial yeasts.

    Science.gov (United States)

    Querol, Amparo; Bond, Ursula

    2009-04-01

    The Saccharomyces sensu stricto genus contains many species that are industrially important for fermentation of wines, beers and ales. The molecular characterization of the genomes of yeasts involved in these processes reveals that the majority arose from interspecific hybridization between two and sometimes three yeast species. The hybridization events generated allopolyploid genomes, and subsequent recombination events between the parental genomes resulted in the formation of mosaic chromosomes. The polyploid and hybrid nature of the genomes confers robust characteristics such as tolerance to environmental stress to these industrial yeasts and provides a means for adaptive evolution.

  9. Media composition influences yeast one- and two-hybrid results

    Directory of Open Access Journals (Sweden)

    Gonzalez Kim L

    2011-08-01

    Full Text Available Abstract Although yeast two-hybrid experiments are commonly used to identify protein interactions, the frequent occurrence of false negatives and false positives hampers data interpretation. Using both yeast one-hybrid and two-hybrid experiments, we have identified potential sources of these problems: the media preparation protocol and the source of the yeast nitrogen base may not only impact signal range but also effect whether a result appears positive or negative. While altering media preparation may optimize signal differences for individual experiments, media preparation must be reported in detail to replicate studies and accurately compare results from different experiments.

  10. Engineering yeast metabolism for production of fuels and chemicals

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2016-01-01

    faster development of metabolically engineered strains that can be used for production of fuels and chemicals. The yeast Saccharomyces cerevisiae is widely used for production of fuels, chemicals, pharmaceuticals and materials. Through metabolic engineering of this yeast a number of novel industrial...... as for metabolic design. In this lecture it will be demonstrated how the Design-Build-Test cycle of metabolic engineering has allowed for development of yeast cell factories for production of a range of different fuels and chemicals. Some examples of different technologies will be presented together with examples...

  11. Construction of gateway-compatible yeast two-hybrid vectors for ...

    African Journals Online (AJOL)

    Yeast two-hybrid system combined with the gateway technology will greatly facilitate the cloning of interested DNA fragment into yeast two-hybrid vectors and therefore increase the efficiency of yeast two-hybrid analysis. In this study, we constructed a pair of Gateway-compatible yeast two-hybrid vectors pBTM116GW and ...

  12. The manometric determination of thiamine pyrophosphate and the inhibition of the acid yeast phosphatase

    NARCIS (Netherlands)

    Steyn-Parvé, Elizabeth P.

    1962-01-01

    Sodium molybdate is a powerful inhibitor of the acid yeast phosphatase in both fresh baker's yeast and dried brewer's yeast, provided that the yeast is suspended in a suitable buffer. It displays no action in citrate or phosphate buffers, but is active in acetate or maleate buffers, both at the

  13. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants.

  14. Contribution to the yeast biota of Egypt. Biochemical, molecular characterization and diversity in citrus and grapevine plantations

    OpenAIRE

    Soliman, Zeinab; Moubasher, A. H.; Abdel-Sater, M. A.

    2017-01-01

    ABSTRACT 3 HISTORICAL REVIEW 5 1. Air-borne yeast fungi 9 2. Yeast fungi recovered from soils 10 3. Phyllosphere and phylloplane yeast fungi 12 4. Carposphere and carpoplane yeast fungi 13 5. Yeast fungi recovered from juice 15 OBJECTIVES OF THIS STUDY 18 METHODOLOGY 19 1. Sampling location 19 2. Collection of samples 19 3. Isolation of air-borne yeast fungi 23 4. Isolation of soil yeast fungi 24 A. Determination of soil moisture content (MC) 24 B. De...

  15. Tools for genetic engineering of the yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Saraya, Ruchi; Gidijala, Loknath; Veenhuis, Marten; van der Klei, Ida J; Mapelli, Valeria

    2014-01-01

    Hansenula polymorpha is a methylotrophic yeast species that has favorable properties for heterologous protein production and metabolic engineering. It provides an attractive expression platform with the capability to secrete high levels of commercially important proteins. Over the past few years

  16. Determination of tritium in wine and wine yeast samples

    International Nuclear Information System (INIS)

    Cotarlea, Monica-Ionela; Paunescu, Niculina; Galeriu, D.; Mocanu, N.; Margineanu, R.; Marin, G.

    1997-01-01

    A sensitive method for evaluating the tritium content in wine and wine yeast was applied to estimate tritium impact on the environment in the surrounding area of nuclear power plant Cernavoda, where the vineyards are part of representative agricultural ecosystem. Analytical procedures were developed to determine HTO in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractionating distillation for wine samples and azeotropic distillation followed by fractional distillation for wine yeast samples. Finally, the water samples obtained after fractional distillation were normally distilled with KMO 4 . The established procedures were successfully applied for wine and wine yeast samples from Mulfatlar harvests of the years 1995 and 1996. (authors)

  17. A contribution to the knowledge of yeasts in Olsztyn lakes

    Directory of Open Access Journals (Sweden)

    Maria Dynowska

    2014-08-01

    Full Text Available Yeasts species have been analysed from Skanda and Kartowo Lakes. Their presence reflects poor sanitary stale of the lakes, with Skanda Lake particulary affected by the process of eutrophication.

  18. Animal vaccines based on orally presented yeast recombinants.

    Science.gov (United States)

    Shin, Min-Kyoung; Yoo, Han Sang

    2013-09-13

    In veterinary vaccinology, the oral route of administration is an attractive alternative compared to the commonly used parenteral route. Yeasts have a number of properties that make them potential live delivery systems for oral vaccination purposes such as their high expression levels, their GRAS status, adjuvant properties, and post-translational modification possibilities. Consequently, yeasts have been employed for the expression of heterologous genes and for the production of therapeutic proteins. Yeast-based vaccines are reviewed with regard to their ability to express and produce antigens from pathogens for veterinary use. Many of these vaccines have been shown to elicit protective immune responses following oral immunization in animals. Ultimately, yeast-based oral vaccines may offer a potential opportunity for the development of novel ideal vaccines in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Phylogenetic classification of yeasts and related taxa within Pucciniomycotina

    NARCIS (Netherlands)

    Wang, Q. -M.; Yurkov, A. M.; Goeker, M.; Lumbsch, H. T.; Leavitt, S. D.; Groenewald, M.; Theelen, B.; Liu, X. -Z.; Boekhout, T.; Bai, F. -Y.

    Most small genera containing yeast species in the Pucciniomycotina (Basidiomycota, Fungi) are monophyletic, whereas larger genera including Bensingtonia, Rhodosporidium, Rhodotorula, Sporidiobolus and Sporobolomyces are polyphyletic. With the implementation of the “One Fungus = One Name”

  20. Hybridization and emergence of virulence in opportunistic human yeast pathogens.

    Science.gov (United States)

    Mixão, Verónica; Gabaldón, Toni

    2018-01-01

    Hybridization between different species can result in the emergence of new lineages and adaptive phenotypes. Occasionally, hybridization in fungal organisms can drive the appearance of opportunistic lifestyles or shifts to new hosts, resulting in the emergence of novel pathogens. In recent years, an increasing number of studies have documented the existence of hybrids in diverse yeast clades, including some comprising human pathogens. Comparative and population genomics studies performed on these clades are enabling us to understand what roles hybridization may play in the evolution and emergence of a virulence potential towards humans. Here we survey recent genomic studies on several yeast pathogenic clades where hybrids have been identified, and discuss the broader implications of hybridization in the evolution and emergence of pathogenic lineages. © 2017 The Authors. Yeast published by John Wiley & Sons, Ltd. © 2017 The Authors. Yeast published by John Wiley & Sons, Ltd.

  1. Yeasts in Ensiled High-Moisture Corn1

    Science.gov (United States)

    Burmeister, Harland R.; Hartman, Paul A.

    1966-01-01

    A total of 1,365 yeasts were selected from ensiled high-moisture corn at various stages in the ensiling process to determine the sequence and relative numbers of yeast species. The yeast species most frequently isolated from freshly harvested corn were Candida parapsilosis and C. intermedia; these two species were isolated infrequently after the third week of storage. Species of yeasts that predominate after the 12th day of storage were Hansenula anomala (66% of the isolates studied) and C. krusei (26% of the isolates studied). The preponderance of H. anomala and C. krusei in ensiled corn is believed to be associated with the ability of these two species to assimilate lactic acid. PMID:5914494

  2. [Overexpression of FKS1 to improve yeast autolysis-stress].

    Science.gov (United States)

    Li, Jia; Wang, Jinjing; Li, Qi

    2015-09-01

    With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing.

  3. Respiration in the yeast and mycelial phases of Histoplasma capsulatum.

    Science.gov (United States)

    Maresca, B; Lambowitz, A M; Kobayashi, G S; Medoff, G

    1979-05-01

    Respiration in the yeast and mycelial phases of Histoplasma capsulatum proceeds via a cytochrome system and an alternate oxidase, both present constitutively. The mycelial cytochrome system is distinguished by an additional partial shunt around the antimycin-sensitive site.

  4. Barrier busting yeast brew trouble in the gut.

    Science.gov (United States)

    Clark, Rachael A

    2017-04-07

    Saccharomyces cerevisiae , a common yeast in the gut, induces uric acid production by intestinal epithelium, leading to decreased barrier function and increased colitis in mouse models. Copyright © 2017, American Association for the Advancement of Science.

  5. Rapid asymmetrical evolution of Saccharomyces cerevisiae wine yeasts.

    Science.gov (United States)

    Ambrona, Jesús; Vinagre, Antonia; Ramírez, Manuel

    2005-12-01

    Genetic instability causes very rapid asymmetrical loss of heterozygosity (LOH) at the cyh2 locus and loss of killer K2 phenotype in some wine yeasts under the usual laboratory propagation conditions or after long freeze-storage. The direction of this asymmetrical evolution in heterozygous cyh2(R)/CYH2(S) hybrids is determined by the mechanism of asymmetrical LOH. However, the speed of the process is affected by the differences in cell viability between the new homozygous yeasts and the original heterozygous hybrid cells. The concomitant loss of ScV-M2 virus in the LOH process may increase cell viability of cyh2(R)/cyh2(R) yeasts and so favour asymmetrical evolution. The presence of active killer K2 toxin, however, abolishes the asymmetrical evolution of the hybrid populations. This phenomenon may cause important sudden phenotype changes in industrial and pathogenic yeasts. Copyright 2005 John Wiley & Sons, Ltd.

  6. Oxidative Stress and Programmed Cell Death in Yeast

    International Nuclear Information System (INIS)

    Farrugia, Gianluca; Balzan, Rena

    2012-01-01

    Yeasts, such as Saccharomyces cerevisiae, have long served as useful models for the study of oxidative stress, an event associated with cell death and severe human pathologies. This review will discuss oxidative stress in yeast, in terms of sources of reactive oxygen species (ROS), their molecular targets, and the metabolic responses elicited by cellular ROS accumulation. Responses of yeast to accumulated ROS include upregulation of antioxidants mediated by complex transcriptional changes, activation of pro-survival pathways such as mitophagy, and programmed cell death (PCD) which, apart from apoptosis, includes pathways such as autophagy and necrosis, a form of cell death long considered accidental and uncoordinated. The role of ROS in yeast aging will also be discussed.

  7. Investigation of Yeast Mitophagy with Fluorescence Microscopy and Western Blotting.

    Science.gov (United States)

    Nagumo, Sachiyo; Okamoto, Koji

    2017-03-24

    Selective clearance of superfluous or dysfunctional mitochondria is a fundamental process that depends on the autophagic membrane trafficking pathways found in many cell types. This catabolic event, called mitophagy, is conserved from yeast to humans and serves to control mitochondrial quality and quantity. In budding yeast, degradation of mitochondria occurs under various physiological conditions, such as respiration at stationary phase, or starvation in a prolonged period. During these events, the transmembrane protein Atg32 localizes to the mitochondrial surface and plays a specific and essential role in yeast mitophagy. In this chapter, we describe methods to observe transport of mitochondria to the vacuole, a lytic compartment in yeast, using fluorescence microscopy, and semi-quantify the progression of Atg32-mediated mitophagy by Western blotting.

  8. Conversion of homothallic yeast to heterothallism through to gene disruption

    CSIR Research Space (South Africa)

    Van Zyl, WH

    1993-04-01

    Full Text Available A simple method was developed for the conversion of homothallic Saccharomyces cerevisiae yeast strains to heterothallism through HO gene disruption. An integrative ho=neo disrupted allele was constructed by cloning a dominant selectable marker...

  9. Yeast Communities of Chestnut Soils under Vineyards in Dagestan

    Science.gov (United States)

    Abdullabekova, D. A.; Magomedova, E. S.; Magomedov, G. G.; Aliverdieva, D. A.; Kachalkin, A. V.

    2017-12-01

    The study of yeast communities in chestnut soils (Kastanozems) under vineyards in the Republic of Dagestan made it possible to isolate 20 yeast species. Most of the yeasts under vineyards belonged to ascomycetes, among which species of the Saccharomycetaceae family (in particular, Saccharomyces cerevisiae) comprised a significant part. The obtained results indicate that the soils under vineyards keep the pool of microbial diversity and ensure preservation of many species typical for grapes. The method of enrichment culture on grape juice medium proved to be more efficient than other methods of analysis with respect to the number of isolated species and the rate of their detection. However, implementation of different techniques to study yeasts' diversity can give somewhat different results; a set of methods should be used for an integrated analysis.

  10. Spent yeast as natural source of functional food additives

    Science.gov (United States)

    Rakowska, Rita; Sadowska, Anna; Dybkowska, Ewa; Świderski, Franciszek

    Spent yeasts are by-products arising from beer and wine production which over many years have been chiefly used as feed additives for livestock. They contain many valuable and bioactive substances which has thereby generated much interest in their exploitation. Up till now, the main products obtained from beer-brewing yeasts are β-glucans and yeast extracts. Other like foodstuffs include dried brewer’s yeast, where this is dried and the bitterness removed to be fit for human consumption as well as mannan-oligosaccharides hitherto used in the feed industry. β-glucans constitute the building blocks of yeast cell walls and can thus be used in human nutrition as dietary supplements or serving as food additives in functional foods. β-glucans products obtained via post-fermentation of beer also exhibit a high and multi-faceted biological activity where they improve the blood’s lipid profile, enhance immunological status and have both prebiotic and anti-oxidant properties. Yeast extracts are currently being used more and more to enhance flavour in foodstuffs, particularly for meat and its products. Depending on how autolysis is carried out, it is possible to design extracts of various meat flavours characteristic of specific meats. Many different flavour profiles can be created which may be additionally increased in combination with vegetable extracts. Within the food market, yeast extracts can appear in various guises such as liquids, pastes or powders. They all contain significant amounts of glutamic acid, 5’-GMP and 5’-IMP nucleotides together with various amino acids and peptides that act synergistically for enhancing the flavour of foodstuff products. Recent studies have demonstrated additional benefits of yeast extracts as valuable sources of amino acids and peptides which can be used in functional foods and dietary supplements. These products possess GRAS status (Generally Recognised As Safe) which thereby also adds further as to why they should be used

  11. Experimental study on bread yeast cultured in sweet sorghum juice

    International Nuclear Information System (INIS)

    Wang Jufang; Dong Xicun; Li Wenjian; Xiao Guoqing; Ma Liang; Gao Feng

    2008-01-01

    As a substitute for food supplies, sweet sorghum juice with high grade has demonstrated out- standing advantage in fermentation. To obtain the optimized fermentation conditions, the growth, the bio- mass of bread yeast cultured in sweet sorghum juice and total residual sugar were investigated in the paper. The fermentation was performed and optimized in a 10-100 1 bio-reactor. The results show that the application of sweet sorghum juice in bread yeast production is very potential. (authors)

  12. Yeast biofilm colony as an orchestrated multicellular organism

    Czech Academy of Sciences Publication Activity Database

    Šťovíček, V.; Váchová, Libuše; Palková, Zdena

    2012-01-01

    Roč. 5, č. 2 (2012), s. 203-205 ISSN 1942-0889 R&D Projects: GA ČR GA204/08/0718; GA MŠk(CZ) LC531 Grant - others:GA MŠk(CZ) LC06063 Program:LC Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast biofilm * yeast cell Subject RIV: EE - Microbiology, Virology

  13. Visible light alters yeast metabolic rhythms by inhibiting respiration

    OpenAIRE

    Robertson, James Brian; Davis, Chris R.; Johnson, Carl Hirschie

    2013-01-01

    In some organisms, respiration fluctuates cyclically, and these rhythms can be a sensitive gauge of metabolism. Constant or pulsatile exposure of yeast to visible wavelengths of light significantly alters and/or initiates these respiratory oscillations, revealing a further dimension of the challenges to yeast living in natural environments. Our results also have implications for the use of light as research tools—e.g., for excitation of fluorescence microscopically—even in organisms such as y...

  14. Isolation of yeast Saccharomyces cerevisiae from unusual natural habitats

    OpenAIRE

    Finžgar, Bernarda

    2012-01-01

    Baker yeast Saccharomyces cerevisiae has been an eukarontic experimental organism since 1960s, becoming even more significant with the determination of its complete nucleotide genome sequence in 1996. Even though its biochemical function in the fermentation process had long remained unclear, its metabolism and products (eg. bread, beer, wine) have been used for millennia. S. cerevisiae yeast represents an important organism for production of recombinant proteins (gene manipulation). Moreover,...

  15. Bioprospection of yeasts as biocontrol agents against phytopathogenic molds

    Directory of Open Access Journals (Sweden)

    Márcia Maria Rosa-Magri

    2011-02-01

    Full Text Available Yeasts isolated from sugar cane and maize rhizosphere, leaves and stalks were screened against the phytopathogenic molds Colletotrichum sublineolum and Colletotrichum graminicola, both causal agents of the anthracnose disease in sorghum and maize, respectively. Strains identified as Torulaspora globosa and Candida intermedia were able to inhibit the mold growth, with the first species also exhibiting killer activity. No previous report on the application and potentiality of these yeasts as biocontrol agents were found neither the killer phenotype in Torulaspora globosa.

  16. Metabolic diversification of cells during the development of yeast colonies

    Czech Academy of Sciences Publication Activity Database

    Váchová, Libuše; Kučerová, Helena; Devaux, F.; Úlehlová, M.; Palková, Z.

    2009-01-01

    Roč. 11, č. 2 (2009), s. 494-504 ISSN 1462-2912 R&D Projects: GA ČR GA204/05/0294; GA ČR GA204/08/0718; GA MŠk(CZ) LC531 Grant - others:GB(GB) Howard Hughes Medical Institute International Research Award Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast * yeast colonies * saccharomyces cerevisiae Subject RIV: EE - Microbiology , Virology Impact factor: 4.909, year: 2009

  17. Yeast expression proteomics by high-resolution mass spectrometry

    DEFF Research Database (Denmark)

    Walther, Tobias C; Olsen, Jesper Velgaard; Mann, Matthias

    2010-01-01

    -translational controls contribute majorly to regulation of protein abundance, for example in heat shock stress response. The development of new sample preparation methods, high-resolution mass spectrometry and novel bioinfomatic tools close this gap and allow the global quantitation of the yeast proteome under different...... conditions. Here, we provide background information on proteomics by mass-spectrometry and describe the practice of a comprehensive yeast proteome analysis....

  18. Yeast synthetic biology for the production of recombinant therapeutic proteins.

    Science.gov (United States)

    Kim, Hyunah; Yoo, Su Jin; Kang, Hyun Ah

    2015-02-01

    The production of recombinant therapeutic proteins is one of the fast-growing areas of molecular medicine and currently plays an important role in treatment of several diseases. Yeasts are unicellular eukaryotic microbial host cells that offer unique advantages in producing biopharmaceutical proteins. Yeasts are capable of robust growth on simple media, readily accommodate genetic modifications, and incorporate typical eukaryotic post-translational modifications. Saccharomyces cerevisiae is a traditional baker's yeast that has been used as a major host for the production of biopharmaceuticals; however, several nonconventional yeast species including Hansenula polymorpha, Pichia pastoris, and Yarrowia lipolytica have gained increasing attention as alternative hosts for the industrial production of recombinant proteins. In this review, we address the established and emerging genetic tools and host strains suitable for recombinant protein production in various yeast expression systems, particularly focusing on current efforts toward synthetic biology approaches in developing yeast cell factories for the production of therapeutic recombinant proteins. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  19. Yeast diversity on grapes in two German wine growing regions.

    Science.gov (United States)

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-02

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples. Copyright © 2015. Published by Elsevier B.V.

  20. Prevalence of yeast other than Candida albicans in denture wearers.

    Science.gov (United States)

    Cavaleiro, Inês; Proença, Luis; Félix, Sérgio; Salema-Oom, Madalena

    2013-07-01

    The isolation of yeast species other than Candida albicans from the oral mucosa has been increasing in frequency, suggesting that those may constitute emerging potential oral colonizers. The purpose of this work was to determine whether yeast species other than C. albicans are associated with factors related to wearing of dental prostheses. tRNA-PCR fingerprinting and sequencing of the 26S rDNA D1/D2 domain were used to identify all yeasts isolated from CHROMagar™ Candida cultures of oral swabs collected from 178 patients. Besides C. albicans, 13 other species were identified, corresponding to 34% of the yeast isolates. The majority of the non-C. albicans species were not detected as single colonizers but rather in co-colonization with one or two other yeasts, often with C. albicans. No significant associations were found with non-C. albicans species. On the contrary, the best-fitted logistic regression model predicts that either wearing a denture (adjusted odds = 4.6) or insufficient oral hygiene (adjusted odds = 2.3) are risks for colonization by yeast, in general. The colonization with non-C. albicans species and co-colonization were not independently associated with any of the analyzed host-related factors. In particular, neither wearing a removable denture nor being elderly were significant predictors. © 2012 by the American College of Prosthodontists.

  1. Guidelines and recommendations on yeast cell death nomenclature

    Directory of Open Access Journals (Sweden)

    Didac Carmona-Gutierrez

    2018-01-01

    Full Text Available Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research.

  2. Influence of yeast strain on Shiraz wine quality indicators.

    Science.gov (United States)

    Holt, Helen; Cozzolino, Daniel; McCarthy, Jane; Abrahamse, Caroline; Holt, Sylvester; Solomon, Mark; Smith, Paul; Chambers, Paul J; Curtin, Chris

    2013-08-01

    Wine styles are defined by complex and highly diverse chemical compositions. Evidence suggests that some of this complexity is determined by the choice of yeast strain used in fermentation. There are hundreds of different commercially available wine yeast strains that, potentially, provide a means by which winemakers can tailor their wines for different consumer market segments. In this study we evaluated the impacts of fermenting Shiraz must with different yeast strains, with a focus on chemical composition and tannin content of the finished wines. Principal Component Analysis (PCA) of the wines indicated that choice of yeast strain had a strong influence on a number of wine compositional parameters, including tannin. In three fermentation experiments, across two vintages and using different winemaking protocols, a compelling case for yeast strain 'signature' was evident. The results demonstrate that there is an opportunity to use commercial wine yeast diversity to modulate red wine composition and, by implication, the style of finished wines. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. [Yeast microbiota in artisanal cheeses from Corrientes, Argentina].

    Science.gov (United States)

    Cardozo, Marina C; Fusco, Ángel J V; Carrasco, Marta S

    2017-10-24

    The artisanal cheese from Corrientes (from the Spanish acronym QAC-Queso Artesanal de Corrientes/Artisanal Cheese from Corrientes) is a soft cheese elaborated with raw cow milk and an artisanal coagulant agent. Lactic bacteria contitute the main flora of this cheese although yeasts are also present in high quantities as secondary microbiota and might play a relevant role in cheese ripening. The aim of this work was to evaluate yeast occurrence during QAC elaboration and ripening, and the effect of seasonal variation. Yeasts were isolated and purified from raw materials and cheese at different ripening stagesl elaborated during the different seasons. Yeast sample counts were in the order of 10 3 - 10 7 UFC/ml o UFC/g. Ninety yeast strains were classified: 9 from milk, 28 from the coagulant agent, 10 from curd and 43 from cheese. Candida predominated in milk samples while other yeast genera had low incidence. Candida also predominated in the coagulant agent samples, followed by genera Myxozyma and Debaryomyces. The isolates obtained from cheese belonged to the same genera predominating in the coagulant agent, and showed the same order of prevalence. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  4. The Yeast Deletion Collection: A Decade of Functional Genomics

    Science.gov (United States)

    Giaever, Guri; Nislow, Corey

    2014-01-01

    The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

  5. The Slime Production by Yeasts Isolated from Subclinical Mastitic Cows

    Directory of Open Access Journals (Sweden)

    Süheyla Türkyılmaz

    2010-01-01

    Full Text Available The aim of this study was to isolate yeasts from subclinical mastitic cows and to investigate the slime production by the isolated yeasts. The material used in this study included 339 milk samples from 152 dairy cattle with subclinical mastitis. Milk was plated onto blood agar, MacConkey agar and Sabouraud dextrose agar. Forty-one samples (12.1% of total milk samples were found positive for the yeast by API 20 C AUX identification system. The isolated yeasts were classified into four genera of Candida, Trichosporon, Cryptococcus and Saccharomyces. The Candida species were following: C. krusei, C. kefyr, C. guilliermondii, C. famata, C. rugosa and C. utulis. Other yeasts were identified as Trichosporon mucoides, T. asahii, Cryptococcus laurentii, C.  neoformans and Saccharomyces cerevisiae. Slime production was tested on Congo red brain heart infusion agar and evaluated according to Congo red phenomenon. Fifteen (36.6% strains were slime factor positive: seven were C. krusei, four C. kefyr, one C. guilliermondii, one C. famata, one T. asahii, and one C. laurentii. The results of the present study indicate that yeast mastitis is significant for causing economic losses and slime production is mostly found in non-albicans Candida species. Therefore, non-albicans Candida species should be examined for slime production.

  6. The Fermentative and Aromatic Ability of Kloeckera and Hanseniaspora Yeasts

    Science.gov (United States)

    Díaz-Montaño, Dulce M.; de Jesús Ramírez Córdova, J.

    Spontaneous alcoholic fermentation from grape, agave and others musts into an alcoholic beverage is usually characterized by the presence of several non-Saccharomyces yeasts. These genera yeasts are dominant in the early stages of the alcoholic fermentation. However the genera Hanseniaspora and Kloeckera may survive at a significant level during fermentation and can influence the chemical composition of the beverage. Several strains belonging to the species Kloeckera api-culata and Hanseniaspora guilliermondii have been extensively studied in relation to the formation of some metabolic compounds affecting the bouquet of the final product. Indeed some apiculate yeast showed positive oenological properties and their use in the alcoholic fermentations has been suggested to enhance the aroma and flavor profiles. The non- Saccharomyces yeasts have the capability to produce and secrete enzymes in the medium, such as β -glucosidases, which release monoterpenes derived from their glycosylated form. These compounds contribute to the higher fruit-like characteristic of final product. This chapter reviews metabolic activity of Kloeckera and Hanseniaspora yeasts in several aspects: fermentative capability, aromatic compounds production and transformation of aromatic precursor present in the must, also covers the molecular methods for identifying of the yeast

  7. The sensitivity of yeast and yeast-like cells to new lysosomotropic agents

    Czech Academy of Sciences Publication Activity Database

    Krasowska, A.; Chmielewska, L.; Adamski, R.; Luszynski, J.; Witek, S.; Sigler, Karel

    2004-01-01

    Roč. 9, 4A (2004), s. 675-683 ISSN 1425-8153 R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Grant - others:GA MŠk(CZ) KONTAKT 01-032; Polish-Czech Treaty on Scientific and Scientific-Technical Cooperation(XX) 2 Institutional research plan: CEZ:AV0Z5020903 Keywords : lysosomotropic agents * yeast * quinacrine Subject RIV: EE - Microbiology, Virology Impact factor: 0.495, year: 2004

  8. Effect of yeast pretreatment on the characteristics of yeast-modified electrodes as mediated amperometric biosensors for lactic acid.

    Science.gov (United States)

    Garjonyte, R; Melvydas, V; Malinauskas, A

    2008-11-01

    Carbon paste electrode modified with baker' and wine yeast Saccharomyces cerevisiae (a source of flavocytochrome b(2)) were investigated as amperometric biosensors for L-lactic acid. Before immobilization on the electrode surface, yeast cells were pretreated with various electrolytes, alcohols and weak organic acids. Electrode responses to L-lactic acid were tested in the presence of various mediators (potassium ferricyanide, phenazine methosulfate, 2,6-dichlorophenolindophenol sodium salt hydrate, 1,2-naphthoquinone-4-sulfonic acid sodium salt). The highest (144+/-7 nA per 0.2 mM L-lactic acid) and the most stable responses were obtained after yeast pretreatment with 30% ethanol using potassium ferricyanide as a mediator. Different electrode sensitivities with mediator phenazine methosulphate probably reflected diverse changes in yeast membrane (and/or cell wall).

  9. Mutational analysis of yeast vacuolar H+ -ATPase

    International Nuclear Information System (INIS)

    Noumi, Takato; Beltran, C.; Nelson, H.; Nelson, N.

    1991-01-01

    Yeast mutants in which genes encoding subunits of the vacuolar H + -ATPase were interrupted were assayed for their vacuolar ATPase and proton-uptake activities. The vacuoles from the mutants lacking subunits A (72 kDa), B (57 kDa), or c (proteolipid, 16 kDa) were completely inactive in these reactions. Immunological studies revealed that in the absence of each one of those subunits the catalytic sector was not assembled. Labeling with N,N' -[ 14 C]dicyclohexylcarbodiimide showed the presence of the proteolipid in vacuoles of mutants in which genes encoding subunits of the catalytic sectors were interrupted. No labeling was detected in the mutant in which the gene encoding the proteolipid was interrupted. The authors conclude that of all the ATPase subunits only the proteolipid is assembled independently and it serves as a template for the assembly of the other subunits. Site-specific mutations were generated in the gene encoding the proteolipid. All of the drastic changes and replacements gave inactive proteins. About half of the single amino acid replacements gave active proteins. Replacing glutamic acid-137 by any of several amino acids, except for aspartic acid, abolished the activity of the enzyme. Other amino acids that may function in proton conductance were changed. It was found that glycine residues may replace amino acids with exchangeable protons

  10. Zinc starvation induces autophagy in yeast.

    Science.gov (United States)

    Kawamata, Tomoko; Horie, Tetsuro; Matsunami, Miou; Sasaki, Michiko; Ohsumi, Yoshinori

    2017-05-19

    Zinc is an essential nutrient for all forms of life. Within cells, most zinc is bound to protein. Because zinc serves as a catalytic or structural cofactor for many proteins, cells must maintain zinc homeostasis under severely zinc-deficient conditions. In yeast, the transcription factor Zap1 controls the expression of genes required for uptake and mobilization of zinc, but to date the fate of existing zinc-binding proteins under zinc starvation remains poorly understood. Autophagy is an evolutionarily conserved cellular degradation/recycling process in which cytoplasmic proteins and organelles are sequestered for degradation in the vacuole/lysosome. In this study, we investigated how autophagy functions under zinc starvation. Zinc depletion induced non-selective autophagy, which is important for zinc-limited growth. Induction of autophagy by zinc starvation was not directly related to transcriptional activation of Zap1. Instead, TORC1 inactivation directed zinc starvation-induced autophagy. Abundant zinc proteins, such as Adh1, Fba1, and ribosomal protein Rpl37, were degraded in an autophagy-dependent manner. But the targets of autophagy were not restricted to zinc-binding proteins. When cellular zinc is severely depleted, this non-selective autophagy plays a role in releasing zinc from the degraded proteins and recycling zinc for other essential purposes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Genetic basis of metabolome variation in yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey S Breunig

    2014-03-01

    Full Text Available Metabolism, the conversion of nutrients into usable energy and biochemical building blocks, is an essential feature of all cells. The genetic factors responsible for inter-individual metabolic variability remain poorly understood. To investigate genetic causes of metabolome variation, we measured the concentrations of 74 metabolites across ~ 100 segregants from a Saccharomyces cerevisiae cross by liquid chromatography-tandem mass spectrometry. We found 52 quantitative trait loci for 34 metabolites. These included linkages due to overt changes in metabolic genes, e.g., linking pyrimidine intermediates to the deletion of ura3. They also included linkages not directly related to metabolic enzymes, such as those for five central carbon metabolites to ira2, a Ras/PKA pathway regulator, and for the metabolites, S-adenosyl-methionine and S-adenosyl-homocysteine to slt2, a MAP kinase involved in cell wall integrity. The variant of ira2 that elevates metabolite levels also increases glucose uptake and ethanol secretion. These results highlight specific examples of genetic variability, including in genes without prior known metabolic regulatory function, that impact yeast metabolism.

  12. Electrochemical regulation of budding yeast polarity.

    Directory of Open Access Journals (Sweden)

    Armin Haupt

    2014-12-01

    Full Text Available Cells are naturally surrounded by organized electrical signals in the form of local ion fluxes, membrane potential, and electric fields (EFs at their surface. Although the contribution of electrochemical elements to cell polarity and migration is beginning to be appreciated, underlying mechanisms are not known. Here we show that an exogenous EF can orient cell polarization in budding yeast (Saccharomyces cerevisiae cells, directing the growth of mating projections towards sites of hyperpolarized membrane potential, while directing bud emergence in the opposite direction, towards sites of depolarized potential. Using an optogenetic approach, we demonstrate that a local change in membrane potential triggered by light is sufficient to direct cell polarization. Screens for mutants with altered EF responses identify genes involved in transducing electrochemical signals to the polarity machinery. Membrane potential, which is regulated by the potassium transporter Trk1p, is required for polarity orientation during mating and EF response. Membrane potential may regulate membrane charges through negatively charged phosphatidylserines (PSs, which act to position the Cdc42p-based polarity machinery. These studies thus define an electrochemical pathway that directs the orientation of cell polarization.

  13. Silver tolerance and accumulation in yeasts.

    Science.gov (United States)

    Kierans, M; Staines, A M; Bennett, H; Gadd, G M

    1991-01-01

    Debaryomyces hansenii (NCYC 459 and strain 75-21), Candida albicans (3153A), Saccharomyces cerevisiae (X2180-1B), Rhodotorula rubra (NCYC 797) and Aureobasidium pullulans (IMI 45533 and ATCC 42371) were grown on solid medium supplemented with varying concentrations of AgNO3. Although Ag+ is highly toxic towards yeasts, growth on solid media was still possible at Ag concentrations of 1-2 mM. Further subculture on higher Ag concentrations (up to 5 mM) resulted in elevated tolerance. The extent of Ag tolerance depended on whether Ag-containing plates were exposed to light prior to inoculation since light-mediated reduction of Ag+ to Ag0 resulted in the production of a less toxic silver species. Experimental organisms exhibited blackening of colonies and the surrounding agar during growth on AgNO3-containing medium especially at the highest Ag concentrations tested. All organisms accumulated Ag from the medium; electron microscopy revealed that silver was deposited as electron-dense granules in and around cell walls and in the external medium. X-ray microprobe analysis indicated that these granules were metallic Ag0 although AgCl was also present in some organisms. Volatile and non-volatile reducing compounds were produced by several test organisms which presumably effected Ag+ reduction to Ag0.

  14. Computational Modeling of Lipid Metabolism in Yeast

    Directory of Open Access Journals (Sweden)

    Vera Schützhold

    2016-09-01

    Full Text Available Lipid metabolism is essential for all major cell functions and has recently gained increasing attention in research and health studies. However, mathematical modeling by means of classical approaches such as stoichiometric networks and ordinary differential equation systems has not yet provided satisfactory insights, due to the complexity of lipid metabolism characterized by many different species with only slight differences and by promiscuous multifunctional enzymes.Here, we present a object-oriented stochastic model approach as a way to cope with the complex lipid metabolic network. While all lipid species are treated objects in the model, they can be modified by the respective converting reactions based on reaction rules, a hybrid method that integrates benefits of agent-based and classical stochastic simulation. This approach allows to follow the dynamics of all lipid species with different fatty acids, different degrees of saturation and different headgroups over time and to analyze the effect of parameter changes, potential mutations in the catalyzing enzymes or provision of different precursors. Applied to yeast metabolism during one cell cycle period, we could analyze the distribution of all lipids to the various membranes in time-dependent manner.The presented approach allows to efficiently treat the complexity of cellular lipid metabolism and to derive conclusions on the time- and location-dependent distributions of lipid species and their properties such as saturation. It is widely applicable, easily extendable and will provide further insights in healthy and diseased states of cell metabolism.

  15. Molecular architecture of the yeast Mediator complex

    Science.gov (United States)

    Robinson, Philip J; Trnka, Michael J; Pellarin, Riccardo; Greenberg, Charles H; Bushnell, David A; Davis, Ralph; Burlingame, Alma L; Sali, Andrej; Kornberg, Roger D

    2015-01-01

    The 21-subunit Mediator complex transduces regulatory information from enhancers to promoters, and performs an essential role in the initiation of transcription in all eukaryotes. Structural information on two-thirds of the complex has been limited to coarse subunit mapping onto 2-D images from electron micrographs. We have performed chemical cross-linking and mass spectrometry, and combined the results with information from X-ray crystallography, homology modeling, and cryo-electron microscopy by an integrative modeling approach to determine a 3-D model of the entire Mediator complex. The approach is validated by the use of X-ray crystal structures as internal controls and by consistency with previous results from electron microscopy and yeast two-hybrid screens. The model shows the locations and orientations of all Mediator subunits, as well as subunit interfaces and some secondary structural elements. Segments of 20–40 amino acid residues are placed with an average precision of 20 Å. The model reveals roles of individual subunits in the organization of the complex. DOI: http://dx.doi.org/10.7554/eLife.08719.001 PMID:26402457

  16. Yeast diversity and novel yeast D1/D2 sequences from corn phylloplane obtained by a culture-independent approach.

    Science.gov (United States)

    Nasanit, Rujikan; Jaibangyang, Sopin; Tantirungkij, Manee; Limtong, Savitree

    2016-12-01

    Culture-independent techniques have recently been used for evaluation of microbial diversity in the environment since it addresses the problem of unculturable microorganisms. In this study, the diversity of epiphytic yeasts from corn (Zea mays Linn.) phylloplanes in Thailand was investigated using this technique and sequence-based analysis of the D1/D2 domains of the large subunit ribosomal DNA sequences. Thirty-seven samples of corn leaf were collected randomly from 10 provinces. The DNA was extracted from leaf washing samples and the D1/D2 domains were amplified. The PCR products were cloned and then screened by colony PCR. A total of 1049 clones were obtained from 37 clone libraries. From this total, 329 clones (213 sequences) were closely related to yeast strains in the GenBank database, and they were clustered into 77 operational taxonomic units (OTUs) with a similarity threshold of 99 %. The majority of sequences (98.5 %) were classified into the phylum Basidiomycota. Sixteen known yeast species were identified. Interestingly, more than 65 % of the D1/D2 sequences obtained by this technique were suggested to be sequences from new yeast taxa. The predominant yeast sequences detected belonged to the order Ustilaginales with relative frequency of 68.0 %. The most common known yeast species detected on the leaf samples were Pseudozyma hubeiensis pro tem. and Moesziomyces antarcticus with frequency of occurrence of 24.3 and 21.6 %, respectively.

  17. Yeast cell wall chitin reduces wine haze formation.

    Science.gov (United States)

    Ndlovu, Thulile; Divol, Benoit; Bauer, Florian F

    2018-04-27

    Protein haze formation in bottled wines is a significant concern for the global wine industry and wine clarification before bottling is therefore a common but expensive practice. Previous studies have shown that wine yeast strains can reduce haze formation through the secretion of certain mannoproteins, but it has been suggested that other yeast-dependent haze protective mechanisms exist. On the other hand, addition of chitin has been shown to reduce haze formation, likely because grape chitinases have been shown to be the major contributors to haze. In this study, Chardonnay grape must fermented by various yeast strains resulted in wines with different protein haze levels indicating differences in haze protective capacities of the strains. The cell wall chitin levels of these strains were determined, and a strong correlation between cell wall chitin levels and haze protection capability was observed. To further evaluate the mechanism of haze protection, Escherichia coli -produced GFP-tagged grape chitinase was shown to bind efficiently to yeast cell walls in a cell wall chitin concentration-dependent manner, while commercial chitinase was removed from synthetic wine in quantities also correlated with the cell wall chitin levels of the strains. Our findings suggest a new mechanism of reducing wine haze, and propose a strategy for optimizing wine yeast strains to improve wine clarification. Importance In this study, we establish a new mechanism by which wine yeast strains can impact on the protein haze formation of wines, and demonstrate that yeast cell wall chitin binds grape chitinase in a chitin-concentration dependent manner. We also show that yeast can remove this haze-forming protein from wine. Chitin has in the past been shown to efficiently reduce wine haze formation when added to the wine in high concentration as a clarifying agent. Our data suggest that the selection of yeast strains with high levels of cell wall chitin can reduce protein haze. We also

  18. Influence of the farming system on the epiphytic yeasts and yeast-like fungi colonizing grape berries during the ripening process.

    Science.gov (United States)

    Martins, Guilherme; Vallance, Jessica; Mercier, Anne; Albertin, Warren; Stamatopoulos, Panagiotis; Rey, Patrice; Lonvaud, Aline; Masneuf-Pomarède, Isabelle

    2014-05-02

    Grape berries are colonized by a wide array of epiphytic microorganisms such as yeast and filamentous fungi. This microbiota plays a major role in crop health and also interferes with the winemaking process. In this study, culture-dependent and -independent methods were used to investigate the dynamics and diversity of the yeast and yeast-like microorganisms on the grape berry surface during maturation and the influence of cropping systems in this microflora. The results showed a significant impact of both the farming system and the maturity stage on the epiphytic yeast and yeast-like community. A quantitative approach based on counting cultivable populations indicated an increase in the yeast and yeast-like population during the grape ripening process, reaching a maximum when the berries became overripe. The cultivable yeast and yeast-like population also varied significantly depending on the farming system. Microorganism counts were significantly higher for organically- than conventionally-farmed grapes. The yeast and yeast-like community structures were analysed by culture independent methods, using CE-SSCP. The results revealed changes in the genetic structure of the yeast and yeast-like community throughout the ripening process, as well as the impact of the farming system. Copper-based fungicide treatments were revealed as the main factor responsible for the differences in microbial population densities between samples of different farming systems. The results showed a negative correlation between copper levels and yeast and yeast-like populations, providing evidence that copper inhibited this epiphytic community. Taken together, our results showed that shifts in the microbial community were related to changes in the composition of the grape-berry surface, particularly sugar exudation and the occurrence of copper residues from pesticide treatments. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Solving ethanol production problems with genetically modified yeast strains

    Directory of Open Access Journals (Sweden)

    A. Abreu-Cavalheiro

    2013-09-01

    Full Text Available The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.

  20. Chemical genomic guided engineering of gamma-valerolactone tolerant yeast.

    Science.gov (United States)

    Bottoms, Scott; Dickinson, Quinn; McGee, Mick; Hinchman, Li; Higbee, Alan; Hebert, Alex; Serate, Jose; Xie, Dan; Zhang, Yaoping; Coon, Joshua J; Myers, Chad L; Landick, Robert; Piotrowski, Jeff S

    2018-01-12

    Gamma valerolactone (GVL) treatment of lignocellulosic bomass is a promising technology for degradation of biomass for biofuel production; however, GVL is toxic to fermentative microbes. Using a combination of chemical genomics with the yeast (Saccharomyces cerevisiae) deletion collection to identify sensitive and resistant mutants, and chemical proteomics to monitor protein abundance in the presence of GVL, we sought to understand the mechanism toxicity and resistance to GVL with the goal of engineering a GVL-tolerant, xylose-fermenting yeast. Chemical genomic profiling of GVL predicted that this chemical affects membranes and membrane-bound processes. We show that GVL causes rapid, dose-dependent cell permeability, and is synergistic with ethanol. Chemical genomic profiling of GVL revealed that deletion of the functionally related enzymes Pad1p and Fdc1p, which act together to decarboxylate cinnamic acid and its derivatives to vinyl forms, increases yeast tolerance to GVL. Further, overexpression of Pad1p sensitizes cells to GVL toxicity. To improve GVL tolerance, we deleted PAD1 and FDC1 in a xylose-fermenting yeast strain. The modified strain exhibited increased anaerobic growth, sugar utilization, and ethanol production in synthetic hydrolysate with 1.5% GVL, and under other conditions. Chemical proteomic profiling of the engineered strain revealed that enzymes involved in ergosterol biosynthesis were more abundant in the presence of GVL compared to the background strain. The engineered GVL strain contained greater amounts of ergosterol than the background strain. We found that GVL exerts toxicity to yeast by compromising cellular membranes, and that this toxicity is synergistic with ethanol. Deletion of PAD1 and FDC1 conferred GVL resistance to a xylose-fermenting yeast strain by increasing ergosterol accumulation in aerobically grown cells. The GVL-tolerant strain fermented sugars in the presence of GVL levels that were inhibitory to the unmodified strain