WorldWideScience

Sample records for carotenogenic basidiomycetous yeasts

  1. Proteomic analysis of the carotenogenic yeast Xanthophyllomyces dendrorhous

    OpenAIRE

    Martinez-Moya, Pilar; Watt, Steven Alexander; Niehaus, Karsten; Alcaíno, Jennifer; Baeza, Marcelo; Cifuentes, Víctor

    2011-01-01

    Background The yeast Xanthophyllomyces dendrorhous is used for the microbiological production of the antioxidant carotenoid astaxanthin. In this study, we established an optimal protocol for protein extraction and performed the first proteomic analysis of the strain ATCC 24230. Protein profiles before and during the induction of carotenogenesis were determined by two-dimensional polyacrylamide gel electrophoresis and proteins were identified by mass spectrometry. Results Among the approximate...

  2. Proteomic analysis of the carotenogenic yeast Xanthophyllomyces dendrorhous

    Directory of Open Access Journals (Sweden)

    Baeza Marcelo

    2011-06-01

    Full Text Available Abstract Background The yeast Xanthophyllomyces dendrorhous is used for the microbiological production of the antioxidant carotenoid astaxanthin. In this study, we established an optimal protocol for protein extraction and performed the first proteomic analysis of the strain ATCC 24230. Protein profiles before and during the induction of carotenogenesis were determined by two-dimensional polyacrylamide gel electrophoresis and proteins were identified by mass spectrometry. Results Among the approximately 600 observed protein spots, 131 non-redundant proteins were identified. Proteomic analyses allowed us to identify 50 differentially expressed proteins that fall into several classes with distinct expression patterns. These analyses demonstrated that enzymes related to acetyl-CoA synthesis were more abundant prior to carotenogenesis. Later, redox- and stress-related proteins were up-regulated during the induction of carotenogenesis. For the carotenoid biosynthetic enzymes mevalonate kinase and phytoene/squalene synthase, we observed higher abundance during induction and/or accumulation of carotenoids. In addition, classical antioxidant enzymes, such as catalase, glutathione peroxidase and the cytosolic superoxide dismutases, were not identified. Conclusions Our results provide an overview of potentially important carotenogenesis-related proteins, among which are proteins involved in carbohydrate and lipid biosynthetic pathways as well as several redox- and stress-related proteins. In addition, these results might indicate that X. dendrorhous accumulates astaxanthin under aerobic conditions to scavenge the reactive oxygen species (ROS generated during metabolism.

  3. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described. PMID:19341364

  4. Molecular Characterization and Functional Analysis of Cytochrome b5 Reductase (CBR) Encoding Genes from the Carotenogenic Yeast Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Gutiérrez, María Soledad; Rojas, María Cecilia; Sepúlveda, Dionisia; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2015-01-01

    The eukaryotic microsomal cytochrome P450 systems consist of a cytochrome P450 enzyme (P450) and a cytochrome P450 redox partner, which generally is a cytochrome P450 reductase (CPR) that supplies electrons from NADPH. However, alternative electron donors may exist such as cytochrome b5 reductase and cytochrome b5 (CBR and CYB5, respectively) via, which is NADH-dependent and are also anchored to the endoplasmic reticulum. In the carotenogenic yeast Xanthophyllomyces dendrorhous, three P450-encoding genes have been described: crtS is involved in carotenogenesis and the CYP51 and CYP61 genes are both implicated in ergosterol biosynthesis. This yeast has a single CPR (encoded by the crtR gene), and a crtR- mutant does not produce astaxanthin. Considering that this mutant is viable, the existence of alternative cytochrome P450 electron donors like CBR and CYB5 could operate in this yeast. The aim of this work was to characterize the X. dendrorhous CBR encoding gene and to study its involvement in P450 reactions in ergosterol and carotenoid biosynthesis. Two CBRs genes were identified (CBR.1 and CBR.2), and deletion mutants were constructed. The two mutants and the wild-type strain showed similar sterol production, with ergosterol being the main sterol produced. The crtR- mutant strain produced a lower proportion of ergosterol than did the parental strain. These results indicate that even though one of the two CBR genes could be involved in ergosterol biosynthesis, crtR complements their absence in the cbr- mutant strains, at least for ergosterol production. The higher NADH-dependent cytochrome c reductase activity together with the higher transcript levels of CBR.1 and CYB5 in the crtR- mutant as well as the lower NADH-dependent activity in CBS-cbr.1- strongly suggest that CBR.1-CYB5 via participates as an alternative electron donor pathway for P450 enzymes involved in ergosterol biosynthesis in X. dendrorhous. PMID:26466337

  5. Molecular Characterization and Functional Analysis of Cytochrome b5 Reductase (CBR Encoding Genes from the Carotenogenic Yeast Xanthophyllomyces dendrorhous.

    Directory of Open Access Journals (Sweden)

    María Soledad Gutiérrez

    Full Text Available The eukaryotic microsomal cytochrome P450 systems consist of a cytochrome P450 enzyme (P450 and a cytochrome P450 redox partner, which generally is a cytochrome P450 reductase (CPR that supplies electrons from NADPH. However, alternative electron donors may exist such as cytochrome b5 reductase and cytochrome b5 (CBR and CYB5, respectively via, which is NADH-dependent and are also anchored to the endoplasmic reticulum. In the carotenogenic yeast Xanthophyllomyces dendrorhous, three P450-encoding genes have been described: crtS is involved in carotenogenesis and the CYP51 and CYP61 genes are both implicated in ergosterol biosynthesis. This yeast has a single CPR (encoded by the crtR gene, and a crtR- mutant does not produce astaxanthin. Considering that this mutant is viable, the existence of alternative cytochrome P450 electron donors like CBR and CYB5 could operate in this yeast. The aim of this work was to characterize the X. dendrorhous CBR encoding gene and to study its involvement in P450 reactions in ergosterol and carotenoid biosynthesis. Two CBRs genes were identified (CBR.1 and CBR.2, and deletion mutants were constructed. The two mutants and the wild-type strain showed similar sterol production, with ergosterol being the main sterol produced. The crtR- mutant strain produced a lower proportion of ergosterol than did the parental strain. These results indicate that even though one of the two CBR genes could be involved in ergosterol biosynthesis, crtR complements their absence in the cbr- mutant strains, at least for ergosterol production. The higher NADH-dependent cytochrome c reductase activity together with the higher transcript levels of CBR.1 and CYB5 in the crtR- mutant as well as the lower NADH-dependent activity in CBS-cbr.1- strongly suggest that CBR.1-CYB5 via participates as an alternative electron donor pathway for P450 enzymes involved in ergosterol biosynthesis in X. dendrorhous.

  6. Iterative carotenogenic screens identify combinations of yeast gene deletions that enhance sclareol production

    DEFF Research Database (Denmark)

    Trikka, Fotini A; Nikolaidis, Alexandros; Athanasakoglou, Anastasia;

    2015-01-01

    advantage of existing knowledge of the sterol biosynthetic pathway, while many additional factors may affect the output of the engineered system. RESULTS: Aiming to develop a yeast strain that can support high titers of sclareol, a diterpene of great importance for the perfume industry, we sought to....... Applying the same approach using a different starting point could yield alternative sets of deletions with similar or improved outcome....

  7. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol. PMID:17697987

  8. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications. PMID:23558529

  9. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs. PMID:18805521

  10. The BETA-1, 3-Glucanase of Basidiomycete QM 806: Studies on it's production and application in yeast cell wall hydrolysis

    OpenAIRE

    Ryan, Eleanor

    1986-01-01

    In this project the growth and production of JB-1,3-glucanase by Basidiomycete sp QM 806 was investigated, with a view to studying its application in B-1,3-glucan degradation and in yeast extract production. The effect of various parameters on 3-1 »3-glucanase production was examined. The optimal conditions for enzyme production in submerged shake-flask culture were chosen. Two B-1,3-glucans (laminarin and yeast cell walls) were degraded using the B-1,3-glucanase produced. The degra...

  11. Sympodiomycopsis yantaiensis sp. nov., a basidiomycetous yeast isolated from insect frass.

    Science.gov (United States)

    Chen, Liang; Zhang, Lin; Li, Zhi-Hui; Hui, Feng-Li

    2013-09-01

    Two strains (NYNU 121010(T) and NYNU 121032) of a novel basidiomycetous yeast species belonging to the genus Sympodiomycopsis were isolated from insect frass collected from trunks of a pagoda tree (Sophora japonica L.) in Yantai, Shandong province, east China. The sequence analyses of the D1/D2 domain of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region indicated that the closest relatives were Sympodiomycopsis kandeliae FIRDI 007(T), Sympodiomycopsis paphiopedili CBS 7429(T) and Sympodiomycopsis sp. S6A. The D1/D2 sequences of the novel strains differed by 12 nt substitutions (2%) from the type strain of S. kandeliae, and by 13 nt substitutions (2.2%) from the type strain of S. paphiopedili and from Sympodiomycopsis sp. S6A. The novel strains differed from closely related species by more than 4.6% substitutions in the ITS region. The novel strains can also be distinguished from S. kandeliae and S. paphiopedili on the basis of a number of morphological and physiological characteristics and represent a novel species in the genus Sympodiomycopsis, for which the name Sympodiomycopsis yantaiensis sp. nov. is proposed. The type strain is NYNU 121010(T) ( =CICC 32998(T) = CBS 12813(T)). The Mycobank deposit number is MB 804119. PMID:23838443

  12. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence. PMID:23814110

  13. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5. PMID:20652239

  14. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  15. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands

    OpenAIRE

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-01-01

    Background Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and s...

  16. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Verwaal, R.; Wang, J.; Meijnen, J.P.; Visser, H.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2007-01-01

    To determine whether Saccharomyces cerevisiae can serve as a host for efficient carotenoid and especially ß-carotene production, carotenogenic genes from the carotenoid-producing yeast Xanthophyllomyces dendrorhous were introduced and overexpressed in S. cerevisiae. Because overexpression of these g

  17. High-level recombinant protein production by the basidiomycetous yeast Pseudozyma antarctica under a xylose-inducible xylanase promoter.

    Science.gov (United States)

    Watanabe, Takashi; Morita, Tomotake; Koike, Hideaki; Yarimizu, Tohru; Shinozaki, Yukiko; Sameshima-Yamashita, Yuka; Yoshida, Shigenobu; Koitabashi, Motoo; Kitamoto, Hiroko

    2016-04-01

    Yeast host-vector systems are useful tools for the production of recombinant proteins. Here, we report the construction of a new high-level expression plasmid pPAX1-neo for the basidiomycetous yeast, Pseudozyma antarctica. pPAX1-neo harbours a xylose-inducible expression cassette under control of the xylanase promoter and terminator of P. antarctica T-34, a selection cassette of neomycin/G418 with an Escherichia coli neomycin resistance gene under control of the homocitrate synthase promoter of strain T-34, and an autonomously replicating sequence fragment of Ustilago maydis (UARS). Biodegradable plastic (BP)-degrading enzymes of P. antarctica JCM10317 (PaE) and Paraphoma-related fungal strain B47-9 (PCLE) were used as reporter proteins and inserted into pPAX1-neo, resulting in pPAX1-neo::PaCLE1 and pPAX1-neo::PCLE, respectively. Homologous and heterologous BP-degrading enzyme production of transformants of P. antarctica T-34 were detected on agar plates containing xylose and emulsified BP. Recombinant PaE were also produced by transformants of other Pseudozyma strains including Pseudozyma aphidis, Pseudozyma rugulosa, and Pseudozyma tsukubaensis. To improve the stability of transformed genes in cells, the UARS fragment was removed from linearized pPAX1-neo::PaCLE1 and integrated into the chromosome of the P. antarctica strain, GB-4(0), which was selected as a PaE producer in xylose media. Two transformants, GB-4(0)-X14 and X49, had an 11-fold higher activity compared with the wild type strain in xylose-containing liquid media. By xylose fed-batch cultivation using a 3-L jar fermentor, GB-4(0)-X14 produced 73.5 U mL(-1) of PaE, which is 13.4-fold higher than that of the wild type strain GB-4(0), which produced 5.5 U mL(-1) of PaE. PMID:26695155

  18. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  19. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials. PMID:24586250

  20. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  1. An Application of Wastewater Treatment in a Cold Environment and Stable Lipase Production of Antarctic Basidiomycetous Yeast Mrakia blollopis

    OpenAIRE

    Tsuji, Masaharu; Yokota, Yuji; Shimohara, Kodai; Kudoh, Sakae; Hoshino, Tamotsu

    2013-01-01

    Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6%) to Mrakia blollopis CBS8921T in ITS and D1/D2 sequences and had two unique characteristics when ap...

  2. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. PMID:20564650

  3. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Science.gov (United States)

    Tsuji, Masaharu; Yokota, Yuji; Shimohara, Kodai; Kudoh, Sakae; Hoshino, Tamotsu

    2013-01-01

    Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6%) to Mrakia blollopis CBS8921(T) in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD) removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions. PMID:23516630

  4. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  5. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants. PMID:17898510

  6. Effect of Different Carbon Source on Expression of Carotenogenic Genes and Astaxanthin Production in Xanthophyllomyces dendrorhous

    OpenAIRE

    Wei Wu; Xin Yu

    2013-01-01

    The present research gives an insight into astaxanthin production, as well as transcription differences of four key carotenogenic genes, in Xanthophyllomyces dendrorhous when cultured with various carbon sources and soybean oil as co-substrates. Glucose was found to be the carbon source with best culture growth and astaxanthin production and the addition of 2% (v/v) soybean oil resulted in even higher astaxanthin producing. In addition, four carotenogenic genes encoding geranylgeranyl diphosp...

  7. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  8. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast. PMID:20146402

  9. Enzymes of Saprotrophic Basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    Amsterdam: Academic Press, 2007, s. 19-41. ISBN 978-0-12-374185-1 R&D Projects: GA AV ČR KJB600200516; GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : saprotrophic basidiomycetes * extracellular enzymes * polymers Subject RIV: EE - Microbiology, Virology

  10. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs. PMID:18083152

  11. [Antiviral properties of basidiomycetes metabolites].

    Science.gov (United States)

    Avtonomova, A V; Krasnopolskaya, L M

    2014-01-01

    The data on the antiviral action of the Ganoderma lucidum, Lentinus edodes, Grifola frondosa, Agaricus brasiliensis and other basidiomycetes metabolites are summurized. The metabolites of these species of basidiomycetes exhibit a direct antiviral effect on herpes simplex virus types I and II, human immunodeficiency virus (HIV), hepatitis B virus, vesicular stomatitis virus, influenza virus, Epstein-Barr virus, and others. Moreover, metabolites of basidiomycetes increased antiviral immunity. PMID:25975107

  12. Degradation of cellulose by basidiomycetous fungi.

    Science.gov (United States)

    Baldrian, Petr; Valásková, Vendula

    2008-05-01

    Cellulose is the main polymeric component of the plant cell wall, the most abundant polysaccharide on Earth, and an important renewable resource. Basidiomycetous fungi belong to its most potent degraders because many species grow on dead wood or litter, in environment rich in cellulose. Fungal cellulolytic systems differ from the complex cellulolytic systems of bacteria. For the degradation of cellulose, basidiomycetes utilize a set of hydrolytic enzymes typically composed of endoglucanase, cellobiohydrolase and beta-glucosidase. In some species, the absence of cellobiohydrolase is substituted by the production of processive endoglucanases combining the properties of both of these enzymes. In addition, systems producing hydroxyl radicals based on cellobiose dehydrogenase, quinone redox cycling or glycopeptide-based Fenton reaction are involved in the degradation of several plant cell wall components, including cellulose. The complete cellulolytic complex used by a single fungal species is typically composed of more than one of the above mechanisms that contribute to the utilization of cellulose as a source of carbon or energy or degrade it to ensure fast substrate colonization. The efficiency and regulation of cellulose degradation differs among wood-rotting, litter-decomposing, mycorrhizal or plant pathogenic fungi and yeasts due to the different roles of cellulose degradation in the physiology and ecology of the individual groups. PMID:18371173

  13. Isolation of Saprophytic Basidiomycetes from Soil

    OpenAIRE

    Thorn, R.G.; Reddy, C. A.; Harris, D.; Paul, E. A.

    1996-01-01

    A method with the combined advantages of soil particle washing, selective inhibitors, and an indicator substrate was developed to isolate saprophytic basidiomycetes from soil. Organic particles were washed from soil and plated on a medium containing lignin, guaiacol, and benomyl, which reduced mold growth and allowed detection of basidiomycetes producing laccase or peroxidase. The 64 soil samples yielded 67 basidiomycete isolates, representing 51 groups on the basis of morphology and physiolo...

  14. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. PMID:24256196

  15. The yeast flora of the coast redwood, Sequoia sempervirens

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2003-01-01

    Only four yeast species could be isolated from young and perannual shoots of the coast redwood tree, Sequoia sempervirens, and from soil beneath the trees, viz. both varieties of Debaryomyces hansenii, Trichosporon pullulans, T. porosum and an unidentified red basidiomycetous yeast.

  16. Bandoniozyma gen. nov., a Genus of Fermentative and Non-Fermentative Tremellaceous Yeast Species

    OpenAIRE

    Valente, Patricia; Boekhout, Teun; Landell, Melissa Fontes; Crestani, Juliana; Pagnocca, Fernando Carlos; Sette, Lara Durães; Passarini, Michel Rodrigo Zambrano; Rosa, Carlos Augusto; Luciana R Brandão; Pimenta, Raphael S.; Ribeiro, José Roberto; Garcia, Karina Marques; Lee, Ching-Fu; Suh, Sung-Oui; Péter, Gábor

    2012-01-01

    Background Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. Methodology/Principal Findings The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. Con...

  17. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  18. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Science.gov (United States)

    David-Palma, Márcia; Sampaio, José Paulo; Gonçalves, Paula

    2016-06-01

    In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R) and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD) transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism will benefit from

  19. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Directory of Open Access Journals (Sweden)

    Márcia David-Palma

    2016-06-01

    Full Text Available In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism

  20. Proteomic analysis of Rhodotorula mucilaginosa: dealing with the issues of a non-conventional yeast.

    Science.gov (United States)

    Addis, Maria Filippa; Tanca, Alessandro; Landolfo, Sara; Abbondio, Marcello; Cutzu, Raffaela; Biosa, Grazia; Pagnozzi, Daniela; Uzzau, Sergio; Mannazzu, Ilaria

    2016-08-01

    Red yeasts ascribed to the species Rhodotorula mucilaginosa are gaining increasing attention, due to their numerous biotechnological applications, spanning carotenoid production, liquid bioremediation, heavy metal biotransformation and antifungal and plant growth-promoting actions, but also for their role as opportunistic pathogens. Nevertheless, their characterization at the 'omic' level is still scarce. Here, we applied different proteomic workflows to R. mucilaginosa with the aim of assessing their potential in generating information on proteins and functions of biotechnological interest, with a particular focus on the carotenogenic pathway. After optimization of protein extraction, we tested several gel-based (including 2D-DIGE) and gel-free sample preparation techniques, followed by tandem mass spectrometry analysis. Contextually, we evaluated different bioinformatic strategies for protein identification and interpretation of the biological significance of the dataset. When 2D-DIGE analysis was applied, not all spots returned a unambiguous identification and no carotenogenic enzymes were identified, even upon the application of different database search strategies. Then, the application of shotgun proteomic workflows with varying levels of sensitivity provided a picture of the information depth that can be reached with different analytical resources, and resulted in a plethora of information on R. mucilaginosa metabolism. However, also in these cases no proteins related to the carotenogenic pathway were identified, thus indicating that further improvements in sequence databases and functional annotations are strictly needed for increasing the outcome of proteomic analysis of this and other non-conventional yeasts. Copyright © 2016 John Wiley & Sons, Ltd. PMID:26987668

  1. Ethanol induced astaxanthin accumulation and transcriptional expression of carotenogenic genes in Haematococcus pluvialis.

    Science.gov (United States)

    Wen, Zewen; Liu, Zhiyong; Hou, Yuyong; Liu, Chenfeng; Gao, Feng; Zheng, Yubin; Chen, Fangjian

    2015-10-01

    Haematococcus pluvialis is one of the most promising natural sources of astaxanthin. However, inducing the accumulation process has become one of the primary obstacles in astaxanthin production. In this study, the effect of ethanol on astaxanthin accumulation was investigated. The results demonstrated that astaxanthin accumulation occurred with ethanol addition even under low-light conditions. The astaxanthin productivity could reach 11.26 mg L(-1) d(-1) at 3% (v/v) ethanol, which was 2.03 times of that of the control. The transcriptional expression patterns of eight carotenogenic genes were evaluated using real-time PCR. The results showed that ethanol greatly enhanced transcription of the isopentenyl diphosphate (IPP) isomerase genes (ipi-1 and ipi-2), which were responsible for isomerization reaction of IPP and dimethylallyl diphosphate (DMAPP). This finding suggests that ethanol induced astaxanthin biosynthesis was up-regulated mainly by ipi-1 and ipi-2 at transcriptional level, promoting isoprenoid synthesis and substrate supply to carotenoid formation. Thus ethanol has the potential to be used as an effective reagent to induce astaxanthin accumulation in H. pluvialis. PMID:26215339

  2. Eighteen new oleaginous yeast species.

    Science.gov (United States)

    Garay, Luis A; Sitepu, Irnayuli R; Cajka, Tomas; Chandra, Idelia; Shi, Sandy; Lin, Ting; German, J Bruce; Fiehn, Oliver; Boundy-Mills, Kyria L

    2016-07-01

    Of 1600 known species of yeasts, about 70 are known to be oleaginous, defined as being able to accumulate over 20 % intracellular lipids. These yeasts have value for fundamental and applied research. A survey of yeasts from the Phaff Yeast Culture Collection, University of California Davis was performed to identify additional oleaginous species within the Basidiomycota phylum. Fifty-nine strains belonging to 34 species were grown in lipid inducing media, and total cell mass, lipid yield and triacylglycerol profiles were determined. Thirty-two species accumulated at least 20 % lipid and 25 species accumulated over 40 % lipid by dry weight. Eighteen of these species were not previously reported to be oleaginous. Triacylglycerol profiles were suitable for biodiesel production. These results greatly expand the number of known oleaginous yeast species, and reveal the wealth of natural diversity of triacylglycerol profiles within wild-type oleaginous Basidiomycetes. PMID:27072563

  3. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  4. Biological activities of selected basidiomycetes from Yemen.

    Science.gov (United States)

    Al-Fatimi, M; Schröder, G; Kreisel, H; Lindequist, U

    2013-03-01

    In a previous paper we demonstrated the results of biological screening of Yemeni basidiomycetes. The present study was aimed to investigate the antimicrobial and the antioxidant activity of further basidiomycetes collected in Yemen. Dichloromethane, methanol and aqueous extracts of the fruiting bodies of 25 species were screened in vitro for their antibacterial activities against three Gram-positive bacteria (Staphyloccocus aureus, Bacillus subtilis, Micrococcus flavus) and two Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa), against six human fungal pathogens (Candida albicans, Candida krusei, Aspergillus fumigatus, Mucor sp., Microsporum gypseum, Trichophyton mentagrophytes) and against one non human pathogenic fungus (Candida maltosa). The results indicated that 75 extracts exhibited activity against one or more of the bacteria. The methanol extracts of Agaricus cf. bernardii, Agrocybe pediades, Chlorophyllum molybdites, Coriolopsis polyzona, Ganoderma xylonoides, Pycnoporus sanguineus, Trametes lactinea and Trametes cingulata showed activity against all tested bacteria. The highest antibacterial activity was exhibited by methanol extracts from Chlorophyllum molybdites, Ganoderma xylonoides and Trametes cingulata and Agaricus cf. bernardii, Agrocybe pediades, Coriolopsis polyzona, Pycnoporus sanguineus and Trametes lactinea. The methanol extracts of Chlorophyllum molybdites, Ganoderma xylonoides and Pycnoporus sanguineus showed considerable antifungal activities against the tested fungal strains. Strong antioxidative effects employing the DPPH assay were exhibited by methanol extracts from Chlorophyllum molybdites, Ganoderma xylonoides, Hexagonia velutina, Pycnoporus sanguineus, Trametes lactinea and Trametes cingulata. Our previous and presented studies about 48 basidiomycetes collected in Yemen provide evidence that basidiomycetes from the Arabic region so far should attract more attention as potential source for new biologically active

  5. Lignicolous Basidiomycetes as Valuable Biotechnological Agents

    Directory of Open Access Journals (Sweden)

    Cristiana-Virginia Petre

    2014-10-01

    Full Text Available Lignicolous basidiomycetes are highly specialized organisms that are capable of degrading lignin, one of the most abundant and resistant organic compounds. Through their enzymes and secondary metabolites, these fungi have a great potential that can be successfully used in various biotechnological processes, ranging from mycoremediation of different pollutants and isolation of bioactive molecules with applications in the pharmacological industry and agriculture, as biocontrol agents of phytopathogens.

  6. [Morphology and structural peculiarities of Basidiomycetes pathogens].

    Science.gov (United States)

    Boĭko, O A; Shevchenko, T P; Boĭko, A A

    2013-01-01

    The materials of studies of morphology and structural peculiarities of viruses, fungi and bacteria, which affect Basidiomycetes under biotechnology process and nature biocenosis conditions are given. The analysis of infection development in button mushroom (Agaricus bisporus) (J.Lge) Imbach and in oyster mushroom (Pleurotus ostreatus Kumm.), which served as model objects in the experiments of various levels of complexity has been carried out. Other kinds of edible and medicinal mushrooms, which were a source of biochemical fractions to form biologicals were investigated. PMID:23866587

  7. Differential expression of carotenogenic genes, associated changes on astaxanthin production and photosynthesis features induced by JA in H. pluvialis.

    Directory of Open Access Journals (Sweden)

    Zhengquan Gao

    Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.

  8. Basidiomycete cryopreservation on perlite: Evaluation of a new method

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    2006-01-01

    Roč. 52, - (2006), s. 446-453. ISSN 0011-2240 Institutional research plan: CEZ:AV0Z50200510 Keywords : cryopreservation * perlite * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.162, year: 2006

  9. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  10. Survey of Basidiomycets and Insect Infested Roadside Trees

    OpenAIRE

    Oga, Shoji; Nomura, Shuhei; Inoue, Susumu

    1995-01-01

    Some biotic and abiotic factors causal to the deterioration of roadside trees were surveyed in Fukuoka City on 23 species planted along 22 main streets. Various fruit bodies of basidiomycete, imperfect fungi and bacterial canker disease as well as insect pests were detected. Forty-six fungi strains were obtained in this survey. Aphyllophorales basidiomycete was the most abundant fungi found in surveyed raodside trees. Fruit bodies of 7 edible mushroom species were identified on the scaffold l...

  11. Screening of Brazilian basidiomycetes for antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Rosa Luiz Henrique

    2003-01-01

    Full Text Available A total of 103 isolates of basidiomycetes, representing 84 species from different Brazilian ecosystems, were evaluated for their antifungal and antibacterial activity in a panel of pathogenic and non-pathogenic microorganisms. Tissue plugs of the fruiting bodies were cultivated in liquid media and the whole culture extracted with ethyl acetate. Crude extracts from Agaricus cf. nigrecentulus, Agrocybe perfecta, Climacodon pulcherrimus, Gloeoporus thelephoroides, Hexagonia hydnoides, Irpex lacteus, Leucoagaricus cf. cinereus, Marasmius cf. bellus, Marasmius sp., Nothopanus hygrophanus, Oudemansiella canarii, Pycnoporus sanguineus, Phellinus sp., and Tyromyces duracinus presented significant activity against one or more of the target microorganisms. Eight isolates were active only against bacteria while three inhibited exclusively the growth of fungi. Two extracts presented wide antimicrobial spectrum and were active against both fungi and bacteria. Differences in the bioactivity of extracts obtained from isolates from the same species were observed.

  12. Production of β-ionone by combined expression of carotenogenic and plant CCD1 genes in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Lopez, Javiera; Essus, Karen; Kim, Il-Kwon;

    2015-01-01

    number episomal vectors, in an engineered strain that accumulates FPP. Results: Integration of an extra copy of the geranylgeranyl diphosphate synthase gene (BTS1), together with the carotenogenic genes crtYB and crtI from the ascomycete Xanthophyllomyces dendrorhous, resulted in carotenoid producing...... cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods....

  13. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  14. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  15. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  16. Overwintering of vineyard yeasts: survival of interacting yeast communities in grapes mummified on vines

    Directory of Open Access Journals (Sweden)

    Matthias eSipiczki

    2016-02-01

    Full Text Available The conversion of grape must into wine involves the development and succession of yeast populations differing in species composition. The initial population is formed by vineyard strains which are washed into the must from the crushed grapes and then completed with yeasts coming from the cellar environment. As the origin and natural habitat of the vineyard yeasts are not fully understood, this study addresses the possibility that grape yeasts can be preserved in berries left behind on vines at harvest until the spring of the next year. These berries become mummified during the winter on the vines. To investigate whether yeasts can survive in these overwintering grapes, mummified berries were collected in 16 localities in the Tokaj wine region (Hungary-Slovakia in early March. The collected berries were rehydrated to recover viable yeasts by plating samples onto agar plates. For the detection of minority species which would not be detected by direct plating, an enrichment step repressing the propagation of alcohol-sensitive yeasts was also included in the process. The morphological, physiological and molecular analysis identified 13 basidiomycetous and 23 ascomycetous species including fermentative yeasts of wine-making relevance among the 3879 isolates. The presence of viable strains of these species demonstrates that the grapes mummified on the vine can serve as a safe reservoir of yeasts, and may contribute to the maintenance of grape-colonizing yeast populations in the vineyard over years, parallel with other vectors and habitats. All basidiomycetous species were known phylloplane yeasts. Three Hanseniaspora species and pigmented Metschnikowia strains were the most frequent ascomycetes. Other fermentative yeasts of wine-making relevance were detected only in the enrichment cultures. Saccharomyces (S. paradoxus, S. cerevisiae and S. uvarum were recovered from 13 % of the samples. No Candida zemplinina was found. The isolates with Aureobasidium

  17. Draft Genome Sequence of the Yeast Pseudozyma antarctica Type Strain JCM10317, a Producer of the Glycolipid Biosurfactants, Mannosylerythritol Lipids.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Hori, Tomoyuki; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai; Morita, Tomotake

    2014-01-01

    The basidiomycetous yeast Pseudozyma antarctica is known as a producer of industrial enzymes and the extracellular glycolipids, mannosylerythritol lipids. Here, we report the draft genome sequence of the type strain JCM10317. The draft genome assembly has a size of 18.1 Mb and a G+C content of 60.9%, and it consists of 197 scaffolds. PMID:25291760

  18. Degradation of humic acids by letter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Trögl, Josef; Steffen, K.; Heeg, K.; Hofrichter, M.; Baldrian, Petr

    Praha: ČSSM, 2007, s. 105-108. [Kongres Československé společnosti mikrobiologické /24./. Liberec (CZ), 02.10.2007-05.10.2007] R&D Projects: GA ČR GA526/05/0168 Institutional research plan: CEZ:AV0Z50200510 Keywords : saprotrophic basidiomycetes Subject RIV: EE - Microbiology, Virology

  19. Oxidases and peroxidases of saprotrophic basidiomycetes decomposing leaf litter

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Bittner, B.; Šnajdr, Jaroslav; Hofrichter, M.; Baldrian, Petr

    Barcelona : Verlag, 2007, s. 15-15. [COST Action 868 – Biotechnical functionalisation of renewable polymeric materials. Sitges (ES), 14.04.2007-17.04.2007] R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes Subject RIV: EE - Microbiology, Virology

  20. Enzyme Profiles of Basidiomycete Strains Growing on Different Wood Substrates

    Czech Academy of Sciences Publication Activity Database

    Nerud, František; Homolka, Ladislav; Lisá, Ludmila

    Riga : Riga centre, 2007, s. 44-44. [International conference Biodeterioration of Wood and Wood Products. Riga (LT), 26.09.2007-29.09.2007] R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete Subject RIV: EE - Microbiology, Virology

  1. The influence of Aster x salignus Willd. Invasion on the diversity of soil yeast communities

    Science.gov (United States)

    Glushakova, A. M.; Kachalkin, A. V.; Chernov, I. Yu.

    2016-07-01

    The annual dynamics of yeast communities were studied in the soddy-podzolic soil under the thickets of Aster x salignus Willd., one of the widespread invasive plant species in central Russia. Yeast groups in the soils under continuous aster thickets were found to differ greatly from the yeast communities in the soils under the adjacent indigenous meadow vegetation. In both biotopes the same species ( Candida vartiovaarae, Candida sake, and Cryptococcus terreus) are dominants. However, in the soils under indigenous grasses, eurybiontic yeasts Rhodotorula mucilaginosa, which almost never occur in the soil under aster, are widespread. In the soil under aster, the shares of other typical epiphytic and pedobiontic yeast fungi (ascomycetic species Wickerhamomyces aniomalus, Barnettozyma californica and basidiomycetic species Cystofilobasidium macerans, Guehomyces pullulans) significantly increase. Thus, the invasion of Aster x salignus has a clear effect on soil yeast complexes reducing their taxonomic and ecological diversity.

  2. Polysaccharide production by submerged and solid-state cultures from several medicinal higher Basidiomycetes.

    Science.gov (United States)

    Montoya, Sandra; Sanchez, Oscar Julian; Levin, Laura

    2013-01-01

    Polysaccharides produced by microorganisms represent an industrially unexploited market. An important number of polysaccharides have been isolated from fungi, especially mushrooms, with many interesting biological functions, such as antitumor, hypoglycemic, and immunostimulating activities. In the search of new sources of fungal polysaccharides, the main goal of this research was to test the ability of several species of basidiomycetes, among them various edible mushrooms, to produce both extracellular polysaccharides (EPSs) and intracellular polysaccharides (IPSs). Among 10 species screened for production of EPSs in submerged cultures with glucose, soy oil, and yeast extract, the best results were obtained with Ganoderma lucidum (0.79 g/L EPS) and Pleurotus ostreatus (0.75 g/L EPS). Agitation strongly improved EPS production in most of the studied strains. Eight of 10 species assayed successfully developed basidiomes during synthetic "bag-log" cultivation on a substrate consisting of oak sawdust and corn bran. This work describes for the first time the environmental factors required for fruiting of 4 species under such conditions: Schizophyllum commune, Ganoderma applanatum, Trametes versicolor, and T. trogii. IPSs were extracted from the carpophores. The IPS content of the carpophores varied from 1.4% (G. applanatum) up to 5.5% and 6% in G. lucidum and Grifola frondosa, respectively. PMID:23510286

  3. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment. PMID:23350659

  4. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site. PMID:17922847

  5. A Preliminary Note on Yeasts Associated With Fecal Pellets of Rodents and Marsupials of Atlantic Forest Fragments in Rio de Janeiro, Brazil

    OpenAIRE

    Jacqueline Abranches; Hilda N. Nóbrega; Patrícia Valente; Leda C. Mendonça-Hagler; Allen N. Hagler

    1998-01-01

    Yeasts had mean counts of above 106 CFU/g in the fecal pellets of small mammals from tropical forest fragments. Most of the 55 species isolated were fermentative ascomycetes, with the most frequent being Debaryomyces hansenii, Pichia membranifaciens and Issatchenkia orientalis, whereas Rhodotorula mucilaginosa was the most frequent yeast of basidiomycetous affinity.Leveduras em pelotas fecais de pequenos mamíferos provenientes de fragmentos de Mata Atlântica tiveram contagem média acima de 10...

  6. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    proteins. Several TCS proteins are highly conserved among all the basidiomycetes, and other TCS proteins appear to be specific to particular species of basidiomycetes. Moreover, some species appear to have developed a unique histidine kinase group with unusual domain architecture, the Dual-histidine...

  7. Development of novel fermentation systems for the production of nonalcoholic beverages with basidiomycetes

    OpenAIRE

    Zhang, Yanyan

    2015-01-01

    Basidiomycetes represent the highest developed class of fungi. They are able to synthesize pharmacological relevant secondary metabolites, natural flavor compounds, and highly sought after enzymes. Because of their biochemical potential, basidiomycetes are ideal tools for the food industry. With the recent worldwide declining consumption of beer, breweries are eagerly searching for innovative nonalcoholic fermented beverages to compensate for this negative trend. Different from microorgan...

  8. Cryptococcus friedmannii, a new species of yeast from the Antarctic

    Science.gov (United States)

    Vishniac, H. S.

    1985-01-01

    Cryptococcus friedmannii Vishniac sp. nov. from an Antarctic cryptoendolithic community is a psychrophilic basidioblastomycete characterized by cream-colored colonies of cells with smooth, layered walls, budding monopolarly, producing amylose and extracellular proteinase, utilizing nitrate and D-alanine (inter alia) as nitrogen sources and L-arabinose, arbutin, cellobiose, D-glucuronate, maltose, melezitose, salicin, soluble starch, trehalose, and D-xylose as carbon sources. This species differs from all other basidiomycetous yeasts in possessing the following combination of characters: amylose production (positive), assimilation of cellobiose (positive), D-galactose (negative), myo-inositol (negative), D-mannitol (negative), and sucrose (negative).

  9. Identification and functional characterization of the CYP51 gene from the yeast Xanthophyllomyces dendrorhous that is involved in ergosterol biosynthesis

    OpenAIRE

    Leiva, Kritsye; Werner, Nicole; Sepúlveda, Dionisia; Barahona, Salvador; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2015-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that synthesizes astaxanthin, a carotenoid with great biotechnological impact. The ergosterol and carotenoid synthetic pathways derive from the mevalonate pathway and involve cytochrome P450 enzymes. Among these enzymes, the CYP51 family, which is involved in ergosterol biosynthesis, is one of the most remarkable that has C14-demethylase activity. Results In this study, the CYP51 gene from X. dendrorhous was isolated and its ...

  10. Viability of Basidiomycete Strains after Cryopreservation: Compatison of Ewo Different Freezing Protocols

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Nerud, František

    2003-01-01

    Roč. 48, č. 2 (2003), s. 219-226. ISSN 0015-5632 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycete strains * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.857, year: 2003

  11. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  12. Сultivation Features of Higher Basidiomycetes Trametes zonatus for Liquid Medium

    OpenAIRE

    Тітова, Лариса Олександрівна; Клечак, Інна Рішардівна

    2016-01-01

    Background. The basidiomycetes T. zonatus are producers and cellulose oxidative enzymes and polysaccharides with antitumor activity. The feasibility of this study is that the creation of functional food biotechnology from strains of biomass from domestic collections is not enough initial data: fragmentary data on cultivation conditions and culture medium composition, biochemical biomass of T. zonatus.Оbjective. The aim of the study is to conduct screening of basidiomycetes strains T. zonatus ...

  13. Gene knockdown by ihpRNA-triggering in the ectomycorrhizal basidiomycete fungus Laccaria bicolor

    OpenAIRE

    Kemppainen, Minna J.; Pardo, Alejandro G.

    2010-01-01

    Ectomycorrhiza (ECM) is a mutualistic association between fungi and the roots of the vast majority of trees. These include numerous ecologically and economically relevant species and the participating fungal symbionts are predominantly filamentous basidiomycetes. In natural ecosystems the plant nutrient uptake from soil takes place via the extraradical mycelia of these ECM mycosimbionts as a trade for plant photosyntates. The symbiotic phase in the life cycle of ECM basidiomycetes is the dika...

  14. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    OpenAIRE

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant ...

  15. Yeasts associated with fresh and frozen pulps of Brazilian tropical fruits.

    Science.gov (United States)

    Trindade, Rita C; Resende, Maria Aparecida; Silva, Claudia M; Rosa, Carlos A

    2002-08-01

    The occurrence of yeasts on ripe fruits and frozen pulps of pitanga (Eugenia uniflora L), mangaba (Hancornia speciosa Gom.), umbu (Spondias tuberosa Avr. Cam.), and acerola (Malpighia glaba L) was verified. The incidence of proteolytic, pectinolytic, and mycocinogenic yeasts on these communities was also determined. A total of 480 colonies was isolated and grouped in 405 different strains. These corresponded to 42 ascomycetous and 28 basidiomycetous species. Candida sorbosivorans, Pseudozyma antarctica, C. spandovensis-like, C. spandovensis, Kloeckera apis, C. parapsilosis, Rhodotorula graminis, Kluyveromyces marxianus, Cryptococcus laurentii, Metchnikowia sp (isolated only from pitanga ripe fruits), Issatchenkia occidentalis and C. krusei (isolated only from mangaba frozen pulps), were the most frequent species. The yeast communities from pitanga ripe fruits exhibited the highest frequency of species, followed by communities from acerola ripe fruits and mangaba frozen pulps. Yeast communities from frozen pulp and ripe fruits of umbu had the lowest number of species. Except the yeasts from pitanga, yeast communities from frozen pulp exhibited higher number of yeasts than ripe fruit communities. Mycocinogenic yeasts were found in all of the substrates studied except in communities from umbu ripe fruits and pitanga frozen pulps. Most of the yeasts found to produce mycocins were basidiomycetes and included P. antarctica, Cryptococcus albidus, C. bhutanensis-like, R. graminis and R. mucilaginosa-like from pitanga ripe fruits as well as black yeasts from pitanga and acerola ripe fruits. The umbu frozen pulps community had the highest frequency of proteolytic species. Yeasts able to hydrolyse casein at pH 5.0 represented 38.5% of the species isolated. Thirty-seven percent of yeast isolates were able to hydrolyse casein at pH 7.0. Pectinolytic yeasts were found in all of the communities studied, excepted for those of umbu frozen pulps. The highest frequency of

  16. Polyphenolic substrates and dyes degradation by yeasts from 25 de Mayo/King George Island (Antarctica).

    Science.gov (United States)

    Rovati, José I; Pajot, Hipólito F; Ruberto, Lucas; Mac Cormack, Walter; Figueroa, Lucía I C

    2013-11-01

    Antarctica offers a range of extreme climatic conditions, such as low temperatures, high solar radiation and low nutrient availability, and constitutes one of the harshest environments on Earth. Despite that, it has been successfully colonized by ’cold-loving’ fungi, which play a key role in decomposition cycles in cold ecosystems. However, knowledge about the ecological role of yeasts in nutrient or organic matter recycling/mineralization remains highly fragmentary. The aim of this work was to study the yeast microbiota in samples collected on 25 de Mayo/King George Island regarding the scope of their ability to degrade polyphenolic substrates such as lignin and azo dyes. Sixty-one yeast isolates were obtained from 37 samples, including soil, rocks, wood and bones. Molecular analyses based on rDNA sequences revealed that 35 yeasts could be identified at the species level and could be classified in the genera Leucosporidiella, Rhodotorula, Cryptococcus, Bullera and Candida. Cryptococcus victoriae was by far the most ubiquitous species. In total, 33% of the yeast isolates examined showed significant activity for dye decolorization, 25% for laccase activity and 38% for ligninolytic activity. Eleven yeasts did not show positive activity in any of the assays performed and no isolates showed positive activity across all tested substrates. A high diversity of yeasts were isolated in this work, possibly including undescribed species and conspicuous Antarctic yeasts, most of them belonging to oligotrophic, slow-growing and metabolically diverse basidiomycetous genera. PMID:24298603

  17. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  18. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  19. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  20. Subcutaneous abscess due to the basidiomycete Phellinus mori in a patient with chronic granulomatous disease.

    Science.gov (United States)

    Shigemura, T; Nakazawa, Y; Amano, Y; Sudo, A; Watanabe, M; Kobayashi, M; Kobayashi, N; Koike, K; Agematsu, K; Nishimura, K

    2015-06-01

    Chronic granulomatous disease (CGD), a primary immunodeficiency caused by impaired phagocyte killing of intracellular pathogens, is characterized by recurrent, life-threatening, bacterial and fungal infections. As a result of improvements in microbiologic culture and identification techniques, a number of unique filamentous fungi have been reported as significant pathogens in patients with CGD. We report a case of subcutaneous basidiomycete Phellinus mori infection in a patient with CGD. To the best of our knowledge, this is the first reported case of human infection by this fungus. The causative fungus was identified on the basis of its morphological characteristics and nucleotide sequence on the internal transcribed spacer region of the ribosomal RNA gene. This is the fifth case report of filamentous basidiomycetes infecting a patient with CGD; all of these cases have been caused by Phellinus species. We highlight the importance of recognizing filamentous basidiomycetes Phellinus species as possible agents of non-Aspergillus fungal infections in patients with CGD. PMID:25600930

  1. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  2. Yeast communities associated with the bulk-soil, rhizosphere and ectomycorrhizosphere of a Nothofagus pumilio forest in northwestern Patagonia, Argentina.

    Science.gov (United States)

    Mestre, M Cecilia; Rosa, Carlos A; Safar, Silvana V B; Libkind, Diego; Fontenla, Sonia B

    2011-12-01

    Soil microorganisms play an important role in soil quality and they interact closely with vegetation. Little is known about yeast diversity and function in forest soil ecosystems and their interactions with other biotic soil components, particularly in the mycorrhizosphere. We studied the diversity of yeasts inhabiting the bulk-soil, rhizosphere and ectomycorrhizosphere of a Nothofagus pumilio forest in Nahuel Huapi National Park (Bariloche, Argentina). Ectomycorrhizal infection was observed in all N. pumilio trees studied. A total of 126 yeast isolates were obtained, including 18 known and three possibly new species. Basidiomycetous yeasts were predominant in all soil fractions, and the most frequently isolated species was Cryptococcus podzolicus. Diversity indices and multivariate analyses were used to study and compare yeast communities in the bulk-soil, rhizosphere and ectomycorrhizosphere. Yeasts able to ferment glucose were found associated with the rhizosphere. Many of the recovered yeast species were associated with lignocelluloses compound degradation, which suggest that yeast plays an important role as a decomposer in these forest soils. Each soil fraction has a distinct yeast assemblage related to their physiologic capacities and soil nutrient availability. PMID:22067034

  3. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  4. Identification and characterization of yeasts isolated from sedimentary rocks of Union Glacier at the Antarctica.

    Science.gov (United States)

    Barahona, Salvador; Yuivar, Yassef; Socias, Gabriel; Alcaíno, Jennifer; Cifuentes, Víctor; Baeza, Marcelo

    2016-07-01

    The study of the yeasts that inhabit cold environments, such as Antarctica, is an active field of investigation oriented toward understanding their ecological roles in these ecosystems. In a great part, the interest in cold-adapted yeasts is due to several industrial and biotechnological applications that have been described for them. The aim of this work was to isolate and identify yeasts from sedimentary rock samples collected at the Union Glacier, Antarctica. Furthermore, the yeasts were physiologically characterized, including the production of metabolites of biotechnological interest. The yeasts isolated that were identified at the molecular level belonged to genera Collophora (1 isolate), Cryptococcus (2 isolates), Sporidiobolus (4 isolates), Sporobolomyces (1 isolate) and Torrubiella (2 isolates). The majority of yeasts were basidiomycetous and psychrotolerant. By cross-test assays for anti-yeast activity, it was determined that Collophora sp., Sporidiobolus salmonicolor, and Sporobolomyces roseus secreted a protein factor that kills Sporidiobolus metaroseus. The colored yeasts Sp. salmonicolor, Sp. metaroseus and Collophora sp. produced several carotenoid pigments that were identified as 2,3 dihydroxy-γ-carotene, -carotene, 4-ketotorulene, torulene β-cryptoxanthin and spirilloxanthin. Concerning analysis of mycosporines, these metabolites were only found in the yeasts Torrubiella sp. and Cryptococcus sp. T11-10-1. Furthermore, the yeasts were evaluated for the production of extracellular hydrolytic activities. Of the twelve activities analyzed, alkaline phosphatase, invertase, gelatinase, cellulase, amylase, and protease enzyme activities were detected. The yeasts Cryptococcus sp. T11-10-1 and Sporidiobolus metaroseus showed the highest number of different enzyme activities. PMID:27215207

  5. Yeasts in malting, with special emphasis on Wickerhamomyces anomalus (synonym Pichia anomala).

    Science.gov (United States)

    Laitila, Arja; Sarlin, Tuija; Raulio, Mari; Wilhelmson, Annika; Kotaviita, Erja; Huttunen, Timo; Juvonen, Riikka

    2011-01-01

    Malted barley is a major raw material of beer, as well as distilled spirits and several food products. The production of malt (malting) exploits the biochemical reactions of a natural process, grain germination. In addition to germinating grain, the malting process includes another metabolically active component: a diverse microbial community that includes various types of bacteria and fungi. Therefore, malting can be considered as a complex ecosystem involving two metabolically active groups. Yeasts and yeast-like fungi are an important part of this ecosystem, but previously the significance of yeasts in malting has been largely underestimated. Characterization and identification of yeasts in industrial processes revealed 25 ascomycetous yeasts belonging to 10 genera, and 18 basidiomycetous yeasts belonging to 7 genera. In addition, two ascomycetous yeast-like fungi belonging to the genera Aureobasidium and Exophiala were commonly detected. Yeasts and yeast-like fungi produced extracellular hydrolytic enzymes with a potentially positive contribution to the malt enzyme spectrum. Several ascomycetous yeast strains showed strong antagonistic activity against field and storage moulds, Wickerhamomyces anomalus (synonym Pichia anomala) being the most effective species. Malting studies revealed that W. anomalus VTT C-04565 effectively restricted Fusarium growth and hydrophobin production during malting and prevented beer gushing. In order to broaden the antimicrobial spectrum and to improve malt brewhouse performance, W. anomalus could be combined with other starter cultures such as Lactobacillus plantarum. Well-characterized microbial mixtures consisting of barley and malt-derived microbes open up several possibilities to improve malt properties and to ensure the safety of the malting process. PMID:20872177

  6. Saprotrophic basidiomycetes from temperate oak (Quercus petraea) forest soil: degradation of soil organic matter

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Cajthaml, Tomáš; Merhautová, Věra; Baldrian, Petr

    Vienna: Verlag, 2006, A141-A141. [International Symposium on Microbial Ecology – ISME-11 /11./. Vienna (AT), 20.08.2006-25.08.2006] R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycetes * forest soil * saprotrophic fungi Subject RIV: EE - Microbiology, Virology

  7. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  8. Distribution of Brown Blotch Bacteria in Wild and Cultivated Species of Basidiomycetes

    OpenAIRE

    Bessette, Alan E.

    1984-01-01

    Wild and cultivated Basidiomycetes species were cultured to determine the distribution of bacteria causing brown blotch disease of Agaricus bisporus. Colonies from each basidiocarp were screened for brown blotch organisms by the white line and host pathogenicity tests. Isolates causing brown blotch were identified as Pseudomonas tolaasi and an Arthrobacter species.

  9. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  10. Assessment of endophytic yeast diversity in rice leaves by a culture-independent approach.

    Science.gov (United States)

    Tantirungkij, Manee; Nasanit, Rujikan; Limtong, Savitree

    2015-09-01

    Endophytic microorganisms inhabit internal plant tissues in the host plant without causing any symptoms or negative effects. Although the diversity of endophytes has been evaluated by both culture-dependent and culture-independent methods, less information is available on yeast communities. Therefore, in this study a culture-independent method was used to examine endophytic yeasts associated with rice leaves based on the large subunit of ribosomal DNA using a semi-nested PCR technique. Sequence analysis indicated that the colonization frequency and the relative species frequency (RF) of endophytic yeast phylotypes were 0.41 and 0.06, respectively, and the majority of the yeast phylotypes were basidiomycetous yeasts. The phylotypes were designated as five known species (Cryptococcus victoriae, Debaryomyces hansenii, Debaryomyces vindobonensis, Meyerozyma guilliermondii and Pseudozyma antarctica), together with seventeen phylotypes closest to Candida metapsilosis, Cryp. foliicola, Cryp. laurentii, Pseudozyma abaconensis, Pseudozyma aphidis and Trichosporon asahii, among which some could be novel species. The most prevalent phylotypes were those closest to Cryp. foliicola (47.5 % RF) followed by D. hansenii (22.8 % RF) and P. antarctica (16.8 % RF). The presence of the phylotypes related to species known for their potential applications as biocontrol agents and plant growth promoting hormone producers suggests that they may have valuable applications. In addition, our findings revealed the occurrence of novel phylotypes at high frequency, which should encourage extensive studies to discover novel yeast species and to understand their roles in the rice leaves. PMID:26122889

  11. High Level Secretion of Laccase (LccH) from a Newly Isolated White-Rot Basidiomycete, Hexagonia hirta MSF2

    Science.gov (United States)

    Kandasamy, Sujatha; Muniraj, Iniya K.; Purushothaman, Namitha; Sekar, Ashika; Sharmila, D. J. S.; Kumarasamy, Ramasamy; Uthandi, Sivakumar

    2016-01-01

    Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH) in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY) medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modeling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7) with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5%, respectively. Such high level secretion, thermal and solvent stability of LccH make H. hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications. PMID:27242729

  12. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  13. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  14. Yeast Infection (Candidiasis)

    Science.gov (United States)

    ... rash and rashes clinical tools newsletter | contact Share | Yeast Infection (Candidiasis) Information for adults A A A This is a candida (yeast) infection of the skin folds of the abdomen. Overview ...

  15. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the ...

  16. Metabolic pathways of biotransformation and biosynthesis of aromatic compounds for the flavour industry by the basidiomycete Pycnoporus cinnabarinus

    OpenAIRE

    Asther, Marcel; Lomascolo, A.; Asther, M.; Moukha, S.; Lesage-Meessen, L.

    1998-01-01

    Among filamentous fungi, white-rot Basidiomycetes have become a strategic group to generate industrial aromatic flavours. In the course of a basidiomycete screening, the biotechnological potential of #Pycnoporus cinnabarinus$ strains was studied in order to produce, by transformation or de novo, natural aromatic flavours in liquid cultures. Ferulic acid and L-phenylalanine were found to be suitable substrates for vanillin and benzaldehyde (bitter almond aroma) production, respectively. These ...

  17. Prions in Yeast

    OpenAIRE

    Liebman, Susan W; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in unde...

  18. Yeast That Smell

    Directory of Open Access Journals (Sweden)

    Eugenia Y Xu

    2008-08-01

    Full Text Available The fundamental mechanism of olfactory receptor activation has been conserved from yeast to humans. Engineered yeast cells can smell some of the same odorants as humans can, which makes yeast an ideal model system for studying human olfaction. Furthermore, if engineered yeast cells are incorporated into sensory arrays, they can be used as biosensors or artificial noses.Keywords: Yeast, olfactory receptor, G protein-coupled receptor, biosensor, smellReceived: 31 July 2008 / Received in revised form: 6 August 2008, Accepted: 13 August 2008, Published online: 17 August 2008

  19. Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi.

    OpenAIRE

    Bakkeren, G; Kronstad, J. W.

    1994-01-01

    Sexual compatibility requires self vs. non-self recognition. Genetically, two compatibility or mating-type systems govern recognition in heterothallic basidiomycete fungi such as the edible and woodrotting mushrooms and the economically important rust and smut phytopathogens. A bipolar system is defined by a single genetic locus (MAT) that can have two or multiple alleles. A tetrapolar system has two loci, each with two or more specificities. We have employed two species from the genus Ustila...

  20. Mating System and Basidiospore Formation in the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Alic, Margaret; Letzring, Celia; Gold, Michael H.

    1987-01-01

    Prototrophic strains recovered from crosses between auxotrophic strains of the lignin-degrading basidiomycete Phanerochaete chrysosporium were induced to fruit. The progeny of most of these self-crosses were prototrophic, indicating that the nuclei of the original prototroph were wild-type recombinants rather than complementary heterokaryons and that the binucleate basidiospores of this organism are homokaryotic. Various wild-type strains were shown to have multinucleate cells lacking clamp c...

  1. Patterns of Repeat-Induced Point Mutation in Transposable Elements of Basidiomycete Fungi

    OpenAIRE

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E.

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-...

  2. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    OpenAIRE

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree...

  3. Iron-Binding Compounds Produced by Wood-Decaying Basidiomycetes

    OpenAIRE

    Fekete, Frank A.; Chandhoke, Vikas; Jellison, Jody

    1989-01-01

    The chrome azurol-S universal siderophore assay and the rapid paper electrophoresis siderophore assay were used to screen 10 wood-decaying basidiomycete isolates for the formation of iron-chelating compounds. All 10 isolates were positive for chrome azurol-S reactivity on solid plating medium and in liquid cultures, and 9 of the 10 isolates produced fluorescent iron-binding compounds in the paper electrophoresis assay.

  4. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing basidiomycetes strains

    OpenAIRE

    Moreira Neto, S. L.; Solange I. Mussatto; Machado, K. M. G.; Milagres, Adriane M. F.

    2013-01-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Ciba...

  5. Decolorization of Several Polymeric Dyes by the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Glenn, Jeffrey K.; Michael H Gold

    1983-01-01

    The polymeric dyes Poly B-411, Poly R-481, and Poly Y-606 were examined as possible alternatives to the radiolabeled lignin previously used as a substrate in lignin biodegradation assays. Like lignin degradation, the decolorization of these dyes by the white rot basidiomycete Phanerochaete chrysosporium occurred during secondary metabolism, was suppressed in cultures grown in the presence of high levels of nitrogen, and was strongly dependent on the oxygen concentration in the cultures. A var...

  6. Basidiomycete DyPs: Genomic diversity, structural–functional aspects, reaction mechanism and environmental significance

    OpenAIRE

    Linde, Dolores; Ruiz-Dueñas, Francisco J.; Fernandez-Fueyo, Elena; Guallar, Víctor; Hammel, Kenneth E.; Pogni, Rebecca; Martínez, Angel T.

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes...

  7. Yeasts in mixed deciduous forest areas of Phujong Nayoy National Park and their ability to produce xylanase and carboxymethyl cellulase

    Directory of Open Access Journals (Sweden)

    Jantaporn Thongekkaew,

    2012-04-01

    Full Text Available A total of 61 yeast strains were obtained from 132 samples collected from various sources such as soil, mushroom,flowers, fruits, tree barks and insect frass in the mixed deciduous forest areas of Phujong Nayoy National Park, Thailand.Based on D1/D2 region at the 5 end of the large subunit ribosomal RNA gene (rRNA gene region D1/D2 analysis, 39 strainswere identified as ascomycetous yeasts and distributed to 7 genera i.e. Blastobotrys, Candida, Debaryomyces, Dipodascus,Kodamaea, Pichia and Torulaspora. Twenty strains were identified as basidiomycetous yeasts which belonged to the generaAsterotremella, Cryptococcus, Sporidiobolus and Trichosporon. Another two strains of yeast-like fungi were belonged togenus Aureobasidium. The predominant genus was Candida with a 31.14% contribution. For testing of xylanase and carboxymethylcellulase production of the 61 strains of yeasts and yeast-like fungi, Candida glabrata and Aureobasidiumpullulans showed xylanase activity of 0.91 and 0.52 UmL-1, respectively, and carboxymethyl cellulase activity of 0.38 and0.44 UmL-1, respectively.

  8. Pexophagy in yeasts.

    Science.gov (United States)

    Oku, Masahide; Sakai, Yasuyoshi

    2016-05-01

    Pexophagy, selective degradation of peroxisomes via autophagy, is the main system for reducing organelle abundance. Elucidation of the molecular machinery of pexophagy has been pioneered in studies of the budding yeast Saccharomyces cerevisiae and the methylotrophic yeasts Pichia pastoris and Hansenula polymorpha. Recent analyses using these yeasts have elucidated the molecular machineries of pexophagy, especially in terms of the interactions and modifications of the so-called adaptor proteins required for guiding autophagic membrane biogenesis on the organelle surface. Based on the recent findings, functional relevance of pexophagy and another autophagic pathway, mitophagy (selective autophagy of mitochondria), is discussed. We also discuss the physiological importance of pexophagy in these yeast systems. PMID:26409485

  9. Isolation and Characterization of a Lycopene ε-Cyclase Gene of Chlorella (Chromochloris zofingiensis. Regulation of the Carotenogenic Pathway by Nitrogen and Light

    Directory of Open Access Journals (Sweden)

    Maria Angeles Vargas

    2012-09-01

    Full Text Available The isolation and characterization of the lycopene ε-cyclase gene from the green microalga Chlorella (Chromochloris zofingiensis (Czlcy-e was performed. This gene is involved in the formation of the carotenoids α-carotene and lutein. Czlcy-e gene encoded a polypeptide of 654 amino acids. A single copy of Czlcy-e was found in C. zofingiensis. Functional analysis by heterologous complementation in Escherichia coli showed the ability of this protein to convert lycopene to δ-carotene. In addition, the regulation of the carotenogenic pathway by light and nitrogen was also studied in C. zofingiensis. High irradiance stress did not increase mRNA levels of neither lycopene β-cyclase gene (lcy-b nor lycopene ε-cyclase gene (lcy-e as compared with low irradiance conditions, whereas the transcript levels of psy, pds, chyB and bkt genes were enhanced, nevertheless triggering the synthesis of the secondary carotenoids astaxanthin, canthaxanthin and zeaxanthin and decreasing the levels of the primary carotenoids α-carotene, lutein, violaxanthin and β-carotene. Nitrogen starvation per se enhanced mRNA levels of all genes considered, except lcy-e and pds, but did not trigger the synthesis of astaxanthin, canthaxanthin nor zeaxanthin. The combined effect of both high light and nitrogen starvation stresses enhanced significantly the accumulation of these carotenoids as well as the transcript levels of bkt gene, as compared with the effect of only high irradiance stress.

  10. Cloning and evaluation of different constitutive promoters in the oleaginous yeast Rhodosporidium toruloides.

    Science.gov (United States)

    Wang, Yanan; Lin, Xinping; Zhang, Sufang; Sun, Wenyi; Ma, Sijia; Zhao, Zongbao Kent

    2016-03-01

    The oleaginous yeast Rhodosporidium toruloides is an unconventional yeast species that can accumulate a high content of lipids. Because it belongs to the basidiomycetous group of fungus, limited tools and functional elements are available for genetic engineering of R. toruloides and related red yeasts. Here we report the functional evaluation of five constitutive promoters from this yeast. We assembled a reporter gene expression cassette, consisting of a promoter, the hygromycin gene (HYG) and the nos terminator, and inserted it into the binary vector pZPK. Hygromycin-resistant transformants were obtained when R. toruloides cells were co-cultured with Agrobacterium tumefaciens AGL1 cells harbouring the engineered vector. Genomic integration of the reporter cassette was verified by successful amplification of target DNA fragments. Quantitative PCR analysis suggested that the transformant had only one copy of the reporter cassette. The strength of these promoters was demonstrated at the phenotypic level on the hygromycin-gradient plate and at the transcriptional level by real-time quantitative PCR. It was found that the strengths of these promoters varied no more than five-fold and followed a decreasing sequence of PPGI, PPGK, PFBA, PTPI, and PGPD. This study established new genetic elements for the construction of superior R. toruloides strains to produce advanced biofuels and related chemicals. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26648086

  11. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. PMID:25637654

  12. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  13. Purification and Characterization of a Trehalose Synthase from the Basidiomycete Grifola frondosa

    OpenAIRE

    Saito, Koki; Kase, Toshiya; Takahashi, Eiichi; Takahashi, Eisaku; Horinouchi, Sueharu

    1998-01-01

    A trehalose synthase (TSase) that catalyzes the synthesis of trehalose from d-glucose and α-d-glucose 1-phosphate (α-d-glucose 1-P) was detected in a basidiomycete, Grifola frondosa. TSase was purified 106-fold to homogeneity with 36% recovery by ammonium sulfate precipitation and several steps of column chromatography. The native enzyme appears to be a dimer since it has apparent molecular masses of 120 kDa, as determined by gel filtration column chromatography, and 60 kDa, as determined by ...

  14. Lignin-Modifying Enzymes of Flavodon flavus, a Basidiomycete Isolated from a Coastal Marine Environment†

    OpenAIRE

    Raghukumar, C.; D’Souza, T. M.; Thorn, R. G.; Reddy, C A

    1999-01-01

    A basidiomycetous fungus Flavodon flavus (Klotzsch) Ryvarden (strain 312), isolated from decaying sea grass from a coral lagoon off the west coast of India, mineralized nearly 24% of 14C-labeled synthetic lignin to 14CO2 in 24 days. When grown in low-nitrogen medium (2.4 mM N) this fungus produced three major classes of extracellular lignin-modifying enzymes (LMEs): manganese-dependent peroxidase (MNP), lignin peroxidase (LIP), and laccase. Low MNP and laccase activities were seen in high-nit...

  15. Characterisation of yeasts isolated from ‘Nduja of Spilinga

    Directory of Open Access Journals (Sweden)

    Filippo Giarratana

    2014-04-01

    Full Text Available The ‘Nduja of Spilinga protected geographical indication (PGI is a spreadable italian salami, obtained by using fat (50%, lean of pork (25%, chili pepper (25% and NaCl, stuffed into natural pork casing. Its predominant flora is represented by yeasts, reaching at the end of seasoning values of 6 log CFU/g. Considering the need to enhance and protect traditional local products, it seemed interesting to carry out a characterisation of yeasts of the ‘Nduja of Spilinga PGI. A total of 127 strains of yeast isolated from samples of ‘Nduja of Spilinga PGI (79 strains from samples at different days of curing and 48 from samples of commerce was subjected to morphological identification, hydrolysis of urea, lipolytic activity and identification with API 20C AUX, ID 32C and simplified identification systems. One hundred twenty three (96.8% strains were attributable to the phylum Ascomycetes (urease-negative, the remaining 4 strains (3.2% were Basidiomycetes (urease-positive. Debaryomyces hansenii and its anamorph shape, Candida famata, represented the most prevalent species (61.42 and 17.32% respectively, followed by Candida glabrata (8.66%, Pichia (Candida guilliermondii (5.17%, Candida parapsilosis and Rhodotorula glutinis (1.57%. Candida catenulata, Criptococcus uniguttulatus, Rhodotorula minuta, Candida zeylanoides and Candida utilis were observed with 0.79%. The lipolytic activity was observed only in 10 strains of D. hansenii and in one of C. zeylanoides. Further investigation will contribute to the selection of indigenous strains that could be used for the creation of specific starter, useful to improve the process of characterisation of the ‘Nduja of Spilinga and also to guarantee its safety.

  16. Yeasts associated with plums and their potential for controlling brown rot after harvest.

    Science.gov (United States)

    Janisiewicz, Wojciech J; Jurick, Wayne M; Peter, Kari A; Kurtzman, Cletus P; Buyer, Jeffrey S

    2014-06-01

    Bacterial and yeast antagonists isolated from fruit surfaces have been effective in controlling various post-harvest diseases, and several microbial antagonists have been developed into commercial products. Our knowledge of the fruit microbial community, with the exception of grapes, apples and some citrus fruit, is rudimentary and the potential of the resident yeasts for biocontrol remains largely unknown. We determined the occurrence of yeasts on plum surfaces during fruit development from the pre-hardening stage until harvest for 2 years. A total of 16 species from 13 genera were isolated. Species from three genera, basidiomycetes Rhodotorula (29.5%) and Sporidiobolus (24.7%) and the dimorphic ascomycete genus Aureobasidium (24.7%), constituted 78.7% of all isolations and were recovered throughout fruit development, while Cryptococcus spp. constituted only 6.2% of the total plum isolates. The yeast community in the final sampling was significantly different from the first three samplings, reflecting a rapidly changing fruit habitat during the maturation of fruit. For example, Hanseniaspora, Pichia, Zygosaccharomyces and Wickerhamomyces occurred only on the most mature fruit. Screening of the yeasts for antagonistic activity against Monilinia fructicola, a fungus that causes brown rot, revealed a range of biocontrol activities. Several isolates provided complete control of the decay on plums, challenged with a pathogen suspension of 10(3) conidia/ml and > 90% of control on fruit inoculated with the pathogen at a concentration 10 times higher. Some of the best antagonists included A. pullulans and R. phylloplana. Populations of both of these antagonists increased rapidly by several orders of magnitude in wounds of plums incubated at 24ºC and 4ºC. Our results indicate that plum surfaces harbour several yeast species, with excellent potential for use in biological control of brown rot of stone fruits. PMID:24687564

  17. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants. PMID:24502208

  18. Determination of trace elements in three mushroom samples of basidiomycetes from Shandong, China.

    Science.gov (United States)

    Wang, Chao; Hou, Yunhua

    2011-09-01

    We have determined the trace element composition of three mushrooms of Basidiomycetes, used in traditional Chinese medicine using atomic absorption spectrophotometer (AAS). Metal concentrations in mushrooms were 203-401 mg/kg for iron, 22-51 mg/kg for manganese, 84-116 mg/kg for zinc, 24.1-41.3 mg/kg for copper, 1.6-5.6 mg/kg for lead, 3.3-4.4 mg/kg for chromium, 9.3-11.5 mg/kg for nickel, 0 mg/kg for vanadium, and 55.3-71 mg/kg for magnesium. The trace metal concentrations in mushrooms are hardly affected by the ecosystem and soil where they grew, as well as by the mushroom species and trace metal species. The results can be used to set new standards to control the quality of the three mushrooms of Basidiomycetes-Ganoderma lucidum, Coprinus comatus, and Grifola frondosa. PMID:20665124

  19. Extracellular laccase produced by an edible basidiomycetous mushroom, Grifola frondosa: purification and characterization.

    Science.gov (United States)

    Nitheranont, Thitinard; Watanabe, Akira; Asada, Yasuhiko

    2011-01-01

    A major laccase isozyme (Lac 1) was isolated from the culture fluid of an edible basidiomycetous mushroom, Grifola frondosa. Lac 1 was revealed to be a monomeric protein with a molecular mass of 71 kDa. The N-terminal amino acid sequence of Lac 1 was highly similar to those of laccases of some other white-rot basidiomycetes. Lac 1 showed the typical absorption spectrum of a copper-containing enzyme. The enzyme was stable in a wide pH range (4.0 to 10.0), and lost no activity up to 60 °C for 60 min. The optimal pH of the enzyme activity varied among substrates. The K(m) values of Lac 1 toward 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 2,6-dimethoxyphenol, guaiacol, catechol, and 3,4-dihydroxy-L-phenylalanine were 0.0137 mM, 0.608 mM, 0.531 mM, 2.51 mM, and 0.149 mM respectively. Lac 1 activity was remarkably inhibited by the chloride ion, in a reversible manner. Lac 1 activity was also inhibited by thiol compounds. PMID:21389619

  20. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  1. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  2. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions. PMID:27481160

  3. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  4. Vaginal Yeast Infection

    Science.gov (United States)

    ... Centers for Diseases Control and Prevention. Micrograph showing Candida albicans from a patient with vaginal candidiasis, also known ... caused by an overgrowth of a fungus called Candida albicans in the vagina. Candida is yeast, which is ...

  5. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  6. Meiosis in haploid yeast

    OpenAIRE

    Wagstaff, Joseph E.; Klapholz, Sue; Esposito, Rochelle Easton

    1982-01-01

    Haploid yeast cells normally contain either the MATa or MATα mating-type allele and cannot undergo meiosis and spore formation. If both mating-type alleles are present as a consequence of chromosome III disomy (MATa/MATα), haploids initiate meiosis but do not successfully form spores, probably because the haploid chromosome complement is irregularly partitioned during meiotic nuclear division. We have demonstrated that the ochre-suppressible mutation spo13-1 enables haploid yeast cells disomi...

  7. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  8. In vitro decomposition of Sphagnum-derived acrotelm and mesotelm peat by indigenous and alien basidiomycetous fungi

    Directory of Open Access Journals (Sweden)

    M.N. Thormann

    2011-05-01

    Full Text Available Northern peatlands have accumulated significant quantities of peat, and it has been predicted that rates of peat decomposition may increase due to climate warming. In peatlands, organic matter decomposition in the acrotelm is accomplished primarily by fungi that act differentially through time on various peat constituents. After four months of decomposition in vitro, I show a distinct microbiological limitation to the decomposition of Sphagnum-derived peat (mean mass losses of 1.1–7.1 % by indigenous and alien basidiomycetous fungi of both acrotelm and mesotelm peat (the mesotelm is the lower part of the acrotelm sensu lato, in which conditions fluctuate between oxic and anoxic. Neither acrotelm nor mesotelm Sphagnum peat can be degraded effectively by many fungi (mean mass losses of 2.7 % and 4.3 % for acrotelm and mesotelm peat, respectively, including the ubiquitous wood decomposing basidiomycetes known to decompose some of nature’s most complex polymers. Peatland basidiomycetes caused significantly greater mass losses of acrotelm and mesotelm peat than wood decay basidiomycetes (mean mass losses of 5.7 % and 1.4 %, respectively. Brown rot fungi caused significantly greater mass losses to acrotelm and mesotelm peat than white rot fungi and non-wood-decay fungi (mean mass losses of 10.1 %, 1.7 %, and 2.3 %, respectively. Rates of peat decomposition may not increase to the extent previously predicted, and peatlands may not necessarily be long-term sources of CO2 in response to a warming climate.

  9. Gene expression profiling of the plant pathogenic basidiomycetous fungus Rhizoctonia solani AG 4 reveals putative virulence factors

    Science.gov (United States)

    Rhizoctonia solani is a ubiquitous basidiomycetous soilborne fungal pathogen causing damping off of seedlings, aerial blights and postharvest diseases. To gain insight into the molecular mechanisms of pathogenesis a global approach based on analysis of expressed sequence tags (ESTs) was undertaken. ...

  10. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  11. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524. E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  12. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  13. A single desaturase gene from red yeast Sporidiobolus pararoseus is responsible for both four- and five-step dehydrogenation of phytoene.

    Science.gov (United States)

    Li, Chunji; Zhang, Ning; Song, Jia; Wei, Na; Li, Bingxue; Zou, Hongtao; Han, Xiaori

    2016-09-15

    Carotenoids are one of the most common classes of natural pigments widely occurring within organisms. These structurally diverse pigments are of great importance in different processes such as nutrition, vision, cellular growth and development. While found in various yeast strains, one of the best-studied carotenoid producer is the pigmented species Sporidiobolus pararoseus. However, the precise nature of the genes involved in the biosynthesis of carotenoids in this species remains unclear. Here, we cloned a cDNA copy of the phytoene desaturase gene crtI from Sporidiobolus pararoseus CGMCC 2.5280. The crtI full-length genomic DNA and cDNA are 2330bp and 1683bp, respectively. This gene encodes a 560-amino acid protein with a predicted molecular mass of 62.28 kDa and a pI of 7.27. Functional identification of the gene was performed using heterologous complementation detection in Escherichia coli. Our experimental findings indicate that the enzymatic conversion of phytoene to lycopene (fourth step product) and 3,4-didehydrolycopene (fifth step product) is catalyzed by this phytoene desaturase of S. pararoseus through consecutive dehydrogenation. Furthermore, our findings suggest that the crtI gene of S. pararoseus represents an alternative gene source for the reconstruction of carotenogenic pathways vital for the production of engineered carotenoids. PMID:27346167

  14. Gene knockdown by ihpRNA-triggering in the ectomycorrhizal basidiomycete fungus Laccaria bicolor.

    Science.gov (United States)

    Kemppainen, Minna J; Pardo, Alejandro G

    2010-01-01

    Ectomycorrhiza (ECM) is a mutualistic association between fungi and the roots of the vast majority of trees. These include numerous ecologically and economically relevant species and the participating fungal symbionts are predominantly filamentous basidiomycetes. In natural ecosystems the plant nutrient uptake from soil takes place via the extraradical mycelia of these ECM mycosimbionts as a trade for plant photosyntates. The symbiotic phase in the life cycle of ECM basidiomycetes is the dikaryotic hyphae. Therefore, studies on symbiotic relevant gene functions require the inactivation of both gene copies in these dikaryotic fungi. RNA silencing is a eukaryotic sequence homology-dependent degradation of target RNAs which is believed to have evolved as a protection mechanism against invading nucleic acids. In different eukaryotic organisms, including fungi, the RNA silencing pathway can be artificially triggered to target and degrade gene transcripts of interest, resulting in gene knock-down. Most importantly, RNA silencing can act at the cytosolic level affecting mRNAs originating from several gene copies and different nuclei thus offering an efficient means of altering gene expression in dikaryotic organisms. Therefore, the pHg/pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII-promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy two-step PCR-cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300-based binary vector carrying a hygromycin resistance cassette, makes the pHg/pSILBAγ plasmid compatible with Agrobacterium-mediated transformation. The pHg/pSILBAγ-system results in predominantly single integrations of RNA silencing triggering T-DNAs in the fungal genome

  15. [Fructose transporter in yeasts].

    Science.gov (United States)

    Lazar, Zbigniew; Dobrowolski, Adam; Robak, Małgorzata

    2014-01-01

    Study of hexoses transporter started with discovery of galactose permease in Saccharomyces cerevisiae. Glucose, fructose and mannose assimilation is assumed by numerous proteins encoded by different genes. To date over 20 hexoses transporters, belonging to Sugar Porter family and to Major Facilitator Superfamily, were known. Genome sequence analysis of Candida glabrata, Kluyveromyces lactis, Yarrowia lipolytica, S. cerevisaie and Debaryomyces hansenii reveled potential presence of 17-48 sugar porter proteins. Glucose transporters in S. cerevisiae have been already characterized. In this paper, hexoses transporters, responsible for assimilation of fructose by cells, are presented and compared. Fructose specific transporter are described for yeasts: Zygosaccharomyces rouxii, Zygosaccharomyces bailli, K. lactis, Saccharomyces pastorianus, S. cerevisiae winemaking strain and for fungus Botritys cinerea and human (Glut5p). Among six yeasts transporters, five are fructose specific, acting by facilitated diffusion or proton symport. Yeasts monosaccharides transporter studies allow understanding of sugars uptake and metabolism important aspects, even in higher eukaryotes cells. PMID:25033548

  16. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  17. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. PMID:24800960

  18. [Biological synthesis of gold nanoparticles by the xylotrophic basidiomycete Lentinula edodes].

    Science.gov (United States)

    Vetchinkina, E P; Burov, A M; Ageeva, M V; Dykman, L A; Nikitina, V E

    2013-01-01

    This is the first study to demonstrate that the medicinal basidiomycete Lentinula edodes can reduce gold (III) ions from hydrogen tetrachloaurate (chloroauric acid) H[AuCl4] to the elementary state with the formation of spherical nanoparticles (nanospheres). When a culture was grown under submerged conditions in the presence of chloroauric acid, the appearance of an intense purple-red color of L. edodes filamentous hyphae was recorded, which indicates that gold ions were reduced to gold nanoparticles. Using transmission electron microscopy and X-ray fluorescence, we observed accumulation of colloidal gold by the fungal mycelium in the form of electron-dense nanospheres of 5 to 50 nm in diameter on the surface and inside fungal cells. PMID:24455867

  19. Cardiovascular effects of the fungal extract of basidiomycetes sp. YL8006.

    Science.gov (United States)

    Andreacchi, A S; Wang, T; Wu, J H

    1997-01-01

    Many fungal products are known to possess biological activity towards the mammalian tissues. We studied vasodilating activity in the crude ethanol extract of the dried mycelia of Basidiomycetes sp. YL8006, cultured by submerged fermentation with a complex medium. The activity was assayed using the isolated perfused rat heart in the working mode. Immediately following injection of the extract into the perfusion system, a 20-25% increase in coronary flow was observed (pvehicle control). There was a concurrent decrease in diastolic pressure and coronary vascular resistance. Aortic flow, systolic pressure, and cardiac output declined slightly over time after treatment. No significant changes in heart rate, efficiency, and oxygen consumption were observed. Solvent vehicle did not cause any changes in hemodynamic performance. PMID:9180352

  20. Coprinopsis cinerea as a Model Fungus to Evaluate Genes Underlying Sexual Development in Basidiomycetes

    Directory of Open Access Journals (Sweden)

    P. Srivilai

    2009-01-01

    Full Text Available Coprinopsis cinerea is an excellent model for study of sexual reproduction and development in basidiomycetes because of its short-life cycle, capability to grow and fruit on artificial media under laboratory conditions. Deepening the understanding of genes underlying sexual reproduction and development in this mushroom model is expected to help in the future the world mushroom cultivation of any other basidiomycetes concerning the potential agronomic, economic and environmental benefits. This study presents findings with clear statements from the literature as well as own results focusing on the genetic analysis of genes acting in sexual reproduction and development in C. cinerea. Sexual reproduction and development in C. cinerea are regulated by the A and B mating type genes that encode two types of homeodomain transcription factors, pheromones and pheromone receptors, respectively. Coprinopsis cinerea has two different mycelial stages defined as the monokaryotic-(primary and dikaryotic-(secondary mycelium. When two compatible haploid monokaryons with different mating type alleles at A and B loci are fused, the fertile dikaryons are formed and developed into fruiting bodies, indicating that mating type genes regulate sexual development in C. cinerea. Self-fertile homokaryon AmutBmut strain with mutations in the A and B mating loci is ideal for production of mutants in fruiting body formation. Co-isogenic strains were generated by the repeated back-crossing against AmutBmut to analyze the genetic background of such mutants and the functions of genes in the fruiting pathway. Genetic analysis of AmutBmut fruiting mutants that are blocked at different stages in fruiting pathway will be described.

  1. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  2. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Science.gov (United States)

    Qhanya, Lehlohonolo Benedict; Matowane, Godfrey; Chen, Wanping; Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  3. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  4. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  5. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    Science.gov (United States)

    Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  6. Yeast fluorescence microscopy

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jiří

    New Jersey : Humana Press, 2005, s. 85-96. ISBN 1-59259-958-3 R&D Projects: GA AV ČR IAA5020102; GA ČR GA204/02/1424 Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast * fluorescence microscopy * immunofluorescence Subject RIV: EE - Microbiology, Virology

  7. Polysome Profile Analysis - Yeast

    Czech Academy of Sciences Publication Activity Database

    Pospíšek, M.; Valášek, Leoš

    2013-01-01

    Roč. 530, č. 2013 (2013), s. 173-181. ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013

  8. Opportunistic Pathogenic Yeasts

    Science.gov (United States)

    Banerjee, Uma

    Advances in medical research, made during the last few decades, have improved the prophylactic, diagnostic and therapeutic capabilities for variety of infections/diseases. However, many of the prophylactic and therapeutic procedures have been seen in many instances to exact a price of host-vulnerability to an expanding group of opportunistic pathogens and yeasts are one of the important members in it. Fortunately amongst the vast majority of yeasts present in nature only few are considered to have the capability to cause infections when certain opportunities predisposes and these are termed as ‘opportunistic pathogenic yeasts.’ However, the term ‘pathogenic’ is quite tricky, as it depends of various factors of the host, the ‘bug’ and the environment to manifest the clinical infection. The borderline is expanding. In the present century with unprecedented increase in number of immune-compromised host in various disciplines of health care settings, where any yeast, which has the capability to grow at 37 ° C (normal body temperature of human), can be pathogenic and cause infection in particular situation

  9. A Checklist of the Basidiomycetous Macrofungi and a Record of Five New Species from Mt. Oseo in Korea

    Science.gov (United States)

    Lee, Won Dong; Lee, Hyun; Fong, Jonathan J.; Oh, Seung-Yoon; Park, Myung Soo; Quan, Ying; Jung, Paul E.

    2014-01-01

    Basidiomycetous macrofungi play important roles in maintaining forest ecosystems via carbon cycling and the mobilization of nitrogen and phosphorus. To understand the impact of human activity on macrofungi, an ongoing project at the Korea National Arboretum is focused on surveying the macrofungi in unexploited areas. Mt. Oseo was targeted in this survey because the number of visitors to this destination has been steadily increasing, and management and conservation plans for this destination are urgently required. Through 5 field surveys of Mt. Oseo from April to October 2012, 116 specimens of basidiomycetous macrofungi were collected and classified. The specimens were identified to the species level by analyzing their morphological characteristics and their DNA sequence data. A total of 80 species belonging to 57 genera and 25 families were identified. To the best of our knowledge, this is the first study to identify five of these species-Artomyces microsporus, Hymenopellis raphanipes, Pholiota abietis, Phylloporus brunneiceps, and Sirobasidium magnum-in Korea. PMID:25071381

  10. L-arabinose fermenting yeast

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2014-09-23

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  11. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  12. Accumulation of cellobiose lipids under nitrogen-limiting conditions by two ustilaginomycetous yeasts, Pseudozyma aphidis and Pseudozyma hubeiensis.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2013-02-01

    Some basidiomycetous yeast strains extracellularly produce cellobiose lipids (CLs), glycolipid biosurfactants which have strong fungicidal activity. The representative CL producer Ustilago maydis produces CLs together with the other glycolipids, mannosylerythritol lipids (MELs); the preference of the two glycolipids is affected considerably by the nitrogen source. To develop new CL producers, 12 MEL producers were cultured under the nitrogen-limited conditions. Pseudozyma aphidis and Pseudozyma. hubeiensis were characterized as new CL producers. CL production was induced on three strains, P. aphidis, Pseudozyma graminicola, and P. hubeiensis under these conditions. The putative homologous genes of U. maydis cyp1, which encodes a P450 monooxygenase, essential for CL biosynthesis, were partially amplified from their genomic DNA. The nucleotide sequences of the gene fragments from P. hubeiensis and P. aphidis shared identities with U. maydis cyp1 of 99% and 78%, respectively. Furthermore, all of the deduced translation products are tightly clustered in the phylogenic tree of the monooxygenase. These results suggest that the genes involved with CL biosynthesis must be widely distributed in the basidiomycetous fungi as well as the MEL biosynthesis genes, and thus, the genus Pseudozyma has great potential as a biosurfactant producer. PMID:22985214

  13. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment. PMID:20585855

  14. Biomass estimation during macro-scale solid-state fermentation of basidiomycetes using established and novel approaches.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-07-01

    Solid-state fermentation (SSF) has been utilised in food production for millennia and is well suited for the cultivation of basidiomycetes, due to the robustness of the process and the possibility of using lignocellulose as the substrate. Basidiomycetes produce diverse enzymes and various primary and secondary metabolites, many of which have biotechnological potential. The quantification of the fungal biomass present is essential for the characterisation of growth kinetics in processes such as SSF. In SSF, fungi grow into the substrate and use it as a nutrient source. Therefore, direct biomass determination is not possible and indirect methods have to be employed. In the presented study, we compared 11 methods for quantifying fungal biomass during SSF of the basidiomycete Trametes hirsuta in a newly developed laboratory reactor (working volume 10 L). The methods were based on measuring the levels of six cell-specific components (ergosterol, glucosamine, nucleic acids, number of fungal nuclei, protein and genomic DNA) and estimations of biological activity (respiration, activities of lignolytic and cellulolytic enzymes, and the glucose and protein contents of the liquid). The methods were evaluated with regards to reproducibility and plausibility of the results, time and resource requirements, possible influential factors, and matrix effects. The most reliable biomass estimates were obtained from measurements of ergosterol content, number of nuclei, and respiration. Thus, these three methods were deemed most suitable for process control and modelling. PMID:25656698

  15. Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

    Science.gov (United States)

    van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

    Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

  16. Iron toxicity in yeast.

    Science.gov (United States)

    Wiśnicka, R; Krzepiłko, A; Wawryn, J; Biliński, T

    1997-01-01

    It has been found that yeast cells are sensitive to iron overload only when grown on glucose as a carbon source. Effective concentration of ferrous iron is much higher than that found in natural environments. Effects of ferrous iron are strictly oxygen dependent, what suggest that the formation of hydroxyl radicals in the Fenton reaction is a cause of the toxicity. Respiratory deficiency and pretreatment of cells with antimycin A prevent toxic effects in the late exponential phase of growth, whereas uncouplers and 2mM magnesium salts completely protect even the most vulnerable exponential cells. Generally, toxic effects correlate with the ability of cells to take up this metal. The results presented suggest that during ferrous iron overload iron is transported through the unspecific divalent cation uptake system which is known in fungi. The data suggest that recently described high and low affinity systems of iron uptake in yeast are the only source of iron in natural environments. PMID:9516981

  17. Ultrastructure of methanotrophic yeasts.

    OpenAIRE

    Wolf, H. J.; Christiansen, M.; Hanson, R. S.

    1980-01-01

    The cellular structure of two yeast strains capable of growth on methane was investigated by electron microscopy. Microbodies were observed in cells of Sporobolomyces roseus strain Y and Rhodotorula glutinis strain CY when grown on methane but rarely when grown on glucose. The size of the microbodies and the number observed per cell in a thin section did not increase with culture age. No crystalline organization was observed within these organelles. Similar microbodies were also observed in c...

  18. Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.

    Science.gov (United States)

    Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges

    2015-11-01

    Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. PMID:26226336

  19. Insights into the plant polysaccharide degradation potential of the xylanolytic yeast Pseudozyma brasiliensis.

    Science.gov (United States)

    Kaupert Neto, Antonio Adalberto; Borin, Gustavo Pagotto; Goldman, Gustavo Henrique; Damásio, André Ricardo de Lima; Oliveira, Juliana Velasco de Castro

    2016-03-01

    In second-generation (2G) bioethanol production, plant cell-wall polysaccharides are broken down to release fermentable sugars. The enzymes of this process are classified as carbohydrate-active enzymes (CAZymes) and contribute substantially to the cost of biofuel production. A novel basidiomycete yeast species, Pseudozyma brasiliensis, was recently discovered. It produces an endo-β-1,4-xylanase with a higher specific activity than other xylanases. This enzyme is essential for the hydrolysis of biomass-derived xylan and has an important role in 2G bioethanol production. In spite of the P. brasiliensis biotechnological potential, there is no information about how it breaks down polysaccharides. For the first time, we characterized the secretome of P. brasiliensis grown on different carbon sources (xylose, xylan, cellobiose and glucose) and also under starvation conditions. The growth and consumption of each carbohydrate and the activity of the CAZymes of culture supernatants were analyzed. The CAZymes found in its secretomes, validated by enzymatic assays, have the potential to hydrolyze xylan, mannan, cellobiose and other polysaccharides. The data show that this yeast is a potential source of hydrolases, which can be used for biomass saccharification. PMID:26712719

  20. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D;

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  1. Flavour-active wine yeasts

    OpenAIRE

    Cordente, Antonio G.; Curtin, Christopher D.; Varela, Cristian; Pretorius, Isak S.

    2012-01-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can infl...

  2. Patterns of repeat-induced point mutation in transposable elements of basidiomycete fungi.

    Science.gov (United States)

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-T transition mutations in particular di- and trinucleotide target sites for TE-like sequences from nine fungal genomes. We find evidence of RIP-like patterns of hypermutation at TpCpG trinucleotide sites in repetitive sequences from all species of the Pucciniomycotina subphylum of the Basidiomycota, Microbotryum lychnidis-dioicae, Puccinia graminis, Melampsora laricis-populina, and Rhodotorula graminis. In contrast, we do not find evidence for RIP-like hypermutation in four species of the Agaricomycotina and Ustilaginomycotina subphyla of the Basidiomycota. Our results suggest that a RIP-like process and the specific nucleotide context for mutations are conserved within the Pucciniomycotina subphylum. These findings imply that coevolutionary interactions between TEs and a hypermutating genome defense are stable over long evolutionary timescales. PMID:22250128

  3. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  4. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. PMID:22954341

  5. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis. PMID:16885300

  6. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-02-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  7. Penarines A-F, (nor-)sesquiterpene carboxylic acids from Hygrophorus penarius (Basidiomycetes).

    Science.gov (United States)

    Otto, Alexander; Porzel, Andrea; Schmidt, Jürgen; Wessjohann, Ludger; Arnold, Norbert

    2014-12-01

    Five sesquiterpene carboxylic acids (1-5) and one nor-sesquiterpene carboxylic acid (6) of the very rare ventricosane type, named penarines A-F, were isolated from fruiting bodies of the basidiomycete Hygrophorus penarius (Hygrophoraceae). This is the first report of (nor)-sesquiterpenes isolated from basidiocarps of the family Hygrophoraceae. Their structures were elucidated on the basis of extensive 1D ((1)H, (13)C) and 2D (HSQC, HMBC, COSY, ROESY) NMR spectroscopic analyses as well as high-resolution mass spectrometry studies. Additionally, the only known member of this rare type of sesquiterpenes, ventricos-7(13)-ene (7), could be identified via headspace GC-MS analysis in a fruiting body of H. penarius. Compounds 1-6 were devoid of remarkable antifungal activity against Cladosporium cucumerinum. Additionally, the cytotoxic activities of compounds 1 and 2 were evaluated against the human prostate cancer cell line PC-3 and the colon cancer cell line HT-29 showing no significant cytotoxic activity. PMID:25269661

  8. Genomics and the making of yeast biodiversity

    Science.gov (United States)

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces ...

  9. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  10. Yeasts preservation: alternatives for lyophilisation

    NARCIS (Netherlands)

    Nyanga, L.K.; Nout, M.J.R.; Smid, E.J.; Boekhout, T.; Zwietering, M.H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts duri

  11. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi.

    Science.gov (United States)

    Riley, Robert; Salamov, Asaf A; Brown, Daren W; Nagy, Laszlo G; Floudas, Dimitrios; Held, Benjamin W; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika A; Sun, Hui; LaButti, Kurt M; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E; Pisabarro, Antonio G; Walton, Jonathan D; Blanchette, Robert A; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David S; Grigoriev, Igor V

    2014-07-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white-rot/brown-rot classification paradigm, we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically informed principal-components analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white-rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown-rot fungi. Our results suggest a continuum rather than a dichotomy between the white-rot and brown-rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay. PMID:24958869

  12. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  13. Lignocellulose-Degrading Enzymes of Hardwood Forest Soil: Their Activity, Spatial Distribution and Their Producers - Saprotrophic Basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Šnajdr, Jaroslav; Valášková, Vendula; Cajthaml, Tomáš; Trögl, Josef; Bittner, B.; Hofrichter, M.

    Wisconsin: Verlag, 2007, s. 58-58. [International Congress on Biotechnology in the Pulp and Paper Industry /10./. Madison (US), 10.06.2007-15.06.2007] R&D Projects: GA ČR GA526/05/0168; GA AV ČR KJB600200516 Grant ostatní: CZ(CZ) PPP D17-CZ27/06-07 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje Keywords : basidiomycetes Subject RIV: EE - Microbiology, Virology

  14. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia)

    OpenAIRE

    Siabatto F. Helbert David

    2005-01-01

    Se realizó la colección de especímenes jóvenes de Basidiomycetes en el páramo de Ocetá, ubicado en el municipio de Monguí, Boyacá, Colombia. Con el fin de crear un inventario de cada morfoespecie colectada, se realizó una descripción macroscópica, microscópica y pruebas químicas con
    el fin de obtener los principales taxones. Se encontraron 11 géneros: Gomphydus, Chroogomphus, Paneolus, Macrolepiota, Tricholoma, Lentinellus, Crepidotus, Amanita, Polyborus, Lycoperdon y Tubaria, pert...

  15. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  16. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  17. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

    Directory of Open Access Journals (Sweden)

    De Lucia Marzia

    2010-09-01

    Full Text Available Abstract Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1, lipid/biomass (68% and lipid/glucose yields (16%. Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils.

  18. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  19. Yeasts: from genetics to biotechnology.

    Science.gov (United States)

    Russo, S; Berkovitz Siman-Tov, R; Poli, G

    1995-01-01

    Yeasts have been known and used in food and alcoholic fermentations ever since the Neolithic Age. In more recent times, on the basis of their peculiar features and history, yeasts have become very important experimental models in both microbiological and genetic research, as well as the main characters in many fermentative production processes. In the last 40 years, advances in molecular biology and genetic engineering have made possible not only the genetic selection of organisms, but also the genetic modification of some of them, especially the simplest of them, such as bacteria and yeasts. These discoveries have led to the availability of new yeast strains fit to fulfill requests of industrial production and fermentation. Moreover, genetically modified and transformed yeasts have been constructed that are able to produce large amounts of biologically active proteins and enzymes. Thus, recombinant yeasts make it easier to produce drugs, biologically active products, diagnostics, and vaccines, by inexpensive and relatively simple techniques. Yeasts are going to become more and more important in the "biotechnological revolution" by virtue of both their features and their very long and safe use in human nutrition and industry. PMID:9003692

  20. Yeasts: From genetics to biotechnology

    Energy Technology Data Exchange (ETDEWEB)

    Russo, S.; Poli, G. [Univ. of Milan (Italy); Siman-Tov, R.B. [Univ. of Jerusalem, Rehovot (Israel)

    1995-12-31

    Yeasts have been known and used in food and alcoholic fermentations ever since the Neolithic Age. In more recent times, on the basis of their peculiar features and history, yeasts have become very important experimental models in both microbiological and genetic research, as well as the main characters in many fermentative production processes. In the last 40 years, advances in molecular biology and genetic engineering have made possible not only the genetic selection of organisms, but also the genetic modification of some of them, especially the simplest of them, such as bacteria and yeasts. These discoveries have led to the availability of new yeast strains fit to fulfill requests of industrial production and fermentation. Moreover, genetically modified and transformed yeasts have been constructed that are able to produce large amounts of biologically active proteins and enzymes. Thus, recombinant yeasts make it easier to produce drugs, biologically active products, diagnostics, and vaccines, by inexpensive and relatively simple techniques. Yeasts are going to become more and more important in the {open_quotes}biotechnological revolution{close_quotes} by virtue of both their features and their very long and safe use in human nutrition and industry. 175 refs., 4 figs., 6 tabs.

  1. Genetic study on yeast

    International Nuclear Information System (INIS)

    Research during the past year has moved ahead on several fronts. A major compilation of all the genetic mapping data for the yeast Saccharomyces cerevisiae has been completed. The map describes the location of over 300 genes on 17 chromosomes. A report on this work will appear in Microbiological Reviews in December 1980. Recombinant DNA procedures have been introduced into the experiments and RAD52 (one of the genes involved in recombination and repair damage), has been successfully cloned. This clone will be used to determine the gene product. Diploid cells homozygous for RAD52 have exceptionally high frequencies of mitotic loss of chromosomes. This loss is stimulated by ionizing radiation. This effect is a very significant finding. The effect has also been seen with certain other RAD mutants

  2. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD+-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  3. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  4. ONYCHOMYCOSIS DUE TO YEAST AND YEAST-LIKE FUNGI

    Directory of Open Access Journals (Sweden)

    F. Zaini

    1986-12-01

    Full Text Available Onychomycosis due to the yeast and yeast-like fungi was investigated among the 147 patient who refered to the mycology laboratory of school of public Health during the period of 11 months. The isolated yeasts and yeast-like fungi were examined by API Auxanogram methed. The distribution of isolated microorganisms were C. tropicalis 10(7.4%, C.guillioimondii & (5.9% cases and one case of each of the C.krusei, C.pseudotropicalis, C.rugosa, trichosporon cutaneum, trolopsis maris, Cryptococcus albidus and finaly 3(2.2% cases of candida famata. High incidence of infection was in the patients with 0-15 years of age and most of them were in the groups of 0-4 years. Nail infection among the females were much more frequently than the males and predominant occupation of the women was house duties. The results which obtained from this investigation with the API Auxanogram system is quite satistactory and use of this rapid method for identification of yeasts and yeast-like fungi from the clinical materials of the patients is recommended.

  5. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935. ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  6. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  7. Vaginal Yeast Infections (For Parents)

    Science.gov (United States)

    ... infection caused by a type of fungus called candida albicans . Yeast infections usually happen in warm, moist parts of the ... fungus can grow. Doctors call this candida overgrowth candidiasis (pronounced: can-dih-DYE-uh-sis) Candida can ...

  8. Red Yeast Rice: An Introduction

    Science.gov (United States)

    ... products varies depending on the yeast strains and culture conditions used to manufacture them. The strains and ... supplements should not be used while pregnant or breastfeeding. Lovastatin can interact with a variety of drugs ...

  9. Shuffling Yeast Gene Expression Data

    OpenAIRE

    Bilke, Sven

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent ...

  10. Mucositis Grades and Yeast Species

    OpenAIRE

    Ognjenović, Marina; Milatić, Katja; Parat, Katica; Kovačić, Ivan; Ježina Bušelić, Marina A.; Božić, Joško

    2013-01-01

    Surgically treated patients with oral, head and neck cancer commonly develop mucositis during additional irradiation therapy. Oral mucosa inflammation other than irradiation is mostly caused by Candida albicans, yeast of Candida genus. This study evaluated possible connection between grades of oral mucositis and oral yeast profile in irradiated patients before, during and after irradiation. In 25 examined patients mucosits grades »0« to »2« before irradiation with 20% positive smears and o...

  11. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    Dominika M Wloch-Salamon

    2014-04-01

    Social theory has provided a useful framework for research with microorganisms. Here I describe the advantages and possible risks of using a well-known model organism, the unicellular yeast Saccharomyces cerevisiae, for sociobiological research. I discuss the problems connected with clear classification of yeast behaviour based on the fitness-based Hamilton paradigm. Relevant traits include different types of communities, production of flocculins, invertase and toxins, and the presence of apoptosis.

  12. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  13. Synthetic Yeast Cooperation

    Science.gov (United States)

    Shou, Wenying; Burton, Justin

    2010-03-01

    Cooperation is wide-spread and has been postulated to drive major transitions in evolution. However, Darwinian selection favors ``cheaters'' that consume benefits without paying a fair cost. How did cooperation evolve against the threat of cheaters? To investigate the evolutionary trajectories of cooperation, we created a genetically tractable system that can be observed as it evolves from inception. The system consists of two engineered yeast strains -- a red-fluorescent strain that requires adenine and releases lysine and a yellow-fluorescent strain that requires lysine and releases adenine. Cells that consume but not supply metabolites would be cheaters. From the properties of two cooperating strains, we calculated and experimentally verified the minimal initial cell densities required for the viability of the cooperative system in the absence of exogenously added adenine and lysine. Strikingly, evolved cooperative systems were viable at 100-fold lower initial cell densities than their ancestors. We are investigating the nature and diversity of pro-cooperation changes, the dynamics of cooperator-cheater cocultures, and the effects of spatial environment on cooperation and cheating.

  14. Metabolic regulation of yeast

    Science.gov (United States)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  15. Cryptococcus randhawai sp. nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India.

    Science.gov (United States)

    Khan, Zia U; Ahmad, Suhail; Hagen, Ferry; Fell, Jack W; Kowshik, Tusharantak; Chandy, Rachel; Boekhout, Teun

    2010-03-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region sequences, the isolate belonged to the Cryptococcus albidus cluster (Filobasidiales, Tremellomycetes) and was closely related to Cryptococcus saitoi, Cryptococcus cerealis and Cryptococcus friedmannii with 98% sequence identity. Phenotypically, the species differed from C. saitoi with respect to growth temperature (up to 37degrees C), presence of a thin capsule, ability to grow in the absence of vitamins, and inability to assimilate citrate and ethylamine. With respect to C. friedmannii, it differed in growth temperature, ability to assimilate lactose, raffinose, L: -rhamnose, myo-inositol, and inability to utilize citrate. Furthermore, our isolate also differed from C. cerealis in growth temperature, presence of capsule and inability to assimilate L: -sorbose. In view of the above phenotypic differences and unique rDNA sequences, we consider that our isolate represents a new species of Cryptococcus, and therefore, a new species, Cryptococcus randhawai is proposed for this taxon. The type strain J11/2002 has been deposited in the culture collection of the Centraalbureau voor Schimmelcultures (CBS10160) and CABI Biosciences (IMI 393306). PMID:20091225

  16. Cryptococcus randhawai sp nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India

    NARCIS (Netherlands)

    Khan, Z.U.; Ahmad, S.; Hagen, F.; Fell, J.W.; Kowshik, T.; Chandy, R.; Boekhout, T.

    2010-01-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region seque

  17. Phytochelatin synthase is required for tolerating metal toxicity in a basidiomycete yeast and is a conserved factor involved in metal homeostasis in fungi

    OpenAIRE

    Shine, Alaina M; Shakya, Viplendra PS; Idnurm, Alexander

    2015-01-01

    Background Phytochelatin synthase (PCS) is an enzyme that catalyzes the biosynthesis of phytochelatin from glutathione. Phytochelatins protect cells against the toxic effects of non-essential heavy metals, such as cadmium, and hence growth is restricted in the presence of these metals in mutants in PCS-encoding genes. PCS genes from fungi have been characterized in only two species in the Ascomycota, and these genes are considered sparsely distributed in the fungal kingdom. Results A gene enc...

  18. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  19. Yeast Genetics and Biotechnological Applications

    Science.gov (United States)

    Mishra, Saroj; Baranwal, Richa

    Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

  20. Primary structure of dihydrofolate reductase and mitochondrial ribosomal protein L36 genes from the basidiomycete Coprinus cinereus.

    Science.gov (United States)

    Aimi, Tadanori; Fukuhara, Shoji; Ishiguro, Maki; Kitamoto, Yutaka; Morinaga, Tsutomu

    2004-08-01

    We amplified and sequenced the dihydrofolate reductase (DHFR) gene of the basidiomycete Coprinus cinereus. Downstream of the DHFR coding region, a mitochondrial (mt) ribosomal protein L36 (RPL36) gene was discovered in the opposite orientation to DHFR gene. Putative polyadenylation signals of the two genes overlapped, both containing the 8-bp palindrome 5'-aatatatt-3'. The finding that C. cinereus DHFR gene is closely clustered with a mt protein gene strongly suggests that C. cinereus DHFR is closely related to mt function and evolution. The amino acid sequence of C. cinereus DHFR is most homologous to eukaryotic proteins such as Cryptococcus neoformans and Pneumocystis carinii DHFRs. However, the sequence of C. cinereus mt RPL36 closely resembles RPL36 of bacteria and cyanobacteria such as Synechocystis sp. and Escherichia coli. This result strongly supports the serial endosymbiotic theory of the development of ancestral eukaryotes, and suggests that C. cinereus mt RPL36 gene originated from the ancestral eubacterial genome. PMID:15620217

  1. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  2. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi. PMID:25239747

  3. Kenaf biomass biodecomposition by basidiomycetes and actinobacteria in submerged fermentation for production of carbohydrates and phenolic compounds.

    Science.gov (United States)

    Brzonova, Ivana; Kozliak, Evguenii; Kubátová, Alena; Chebeir, Michelle; Qin, Wensheng; Christopher, Lew; Ji, Yun

    2014-12-01

    The efficiency and dynamics of simultaneous kenaf biomass decomposition by basidiomycetous fungi and actinobacteria were investigated. After 8weeks of incubation, up to 34wt.% of the kenaf biomass was degraded, with the combination of fungi and bacteria being the most efficient. Lignin decomposition accounted for ∼20% of the observed biomass reduction, regardless of the culture used. The remaining 80% of biomass degradation was due to carbohydrate based polymers. Major monosaccharides were produced in tangible yields (26-38%) at different times. Glucose, fructose and xylose were then fully consumed by day 25 while some galactose persisted until day 45. Once monosaccharides were depleted, the production of laccase, manganese-dependent peroxidase and lignin peroxidase enzymes, essential for lignin decomposition, was induced. The products of lignin biodecomposition were shown to be water-soluble and characterized by thermal desorption-pyrolysis-gas chromatography. PMID:25314665

  4. Evidence from Serpula lacrymans that 2,5-dimethoxyhydroquinone Is a lignocellulolytic agent of divergent brown rot basidiomycetes.

    Science.gov (United States)

    Korripally, Premsagar; Timokhin, Vitaliy I; Houtman, Carl J; Mozuch, Michael D; Hammel, Kenneth E

    2013-04-01

    Basidiomycetes that cause brown rot of wood are essential biomass recyclers in coniferous forest ecosystems and a major cause of failure in wooden structures. Recent work indicates that distinct lineages of brown rot fungi have arisen independently from ligninolytic white rot ancestors via loss of lignocellulolytic enzymes. Brown rot thus proceeds without significant lignin removal, apparently beginning instead with oxidative attack on wood polymers by Fenton reagent produced when fungal hydroquinones or catechols reduce Fe(3+) in colonized wood. Since there is little evidence that white rot fungi produce these metabolites, one question is the extent to which independent lineages of brown rot fungi may have evolved different Fe(3+) reductants. Recently, the catechol variegatic acid was proposed to drive Fenton chemistry in Serpula lacrymans, a brown rot member of the Boletales (D. C. Eastwood et al., Science 333:762-765, 2011). We found no variegatic acid in wood undergoing decay by S. lacrymans. We found also that variegatic acid failed to reduce in vitro the Fe(3+) oxalate chelates that predominate in brown-rotting wood and that it did not drive Fenton chemistry in vitro under physiological conditions. Instead, the decaying wood contained physiologically significant levels of 2,5-dimethoxyhydroquinone, a reductant with a demonstrated biodegradative role when wood is attacked by certain brown rot fungi in two other divergent lineages, the Gloeophyllales and Polyporales. Our results suggest that the pathway for 2,5-dimethoxyhydroquinone biosynthesis may have been present in ancestral white rot basidiomycetes but do not rule out the possibility that it appeared multiple times via convergent evolution. PMID:23377930

  5. Polycyclic aromatic hydrocarbons (PAHs) biodegradation by basidiomycetes fungi, Pseudomonas isolate, and their cocultures: comparative in vivo and in silico approach.

    Science.gov (United States)

    Arun, A; Raja, P Praveen; Arthi, R; Ananthi, M; Kumar, K Sathish; Eyini, M

    2008-12-01

    The polycyclic aromatic hydrocarbons (PAHs) biodegradation potential of the five basidiomycetes' fungal monocultures and their cocultures was compared with that of a Pseudomonas isolate recovered from oil-spilled soil. As utilization of hydrocarbons by the microorganisms is associated with biosurfactant production, the level of biosurfactant production and its composition by the selected microorganisms was also investigated. The Pseudomonas isolate showed higher ability to degrade three of the five PAHs but the isolate did not produce biosurfactant higher than C. versicolor and P. ostreatus. Among the PAHs, the most effective biodegradation of PAH--pyrene (42%)--was obtained with the fungus C. versicolor. Cocultures involving the fungi and Pseudomonas could not significantly degrade the selected PAHs compounds above that degraded by the most efficient monoculture. A slight increase in pyrene degradation was observed in cocultures of C. versicolor and F. palustris (93.7% pyrene). The crude biosurfactant was biochemically characterized as a multicomponent surfactant consisting of protein and polysaccharides. The PAH biodegradation potential of the basidiomycetes fungi positively correlated with their potential to express ligninolytic enzymes such as lignin peroxidase (Lip), manganese peroxidase (Mnp), and laccase. The present study utilized in silico method such as protein-ligand docking using the FRED in Open Eye software as a tool to assess the level of ligninolytic enzymes and PAHs interactions. The in silico analysis using FRED revealed that of the five PAHs, maximum interaction occurred between pyrene and all the three ligninolytic enzymes. The results of the in silico analysis corroborated with our experimental results showing that pyrene was degraded to the maximum extent by species such as C. versicolor and P. ostreatus. PMID:18975143

  6. Shuffling Yeast Gene Expression Data

    CERN Document Server

    Bilke, S

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent cell clock is identified. The capability of the algorithm to extract information about signal flow in the regulatory network underlying the expression patterns is demonstrated.

  7. Highly efficient transformation of intact yeast-like conidium cells of Tremella fuciformis by electroporation

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, also called the blastospore by budding. The yeast-like conidia of T. fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. So it is a good recipient cell for exogenous gene expression. In this study, two expression vectors pGlg-gfp containing gpd-Gl promoter and gfp gene and pGlg-hph containing gpd-Gl promoter and hph gene were constructed. The lowest sensitive concentration of hygromycin for the blastospore was determined on three types of media. Our ex- periments showed that the lowest sensitive concentration of hygromycin for the blastospore was 5 μg/mL on MA medium. The intact blastospores were transformed with the expression vector pGlg-hph by electroporation. The putative transformants were obtained by the MA selective medium. Experi- mental results showed that the most effective parameters for the electroporation of intact blastospores were obtained by using STM buffer, 1.0×108 cells/mL of blastospores, 200 μL in transformation volume, 6 μg plasmid, 2.0 kV/cm of electric pulse voltage, stillness culturing on MB liquid medium for 48 h after electroporation. In these transformation conditions, the efficiency reached 277 colonies/μg DNA. Co-transformation of plasmid pGlg-gfp and pGlg-hph with ratio of 1:1 was performed by electroporation with the optimal parameters. The putative co-transformants were obtained by the MA selective medium. Eight randomly selected colonies from the vast putative co-transformants were analyzed by PCR de- tection and Southern blotting. The experiments showed that the gfp was integrated into the genomes of three transformants. The co-transformation efficiency was 37.5%. Green fluorescence was observed under laser scanning confocal microscope in these gfp positive transformants. This indicates that the exogenous gfp can be expressed effectively in the yeast-like conidia of T. fuciformis.

  8. Radiation stimulation of yeast crops for increasing output of alcohol and baker yeasts

    International Nuclear Information System (INIS)

    The purpose of this study was to stimulate by gamma radiation the existing commercial types of yeast so as to obtain yeasts that would better reflect the substrate and have improved reproductive capacity. The experiments were conducted under ordinary conditions using commercial yeasts received from one factory producing alcohol and bakery yeasts and isolated as pure cultures. Irradiating yeast cultures with small doses (up to 10 krad) was found to stimulate the reproduction and fermenting activity of yeast cells as manifested in increased accumulation of yeast biomass and greater yield of ethyl alcohol. (E.T.)

  9. 21 CFR 73.355 - Phaffia yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Phaffia yeast. 73.355 Section 73.355 Food and... ADDITIVES EXEMPT FROM CERTIFICATION Foods § 73.355 Phaffia yeast. (a) Identity. (1) The color additive phaffia yeast consists of the killed, dried cells of a nonpathogenic and nontoxicogenic strain of...

  10. Black yeasts in cold habitats

    NARCIS (Netherlands)

    L. Selbmann; G.S. de Hoog; L. Zucconi; D. Isola; S. Onofri

    2014-01-01

    Black yeasts have already been known since the end of the nineteenth century, but for a number of reasons, only few workers were familiar with them. That was since recently, until the wealth of biodiversity, stunning ecologies and potential applications have become apparent. Some remote and extreme

  11. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  12. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  13. Mycotoxins - prevention and decontamination by yeasts.

    Science.gov (United States)

    Pfliegler, Walter P; Pusztahelyi, Tünde; Pócsi, István

    2015-07-01

    The application of yeasts has great potential in reducing the economic damage caused by toxigenic fungi in the agriculture. Some yeasts may act as biocontrol agents inhibiting the growth of filamentous fungi. These species may also gain importance in the preservation of agricultural products and in the reduction of their mycotoxin contamination, yet the extent of mycotoxin production in the presence of biocontrol agents is relatively less understood. The application of yeasts in various technological processes may have a direct inhibitory effect on the toxin production of certain molds, which is independent of their growth suppressing effect. Furthermore, several yeast species are capable of accumulating mycotoxins from agricultural products, thereby effectively decontaminating them. Probiotic yeasts or products containing yeast cell wall are also applied to counteract mycotoxicosis in livestock. Several yeast strains are also able to degrade toxins to less-toxic or even non-toxic substances. This intensively researched field would greatly benefit from a deeper knowledge on the genetic and molecular basis of toxin degradation. Moreover, yeasts and their biotechnologically important enzymes may exhibit sensitivity to certain mycotoxins, thereby mounting a considerable problem for the biotechnological industry. It is noted that yeasts are generally regarded as safe; however, there are reports of toxin degrading species that may cause human fungal infections. The aspects of yeast-mycotoxin relations with a brief consideration of strain improvement strategies and genetic modification for improved detoxifying properties and/or mycotoxin resistance are reviewed here. PMID:25682759

  14. Combinatorial pathway assembly in yeast

    Directory of Open Access Journals (Sweden)

    Khalil Essani

    2015-10-01

    Full Text Available With the emergence of synthetic biology and the vast knowledge about individual biocatalytic reactions, the challenge nowadays is to implement whole natural or synthetic pathways into microorganisms. For this purpose balanced enzyme activities throughout the pathway need to be achieved in addition to simple functional gene expression to avoid bottlenecks and to obtain high titers of the desired product. As the optimization of pathways in a specific biological context is often hard to achieve by rational design, combinatorial approaches have been developed to address this issue. Here, current strategies and proof of concepts for combinatorial pathway assembly in yeasts are reviewed. By exploiting its ability to join multiple DNA fragments in a very efficient and easy manner, the yeast Saccharomyces cerevisiae does not only constitute an attractive host for heterologous pathway expression, but also for assembling pathways by recombination in vivo.

  15. Nuclear Import of Yeast Proteasomes

    Directory of Open Access Journals (Sweden)

    Julianne Burcoglu

    2015-08-01

    Full Text Available Proteasomes are highly conserved protease complexes responsible for the degradation of aberrant and short-lived proteins. In highly proliferating yeast and mammalian cells, proteasomes are predominantly nuclear. During quiescence and cell cycle arrest, proteasomes accumulate in granules in close proximity to the nuclear envelope/ER. With prolonged quiescence in yeast, these proteasome granules pinch off as membraneless organelles, and migrate as stable entities through the cytoplasm. Upon exit from quiescence, the proteasome granules clear and the proteasomes are rapidly transported into the nucleus, a process reflecting the dynamic nature of these multisubunit complexes. Due to the scarcity of studies on the nuclear transport of mammalian proteasomes, we summarised the current knowledge on the nuclear import of yeast proteasomes. This pathway uses canonical nuclear localisation signals within proteasomal subunits and Srp1/Kap95, and the canonical import receptor, named importin/karyopherin αβ. Blm10, a conserved 240 kDa protein, which is structurally related to Kap95, provides an alternative import pathway. Two models exist upon which either inactive precursor complexes or active holo-enzymes serve as the import cargo. Here, we reconcile both models and suggest that the import of inactive precursor complexes predominates in dividing cells, while the import of mature enzymes mainly occurs upon exit from quiescence.

  16. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  17. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  18. Biological characteristics of teleomorph and optimized in vitro fruiting conditions of the Hoelen medicinal mushroom, Wolfiporia extensa (Higher Basidiomycetes).

    Science.gov (United States)

    Xu, Zhangyi; Meng, Hu; Xiong, Huan; Bian, Yinbing

    2014-01-01

    Wolfiporia extensa is a basidiomycetous brown rot fungus and is of well-known medicinal import in China, Japan, and other Asiatic countries. Fruiting body induction is of major relevance for basic biological research and for their use in industrial applications. Based on the evaluation of the effects of temperature, time in the dark before induction and culture, and wounding treatment on fruiting, this report describes the most efficient protocol for inducing fruiting of W. extensa growing on agar plates. Furthermore, several biological characteristics of teleomorph, such as the locations of hymenium, the configuration of basidiospores and primary mycelia, and events involved in basidiosporogenesis in W. extensa, were analyzed for the first time using fluorescence microscopy. The results showed that the hymenium born on both sides of the wall of the honeycomb-like structure on the surface of fruiting bodies and the hymenophoral trama situated in the middle. Each basidia has 4 binuclear basidiospores, and the primary mycelia are multinucleate without clamp connections. These results broaden our knowledge about this brown rot fungus and promote further studies of the sexual reproduction, fruiting body development, and advancement of breeding program, new topics related to the contents of pharmacologically active substances in W. extensa fruiting bodies. PMID:25271978

  19. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities. PMID:26616098

  20. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process. PMID:26797957

  1. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Siabatto F. Helbert David

    2005-12-01

    Full Text Available Se realizó la colección de especímenes jóvenes de Basidiomycetes en el páramo de Ocetá, ubicado en el municipio de Monguí, Boyacá, Colombia. Con el fin de crear un inventario de cada morfoespecie colectada, se realizó una descripción macroscópica, microscópica y pruebas químicas con
    el fin de obtener los principales taxones. Se encontraron 11 géneros: Gomphydus, Chroogomphus, Paneolus, Macrolepiota, Tricholoma, Lentinellus, Crepidotus, Amanita, Polyborus, Lycoperdon y Tubaria, pertenecientes a diez familias: Gomphidiaceae, Coprinaceae, Agaricaceae, Tricholomataceae, Pleurotaceae, Crepidotaceae, Amanitaceae, Poliporaceae, Lycoperdaceae y Entolomalaceae; distribuidas éstas en cuatro
    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  2. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  3. Yeast Interacting Proteins Database: YEL005C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available endosome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with th...protein localizes to the endosome; identified as a transcriptional activator in a high-throughput yeast one-

  4. Revaluation of Waste Yeast from Beer Production

    OpenAIRE

    Nicoleta Suruceanu; Sonia Socaci; Teodora Coldea; Elena Mudura

    2013-01-01

    Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, ident...

  5. The Application of Enzyme and Yeast

    OpenAIRE

    Zhao, Qing

    2012-01-01

    This bachelor’s thesis concerns the application of enzymes and yeasts for bio-industry. The purpose of this work is to understand the basic knowledge about enzyme and yeast, and meanwhile, to find out their different applications. Through comprehensive study, the knowledge was accumulated which brought a clear understanding for the enzyme structure and yeast microorganism, together with their working principles for the bioprocess. For wood-based industry, the different enzymes used in bi...

  6. Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

    OpenAIRE

    Stamps, Judy A.; Yang, Louie H; Morales, Vanessa M.; Boundy-Mills, Kyria L.

    2012-01-01

    Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast densit...

  7. OPTIMIZATION OF YEAST FOR ETHANOL PRODUCTION

    Directory of Open Access Journals (Sweden)

    Taghizadeh Ghassem

    2012-02-01

    Full Text Available The production of pure ethanol apparently begins in the 12-14th century. Improvements in the distillation process with the condensation of vapors of lower boiling liquids. Ethanol is produced commercially by chemical synthesis or biosynthesis. High ethanol producing yeast exhibits rapid metabolic activity and a high fermentation rate with high product output in less time.Yeasts were isolated from Corn, Curd, Grapes, Water 1, Water 2, and Paneer. Isolation was done on MGYP (Malt Extract Glucose Yeast extract Peptone media. Contamination was less in selected media. Grape sample yeast was observed as high in producing ethanol after optimization in jaggery broth. Curd yeast gives 4.6% alcohol by volume alcohol (a.b.v after fermentation .Paneer yeast gives 2.88% alcohol by volume alcohol (a.b.v after fermentation. Corn yeast gives 5.25% (a.b.v alcohol after fermentation Water-1 yeast gives 5.51% (a.b.v alcohol after fermentation.Water-2 yeast gives 4.98% (a.b.v alcohol after fermentation.

  8. Construction of Killer Wine Yeast Strain

    OpenAIRE

    Seki, Tetsuji; Choi, Eon-Ho; Ryu, Dewey

    1985-01-01

    A double-stranded RNA plasmid which confers the superkiller phenotype was transferred into a wine yeast (Montrachet strain 522) and its leucine-requiring derivative (strain 694) by cytoduction, using the protoplast fusion technique. The killer wine yeast constructed completely suppressed the growth of killer-sensitive strains of Saccharomyces cerevisiae in yeast extract-peptone-glucose medium at pH 4.5, whereas the killer effect was somewhat decreased at pH 3.5. The wine yeast harboring the k...

  9. Cryopreservation of Filamentous Micromycetes and Yeasts Using Perlite

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Kubátová, A.; Váňová, M.; Janderová, B.; Nerud, František

    2007-01-01

    Roč. 51, č. 2 (2007), s. 153-157. ISSN 0015-5632 R&D Projects: GA MŠk(CZ) 0021620828 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje Keywords : cryopreservation * perlite * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  10. YMDB: the Yeast Metabolome Database.

    Science.gov (United States)

    Jewison, Timothy; Knox, Craig; Neveu, Vanessa; Djoumbou, Yannick; Guo, An Chi; Lee, Jacqueline; Liu, Philip; Mandal, Rupasri; Krishnamurthy, Ram; Sinelnikov, Igor; Wilson, Michael; Wishart, David S

    2012-01-01

    The Yeast Metabolome Database (YMDB, http://www.ymdb.ca) is a richly annotated 'metabolomic' database containing detailed information about the metabolome of Saccharomyces cerevisiae. Modeled closely after the Human Metabolome Database, the YMDB contains >2000 metabolites with links to 995 different genes/proteins, including enzymes and transporters. The information in YMDB has been gathered from hundreds of books, journal articles and electronic databases. In addition to its comprehensive literature-derived data, the YMDB also contains an extensive collection of experimental intracellular and extracellular metabolite concentration data compiled from detailed Mass Spectrometry (MS) and Nuclear Magnetic Resonance (NMR) metabolomic analyses performed in our lab. This is further supplemented with thousands of NMR and MS spectra collected on pure, reference yeast metabolites. Each metabolite entry in the YMDB contains an average of 80 separate data fields including comprehensive compound description, names and synonyms, structural information, physico-chemical data, reference NMR and MS spectra, intracellular/extracellular concentrations, growth conditions and substrates, pathway information, enzyme data, gene/protein sequence data, as well as numerous hyperlinks to images, references and other public databases. Extensive searching, relational querying and data browsing tools are also provided that support text, chemical structure, spectral, molecular weight and gene/protein sequence queries. Because of S. cervesiae's importance as a model organism for biologists and as a biofactory for industry, we believe this kind of database could have considerable appeal not only to metabolomics researchers, but also to yeast biologists, systems biologists, the industrial fermentation industry, as well as the beer, wine and spirit industry. PMID:22064855

  11. Hydrogen Peroxide Metabolism in Yeasts

    OpenAIRE

    Verduyn, C; Giuseppin, M L; Scheffers, W A; van Dijken, J P

    1988-01-01

    A catalase-negative mutant of the yeast Hansenula polymorpha consumed methanol in the presence of glucose when the organism was grown in carbon-limited chemostat cultures. The organism was apparently able to decompose the H2O2 generated in the oxidation of methanol by alcohol oxidase. Not only H2O2 generated intracellularly but also H2O2 added extracellularly was effectively destroyed by the catalase-negative mutant. From the rate of H2O2 consumption during growth in chemostat cultures on mix...

  12. NetPhosYeast: prediction of protein phosphorylation sites in yeast

    DEFF Research Database (Denmark)

    Ingrell, C.R.; Miller, Martin Lee; Jensen, O.N.; Blom, Nikolaj

    2007-01-01

    We here present a neural network-based method for the prediction of protein phosphorylation sites in yeast-an important model organism for basic research. Existing protein phosphorylation site predictors are primarily based on mammalian data and show reduced sensitivity on yeast phosphorylation...... sites compared to those in humans, suggesting the need for an yeast-specific phosphorylation site predictor. NetPhosYeast achieves a correlation coefficient close to 0.75 with a sensitivity of 0.84 and specificity of 0.90 and outperforms existing predictors in the identification of phosphorylation sites...... in yeast....

  13. Inonotus rickii (Pat.) Reid: an important legnicolous basidiomycete in urban trees Inonotus rickii (Pat.) Reid: um importante basidomiceta lenhícola em árvores urbanas

    OpenAIRE

    Ana Paula Ramos; Maria Filomena Caetano; Ireneia Melo

    2008-01-01

    Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of heartwood. In some cases, chlamy...

  14. Purification and characterization of a novel detergent- and organic solvent-resistant endo-beta-1,4-glucanase from a newly isolated basidiomycete Peniophora sp. NDVN01

    OpenAIRE

    TRINH, Dinh Kha; Quyen, Dinh Thi; Do, Thi Tuyen; Nghiem, Ngoc Minh

    2013-01-01

    A novel extracellular endoglucanase from a basidiomycete strain Peniophora sp. NDVN01 was purified 2.8-fold to homogeneity through ammonium sulfate precipitation and gel filtration with Bio-Gel P-100 and Sephadex G-75. The endoglucanase had a specific activity of 163.8 U/mg protein and a molecular mass of 32 kDa. Optimum temperature and pH were at 60 °C and 4.5, respectively. The enzyme was stable at up to 42 °C and in the pH range of 3.5-5.5 with a residual activity of over 80% for 24 h of t...

  15. Biological repair of Pichia Pinus yeasts

    International Nuclear Information System (INIS)

    The effectiveness of liquid-holding recovery of Pichia pinus yeast after γ- and α-irradiation was determined. Haploid cells are not capable of recovery involved. Nonreparable component of diploid yeast recovery is 0.7 after γ-irradiation and 0.8 after α-irradiation

  16. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  17. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Science.gov (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) region and fungal internal transcribed spacer 2 (ITS2) region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity. PMID:25884708

  18. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied. PMID:26330322

  19. Evaluation of different lignocellulosic substrates for the production of cellulases and xylanases by the basidiomycete fungi Bjerkandera adusta and Pycnoporus sanguineus.

    Science.gov (United States)

    Quiroz-Castañeda, Rosa Estela; Pérez-Mejía, Nancy; Martínez-Anaya, Claudia; Acosta-Urdapilleta, Lourdes; Folch-Mallol, Jorge

    2011-06-01

    Agricultural waste products are potential resources for the production of a number of industrial compounds, including biofuels. Basidiomycete fungi display a battery of hydrolytic enzymes with prospective use in lignocellulosic biomass transformation, however little work has been done regarding the characterization of such activities. Growth in several lignocellulosic substrates (oak and cedar sawdust, rice husk, corn stubble, wheat straw and Jatropha seed husk) and the production of cellulases and xylanases by two basidiomycete fungi: Bjerkandera adusta and Pycnoporus sanguineus were analyzed. Growth for P. sanguineus was best in rice husk while corn stubble supported the highest growth rate for B. adusta. Among the substrates tested, cedar sawdust produced the highest cellulolytic activities in both fungal species, followed by oak sawdust and wheat straw. Xylanolytic activity was best in oak and cedar sawdust for both species. We found no correlation between growth and enzyme production. Zymogram analysis of xylanases and cellulases showed that growth in different substrates produced particular combinations of protein bands with hydrolytic activity. PMID:20963471

  20. Accelerating Yeast Prion Biology using Droplet Microfluidics

    Science.gov (United States)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  1. Overview of fission yeast septation.

    Science.gov (United States)

    Pérez, Pilar; Cortés, Juan C G; Martín-García, Rebeca; Ribas, Juan C

    2016-09-01

    Cytokinesis is the final process of the vegetative cycle, which divides a cell into two independent daughter cells once mitosis is completed. In fungi, as in animal cells, cytokinesis requires the formation of a cleavage furrow originated by constriction of an actomyosin ring which is connected to the plasma membrane and causes its invagination. Additionally, because fungal cells have a polysaccharide cell wall outside the plasma membrane, cytokinesis requires the formation of a septum coincident with the membrane ingression. Fission yeast Schizosaccharomyces pombe is a unicellular, rod-shaped fungus that has become a popular model organism for the study of actomyosin ring formation and constriction during cell division. Here we review the current knowledge of the septation and separation processes in this fungus, as well as recent advances in understanding the functional interaction between the transmembrane enzymes that build the septum and the actomyosin ring proteins. PMID:27155541

  2. Modeling competition between yeast strains

    Science.gov (United States)

    de Gee, Maarten; van Mourik, Hilda; de Visser, Arjan; Molenaar, Jaap

    2016-04-01

    We investigate toxin interference competition between S. cerevisiae colonies grown on a solid medium. In vivo experiments show that the outcome of this competition depends strongly on nutrient availability and cell densities. Here we present a new model for S. cerevisiae colonies, calculating the local height and composition of the colonies. The model simulates yeast colonies that show a good fit to experimental data. Simulations of colonies that start out with a homogeneous mixture of toxin producing and toxin sensitive cells can display remarkable pattern formation, depending on the initial ratio of the strains. Simulations in which the toxin producing and toxin sensitive species start at nearby positions clearly show that toxin production is advantageous.

  3. 21 CFR 184.1983 - Bakers yeast extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b)...

  4. 21 CFR 172.898 - Bakers yeast glycan.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast glycan. 172.898 Section 172.898 Food... Multipurpose Additives § 172.898 Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized,...

  5. 21 CFR 172.325 - Bakers yeast protein.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast protein. 172.325 Section 172.325 Food... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be safely used in food in accordance with the following conditions: (a) Bakers yeast protein is...

  6. Biofuels. Altered sterol composition renders yeast thermotolerant

    DEFF Research Database (Denmark)

    Caspeta, Luis; Chen, Yun; Ghiaci, Payam;

    2014-01-01

    Ethanol production for use as a biofuel is mainly achieved through simultaneous saccharification and fermentation by yeast. Operating at ≥40°C would be beneficial in terms of increasing efficiency of the process and reducing costs, but yeast does not grow efficiently at those temperatures. We used...... adaptive laboratory evolution to select yeast strains with improved growth and ethanol production at ≥40°C. Sequencing of the whole genome, genome-wide gene expression, and metabolic-flux analyses revealed a change in sterol composition, from ergosterol to fecosterol, caused by mutations in the C-5 sterol...

  7. Yeast Exocytic v-SNAREs Confer Endocytosis

    OpenAIRE

    Gurunathan, Sangiliyandi; Chapman-Shimshoni, Daphne; Trajkovic, Selena; Gerst, Jeffrey E.

    2000-01-01

    In yeast, homologues of the synaptobrevin/VAMP family of v-SNAREs (Snc1 and Snc2) confer the docking and fusion of secretory vesicles at the cell surface. As no v-SNARE has been shown to confer endocytosis, we examined whether yeast lacking the SNC genes, or possessing a temperature-sensitive allele of SNC1 (SNC1ala43), are deficient in the endocytic uptake of components from the cell surface. We found that both SNC and temperature-shifted SNC1ala43 yeast are d...

  8. Yeast cell factories on the horizon

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2015-01-01

    For thousands of years, yeast has been used for making beer, bread, and wine. In modern times, it has become a commercial workhorse for producing fuels, chemicals, and pharmaceuticals such as insulin, human serum albumin, and vaccines against hepatitis virus and human papillomavirus. Yeast has also...... been engineered to make chemicals at industrial scale (e.g., succinic acid, lactic acid, resveratrol) and advanced biofuels (e.g., isobutanol) (1). On page 1095 of this issue, Galanie et al. (2) demonstrate that yeast can now be engineered to produce opioids (2), a major class of compounds used for...

  9. Immobilization of yeast cells by radiation-induced polymerization

    International Nuclear Information System (INIS)

    Radiation-induced polymerization method was applied to the immobilization of yeast cells. The effects of irradiation, cooling and monomer, which are neccessary for polymerization, were recovered completely by subsequent aerobical incubation of yeast cells. The ethanol productive in immobilized yeast cells increased with the increase of aerobical incubation period. The growth of yeast cells in immobilized yeast cells was indicated. The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. (orig.)

  10. YeastWeb: a workset-centric web resource for gene family analysis in yeast

    Directory of Open Access Journals (Sweden)

    Bao Haihua

    2010-07-01

    Full Text Available Abstract Background Currently, a number of yeast genomes with different physiological features have been sequenced and annotated, which provides invaluable information to investigate yeast genetics, evolutionary mechanism, structure and function of gene families. Description YeastWeb is a novel database created to provide access to gene families derived from the available yeast genomes by assigning the genes into putative families. It has many useful features that complement existing databases, such as SGD, CYGD and Génolevures: 1 Detailed computational annotation was conducted with each entry with InterProScan, EMBOSS and functional/pathway databases, such as GO, COG and KEGG; 2 A well established user-friendly environment was created to allow users to retrieve the annotated genes and gene families using functional classification browser, keyword search or similarity-based search; 3 Workset offers users many powerful functions to manage the retrieved data efficiently, associate the individual items easily and save the intermediate results conveniently; 4 A series of comparative genomics and molecular evolution analysis tools are neatly implemented to allow users to view multiple sequence alignments and phylogenetic tree of gene families. At present, YeastWeb holds the gene families clustered from various MCL inflation values from a total of 13 available yeast genomes. Conclusions Given the great interest in yeast research, YeastWeb has the potential to become a useful resource for the scientific community of yeast biologists and related researchers investigating the evolutionary relationship of yeast gene families. YeastWeb is available at http://centre.bioinformatics.zj.cn/Yeast/.

  11. De Novo Biosynthesis of Vanillin in Fission Yeast (Schizosaccharomyces pombe) and Baker's Yeast (Saccharomyces cerevisiae) ▿

    OpenAIRE

    Hansen, Esben H.; Møller, Birger Lindberg; Kock, Gertrud R.; Bünner, Camilla M.; Kristensen, Charlotte; Jensen, Ole R.; Okkels, Finn T.; Olsen, Carl E.; Motawia, Mohammed S.; Hansen, Jørgen

    2009-01-01

    Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast...

  12. Enzyme contribution of non-Saccharomyces yeasts to wine production

    OpenAIRE

    Maicas i Prieto, Sergi; Mateo Tolosa, José Juan

    2015-01-01

    The fermentation of grape must to produce wine is a biologically complex process, carried on by yeasts and malolactic bacteria. The yeasts present in spontaneous fermentation may be divided into two groups, the Saccharomyces yeasts, particularly S. cerevisiae, and the non-Saccharomyces yeasts which include members of the genera Rhodotorula, Pichia, Candida, Debaryomyces, Metschtnikowia, Hansenula and Hanseniaspora. S. cerevisiae yeasts are able to convert sugar into ethanol and CO2 via fermen...

  13. Production Of Extracellular Enzymes By Some Soil Yeasts

    OpenAIRE

    Falih, A. M. [عبد الله مساعد خلف الفالح

    1997-01-01

    This study investigated the ability of soil yeasts, Geotrichum candidum, Geotrichum capitatum and Williopsis californica to produce extracellular enzymes (amylase, cellulase and protease) in vitro compared with that of a laboratory strain of Saccharomyces cerevisiae. It appears that the soil yeasts studied here were less amylolytic yeasts except the yeast G. candidum, which was highly effective at extracellular amylase production. The soil yeast W. californica was an average producer of cellu...

  14. DETERMINATION OF KILLER CHARACTER OF WINE YEAST ISOLATED FROM ISTRA

    OpenAIRE

    Sandi ORLIC; POGAČIĆ, Martina; Ana JEROMEL; Marko KAROGLAN; Kozina, Bernard; IACUMIN, Lucilla; Redžepović, Sulejman

    2008-01-01

    Wild wine yeasts with killer phenotype are widespread in many wine regions of the world. The presence of killer yeasts may become particularly important in wine fermentations conducted by inoculation with selected strains of Saccharomyces cerevisiae. Wild killer yeasts may suppress selected sensitive yeasts inoculated into the must during the fermentation. The goal of this investigation was to identify killer yeast in Istra region using physiological and molecular methods. In total 50 S.cerev...

  15. Regulatory aspects of methanol metabolism in yeasts

    International Nuclear Information System (INIS)

    Formaldehyde is the first and key intermediate in the metabolism of methylotrophic yeasts since it stands at a branch point of pathways for methanol oxidation and assimilation. Methanol and, formaldehyde are toxic compounds which severely affect the growth rate, yield coefficient, etc., of yeasts. Two questions arise when considering regulation of methanol metabolism in yeasts how a nontoxic level of formaldehyde is maintained in the cell and how the formaldehyde flow is distributed into oxidation and assimilation. To answer these questions we studied the role of GSH, which spontaneously binds formaldehyde, yielding S-hydroxymethylglutathione; in vivo rates of formaldehyde dissimilation and assimilation by using [14C]methanol; profiles of enzymes responsible for production and utilization of formaldehyde; and levels of metabolites affecting dissimilation and assimilation of formaldehyde. All of the experiments were carried out with the methylotrophic yeast Candida boidinii KD1. 19 refs., 4 figs., 1 tab

  16. ENGINEERING THE BIOSYNTHESIS OF STYRENE IN YEAST

    Science.gov (United States)

    The strategy pursued was to insert genes for phenylalanine ammonia lysase (pal) and phenolic acid decarboxylase (pad) into the yeast that would convert phenylalanine to styrene through a cinnamic acid intermediate. Comet assay on tetraploid yeast cells

    DEFF Research Database (Denmark)

    Rank, Jette; Syberg, Kristian; Jensen, Klara

    2009-01-01

    Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from...... three municipal treatment plants were tested for their effect on the yeast-cell DNA. The main problem with using yeast in the comet assay is the necessity to degrade the cell wall. This was achieved by using Zymolase 100 T twice during the procedure, since Zymolase 20 T did not open the cell wall...... causing significant DNA damage was 20 μM for H2O2 and 200 mg/l for acrylamide. Tertiary-treated wastewater from the outlets of three municipal wastewater-treatment plants was tested, but did not cause DNA damage. Even though it is possible to produce comets with tetraploid yeast cells, the amount of DNA...

  17. Adenosine triphosphate inhibition of yeast trehalase.

    Science.gov (United States)

    Panek, A D

    1969-09-01

    Yeast trehalase has been found to be inhibited non-competitively by adenosine triphosphate. Such a biological control could explain the accumulation of trehalose during the stationary phase of the growth curve. PMID:5370287

  18. Genomic Evolution of the Ascomycete Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.

  19. Physiological and environmental control of yeast prions

    OpenAIRE

    Chernova, Tatiana A.; Wilkinson, Keith D.; Chernoff, Yury O.

    2013-01-01

    Prions are self-perpetuating protein isoforms that cause fatal and incurable neurodegenerative disease in mammals. Recent evidence indicates that a majority of human proteins involved in amyloid and neural inclusion disorders possess at least some prion properties. In lower eukaryotes, such as yeast, prions act as epigenetic elements, which increase phenotypic diversity by altering a range of cellular processes. While some yeast prions are clearly pathogenic, it is also postulated that prion ...

  1. Production of biopharmaceutical proteins by yeast

    OpenAIRE

    Nielsen, Jens

    2012-01-01

    Production of recombinant proteins for use as pharmaceuticals, so-called biopharmaceuticals, is a multi-billion dollar industry. Many different cell factories are used for the production of biopharmaceuticals, but the yeast Saccharomyces cerevisiae is an important cell factory as it is used for production of several large volume products. Insulin and insulin analogs are by far the dominating biopharmaceuticals produced by yeast, and this will increase as the global insulin market is expected ...

  2. Mapping the functional yeast ABC transporter interactome

    OpenAIRE

    Snider, Jamie; Hanif, Asad; Lee, Mid Eum; Jin, Ke; Yu, Analyn R.; Graham, Chris; Chuk, Matthew; Damjanovic, Dunja; Wierzbicka, Marta; Tang, Priscilla; Balderes, Dina; Wong, Victoria; Jessulat, Matthew; Darowski, Katelyn D.; Luis, Bryan-Joseph San

    2013-01-01

    ABC transporters are a ubiquitous class of integral membrane proteins of immense clinical interest because of their strong association with human disease and pharmacology. To improve our understanding of these proteins, we used Membrane Yeast Two-Hybrid (MYTH) technology to map the protein interactome of all non-mitochondrial ABC transporters in the model organism Saccharomy cescerevisiae, and combined this data with previously reported yeast ABC transporter interactions in the BioGRID databa...

  3. OPTIMIZATION OF YEAST FOR ETHANOL PRODUCTION

    OpenAIRE

    Taghizadeh Ghassem; Delbari Azam Sadat; Kulkarni D. K.

    2012-01-01

    The production of pure ethanol apparently begins in the 12-14th century. Improvements in the distillation process with the condensation of vapors of lower boiling liquids. Ethanol is produced commercially by chemical synthesis or biosynthesis. High ethanol producing yeast exhibits rapid metabolic activity and a high fermentation rate with high product output in less time.Yeasts were isolated from Corn, Curd, Grapes, Water 1, Water 2, and Paneer. Isolation was done on MGYP (Malt Extract Glucos...

  4. Stationary phase in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Werner-Washburne, M; Braun, E.; Johnston, G C; Singer, R A

    1993-01-01

    Growth and proliferation of microorganisms such as the yeast Saccharomyces cerevisiae are controlled in part by the availability of nutrients. When proliferating yeast cells exhaust available nutrients, they enter a stationary phase characterized by cell cycle arrest and specific physiological, biochemical, and morphological changes. These changes include thickening of the cell wall, accumulation of reserve carbohydrates, and acquisition of thermotolerance. Recent characterization of mutant c...

  5. Principles of chromosomal organization: lessons from yeast

    OpenAIRE

    Zimmer, Christophe; Fabre, Emmanuelle

    2011-01-01

    The spatial organization of genes and chromosomes plays an important role in the regulation of several DNA processes. However, the principles and forces underlying this nonrandom organization are mostly unknown. Despite its small dimension, and thanks to new imaging and biochemical techniques, studies of the budding yeast nucleus have led to significant insights into chromosome arrangement and dynamics. The dynamic organization of the yeast genome during interphase argues for both the physica...

  6. Multidrug resistant yeasts in synanthropic wild birds

    Directory of Open Access Journals (Sweden)

    Somanath Sushela

    2010-03-01

    Full Text Available Abstract Background The aim of this study was to investigate the presence of multidrug resistant yeasts in the faeces of synanthropic wild birds from the Bangsar suburb of Kuala Lumpur. Methods Species characterisations of yeast isolates and determinations of antimycotic susceptibility profiles were undertaken using the commercial characterization kit, Integral System Yeasts Plus (Liofilchem, Italy. Results Fourteen species of yeasts were detected in the bird faecal samples.Candida albicans was present in 28.89% of bird faecal samples, Candida krusei (13.33%, Candida tropicalis (4.44%, Candida glabrata (4.44%, Candida parapsilosis (2.22%, Candida lambica (2.22%, Candida stellatoidea (2.22%, Candida rugosa (2.22% and Candida lusitaniae (2.22%. Amongst the non-candidal yeast isolates, Cryptococcus laurentii was present in 6.67% of bird faecal samples, Cryptococcus uniguttulatus (4.44%, Saccharomyces cerevisiae (4.44%, Trichosporon pullulans (2.22%, Trichosporon pullulans/Cryptococcus albidus (8.89% and Rhodotorula rubra/Rhodotorula glutinis (4.44%. Of the isolated yeasts, 18.1% (or 26/144 were found to be resistant to all 11 antimycotic agents they were tested against i.e. Nystatin, Amphotericin B, Flucytosine, Econazole, Ketoconazole, Clotrimazole, Miconazole, Itraconazole, Voriconazole, Fluconazole 16 and Fluconazole 64. 45.8% (or 66/144 of the bird faecal yeast isolates were resistant to four or more of the 11 antimycotic agents they were tested against. Conclusions This finding is of public health significance as these synanthropic wild birds may be reservoirs for transmission of drug resistant yeast infections to humans.

  7. Laboratory evolution of copper tolerant yeast strains

    OpenAIRE

    Adamo Giusy; Brocca Stefania; Passolunghi Simone; Salvato Benedetto; Lotti Marina

    2012-01-01

    Abstract Background Yeast strains endowed with robustness towards copper and/or enriched in intracellular Cu might find application in biotechnology processes, among others in the production of functional foods. Moreover, they can contribute to the study of human diseases related to impairments of copper metabolism. In this study, we investigated the molecular and physiological factors that confer copper tolerance to strains of baker's yeasts. Results We characterized the effects elicited in ...

  8. Uniform yeast cell assembly via microfluidics

    OpenAIRE

    Chang, Ya-Wen; He, Peng; Marquez, Samantha M.; Cheng, Zhengdong

    2012-01-01

    This paper reports the use of microfluidic approaches for the fabrication of yeastosomes (yeast-celloidosomes) based on self-assembly of yeast cells onto liquid-solid or liquid-gas interfaces. Precise control over fluidic flows in droplet- and bubble-forming microfluidic devices allows production of monodispersed, size-selected templates. The general strategy to organize and assemble living cells is to tune electrostatic attractions between the template (gel or gas core) and the cells via sur...

  9. EXPLORING BIODIVERSITY POTENTIAL OF WINE ASSOCIATED YEASTS

    OpenAIRE

    Dashko, Sofia

    2015-01-01

    Human exploitation of yeast fermentation dates back to the Neolithic. S. cerevisiae has been the most important yeast used for numerous fermentations of biotechnological interest, including grape fermentation for wine production. Despite its abundant use, the molecular mechanisms controlling alcoholic fermentation are rather unclear and the choice of S. cerevisiae as an inoculum is often the consequence of a mere habit, rather than the result of rational analyses. In this work we focused o...

  10. Featured Organism: Schizosaccharomyces pombe, The Fission Yeast

    OpenAIRE

    Jo Wixon

    2002-01-01

    Schizosaccharomyces pombe, the fission yeast, has long been a crucial model for the study of the eukaryote cell cycle. We take a look at this important yeast, whose genome has recently been completed, featuring comments from Valerie Wood, Jürg Bähler, Ramsay McFarlane, Susan Forsburg, Iain Hagan and Paul Nurse on the implications of having the complete sequence and future prospects for pombe genomics.

  11. Determination of tritium in wine yeast samples

    International Nuclear Information System (INIS)

    Analytical procedures were developed to determine tritium in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractioning distillation for wine samples and azeotropic distillation/fractional distillation for wine yeast samples. Finally, the water samples were normally distilled with K MO4. The established procedures were successfully applied for wine and wine samples from Murfatlar harvests of the years 1995 and 1996. (authors)

  12. The wine and beer yeast Dekkera bruxellensis

    OpenAIRE

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P.; Piškur, Jure

    2014-01-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beer...

  13. Flor Yeast: New Perspectives Beyond Wine Aging.

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C; Mannazzu, Ilaria; Coi, Anna L; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air-liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  14. Revaluation of Waste Yeast from Beer Production

    Directory of Open Access Journals (Sweden)

    Nicoleta Suruceanu

    2013-11-01

    Full Text Available Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, identification and quantification of xanthohumol by HPLC method. Waste yeast from brewery pilot plant of USAMV Cluj Napoca it was dried by atomization and the powder was analyzed on xanthohumol content by HPLC method. For quantification a calibration curve it was used. The process of drying by atomisation lead to a powder product. It was used malt dextrin powder for stabilisation. The final product it was encapsulated. The xanthohumol content of powdered yeast it was 1.94 µg/ml. In conclusion the slurry yeast from beer production it is an important source of prenylflavonoids compounds.

  15. Flor Yeast: New Perspectives Beyond Wine Aging

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  16. Spermidine cures yeast of prions

    Directory of Open Access Journals (Sweden)

    Shaun H. Speldewinde

    2015-12-01

    Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN­+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.

  17. The yeasts and yeast-like microorganisms in the denitrification unit biocenosis

    Directory of Open Access Journals (Sweden)

    Alena Sláviková

    2014-08-01

    Full Text Available Taxonomic studies of the yeasts and yeast-like microorganisms in the denitrification unit biocenosis were carried out. A set of 13 strains of these microorganisms were examined for their morphological and physiological characters. Considering their special features and some relation to the known species, the isolated microorganisms were classified to the 3 genera: Candida, Geotrichium and Hansenula.

  18. Taxonomical study of yeasts and yeast-like microorganisms isolated from the denitrification unit biocenosis

    Directory of Open Access Journals (Sweden)

    Elena Sláviková

    2014-08-01

    Full Text Available A set of 8 strains of yeasts and yeast-like microorganisms was isolated from the denitrification unit biocenosis fed with a synthetic medium containing methanol as a carbon source. These strains were identified as Candida boidinii, C. maltosa, Rhodotorula rubra and Trichosporon cutaneum.

  19. Taxonomical study of yeasts and yeast-like microorganisms isolated from the denitrification unit biocenosis

    OpenAIRE

    Elena Sláviková; Anna Grabińska-Łoniewska

    2014-01-01

    A set of 8 strains of yeasts and yeast-like microorganisms was isolated from the denitrification unit biocenosis fed with a synthetic medium containing methanol as a carbon source. These strains were identified as Candida boidinii, C. maltosa, Rhodotorula rubra and Trichosporon cutaneum.

  20. Boolean model of Yeast Apoptosis as a tool to study yeast and human apoptotic regulations

    Directory of Open Access Journals (Sweden)

    MarijaCvijovic

    2012-12-01

    Full Text Available Programmed cell death (PCD is an essential cellular mechanism that is evolutionary conserved, mediated through various pathways and acts by integrating different stimuli. Many diseases such as neurodegenerative diseases and cancers are found to be caused by, or associated with, regulations in the cell death pathways. Yeast Saccharomyces cerevisiae, is a unicellular eukaryotic organism that shares with human cells components and pathways of the PCD and is therefore used as a model organism. Boolean modelling is becoming promising approach to capture qualitative behaviour and describe essential properties of such complex networks. Here we present large literature-based and to our knowledge first Boolean model that combines pathways leading to apoptosis (a type of PCD in yeast. Analysis of the yeast model confirmed experimental findings of anti-apoptotic role of Bir1p and pro-apoptotic role of Stm1p and revealed activation of the stress protein kinase Hog proposing the maximal level of activation upon heat stress. In addition we extended the yeast model and created an in silico humanized yeast in which human pro- and anti-apoptotic regulators Bcl-2 family and Valosin-contain protein (VCP are included in the model. We showed that accumulation of Bax in in silico humanized yeast shows apoptotic markers and that VCP is essential target of Akt Signaling. The presented Boolean model provides comprehensive description of yeast apoptosis network behaviour. Extended model of humanized yeast gives new insights of how complex human disease like neurodegenration can initially be tested.

  1. Yeast Interacting Proteins Database: YFR015C, YFR015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...ression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary ...tion, nitrogen starvation, environmental stress, and entry into stationary phase Rows with this bait as bait..., the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental

  2. Yeast Interacting Proteins Database: YGR013W, YKL012W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGR013W SNU71 Component of U1 snRNP required for mRNA splicing via spliceosome; yeast ... specific, ... snRNP required for mRNA splicing via spliceosome; yeast ... specific, no metazoan counterpart Rows with this b ...

  3. Yeast Interacting Proteins Database: YMR294W, YPL174C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YMR294W JNM1 Component of the yeast ... dynactin complex, consisting of Nip100p, Jnm1p, and Arp1p; r ... t gene name JNM1 Bait description Component of the yeast ... dynactin complex, consisting of Nip100p, Jnm1p, an ...

  4. Terroir of yeasts? – Application of FTIR spectroscopy and molecular methods for strain typing of yeasts

    Directory of Open Access Journals (Sweden)

    Gerhards Daniel

    2015-01-01

    Full Text Available The site specific influence on wine (Terroir is an often by wine producers, consumers and scientists discussed topic in the world of wine. A study on grapes and (spontaneous fermentations from six different vineyards was done to investigate the biodiversity of yeasts and to answer the question if there is a terroir of yeast and how it could be influenced. Randomly isolated yeasts were identified by FTIR-spectroscopy and molecular methods on species and strain level. Vineyard specific yeast floras would be observed but they are not such important as expected. Only a few overlapping strain patterns would be identified during both vintages. The yeast flora of the winery had a huge impact on the spontaneous fermentations, but is not really constant and influenced by different factors from outside.

  5. Ectomycorrhizas in vitro between Tricholoma matsutake, a basidiomycete that associates with Pinaceae, and Betula platyphylla var. japonica, an early-successional birch species, in cool-temperate forests.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Maruyama, Tsuyoshi; Neda, Hitoshi

    2015-04-01

    Tricholoma matsutake is an ectomycorrhizal basidiomycete that associates with Pinaceae in the Northern Hemisphere and produces prized "matsutake" mushrooms. We questioned whether the symbiont could associate with a birch that is an early-successional species in boreal, cool-temperate, or subalpine forests. In the present study, we demonstrated that T. matsutake can form typical ectomycorrhizas with Betula platyphylla var. japonica; the associations included a Hartig net and a thin but distinct fungal sheath, as well as the rhizospheric mycelial aggregate "shiro" that is required for fruiting in nature. The in vitro shiro also emitted a characteristic aroma. This is the first report of an ectomycorrhizal formation between T. matsutake and a deciduous broad-leaved tree in the boreal or cool-temperate zones that T. matsutake naturally inhabits. PMID:25236465

  6. Phylogenetic analysis of β-xylanase SRXL1 of Sporisorium reilianum and its relationship with families (GH10 and GH11) of Ascomycetes and Basidiomycetes

    Science.gov (United States)

    Álvarez-Cervantes, Jorge; Díaz-Godínez, Gerardo; Mercado-Flores, Yuridia; Gupta, Vijai Kumar; Anducho-Reyes, Miguel Angel

    2016-01-01

    In this paper, the amino acid sequence of the β-xylanase SRXL1 of Sporisorium reilianum, which is a pathogenic fungus of maize was used as a model protein to find its phylogenetic relationship with other xylanases of Ascomycetes and Basidiomycetes and the information obtained allowed to establish a hypothesis of monophyly and of biological role. 84 amino acid sequences of β-xylanase obtained from the GenBank database was used. Groupings analysis of higher-level in the Pfam database allowed to determine that the proteins under study were classified into the GH10 and GH11 families, based on the regions of highly conserved amino acids, 233–318 and 180–193 respectively, where glutamate residues are responsible for the catalysis. PMID:27040368

  7. Yeast fuel cell: Application for desalination

    Science.gov (United States)

    Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

    2016-02-01

    Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

  8. Production of alpha-amylase by yeast

    Energy Technology Data Exchange (ETDEWEB)

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  9. Protein patterns of yeast during sporulation

    International Nuclear Information System (INIS)

    High resolution two-dimensional gel electrophoresis was used to study protein synthesis during synchronous meiosis and ascospore formation of Saccharomyces cerevisiae. The stained protein patterns of samples harvested at any stage between meiotic prophase and the four-spore stage in two sporulating strains showed the same approximately 250 polypeptides. Of these only a few seemed to increase or decrease in concentration during sporulation. The characteristic pattern of sporulating yeast was identical to the pattern of glucose-grown staitonary yeast cells adapted to respiration. The latter type of cells readily initiates meiosis when transferred to sporulation medium. This pattern differed from the protein patterns of exponentially growing cells in glucose or acetate presporulation medium. Five major proteins in stationary and sporulating yeast cells were not detected in either type of exponential culture. Two-dimensional autoradiograms of [35S]methionine-labelled yeast proteins revealed that some proteins were preferentially labelled during sporulation, while other proteins were labelled at later stages. These patterns differed from the auroradiograms of exponentially growing yeast cells in glucose presporulation medium in a number of spots. No differences were observed when stained gels or autoradiograms of sporulating cultures and non-sporulating strains in sporulation medium were compared. (author)

  10. Yeast Interactions in Inoculated Wine Fermentation.

    Science.gov (United States)

    Ciani, Maurizio; Capece, Angela; Comitini, Francesca; Canonico, Laura; Siesto, Gabriella; Romano, Patrizia

    2016-01-01

    The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the different yeasts composing the starter culture can led the stability of the final product and the analytical and aromatic profile. In the present review, we will discuss the recent developments regarding yeast interactions in pure and in mixed fermentation, focusing on the influence of interactions on growth and dominance in the process. PMID:27148235

  11. Degradation of 5-hydroxymethylfurfural during yeast fermentation.

    Science.gov (United States)

    Akıllıoglu, Halise Gül; Mogol, Burçe Ataç; Gökmen, Vural

    2011-12-01

    5-Hydroxymethyl furfural (HMF) may occur in malt in high quantities depending on roasting conditions. However, the HMF content of different types of beers is relatively low, indicating its potential for degradation during fermentation. This study investigates the degradation kinetics of HMF in wort during fermentation by Saccharomyces cerevisiae. The results indicated that HMF decreased exponentially as fermentation progressed. The first-order degradation rate of HMF was 0.693 × 10(-2) and 1.397 × 10(-2)min(-1) for wort and sweet wort, respectively, indicating that sugar enhances the activity of yeasts. In wort, HMF was converted into hydroxymethyl furfuryl alcohol by yeasts with a high yield (79-84% conversion). Glucose and fructose were utilised more rapidly by the yeasts in dark roasted malt than in pale malt (pyeast cells, and presence of sugars in the fermentation medium increases this activity. PMID:22010851

  12. Yeast Interactions in Inoculated Wine Fermentation

    Science.gov (United States)

    Ciani, Maurizio; Capece, Angela; Comitini, Francesca; Canonico, Laura; Siesto, Gabriella; Romano, Patrizia

    2016-01-01

    The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the different yeasts composing the starter culture can led the stability of the final product and the analytical and aromatic profile. In the present review, we will discuss the recent developments regarding yeast interactions in pure and in mixed fermentation, focusing on the influence of interactions on growth and dominance in the process. PMID:27148235

  13. Yeast interactions in inoculated wine fermentation

    Directory of Open Access Journals (Sweden)

    Maurizio eCiani

    2016-04-01

    Full Text Available The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the different yeasts composing the starter culture can led the stability of the final product and the analytical and aromatic profile. In the present review, we will discuss the recent developments regarding yeast interactions in pure and in mixed fermentation, focusing on the influence of interactions on growth and dominance in the process.

  14. Drug for Yeast Infections May Raise Miscarriage Risk, FDA Warns

    Science.gov (United States)

    ... gov/medlineplus/news/fullstory_158503.html Drug for Yeast Infections May Raise Miscarriage Risk, FDA Warns Agency ... brand name Diflucan) is used to treat vaginal yeast infections. "Patients who are pregnant or actively trying ...

  15. Modeling diauxic glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Sørensen, Preben Graae

    2010-01-01

    investigations of central metabolism dynamics of yeast cells. We have previously proposed a model for the open system comprised of the primary fermentative reactions in yeast that quantitatively describes the oscillatory dynamics. However, this model fails to describe the transient behavior of metabolic....... Experimental and computational results strongly suggest that regulation of acetaldehyde explains the observed behavior. We have extended the original model with regulation of pyruvate decarboxylase, a reversible alcohol dehydrogenase, and drainage of pyruvate. Using the method of time rescaling in the extended...

  16. Multiple Functions of Sterols in Yeast Endocytosis

    OpenAIRE

    Heese-Peck, Antje; Pichler, Harald; Zanolari, Bettina; Watanabe, Reika; Daum, Günther; Riezman, Howard

    2002-01-01

    Sterols are essential factors for endocytosis in animals and yeast. To investigate the sterol structural requirements for yeast endocytosis, we created a variety of ergΔ mutants, each accumulating a distinct set of sterols different from ergosterol. Mutant erg2Δerg6Δ and erg3Δerg6Δ cells exhibit a strong internalization defect of the α-factor receptor (Ste2p). Specific sterol structures are necessary for pheromone-dependent receptor hyperphosphorylation, a prerequisite for internalization. Th...

  17. Newly identified prions in budding yeast, and their possible functions

    OpenAIRE

    Crow, Emily T.; Li, Liming

    2011-01-01

    Yeast prions are atypical genetic elements that are transmitted as heritable protein conformations. [PSI+], [URE3], and [PIN+] are three well-studied prions in the budding yeast, Saccharomyces cerevisiae. In the last three years, several additional prions have been reported in yeast, including [SWI+], [OCT+], [MCA], [GAR+], [MOT3+], [ISP+], and [NSI+]. The growing number of yeast prions suggests that protein-based inheritance might be a widespread biological phenomenon. In this review, we sum...

  18. Rapid isolation of yeast genomic DNA: Bust n' Grab

    OpenAIRE

    Peterson Kenneth R; Fedosyuk Halyna; Harju Susanna

    2004-01-01

    Abstract Background Mutagenesis of yeast artificial chromosomes (YACs) often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods fo...

  19. Improving industrial yeast strains: exploiting natural and artificial diversity

    OpenAIRE

    Steensels, Jan; Snoek, Tim; Meersman, Esther; Nicolino, Martina Picca; Voordeckers, Karin; Verstrepen, Kevin J.

    2014-01-01

    Yeasts have been used for thousands of years to make fermented foods and beverages, such as beer, wine, sake, and bread. However, the choice for a particular yeast strain or species for a specific industrial application is often based on historical, rather than scientific grounds. Moreover, new biotechnological yeast applications, such as the production of second-generation biofuels, confront yeast with environments and challenges that differ from those encountered in traditional food ferment...

  20. Assessing the potential of wild yeasts for bioethanol production

    OpenAIRE

    Ruyters, Stefan; Mukherjee, Vaskar; Verstrepen, Kevin; Thevelein, Johan; Willems, Kris; Lievens, Bart

    2015-01-01

    Bioethanol fermentations expose yeasts to a new, complex and challenging fermentation medium with specific inhibitors and sugar mixtures depending on the type of carbon source. It is, therefore, suggested that the natural diversity of yeasts should be further exploited in order to find yeasts with good ethanol yield in stressed fermentation media. In this study, we screened more than 50 yeast isolates of which we selected five isolates with promising features. The species Candida bombi, Wicke...

  1. A new methodology to obtain wine yeast strains overproducing mannoproteins

    OpenAIRE

    Quirós Asensio, Manuel; González Ramos, Daniel; Tabera Moreno, Laura; González García, Ramón

    2010-01-01

    Yeast mannoproteins are highly glycosylated proteins that are covalently bound to the β-1,3-glucan present in the yeast cell wall. Among their outstanding enological properties, yeast mannoproteins contribute to several aspects of wine quality by protecting against protein haze, reducing astringency, retaining aroma compounds and stimulating growth of lactic-acid bacteria. The development of a non-recombinant method to obtain enological yeast strains overproducing mannoproteins would therefor...

  2. 21 CFR 172.590 - Yeast-malt sprout extract.

    Science.gov (United States)

    2010-04-01

    ... Saccharomyces cereviseae, Saccharomyces fragilis, or Candida utilis) using the sprout portion of malt barley as... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt...

  3. Isolation and Identification of Yeasts from Tibet Kefir

    OpenAIRE

    Yun Li; Tongjie Liu; Guoqing He

    2015-01-01

    The occurrence and distribution of yeasts in Tibet kefir were investigated in this study. Five samples of Tibetan kefir from Tibet and surrounding areas were collected for yeast isolation. Based on physiological, biochemical characteristics and molecular identification results, eight species of yeast were isolated and identified from Tibet kefir, including Saccharomyces cerevisiae, Pichia fermentans, Debaryomyces hansenii, Rhodotorula mucilaginosa, Candida zeylanoide, Candida parapsilosis, Kl...

  4. Adhesive interactions between medically important yeasts and bacteria

    NARCIS (Netherlands)

    Millsap, KW; van der Mei, HC; Busscher, HJ; Bos, R.R.M.

    1998-01-01

    Yeasts are being increasingly identified as important organisms in human infections. Adhesive interactions between yeasts and bacteria may contribute to yeast retention al body sites. Methods for studying adhesive interactions between bacterial strains are well known, and range from simple macroscop

  5. Yeast Interacting Proteins Database: YDR357C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available izes to the endosome; identified as a transcriptional activator in a high-throughput...ome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with this pr

  6. Yeast Interacting Proteins Database: YFR015C, YLR258W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into statio

  7. Yeast Interacting Proteins Database: YFR015C, YJL137C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...pression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary

  8. Inhibition of Alcoholic Fermentation of Grape Must by Fatty Acids Produced by Yeasts and Their Elimination by Yeast Ghosts

    OpenAIRE

    Lafon-Lafourcade, S.; Geneix, C.; Ribéreau-Gayon, P.

    1984-01-01

    In a complete nutritive medium rich in sugar, such as grape must, the inhibition of alcoholic fermentation is caused by substances produced by the yeast which, acting synergistically with ethanol, are toxic to the yeasts themselves. Among these are decanoic and octanoic acids and their corresponding ethyl esters. Their adsorption by yeast ghosts permits the prevention and treatment of fermentation stoppages.

  9. Yeasts associated with Vienna sausage packaging.

    Science.gov (United States)

    Viljoen, B C; Dykes, G A; Callis, M; von Holy, A

    1993-03-01

    A total of 123 representative yeast isolates from a previous study of a Vienna sausage processing plant were identified according to conventional methods and long-chain fatty acid analyses. The most prevalent isolates belonged to the genera Candida and Debaryomyces. Other genera encountered were Rhodotorula, Yarrowia, Pichia, Galactomyces, Cryptococcus, Trichosporon and Torulaspora. PMID:8466813

  10. Arachidonic acid metabolites in pathogenic yeasts

    Directory of Open Access Journals (Sweden)

    Ells Ruan

    2012-08-01

    Full Text Available Abstract Although most of what is known about the biology and function of arachidonic acid metabolites comes from the study of mammalian biology, these compounds can also be produced by lower eukaryotes, including yeasts and other fungi. It is also in this group of organisms that the least is known about the metabolic pathways leading to the production of these compounds as well as the functions of these compounds in the biology of fungi and yeasts. This review will deal with the discovery of oxylipins from polyunsaturated fatty acids, and more specifically the arachidonic acid derived eicosanoids, such as 3-hydroxy eicosatetraenoic acid, prostaglandin F2α and prostaglandin E2, in yeasts starting in the early 1990s. This review will also focus on what is known about the metabolic pathways and/or proteins involved in the production of these compounds in pathogenic yeasts. The possible roles of these compounds in the biology, including the pathology, of these organisms will be discussed.

  11. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  12. Stress-induced radiation resistance in yeast

    International Nuclear Information System (INIS)

    Cells have evolved biological defense mechanisms that can protect them against a variety of harmful environmental stress including ionizing radiation exposure. The authors have demonstrated that many stresses will induce radiation resistance in yeast. Recently it has become apparent that radiation resistance may be associated with the highly conserved 'stress response' mechanism that confers cellular resistance to a multitude of agents. A universal response to stress is the synthesis of a distinctive set of new proteins, although the function of many of these specific stress proteins is still unknown. One stress protein known to affect thermal tolerance in yeast is HSP104. This report has assessed involvement of HSP104 in the mechanism of radiation resistance by utilizing a yeast strain lacking HSP104 protein (a deletion mutant). It is previously demonstrated that radiation itself will induce yeast cells to develop radiation resistance and that the signal for the response is DNA damage. The nature of the DNA damage signal is important and it is reported that, per unit dose, low linear energy transfer (LET) 60Co gamma-rays induce a greater resistance response compared to high LET neutrons. Here is tested whether the dose rate also influences the signalling efficiency of a radiation inducing dose. (author). 4 refs., 2 figs

  13. Yeast improves resistance to environmental challenges

    Science.gov (United States)

    Alphamune™, a yeast extract antibiotic alternative, was added at either 1 lb/ton or 2 lb/ton to a turkey starter diet. Two trials were conducted to evaluate the effects of Alphamune™ on gut maturation of 7 and 21 day old poults. Sections from the mid-point of the duodenum, jejunum and ileum of each ...

  14. DNA sequence of the yeast transketolase gene.

    Science.gov (United States)

    Fletcher, T S; Kwee, I L; Nakada, T; Largman, C; Martin, B M

    1992-02-18

    Transketolase (EC 2.2.1.1) is the enzyme that, together with aldolase, forms a reversible link between the glycolytic and pentose phosphate pathways. We have cloned and sequenced the transketolase gene from yeast (Saccharomyces cerevisiae). This is the first transketolase gene of the pentose phosphate shunt to be sequenced from any source. The molecular mass of the proposed translated protein is 73,976 daltons, in good agreement with the observed molecular mass of about 75,000 daltons. The 5'-nontranslated region of the gene is similar to other yeast genes. There is no evidence of 5'-splice junctions or branch points in the sequence. The 3'-nontranslated region contains the polyadenylation signal (AATAAA), 80 base pairs downstream from the termination codon. A high degree of homology is found between yeast transketolase and dihydroxyacetone synthase (formaldehyde transketolase) from the yeast Hansenula polymorpha. The overall sequence identity between these two proteins is 37%, with four regions of much greater similarity. The regions from amino acid residues 98-131, 157-182, 410-433, and 474-489 have sequence identities of 74%, 66%, 83%, and 82%, respectively. One of these regions (157-182) includes a possible thiamin pyrophosphate (TPP) binding domain, and another (410-433) may contain the catalytic domain. PMID:1737042

  15. Radiation-sensitive mutants of yeast

    International Nuclear Information System (INIS)

    Nomenclature for various radiosensitive mutants of Saccharomyces cerevisiae is briefly discussed. Tables are presented to show results of allelism tests of most of the radiosensitive mutants isolated by various investigators together with a standardized rad locus designation and map positions of a number of rad loci in yeast

  16. Engineering yeast tolerance to inhibitory lignocellulosic biomass

    OpenAIRE

    Cunha, Joana Filipa Torres Pinheiro; Aguiar, Tatiana Quinta; D. Mendes; Pereira, Francisco B.; Domingues, Lucília

    2013-01-01

    In recent years the necessity for biotechnological manufacturing based on lignocellulosic feedstocks has become evident. However, the pre-treatment step in the production of lignocellulosic bioethanol leads to the accumulation of inhibitory byproducts. Robust second generation bioethanol processes require microorganisms able to ferment these inhibitory lignocellulosic hydrolysates. Significant progress has been made in the understanding of the determinants of yeast tolerance to lignocellulose...

  17. Phosphorylation site on yeast pyruvate dehydrogenase complex

    International Nuclear Information System (INIS)

    The pyruvate dehydrogenase complex was purified to homogeneity from baker's yeast (Saccharomyces cerevisiae). Yeast cells were disrupted in a Manton-Gaulin laboratory homogenizer. The pyruvate dehydrogenase complex was purified by fractionation with polyethylene glycol, isoelectric precipitation, ultracentrifugation and chromatography on hydroxylapatite. Final purification of the yeast pyruvate dehydrogenase complex was achieved by cation-exchange high pressure liquid chromatography (HPLC). No endogenous pyruvate dehydrogenase kinase activity was detected during the purification. However, the yeast pyruvate dehydrogenase complex was phosphorylated and inactivated with purified pyruvate dehydrogenase kinase from bovine kidney. Tryptic digestion of the 32P-labeled complex yielded a single phosphopeptide which was purified to homogeniety. The tryptic digest was subjected to chromatography on a C-18 reverse phase HPLC column with a linear gradient of acetonitrile. Radioactive fractions were pooled, concentrated, and subjected to anion-exchange HPLC. The column was developed with a linear gradient of ammonium acetate. Final purification of the phosphopeptide was achieved by chromatography on a C-18 reverse phase HPLC column developed with a linear gradient of acetonitrile. The amino acid sequence of the homogeneous peptide was determined by manual modified Edman degradation

  18. Raman microspectroscopy of the yeast vacuoles

    Czech Academy of Sciences Publication Activity Database

    Bednárová, Lucie; Palacký, J.; Bauerová, Václava; Hrušková-Heidingsfeldová, Olga; Pichová, Iva; Mojzeš, P.

    Amsterdam: IOS Press, 2013 - (Marques, M.; Batista de Carvalho, L.; Haris, P.), s. 73-77. (Spectroscopy of Biological Molecules. 7). ISBN 978-1-61499-183-0 Institutional research plan: CEZ:AV0Z40550506 Keywords : Candida albicans * chemical composition * living cell * polyphosphate * Raman microspectroscopy * vacuole * yeast Subject RIV: CE - Biochemistry

  19. Catalytic site interactions in yeast OMP synthase

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Barr, Eric W.; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R.

    2014-01-01

    45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal...

  20. Regulations of sugar transporters: insights from yeast

    Czech Academy of Sciences Publication Activity Database

    Horák, Jaroslav

    2013-01-01

    Roč. 59, 1-2 (2013), s. 1-31. ISSN 0172-8083 R&D Projects: GA ČR(CZ) GAP503/10/0307 Institutional support: RVO:67985823 Keywords : sugar transporter * yeast * glucose signaling * sensing Subject RIV: EE - Microbiology, Virology Impact factor: 1.712, year: 2013

  1. Killer yeasts as biocontrol agents of spoilage yeasts and bacteria isolated from wine

    Directory of Open Access Journals (Sweden)

    Fernández de Ullivarri Miguel

    2014-01-01

    Full Text Available During the winemaking process Saccharomyces cerevisiae is the main yeast species but other yeasts called non-Saccharomyces as well as different species of lactic acid bacteria (LAB are also present. Then, one strategy to prevent or reduce microbial contamination during the winemaking process is the use of killer yeasts. The aim of this study was to evaluate the killer activity (KA of autochthonous yeasts from Northwest region of Argentine (S. cerevisiae Cf8 and Wickerhamomyces anomalus Cf20 on spoilage yeasts and in LAB of the wine. The KA was evaluated using cell-free supernatants obtained from pure and mixed cultures of strains Cf8-Cf20. S. cerevisiae Cf8 showed a growth reduction between 7 and 48% on D. anomala BDa15, P. membranifaciens BPm481 and Z. bailii Bzb317 while W. anomalus Cf20 exhibited KA of 20, 61, 91 and 92% against B. bruxellensis Ld1, D. anomala BDa15, P. membranifaciens BPm481 and P. guilliermondii Cd6, respectively. Killer mixed supernatants showed growth inhibition similar to strain Cf20. Screening against LAB showed that both killer toxins were able to inhibit the growth of L. hilgardii 5w as well as to reduce a 16–31% histamine production by this LAB strain. These results confirm the potential of autochthonous killer yeasts as biocontrol agents in winemaking process. The mixed culture S. cerevisiae Cf8-W. anomalus Cf20 presented a wide range of KA on spoilage yeasts as well as on L. hilgardii. Therefore, the use of killer yeasts as starter cultures would allow producing wines with controlled quality.

  2. Effect of yeast storage temperature and flour composition on fermentative activities of baker's yeast

    Directory of Open Access Journals (Sweden)

    Pejin Dušanka J.

    2009-01-01

    Full Text Available Baker's yeast is a set of living cells of Saccharomyces cerevisiae. It contains around 70-72% of water, 42-45% of proteins, around 40% of carbohydrates, around 7.5% of lipids (based on dry matter, and vitamin B-complex. On the basis of yeast cell analysis it can be concluded that yeast is a complex biological system which changes in time. The intensity of the changes depends on temperature. Yeast sample was stored at 4°C i 24°C for 12 days. During storage at 4°C, the content of total carbohydrates decreased from 48.81% to 37.50% (dry matter, whereas carbohydrate loss ranged from 40.81% to 29.28% at 24°C. The content of trehalose was 12.33% in the yeast sample stored at 4°C and 0.24% at 24°C. Loss of fermentative activity was 81.76% in the sample stored at 24°C for 12 days. The composition of five samples of 1st category flour was investigated. It was found that flours containing more reducing sugars and maltose enable higher fermentation activities. The flours with higher ash content (in the range 0.5-0.94% had higher contents of phytic acid. Higher ash and phytic contents in flour increased the yeast fermentative efficiency. In bakery industry, a range of ingredients has been applied to improve the product's quality such as surface active substances (emulsifiers, enzymes, sugars and fats. In the paper, the effect of some ingredients added to dough (margarine, saccharose, sodium chloride and malted barley on the yeast fermentative activity was studied. The mentioned ingredients were added to dough at different doses: 0.5, 1.0, 1.5 and 2.0%, flour basis. It was found that the investigated ingredients affected the fermentative activity of yeast and improved the bread quality.

  3. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast.

    OpenAIRE

    Hermanson, G G; Hoekstra, M F; McElligott, D. L.; Evans, G A

    1991-01-01

    Yeast artificial chromosomes (YACs) provide a powerful tool for the isolation and mapping of large regions of mammalian chromosomes. We developed a rapid and efficient method for the isolation of DNA fragments representing the extreme ends of YAC clones by the insertion of a rescue plasmid into the YAC vector by homologous recombination. Two rescue vectors were constructed containing a yeast LYS2 selectable gene, a bacterial origin of replication, an antibiotic resistance gene, a polylinker c...

  4. Yeast Interacting Proteins Database: YBR288C, YGR261C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YBR288C APM3 Mu3-like subunit of the clathrin associated protein complex (AP-3); functions in tr ... as prey (0) YGR261C APL6 Beta3-like subunit of the yeast ... AP-3 complex; functions in transport of alkaline p ... me APL6 Prey description Beta3-like subunit of the yeast ... AP-3 complex; functions in transport of alkaline p ...

  5. Yeast Interacting Proteins Database: YOL069W, YMR294W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YOL069W NUF2 Component of the evolutionarily conserved kinetochore-associated Ndc80 complex (Ndc ... his bait as prey (0) YMR294W JNM1 Component of the yeast ... dynactin complex, consisting of Nip100p, Jnm1p, an ... y gene name JNM1 Prey description Component of the yeast ... dynactin complex, consisting of Nip100p, Jnm1p, an ...

  6. Yeast Interacting Proteins Database: YDR311W, YMR294W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDR311W TFB1 Subunit of TFIIH and nucleotide excision repair factor 3 complexes, required for nu ... his bait as prey (0) YMR294W JNM1 Component of the yeast ... dynactin complex, consisting of Nip100p, Jnm1p, an ... y gene name JNM1 Prey description Component of the yeast ... dynactin complex, consisting of Nip100p, Jnm1p, an ...

  7. Occurrence of Killer Yeast Strains in Fruit and Berry Wine Yeast Populations

    OpenAIRE

    Gulbiniene, Gintare; Kondratiene, Laima; Jokantaite, Tautvile; Serviene, Elena; Melvydas, Vytautas; Petkuniene, Giedre

    2004-01-01

    Apple, cranberry, chokeberry and Lithuanian red grape wine yeast populations were used for the determination of killer yeast occurrence. According to the tests of the killer characteristics and immunity the isolated strains were divided into seven groups. In this work the activity of killer toxins purified from some typical strains was evaluated. The analysed strains produced different amounts of active killer toxin and some of them possessed new industrially significant killer properties. To...

  8. Alternative branch points are selected during splicing of a yeast pre-mRNA in mammalian and yeast extracts.

    OpenAIRE

    Ruskin, B; Pikielny, C W; Rosbash, M; Green, M R

    1986-01-01

    Pre-mRNA splicing in yeast and higher eukaryotes proceeds by similar pathways, in which a probable splicing intermediate and the excised intron are in a lariat configuration. To compare the pre-mRNA splicing mechanisms in yeast and higher eukaryotes, we have analyzed the RNA products resulting from in vitro processing of a yeast intron-containing pre-mRNA in HeLa cell and yeast extracts. In yeast, the RNA branch (2'-5' phosphodiester bond) of the RNA lariat forms at the third adenosine of the...

  9. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  10. Laboratory evolution of copper tolerant yeast strains

    Directory of Open Access Journals (Sweden)

    Adamo Giusy

    2012-01-01

    Full Text Available Abstract Background Yeast strains endowed with robustness towards copper and/or enriched in intracellular Cu might find application in biotechnology processes, among others in the production of functional foods. Moreover, they can contribute to the study of human diseases related to impairments of copper metabolism. In this study, we investigated the molecular and physiological factors that confer copper tolerance to strains of baker's yeasts. Results We characterized the effects elicited in natural strains of Candida humilis and Saccharomyces cerevisiae by the exposure to copper in the culture broth. We observed that, whereas the growth of Saccharomyces cells was inhibited already at low Cu concentration, C. humilis was naturally robust and tolerated up to 1 g · L-1 CuSO4 in the medium. This resistant strain accumulated over 7 mg of Cu per gram of biomass and escaped severe oxidative stress thanks to high constitutive levels of superoxide dismutase and catalase. Both yeasts were then "evolved" to obtain hyper-resistant cells able to proliferate in high copper medium. While in S. cerevisiae the evolution of robustness towards Cu was paralleled by the increase of antioxidative enzymes, these same activities decreased in evolved hyper-resistant Candida cells. We also characterized in some detail changes in the profile of copper binding proteins, that appeared to be modified by evolution but, again, in a different way in the two yeasts. Conclusions Following evolution, both Candida and Saccharomyces cells were able to proliferate up to 2.5 g · L-1 CuSO4 and to accumulate high amounts of intracellular copper. The comparison of yeasts differing in their robustness, allowed highlighting physiological and molecular determinants of natural and acquired copper tolerance. We observed that different mechanisms contribute to confer metal tolerance: the control of copper uptake, changes in the levels of enzymes involved in oxidative stress response and

  11. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  12. Phosphorylation-dephosphorylation of yeast pyruvate dehydrogenase

    International Nuclear Information System (INIS)

    Pyruvate dehydrogenase complex (PDC) was purified to homogeneity from baker's yeast (Saccharomyces cerevisiae). No pyruvate dehydrogenase (PDH) kinase activity was detected at any stage of the purification. However, the purified PDC was phosphorylated and inactivated by purified PDH kinase from bovine kidney mitochondria, Mg2+, and [γ-32P]ATP. The protein-bound radioactivity was localized in the PDH α subunit. The phosphorylated, inactivated PDC was dephosphorylated and reactivated with purified bovine PDH phosphatase, Mg2+, and Ca2+. From a tryptic digest of phosphorylated yeast PDC a radioactive peptide was isolated by anion and reverse phase HPLC. The sequence of this tetradecapeptide is Tyr-Gly-Gly-His-Ser(P)-Met-Ser-Asp-Pro-Gly-Thr-Thr-Tyr-Arg. This sequence is very similar to the sequence of a tryptic phosphopeptide derived from the α subunit of bovine kidney and heart PDH: Tyr-His-Gly-His-Ser(P)-Met-Ser-Asp-Pro-Gly-Val-Ser-Tyr-Arg

  13. Mapping the functional yeast ABC transporter interactome.

    Science.gov (United States)

    Snider, Jamie; Hanif, Asad; Lee, Mid Eum; Jin, Ke; Yu, Analyn R; Graham, Chris; Chuk, Matthew; Damjanovic, Dunja; Wierzbicka, Marta; Tang, Priscilla; Balderes, Dina; Wong, Victoria; Jessulat, Matthew; Darowski, Katelyn D; San Luis, Bryan-Joseph; Shevelev, Igor; Sturley, Stephen L; Boone, Charles; Greenblatt, Jack F; Zhang, Zhaolei; Paumi, Christian M; Babu, Mohan; Park, Hay-Oak; Michaelis, Susan; Stagljar, Igor

    2013-09-01

    ATP-binding cassette (ABC) transporters are a ubiquitous class of integral membrane proteins of immense clinical interest because of their strong association with human disease and pharmacology. To improve our understanding of these proteins, we used membrane yeast two-hybrid technology to map the protein interactome of all of the nonmitochondrial ABC transporters in the model organism Saccharomyces cerevisiae and combined this data with previously reported yeast ABC transporter interactions in the BioGRID database to generate a comprehensive, integrated 'interactome'. We show that ABC transporters physically associate with proteins involved in an unexpectedly diverse range of functions. We specifically examine the importance of the physical interactions of ABC transporters in both the regulation of one another and in the modulation of proteins involved in zinc homeostasis. The interaction network presented here will be a powerful resource for increasing our fundamental understanding of the cellular role and regulation of ABC transporters. PMID:23831759

  14. Structural Studies of the Yeast Mitochondrial Degradosome

    DEFF Research Database (Denmark)

    Feddersen, Ane; Jonstrup, Anette Thyssen; Brodersen, Ditlev Egeskov

    The yeast mitochondrial degradosome/exosome (mtExo) is responsible for most RNA turnover in mitochondria and has been proposed to form a central part of a mitochondrial RNA surveillance system responsible for degradation of aberrant and unprocessed RNA ([1], [2]). In contrast to the cytoplasmic...... and nuclear exosome complexes, which consist of 10-12 different nuclease subunits, the mitochondrial degradosome is composed of only two large subunits - an RNase (Dss1p) and a helicase (Suv3p), belonging the Ski2 class of DExH box RNA helicases. Both subunits are encoded on the yeast nuclear genome...... and imported to the mitochondrial matrix posttranslationally. In an effort to understand the complex mechanisms underlying control of RNA turnover and surveillance in eukaryotic organisms, we are studying the structure of the mitochondrial degradosome as a model system for the more complex exosomes. Dss1p...

  15. Uniform yeast cell assembly via microfluidics.

    Science.gov (United States)

    Chang, Ya-Wen; He, Peng; Marquez, Samantha M; Cheng, Zhengdong

    2012-06-01

    This paper reports the use of microfluidic approaches for the fabrication of yeastosomes (yeast-celloidosomes) based on self-assembly of yeast cells onto liquid-solid or liquid-gas interfaces. Precise control over fluidic flows in droplet- and bubble-forming microfluidic devices allows production of monodispersed, size-selected templates. The general strategy to organize and assemble living cells is to tune electrostatic attractions between the template (gel or gas core) and the cells via surface charging. Layer-by-Layer (LbL) polyelectrolyte deposition was employed to invert or enhance charges of solid surfaces. We demonstrated the ability to produce high-quality, monolayer-shelled yeastosome structures under proper conditions when sufficient electrostatic driving forces are present. The combination of microfluidic fabrication with cell self-assembly enables a versatile platform for designing synthetic hierarchy bio-structures. PMID:22655026

  16. Homocysteine thiolactone affects protein ubiquitination in yeast.

    Science.gov (United States)

    Bretes, Ewa; Zimny, Jarosław

    2013-01-01

    The formation of homocysteine thiolactone (HcyTl) from homocysteine occurs in all examined so far organisms including bacteria, yeast, and humans. Protein N-homocysteinylation at the ε-amino group of lysine is an adverse result of HcyTl accumulation. Since tagging of proteins by ubiquitination before their proteasomal degradation takes place at the same residue, we wondered how N-homocysteinylation may affect the ubiquitination of proteins. We used different yeast strains carrying mutations in genes involved in the homocysteine metabolism. We found positive correlation between the concentration of endogenous HcyTl and the concentration of ubiquitinated proteins. This suggests that N-homocysteinylation of proteins apparently does not preclude but rather promotes their decomposition. PMID:24051443

  17. Stochasticity in the yeast mating pathway

    International Nuclear Information System (INIS)

    We report stochastic simulations of the yeast mating signal transduction pathway. The effects of intrinsic and external noise, the influence of cell-to-cell difference in the pathway capacity, and noise propagation in the pathway have been examined. The stochastic temporal behaviour of the pathway is found to be robust to the influence of inherent fluctuations, and intrinsic noise propagates in the pathway in a uniform pattern when the yeasts are treated with pheromones of different stimulus strengths and of varied fluctuations. In agreement with recent experimental findings, extrinsic noise is found to play a more prominent role than intrinsic noise in the variability of proteins. The occurrence frequency for the reactions in the pathway are also examined and a more compact network is obtained by dropping most of the reactions of least occurrence

  18. Effect of Yeast : Saccharomyces cerevisiae and Marine Yeast as probiotic supplement on performance of poultry

    Directory of Open Access Journals (Sweden)

    I Putu Kompiang

    2002-03-01

    Full Text Available An experiment had been conducted to evaluate the effect of marine yeast and Saccharomyces cerevisiae (Sc as probiotic supplement on poultry performance. Marine yeast isolated from rotten sea-weed and commercial Saccharomyces cerevisiae were used. Evaluation was conducted by comparing performance of broiler chicken supplemented with marine yeast or Sc, which were given through drinking water (5 ml/l to negative control (feed without antibiotic growth promotor/GPA, positive control (feed with GPA, and reference commercial probiotic. Forty DOC broiler birds were used for each treatment, divided into 4 replicates (10 birds/replicate and raised in wire cages for 5 weeks. Body weight and feed consumption were measured weekly and mortality was recorded during the trial. The results showed that there were no significant difference on the birds performance among marine yeast, Sc, positive control and probiotic reference control treatments. However their effects on bird performance were better (P<0.05 than treatment of negative control. It is concluded that marine yeast or Saccharomyces cerevisiae could replace the function of antibiotic as a growth promotant.

  19. Molecular analysis of ectomycorrhizal basidiomycete communities in a Pinus sylvestris L. stand reveals long-term increased diversity after removal of litter and humus layers.

    Science.gov (United States)

    Smit, Eric; Veenman, Christiaan; Baar, Jacqueline

    2003-07-01

    Abstract The number of fruiting bodies of ectomycorrhizal species in pine forests in The Netherlands has decreased dramatically in recent decades. This decrease has been attributed to an increase in nitrogen deposition and the accumulation of litter and humus. The effects of sod cutting and the removal of litter and humus, to restore ectomycorrhizal diversity in a Scots pine forest in Dwingeloo, The Netherlands, were investigated previously from 1990 to 1993. Removal of the litter and humus resulted in a significant increase in the numbers of species and fruiting bodies of ectomycorrhizal fungi. However, until now all data were obtained by counting fruiting bodies and the effects on mycelial development below ground were not assessed. To investigate hyphal development, DNA was extracted from bulk soil and polymerase chain reaction products were obtained by amplification using basidiomycete-specific internal transcribed spacer (ITS) primers. The differences in diversity between the control plots and the treated plots were analyzed using denaturing gradient gel electrophoresis. To assess the species composition and differences, ITS regions of the amplified fragments were cloned and sequenced. Sequences were compared with sequences from GenBank and from fruiting bodies collected from the same plots. Data indicated increased below-ground ectomycorrhizal diversity in the plots that had been subjected to removal of the litter and humus layers. PMID:19719606

  20. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi. PMID:16447071

  1. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies. PMID:25954907

  2. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with the degree of soil organic matter humification and available electrolytes.

    Science.gov (United States)

    Gryndler, M; Soukupová, L; Gryndlerová, H; Baldrian, P; Hršelová, H

    2010-09-01

    Spatial distribution of ectomycorrhizae-associated basidiomycetes was determined in oakbirch forest using terminal restriction fragment length polymorphism (T-RFLP) analysis. The data were correlated with actual soil humidity, pH, electric conductivity of the soil extract, absorbance A(465) and A(665) of water and alkali soil extracts and with the ratio A(465)/A(665) (parameter A4/A6). Natural non-homogeneity of the soil parameters was used as experimental gradient. Distance-based redundancy analysis of the T-RFLP data (with soil parameters being taken as environmental parameters) provided significant results when ITS1F-terminanted restriction fragments were analyzed. Among other fungi, a Mycena galericulata related fungus was observed to correlate negatively with A4/A6, indicating its association with highly humified soil organic matter. Positive association of other, unidentified fungi with A4/A6 was also observed. Several other unidentified fungi negatively correlated with electric conductivity of the soil extract. The results may explain nonhomogeneity of the spatial distribution of the fungi associated with ectomycorrhizae as a result of their interaction with non-homogeneous soil environment. PMID:20941580

  3. Dissection and design of yeast prions.

    OpenAIRE

    Osherovich, Lev Z; Cox, Brian S; Mick F Tuite; Weissman, Jonathan S

    2004-01-01

    Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids). Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p) to examine the requirements for prion formation and inheritance. In both proteins, ...

  4. Telomere behavior in a hybrid yeast

    Institute of Scientific and Technical Information of China (English)

    Ona C Martin; Christopher G De Sevo; Benjamin Z Guo; Douglas E Koshland; Maiterya J Dunham; Yixian Zheng

    2009-01-01

    @@ Dear Editor, Telomeres and the protein/RNA complexes involved in maintaining them are rapidly evolving systems across eukaryotes.Using two Saccharomyces species, among S.cerevisiae and S.bayanus, we provide evidence that the telomere systems of these two closely related yeasts have evolved significantly apart and that the gene in one spe-cies cannot maintain the set-point of telomere length of the other soecies in the hybrid.

  5. Yeast mutants auxotrophic for choline or ethanolamine.

    OpenAIRE

    Atkinson, K D; Jensen, B.; Kolat, A I; Storm, E M; Henry, S. A.; Fogel, S

    1980-01-01

    Three mutants of the yeast Saccharomyces cerevisiae which require exogenous ethanolamine or choline were isolated. The mutants map to a single locus (cho1) on chromosome V. The lipid composition suggests that cho1 mutants do not synthesize phosphatidylserine under any growth conditions. If phosphatidylethanolamine or phosphatidylcholine, which are usually derived from phosphatidylserine, were synthesized from exogenous ethanolamine or choline, the mutants grew and divided relatively normally....

  6. Environmental influences on organotin-yeast interactions

    OpenAIRE

    White, Jane S.

    2002-01-01

    As a consequence of the widespread industrial and agricultural applications of organotin compounds, contamination of various ecosystems has occurred in recent decades. Understanding how these compounds interact with cellular membranes is essential in assessing the risks of organotin pollution. The organotins, tributyltin (TBT) and trimethyltin (TMT) and inorganic tin, Sn(IV), were investigated for their physical interactions with non-metabolising cells and protoplasts of the yeast, Candida ma...

  7. Multipurpose Transposon-Insertion Libraries in Yeast.

    Science.gov (United States)

    Kumar, Anuj

    2016-01-01

    Libraries of transposon-insertion alleles constitute powerful and versatile tools for large-scale analysis of yeast gene function. Transposon-insertion libraries are constructed most simply through mutagenesis of a plasmid-based genomic DNA library; modification of the mutagenizing transposon by incorporation of yeast selectable markers, recombination sites, and an epitope tag enables the application of insertion alleles for phenotypic screening and protein localization. In particular, yeast genomic DNA libraries have been mutagenized with modified bacterial transposons carrying the URA3 marker, lox recombination sites, and sequence encoding multiple copies of the hemagglutinin (HA) epitope. Mutagenesis with these transposons has yielded a large resource of insertion alleles affecting nearly 4000 yeast genes in total. Through well-established protocols, these insertion libraries can be introduced into the desired strain backgrounds and the resulting insertional mutants can be screened or systematically analyzed. Relative to alternative methods of UV irradiation or chemical mutagenesis, transposon-insertion alleles can be easily identified by PCR-based approaches or high-throughput sequencing. Transposon-insertion libraries also provide a cost-effective alternative to targeted deletion approaches, although, in contrast to start-codon to stop-codon deletions, insertion alleles might not represent true null-mutants. For protein-localization studies, transposon-insertion alleles can provide encoded epitope tags in-frame with internal codons; in many cases, these transposon-encoded epitope tags can provide a more accurate localization for proteins in which terminal sequences are crucial for intracellular targeting. Thus, overall, transposon-insertion libraries can be used quickly and economically and have a particular utility in screening for desired phenotypes and localization patterns in nonstandard genetic backgrounds. PMID:27250950

  8. Pentose utilization in yeasts: Physiology and biochemistry

    Energy Technology Data Exchange (ETDEWEB)

    Jeppson, H.

    1996-04-01

    The fermentive performance of bacteria, yeasts, and filamentous fungi was investigated in a pentose (xylose)-rich lignocellulosic hydrolyzate. The filamentous fungus Fusarium oxysporum and the xylose-fermenting yeast Pichia stipitis were found to be very sensitive to the inhibiting hydrolyzate. Recombinant xylose-utilizing Saccharomyces cerevisiae showed very poor ethanol formation from xylose; xylitol being the major product formed. The highest ethanol yields were obtained with recombinant Escherichia coli KO11, however, for maximal ethanol yield detoxification of the hydrolyzate was required. The influence of oxygen on the regulation of carbohydrate metabolism in the xylose-fermenting yeast P. stipitis CBS 6054 was investigated. A low and well-controlled level of oxygenation has been found to be required for efficient ethanol formation from xylose by the xylose-fermenting yeasts. The requirement of oxygen is frequently ascribed to the apparent redox imbalance which develops under anaerobic conditions due to the difference in co-factor utilization of the two first enzymes in the xylose metabolism, further reflected in xylitol excretion. However, a low and well controlled level of oxygenation for maximal ethanol production from glucose was also demonstrated, suggesting that the oxygen requirement is not only due to the dual co-factor utilization, but also serves other purposes. Cyanide-insensitive and salicyl hydroxamic acid-sensitive respiration (CIR) was found in P. stipitis. CIR is suggested to act as a redox sink preventing xylitol formation in P. stipitis under oxygen-limited xylose fermentations. Xylitol metabolism by P. stipitis CBS 6054 was strictly respiratory and ethanol was not formed under any conditions. The absence of ethanol formation was not due to a lack of fermentative enzymes, since the addition of glucose to xylitol-pregrown cells resulted in ethanol formation. 277 refs, 5 figs, 7 tabs

  9. Kinetics of hairpin ribozyme cleavage in yeast.

    OpenAIRE

    Donahue, C P; Fedor, M J

    1997-01-01

    Hairpin ribozymes catalyze a self-cleavage reaction that provides a simple model for quantitative analyses of intracellular mechanisms of RNA catalysis. Decay rates of chimeric mRNAs containing self-cleaving ribozymes give a direct measure of intracellular cleavage kinetics in yeast. Intracellular ribozyme-mediated cleavage occurs at similar rates and shows similar inhibition by ribozyme mutations as ribozyme-mediated reactions in vitro, but only when ribozymes are located in a favorable mRNA...

  10. Regulation of phospholipid synthesis in yeast

    OpenAIRE

    Carman, George M.; Han, Gil-Soo

    2009-01-01

    Phospholipid synthesis in the yeast Saccharomyces cerevisiae is a complex process that involves regulation by both genetic and biochemical mechanisms. The activity levels of phospholipid synthesis enzymes are controlled by gene expression (e.g., transcription) and by factors (lipids, water-soluble phospholipid precursors and products, and covalent modification of phosphorylation) that modulate catalysis. Phosphatidic acid, whose levels are controlled by the biochemical regulation of key phosp...

  11. Population genomics of domestic and wild yeasts

    OpenAIRE

    Liti, Gianni; Carter, David M.; Moses, Alan M.; Warringer, Jonas; Parts, Leopold; James, Stephen A.; Davey, Robert P.; Roberts, Ian N.; Burt, Austin; Koufopanou, Vassiliki; Tsai, Isheng J.; Bergman, Casey M.; Bensasson, Douda; O'Kelly, Michael J.T.; van Oudenaarden, Alexander

    2009-01-01

    Since the completion of the genome sequence of Saccharomyces cerevisiae in 19961,2, there has been an exponential increase in complete genome sequences accompanied by great advances in our understanding of genome evolution. Although little is known about the natural and life histories of yeasts in the wild, there are an increasing number of studies looking at ecological and geographic distributions3,4, population structure5-8, and sexual versus asexual reproduction9,10. Less well understood a...

  12. Conflict between noise and plasticity in yeast.

    OpenAIRE

    Lehner, Ben

    2010-01-01

    Gene expression responds to changes in conditions but also stochastically among individuals. In budding yeast, both expression responsiveness across conditions (“plasticity”) and cell-to-cell variation (“noise”) have been quantified for thousands of genes and found to correlate across genes. It has been argued therefore that noise and plasticity may be strongly coupled and mechanistically linked. This is consistent with some theoretical ideas, but a strong coupling between noise and plasticit...

  13. Raman Microspectroscopy of the Yeast Vacuoles

    Czech Academy of Sciences Publication Activity Database

    Bednárová, Lucie; Palacký, J.; Bauerová, Václava; Hrušková-Heidingsfeldová, Olga; Pichová, Iva; Mojzeš, P.

    2012-01-01

    Roč. 27, 5-6 (2012), s. 503-507. ISSN 0712-4813 R&D Projects: GA ČR GAP208/10/0376; GA ČR GA310/09/1945 Institutional research plan: CEZ:AV0Z40550506 Keywords : Raman microspectroscopy * living cell * yeast * vacuole * chemical composition * polyphospate * Candida albicans Subject RIV: CE - Biochemistry Impact factor: 0.530, year: 2012

  14. Vacuole Partitioning during Meiotic Division in Yeast

    OpenAIRE

    Roeder, A D; Shaw, J.M.

    1996-01-01

    We have examined the partitioning of the yeast vacuole during meiotic division. In pulse-chase experiments, vacuoles labeled with the lumenal ade2 fluorophore or the membrane-specific dye FM 4-64 were not inherited by haploid spores. Instead, these fluorescent markers were excluded from spores and trapped between the spore cell walls and the ascus. Serial optical sections using a confocal microscope confirmed that spores did not inherit detectable amounts of fluorescently labeled vacuoles. Mo...

  15. Raman microspectroscopy of the yeast vacuoles

    Czech Academy of Sciences Publication Activity Database

    Bednárová, Lucie; Gregorová, Š.; Bauerová, Václava; Hrušková-Heidingsfeldová, Olga; Palacký, J.; Mojzeš, P.

    2014-01-01

    Roč. 21, č. 1 (2014), s. 15. ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /12./. 13.03.2014-15.03.2014, Nové Hrady] R&D Projects: GA ČR GAP208/10/0376 Institutional support: RVO:61388963 Keywords : Raman microspectroscopy * yeast vacuoles Subject RIV: CF - Physical ; Theoretical Chemistry

  16. Yeast Oligo-mediated Genome Engineering (YOGE)

    OpenAIRE

    DiCarlo, JE; Conley, AJ; Penttilä, M; Jäntti, J; Wang, HH; Church, GM

    2013-01-01

    High-frequency oligonucleotide-directed recombination engineering (recombineering) has enabled rapid modification of several prokaryotic genomes to date. Here, we present a method for oligonucleotide-mediated recombineering in the model eukaryote and industrial production host S. cerevisiae, which we call Yeast Oligo-mediated Genome Engineering (YOGE). Through a combination of overexpression and knockouts of relevant genes and optimization of transformation and oligonucleotide designs, we ach...

  17. Yeast Interactions in Inoculated Wine Fermentation

    OpenAIRE

    Ciani, Maurizio; Capece, Angela; Comitini, Francesca; Canonico, Laura; Siesto, Gabriella; Romano, Patrizia

    2016-01-01

    The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the diffe...

  18. Zinc accumulation and utilization by wine yeasts

    OpenAIRE

    Walker, Graeme

    2009-01-01

    Raffaele De Nicola1,3, Nichola Hall2,3, Tatiana Bollag3, Georgios Thermogiannis3, Graeme M Walker31DSM Nutritional Products, Dept. NRD/CX, Basel, Switzerland; 2Vinquiry, Inc. Windsor, CA, USA; 3School of Contemporary Sciences, University of Abertay Dundee, Dundee, UK Abstract: The present study has focused on the accumulation of zinc by wine yeast strains of Saccharomyces cerevisiae during fermentation of both grape juice and chemically defined medium with different carbohydrates and...

  19. Sugarcane bagasse hydrolysis using yeast cellulolytic enzymes.

    Science.gov (United States)

    Souza, Angelica Cristina de; Carvalho, Fernanda Paula; Silva e Batista, Cristina Ferreira; Schwan, Rosane Freitas; Dias, Disney Ribeiro

    2013-10-28

    Ethanol fuel production from lignocellulosic biomass is emerging as one of the most important technologies for sustainable development. To use this biomass, it is necessary to circumvent the physical and chemical barriers presented by the cohesive combination of the main biomass components, which hinders the hydrolysis of cellulose and hemicellulose into fermentable sugars. This study evaluated the hydrolytic capacity of enzymes produced by yeasts, isolated from the soils of the Brazilian Cerrado biome (savannah) and the Amazon region, on sugarcane bagasse pre-treated with H2SO4. Among the 103 and 214 yeast isolates from the Minas Gerais Cerrado and the Amazon regions, 18 (17.47%) and 11 (5.14%) isolates, respectively, were cellulase-producing. Cryptococcus laurentii was prevalent and produced significant β- glucosidase levels, which were higher than the endo- and exoglucanase activities. In natura sugarcane bagasse was pre-treated with 2% H2SO4 for 30 min at 150oC. Subsequently, the obtained fibrous residue was subjected to hydrolysis using the Cryptococcus laurentii yeast enzyme extract for 72 h. This enzyme extract promoted the conversion of approximately 32% of the cellulose, of which 2.4% was glucose, after the enzymatic hydrolysis reaction, suggesting that C. laurentii is a good β-glucosidase producer. The results presented in this study highlight the importance of isolating microbial strains that produce enzymes of biotechnological interest, given their extensive application in biofuel production. PMID:23851270

  20. Comparative genomics of biotechnologically important yeasts.

    Science.gov (United States)

    Riley, Robert; Haridas, Sajeet; Wolfe, Kenneth H; Lopes, Mariana R; Hittinger, Chris Todd; Göker, Markus; Salamov, Asaf A; Wisecaver, Jennifer H; Long, Tanya M; Calvey, Christopher H; Aerts, Andrea L; Barry, Kerrie W; Choi, Cindy; Clum, Alicia; Coughlan, Aisling Y; Deshpande, Shweta; Douglass, Alexander P; Hanson, Sara J; Klenk, Hans-Peter; LaButti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lipzen, Anna M; Meier-Kolthoff, Jan P; Ohm, Robin A; Otillar, Robert P; Pangilinan, Jasmyn L; Peng, Yi; Rokas, Antonis; Rosa, Carlos A; Scheuner, Carmen; Sibirny, Andriy A; Slot, Jason C; Stielow, J Benjamin; Sun, Hui; Kurtzman, Cletus P; Blackwell, Meredith; Grigoriev, Igor V; Jeffries, Thomas W

    2016-08-30

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the clade sister to the known CUG-Ser clade. Our well-resolved yeast phylogeny shows that some traits, such as methylotrophy, are restricted to single clades, whereas others, such as l-rhamnose utilization, have patchy phylogenetic distributions. Gene clusters, with variable organization and distribution, encode many pathways of interest. Genomics can predict some biochemical traits precisely, but the genomic basis of others, such as xylose utilization, remains unresolved. Our data also provide insight into early evolution of ascomycetes. We document the loss of H3K9me2/3 heterochromatin, the origin of ascomycete mating-type switching, and panascomycete synteny at the MAT locus. These data and analyses will facilitate the engineering of efficient biosynthetic and degradative pathways and gateways for genomic manipulation. PMID:27535936

  1. [Determination of riboflavin kinase activity in yeast].

    Science.gov (United States)

    Shavlovsky, G M; Kashchenko, V E

    1975-01-01

    It is established that the main reason of the riboflavin kinase (RFK, EC 2.7.1.26) low specific activity in the cell-free extracts of the yeast Pichia guillermondii Wickerham ATCC 9058 is the presence of alkaline phosphatase (EC 3.1.3.1), effectively destructing flaven mononucleotide. By chromatography of the cell-free extracts of P. guillermondii on DEAE-Sephadex A-50, CM-Sphadex C-50, CM-cellulose, Sephadexes G-75 and G-100 RFK and alkaline phosphatase may be separated completely. Any of these procedures results in a several times increase of the RFK activity as compared with the initial preparation. One failed to obtain a similar effect by fractionation of the extracts with amminium sulphate and by hydroxylapatite chromatography. A simple method is developed for determining the activity of RFK in the cell-free extracts of yeast on the basis of negative adsorption of this enzyme on DEAE-Sephadex A-50. A selective inhibition of alkaline phosphatase by ions Be2+ and F- yields a less satisfactory result. The data are presented on the PFK activity of certain species of flavinogenic (Pichia guillermondii, Torulopsis camdida) and non-flavinogenic (Pichia ohmeri, Candida utilis, Saccharomyces cervisiae) yeast. PMID:174262

  2. YeastMed: an XML-Based System for Biological Data Integration of Yeast

    CERN Document Server

    Briache, Abdelaali; Kerzazi, Amine; Navas-Delgado, Ismael; Montes, Jose F Aldana; Hassani, Badr D Rossi; Lairini, Khalid

    2010-01-01

    A key goal of bioinformatics is to create database systems and software platforms capable of storing and analysing large sets of biological data. Hundreds of biological databases are now available and provide access to huge amount of biological data. SGD, Yeastract, CYGD-MIPS, BioGrid and PhosphoGrid are five of the most visited databases by the yeast community. These sources provide complementary data on biological entities. Biologists are brought systematically to query these data sources in order to analyse the results of their experiments. Because of the heterogeneity of these sources, querying them separately and then manually combining the returned result is a complex and laborious task. To provide transparent and simultaneous access to these sources, we have developed a mediator-based system called YeastMed. In this paper, we present YeastMed focusing on its architecture.

  3. Black yeast-like fungi in skin and nail

    DEFF Research Database (Denmark)

    Saunte, D M; Tarazooie, B; Arendrup, M C;

    2011-01-01

    Black yeast-like fungi are rarely reported from superficial infections. We noticed a consistent prevalence of these organisms as single isolations from mycological routine specimens. To investigate the prevalence of black yeast-like fungi in skin, hair and nail specimens and to discuss...... the probability of these species to be involved in disease. Slow-growing black yeast-like fungi in routine specimens were prospectively collected and identified. A questionnaire regarding patient information was sent to physicians regarding black yeast-like fungus positive patients. A total of 20 746...... dermatological specimens were examined by culture. Black yeast-like fungi accounted for 2.2% (n = 108) of the positive cultures. Only 31.0% of the samples, culture positive for black yeast-like fungi were direct microscopy positive when compared with overall 68.8% of the culture positive specimens. The most...

  4. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    Science.gov (United States)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  5. Biosorption of nickel by yeasts in an osmotically unsuitable environment

    Energy Technology Data Exchange (ETDEWEB)

    Breierova, Emilia; Kovarova, Annamaria [SAS, Bratislava (Slovakia). Inst. of Chemistry; Certik, Milan [SUT, Bratislava (Slovakia). Dept. of Biochemical Technology; Gregor, Tomas [Mendel Univ. of Agriculture and Forestry, Brno (Czech Republic)

    2008-11-15

    The tolerance, sorption of nickel(II) ions, and changes in the production and composition of exopolymers of eight yeast strains grown under nickel presence with/without NaCl were studied. Strains of Pichia anomala and Candida maltosa known as the most resistant yeasts against nickel tolerated up to 3 mm Ni{sup 2+}. NaCl addition decreased both the resistance ofthe yeast strains toward nickel ions and the sorption of metal ions into cells. All yeasts absorbed nickel predominantly into exopolymers (glycoproteins) and on the surface of cells. However, while the amount of polysaccharide moieties of exoglycoproteins of most of the resistant yeasts was induced by stress conditions, the ratio polysaccharide/protein in the exopolymers remained unchanged in the sensitive species Cystofilobasidium. The exopolymer composition might play a key role in yeast adaptation to stress conditions caused by heavy metal ions. (orig.)

  6. Why, when, and how did yeast evolve alcoholic fermentation?

    OpenAIRE

    Dashko, Sofia; Zhou, Nerve; Compagno, Concetta; Piškur, Jure

    2014-01-01

    The origin of modern fruits brought to microbial communities an abundant source of rich food based on simple sugars. Yeasts, especially Saccharomyces cerevisiae, usually become the predominant group in these niches. One of the most prominent and unique features and likely a winning trait of these yeasts is their ability to rapidly convert sugars to ethanol at both anaerobic and aerobic conditions. Why, when, and how did yeasts remodel their carbon metabolism to be able to accumulate ethanol u...

  7. Measuring Replicative Life Span in the Budding Yeast

    OpenAIRE

    Steffen, Kristan K.; Kennedy, Brian K.; Kaeberlein, Matt

    2009-01-01

    Aging is a degenerative process characterized by a progressive deterioration of cellular components and organelles resulting in mortality. The budding yeast Saccharomyces cerevisiae has been used extensively to study the biology of aging, and several determinants of yeast longevity have been shown to be conserved in multicellular eukaryotes, including worms, flies, and mice 1. Due to the lack of easily quantified age-associated phenotypes, aging in yeast has been assayed almost exclusively by...

  8. Gas bubble formation in the cytoplasm of a fermenting yeast

    OpenAIRE

    Swart, Chantel W.; Dithebe, Khumisho; Pohl, Carolina H.; Swart, Hendrik C.; Coetsee, Elizabeth; van Wyk, Pieter WJ; Swarts, Jannie C.; Lodolo, Elizabeth J; Kock, Johan LF

    2012-01-01

    Abstract Current paradigms assume that gas bubbles cannot be formed within yeasts although these workhorses of the baking and brewing industries vigorously produce and release CO2 gas. We show that yeasts produce gas bubbles that fill a significant part of the cell. The missing link between intracellular CO2 production by glycolysis and eventual CO2 release from cells has therefore been resolved. Yeasts may serve as model to study CO2 behavior under pressurized conditions that may impact on f...

  9. Biodiversity of Yeasts During Plum Wegierka Zwykla Spontaneous Fermentation

    OpenAIRE

    Satora, Pawel; Tuszynski, Tadeusz

    2005-01-01

    The study comprises an analysis of the yeast microbiota that participated in the spontaneous fermentation of crushed Wegierka Zwykla plum fruit, which is the raw material for slivovitz production in the mountain region in the south of Poland. Saccharomyces cerevisiae yeast strains were differentiated by means of the killer sensitivity analysis related to a killer reference panel of 9 well-known killer yeast strains. The first phase of the fermentation was dominated by the representatives of K...

  10. Probiotic properties of yeasts occurring in fermented food and beverages

    DEFF Research Database (Denmark)

    Jespersen, Lene

    Besides being able to improve the quality and safety of many fermented food and beverages some yeasts offer a number of probiotic traits. Especially a group of yeast referred to as "Saccharomyces boulardii", though taxonomically belonging to Saccharomyces cerevisiae, has been claimed to have...... probiotic properties. Besides, yeasts naturally occurring globally in food and beverages will have traits that might have a positive impact on human health....

  11. Responses of Yeast Biocontrol Agents to Environmental Stress

    OpenAIRE

    Sui, Yuan; Wisniewski, Michael; Droby, Samir; Liu, Jia

    2015-01-01

    Biological control of postharvest diseases, utilizing wild species and strains of antagonistic yeast species, is a research topic that has received considerable attention in the literature over the past 30 years. In principle, it represents a promising alternative to chemical fungicides for the management of postharvest decay of fruits, vegetables, and grains. A yeast-based biocontrol system is composed of a tritrophic interaction between a host (commodity), a pathogen, and a yeast species, a...

  12. Dietary glucose regulates yeast consumption in adult Drosophila males

    OpenAIRE

    Sebastien eLebreton; Peter eWitzgall; Marie eOlsson; Becher, Paul G.

    2014-01-01

    The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies ...

  13. Mediated Electrochemical Measurements of Intracellular Catabolic Activities of Yeast Cells

    Institute of Scientific and Technical Information of China (English)

    Jin Sheng ZHAO; Zhen Yu YANG; Yao LU; Zheng Yu YANG

    2005-01-01

    Coupling with the dual mediator system menadione/ferricyanide, microelectrode voltammetric measurements were undertaken to detect the ferrocyanide accumulations arising from the mediated reduction of ferricyanide by yeast cells. The results indicate that the dual mediator system menadione/ferricyanide could be used as a probe to detect cellular catabolic activities in yeast cells and the electrochemical response has a positive relationship with the specific growth rate of yeast cells.

  14. Whole Genome Analysis of a Wine Yeast Strain

    OpenAIRE

    Hauser, Nicole C.; Kurt Fellenberg; Rosario Gil; Sonja Bastuck; Hoheisel, Jörg D; Pérez-Ortín, José E.

    2001-01-01

    Saccharomyces cerevisiae strains frequently exhibit rather specific phenotypic features needed for adaptation to a special environment. Wine yeast strains are able to ferment musts, for example, while other industrial or laboratory strains fail to do so. The genetic differences that characterize wine yeast strains are poorly understood, however. As a first search of genetic differences between wine and laboratory strains, we performed DNA-array analyses on the typical wine yeast strain T73 an...

  15. Aboveground Deadwood Deposition Supports Development of Soil Yeasts

    Directory of Open Access Journals (Sweden)

    Thorsten Wehde

    2012-12-01

    Full Text Available Unicellular saprobic fungi (yeasts inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil-borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon. Unlike soils underneath logs, yeast communities in adjacent areas harbored a considerable number of transient (phylloplane-related yeasts reaching 30% of the total yeast quantity. We showed that distinguishing autochthonous community members and species transient in soils is essential to estimate appropriate effects of environmental factors on soil fungi. Furthermore, a better understanding of species niches is crucial for analyses of culture-independent data, and may hint to the discovery of unifying patterns of microbial species distribution.

  16. Yeast as a platform to explore polyglutamine toxicity and aggregation.

    Science.gov (United States)

    Duennwald, Martin L

    2013-01-01

    Protein misfolding is associated with many neurodegenerative diseases, including neurodegenerative diseases caused by polyglutamine expansion proteins, such as Huntington's disease. The model organism baker's yeast (Saccharomyces cerevisiae) has provided important general insights into the basic cellular mechanisms underlying protein misfolding. Furthermore, experiments in yeast have identified cellular factors that modulate the toxicity and the aggregation associated with polyglutamine expansion proteins. Notably, many features discovered in yeast have been proven to be highly relevant in other model organisms and in human pathology. The experimental protocols depicted here serve to reliably determine polyglutamine toxicity and polyglutamine aggregation in yeast. PMID:23719914

  17. Differential Adsorption of Ochratoxin A and Anthocyanins by Inactivated Yeasts and Yeast Cell Walls during Simulation of Wine Aging

    OpenAIRE

    Leonardo Petruzzi; Antonietta Baiano; Antonio De Gianni; Milena Sinigaglia; Maria Rosaria Corbo; Antonio Bevilacqua

    2015-01-01

    The adsorption of ochratoxin A (OTA) by yeasts is a promising approach for the decontamination of musts and wines, but some potential competitive or interactive phenomena between mycotoxin, yeast cells, and anthocyanins might modify the intensity of the phenomenon. The aim of this study was to examine OTA adsorption by two strains of Saccharomyces cerevisiae (the wild strain W13, and the commercial isolate BM45), previously inactivated by heat, and a yeast cell wall preparation. Experiments w...

  18. Biodiversity of Saccharomyces yeast strains from grape berries of wine-producing areas using starters commercial yeasts

    OpenAIRE

    Valero, Eva; Cambon, Brigitte; Schuller, Dorit Elisabeth; Casal, Margarida; Dequin, Sylvie

    2007-01-01

    The use of commercial wine yeast strains as starters has been extensively generalised over the past two decades. In this study, a large scale sampling plan was devised over a period of three years in three different vineyards in the south of France, to evaluate autochthonous wine yeast biodiversity in vineyards around wineries where active dry yeasts have been used as fermentation starters during more than 5 years. 72 spontaneous fermentations were performed from a total of 106 grape samples,...

  19. Screening of basidiomycetes for the production of exopolysaccharide and biomass in submerged culture Triagem de basidiomicetos para a produção de exopolissacarídeos e biomassa em cultura líquida

    OpenAIRE

    Rosana Maziero; Valeria Cavazzoni; Vera Lúcia Ramos Bononi

    1999-01-01

    Fifty-six strains of Basidiomycetes, including native Brazilian fungi isolated from different ecosystems and edible mushrooms, were screened for production of exopolysaccharides and biomass in submerged culture. Agaricus sp. (CCB 280) and Oudemansiella canarii (Jungh.) Hohn (CCB 179) were the highest exopolysaccharide producers (6.01 and 3.54 g dry w./l respectively) after 7 days of incubation. The best producer of biomass was Schizophyllum commune Fr.:Fr. (CCB 473) with 16.68 g dry w./l in 1...

  20. Yeast Interacting Proteins Database: YMR294W, YLL049W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YMR294W JNM1 Component of the yeast dynactin complex, consisting of Nip100p, Jnm1p, and Arp1p; r ... equired for proper nuclear migration ... and spindle partitioning during mitotic anaphase B ... Protein of unknown function; required for nuclear migration ; null mutant shows a reduced affinity for the alci ...

  1. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2013-05-14

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  2. Genetically modified yeast species and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet (Kingsport, TN); Koivuranta, Kari (Helsinki, FI); Penttila, Merja (Helsinki, FI); Ilmen, Marja (Helsinki, FI); Suominen, Pirkko (Maple Grove, MN); Aristidou, Aristos (Maple Grove, MN); Miller, Christopher Kenneth (Cottage Grove, MN); Olson, Stacey (St. Bonifacius, MN); Ruohonen, Laura (Helsinki, FI)

    2011-05-17

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  3. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2014-01-07

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  4. Studies on the yeast nucleus : III. Properties of a deoxyribonucleoprotein complex derived from yeast

    NARCIS (Netherlands)

    Vliet, P.C. van der; Tonino, G.J.M.; Rozijn, Th.H.

    1969-01-01

    1. A deoxyribonucleoprotein complex was isolated from Saccharomyces cerevisiae. It is composed of 36% DNA, 4% RNA and 60% protein. About 70% of the protein is acid-extractable. The complex sediments as a single band with a s°20,w of 27 S. 2. The yeast deoxyribonucleoprotein shows a biphasic melting

  5. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2016-08-09

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  6. How does yeast respond to pressure?

    Directory of Open Access Journals (Sweden)

    Fernandes P.M.B.

    2005-01-01

    Full Text Available The brewing and baking yeast Saccharomyces cerevisiae has been used as a model for stress response studies of eukaryotic cells. In this review we focus on the effect of high hydrostatic pressure (HHP on S. cerevisiae. HHP exerts a broad effect on yeast cells characteristic of common stresses, mainly associated with protein alteration and lipid bilayer phase transition. Like most stresses, pressure induces cell cycle arrest. Below 50 MPa (500 atm yeast cell morphology is unaffected whereas above 220 MPa wild-type cells are killed. S. cerevisiae cells can acquire barotolerance if they are pretreated with a sublethal stress due to temperature, ethanol, hydrogen peroxide, or pressure. Nevertheless, pressure only leads to protection against severe stress if, after pressure pretreatment, the cells are also re-incubated at room pressure. We attribute this effect to the inhibition of the protein synthesis apparatus under HHP. The global genome expression analysis of S. cerevisiae cells submitted to HHP revealed a stress response profile. The majority of the up-regulated genes are involved in stress defense and carbohydrate metabolism while most repressed genes belong to the cell cycle progression and protein synthesis categories. However, the signaling pathway involved in the pressure response is still to be elucidated. Nitric oxide, a signaling molecule involved in the regulation of a large number of cellular functions, confers baroprotection. Furthermore, S. cerevisiae cells in the early exponential phase submitted to 50-MPa pressure show induction of the expression level of the nitric oxide synthase inducible isoform. As pressure becomes an important biotechnological tool, studies concerning this kind of stress in microorganisms are imperative.

  7. Biological Effects of Yeast β-Glucans

    Directory of Open Access Journals (Sweden)

    Vlatka Petravić-tominac

    2010-12-01

    Full Text Available β-Glucans are glucose polymers that naturally occur in yeasts, molds, algae, mushrooms, bacteria, oats and barley. Immunostimulation is one of the most important properties of β-glucans. They are classified as biological response modifiers and because of their biological activities they can be used in human and veterinary medicine and pharmacy. Additionally, β-glucans show interesting physicochemical properties and therefore could be applied in food and feed production as well as in cosmetic and chemical industries. Immunomodulation by β-glucan, both in vitro and in vivo, inhibits cancer cell growth and metastasis and prevents or reduces bacterial infection. In humans, dietary β-glucan lowers blood cholesterol, improves glucose utilization by body cells and also helps wound healing. β-Glucans work, in part, by stimulating the innate immune mechanism to fight a range of foreign challenges and could be used as an adjuvant, in combination with anti infective or antineoplastic agents, radiotherapy, and a range of topical agents and nutrients. The structure of β-glucans depends on the source they are isolated from. Native β-glucan molecules can be linked and branched in several ways. Biological properties of different β-glucan molecules are dependent on their molecular structure. Some authors claim that the β-(1→3, (1→6-glucan derived from yeast Saccharomyces cerevisiae produce the highest biological effects. Thus, in this review the β-glucans and their metabolic activity are discussed, with the special accent on those isolated from yeast. Other possible β-glucan applications, directed to cosmetic production, non-medical application in pharmaceutical and chemical industry, are also discussed.

  8. Detection and identification of wild yeasts in lager breweries.

    Science.gov (United States)

    van der Aa Kühle, A; Jespersen, L

    1998-09-01

    Wild yeasts were detected in 41 out of 101 brewery yeast samples investigated using six different selective principles. Malt extract, yeast extract, glucose, peptone (MYGP) agar supplemented with 195 ppm CuSO4 was found to be the most effective selective principle, detecting wild yeasts in 80% of the contaminated samples. Both Saccharomyces and non-Saccharomyces wild yeasts were detected on this medium. Lysine medium, crystal violet medium and incubation of non-selective media at 37 degrees C detected wild yeasts in 46-56% of the contaminated samples. On using actidione medium, only 20% of the wild yeasts were detected. The combined use of MYGP supplemented with 195 ppm CuSO4 and one of the other selective principles did not improve the recovery of the wild yeasts. The wild yeasts found consisted of Saccharomyces cerevisiae (57%), Pichia spp. (28%) and Candida spp. (15%). Using the API ID 32 C kit, 35 different assimilation profiles were obtained for the 124 wild yeast isolates investigated. All isolates were capable of glucose assimilation, whereas only 79% of the isolates assimilated saccharose, 75% maltose, 70% galactose, 65% raffinose and 65% lactate. Lactose, inositol, rhamnose and glucuronate were not assimilated by any of the isolates. The differences in assimilation pattern did not reflect any differences in recovery by the selective principles investigated. The majority of the wild yeast isolates investigated were capable of growth in wort and beer, indicating their possible role as spoilage organisms. The Sacch. cerevisiae isolates were found to be the most hazardous, with some isolates being capable of extensive growth in bottled beer within seventeen days at ambient temperature. PMID:9801196

  9. Alteration of yeast activity by gamma radiation

    International Nuclear Information System (INIS)

    Yeast is an important component in microbe based industrial technologies. Due to the techno-economic reasons, the fermentation technique has acquired renewed interest. The effect of γ-radiation on the fermentation reaction has been investigated. The studies show that exposure of the fermentation mixture to γ-radiation at 5 kGy enhance alcohol production, whereas irradiation at higher doses, viz., 10 kGy and 25 kGy caused a considerable reduction in the alcohol yield. Therefore, low dose irradiation of fermentation mixtures can be applied for increasing the alcohol production by about 25%. (author). 13 refs., 1 fig

  10. Thermotolerant yeasts and application for ethanol production

    OpenAIRE

    To-on, N.; Charernjiratrakul, W.; Dissara, Y.

    2007-01-01

    A total of 70 thermotolerant yeast strains were isolated at 40oC from 145 samples including fruit, leaves, flowers, soils and oil-palm fruits. Six isolates showed maximum growth at 40oC within 18 h. Three isolates (MIY1, MIY48 and MIY57) were selected based on their ability to ferment glucose and sucrose rapidly (24 h) and showed the maximum temperature for growth at 42oC but it was good at 40oC. MIY57 produced 4.6% (v/v) ethanol at 40oC from a medium containing 15% glucose. The optimum culti...

  11. Optimized Affinity Capture of Yeast Protein Complexes.

    Science.gov (United States)

    LaCava, John; Fernandez-Martinez, Javier; Hakhverdyan, Zhanna; Rout, Michael P

    2016-01-01

    Here, we describe an affinity isolation protocol. It uses cryomilled yeast cell powder for producing cell extracts and antibody-conjugated paramagnetic beads for affinity capture. Guidelines for determining the optimal extraction solvent composition are provided. Captured proteins are eluted in a denaturing solvent (sodium dodecyl sulfate polyacrylamide gel electrophoresis sample buffer) for gel-based proteomic analyses. Although the procedures can be modified to use other sources of cell extract and other forms of affinity media, to date we have consistently obtained the best results with the method presented. PMID:27371596

  12. Assessment of Yeast Aging by Flow Cytometry

    Czech Academy of Sciences Publication Activity Database

    Baszczyňski, Martin; Kuřec, M.; Novák, Pavel; Brányik, Tomáš; Růžička, Marek; Drahoš, Jiří

    Bratislava : Slovak University of Technology, 2009 - (Markoš, J.), s. 317 ISBN 978-80-227-3072-3. [International Conference of Slovak Society of Chemical Engineering /36./. Tatranské Matliare (SK), 25.05.2009-29.05.2009] R&D Projects: GA ČR GA104/07/1110; GA ČR(CZ) GD104/08/H055; GA ČR GA104/06/1418 Institutional research plan: CEZ:AV0Z40720504 Keywords : yeast * aging * bud scars Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  13. UBA domain containing proteins in fission yeast

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Semple, Colin A M; Ponting, Chris P;

    2003-01-01

    and transcription. Considering this variety of cell biological processes, it is puzzling that until recently only very few proteins were known to possess the ability to interact specifically with ubiquitin chains. However, several ubiquitin binding proteins have now been identified and the binding domains have been...... characterised on both the functional and structural levels. One example of a widespread ubiquitin binding module is the ubiquitin associated (UBA) domain. Here, we discuss the approximately 15 UBA domain containing proteins encoded in the relatively small genome of the fission yeast Schizosaccharomyces pombe...

  14. Flor yeast: new perspectives beyond wine aging

    OpenAIRE

    Legras, Jean Luc; Jaime MORENO-GARCIA; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum o...

  15. Functional differences in yeast protein disulfide isomerases

    DEFF Research Database (Denmark)

    Nørgaard, P; Westphal, V; Tachibana, C;

    2001-01-01

    PDI1 is the essential gene encoding protein disulfide isomerase in yeast. The Saccharomyces cerevisiae genome, however, contains four other nonessential genes with homology to PDI1: MPD1, MPD2, EUG1, and EPS1. We have investigated the effects of simultaneous deletions of these genes. In several...... essentiality of protein disulfide isomerase-catalyzed oxidation. Most mutant combinations show defects in carboxypeptidase Y folding as well as in glycan modification. There are, however, no significant effects on ER-associated protein degradation in the various protein disulfide isomerase-deleted strains....

  16. The economics of ribosome biosynthesis in yeast.

    Science.gov (United States)

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  17. Flor yeast: new perspectives beyond wine ageing

    OpenAIRE

    Jean-luc eLegras; Jaime eMoreno García; Severino eZara; Giacomo eZara; Teresa eGarcia Martinez; Ilaria Maria Mannazzu; Juan Carlos Mauricio; Anna Lisa Coi; Marc eBou Zeidan; Sylvie eDequin; Juan eMoreno; Marilena eBudroni

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the ageing of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air-liquid biofilm on the wine surface, which is also known as the velum...

  18. Flor yeast: new perspectives beyond wine aging

    OpenAIRE

    Legras, Jean Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    Pas de clé UT The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen andfermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also kno...

  19. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones Data detail Data name 5'-end sequence...s of budding yeast full-length cDNA clones Description of data contents cDNA sequence...e Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive ...

  20. New yeast-based approaches in production of palmitoleic acid

    Czech Academy of Sciences Publication Activity Database

    Kolouchová, I.; Sigler, Karel; Schreiberová, O.; Masák, J.; Řezanka, Tomáš

    2015-01-01

    Roč. 192, SEP 2015 (2015), s. 726-734. ISSN 0960-8524 R&D Projects: GA ČR(CZ) GAP503/11/0215; GA ČR GA14-00227S Institutional support: RVO:61388971 Keywords : Oleaginous yeasts * Non-oleaginous yeasts * Palmitoleic acid Subject RIV: EE - Microbiology, Virology Impact factor: 4.494, year: 2014

  1. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  2. The Metabolic Synchronization of Immobilized Yeast Cells: Effect of Matrices

    Czech Academy of Sciences Publication Activity Database

    Bolyó, Juraj; Mair, T.; Kuncová, Gabriela

    -: -, 2009, s. 1-1. ISBN N. [Conference on Functional Dynamics. Cascais (PT), 02.03.2009-05.03.2009] R&D Projects: GA MŠk OC 121 Institutional research plan: CEZ:AV0Z40720504 Keywords : yeast * immobilized yeast cells Subject RIV: CE - Biochemistry

  3. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  4. Dielectric modelling of cell division for budding and fission yeast

    Science.gov (United States)

    Asami, Koji; Sekine, Katsuhisa

    2007-02-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast.

  5. [Determination of the total quantity of carbohydrates in dried yeast].

    Science.gov (United States)

    Maksimenko, O A; Ziukova, L A; Fedorovich, R M

    1975-01-01

    Different colourimetric methods for measuring carbohydrates in yeast have been compared. A method using 5% phenol aqueous solution in the presence of concentrated sulphuric acid has been developed to quantitate carbohydrates. The method has been described as applied to an analysis of dry yeast. PMID:1129224

  6. Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

    Science.gov (United States)

    Deutch, Charles E.; Marshall, Pamela A.

    2008-01-01

    In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

  7. Quantitative phosphoproteomics applied to the yeast pheromone signaling pathway

    DEFF Research Database (Denmark)

    Gruhler, Albrecht; Olsen, Jesper Velgaard; Mohammed, Shabaz;

    2005-01-01

    /MS/MS) for identification. This integrated phosphoproteomic technology identified and quantified phosphorylation in key regulator and effector proteins of a prototypical G-protein-coupled receptor signaling pathway, the yeast pheromone response. SILAC encoding of yeast proteomes was achieved by incorporation...

  8. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall betwe

  9. 21 CFR 573.750 - Pichia pastoris dried yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Pichia pastoris dried yeast. 573.750 Section 573.750 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Food Additive Listing § 573.750 Pichia pastoris dried yeast. (a) Identity. The food additive...

  10. Description of new yeast species – is one strain enough?

    Science.gov (United States)

    The issue of description of new yeast species on the basis of a single strain is discussed. Single gene sequences, such as those from D1/D2 LSU rRNA, or sequences from ITS1/ITS2 are commonly used as the basis for recognizing new yeast species. Evidence is presented that hybrids and species with poly...

  11. Novel model for wine fermentation including the yeast dying phase

    OpenAIRE

    Borzì, Alfio; Merger, Juri; Müller, Jonas; Rosch, Achim; Schenk, Christina; Schmidt, Dominik; Schmidt, Stephan; Schulz, Volker; Velten, Kai; von Wallbrunn, Christian; Zänglein, Michael

    2014-01-01

    This paper presents a novel model for wine fermentation including a death phase for yeast and the influence of oxygen on the process. A model for the inclusion of the yeast dying phase is derived and compared to a model taken from the literature. The modeling ability of the several models is analyzed by comparing their simulation results.

  12. Effect of salt hyperosmotic stress on yeast cell viability

    Directory of Open Access Journals (Sweden)

    Logothetis Stelios

    2007-01-01

    Full Text Available During fermentation for ethanol production, yeasts are subjected to different kinds of physico-chemical stresses such as: initially high sugar concentration and low temperature; and later, increased ethanol concentrations. Such conditions trigger a series of biological responses in an effort to maintain cell cycle progress and yeast cell viability. Regarding osmostress, many studies have been focused on transcriptional activation and gene expression in laboratory strains of Saccharomyces cerevisiae. The overall aim of this present work was to further our understanding of wine yeast performance during fermentations under osmotic stress conditions. Specifically, the research work focused on the evaluation of NaCl-induced stress responses of an industrial wine yeast strain S. cerevisiae (VIN 13, particularly with regard to yeast cell growth and viability. The hypothesis was that osmostress conditions energized specific genes to enable yeast cells to survive under stressful conditions. Experiments were designed by pretreating cells with different sodium chloride concentrations (NaCl: 4%, 6% and 10% w/v growing in defined media containing D-glucose and evaluating the impact of this on yeast growth and viability. Subsequent fermentation cycles took place with increasing concentrations of D-glucose (20%, 30%, 40% w/v using salt-adapted cells as inocula. We present evidence that osmostress induced by mild salt pre-treatments resulted in beneficial influences on both cell viability and fermentation performance of an industrial wine yeast strain.

  13. A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin

    Directory of Open Access Journals (Sweden)

    Zhang Tingting

    2012-12-01

    Full Text Available Abstract Background Yeast Saccharomyces cerevisiae is a widely-used system for protein expression. We previously showed that heat-killed whole recombinant yeast vaccine expressing mammalian myostatin can modulate myostatin function in mice, resulting in increase of body weight and muscle composition in these animals. Foreign DNA introduced into yeast cells can be lost soon unless cells are continuously cultured in selection media, which usually contain antibiotics. For cost and safety concerns, it is essential to optimize conditions to produce quality food and pharmaceutical products. Results We developed a simple but effective method to engineer a yeast strain stably expressing mammalian myostatin. This method utilized high-copy-number integration of myostatin gene into the ribosomal DNA of Saccharomyces cerevisiae. In the final step, antibiotic selection marker was removed using the Cre-LoxP system to minimize any possible side-effects for animals. The resulting yeast strain can be maintained in rich culture media and stably express mammalian myostatin for two years. Oral administration of the recombinant yeast was able to induce immune response to myostatin and modulated the body weight of mice. Conclusions Establishment of such yeast strain is a step further toward transformation of yeast cells into edible vaccine to improve meat production in farm animals and treat human muscle-wasting diseases in the future.

  14. Thermotolerant yeasts and application for ethanol production

    Directory of Open Access Journals (Sweden)

    To-on, N.

    2007-07-01

    Full Text Available A total of 70 thermotolerant yeast strains were isolated at 40oC from 145 samples including fruit, leaves, flowers, soils and oil-palm fruits. Six isolates showed maximum growth at 40oC within 18 h. Three isolates (MIY1, MIY48 and MIY57 were selected based on their ability to ferment glucose and sucrose rapidly (24 h and showed the maximum temperature for growth at 42oC but it was good at 40oC. MIY57 produced 4.6% (v/v ethanol at 40oC from a medium containing 15% glucose. The optimum cultivation conditions for growth and ethanol production of MIY57 was 5% inoculum into the fermentation medium containing 15% glucose and 1% yeast extract with initial pH of 4.5 on a shaking incubator at 150 rpm at 40oC. MIY57, under these conditions, produced maximum ethanol of 5.0% (v/v after 48 h incubation while S. cerevisiae TISTR 5048 produced only 3.7% (v/v. Maximum cell dry weight was 7.2 g/L (at 18 h, again much higher than that of S. cerevisiae TISTR 5048 (4.1 g/L. Based on morphological, physiological and molecular studies, this strain (MIY57 was identified as Saccharomyces cerevisiae.

  15. Parameters affecting methanol utilization by yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Foda, M.S.; El-Masry, H.G.

    1981-01-01

    Screening of 28 yeast cultures, representing 22 species of various yeasts, with respect to their capabilities to assimilate methanol, has shown that this property was mostly found in certain species of the two genera Hansenula and Candida. When methanol was used as a sole carbon source for a methanol-adapted strain of Hansenula polymorpha, a linear yield response could be obtained with increasing alcohol up to 2% concentration. The amount of inoculum proved to be the decisive factor in determining a priori the ability of the organism to grow at 6% methanol as final concentration. The optimum pH values for growth ranged between 4.5-5.5 with no growth at pH 6.5 or higher. A marked growth stimulation was obtained when the medium was supplied with phosphate up to 0.08 M as final concentration. Within the nitrogen sources tested, corn steep liquor concentrate gave the highest yield of cells. The significance of the obtained results are discussed with reference to feasibilities of application.

  16. Microscopy of Fission Yeast Sexual Lifecycle.

    Science.gov (United States)

    Vjestica, Aleksandar; Merlini, Laura; Dudin, Omaya; Bendezu, Felipe O; Martin, Sophie G

    2016-01-01

    The fission yeast Schizosaccharomyces pombe has been an invaluable model system in studying the regulation of the mitotic cell cycle progression, the mechanics of cell division and cell polarity. Furthermore, classical experiments on its sexual reproduction have yielded results pivotal to current understanding of DNA recombination and meiosis. More recent analysis of fission yeast mating has raised interesting questions on extrinsic stimuli response mechanisms, polarized cell growth and cell-cell fusion. To study these topics in detail we have developed a simple protocol for microscopy of the entire sexual lifecycle. The method described here is easily adjusted to study specific mating stages. Briefly, after being grown to exponential phase in a nitrogen-rich medium, cell cultures are shifted to a nitrogen-deprived medium for periods of time suited to the stage of the sexual lifecycle that will be explored. Cells are then mounted on custom, easily built agarose pad chambers for imaging. This approach allows cells to be monitored from the onset of mating to the final formation of spores. PMID:27022830

  17. An overview of macroautophagy in yeast.

    Science.gov (United States)

    Wen, Xin; Klionsky, Daniel J

    2016-05-01

    Macroautophagy is an evolutionarily conserved dynamic pathway that functions primarily in a degradative manner. A basal level of macroautophagy occurs constitutively, but this process can be further induced in response to various types of stress including starvation, hypoxia and hormonal stimuli. The general principle behind macroautophagy is that cytoplasmic contents can be sequestered within a transient double-membrane organelle, an autophagosome, which subsequently fuses with a lysosome or vacuole (in mammals, or yeast and plants, respectively), allowing for degradation of the cargo followed by recycling of the resulting macromolecules. Through this basic mechanism, macroautophagy has a critical role in cellular homeostasis; however, either insufficient or excessive macroautophagy can seriously compromise cell physiology, and thus, it needs to be properly regulated. In fact, a wide range of diseases are associated with dysregulation of macroautophagy. There has been substantial progress in understanding the regulation and molecular mechanisms of macroautophagy in different organisms; however, many questions concerning some of the most fundamental aspects of macroautophagy remain unresolved. In this review, we summarize current knowledge about macroautophagy mainly in yeast, including the mechanism of autophagosome biogenesis, the function of the core macroautophagic machinery, the regulation of macroautophagy and the process of cargo recognition in selective macroautophagy, with the goal of providing insights into some of the key unanswered questions in this field. PMID:26908221

  18. Optimization of Fermentation Condition of Yeast Culture

    Institute of Scientific and Technical Information of China (English)

    WANG Qiuju; XU Li; CUI Yizhe

    2008-01-01

    Culture condition of every phase for fermentation of yeast culture was studied, and its solid and liquid conditions of elaboration were optimized to improve the total counts of living cells.Results showed that microzyme grew best at 30℃ when solid fermented,and the count of the living cells reached the tiptop with pH 5.5.The count of Candida tropicalis could reach 137.96×109 cfu·g-1,the count of Saccharomyces cerevisia could reach 134.62×109 cfu·g-1;the best liquid fermentation condition for cell-wall broken was 50℃ for 28 h,the rate of cell-wall broken could reach 80% at least;the rate of vitamin loss in yeast could be the minimun, the loss rate of vitamin B1 in Candida tropicalis and Saccharomyces cerevisiae was 8.71% and 19.54% respectively, the loss rate of vitamin B2 was 19.39% and 13.18%,respectively,and the loss rate of vitamin B6 was 6.3% and 3.04%,respectively.

  19. Yeast cell factories for fine chemical and API production

    Directory of Open Access Journals (Sweden)

    Glieder Anton

    2008-08-01

    Full Text Available Abstract This review gives an overview of different yeast strains and enzyme classes involved in yeast whole-cell biotransformations. A focus was put on the synthesis of compounds for fine chemical and API (= active pharmaceutical ingredient production employing single or only few-step enzymatic reactions. Accounting for recent success stories in metabolic engineering, the construction and use of synthetic pathways was also highlighted. Examples from academia and industry and advances in the field of designed yeast strain construction demonstrate the broad significance of yeast whole-cell applications. In addition to Saccharomyces cerevisiae, alternative yeast whole-cell biocatalysts are discussed such as Candida sp., Cryptococcus sp., Geotrichum sp., Issatchenkia sp., Kloeckera sp., Kluyveromyces sp., Pichia sp. (including Hansenula polymorpha = P. angusta, Rhodotorula sp., Rhodosporidium sp., alternative Saccharomyces sp., Schizosaccharomyces pombe, Torulopsis sp., Trichosporon sp., Trigonopsis variabilis, Yarrowia lipolytica and Zygosaccharomyces rouxii.

  20. Yeast diversity and native vigor for flavor phenotypes.

    Science.gov (United States)

    Carrau, Francisco; Gaggero, Carina; Aguilar, Pablo S

    2015-03-01

    Saccharomyces cerevisiae, the yeast used widely for beer, bread, cider, and wine production, is the most resourceful eukaryotic model used for genetic engineering. A typical concern about using engineered yeasts for food production might be negative consumer perception of genetically modified organisms. However, we believe the true pitfall of using genetically modified yeasts is their limited capacity to either refine or improve the sensory properties of fermented foods under real production conditions. Alternatively, yeast diversity screening to improve the aroma and flavors could offer groundbreaking opportunities in food biotechnology. We propose a 'Yeast Flavor Diversity Screening' strategy which integrates knowledge from sensory analysis and natural whole-genome evolution with information about flavor metabolic networks and their regulation. PMID:25630239

  1. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  2. Isolation and Identification of Yeasts from Tibet Kefir

    Directory of Open Access Journals (Sweden)

    Yun Li

    2015-02-01

    Full Text Available The occurrence and distribution of yeasts in Tibet kefir were investigated in this study. Five samples of Tibetan kefir from Tibet and surrounding areas were collected for yeast isolation. Based on physiological, biochemical characteristics and molecular identification results, eight species of yeast were isolated and identified from Tibet kefir, including Saccharomyces cerevisiae, Pichia fermentans, Debaryomyces hansenii, Rhodotorula mucilaginosa, Candida zeylanoide, Candida parapsilosis, Kluyveromyces marxianus and Kazachstania unispora. Among the test samples, K. marxianus, Ka. unispora and P. fermentans were the highest three species in frequency of occurrence of yeast isolates. C. zeylanoides, C. parapsilosis and R. mucilaginosa were first found the occurrence in Tibet kefir. The results provided new information of yeast composition and biodiversity of Tibet kefir.

  3. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    Directory of Open Access Journals (Sweden)

    Jennifer R Bellon

    Full Text Available Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade, has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  4. Introducing a New Breed of Wine Yeast: Interspecific Hybridisation between a Commercial Saccharomyces cerevisiae Wine Yeast and Saccharomyces mikatae

    OpenAIRE

    Bellon, Jennifer R.; Schmid, Frank; Capone, Dimitra L.; Dunn, Barbara L.; Chambers, Paul J.

    2013-01-01

    Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentatio...

  5. Biological Effects of Yeast β-Glucans

    Directory of Open Access Journals (Sweden)

    Vlatka Petravić-Tominac

    2014-02-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0pt 5.4pt 0pt 5.4pt; mso-para-margin:0pt; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} β-Glucans are glucose polymers that naturally occur in yeasts, molds, algae, mushrooms, bacteria, oats and barley. Immunostimulation is one of the most important properties of β-glucans. They are classified as biological response modifiers and because of their biological activities they can be used in human and veterinary medicine and pharmacy. Additionally, β-glucans show interesting physicochemical properties and therefore could be applied in food and feed production as well as in cosmetic and chemical industries. Immunomodulation by β-glucan, both in vitro and in vivo, inhibits cancer cell growth and metastasis and prevents or reduces bacterial infection. In humans, dietary β-glucan lowers blood cholesterol, improves glucose utilization by body cells and also helps wound healing. β-Glucans work, in part, by stimulating the innate immune mechanism to fight a range of foreign challenges and could be used as an adjuvant, in combination with anti infective or antineoplastic agents, radiotherapy, and a range of topical agents and nutrients. The structure of β-glucans depends on the source they are isolated from. Native β-glucan molecules can be linked and branched in several ways. Biological properties of different β-glucan molecules are dependent on their molecular structure. Some authors claim that the β-(1→3, (1→6-glucan derived from yeast Saccharomyces cerevisiae produce the highest biological effects. Thus, in this review the β-glucans and their metabolic

  6. YeastMed: an XML-Based System for Biological Data Integration of Yeast

    OpenAIRE

    Briache, Abdelaali; Marrakchi, Kamar; Kerzazi, Amine; Navas-Delgado, Ismael; Montes, Jose F Aldana; Hassani, Badr D. Rossi; Lairini, Khalid

    2010-01-01

    A key goal of bioinformatics is to create database systems and software platforms capable of storing and analysing large sets of biological data. Hundreds of biological databases are now available and provide access to huge amount of biological data. SGD, Yeastract, CYGD-MIPS, BioGrid and PhosphoGrid are five of the most visited databases by the yeast community. These sources provide complementary data on biological entities. Biologists are brought systematically to query these data sources i...

  7. Systematic identification of yeast proteins extracted into model wine during aging on the yeast lees.

    Science.gov (United States)

    Rowe, Jeffrey D; Harbertson, James F; Osborne, James P; Freitag, Michael; Lim, Juyun; Bakalinsky, Alan T

    2010-02-24

    Total protein and protein-associated mannan concentrations were measured, and individual proteins were identified during extraction into model wines over 9 months of aging on the yeast lees following completion of fermentations by seven wine strains of Saccharomyces cerevisiae. In aged wines, protein-associated mannan increased about 6-fold (+/-66%), while total protein only increased 2-fold (+/-20%), which resulted in a significantly greater protein-associated mannan/total protein ratio for three strains. A total of 219 proteins were identified among all wine samples taken over the entire time course. Of the 17 "long-lived" proteins detected in all 9 month samples, 13 were cell wall mannoproteins, and four were glycolytic enzymes. Most cytosolic proteins were not detected after 6 months. Native mannosylated yeast invertase was assayed for binding to wine tannin and was found to have a 10-fold lower affinity than nonglycosylated bovine serum albumin. Enrichment of mannoproteins in the aged model wines implies greater solution stability than other yeast proteins and the possibility that their contributions to wine quality may persist long after bottling. PMID:20108898

  8. Biocavity laser spectroscopy of genetically altered yeast cells and isolated yeast mitochondria

    Science.gov (United States)

    Gourley, Paul L.; Hendricks, Judy K.; McDonald, Anthony E.; Copeland, R. Guild; Naviaux, Robert K.; Yaffe, Michael P.

    2006-02-01

    We report an analysis of 2 yeast cell mutants using biocavity laser spectroscopy. The two yeast strains differed only by the presence or absence of mitochondrial DNA. Strain 104 is a wild-type (ρ +) strain of the baker's yeast, Saccharomyces cerevisiae. Strain 110 was derived from strain 104 by removal of its mitochondrial DNA (mtDNA). Removal of mtDNA causes strain 110 to grow as a "petite" (ρ -), named because it forms small colonies (of fewer cells because it grows more slowly) on agar plates supplemented with a variety of different carbon sources. The absence of mitochondrial DNA results in the complete loss of all the mtDNA-encoded proteins and RNAs, and loss of the pigmented, heme-containing cytochromes a and b. These cells have mitochondria, but the mitochondria lack the normal respiratory chain complexes I, III, IV, and V. Complex II is preserved because its subunits are encoded by genes located in nuclear DNA. The frequency distributions of the peak shifts produced by wild-type and petite cells and mitochondria show striking differences in the symmetry and patterns of the distributions. Wild-type ρ + cells (104) and mitochondria produced nearly symmetric, Gaussian distributions. The ρ - cells (110) and mitochondria showed striking asymmetry and skew that appeared to follow a Poisson distribution.

  9. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  10. Yeast cell-based analysis of human lactate dehydrogenase isoforms.

    Science.gov (United States)

    Mohamed, Lulu Ahmed; Tachikawa, Hiroyuki; Gao, Xiao-Dong; Nakanishi, Hideki

    2015-12-01

    Human lactate dehydrogenase (LDH) has attracted attention as a potential target for cancer therapy and contraception. In this study, we reconstituted human lactic acid fermentation in Saccharomyces cerevisiae, with the goal of constructing a yeast cell-based LDH assay system. pdc null mutant yeast (mutated in the endogenous pyruvate decarboxylase genes) are unable to perform alcoholic fermentation; when grown in the presence of an electron transport chain inhibitor, pdc null strains exhibit a growth defect. We found that introduction of the human gene encoding LDHA complemented the pdc growth defect; this complementation depended on LDHA catalytic activity. Similarly, introduction of the human LDHC complemented the pdc growth defect, even though LDHC did not generate lactate at the levels seen with LDHA. In contrast, the human LDHB did not complement the yeast pdc null mutant, although LDHB did generate lactate in yeast cells. Expression of LDHB as a red fluorescent protein (RFP) fusion yielded blebs in yeast, whereas LDHA-RFP and LDHC-RFP fusion proteins exhibited cytosolic distribution. Thus, LDHB exhibits several unique features when expressed in yeast cells. Because yeast cells are amenable to genetic analysis and cell-based high-throughput screening, our pdc/LDH strains are expected to be of use for versatile analyses of human LDH. PMID:26126931

  11. Novel yeast cell dehydrogenase activity assay in situ.

    Science.gov (United States)

    Berłowska, Joanna; Kregiel, Dorota; Klimek, Leszek; Orzeszyna, Bartosz; Ambroziak, Wojciech

    2006-01-01

    The aim of this research was to develop a suitable method of succinate dehydrogenase activity assay in situ for different industrial yeast strains. For this purpose different compounds: EDTA, Triton X-100, sodium deoxycholate, digitonin, nystatin and beta-mercaptoethanol were used. The permeabilization process was controlled microscopically by primuline staining. Enzyme assay was conducted in whole yeast cells with Na-succinate as substrate, phenazine methosulfate (PMS) as electron carrier and in the presence one of two different tetrazolium salts: tetrazolium blue chloride (BT) or cyanoditolyl tetrazolium chloride (CTC) reduced during the assay. In comparabile studies of yeast vitality the amount of intracellular ATP was determined according to luciferin/luciferase method. During the succinate dehydrogenase assay in intact yeast cells without permeabilization, BT formazans were partially visualized in the cells, but CTC formazans appeared to be totally extracellular or associated with the plasma membrane. Under these conditions there was no linear relationship between formazan color intensity signal and yeast cell density. From all chemical compounds tested, only digitonin was effective in membrane permeabilization without negative influence on cell morphology. Furthermore, with digitonin-treated cells a linear relationship between formazan color intensity signal and yeast cell number was noticed. Significant decreasing of succinate dehydrogenase activity and ATP content were observed during aging of the tested yeast strains. PMID:17419290

  12. Yeast Biomass Production in Brewery's Spent Grains Hemicellulosic Hydrolyzate

    Science.gov (United States)

    Duarte, Luís C.; Carvalheiro, Florbela; Lopes, Sónia; Neves, Ines; Gírio, Francisco M.

    Yeast single-cell protein and yeast extract, in particular, are two products which have many feed, food, pharmaceutical, and biotechnological applications. However, many of these applications are limited by their market price. Specifically, the yeast extract requirements for culture media are one of the major technical hurdles to be overcome for the development of low-cost fermentation routes for several top value chemicals in a biorefinery framework. A potential biotechnical solution is the production of yeast biomass from the hemicellulosic fraction stream. The growth of three pentose-assimilating yeast cell factories, Debaryomyces hansenii, Kluyveromyces marxianus, and Pichia stipitis was compared using non-detoxified brewery's spent grains hemicellulosic hydrolyzate supplemented with mineral nutrients. The yeasts exhibited different specific growth rates, biomass productivities, and yields being D. hansenii as the yeast species that presented the best performance, assimilating all sugars and noteworthy consuming most of the hydrolyzate inhibitors. Under optimized conditions, D. hansenii displayed a maximum specific growth rate, biomass yield, and productivity of 0.34 h-1, 0.61 g g-1, and 0.56 g 1-1 h-1, respectively. The nutritional profile of D. hansenii was thoroughly evaluated, and it compares favorably to others reported in literature. It contains considerable amounts of some essential amino acids and a high ratio of unsaturated over saturated fatty acids.

  13. Accumulation and metabolism of selenium by yeast cells.

    Science.gov (United States)

    Kieliszek, Marek; Błażejak, Stanisław; Gientka, Iwona; Bzducha-Wróbel, Anna

    2015-07-01

    This paper examines the process of selenium bioaccumulation and selenium metabolism in yeast cells. Yeast cells can bind elements in ionic from the environment and permanently integrate them into their cellular structure. Up to now, Saccharomyces cerevisiae, Candida utilis, and Yarrowia lipolytica yeasts have been used primarily in biotechnological studies to evaluate binding of minerals. Yeast cells are able to bind selenium in the form of both organic and inorganic compounds. The process of bioaccumulation of selenium by microorganisms occurs through two mechanisms: extracellular binding by ligands of membrane assembly and intracellular accumulation associated with the transport of ions across the cytoplasmic membrane into the cell interior. During intracellular metabolism of selenium, oxidation, reduction, methylation, and selenoprotein synthesis processes are involved, as exemplified by detoxification processes that allow yeasts to survive under culture conditions involving the elevated selenium concentrations which were observed. Selenium yeasts represent probably the best absorbed form of this element. In turn, in terms of wide application, the inclusion of yeast with accumulated selenium may aid in lessening selenium deficiency in a diet. PMID:26003453

  14. Potential Application of Yeast β-Glucans in Food Industry

    Directory of Open Access Journals (Sweden)

    Vesna Zechner-krpan

    2009-12-01

    Full Text Available Different β-glucans are found in a variety of natural sources such as bacteria, yeast, algae, mushrooms, barley and oat. They have potential use in medicine and pharmacy, food, cosmetic and chemical industries, in veterinary medicine and feed production. The use of different β-glucans in food industry and their main characteristics important for food production are described in this paper. This review focuses on beneficial properties and application of β-glucans isolated from different yeasts, especially those that are considered as waste from brewing industry. Spent brewer’s yeast, a by-product of beer production, could be used as a raw-material for isolation of β-glucan. In spite of the fact that large quantities of brewer’s yeast are used as a feedstuff , certain quantities are still treated as a liquid waste. β-Glucan is one of the compounds that can achieve a greater commercial value than the brewer’s yeast itself and maximize the total profitability of the brewing process. β-Glucan isolated from spent brewer’s yeast possesses properties that are benefi cial for food production. Therefore, the use of spent brewer’s yeast for isolation of β-glucan intended for food industry would represent a payable technological and economical choice for breweries.

  15. Calling Card Analysis in Budding Yeast.

    Science.gov (United States)

    Mayhew, David; Mitra, Robi D

    2016-02-01

    Calling card analysis is a high-throughput method for identifying the genomic binding sites of multiple transcription factors in a single experiment in budding yeast. By tagging a DNA-binding protein with a targeting domain that directs the insertion of the Ty5 retrotransposon, the genomic binding sites for that transcription factor are marked. The transposition locations are then identified en masse by Illumina sequencing. The calling card protocol allows for simultaneous analysis of multiple transcription factors. By cloning barcodes into the Ty5 transposon, it is possible to pair a unique barcode with every transcription factor in the experiment. The method presented here uses expression of transcription factors from their native loci; however, it can also be altered to measure binding sites of transcription factors overexpressed from a plasmid. PMID:26832687

  16. Alcohol dehydrogenase activity in immobilized yeast cells

    International Nuclear Information System (INIS)

    A method for the immobilization of Saccharomyces cerevisiae was developed and the activity of alcohol dehydrogenase of the immobilized cells was determined. The treatment of the yeast cells with 1 % toluene followed by irradiation with acrylamide and bisacrylamide resulted in a high activity of alcohol dehydrogenase in the immobilized cells. The enzyme of the immobilized cells was stable in the pH range of 7.5 - 8.0 and the optimum pH opposed to be 8.5. Although the immobilized cells showed a rather low level of thermostability, it is suggested that they could be used for a long period of time at a temperature of 27 deg C. The immobilized cells did not exhibit any loss in the enzyme activity when stored at 4 deg C or -20 deg C. (author)

  17. TOTAL ANTIOXIDANT ACTIVITY OF YEAST SACCHAROMYCES CEREVISIAE

    Directory of Open Access Journals (Sweden)

    Blažena Lavová

    2013-02-01

    Full Text Available Antioxidants are health beneficial compounds that can protect cells and macromolecules (e.g. fats, lipids, proteins and DNA from the damage of reactive oxygen species (ROS. Sacchamomyces cerevisiae are know as organisms with very important antioxidative enzyme systems such as superoxide dismutase or catalase. The total antioxidant activity (mmol Trolox equivalent – TE.g-1 d.w. of Saccharomyces cerevisiae was measured by 2,2´-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid during the yeast cultivation. It was found that the total antioxidant activity was the highest (1.08 mmol TE.g-1 d.w. in the strain Kolín after 32 hours of cultivation and the lowest (0.26 mmol TE.g-1 d.w. in the strain Gyöng after 12 hours of cultivation.

  18. Hybridization of halotolerant yeast for alcohol fermentation

    International Nuclear Information System (INIS)

    Attempt have been made to construct a new yeast strain from alcohol fermenting strains and salt tolerant strains. It is anticipated that the new yeast strain will be able to ferment alcohol in molasses mash with high salinity, up to 3% of NaCl. Another characteristics is its ability to tolerate up to 40 C temperature which is desirable for alcohol fermentation in tropical countries. Commercial and wild strains of Saccharomyces cerevisiae were screened for their fermenting ability and strain SC90, 191 TJ3, and AM12 were selected as parental strains for fusion among themselves and with other halo tolerant species. Halo tolerant strains selected at 5% NaCl in molasses mash were tentatively identified as Torulopsis grabrata, T. candida, T. Bovina and S. Rouxii whereas all of those strains selected at 17% NaCl were Citeromyces sp. It was found that fusant TA73 derived from wild strain and sake fermenting strain performed best among 4,087 fusants investigated. This fusant fermented much better than their parental strains when salt concentrations were increased to 5 and 7% NaCl. Experiment was carried out in fermentor, 1.5 liter working volume using molasses mash with 3% NaCl and temperature was controlled at 35 degree C. Fermentation rate of TA73, TJ3 and AM12 were 2.17, 1.50 and 1.87 g/L/hr respectively, Maximum ethanol concentration obtained were 7.6, 6.7 and 7.4% by weight after 60 and 78 hours respectively. Other fusants derived from fusion of Saccharomyces cerevisiae with other halo tolerant species were mostly inferior to their parental strains and only 7 fusants were slightly better than parental strains. (author)

  19. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  20. DNA double strand break induction in yeast

    International Nuclear Information System (INIS)

    The induction of DNA double strand breaks (DSBs) by accelerated heavy ions was systematically measured in diploid yeast cells. Particles were provided by the accelerators at GSI, Darmstadt, and HMI, Berlin. DNA was separated using pulsed field gel electrophoresis and the intensity of the largest bands used to determine the loss of molecular weight. Since the DNA content of each chromosome is exactly known absolute values for DSB induction can be measured without calibration procedures. Ions used range from protons to uranium with LET values between 2 and about 15,000 keV.μm-1. Induction cross sections increase in the lower LET region approaching a plateau around 200 keV.μm-1. With higher LET values the dependence can no longer be described by a common curve with each ion showing a specific behaviour. With very heavy particles the influence of the penumbra becomes obvious: cross sections decrease with LET because of the reduced penumbra extensions. Classical target theory would predict cross sections to follow a simple saturation function which is not substantiated by the data. Track structure analysis as introduced by Butts and Katz in Radiat. Res. 30 855-71 1967 is also not able to predict the experimental results. A semi-empirical fit indicates a linear-quadratic dependence of induction cross sections on LET up to about 1000 keV.μm-1. RBE for DSB induction rises above unity reaching a maximum of about 2.5 around 200 keV.μm-1. This is different from many experiments in mammalian cells and is presumably due to differences in chromatin structure since yeast cells seem to lack a functional H1 histone. (author)

  1. Cadmium biosorption by baker’s yeast in aqueous suspension

    OpenAIRE

    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla

    2012-01-01

    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  2. Biomineralization of iron phosphate nanoparticles in yeast cells

    International Nuclear Information System (INIS)

    Amorphous iron phosphate nanoparticles mineralized in yeast cells are studied by transmission electron microscopy, Fourier transform infrared spectrograph and micro electrophoresis. Iron phosphate nanoparticles in yeast cells show uniform morphology with extensive surface roughness and disperse well. The size distribution of iron phosphate is about 50-200 nm. Fourier transform infrared spectroscopy (FT-IR) is used to analyze the chemical bond linkages between iron phosphate nanoparticles with protein macromolecules in yeast cells. The mechanism of biomineralization was simply discussed by chemical bonds and surface charges.

  3. The occurrence of yeasts in some of the Masurian Lakes

    OpenAIRE

    Stanisław Niewolak

    2014-01-01

    The results are reported of investigations on the abundance of yeasts in the Kortowskie and Iławskle lakes. The amount and qualitative composition of yeasts was studied in the lakes of the Węgorzewo district. The yeasts were least numerous (up to 82 cells per l ml water) in the lakes with relatively unpolluted water and most abundant in bottom deposits with a silty substrate (up to 6200 cells per l g dry weight). Net plankton contained up to 15 000 cells in 1 g of fresh weight.

  4. A network of yeast basic helix–loop–helix interactions

    OpenAIRE

    Robinson, Kelly A.; Koepke, Jay I.; Kharodawala, Murtaza; Lopes, John M.

    2000-01-01

    The Ino4 protein belongs to the basic helix–loop–helix (bHLH) family of proteins. It is known to form a dimer with Ino2p, which regulates phospholipid biosynthetic genes. Mammalian bHLH proteins have been shown to form multiple dimer combinations. However, this flexibility in dimerization had not been documented for yeast bHLH proteins. Using the yeast two-hybrid assay and a biochemical assay we show that Ino4p dimerizes with the Pho4p, Rtg1p, Rtg3p and Sgc1p bHLH proteins. Screening a yeast ...

  5. Production of yeast extract from whey using Kluyveromyces marxianus

    OpenAIRE

    Revillion Jean P. de Palma; Brandelli Adriano; Ayub Marco A. Záchia

    2003-01-01

    The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide ric...

  6. How do yeast cells become tolerant to high ethanol concentrations?

    Science.gov (United States)

    Snoek, Tim; Verstrepen, Kevin J; Voordeckers, Karin

    2016-08-01

    The brewer's yeast Saccharomyces cerevisiae displays a much higher ethanol tolerance compared to most other organisms, and it is therefore commonly used for the industrial production of bioethanol and alcoholic beverages. However, the genetic determinants underlying this yeast's exceptional ethanol tolerance have proven difficult to elucidate. In this perspective, we discuss how different types of experiments have contributed to our understanding of the toxic effects of ethanol and the mechanisms and complex genetics underlying ethanol tolerance. In a second part, we summarize the different routes and challenges involved in obtaining superior industrial yeasts with improved ethanol tolerance. PMID:26758993

  7. Production of yeast extract from whey using Kluyveromyces marxianus

    Directory of Open Access Journals (Sweden)

    Revillion Jean P. de Palma

    2003-01-01

    Full Text Available The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide rich extract with K. marxianus.

  8. Selection of functional cDNAs by complementation in yeast.

    OpenAIRE

    McKnight, G L; McConaughy, B L

    1983-01-01

    Yeast cDNA was prepared in a yeast expression plasmid to generate a cDNA plasmid pool composed of approximately 40,000 members. Several yeast mutants were transformed with the cDNA plasmid pool, and the cDNAs for ADC1, HIS3, URA3, and ASP5 were isolated by functional complementation. Restriction enzyme analysis confirmed the genetic identity of the ADC1, HIS3, and URA3 cDNAs and demonstrated that the URA3 cDNA contains 5' noncoding sequences. The relative abundance of the various cDNAs in the...

  9. Media composition influences yeast one- and two-hybrid results

    Directory of Open Access Journals (Sweden)

    Gonzalez Kim L

    2011-08-01

    Full Text Available Abstract Although yeast two-hybrid experiments are commonly used to identify protein interactions, the frequent occurrence of false negatives and false positives hampers data interpretation. Using both yeast one-hybrid and two-hybrid experiments, we have identified potential sources of these problems: the media preparation protocol and the source of the yeast nitrogen base may not only impact signal range but also effect whether a result appears positive or negative. While altering media preparation may optimize signal differences for individual experiments, media preparation must be reported in detail to replicate studies and accurately compare results from different experiments.

  10. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants. PMID:26756185

  11. Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher Basidiomycetes mushrooms.

    Science.gov (United States)

    Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P

    2014-01-01

    This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources

  12. Inonotus rickii (Pat. Reid: an important legnicolous basidiomycete in urban trees Inonotus rickii (Pat. Reid: um importante basidomiceta lenhícola em árvores urbanas

    Directory of Open Access Journals (Sweden)

    Ana Paula Ramos

    2008-12-01

    Full Text Available Inonotus rickii is a basidiomycete that causes cankers and decay in several ornamental trees, and has been reported in Portugal since 2002. The aim of the present work was to evaluate the incidence of the disease caused by I. rickii on Celtis australis, in the community of Alcântara, Lisbon, where the European hackberry tree is the main sidewalk species. Disease incidence reached 19%, and affected trees showed sparse foliage, death of branches and white rot of heartwood. In some cases, chlamydospores masses and basidiocarps occurred on trunks and branches, especially on trees with more than 40 cm of DBH. Considering the increasingly importance of I. rickii and being C. australis one of the most important ornamental species used in the green areas of Lisbon, morphological and cultural characteristics of the pathogen are presented and its impact as agent of decline of urban trees is discussed.Inonotus rickii é um basidiomiceta que causa cancros, exsudações e podridão branca do cerne em diversas espécies arbóreas, tendo sido identificado em Portugal em 2002. No presente trabalho pretendeu-se avaliar a incidência da doença causada por I. rickii em Celtis australis, numa zona de Lisboa onde esta espécie é a principal árvore de alinhamento. A incidência da doença ronda os 19%, sendo os sintomas mais frequentes a redução do tamanho das folhas, morte de ramos e podridão branca do lenho. Por vezes, observaram-se a presença de massas de clamidósporos e a formação de basidiomas nos troncos e nas pernadas, essencialmente nas árvores com DAP superior a 40 cm. Considerando a importância crescente de I. rickii e sendo o lodão a espécie de eleição da cidade de Lisboa, descrevem-se as características morfológicas e culturais do fungo e discutese o papel que este patogénio pode assumir no declínio do arvoredo urbano.

  13. Immobilization of yeast cells with hydrophilic carrier by radiation-induced polymerization

    International Nuclear Information System (INIS)

    Radiation-induced polymerization method was applied to the immobilization of yeast cells. The effects of irradiation, cooling and monomer, which are necessary for polymerization, were recovered completely by subsequent aerobical incubation of yeast cells. The ethanol productivity in immobilized yeast cells increased with the increase of aerobical incubation period. The growth of yeast cells in immobilized yeast cells was indicated. The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. (author)

  14. Differential Adsorption of Ochratoxin A and Anthocyanins by Inactivated Yeasts and Yeast Cell Walls during Simulation of Wine Aging

    Directory of Open Access Journals (Sweden)

    Leonardo Petruzzi

    2015-10-01

    Full Text Available The adsorption of ochratoxin A (OTA by yeasts is a promising approach for the decontamination of musts and wines, but some potential competitive or interactive phenomena between mycotoxin, yeast cells, and anthocyanins might modify the intensity of the phenomenon. The aim of this study was to examine OTA adsorption by two strains of Saccharomyces cerevisiae (the wild strain W13, and the commercial isolate BM45, previously inactivated by heat, and a yeast cell wall preparation. Experiments were conducted using Nero di Troia red wine contaminated with 2 μg/L OTA and supplemented with yeast biomass (20 g/L. The samples were analyzed periodically to assess mycotoxin concentration, chromatic characteristics, and total anthocyanins over 84 days of aging. Yeast cell walls revealed the highest OTA-adsorption in comparison to thermally-inactivated cells (50% vs. 43% toxin reduction, whilst no significant differences were found for the amount of adsorbed anthocyanins in OTA-contaminated and control wines. OTA and anthocyanins adsorption were not competitive phenomena. Unfortunately, the addition of yeast cells to wine could cause color loss; therefore, yeast selection should also focus on this trait to select the best strain.

  15. Differential Adsorption of Ochratoxin A and Anthocyanins by Inactivated Yeasts and Yeast Cell Walls during Simulation of Wine Aging.

    Science.gov (United States)

    Petruzzi, Leonardo; Baiano, Antonietta; De Gianni, Antonio; Sinigaglia, Milena; Corbo, Maria Rosaria; Bevilacqua, Antonio

    2015-10-01

    The adsorption of ochratoxin A (OTA) by yeasts is a promising approach for the decontamination of musts and wines, but some potential competitive or interactive phenomena between mycotoxin, yeast cells, and anthocyanins might modify the intensity of the phenomenon. The aim of this study was to examine OTA adsorption by two strains of Saccharomyces cerevisiae (the wild strain W13, and the commercial isolate BM45), previously inactivated by heat, and a yeast cell wall preparation. Experiments were conducted using Nero di Troia red wine contaminated with 2 μg/L OTA and supplemented with yeast biomass (20 g/L). The samples were analyzed periodically to assess mycotoxin concentration, chromatic characteristics, and total anthocyanins over 84 days of aging. Yeast cell walls revealed the highest OTA-adsorption in comparison to thermally-inactivated cells (50% vs. 43% toxin reduction), whilst no significant differences were found for the amount of adsorbed anthocyanins in OTA-contaminated and control wines. OTA and anthocyanins adsorption were not competitive phenomena. Unfortunately, the addition of yeast cells to wine could cause color loss; therefore, yeast selection should also focus on this trait to select the best strain. PMID:26516913

  16. The Effect of Different Temperatures on Autolysis of Baker’s Yeast for the Production of Yeast Extract

    OpenAIRE

    TANGÜLER, Hasan; Erten, Hüseyin

    2009-01-01

    This study aimed to determine the optimum autolysis conditions for the production of yeast extract, which is used to give a meaty flavor to food products and to increase their nutritional value. Autolysis was induced by incubating baker’s yeast cell suspensions at different temperatures (45, 50, 55, and 60 °C) with a reaction time ranging from 8 to 72 h. Content and yield of total solids, a-amino nitrogen (a-AN), and protein were determined. Yeast extract powder was obtained by dryi...

  17. Yeast diversity associated to sediments and water from two Colombian artificial lakes

    OpenAIRE

    Silva-Bedoya, L.M.; M. Ramírez-Castrillón; Osorio-Cadavid, E.

    2014-01-01

    In Colombia, knowledge of the yeast and yeast-like fungi community is limited because most studies have focused on species with clinical importance. Sediments and water represent important habitats for the study of yeast diversity, especially for yeast species with industrial, biotechnological, and bioremediation potential. The main purpose of this study was to identify and compare the diversity of yeast species associated with sediment and water samples from two artificial lakes in Universid...

  18. Effect of Yeast Hulls on Stuck and Sluggish Wine Fermentations: Importance of the Lipid Component

    OpenAIRE

    Munoz, Eeva; Ingledew, W. M.

    1989-01-01

    The effect of yeast hulls (yeast ghosts) on sluggish or stuck white wine fermentations was studied. The enhancing effect on yeast growth and fermentation rate displayed by the hulls was shown to be similar to the effect provided by lipid extract from the same hulls. Unsaturated fatty acids and sterols were incorporated into the yeast from lipid extracts during fermentation carried out under oxygen-limited conditions. Adsorption of toxic medium-chain fatty acid (decanoic acid) onto the yeast h...

  19. Associations of Yeasts with Spotted-Wing Drosophila (Drosophila suzukii; Diptera: Drosophilidae) in Cherries and Raspberries

    OpenAIRE

    Hamby, Kelly A.; Hernández, Alejandro; Boundy-Mills, Kyria; Frank G. Zalom

    2012-01-01

    A rich history of investigation documents various Drosophila-yeast mutualisms, suggesting that Drosophila suzukii similarly has an association with a specific yeast species or community. To discover candidate yeast species, yeasts were isolated from larval frass, adult midguts, and fruit hosts of D. suzukii. Terminal restriction fragment length polymorphism (TRFLP) technology and decimal dilution plating were used to identify and determine the relative abundance of yeast species present in fr...

  20. Growth of marine yeast on different strength of stress solutes

    Digital Repository Service at National Institute of Oceanography (India)

    Gupta, R.

    Sixteen isolates of marine yeasts belonging to genera Candida, Debaryomyces, Rhodotorula and Saccharomyces, isolated from the (EEZ) of India were screened for their growth on different concentrations of sodium chloride (NaCl). Most of them showed...

  1. Pichia sporocuriosa sp. nov., a new yeast isolated from rambutan.

    Science.gov (United States)

    Péter, G; Tornai-Lehoczki, J; Dlauchy, D; Vitányi, G

    2000-01-01

    A strain of a hitherto undescribed yeast species with a unique ascospore morphology was isolated from rambutan (Nephelium lappaceum). A description of the new species, Pichia sporocuriosa, is given. PMID:10696876

  2. Biodiversity of brewery yeast strains and their fermentative activities.

    Science.gov (United States)

    Berlowska, Joanna; Kregiel, Dorota; Rajkowska, Katarzyna

    2015-01-01

    We investigated the genetic, biochemical, fermentative and physiological characteristics of brewery yeast strains and performed a hierarchical cluster analysis to evaluate their similarity. We used five different ale and lager yeast strains, originating from different European breweries and deposited at the National Collection of Yeast Cultures (UK). Ale and lager strains exhibited different genomic properties, but their assimilation profiles and pyruvate decarboxylase activities corresponded to their species classifications. The activity of another enzyme, succinate dehydrogenase, varied between different brewing strains. Our results confirmed that ATP and glycogen content, and the activity of the key metabolic enzymes succinate dehydrogenase and pyruvate decarboxylase, may be good general indicators of cell viability. However, the genetic properties, physiology and fermentation capacity of different brewery yeasts are unique to individual strains. PMID:25267007

  3. Probiotic Properties of Non-Saccharomyces Yeasts

    DEFF Research Database (Denmark)

    Smith, Ida Mosbech

    when administered in adequate amounts confer a health benefit on the host. While the majority of probiotic microorganisms studied to date are lactic acid bacteria, research in yeasts with potentially beneficial influences on human health has mainly revolved around Saccharomyces boulardii. This yeast...... interactions with cells of the human gastrointestinal tract. Specifically, the included publications represent scientific investigation of non-Saccharomyces yeast modulation of human DC function, induction of human T cell responses indicating inflammation versus tolerance, capacity for enhancing human...... epithelial cell barrier function, and properties of pathogen inhibition. In a large-scale in vitro study, 170 strains representing 75 diverse yeast species were evaluated for modulation of inflammatory cytokine secretion by human DCs, as compared to cytokine responses induced by S. boulardii. Our findings...

  4. Assay for Spore Wall Integrity Using a Yeast Predator.

    Science.gov (United States)

    Okada, Hiroki; Neiman, Aaron M; Ohya, Yoshikazu

    2016-01-01

    During the budding yeast life cycle, a starved diploid cell undergoes meiosis followed by production of four haploid spores, each surrounded by a spore wall. The wall allows the spores to survive in harsh environments until conditions improve. Spores are also more resistant than vegetative cells to treatments such as ether vapor, glucanases, heat shock, high salt concentrations, and exposure to high or low pH, but the relevance of these treatments to natural environmental stresses remains unclear. This protocol describes a method for assaying the yeast spore wall under natural environmental conditions by quantifying the survival of yeast spores that have passed through the digestive system of a yeast predator, the fruit fly. PMID:27480715

  5. THE UPTAKE OF AROMATIC AND BRANCHED CHAIN HYDROCARBONS BY YEAST

    Science.gov (United States)

    Studies of the hydrocarbon utilizing yeasts, Candida maltosa and C. lipolytica, have shown that both were capable of reducing recoverable amounts of branched chain and aromatic hydrocarbons in a mixture of naphthalene, tetradecane, hexadecane, pristane (tetra-methylpentadecane). ...

  6. [Overexpression of FKS1 to improve yeast autolysis-stress].

    Science.gov (United States)

    Li, Jia; Wang, Jinjing; Li, Qi

    2015-09-01

    With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing. PMID:26955712

  7. Culture nutrition key to inhibitor-tolerant yeast performance

    Science.gov (United States)

    Inhibitory compounds generated during acid hydrolysis pretreatment of lignocellulosic biomass interfere with subsequent fermentation to ethanol. A tolerant yeast strain Saccharomyces cerevisiae Y-50049 has recently been developed by targeted evolution in the presence of 5-hydroxymethylfurfural and f...

  8. Reprogrammed Glucose Metabolic Pathways of Inhibitor-Tolerant Yeast

    Science.gov (United States)

    Representative inhibitory compounds such as furfural and 5-hydroxymethylfurfural generated from lignocellulosic biomass pretreatment inhibit yeast growth and interfere with the subsequent ethanol fermentation. Evolutionary engineering under laboratory settings is a powerful tool that can be used to ...

  9. Domestication and Divergence of Saccharomyces cerevisiae Beer Yeasts.

    Science.gov (United States)

    Gallone, Brigida; Steensels, Jan; Prahl, Troels; Soriaga, Leah; Saels, Veerle; Herrera-Malaver, Beatriz; Merlevede, Adriaan; Roncoroni, Miguel; Voordeckers, Karin; Miraglia, Loren; Teiling, Clotilde; Steffy, Brian; Taylor, Maryann; Schwartz, Ariel; Richardson, Toby; White, Christopher; Baele, Guy; Maere, Steven; Verstrepen, Kevin J

    2016-09-01

    Whereas domestication of livestock, pets, and crops is well documented, it is still unclear to what extent microbes associated with the production of food have also undergone human selection and where the plethora of industrial strains originates from. Here, we present the genomes and phenomes of 157 industrial Saccharomyces cerevisiae yeasts. Our analyses reveal that today's industrial yeasts can be divided into five sublineages that are genetically and phenotypically separated from wild strains and originate from only a few ancestors through complex patterns of domestication and local divergence. Large-scale phenotyping and genome analysis further show strong industry-specific selection for stress tolerance, sugar utilization, and flavor production, while the sexual cycle and other phenotypes related to survival in nature show decay, particularly in beer yeasts. Together, these results shed light on the origins, evolutionary history, and phenotypic diversity of industrial yeasts and provide a resource for further selection of superior strains. PAPERCLIP. PMID:27610566

  10. Effect of the growth of yeast in irradiated tapioca

    International Nuclear Information System (INIS)

    Tapioca can be used as yeast growth medium because it has high carbohydrates. Sterilization by gamma rays resulted in simple compounds and toxic compounds. The aim of the experiment was to know the effect of gamma rays on physical and chemical characteristic from tapioca and the growth of yeast isolates R1, R2 and mutant of R110 and R210. The doses were 10, 20, and 30 kGy. The results showed that the color of irradiated tapioca was lighter than non irradiated and the granule of pati was smaller proportional to the doses. Chemically a decrease of pH and solubility and the increase of glucose was obtained in tapioca. Irradiated tapioca has no influence on yeast growth with was detected by the showing of clear zone, and the yeast growth in 1% liquid tapioca medium showed fluctuation and had two growth pattern. (author)

  11. Determination of Fermentation Potentials of Tamarindus indica Yeast Isolates

    Directory of Open Access Journals (Sweden)

    A. Ado

    2015-01-01

    Full Text Available Determination of fermentation potentials of Tamarindus indica yeast isolates was carried out using isolation, morphological identification and physiological (fermentation procedures. Ty1; Ty2 and Ty3; Ty4 isolates are morphologically similar as small cylinder to ovoid and small spherical yeast cells respectively. The fermentation process indicates gradual changes in pH (5.5-1.96 and brix (20-7.40%. Long lag phase (132 h was observed in the natural fermentation. The alcohol production potentials of the four yeast isolates have shown variations: Ty3NF (D3:6.48%>Ty2SF (D6:5.47%>Ty3SF (D6:5.08%>Ty4SF (D6:4.34%. Thus T. indica could be a good source of wild yeast and biofuel.

  12. Determination of tritium in wine and wine yeast samples

    International Nuclear Information System (INIS)

    A sensitive method for evaluating the tritium content in wine and wine yeast was applied to estimate tritium impact on the environment in the surrounding area of nuclear power plant Cernavoda, where the vineyards are part of representative agricultural ecosystem. Analytical procedures were developed to determine HTO in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractionating distillation for wine samples and azeotropic distillation followed by fractional distillation for wine yeast samples. Finally, the water samples obtained after fractional distillation were normally distilled with KMO4. The established procedures were successfully applied for wine and wine yeast samples from Mulfatlar harvests of the years 1995 and 1996. (authors)

  13. Fermenting knowledge: the history of winemaking, science and yeast research

    OpenAIRE

    Paul J Chambers; Pretorius, Isak S.

    2010-01-01

    In the second article of the ‘Food and Science' series, Paul Chambers and Isak Pretorius explain the central role of yeast in wine making and how biotechnology can contribute to improving the quality of wine.

  14. The sensitive [SWI+] prion: New perspectives on yeast prion diversity

    OpenAIRE

    Hines, Justin K; Craig, Elizabeth A

    2011-01-01

    Yeast prions are heritable protein-based genetic elements which rely on molecular chaperone proteins for stable transmission to cell progeny. Within the past few years, five new prions have been validated and 18 additional putative prions identified in Saccharomyces cerevisiae. The exploration of the physical and biological properties of these “nouveau prions” has begun to reveal the extent of prion diversity in yeast. We recently reported that one such prion, [SWI+], differs from the best st...

  15. Evaluation and Properties of the Budding Yeast Phosphoproteome

    OpenAIRE

    Amoutzias, G. D.; He, Y.; Lilley, K. S.; Van de Peer, Y.; Oliver, S G

    2012-01-01

    We have assembled a reliable phosphoproteomic data set for budding yeast Saccharomyces cerevisiae and have investigated its properties. Twelve publicly available phosphoproteome data sets were triaged to obtain a subset of high-confidence phosphorylation sites (p-sites), free of "noisy" phosphorylations. Analysis of this combined data set suggests that the inventory of phosphoproteins in yeast is close to completion, but that these proteins may have many undiscovered p-sites. Proteins involve...

  16. Yeasts and wine off-flavours: a technological perspective

    OpenAIRE

    Malfeito-Ferreira, Manuel

    2010-01-01

    In wine production, yeasts have both beneficial and detrimental activities. Saccharomyces cerevisiae is the yeast mainly responsible for turning grape juice into wine but this species and several others may also show undesirable effects in wines. Among such effects, technologists are particularly concerned with the production of offflavours that may occur during all stages of winemaking. Typical spoiling activities include the production of ethyl acetate by apiculate y...

  17. Yeast biofilm colony as an orchestrated multicellular organism

    Czech Academy of Sciences Publication Activity Database

    Šťovíček, V.; Váchová, Libuše; Palková, Zdena

    2012-01-01

    Roč. 5, č. 2 (2012), s. 203-205. ISSN 1942-0889 R&D Projects: GA ČR GA204/08/0718; GA MŠk(CZ) LC531 Grant ostatní: GA MŠk(CZ) LC06063 Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast biofilm * yeast cell Subject RIV: EE - Microbiology, Virology

  18. Aging-related changes in yeast mitochondrial morphology and respiration

    Czech Academy of Sciences Publication Activity Database

    Sigler, Karel; Pichová, Alena; Volejníková, Andrea; Hlousková, Jana

    Bratislava : Bratislava: SAS, 2011. s. 55-55. ISSN 1336-4839. [Annual Conference on Yeasts /39./. 03.05.2011-06.05.2011, Smolenice] R&D Projects: GA MŠk 1M0570; GA MŠk ME09043; GA ČR GA301/07/0339 Institutional research plan: CEZ:AV0Z50200510 Keywords : s. cerevisiae * yeast Subject RIV: EE - Microbiology, Virology

  19. The 2 micron plasmid purloins the yeast cohesin complex

    OpenAIRE

    Mehta, Shwetal; Yang, Xian Mei; Chan, Clarence S.; Dobson, Melanie J.; Jayaram, Makkuni; Velmurugan, Soundarapandian

    2002-01-01

    The yeast 2 micron plasmid achieves high fidelity segregation by coupling its partitioning pathway to that of the chromosomes. Mutations affecting distinct steps of chromosome segregation cause the plasmid to missegregate in tandem with the chromosomes. In the absence of the plasmid stability system, consisting of the Rep1 and Rep2 proteins and the STB DNA, plasmid and chromosome segregations are uncoupled. The Rep proteins, acting in concert, recruit the yeast cohesin complex to the STB locu...

  20. Production and characterization of yeast killer toxin monoclonal antibodies

    OpenAIRE

    Polonelli, L; Morace, G

    1987-01-01

    Monoclonal antibodies were obtained after fusion of mouse myeloma cells with spleen cells isolated from mice primed with a crude extract of yeast killer toxin produced by a strain of Hansenula anomala. Hybridomas were selected by specific immunoassay reaction of their fluid with crude yeast killer toxin extract. Among the monoclonal antibodies, which were characterized by the Western blot technique, one (designated KT4) proved to have precipitating properties, thus permitting the neutralizati...

  1. Yeast PPR proteins, watchdogs of mitochondrial gene expression

    OpenAIRE

    Herbert, Christopher J.; Golik, Pawel; Bonnefoy, Nathalie

    2013-01-01

    PPR proteins are a family of ubiquitous RNA-binding factors, found in all the Eukaryotic lineages, and are particularly numerous in higher plants. According to recent bioinformatic analyses, yeast genomes encode from 10 (in S. pombe) to 15 (in S. cerevisiae) PPR proteins. All of these proteins are mitochondrial and very often interact with the mitochondrial membrane. Apart from the general factors, RNA polymerase and RNase P, most yeast PPR proteins are involved in the stability and/or transl...

  2. Bioprospection of yeasts as biocontrol agents against phytopathogenic molds

    OpenAIRE

    Márcia Maria Rosa-Magri; Sâmia Maria Tauk-Tornisielo; Sandra Regina Ceccato-Antonini

    2011-01-01

    Yeasts isolated from sugar cane and maize rhizosphere, leaves and stalks were screened against the phytopathogenic molds Colletotrichum sublineolum and Colletotrichum graminicola, both causal agents of the anthracnose disease in sorghum and maize, respectively. Strains identified as Torulaspora globosa and Candida intermedia were able to inhibit the mold growth, with the first species also exhibiting killer activity. No previous report on the application and potentiality of these yeasts as bi...

  3. Pheromone communication in the fission yeast Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Nielsen, O; Davey, William John; Nielsen, Olaf

    1995-01-01

    Conjugation between two haploid yeast cells is generally controlled by the reciprocal action of diffusible mating pheromones, cells of each mating type releasing pheromones that induce mating-specific changes in cells of the opposite type. Recent studies into pheromone signalling in the fission...... yeast Schizosaccharomyces pombe have revealed significant parallels with processes in higher eukaryotes and could provide the opportunity for investigating communication in an organism that is amenable to both biochemical and genetic manipulation....

  4. Yeast expression proteomics by high-resolution mass spectrometry

    DEFF Research Database (Denmark)

    Walther, Tobias C; Olsen, Jesper Velgaard; Mann, Matthias

    2010-01-01

    -translational controls contribute majorly to regulation of protein abundance, for example in heat shock stress response. The development of new sample preparation methods, high-resolution mass spectrometry and novel bioinfomatic tools close this gap and allow the global quantitation of the yeast proteome under different...... conditions. Here, we provide background information on proteomics by mass-spectrometry and describe the practice of a comprehensive yeast proteome analysis....

  5. Collaborative evaluation of the Abbott yeast identification system.

    OpenAIRE

    Cooper, B. H.; Prowant, S; B. Alexander; Brunson, D H

    1984-01-01

    The Abbott yeast identification system (Abbott Laboratories, Diagnostics Division, Irving, Tex.) is a 24-h, instrumental method for identifying medically important yeasts, based on matrix analysis of 19 biochemical reactions and the germ tube test. The system was evaluated in two clinical laboratories by using 179 coded isolates, which included a high percentage of the less frequently encountered species. Based upon results with these coded isolates and from previously obtained laboratory dat...

  6. Influence of non-Saccharomyces yeasts on white dry wines

    OpenAIRE

    Poulard, Alain; Pascari, Xenia; Boris GAINA

    2014-01-01

    It was demonstrated a positive action of the non-Saccharomyces yeasts on the organoleptic properties of wines. Also, their participation in fermentation process did not involve an excessive accumulation of volatile acidity or other taste and aroma defects. The involvement of the non-Saccharomyces yeasts in practical oenology that keeps on recent achievements in oenological biotechnologies allow an increase of aromatic intensity (floral, fruitful etc.) in varietal wines and preserve the variet...

  7. Bacterial and yeast counts in Brazilian commodities and spices

    Directory of Open Access Journals (Sweden)

    Freire Francisco das Chagas Oliveira

    2002-01-01

    Full Text Available A total of thirteen genera of bacteria and two genera of yeasts were detected in surface sterilized and unsterilized Brazilian commodities and spices such as cashew kernels, Brazil nut kernels, black and white pepper. The genus Bacillus with eight species was by far the most common. The yeasts isolated were Pichia sp., P. guillermondii and Rhodotorula sp. Bacillus cereus, Salmonella typhimurium and Staphylococcus aureus were detected in cashew and Brazil nut kernels.

  8. Occurrence and diversity of marine yeasts in Antarctica environments

    Science.gov (United States)

    Zhang, Xue; Hua, Mingxia; Song, Chunli; Chi, Zhenming

    2012-03-01

    A total of 28 yeast strains were obtained from the sea sediment of Antarctica. According to the results of routine identification and molecular characterization, the strains belonged to species of Yarrowia lipolytica, Debaryomyces hansenii, Rhodotorula slooffiae, Rhodotorula mucilaginosa, Sporidiobolus salmonicolor, Aureobasidium pullulans, Mrakia frigida and Guehomyces pullulans, respectively. The Antarctica yeasts have wide potential applications in biotechnology, for some of them can produce β-galactosidase and killer toxins.

  9. Experimental study on bread yeast cultured in sweet sorghum juice

    International Nuclear Information System (INIS)

    As a substitute for food supplies, sweet sorghum juice with high grade has demonstrated out- standing advantage in fermentation. To obtain the optimized fermentation conditions, the growth, the bio- mass of bread yeast cultured in sweet sorghum juice and total residual sugar were investigated in the paper. The fermentation was performed and optimized in a 10-100 1 bio-reactor. The results show that the application of sweet sorghum juice in bread yeast production is very potential. (authors)

  10. Cell Shape and Cell Division in Fission Yeast Minireview

    OpenAIRE

    Piel, Matthieu; Tran, Phong T.

    2009-01-01

    The fission yeast Schizosaccharomyces pombe has served as an important model organism for investigating cellular morphogenesis. This unicellular rod-shaped fission yeast grows by tip extension and divides by medial fission. In particular, microtubules appear to define sites of polarized cell growth by delivering cell polarity factors to the cell tips. Microtubules also position the cell nucleus at the cell middle, marking sites of cell division. Here, we review the microtubule-dependent mecha...

  11. Antifungal Susceptibility Testing of Ascomycetous Yeasts Isolated from Animals.

    Science.gov (United States)

    Álvarez-Pérez, Sergio; García, Marta E; Peláez, Teresa; Martínez-Nevado, Eva; Blanco, José L

    2016-08-01

    Recent studies suggest that antifungal resistance in yeast isolates of veterinary origin may be an underdiagnosed threat. We tested a collection of 92 ascomycetous yeast isolates that were obtained in Spain from birds, mammals and insects for antifungal susceptibility. MICs to amphotericin B and azoles were low, and no resistant isolates were detected. Despite these results, and given the potential role of animals as reservoirs of resistant strains, continuous monitoring of antifungal susceptibility in the veterinary setting is recommended. PMID:27216048

  12. PREPARATION OF RED WINE BY BAKER’S YEAST

    OpenAIRE

    Rashmi Mishra

    2016-01-01

    Wine is an alcoholic beverage made from fermented grapes or other fruits. The natural chemical balance of grapes lets them ferment without the addition of sugars, acids, enzymes, water, or other nutrients. Yeast consumes the sugars in the grapes and converts them into alcohol. Different varieties of grapes and strains of yeasts produce different types of wine such as red wine ,white wine, sparkling wine, rose wine etc. Study was conducted to produce red wine without using any sugar and making...

  13. Yeast diversity on grapes in two German wine growing regions.

    Science.gov (United States)

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-01

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples. PMID:26292165

  14. The Fermentative and Aromatic Ability of Kloeckera and Hanseniaspora Yeasts

    Science.gov (United States)

    Díaz-Montaño, Dulce M.; de Jesús Ramírez Córdova, J.

    Spontaneous alcoholic fermentation from grape, agave and others musts into an alcoholic beverage is usually characterized by the presence of several non-Saccharomyces yeasts. These genera yeasts are dominant in the early stages of the alcoholic fermentation. However the genera Hanseniaspora and Kloeckera may survive at a significant level during fermentation and can influence the chemical composition of the beverage. Several strains belonging to the species Kloeckera api-culata and Hanseniaspora guilliermondii have been extensively studied in relation to the formation of some metabolic compounds affecting the bouquet of the final product. Indeed some apiculate yeast showed positive oenological properties and their use in the alcoholic fermentations has been suggested to enhance the aroma and flavor profiles. The non- Saccharomyces yeasts have the capability to produce and secrete enzymes in the medium, such as β -glucosidases, which release monoterpenes derived from their glycosylated form. These compounds contribute to the higher fruit-like characteristic of final product. This chapter reviews metabolic activity of Kloeckera and Hanseniaspora yeasts in several aspects: fermentative capability, aromatic compounds production and transformation of aromatic precursor present in the must, also covers the molecular methods for identifying of the yeast

  15. Yeast Infection and Diabetes Mellitus among Pregnant Mother in Malaysia

    Science.gov (United States)

    Sopian, Iylia Liyana; Shahabudin, Sa’adiah; Ahmed, Mowaffaq Adam; Lung, Leslie Than Thian; Sandai, Doblin

    2016-01-01

    Background Vaginal yeast infection refers to irritation of the vagina due to the presence of opportunistic yeast of the genus Candida (mostly Candida albicans). About 75% of women will have at least one episode of vaginal yeast infection during their lifetime. Several studies have shown that pregnancy and uncontrolled diabetes increase the infection risk. Reproductive hormone fluctuations during pregnancy and elevated glucose levels characteristic of diabetes provide the carbon needed for Candida overgrowth and infection. The goal of this study was to determine the prevalence of vaginal yeast infection among pregnant women with and without diabetes. Methods This was a case-control study using cases reports from Kepala Batas Health Clinic, Penang State, Malaysia from 2006 to 2012. In total, 740 pregnant ladies were chosen as sample of which 370 were diabetic and 370 were non-diabetic cases. Results No relationship between diabetes and the occurrence of vaginal yeast infection in pregnant women was detected, and there was no significant association between infection and age group, race or education level. Conclusion In conclusion, within radius of this study, vaginal yeast infection can occur randomly in pregnant women.

  16. Advances in Gene Expression in Non-Conventional Yeasts

    Science.gov (United States)

    Nel, Sanet; Labuschagne, Michel; Albertyn, Jacobus

    Yeast has been a favoured lower eukaryotic system for the expression and production of recombinant proteins for both basic research and practical applications, and the demand for foreign-gene expression systems is increasing rapidly. Despite the vast amount of information on the molecular biology and physiology of Saccharomyces cerevisiae, which has consequently been the first choice as host system for recombinant protein production in the past, several limitations have been identified in this expression system. These limitations have recently been relieved by the development of expression systems in other yeast species known as ‘ non-conventional yeasts’ or ‘non-Saccharomyces ’ yeasts. With the increasing interest in the biotechnological applications of these yeasts in applied and fundamental studies and processes, the term ‘ non-conventional ’ yeast may well soon become redundant. As there is no universal expression system for heterologous protein production, it is necessary to recognize the merits and demerits of each system in order to make a right choice. This chapter will evaluate the competitive environment of non-conventional expression platforms represented by some of the best-known alternative yeasts systems including Kluyveromyces lactis, Yarrowia lipolytica, Hansenula polymorpha, Pichia pastoris and more recently, Arxula adeninivorans.

  17. Determination of Yeasts Antimicrobial Activity in Milk and Meat Products

    Directory of Open Access Journals (Sweden)

    L.B. Roostita

    2011-12-01

    Full Text Available The research was arranged to isolate yeasts from livestock products and then the yeasts antimicrobial activity was tested towards putrefaction and pathogenic bacteria. Yeasts isolated from livestock products using Malt Extract Agar (MEA, the total yeasts population counted with using total plate count method, antimicrobial activity tested using diffusion methods against Pseudomonas aerugenes, Staphylococcus aureus and Escherichia coli and then the chosen isolate identified with using 18s RNA method. The results have shown that the total yeasts population on pasteurized cow’s milk were 1.2×106 cfu/g, fruit yoghurt 5.4×106 cfu/g, lamb meat 1×105 cfu/g, beef 1×105 cfu/g and beef sausages 1×106 cfu/g total yeasts population. Fruit yoghurt isolate shown the best antimicrobial activity with 35 mm clear zone diameter against Pseudomonas aerugenes, 8 mm clear zone diameter against Staphylococcus aureus and 10 mm clear zone diameter against Escherichia coli. The 18 s RNA test shown that fruit yoghurt isolate was 100% (FR3-F primer and 99% (FR3-R primer identical with Candida parapsilosis.

  18. Fast and sensitive detection of genetically modified yeasts in wine.

    Science.gov (United States)

    León, Carlos; García-Cañas, Virginia; González, Ramón; Morales, Pilar; Cifuentes, Alejandro

    2011-10-21

    In this work, a novel screening methodology based on the combined use of multiplex polymerase chain reaction (PCR) and capillary gel electrophoresis with laser induced fluorescence (CGE-LIF) is developed for the fast and sensitive detection of genetically modified yeasts in wine. As model, a recombinant EKD-13 Saccaromyces cerevisiae strain was selected and different wines were prepared using either recombinant or conventional yeasts. Special emphasis is put on the yeast DNA extraction step, exploring different commercial and non-commercial methods, in order to overcome the important difficulty of obtaining amplifiable DNA from wine samples. To unequivocally detect the transgenic yeast, two specific segments of the transgenic construction were amplified. In addition, a third primer pair was used as amplification control to confirm the quality of the yeast DNA obtained from the extraction step. CGE-LIF provides high sensitivity, good analysis speed and impressive resolution of DNA fragments, making this technique very convenient to optimize multiplex PCR parameters and to analyze the amplified DNA fragments. Thus, the CGE-LIF method provided %RSD values for DNA migration times lower than 0.82% (n=10) with the same capillary and lower than 1.92% (n=15) with three different capillaries, allowing the adequate size determination of the PCR products with an error lower than 4% compared to the theoretically expected. The whole method developed in this work requires less than one working day and grants the sensitive detection of transgenic yeasts in wine samples. PMID:21296357

  19. Automated Yeast Mating Protocol Using Open Reading Frames from Saccharomyces cerevisiae Genome to Improve Yeast Strains for Cellulosic Ethanol Production

    Science.gov (United States)

    Engineering the industrial ethanologen Saccharomyces cerevisiae to utilize pentose sugars from lignocellulosic biomass is critical for commercializing cellulosic fuel ethanol production. Approaches to engineer pentose-fermenting yeasts have required expression of additional genes. We implemented a...

  20. The sensitivity of yeast and yeast-like cells to new lysosomotropic agents

    Czech Academy of Sciences Publication Activity Database

    Krasowska, A.; Chmielewska, L.; Adamski, R.; Luszynski, J.; Witek, S.; Sigler, Karel

    2004-01-01

    Roč. 9, 4A (2004), s. 675-683. ISSN 1425-8153 R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Grant ostatní: GA MŠk(CZ) KONTAKT 01-032; Polish-Czech Treaty on Scientific and Scientific-Technical Cooperation(XX) 2 Institutional research plan: CEZ:AV0Z5020903 Keywords : lysosomotropic agents * yeast * quinacrine Subject RIV: EE - Microbiology, Virology Impact factor: 0.495, year: 2004