WorldWideScience

Sample records for carotenogenic basidiomycetous yeasts

  1. Proteomic analysis of the carotenogenic yeast Xanthophyllomyces dendrorhous

    Directory of Open Access Journals (Sweden)

    Baeza Marcelo

    2011-06-01

    Full Text Available Abstract Background The yeast Xanthophyllomyces dendrorhous is used for the microbiological production of the antioxidant carotenoid astaxanthin. In this study, we established an optimal protocol for protein extraction and performed the first proteomic analysis of the strain ATCC 24230. Protein profiles before and during the induction of carotenogenesis were determined by two-dimensional polyacrylamide gel electrophoresis and proteins were identified by mass spectrometry. Results Among the approximately 600 observed protein spots, 131 non-redundant proteins were identified. Proteomic analyses allowed us to identify 50 differentially expressed proteins that fall into several classes with distinct expression patterns. These analyses demonstrated that enzymes related to acetyl-CoA synthesis were more abundant prior to carotenogenesis. Later, redox- and stress-related proteins were up-regulated during the induction of carotenogenesis. For the carotenoid biosynthetic enzymes mevalonate kinase and phytoene/squalene synthase, we observed higher abundance during induction and/or accumulation of carotenoids. In addition, classical antioxidant enzymes, such as catalase, glutathione peroxidase and the cytosolic superoxide dismutases, were not identified. Conclusions Our results provide an overview of potentially important carotenogenesis-related proteins, among which are proteins involved in carbohydrate and lipid biosynthetic pathways as well as several redox- and stress-related proteins. In addition, these results might indicate that X. dendrorhous accumulates astaxanthin under aerobic conditions to scavenge the reactive oxygen species (ROS generated during metabolism.

  2. Production of glycolipid biosurfactants by basidiomycetous yeasts.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2009-05-01

    BSs (biosurfactants) produced by various micro-organisms show unique properties (e.g. mild production conditions, lower toxicity, higher biodegradability and environmental compatibility) compared with chemically synthesized surfactants. The numerous advantages of BSs have prompted applications not only in the food, cosmetic and pharmaceutical industries but also in environmental protection and energy-saving technology. Among BSs, glycolipid types are the most promising, owing to their high productivity from renewable resources and versatile biochemical properties. MELs (mannosylerythritol lipids), which are glycolipid BSs abundantly produced by basidiomycetous yeasts such as strains of Pseudozyma, exhibit not only excellent interfacial properties, but also remarkable differentiation-inducing activities against human leukaemia cells. MELs also show high binding affinity towards different immunoglobulins and lectins. Recently, a cationic liposome bearing MEL has been demonstrated to increase dramatically the efficiency of gene transfection into mammalian cells. These features of BSs should broaden their application in new advanced technologies. In the present review the current status of research and development on glycolipid BSs, especially their production by Pseudozyma yeasts, is described. PMID:19341364

  3. Molecular Characterization and Functional Analysis of Cytochrome b5 Reductase (CBR) Encoding Genes from the Carotenogenic Yeast Xanthophyllomyces dendrorhous.

    Science.gov (United States)

    Gutiérrez, María Soledad; Rojas, María Cecilia; Sepúlveda, Dionisia; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2015-01-01

    The eukaryotic microsomal cytochrome P450 systems consist of a cytochrome P450 enzyme (P450) and a cytochrome P450 redox partner, which generally is a cytochrome P450 reductase (CPR) that supplies electrons from NADPH. However, alternative electron donors may exist such as cytochrome b5 reductase and cytochrome b5 (CBR and CYB5, respectively) via, which is NADH-dependent and are also anchored to the endoplasmic reticulum. In the carotenogenic yeast Xanthophyllomyces dendrorhous, three P450-encoding genes have been described: crtS is involved in carotenogenesis and the CYP51 and CYP61 genes are both implicated in ergosterol biosynthesis. This yeast has a single CPR (encoded by the crtR gene), and a crtR- mutant does not produce astaxanthin. Considering that this mutant is viable, the existence of alternative cytochrome P450 electron donors like CBR and CYB5 could operate in this yeast. The aim of this work was to characterize the X. dendrorhous CBR encoding gene and to study its involvement in P450 reactions in ergosterol and carotenoid biosynthesis. Two CBRs genes were identified (CBR.1 and CBR.2), and deletion mutants were constructed. The two mutants and the wild-type strain showed similar sterol production, with ergosterol being the main sterol produced. The crtR- mutant strain produced a lower proportion of ergosterol than did the parental strain. These results indicate that even though one of the two CBR genes could be involved in ergosterol biosynthesis, crtR complements their absence in the cbr- mutant strains, at least for ergosterol production. The higher NADH-dependent cytochrome c reductase activity together with the higher transcript levels of CBR.1 and CYB5 in the crtR- mutant as well as the lower NADH-dependent activity in CBS-cbr.1- strongly suggest that CBR.1-CYB5 via participates as an alternative electron donor pathway for P450 enzymes involved in ergosterol biosynthesis in X. dendrorhous. PMID:26466337

  4. Molecular Characterization and Functional Analysis of Cytochrome b5 Reductase (CBR Encoding Genes from the Carotenogenic Yeast Xanthophyllomyces dendrorhous.

    Directory of Open Access Journals (Sweden)

    María Soledad Gutiérrez

    Full Text Available The eukaryotic microsomal cytochrome P450 systems consist of a cytochrome P450 enzyme (P450 and a cytochrome P450 redox partner, which generally is a cytochrome P450 reductase (CPR that supplies electrons from NADPH. However, alternative electron donors may exist such as cytochrome b5 reductase and cytochrome b5 (CBR and CYB5, respectively via, which is NADH-dependent and are also anchored to the endoplasmic reticulum. In the carotenogenic yeast Xanthophyllomyces dendrorhous, three P450-encoding genes have been described: crtS is involved in carotenogenesis and the CYP51 and CYP61 genes are both implicated in ergosterol biosynthesis. This yeast has a single CPR (encoded by the crtR gene, and a crtR- mutant does not produce astaxanthin. Considering that this mutant is viable, the existence of alternative cytochrome P450 electron donors like CBR and CYB5 could operate in this yeast. The aim of this work was to characterize the X. dendrorhous CBR encoding gene and to study its involvement in P450 reactions in ergosterol and carotenoid biosynthesis. Two CBRs genes were identified (CBR.1 and CBR.2, and deletion mutants were constructed. The two mutants and the wild-type strain showed similar sterol production, with ergosterol being the main sterol produced. The crtR- mutant strain produced a lower proportion of ergosterol than did the parental strain. These results indicate that even though one of the two CBR genes could be involved in ergosterol biosynthesis, crtR complements their absence in the cbr- mutant strains, at least for ergosterol production. The higher NADH-dependent cytochrome c reductase activity together with the higher transcript levels of CBR.1 and CYB5 in the crtR- mutant as well as the lower NADH-dependent activity in CBS-cbr.1- strongly suggest that CBR.1-CYB5 via participates as an alternative electron donor pathway for P450 enzymes involved in ergosterol biosynthesis in X. dendrorhous.

  5. Iterative carotenogenic screens identify combinations of yeast gene deletions that enhance sclareol production

    DEFF Research Database (Denmark)

    Trikka, Fotini A; Nikolaidis, Alexandros; Athanasakoglou, Anastasia;

    2015-01-01

    advantage of existing knowledge of the sterol biosynthetic pathway, while many additional factors may affect the output of the engineered system. RESULTS: Aiming to develop a yeast strain that can support high titers of sclareol, a diterpene of great importance for the perfume industry, we sought to....... Applying the same approach using a different starting point could yield alternative sets of deletions with similar or improved outcome....

  6. Microbial conversion of glycerol into glycolipid biosurfactants, mannosylerythritol lipids, by a basidiomycete yeast, Pseudozyma antarctica JCM 10317(T).

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2007-07-01

    Microbial conversion of glycerol into functional bio-based materials was investigated, aiming to facilitate the utilization of waste glycerol. A basidiomycete yeast, Pseudozyma antarctica JCM 10317, efficiently produced mannosylerythritol lipids (MELs) as glycolipid biosurfactants from glycerol. The amount of MEL yield reached 16.3 g l(-1) by intermittent feeding of glycerol. PMID:17697987

  7. Genome Sequence of the Basidiomycetous Yeast Pseudozyma antarctica T-34, a Producer of the Glycolipid Biosurfactants Mannosylerythritol Lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Koyama, Yoshinori; Hagiwara, Hiroko; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Machida, Masayuki; Kitamoto, Dai

    2013-01-01

    The basidiomycetous yeast Pseudozyma antarctica T-34 is an excellent producer of mannosylerythritol lipids (MELs), members of the multifunctional extracellular glycolipids, from various feedstocks. Here, the genome sequence of P. antarctica T-34 was determined and annotated. Analysis of the sequence might provide insights into the properties of this yeast that make it superior for use in the production of functional glycolipids, leading to the further development of P. antarctica for industrial applications. PMID:23558529

  8. A basidiomycetous yeast, Pseudozyma crassa, produces novel diastereomers of conventional mannosylerythritol lipids as glycolipid biosurfactants.

    Science.gov (United States)

    Fukuoka, Tokuma; Kawamura, Mayo; Morita, Tomotake; Imura, Tomohiro; Sakai, Hideki; Abe, Masahiko; Kitamoto, Dai

    2008-11-24

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties, but also versatile biochemical actions. During a survey of new MEL producers, we found that a basidiomycetous yeast, Pseudozyma crassa, extracellularly produces three glycolipids. When glucose and oleic acid were used as the carbon source, the total amount of glycolipids reached approximately 4.6g/L in the culture medium. The structures of these glycolipids were similar to those of well-known MEL-A, -B, and -C, respectively. Very interestingly, in all the present glycolipids, the configuration of the erythritol moiety was entirely opposite to that of conventional MELs. The present glycolipids were identified to have the carbohydrate structure of 4-O-beta-D-mannopyranosyl-(2R,3S)-erythritol, stereochemically different from 4-O-beta-D-mannopyranosyl-(2S,3R)-erythritol of conventional MELs. Furthermore, these new glycolipids possessed both short-chain acids (C(2) or C(4)) and long-chain acids (C(14), C(16), or C(18)) on the mannose moiety. The major component of the present glycolipids clearly showed different interfacial and biological properties, compared to conventional MELs comprising two medium-chain acids on the mannose moiety. Accordingly, the novel MEL diastereomers produced by P. crassa should provide us with different glycolipid functions, and facilitate a broad range of applications of MELs. PMID:18805521

  9. The BETA-1, 3-Glucanase of Basidiomycete QM 806: Studies on it's production and application in yeast cell wall hydrolysis

    OpenAIRE

    Ryan, Eleanor

    1986-01-01

    In this project the growth and production of JB-1,3-glucanase by Basidiomycete sp QM 806 was investigated, with a view to studying its application in B-1,3-glucan degradation and in yeast extract production. The effect of various parameters on 3-1 »3-glucanase production was examined. The optimal conditions for enzyme production in submerged shake-flask culture were chosen. Two B-1,3-glucans (laminarin and yeast cell walls) were degraded using the B-1,3-glucanase produced. The degra...

  10. Cold-stress responses in the Antarctic basidiomycetous yeast Mrakia blollopis.

    Science.gov (United States)

    Tsuji, Masaharu

    2016-07-01

    Microbes growing at subzero temperatures encounter numerous growth constraints. However, fungi that inhabit cold environments can grow and decompose organic compounds under subzero temperatures. Thus, understanding the cold-adaptation strategies of fungi under extreme environments is critical for elucidating polar-region ecosystems. Here, I report that two strains of the Antarctic basidiomycetous yeast Mrakia blollopis exhibited distinct growth characteristics under subzero conditions: SK-4 grew efficiently, whereas TKG1-2 did not. I analysed the metabolite responses elicited by cold stress in these two M. blollopis strains by using capillary electrophoresis-time-of-flight mass spectrometry. M. blollopis SK-4, which grew well under subzero temperatures, accumulated high levels of TCA-cycle metabolites, lactic acid, aromatic amino acids and polyamines in response to cold shock. Polyamines are recognized to function in cell-growth and developmental processes, and aromatic amino acids are also known to improve cell growth at low temperatures. By contrast, in TKG1-2, which did not grow efficiently, cold stress strongly induced the metabolites of the TCA cycle, but other metabolites were not highly accumulated in the cell. Thus, these differences in metabolite responses could contribute to the distinct abilities of SK-4 and TKG1-2 cells to grow under subzero temperature conditions. PMID:27493768

  11. Rhodotorula subericola sp. nov., an anamorphic basidiomycetous yeast species isolated from bark of Quercus suber (cork oak).

    Science.gov (United States)

    Belloch, C; Villa-Carvajal, M; Alvarez-Rodríguez, M L; Coque, J J R

    2007-07-01

    Two yeasts strains, Y-31(T) and Y-20B, pertaining to a previously unknown yeast species were isolated from bark of cork oak in Spain. Physiological characterization revealed a pattern of assimilation of carbon and nitrogen compounds compatible with members of the genus Rhodotorula. From sequence analysis of the D1/D2 region of the 26S rRNA gene, Rhodotorula cycloclastica and Rhodotorula philyla were related to the unknown species. Phylogenetic reconstruction based on the D1/D2 region of the 26S rRNA gene showed that the novel species clustered in a branch together with R. cycloclastica. The name Rhodotorula subericola sp. nov. is proposed, with isolate Y-31(T) (=CECT 11976(T)=CBS 10442(T)) the type strain of this novel taxon in the Microbotryum lineage, subclass Microbotryomycetidae, class Urediniomycetes of basidiomycetous yeasts.

  12. Draft Genome Sequence of the Basidiomycetous Yeast-Like Fungus Pseudozyma hubeiensis SY62, Which Produces an Abundant Amount of the Biosurfactant Mannosylerythritol Lipids.

    Science.gov (United States)

    Konishi, Masaaki; Hatada, Yuji; Horiuchi, Jun-Ichi

    2013-01-01

    The basidiomycetous yeast-like fungus Pseudozyma hubeiensis strain SY62 is capable of producing an abundant amount of the glycolipid biosurfactant mannosylerythritol lipids (MELs), which are a major component of monoacetylated MEL (MEL-C). To reveal the synthetic pathway of the MELs of strain SY62, we present the 18.44-Mb draft genome sequence. PMID:23814110

  13. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5. PMID:20652239

  14. Analysis of expressed sequence tags from the anamorphic basidiomycetous yeast, Pseudozyma antarctica, which produces glycolipid biosurfactants, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2006-07-15

    Pseudozyma antarctica T-34 secretes a large amount of biosurfactants (BS), mannosylerythritol lipids (MEL), from different carbon sources such as hydrocarbons and vegetable oils. The detailed biosynthetic pathway of MEL remained unknown due to lack of genetic information on the anamorphic basidiomycetous yeasts, including the genus Pseudozyma. Here, in order to obtain genetic information on P. antarctica T-34, we constructed a cDNA library from yeast cells producing MEL from soybean oil and identified the genes expressed through the creation of an expressed sequence tags (EST) library. We generated 398 ESTs, assembled into 146 contiguous sequences. Based upon a BLAST search similarity cut-off of E

  15. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands

    OpenAIRE

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-01-01

    Background Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and s...

  16. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  17. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Verwaal, R.; Wang, J.; Meijnen, J.P.; Visser, H.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2007-01-01

    To determine whether Saccharomyces cerevisiae can serve as a host for efficient carotenoid and especially ß-carotene production, carotenogenic genes from the carotenoid-producing yeast Xanthophyllomyces dendrorhous were introduced and overexpressed in S. cerevisiae. Because overexpression of these g

  18. High-level recombinant protein production by the basidiomycetous yeast Pseudozyma antarctica under a xylose-inducible xylanase promoter.

    Science.gov (United States)

    Watanabe, Takashi; Morita, Tomotake; Koike, Hideaki; Yarimizu, Tohru; Shinozaki, Yukiko; Sameshima-Yamashita, Yuka; Yoshida, Shigenobu; Koitabashi, Motoo; Kitamoto, Hiroko

    2016-04-01

    Yeast host-vector systems are useful tools for the production of recombinant proteins. Here, we report the construction of a new high-level expression plasmid pPAX1-neo for the basidiomycetous yeast, Pseudozyma antarctica. pPAX1-neo harbours a xylose-inducible expression cassette under control of the xylanase promoter and terminator of P. antarctica T-34, a selection cassette of neomycin/G418 with an Escherichia coli neomycin resistance gene under control of the homocitrate synthase promoter of strain T-34, and an autonomously replicating sequence fragment of Ustilago maydis (UARS). Biodegradable plastic (BP)-degrading enzymes of P. antarctica JCM10317 (PaE) and Paraphoma-related fungal strain B47-9 (PCLE) were used as reporter proteins and inserted into pPAX1-neo, resulting in pPAX1-neo::PaCLE1 and pPAX1-neo::PCLE, respectively. Homologous and heterologous BP-degrading enzyme production of transformants of P. antarctica T-34 were detected on agar plates containing xylose and emulsified BP. Recombinant PaE were also produced by transformants of other Pseudozyma strains including Pseudozyma aphidis, Pseudozyma rugulosa, and Pseudozyma tsukubaensis. To improve the stability of transformed genes in cells, the UARS fragment was removed from linearized pPAX1-neo::PaCLE1 and integrated into the chromosome of the P. antarctica strain, GB-4(0), which was selected as a PaE producer in xylose media. Two transformants, GB-4(0)-X14 and X49, had an 11-fold higher activity compared with the wild type strain in xylose-containing liquid media. By xylose fed-batch cultivation using a 3-L jar fermentor, GB-4(0)-X14 produced 73.5 U mL(-1) of PaE, which is 13.4-fold higher than that of the wild type strain GB-4(0), which produced 5.5 U mL(-1) of PaE. PMID:26695155

  19. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Directory of Open Access Journals (Sweden)

    Tomotake Morita

    Full Text Available Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs, multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes. The gene encoding an ATP/citrate lyase (ACL related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials.

  20. Genome and transcriptome analysis of the basidiomycetous yeast Pseudozyma antarctica producing extracellular glycolipids, mannosylerythritol lipids.

    Science.gov (United States)

    Morita, Tomotake; Koike, Hideaki; Hagiwara, Hiroko; Ito, Emi; Machida, Masayuki; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2014-01-01

    Pseudozyma antarctica is a non-pathogenic phyllosphere yeast known as an excellent producer of mannosylerythritol lipids (MELs), multi-functional extracellular glycolipids, from vegetable oils. To clarify the genetic characteristics of P. antarctica, we analyzed the 18 Mb genome of P. antarctica T-34. On the basis of KOG analysis, the number of genes (219 genes) categorized into lipid transport and metabolism classification in P. antarctica was one and a half times larger than that of yeast Saccharomyces cerevisiae (140 genes). The gene encoding an ATP/citrate lyase (ACL) related to acetyl-CoA synthesis conserved in oleaginous strains was found in P. antarctica genome: the single ACL gene possesses the four domains identical to that of the human gene, whereas the other oleaginous ascomycetous species have the two genes covering the four domains. P. antarctica genome exhibited a remarkable degree of synteny to U. maydis genome, however, the comparison of the gene expression profiles under the culture on the two carbon sources, glucose and soybean oil, by the DNA microarray method revealed that transcriptomes between the two species were significantly different. In P. antarctica, expression of the gene sets relating fatty acid metabolism were markedly up-regulated under the oily conditions compared with glucose. Additionally, MEL biosynthesis cluster of P. antarctica was highly expressed regardless of the carbon source as compared to U. maydis. These results strongly indicate that P. antarctica has an oleaginous nature which is relevant to its non-pathogenic and MEL-overproducing characteristics. The analysis and dataset contribute to stimulate the development of improved strains with customized properties for high yield production of functional bio-based materials. PMID:24586250

  1. Trichosporon wieringae sp.nov., an anamorphic basidiomycetous yeast from soil, and assimilation of some phenolic compounds, polysaccharides and other non-conventional carbon sources by saprophytic Trichosporon species

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    A morphological and physiological description of an anamorphic basidiomycetous yeast species isolated from soil, named Trichosporon wieringae, is presented. The phylogenetic position within the genus, based on nuclear base sequencing of the D1/D2 region of the large subunit of rDNA and of the ITS re

  2. Cryptococcus yokohamensis sp. nov., a basidiomycetous yeast isolated from trees and a Queensland koala kept in a Japanese zoological park.

    Science.gov (United States)

    Alshahni, Mohamed Mahdi; Makimura, Koichi; Satoh, Kazuo; Nishiyama, Yayoi; Kido, Nobuhide; Sawada, Takuo

    2011-12-01

    Three strains were isolated from the nostrils of a koala and the surrounding environment in a Japanese zoological park. Sequence analysis of the nuclear rDNA internal transcribed spacer (ITS) region and the large subunit rDNA D1/D2 domains in addition to physiological and morphological studies indicated that the isolates represent a single novel species belonging to the basidiomycetous genus Cryptococcus (Tremellales, Tremellomycetes, Agaricomycotina). Phylogenetic analysis based on D1/D2 and ITS regions revealed that the novel species belongs to the Fuciformis clade. The name Cryptococcus yokohamensis sp. nov. is proposed to accommodate these isolates with strain JCM 16989(T) (=TIMM 10001(T)=CBS 11776(T)=DSM 23671(T)) as the type strain.

  3. Identification of the gene PaEMT1 for biosynthesis of mannosylerythritol lipids in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Kitamoto, Hiroko K; Takegawa, Kaoru; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-11-01

    The yeast Pseudozyma antarctica produces a large amount of glycolipid biosurfactants known as mannosylerythritol lipids (MELs), which show not only excellent surface-active properties but also versatile biochemical actions. To investigate the biosynthesis of MELs in the yeast, we recently reported expressed sequence tag (EST) analysis and estimated genes expressing under MEL production conditions. Among the genes, a contiguous sequence of 938 bp, PA_004, showed high sequence identity to the gene emt1, encoding an erythritol/mannose transferase of Ustilago maydis, which is essential for MEL biosynthesis. The predicted translation product of the extended PA_004 containing the two introns and a stop codon was aligned with Emt1 of U. maydis. The predicted amino acid sequence shared high identity (72%) with Emt1 of U. maydis, although the amino-terminal was incomplete. To identify the gene as PaEMT1 encoding an erythritol/mannose transferase of P. antarctica, the gene-disrupted strain was developed by the method for targeted gene disruption, using hygromycin B resistance as the selection marker. The obtained ΔPaEMT1 strain failed to produce MELs, while its growth was the same as that of the parental strain. The additional mannosylerythritol into culture allowed ΔPaEMT1 strain to form MELs regardless of the carbon source supplied, indicating a defect of the erythritol/mannose transferase activity. Furthermore, we found that MEL formation is associated with the morphology and low-temperature tolerance of the yeast. PMID:20564650

  4. Characterization of new types of mannosylerythritol lipids as biosurfactants produced from soybean oil by a basidiomycetous yeast, Pseudozyma shanxiensis.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2007-01-01

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These show not only the excellent surface-active properties but also versatile biochemical actions. In course of MEL production from soybean oil by P. shanxiensis, new extracellular glycolipids (more hydrophilic than the previously reported MELs) were found in the culture medium. As a result of the structural characterization, the glycolipids were identified as a mixture of 4-O-[(2', 4'-di-O-acetyl-3'-O-alka(e)noyl)-beta-D-mannopyranosyl]-D-erythritol and 4-O-[(4'-O-acetyl-3'-O-alka(e)noyl-2'-O-butanoyl)-beta-D-mannopyranosyl]-D-erythritol. Interestingly, the new MELs possessed a much shorter chain (C(2) or C(4)) at the C-2' position of the mannose moiety compared to the MELs hitherto reported, which mainly possess a medium-chain acid (C(10)) at the position. They would thus show higher hydrophilicity and/or water-solubility, and expand the development of the environmentally advanced yeast biosurfactants. PMID:17898510

  5. Ubc2, an Ortholog of the Yeast Ste50p Adaptor, Possesses a Basidiomycete-Specific Carboxy terminal Extension Essential for Pathogenicity Independent of Pheromone Response.

    Science.gov (United States)

    Proteins involved in the MAP kinase pathway controlling mating, morphogenesis and pathogenicity have been identified previously in the fungus Ustilago maydis. One of these, the Ubc2 adaptor protein, possesses a basidiomycete-specific structure. In addition to containing SAM and RA domains typical of...

  6. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of th

  7. Cryptococcus allantoinivorans sp.nov., an anamorphic basidiomycetous yeast (Tremellales) physiologicallt resembling other species of the Cryptococcus laurentii complex that degrade polysaccharides and C2 compounds

    OpenAIRE

    Middelhoven, W.J.

    2005-01-01

    A novel Cryptococcus species is proposed to accommodate a yeast strain (CBS 9604) able to assimilate allantoin as sole carbon source, a characteristic very uncommon among yeasts. By traditional methods, the strain could not be distinguished from Cryptococcus laurentii, but nucleotide sequences of the D1D2 region of the large subunit (26S) and of the ITS region of ribosomal DNA showed relationship to the Bulleromyces clade of the genus Cryptococcus (order Tremellales) with some Tremella spp. a...

  8. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  9. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S)-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Fukuoka, Tokuma; Yamamoto, Shuhei; Kishimoto, Takahide; Morita, Tomotake

    2016-01-01

    Mannosylerythritol lipids (MELs) belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S)-erythritol (R-form) as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R)-erythritol (S-form) as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL. PMID:27327162

  10. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  11. The role of PaAAC1 encoding a mitochondrial ADP/ATP carrier in the biosynthesis of extracellular glycolipids, mannosylerythritol lipids, in the basidiomycetous yeast Pseudozyma antarctica.

    Science.gov (United States)

    Morita, Tomotake; Ito, Emi; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2010-07-01

    Pseudozyma antarctica produces large amounts of the glycolipid biosurfactants known as mannosylerythritol lipids (MEL), which show not only excellent surface-active properties but also versatile biochemical actions. A gene homologous with a mitochondrial ADP/ATP carrier was dominantly expressed in P. antarctica under MEL-producing conditions on the basis of previous gene expression analysis. The gene encoding the mitochondrial ADP/ATP carrier of P. antarctica (PaAAC1) contained a putative open reading frame of 954 bp and encodes a polypeptide of 317 amino acids. The deduced translation product shared high identity of 66%, 70%, 69%, 74%, 75% and 52% with the mitochondrial ADP/ATP carrier of Saccharomyces cerevisiae (AAC1), S. cerevisiae (AAC2), S. cerevisiae (AAC3), Kluyveromyces lactis (KlAAC), Neurospora crassa (NcAAC) and human (ANT1), respectively, and conserved the consensus sequences of all ADP/ATP carrier proteins. The gene expression by introducing a plasmid pUXV1-PaAAC1 into the yeast cells increased the MEL production. In addition, the expression of PaAAC1 in which the conserved arginine and leucine required for ATP transport activity were replaced with isoleucine and serine, respectively, failed to increase MEL production. Accordingly, these results suggest that PaAAC1 encoding a mitochondrial ADP/ATP carrier should be involved in MEL biosynthesis in the yeast. PMID:20146402

  12. A basidiomycetous yeast, Pseudozyma tsukubaensis, efficiently produces a novel glycolipid biosurfactant. The identification of a new diastereomer of mannosylerythritol lipid-B.

    Science.gov (United States)

    Fukuoka, Tokuma; Morita, Tomotake; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2008-02-25

    Mannosylerythritol lipids (MELs) are glycolipid biosurfactants produced by the yeast strains of the genus Pseudozyma. These compounds show not only excellent surface-active properties but also versatile biochemical activities. In the course of MEL production by Pseudozyma tsukubaensis, we found an unusual MEL that had a different carbohydrate structure from that of conventional MELs. The carbohydrate structure was identified as 1-O-beta-D-mannopyranosyl-D-erythritol, and the MEL was confirmed to be 1-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol. Interestingly, the configuration of the erythritol moiety in the present MEL was opposite to that of the known MEL-B, 4-O-beta-(2',3'-di-O-alka(e)noyl-6'-O-acetyl-D-mannopyranosyl)-D-erythritol, and to that of all MELs hitherto reported. The present MEL should thus provide different interfacial and biochemical properties compared to conventional MELs. PMID:18083152

  13. Degradation of cellulose by basidiomycetous fungi.

    Science.gov (United States)

    Baldrian, Petr; Valásková, Vendula

    2008-05-01

    Cellulose is the main polymeric component of the plant cell wall, the most abundant polysaccharide on Earth, and an important renewable resource. Basidiomycetous fungi belong to its most potent degraders because many species grow on dead wood or litter, in environment rich in cellulose. Fungal cellulolytic systems differ from the complex cellulolytic systems of bacteria. For the degradation of cellulose, basidiomycetes utilize a set of hydrolytic enzymes typically composed of endoglucanase, cellobiohydrolase and beta-glucosidase. In some species, the absence of cellobiohydrolase is substituted by the production of processive endoglucanases combining the properties of both of these enzymes. In addition, systems producing hydroxyl radicals based on cellobiose dehydrogenase, quinone redox cycling or glycopeptide-based Fenton reaction are involved in the degradation of several plant cell wall components, including cellulose. The complete cellulolytic complex used by a single fungal species is typically composed of more than one of the above mechanisms that contribute to the utilization of cellulose as a source of carbon or energy or degrade it to ensure fast substrate colonization. The efficiency and regulation of cellulose degradation differs among wood-rotting, litter-decomposing, mycorrhizal or plant pathogenic fungi and yeasts due to the different roles of cellulose degradation in the physiology and ecology of the individual groups. PMID:18371173

  14. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  15. Plant-polysaccharide-degrading enzymes from basidiomycetes

    NARCIS (Netherlands)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P; Mäkelä, Miia R; van den Brink, J.

    2014-01-01

    SUMMARY: Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-poly

  16. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  17. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Science.gov (United States)

    David-Palma, Márcia; Sampaio, José Paulo; Gonçalves, Paula

    2016-06-01

    In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R) and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD) transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism will benefit from

  18. Genetic Dissection of Sexual Reproduction in a Primary Homothallic Basidiomycete.

    Directory of Open Access Journals (Sweden)

    Márcia David-Palma

    2016-06-01

    Full Text Available In fungi belonging to the phylum Basidiomycota, sexual compatibility is usually determined by two genetically unlinked MAT loci, one of which encodes one or more pheromone receptors (P/R and pheromone precursors, and the other comprehends at least one pair of divergently transcribed genes encoding homeodomain (HD transcription factors. Most species are heterothallic, meaning that sexual reproduction requires mating between two sexually compatible individuals harboring different alleles at both MAT loci. However, some species are known to be homothallic, one individual being capable of completing the sexual cycle without mating with a genetically distinct partner. While the molecular underpinnings of the heterothallic life cycles of several basidiomycete model species have been dissected in great detail, much less is known concerning the molecular basis for homothallism. Following the discovery in available draft genomes of the homothallic basidiomycetous yeast Phaffia rhodozyma of P/R and HD genes, we employed available genetic tools to determine their role in sexual development. Two P/R clusters, each harboring one pheromone receptor and one pheromone precursor gene were found in close vicinity of each other and were shown to form two redundant P/R pairs, each receptor being activated by the pheromone encoded by the most distal pheromone precursor gene. The HD locus is apparently genetically unlinked to the P/R locus and encodes a single pair of divergently transcribed HD1 and HD2 transcription factors, both required for normal completion of the sexual cycle. Given the genetic makeup of P. rhodozyma MAT loci, we postulate that it is a primarily homothallic organism and we propose a model for the interplay of molecular interactions required for sexual development in this species. Phaffia rhodozyma is considered one of the most promising microbial source of the carotenoid astaxanthin. Further development of this yeast as an industrial organism

  19. The yeast flora of the coast redwood, Sequoia sempervirens

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2003-01-01

    Only four yeast species could be isolated from young and perannual shoots of the coast redwood tree, Sequoia sempervirens, and from soil beneath the trees, viz. both varieties of Debaryomyces hansenii, Trichosporon pullulans, T. porosum and an unidentified red basidiomycetous yeast.

  20. Proteomic analysis of Rhodotorula mucilaginosa: dealing with the issues of a non-conventional yeast.

    Science.gov (United States)

    Addis, Maria Filippa; Tanca, Alessandro; Landolfo, Sara; Abbondio, Marcello; Cutzu, Raffaela; Biosa, Grazia; Pagnozzi, Daniela; Uzzau, Sergio; Mannazzu, Ilaria

    2016-08-01

    Red yeasts ascribed to the species Rhodotorula mucilaginosa are gaining increasing attention, due to their numerous biotechnological applications, spanning carotenoid production, liquid bioremediation, heavy metal biotransformation and antifungal and plant growth-promoting actions, but also for their role as opportunistic pathogens. Nevertheless, their characterization at the 'omic' level is still scarce. Here, we applied different proteomic workflows to R. mucilaginosa with the aim of assessing their potential in generating information on proteins and functions of biotechnological interest, with a particular focus on the carotenogenic pathway. After optimization of protein extraction, we tested several gel-based (including 2D-DIGE) and gel-free sample preparation techniques, followed by tandem mass spectrometry analysis. Contextually, we evaluated different bioinformatic strategies for protein identification and interpretation of the biological significance of the dataset. When 2D-DIGE analysis was applied, not all spots returned a unambiguous identification and no carotenogenic enzymes were identified, even upon the application of different database search strategies. Then, the application of shotgun proteomic workflows with varying levels of sensitivity provided a picture of the information depth that can be reached with different analytical resources, and resulted in a plethora of information on R. mucilaginosa metabolism. However, also in these cases no proteins related to the carotenogenic pathway were identified, thus indicating that further improvements in sequence databases and functional annotations are strictly needed for increasing the outcome of proteomic analysis of this and other non-conventional yeasts. Copyright © 2016 John Wiley & Sons, Ltd. PMID:26987668

  1. [Basidiomycetes: A new source of secondary metabolites.].

    Science.gov (United States)

    Brizuela, M A; García, L; Pérez, L; Mansur, M

    1998-06-01

    The area of natural products research is the most rapidly growing field of organic chemistry, due to the great technical developments in the isolation and identification techniques. Today, near to one million natural products -isolated from the most diverse living things- are known. Microorganisms are among the least-studied of these. Nevertheless, they offer large possibilities for the discovery of new structures and biological activities. Among the microorganisms, the Basidiomycetes present a production capacity and a range of biologically active metabolites, which have scarcely been investigated. The wide spectrum of natural products with biological activity produced by Basidiomycetes includes antimicrobial agents, antifungal, antiviral and cytotoxic activities, enzymes, plant growth regulators and flavors. These metabolites are generally grouped by their chemical origin, and the relationship between chemical structure and the different biological activities reported. The main objective of this review is to bring an updated revision of the numerous and interesting biosynthetic pathways from basidiomycetes.

  2. The cell end marker Tea4 regulates morphogenesis and pathogenicity in the basidiomycete fungus Ustilago maydis.

    Science.gov (United States)

    Valinluck, Michael; Woraratanadharm, Tad; Lu, Ching-yu; Quintanilla, Rene H; Banuett, Flora

    2014-05-01

    Positional cues localized to distinct cell domains are critical for the generation of cell polarity and cell morphogenesis. These cues lead to assembly of protein complexes that organize the cytoskeleton resulting in delivery of vesicles to sites of polarized growth. Tea4, an SH3 domain protein, was first identified in fission yeast, and is a critical determinant of the axis of polarized growth, a role conserved among ascomycete fungi. Ustilago maydis is a badiomycete fungus that exhibits a yeast-like form that is nonpathogenic and a filamentous form that is pathogenic on maize and teozintle. We are interested in understanding how positional cues contribute to generation and maintenance of these two forms, and their role in pathogenicity. We identified a homologue of fission yeast tea4 in a genetic screen for mutants with altered colony and cell morphology and present here analysis of Tea4 for the first time in a basidiomycete fungus. We demonstrate that Tea4 is an important positional marker for polarized growth and septum location in both forms. We uncover roles for Tea4 in maintenance of cell and neck width, cell separation, and cell wall deposition in the yeast-like form, and in growth rate, formation of retraction septa, growth reversal, and inhibition of budding in the filamentous form. We show that Tea4::GFP localizes to sites of polarized or potential polarized growth in both forms, as observed in ascomycete fungi. We demonstrate an essential role of Tea4 in pathogencity in the absence of cell fusion. Basidiomycete and ascomycete Tea4 homologues share SH3 and Glc7 domains. Tea4 in basidiomycetes has additional domains, which has led us to hypothesize that Tea4 has novel functions in this group of fungi.

  3. Eighteen new oleaginous yeast species.

    Science.gov (United States)

    Garay, Luis A; Sitepu, Irnayuli R; Cajka, Tomas; Chandra, Idelia; Shi, Sandy; Lin, Ting; German, J Bruce; Fiehn, Oliver; Boundy-Mills, Kyria L

    2016-07-01

    Of 1600 known species of yeasts, about 70 are known to be oleaginous, defined as being able to accumulate over 20 % intracellular lipids. These yeasts have value for fundamental and applied research. A survey of yeasts from the Phaff Yeast Culture Collection, University of California Davis was performed to identify additional oleaginous species within the Basidiomycota phylum. Fifty-nine strains belonging to 34 species were grown in lipid inducing media, and total cell mass, lipid yield and triacylglycerol profiles were determined. Thirty-two species accumulated at least 20 % lipid and 25 species accumulated over 40 % lipid by dry weight. Eighteen of these species were not previously reported to be oleaginous. Triacylglycerol profiles were suitable for biodiesel production. These results greatly expand the number of known oleaginous yeast species, and reveal the wealth of natural diversity of triacylglycerol profiles within wild-type oleaginous Basidiomycetes. PMID:27072563

  4. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  5. Cryopreservation of basidiomycete strains using perlite.

    Science.gov (United States)

    Homolka, L; Lisá, L; Eichlerová, I; Nerud, F

    2001-12-01

    A new alternative method using perlite as a particulate solid carrier in the growth medium with a cryoprotectant was successfully tested for cryopreservation of several basidiomycete species from different genera (Armillaria, Pleurotus, Pluteus, Polyporus) which failed to survive or retain their properties in cryopreservation procedures routinely used in our laboratory. Frozen basidiomycete strains were kept in cryovials submerged in liquid nitrogen and were either immediately after the freezing process or after a 6-month storage thawed and checked for viability, purity and changes in growth, morphology and biochemical characteristics. All cultures survived the cryopreservation procedure and no negative effects of cryopreservation by this method have been observed after 6 months of storage in liquid nitrogen.

  6. [Morphology and structural peculiarities of Basidiomycetes pathogens].

    Science.gov (United States)

    Boĭko, O A; Shevchenko, T P; Boĭko, A A

    2013-01-01

    The materials of studies of morphology and structural peculiarities of viruses, fungi and bacteria, which affect Basidiomycetes under biotechnology process and nature biocenosis conditions are given. The analysis of infection development in button mushroom (Agaricus bisporus) (J.Lge) Imbach and in oyster mushroom (Pleurotus ostreatus Kumm.), which served as model objects in the experiments of various levels of complexity has been carried out. Other kinds of edible and medicinal mushrooms, which were a source of biochemical fractions to form biologicals were investigated. PMID:23866587

  7. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  8. Survey of Basidiomycets and Insect Infested Roadside Trees

    OpenAIRE

    Oga, Shoji; Nomura, Shuhei; Inoue, Susumu

    1995-01-01

    Some biotic and abiotic factors causal to the deterioration of roadside trees were surveyed in Fukuoka City on 23 species planted along 22 main streets. Various fruit bodies of basidiomycete, imperfect fungi and bacterial canker disease as well as insect pests were detected. Forty-six fungi strains were obtained in this survey. Aphyllophorales basidiomycete was the most abundant fungi found in surveyed raodside trees. Fruit bodies of 7 edible mushroom species were identified on the scaffold l...

  9. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  10. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii c

  11. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  12. Polyphasic identification of yeasts isolated from bark of cork oak during the manufacturing process of cork stoppers.

    Science.gov (United States)

    Villa-Carvajal, Mercedes; Coque, Juan José R; Alvarez-Rodríguez, María Luísa; Uruburu, Federico; Belloch, Carmela

    2004-05-01

    A two-step protocol was used for the identification of 52 yeasts isolated from bark of cork oak at initial stages of the manufacturing process of cork stoppers. The first step in the identification was the separation of the isolates into groups by their physiological properties and RFLPs of the ITS-5.8S rRNA gene. The second step was the sequencing of the D1/D2 domains of the 26S rRNA gene of selected isolates representing the different groups. The results revealed a predominance of basidiomycetous yeasts (11 species), while only two species represented the ascomycetous yeasts. Among the basidiomycetous yeasts, members representing the species Rhodosporidium kratochvilovae and Rhodotorula nothofagi, that have been previously isolated from plant material, were the most abundant. Yeasts pertaining to the species Debaryomyces hansenii var. fabryii, Rhodotorula mucilaginosa and Trichosporon mucoides were isolated in small numbers.

  13. A deviation from the bipolar-tetrapolar mating paradigm in an early diverged basidiomycete.

    Directory of Open Access Journals (Sweden)

    Marco A Coelho

    2010-08-01

    Full Text Available In fungi, sexual identity is determined by specialized genomic regions called MAT loci which are the equivalent to sex chromosomes in some animals and plants. Usually, only two sexes or mating types exist, which are determined by two alternate sets of genes (or alleles at the MAT locus (bipolar system. However, in the phylum Basidiomycota, a unique tetrapolar system emerged in which four different mating types are generated per meiosis. This occurs because two functionally distinct molecular recognition systems, each encoded by one MAT region, constrain the selection of sexual partners. Heterozygosity at both MAT regions is a pre-requisite for mating in both bipolar and tetrapolar basidiomycetes. Tetrapolar mating behaviour results from the absence of genetic linkage between the two regions bringing forth up to thousands of mating types. The subphylum Pucciniomycotina, an early diverged lineage of basidiomycetes encompassing important plant pathogens such as the rusts and saprobes like Rhodosporidium and Sporidiobolus, has been so far poorly explored concerning the content and organization of MAT loci. Here we show that the red yeast Sporidiobolus salmonicolor has a mating system unlike any previously described because occasional disruptions of the genetic cohesion of the bipolar MAT locus originate new mating types. We confirmed that mating is normally bipolar and that heterozygosity at both MAT regions is required for mating. However, a laboratory cross showed that meiotic recombination may occur within the bipolar MAT locus, explaining tetrapolar features like increased allele number and evolution rates of some MAT genes. This pseudo-bipolar system deviates from the classical bipolar-tetrapolar paradigm and, to our knowledge, has never been observed before. We propose a model for MAT evolution in the Basidiomycota in which the pseudo-bipolar system may represent a hitherto unforeseen gradual form of transition from an ancestral tetrapolar

  14. Draft Genome Sequence of the Yeast Pseudozyma antarctica Type Strain JCM10317, a Producer of the Glycolipid Biosurfactants, Mannosylerythritol Lipids.

    Science.gov (United States)

    Saika, Azusa; Koike, Hideaki; Hori, Tomoyuki; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai; Morita, Tomotake

    2014-01-01

    The basidiomycetous yeast Pseudozyma antarctica is known as a producer of industrial enzymes and the extracellular glycolipids, mannosylerythritol lipids. Here, we report the draft genome sequence of the type strain JCM10317. The draft genome assembly has a size of 18.1 Mb and a G+C content of 60.9%, and it consists of 197 scaffolds. PMID:25291760

  15. Overwintering of vineyard yeasts: survival of interacting yeast communities in grapes mummified on vines

    Directory of Open Access Journals (Sweden)

    Matthias eSipiczki

    2016-02-01

    Full Text Available The conversion of grape must into wine involves the development and succession of yeast populations differing in species composition. The initial population is formed by vineyard strains which are washed into the must from the crushed grapes and then completed with yeasts coming from the cellar environment. As the origin and natural habitat of the vineyard yeasts are not fully understood, this study addresses the possibility that grape yeasts can be preserved in berries left behind on vines at harvest until the spring of the next year. These berries become mummified during the winter on the vines. To investigate whether yeasts can survive in these overwintering grapes, mummified berries were collected in 16 localities in the Tokaj wine region (Hungary-Slovakia in early March. The collected berries were rehydrated to recover viable yeasts by plating samples onto agar plates. For the detection of minority species which would not be detected by direct plating, an enrichment step repressing the propagation of alcohol-sensitive yeasts was also included in the process. The morphological, physiological and molecular analysis identified 13 basidiomycetous and 23 ascomycetous species including fermentative yeasts of wine-making relevance among the 3879 isolates. The presence of viable strains of these species demonstrates that the grapes mummified on the vine can serve as a safe reservoir of yeasts, and may contribute to the maintenance of grape-colonizing yeast populations in the vineyard over years, parallel with other vectors and habitats. All basidiomycetous species were known phylloplane yeasts. Three Hanseniaspora species and pigmented Metschnikowia strains were the most frequent ascomycetes. Other fermentative yeasts of wine-making relevance were detected only in the enrichment cultures. Saccharomyces (S. paradoxus, S. cerevisiae and S. uvarum were recovered from 13 % of the samples. No Candida zemplinina was found. The isolates with Aureobasidium

  16. Chemical constituents from fruiting bodies of Basidiomycete Perenniporia subacida.

    Science.gov (United States)

    Wen, Chun-Nan; Hu, Dong-Bao; Bai, Xue; Wang, Fang; Li, Zheng-Hui; Feng, Tao; Liu, Ji-Kai

    2016-03-01

    Four new aromatic abietane diterpenoids and two new benzene derivatives, namely perenacidins A-F (1-6), have been isolated from the fruiting bodies of Basidiomycete Perenniporia subacida. The structures were elucidated by means of extensive spectroscopic methods and computational ECD method. The antifungal activities against Canidia albicans and the cytotoxic activities against four cancer cell lines (including K-562, A-549, SMMC-7721, MCF-7) were evaluated in vitro. PMID:26779942

  17. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-12-01

    Full Text Available ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP, which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need of eco-efficient solutions for its colored effluents. White rot basidiomycetous fungi comprise the only group of organisms known to completely degrade lignin. Ligninolytic enzymes have potential applications in a large number of fields, including the chemical, fuel, food, agricultural, paper, textile, cosmetic industrial sectors and more. This ligninolytic system of white-rot fungi is also directly involved in the degradation of various xenobiotic compounds apart from textile dyes. Their capacities to remove xenobiotic substances make them a useful tool for bioremediation purposes. This paper reviews involvement of ligninolytic enzymes of white rot basidiomycetes in the degradation of textiles dyes and xenobiotic compounds for their industrial and biotechnological applications.

  18. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment.

  19. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

    Science.gov (United States)

    Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

    2013-04-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment. PMID:23350659

  20. Substrate recognition by glycoside hydrolase family 74 xyloglucanase from the basidiomycete Phanerochaete chrysosporium.

    Science.gov (United States)

    Ishida, Takuya; Yaoi, Katsuro; Hiyoshi, Ayako; Igarashi, Kiyohiko; Samejima, Masahiro

    2007-11-01

    The basidiomycete Phanerochaete chrysosporium produces xyloglucanase Xgh74B, which has the glycoside hydrolase (GH) family 74 catalytic domain and family 1 carbohydrate-binding module, in cellulose-grown culture. The recombinant enzyme, which was heterologously expressed in the yeast Pichia pastoris, had high hydrolytic activity toward xyloglucan from tamarind seed (TXG), whereas other beta-1,4-glucans examined were poor substrates for the enzyme. The existence of the carbohydrate-binding module significantly affects adsorption of the enzyme on crystalline cellulose, but has no effect on the hydrolysis of xyloglucan, indicating that the domain may contribute to the localization of the enzyme. HPLC and MALDI-TOF MS analyses of the hydrolytic products of TXG clearly indicated that Xgh74B hydrolyzes the glycosidic bonds of unbranched glucose residues, like other GH family 74 xyloglucanases. However, viscometric analysis suggested that Xgh74B hydrolyzes TXG in a different manner from other known GH family 74 xyloglucanases. Gel permeation chromatography showed that Xgh74B initially produced oligosaccharides of degree of polymerization (DP) 16-18, and these oligosaccharides were then slowly hydrolyzed to final products of DP 7-9. In addition, the ratio of oligosaccharides of DP 7-9 versus those of DP 16-18 was dependent upon the pH of the reaction mixture, indicating that the affinity of Xgh74B for the oligosaccharides of DP 16-18 is affected by the ionic environment at the active site. PMID:17922847

  1. The influence of Aster x salignus Willd. Invasion on the diversity of soil yeast communities

    Science.gov (United States)

    Glushakova, A. M.; Kachalkin, A. V.; Chernov, I. Yu.

    2016-07-01

    The annual dynamics of yeast communities were studied in the soddy-podzolic soil under the thickets of Aster x salignus Willd., one of the widespread invasive plant species in central Russia. Yeast groups in the soils under continuous aster thickets were found to differ greatly from the yeast communities in the soils under the adjacent indigenous meadow vegetation. In both biotopes the same species ( Candida vartiovaarae, Candida sake, and Cryptococcus terreus) are dominants. However, in the soils under indigenous grasses, eurybiontic yeasts Rhodotorula mucilaginosa, which almost never occur in the soil under aster, are widespread. In the soil under aster, the shares of other typical epiphytic and pedobiontic yeast fungi (ascomycetic species Wickerhamomyces aniomalus, Barnettozyma californica and basidiomycetic species Cystofilobasidium macerans, Guehomyces pullulans) significantly increase. Thus, the invasion of Aster x salignus has a clear effect on soil yeast complexes reducing their taxonomic and ecological diversity.

  2. Development of novel fermentation systems for the production of nonalcoholic beverages with basidiomycetes

    OpenAIRE

    Zhang, Yanyan

    2015-01-01

    Basidiomycetes represent the highest developed class of fungi. They are able to synthesize pharmacological relevant secondary metabolites, natural flavor compounds, and highly sought after enzymes. Because of their biochemical potential, basidiomycetes are ideal tools for the food industry. With the recent worldwide declining consumption of beer, breweries are eagerly searching for innovative nonalcoholic fermented beverages to compensate for this negative trend. Different from microorgan...

  3. A Preliminary Note on Yeasts Associated With Fecal Pellets of Rodents and Marsupials of Atlantic Forest Fragments in Rio de Janeiro, Brazil

    OpenAIRE

    Jacqueline Abranches; Hilda N. Nóbrega; Patrícia Valente; Leda C. Mendonça-Hagler; Allen N. Hagler

    1998-01-01

    Yeasts had mean counts of above 106 CFU/g in the fecal pellets of small mammals from tropical forest fragments. Most of the 55 species isolated were fermentative ascomycetes, with the most frequent being Debaryomyces hansenii, Pichia membranifaciens and Issatchenkia orientalis, whereas Rhodotorula mucilaginosa was the most frequent yeast of basidiomycetous affinity.Leveduras em pelotas fecais de pequenos mamíferos provenientes de fragmentos de Mata Atlântica tiveram contagem média acima de 10...

  4. Cryptococcus friedmannii, a new species of yeast from the Antarctic

    Science.gov (United States)

    Vishniac, H. S.

    1985-01-01

    Cryptococcus friedmannii Vishniac sp. nov. from an Antarctic cryptoendolithic community is a psychrophilic basidioblastomycete characterized by cream-colored colonies of cells with smooth, layered walls, budding monopolarly, producing amylose and extracellular proteinase, utilizing nitrate and D-alanine (inter alia) as nitrogen sources and L-arabinose, arbutin, cellobiose, D-glucuronate, maltose, melezitose, salicin, soluble starch, trehalose, and D-xylose as carbon sources. This species differs from all other basidiomycetous yeasts in possessing the following combination of characters: amylose production (positive), assimilation of cellobiose (positive), D-galactose (negative), myo-inositol (negative), D-mannitol (negative), and sucrose (negative).

  5. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  6. DESTRUCTION OF XENOBIOTICS BY CULTURE FILTRATE FROM XYLOTROPHIC BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O. V.

    2015-12-01

    Full Text Available The article deals with the efficiency of pollutants biodegradation by xylotrophic basidiomycetes submerged cultures grown on standard glucose-peptone medium (GPM. The efficiency of pollutants biodegradation was determined by the model compound – dye Methyl Orange. The purpose of the work is screening of 19 species 81 strains xylotrophic basidiomycetes cultures on the indicator of the dye oxidative degradation efficiency and exploring the possibility of induction of this indicator by modifying the culture medium. The biodegradation efficiency was determined by following method. Assigned amount of culture filtrate (experiment or medium (control was added to the 0.001% solution of Methyl Orange in sodium acetate buffer. pH of the reaction mixture was 4.4 units. Samples were incubated at +40°C for 48 hours. Then pH of the reaction mixture was set up at 3.1 units using sodium acetate buffer and the optical density of solutions at a wavelength of 506 nm was measured. The efficiency of biodegradation was calculated by the difference of the optical density of control and experiment as a percentage. The most promising strains – F. velutipes F-1105, P. eryngii P-er, T. hirsuta Th-11 and D. quercina Dq-08 were selected. The composition of the glucose-peptone medium was modified for these strains by the introduction in the medium lignosulfonate, Tween 80, Kirk’s minerals solution and selecting the concentration of these components. According to the study for the purpose of pollutants degradation it is advisable to cultivate F. velutipes F-1105 strain on modified GPM, which further comprises at 1 l: lignosulfonate – 3.5 g; Tween 80 – 1.0 g, Kirk’s minerals solution – 70 ml; P. eryngii P-er strain – 5.0 g, 1.0 g, 70 ml; T. hirsuta Th-11 strain – 5.0 g, 1.0 g, 105 ml; and D. quercina Dq-08 strain – 6.5 g, 1.0 g, 105 ml, respectively. This allowed to increase the model compound degradation efficiency by the culture filtrate of strain F

  7. Сultivation Features of Higher Basidiomycetes Trametes zonatus for Liquid Medium

    OpenAIRE

    Тітова, Лариса Олександрівна; Клечак, Інна Рішардівна

    2016-01-01

    Background. The basidiomycetes T. zonatus are producers and cellulose oxidative enzymes and polysaccharides with antitumor activity. The feasibility of this study is that the creation of functional food biotechnology from strains of biomass from domestic collections is not enough initial data: fragmentary data on cultivation conditions and culture medium composition, biochemical biomass of T. zonatus.Оbjective. The aim of the study is to conduct screening of basidiomycetes strains T. zonatus ...

  8. Basidiomycete cryopreservation on perlite: evaluation of a new method.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2006-06-01

    A new cryopreservation method using perlite as a carrier was evaluated on a large set of mycelial cultures of basidiomycetes. The viability and some other characteristics--growth, macro- and micromorphology, and laccase production--of 442 strains were tested after 48-h and then after 3-year storage in liquid nitrogen using a perlite protocol (PP). All (100%) of them survived successfully both 48-h storage and 3-year storage in liquid nitrogen without noticeable growth and morphological changes. Also laccase production was unchanged. The viability and laccase production of a part (250) of these strains were compared with those of the strains subjected to an original agar plug protocol (OP). Using OP, 144 strains (57.6%) out of 250 survived a 3-year storage in liquid nitrogen. The results indicate that the cryopreservation protocol used significantly influences survival of the strains. Markedly better results were achieved using the PP.

  9. Identification and functional characterization of the CYP51 gene from the yeast Xanthophyllomyces dendrorhous that is involved in ergosterol biosynthesis

    OpenAIRE

    Leiva, Kritsye; Werner, Nicole; Sepúlveda, Dionisia; Barahona, Salvador; Baeza, Marcelo; Cifuentes, Víctor; Alcaíno, Jennifer

    2015-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that synthesizes astaxanthin, a carotenoid with great biotechnological impact. The ergosterol and carotenoid synthetic pathways derive from the mevalonate pathway and involve cytochrome P450 enzymes. Among these enzymes, the CYP51 family, which is involved in ergosterol biosynthesis, is one of the most remarkable that has C14-demethylase activity. Results In this study, the CYP51 gene from X. dendrorhous was isolated and its ...

  10. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  11. The basidiomycete Ustilago maydis has two plasma membrane H⁺-ATPases related to fungi and plants.

    Science.gov (United States)

    Robles-Martínez, Leobarda; Pardo, Juan Pablo; Miranda, Manuel; Mendez, Tavis L; Matus-Ortega, Macario Genaro; Mendoza-Hernández, Guillermo; Guerra-Sánchez, Guadalupe

    2013-10-01

    The fungal and plant plasma membrane H⁺-ATPases play critical roles in the physiology of yeast, plant and protozoa cells. We identified two genes encoding two plasma membrane H⁺-ATPases in the basidiomycete Ustilago maydis, one protein with higher identity to fungal (um02581) and the other to plant (um01205) H⁺-ATPases. Proton pumping activity was 5-fold higher when cells were grown in minimal medium with ethanol compared to cells cultured in rich YPD medium, but total vanadate-sensitive ATPase activity was the same in both conditions. In contrast, the activity in cells cultured in minimal medium with glucose was 2-fold higher than in YPD or ethanol, implicating mechanisms for the regulation of the plasma membrane ATPase activity in U. maydis. Analysis of gene expression of the H⁺-ATPases from cells grown under different conditions, showed that the transcript expression of um01205 (plant-type) was higher than that of um02581 (fungal-type). The translation of the two proteins was confirmed by mass spectrometry analysis. Unlike baker's yeast and plant H⁺-ATPases, where the activity is increased by a short incubation with glucose or sucrose, respectively, U. maydis H⁺-ATPase activity did not change in response to these sugars. Sequence analysis of the two U. maydis H⁺-ATPases revealed the lack of canonical threonine and serine residues which are targets of protein kinases in Saccharomyces cerevisiae and Arabidopsis thaliana plasma membrane H⁺-ATPases, suggesting that phosphorylation of the U. maydis enzymes occurs at different amino acid residues.

  12. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  13. Diversity of soil yeasts isolated from South Victoria Land, Antarctica

    Science.gov (United States)

    Connell, L.; Redman, R.; Craig, S.; Scorzetti, G.; Iszard, M.; Rodriguez, R.

    2008-01-01

    Unicellular fungi, commonly referred to as yeasts, were found to be components of the culturable soil fungal population in Taylor Valley, Mt. Discovery, Wright Valley, and two mountain peaks of South Victoria Land, Antarctica. Samples were taken from sites spanning a diversity of soil habitats that were not directly associated with vertebrate activity. A large proportion of yeasts isolated in this study were basidiomycetous species (89%), of which 43% may represent undescribed species, demonstrating that culturable yeasts remain incompletely described in these polar desert soils. Cryptococcus species represented the most often isolated genus (33%) followed by Leucosporidium (22%). Principle component analysis and multiple linear regression using stepwise selection was used to model the relation between abiotic variables (principle component 1 and principle component 2 scores) and yeast biodiversity (the number of species present at a given site). These analyses identified soil pH and electrical conductivity as significant predictors of yeast biodiversity. Species-specific PCR primers were designed to rapidly discriminate among the Dioszegia and Leucosporidium species collected in this study. ?? 2008 Springer Science+Business Media, LLC.

  14. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  15. Protease activity in cockroach and basidiomycete allergen extracts.

    Science.gov (United States)

    Wongtim, S; Lehrer, S B; Salvaggio, J E; Horner, W E

    1993-01-01

    Inherent proteolytic activity was estimated in cockroach and basidiomycete extracts by quantifying acid soluble peptides that were released by incubating extracts with 1% bovine serum albumin as measured by Lowry (Sigma). Reference proteases released 740 (Proteinase K, 0.1 U), 248 (Trypsin, 1.0 U), and 533 micrograms/ml (Pronase, 0.5 U) of soluble peptides. American whole body cockroach extract (0.1 mg dry weight) released 330 micrograms/ml of soluble peptides, representing 13 trypsin equivalent units (TEU)/mg. Extracts from spores of the mushroom Pleurotus ostreatus released 230 micrograms/ml (0.9 TEU/mg) and Pleurotus cap extract released 112 micrograms/ml (0.5 TEU/mg). Mycelium of Pleurotus and the mushroom Psilocybe cubensis and spores of Psilocybe and the puffball Calvatia cyathiformis showed negligible amounts of proteolytic activity. The protease inhibitor phenylmethylsulfonyl flouride reduced the proteolytic activity of American whole body cockroach extract by 80% (@1 mM) and the inhibitor ethylene diaminetetraacetic acid inhibited the proteolytic activity of Pleurotus spores by 95% (@1 mM). Loss of allergen activity as determined by RAST inhibition and immunoprinting correlated with protease activity. Thus, in the preparation and handling of allergen extracts, one should employ conditions that minimize proteolysis.

  16. DESCRIPTION OF THE CULTURE CHARACTERISTICS OF SOME LIGNICOLOUS BASIDIOMYCETES SPECIES GROWN ON THREE SYNTHETIC MEDIA

    Directory of Open Access Journals (Sweden)

    PETRE Cristiana Virginia

    2013-12-01

    Full Text Available A number of 12 species of lignicolous basidiomycetes were cultivated on potato dextrose agar and malt extract agar, incubated at 25 °C and carefully analyzed for a period of 5 weeks. Lignicolous basidiomycetes are fungi that produce potent enzymes and bioactive secondary metabolites which are successfully used in various industries: bioremediation of polluted environments, biodegradation of toxic substances, pharmacology or agriculture. The objective of this study was the description of the main characteristics of in vitro cultures of some lignicolous basidiomycetes species grown on synthetic media. The main characteristics followed were: the growth rate of the colonies, the general features of the mycelium: shape, color, surface aspect, reverse, the presence of fruiting bodies and exudates and the particular odor.

  17. Polyphenolic substrates and dyes degradation by yeasts from 25 de Mayo/King George Island (Antarctica).

    Science.gov (United States)

    Rovati, José I; Pajot, Hipólito F; Ruberto, Lucas; Mac Cormack, Walter; Figueroa, Lucía I C

    2013-11-01

    Antarctica offers a range of extreme climatic conditions, such as low temperatures, high solar radiation and low nutrient availability, and constitutes one of the harshest environments on Earth. Despite that, it has been successfully colonized by ’cold-loving’ fungi, which play a key role in decomposition cycles in cold ecosystems. However, knowledge about the ecological role of yeasts in nutrient or organic matter recycling/mineralization remains highly fragmentary. The aim of this work was to study the yeast microbiota in samples collected on 25 de Mayo/King George Island regarding the scope of their ability to degrade polyphenolic substrates such as lignin and azo dyes. Sixty-one yeast isolates were obtained from 37 samples, including soil, rocks, wood and bones. Molecular analyses based on rDNA sequences revealed that 35 yeasts could be identified at the species level and could be classified in the genera Leucosporidiella, Rhodotorula, Cryptococcus, Bullera and Candida. Cryptococcus victoriae was by far the most ubiquitous species. In total, 33% of the yeast isolates examined showed significant activity for dye decolorization, 25% for laccase activity and 38% for ligninolytic activity. Eleven yeasts did not show positive activity in any of the assays performed and no isolates showed positive activity across all tested substrates. A high diversity of yeasts were isolated in this work, possibly including undescribed species and conspicuous Antarctic yeasts, most of them belonging to oligotrophic, slow-growing and metabolically diverse basidiomycetous genera. PMID:24298603

  18. Basidiomycete cultures on perlite survive successfully repeated freezing and thawing in cryovials without subculturing.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Nerud, Frantisek

    2007-06-01

    Mycelial basidiomycete cultures on perlite in cryovials survived successfully three successive cycles of freezing, storage in liquid nitrogen (LN) and thawing without noticeable changes. This indicates that using perlite as a carrier for cryopreservation could in most cases overcome difficulties caused by interrupted supply of LN or electric power during the storage. Cultures on perlite can also be reused for successive inoculations.

  19. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  20. Genomic Analysis of Two-Component Signal Transduction Proteins in Basidiomycetes

    DEFF Research Database (Denmark)

    Ussery, David; Lavín, JL; Binnewies, Tim Terence;

    2010-01-01

    Two-component system (TCS) proteins are components of complex signal transduction pathways in fungi, and play essential roles in the regulation of several cellular functions and responses. Species of basidiomycetes have a marked variation in their specific physiological traits, morphological...

  1. Distribution of Brown Blotch Bacteria in Wild and Cultivated Species of Basidiomycetes

    OpenAIRE

    Bessette, Alan E.

    1984-01-01

    Wild and cultivated Basidiomycetes species were cultured to determine the distribution of bacteria causing brown blotch disease of Agaricus bisporus. Colonies from each basidiocarp were screened for brown blotch organisms by the white line and host pathogenicity tests. Isolates causing brown blotch were identified as Pseudomonas tolaasi and an Arthrobacter species.

  2. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  3. Hongos basidiomycetes: una contribución al conocimiento de 14 generos en norte de santander

    Directory of Open Access Journals (Sweden)

    Nancy Jackeline Sanchez-Sandoval

    2006-07-01

    Full Text Available In this article 14 genera of Basidiomycetes are reported tor Norte de Santander Department. These genera belong to 10 families and 5 orders: Agaricales, Boletales, Schizophyllales, Polyporales and Lycoperdales. The last order belongs to Gasteromycetes. The study was done in Chinócota county, during the years 2003-2004.

  4. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  5. Identification and characterization of yeasts isolated from sedimentary rocks of Union Glacier at the Antarctica.

    Science.gov (United States)

    Barahona, Salvador; Yuivar, Yassef; Socias, Gabriel; Alcaíno, Jennifer; Cifuentes, Víctor; Baeza, Marcelo

    2016-07-01

    The study of the yeasts that inhabit cold environments, such as Antarctica, is an active field of investigation oriented toward understanding their ecological roles in these ecosystems. In a great part, the interest in cold-adapted yeasts is due to several industrial and biotechnological applications that have been described for them. The aim of this work was to isolate and identify yeasts from sedimentary rock samples collected at the Union Glacier, Antarctica. Furthermore, the yeasts were physiologically characterized, including the production of metabolites of biotechnological interest. The yeasts isolated that were identified at the molecular level belonged to genera Collophora (1 isolate), Cryptococcus (2 isolates), Sporidiobolus (4 isolates), Sporobolomyces (1 isolate) and Torrubiella (2 isolates). The majority of yeasts were basidiomycetous and psychrotolerant. By cross-test assays for anti-yeast activity, it was determined that Collophora sp., Sporidiobolus salmonicolor, and Sporobolomyces roseus secreted a protein factor that kills Sporidiobolus metaroseus. The colored yeasts Sp. salmonicolor, Sp. metaroseus and Collophora sp. produced several carotenoid pigments that were identified as 2,3 dihydroxy-γ-carotene, -carotene, 4-ketotorulene, torulene β-cryptoxanthin and spirilloxanthin. Concerning analysis of mycosporines, these metabolites were only found in the yeasts Torrubiella sp. and Cryptococcus sp. T11-10-1. Furthermore, the yeasts were evaluated for the production of extracellular hydrolytic activities. Of the twelve activities analyzed, alkaline phosphatase, invertase, gelatinase, cellulase, amylase, and protease enzyme activities were detected. The yeasts Cryptococcus sp. T11-10-1 and Sporidiobolus metaroseus showed the highest number of different enzyme activities. PMID:27215207

  6. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  7. Metabolic pathways of biotransformation and biosynthesis of aromatic compounds for the flavour industry by the basidiomycete Pycnoporus cinnabarinus

    OpenAIRE

    Asther, Marcel; Lomascolo, A.; Asther, M.; Moukha, S.; Lesage-Meessen, L.

    1998-01-01

    Among filamentous fungi, white-rot Basidiomycetes have become a strategic group to generate industrial aromatic flavours. In the course of a basidiomycete screening, the biotechnological potential of #Pycnoporus cinnabarinus$ strains was studied in order to produce, by transformation or de novo, natural aromatic flavours in liquid cultures. Ferulic acid and L-phenylalanine were found to be suitable substrates for vanillin and benzaldehyde (bitter almond aroma) production, respectively. These ...

  8. Yeasts in malting, with special emphasis on Wickerhamomyces anomalus (synonym Pichia anomala).

    Science.gov (United States)

    Laitila, Arja; Sarlin, Tuija; Raulio, Mari; Wilhelmson, Annika; Kotaviita, Erja; Huttunen, Timo; Juvonen, Riikka

    2011-01-01

    Malted barley is a major raw material of beer, as well as distilled spirits and several food products. The production of malt (malting) exploits the biochemical reactions of a natural process, grain germination. In addition to germinating grain, the malting process includes another metabolically active component: a diverse microbial community that includes various types of bacteria and fungi. Therefore, malting can be considered as a complex ecosystem involving two metabolically active groups. Yeasts and yeast-like fungi are an important part of this ecosystem, but previously the significance of yeasts in malting has been largely underestimated. Characterization and identification of yeasts in industrial processes revealed 25 ascomycetous yeasts belonging to 10 genera, and 18 basidiomycetous yeasts belonging to 7 genera. In addition, two ascomycetous yeast-like fungi belonging to the genera Aureobasidium and Exophiala were commonly detected. Yeasts and yeast-like fungi produced extracellular hydrolytic enzymes with a potentially positive contribution to the malt enzyme spectrum. Several ascomycetous yeast strains showed strong antagonistic activity against field and storage moulds, Wickerhamomyces anomalus (synonym Pichia anomala) being the most effective species. Malting studies revealed that W. anomalus VTT C-04565 effectively restricted Fusarium growth and hydrophobin production during malting and prevented beer gushing. In order to broaden the antimicrobial spectrum and to improve malt brewhouse performance, W. anomalus could be combined with other starter cultures such as Lactobacillus plantarum. Well-characterized microbial mixtures consisting of barley and malt-derived microbes open up several possibilities to improve malt properties and to ensure the safety of the malting process. PMID:20872177

  9. Assessment of endophytic yeast diversity in rice leaves by a culture-independent approach.

    Science.gov (United States)

    Tantirungkij, Manee; Nasanit, Rujikan; Limtong, Savitree

    2015-09-01

    Endophytic microorganisms inhabit internal plant tissues in the host plant without causing any symptoms or negative effects. Although the diversity of endophytes has been evaluated by both culture-dependent and culture-independent methods, less information is available on yeast communities. Therefore, in this study a culture-independent method was used to examine endophytic yeasts associated with rice leaves based on the large subunit of ribosomal DNA using a semi-nested PCR technique. Sequence analysis indicated that the colonization frequency and the relative species frequency (RF) of endophytic yeast phylotypes were 0.41 and 0.06, respectively, and the majority of the yeast phylotypes were basidiomycetous yeasts. The phylotypes were designated as five known species (Cryptococcus victoriae, Debaryomyces hansenii, Debaryomyces vindobonensis, Meyerozyma guilliermondii and Pseudozyma antarctica), together with seventeen phylotypes closest to Candida metapsilosis, Cryp. foliicola, Cryp. laurentii, Pseudozyma abaconensis, Pseudozyma aphidis and Trichosporon asahii, among which some could be novel species. The most prevalent phylotypes were those closest to Cryp. foliicola (47.5 % RF) followed by D. hansenii (22.8 % RF) and P. antarctica (16.8 % RF). The presence of the phylotypes related to species known for their potential applications as biocontrol agents and plant growth promoting hormone producers suggests that they may have valuable applications. In addition, our findings revealed the occurrence of novel phylotypes at high frequency, which should encourage extensive studies to discover novel yeast species and to understand their roles in the rice leaves. PMID:26122889

  10. Cryopreservation of cryosensitive basidiomycete cultures by application and modification of perlite protocol.

    Science.gov (United States)

    Sato, Masanori; Sukenobe, Junji; Nakagiri, Akira

    2012-01-01

    Homolka's perlite protocol (HPP) for cryopreservation of fungal cultures was evaluated in 12 strains (7 species) of cryosensitive basidiomycete cultures maintained in NBRC culture collection by investigating viability, time to recover, and basic morphological study after freezing and storing at -80 degree C for 6 months. The viability of the fungal strains was 60 percent in Phallus hadriani and 100 percent in remaining 11 strains, indicating the efficacy of HPP method for cryopreservation of some cryosensitive basidiomycetes. The HPP method was modified by changing the addition of cryoprotectant (glycerol) from prior precultivation to post precultivation, limiting the cryoprotectant exposure time to 48 hours, and increasing the glycerol concentration from 5 percent to 12 percent. The viability of P. hadriani strain increased from 60 percent to 100 percent with the modified perlite protocol after storage at -80 degree C for 6 months.

  11. Linkage of mating-type loci distinguishes bipolar from tetrapolar mating in basidiomycetous smut fungi.

    OpenAIRE

    Bakkeren, G; Kronstad, J. W.

    1994-01-01

    Sexual compatibility requires self vs. non-self recognition. Genetically, two compatibility or mating-type systems govern recognition in heterothallic basidiomycete fungi such as the edible and woodrotting mushrooms and the economically important rust and smut phytopathogens. A bipolar system is defined by a single genetic locus (MAT) that can have two or multiple alleles. A tetrapolar system has two loci, each with two or more specificities. We have employed two species from the genus Ustila...

  12. Mating System and Basidiospore Formation in the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Alic, Margaret; Letzring, Celia; Gold, Michael H.

    1987-01-01

    Prototrophic strains recovered from crosses between auxotrophic strains of the lignin-degrading basidiomycete Phanerochaete chrysosporium were induced to fruit. The progeny of most of these self-crosses were prototrophic, indicating that the nuclei of the original prototroph were wild-type recombinants rather than complementary heterokaryons and that the binucleate basidiospores of this organism are homokaryotic. Various wild-type strains were shown to have multinucleate cells lacking clamp c...

  13. Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing basidiomycetes strains

    OpenAIRE

    Moreira Neto, S. L.; Solange I. Mussatto; Machado, K. M. G.; Milagres, Adriane M. F.

    2013-01-01

    The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Ciba...

  14. Decolorization of Several Polymeric Dyes by the Lignin-Degrading Basidiomycete Phanerochaete chrysosporium

    OpenAIRE

    Glenn, Jeffrey K.; Michael H Gold

    1983-01-01

    The polymeric dyes Poly B-411, Poly R-481, and Poly Y-606 were examined as possible alternatives to the radiolabeled lignin previously used as a substrate in lignin biodegradation assays. Like lignin degradation, the decolorization of these dyes by the white rot basidiomycete Phanerochaete chrysosporium occurred during secondary metabolism, was suppressed in cultures grown in the presence of high levels of nitrogen, and was strongly dependent on the oxygen concentration in the cultures. A var...

  15. Basidiomycete DyPs: Genomic diversity, structural–functional aspects, reaction mechanism and environmental significance

    OpenAIRE

    Linde, Dolores; Ruiz-Dueñas, Francisco J.; Fernandez-Fueyo, Elena; Guallar, Víctor; Hammel, Kenneth E.; Pogni, Rebecca; Martínez, Angel T.

    2015-01-01

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes...

  16. Kinesin-3 in the basidiomycete Ustilago maydis transports organelles along the entire microtubule array.

    Science.gov (United States)

    Steinberg, Gero

    2015-01-01

    The molecular motor kinesin-3 transports early endosomes along microtubules in filamentous fungi. It was reported that kinesin-3 from the ascomycete fungi Aspergillus nidulans and Neurospora crassa use a subset of post-translationally modified and more stable microtubules. Here, I show that kinesin-3 from the basidiomycete Ustilago maydis moves along all hyphal microtubules. This difference is likely due to variation in cell cycle control and associated organization of the microtubule array.

  17. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    OpenAIRE

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree...

  18. Four new spiroaxane sesquiterpenes and one new rosenonolactone derivative from cultures of Basidiomycete Trametes versicolor.

    Science.gov (United States)

    Wang, Su-Rui; Zhang, Ling; Chen, He-Ping; Li, Zheng-Hui; Dong, Ze-Jun; Wei, Kun; Liu, Ji-Kai

    2015-09-01

    Four new spiroaxane sesquiterpenes, tramspiroins A-D (1-4), one new rosenonolactone 15,16-acetonide (5), and the known drimane sesquiterpenes isodrimenediol (6) and funatrol D (7) have been isolated from the cultures of Basidiomycete Trametes versicolor. The structures of new compounds were elucidated by means of spectroscopic methods. Compounds 1-7 were investigated for their cytotoxicities against five human cancer cell lines. PMID:26136058

  19. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the vagina , ...

  20. Yeast Infection (Candidiasis)

    Science.gov (United States)

    ... rash and rashes clinical tools newsletter | contact Share | Yeast Infection (Candidiasis) Information for adults A A A This is a candida (yeast) infection of the skin folds of the abdomen. Overview ...

  1. Prions in Yeast

    OpenAIRE

    Liebman, Susan W; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in unde...

  2. Yeast That Smell

    Directory of Open Access Journals (Sweden)

    Eugenia Y Xu

    2008-08-01

    Full Text Available The fundamental mechanism of olfactory receptor activation has been conserved from yeast to humans. Engineered yeast cells can smell some of the same odorants as humans can, which makes yeast an ideal model system for studying human olfaction. Furthermore, if engineered yeast cells are incorporated into sensory arrays, they can be used as biosensors or artificial noses.Keywords: Yeast, olfactory receptor, G protein-coupled receptor, biosensor, smellReceived: 31 July 2008 / Received in revised form: 6 August 2008, Accepted: 13 August 2008, Published online: 17 August 2008

  3. Multigene assessment of the species boundaries and sexual status of the basidiomycetous yeasts Cryptococcus flavescens and C. terrestris (Tremellales.

    Directory of Open Access Journals (Sweden)

    Andrey Yurkov

    Full Text Available Cryptococcus flavescens and C. terrestris are phenotypically indistinguishable sister species that belong to the order Tremellales (Tremellomycetes, Basidiomycota and which may be mistaken for C. laurentii based on phenotype. Phylogenetic separation between C. flavescens and C. terrestris was based on rDNA sequence analyses, but very little is known on their intraspecific genetic variability or propensity for sexual reproduction. We studied 59 strains from different substrates and geographic locations, and used a multilocus sequencing (MLS approach complemented with the sequencing of mating type (MAT genes to assess genetic variation and reexamine the boundaries of the two species, as well as their sexual status. The following five loci were chosen for MLS: the rDNA ITS-LSU region, the rDNA IGS1 spacer, and fragments of the genes encoding the largest subunit of RNA polymerase II (RPB1, the translation elongation factor 1 alpha (TEF1 and the p21-activated protein kinase (STE20. Phylogenetic network analyses confirmed the genetic separation of the two species and revealed two additional cryptic species, for which the names Cryptococcus baii and C. ruineniae are proposed. Further analyses of the data revealed a high degree of genetic heterogeneity within C. flavescens as well as evidence for recombination between lineages detected for this species. Strains of C. terrestris displayed higher levels of similarity in all analysed genes and appear to make up a single recombining group. The two MAT genes (STE3 and SXI1/SXI2 sequenced for C. flavescens strains confirmed the potential for sexual reproduction and suggest the presence of a tetrapolar mating system with a biallelic pheromone/receptor locus and a multiallelic HD locus. In C. terrestris we could only sequence STE3, which revealed a biallelic P/R locus. In spite of the strong evidence for sexual recombination in the two species, attempts at mating compatible strains of both species on culture media were unsuccessful.

  4. Basidiomycete DyPs: Genomic diversity, structural-functional aspects, reaction mechanism and environmental significance.

    Science.gov (United States)

    Linde, Dolores; Ruiz-Dueñas, Francisco J; Fernández-Fueyo, Elena; Guallar, Victor; Hammel, Kenneth E; Pogni, Rebecca; Martínez, Angel T

    2015-05-15

    The first enzyme with dye-decolorizing peroxidase (DyP) activity was described in 1999 from an arthroconidial culture of the fungus Bjerkandera adusta. However, the first DyP sequence had been deposited three years before, as a peroxidase gene from a culture of an unidentified fungus of the family Polyporaceae (probably Irpex lacteus). Since the first description, fewer than ten basidiomycete DyPs have been purified and characterized, but a large number of sequences are available from genomes. DyPs share a general fold and heme location with chlorite dismutases and other DyP-type related proteins (such as Escherichia coli EfeB), forming the CDE superfamily. Taking into account the lack of an evolutionary relationship with the catalase-peroxidase superfamily, the observed heme pocket similarities must be considered as a convergent type of evolution to provide similar reactivity to the enzyme cofactor. Studies on the Auricularia auricula-judae DyP showed that high-turnover oxidation of anthraquinone type and other DyP substrates occurs via long-range electron transfer from an exposed tryptophan (Trp377, conserved in most basidiomycete DyPs), whose catalytic radical was identified in the H2O2-activated enzyme. The existence of accessory oxidation sites in DyP is suggested by the residual activity observed after site-directed mutagenesis of the above tryptophan. DyP degradation of substituted anthraquinone dyes (such as Reactive Blue 5) most probably proceeds via typical one-electron peroxidase oxidations and product breakdown without a DyP-catalyzed hydrolase reaction. Although various DyPs are able to break down phenolic lignin model dimers, and basidiomycete DyPs also present marginal activity on nonphenolic dimers, a significant contribution to lignin degradation is unlikely because of the low activity on high redox-potential substrates. PMID:25637654

  5. Functional Genomics of Lignocellulose Degradation in the Basidiomycete White Rot Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A. [Joint Genome Inst., Walnut Creek, CA (United States); Tegelaar, Martin [Utrecht Univ. (Netherlands); Henrissat, Bernard [Univ. of Marseille (France); Brewer, Heather M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wosten, Han A. B. [Utrecht Univ. (Netherlands); Grigoriev, Igor V. [Joint Genome Inst., Walnut Creek, CA (United States); Lugones, Luis G. [Utrecht Univ. (Netherlands)

    2013-03-01

    White and brown rot fungi are among the most important wood decayers in nature. Although more than 50 genomes of Basidiomycete white and brown rots have been sequenced by the Joint Genome Institute, there is still a lot to learn about how these fungi degrade the tough polymers present in wood. In particular, very little is known about how these fungi regulate the expression of genes involved in lignocellulose degradation. Here, we used transcriptomics, proteomics, and promoter analysis in an effort to gain insight into the process of lignocellulose degradation.

  6. Lignin-Modifying Enzymes of Flavodon flavus, a Basidiomycete Isolated from a Coastal Marine Environment†

    OpenAIRE

    Raghukumar, C.; D’Souza, T. M.; Thorn, R. G.; Reddy, C A

    1999-01-01

    A basidiomycetous fungus Flavodon flavus (Klotzsch) Ryvarden (strain 312), isolated from decaying sea grass from a coral lagoon off the west coast of India, mineralized nearly 24% of 14C-labeled synthetic lignin to 14CO2 in 24 days. When grown in low-nitrogen medium (2.4 mM N) this fungus produced three major classes of extracellular lignin-modifying enzymes (LMEs): manganese-dependent peroxidase (MNP), lignin peroxidase (LIP), and laccase. Low MNP and laccase activities were seen in high-nit...

  7. Role of plants in the vegetative and reproductive growth of saprobic basidiomycetous ground fungi.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2008-11-01

    Non-symbiotic microorganisms engineered or expensively selected to degrade xenobiotic hydrocarbons or modify heavy-metal uptake of plants in soil remediations die back after their introduction into the target soils. Mycelia of saprobic basidiomycetes were therefore inoculated into soil samples of 1 l in glass vessels to record mycelial growth and reproduction in the immediate rhizosphere of up to 11 herbaceous plant species, or to study their responses to the separate volatiles from whole plant swards or their root balls whose emanations had been collected in 1.5-l plastic bags fixed to the glass vessels. Excess CO2 was controlled with NaOH solution. Volatiles from root balls of parsley and pea but not wheat, from unplanted soils, from the fungus-permeated, unplanted substrate soil itself, and from the rooting soil of whole wheat sward increased mycelial densities in Clitocybe sp. more than in Agaricus macrocarpus and indicated thus a higher nutrient state of the mycelia. Organic volatiles proved therefore to be a significant carbon source for certain basidiomycetes in poor natural soils. The contemporary decline in the number of basidiocarp initials to 0 to 36% in both fungi relative to the unplanted and aerated controls was caused by volatiles from rooted and unplanted soil and pointed thus to their ecological role as antibiotics, fumigants, toxins, and hormonal compounds. Aqueous extracts from root balls of wheat stimulated mycelial density and fruiting in A. macrocarpus contemporarily because of their contents in soil-derived macronutrients. They suppressed once more fruiting in the more sensitive Clitocybe sp. by active agents in the aqueous phase. Within plant rhizospheres, densities of Clitocybe sp. mycelia were stimulated in the presence of alfalfa, carrot, red clover, ryegrass, and spinach, whereas those of A. macrocarpus were halved by 7 of 10 plant species including alfalfa, red clover, ryegrass, and spinach. Mycelia of A. macrocarpus may thereby have

  8. Antifungal activity of some metabolites of higher fungi (Basidiomycetes - an overview

    Directory of Open Access Journals (Sweden)

    Teresa Florianowicz

    2014-02-01

    Full Text Available A series of compounds of different chemical structures showing antifungal activity were isolated from higher fungi (Basidiomycetes fruit bodies. Among the microflora against which the examined metabolites showed effective activity, there are pathogenic organisms for people as well as for animals: Candida albicans, Candida tropicalis, Rhodotorula rubra, Aspergillus fumigatus and pathogens attacking plants: Penicillium chrysogenum, Botrytis cinerea, Alternaria solani, Fusarium culmorum, Trichoderma lignorum and Verticillium dahlae. Searching for fungal metabolites having antifungal activity creates possibilities of using them against a range of fungal pathogens of clinical, agronomic and environmental significance.

  9. A comparison of hypoglycemic activity of three species of basidiomycetes rich in vanadium.

    Science.gov (United States)

    Han, Chunchao; Liu, Tongjun

    2009-02-01

    The hypoglycemic activity of fermented mushroom of three fungi of basidiomycetes rich in vanadium was studied in this paper. Alloxan- and adrenalin-induced hyperglycemic mice were used in the study. The blood glucose and the sugar tolerance were determined. After the mice were administered (ig) with Coprinus comatus rich in vanadium, the blood glucose of alloxan-induced hyperglycemic mice decreased (p vanadium and Grifola frondosa rich in vanadium, the hypoglycemic effects of Coprinus comatus rich in vanadium on hyperglycemic animals are significant; it may be used as a hypoglycemic food or medicine for hyperglycemic people.

  10. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants. PMID:24502208

  11. Larvicidal effects of endophytic and basidiomycete fungus extracts on Aedes and Anopheles larvae (Diptera, Culicidae

    Directory of Open Access Journals (Sweden)

    Augusto Bucker

    2013-08-01

    Full Text Available Introduction In vitro bioassays were performed to access the larvicidal activity of crude extracts from the endophytic fungus Pestalotiopsis virgulata (Melanconiales, Amphisphaeriaceae and the saprophytic fungus Pycnoporus sanguineus (Basidiomycetes, Polyporaceae against the mosquitoes Aedes aegypti and Anopheles nuneztovari. Methods The extracts were tested at concentrations of 100, 200, 300, 400 and 500ppm. Ethyl acetate mycelia (EAM extracts and liquid culture media (LCM from Pe. virgulata and Py. sanguineus were tested against third instar larvae of Ae. aegypti and An. nuneztovari. Results The larvicidal activity of the EAM extracts from Pe. virgulata against Ae. aegypti had an LC50=101.8ppm, and the extract from the basidiomycete fungus Py. sanguineus had an LC50=156.8ppm against the Ae. aegypti larvae. The Pe. virgulata extract had an LC50=16.3ppm against the An. nuneztovari larvae, and the Py. sanguineus extract had an LC50=87.2ppm against these larvae. Conclusions These results highlight the larvicidal effect of EAM extracts from the endophyte Pe. virgulata against the two larval mosquitoes tested. Thus, Pe. virgulata and Py. sanguineus have the potential for the production of bioactive substances against larvae of these two tropical disease vectors, with An. nuneztovari being more susceptible to these extracts.

  12. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  13. Characterization of Basidiomycetes associated with wood rot of citrus in southern Italy.

    Science.gov (United States)

    Roccotelli, Angela; Schena, Leonardo; Sanzani, Simona M; Cacciola, Santa O; Mosca, Saveria; Faedda, Roberto; Ippolito, Antonio; di San Lio, Gaetano Magnano

    2014-08-01

    The characterization of Basidiomycetes associated with wood rots in commercial citrus orchards in southern Italy revealed that both white and brown rot fungi are implicated in this disease. Fomitiporia mediterranea was the most prevalent species causing a white rot, followed by Fomitopsis sp. which, by contrast, was associated with brown rot wood decay. Furthermore, Phellinus spp. and other nonidentified basidiomycetous fungi showing genetic affinity with the genera Phellinus and Coniophora were occasionally isolated. Artificial inoculations on lemon (Citrus limon) branches showed a faster wood colonization by Fomitopsis sp. compared with F. mediterranea, indicating that the former species as a potentially serious pathogen of citrus trees. The analysis of F. mediterranea internal transcribed spacer (ITS) sequences revealed a high level of genetic variability, with 13 genotypes which were both homozygous (6 genotypes) and heterozygous (7 genotypes). The presence of heterozygous genomes based on ITS sequences has never been reported before for F. mediterranea. This, together with the high frequency of basidiomata on infected wood, unambiguously confirms the outcrossing nature of reproduction in F. mediterranea and the primary role of basidiospores in the dissemination of inoculum. Similarly, high genetic variability was observed analyzing Fomitopsis sp. Because basidiomata of this fungus have not been observed on citrus trees, it can be hypothesized that basidiospores are produced on alternative host plants.

  14. Screening for Antimicrobial Activity of Wood Rotting Higher Basidiomycetes Mushrooms from Uruguay against Phytopathogens.

    Science.gov (United States)

    Barneche, Stephanie; Jorcin, Gabriela; Cecchetto, Gianna; Cerdeiras, María Pía; Vázquez, Alvaro; Alborés, Silvana

    2016-01-01

    In this work, the antimicrobial activity of extracts of wood rotting higher Basidiomycetes mushrooms isolated from Eucalyptus plantations in Uruguay was studied using bacterial and fungal phytopathogens as targets. Fifty-one extracts from mycelia and growth broth were prepared from higher Basidiomycetes mushrooms, from which eight extracts (from Ganoderma resinaceum, Laetiporus sulphureus, Dictyopanus pusillus, and Bjerkandera adusta) showed antimicrobial activity against Xanthomonas vesicatoria, Aspergillus oryzae, Penicillium expansum, Botrytis cinerea, and Rhizopus stolonifer as assayed in the qualitative test. The minimum inhibitory concentration (MIC) for those fungal extracts was determined and the results showed that L. sulphureus deserved further study, with low MIC values against X. vesicatoria. The antimicrobial activity of L. sulphureus culture broth extracts grown under different culture conditions was evaluated against X. vesicatoria. From the results of these assays, larger-scale cultures for the production of the compound(s) with antimicrobial activity should be performed using malt extract broth, at pH 5, at 20°C and static culture conditions. PMID:27481160

  15. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  16. Classification of yeast cells from image features to evaluate pathogen conditions

    Science.gov (United States)

    van der Putten, Peter; Bertens, Laura; Liu, Jinshuo; Hagen, Ferry; Boekhout, Teun; Verbeek, Fons J.

    2007-01-01

    Morphometrics from images, image analysis, may reveal differences between classes of objects present in the images. We have performed an image-features-based classification for the pathogenic yeast Cryptococcus neoformans. Building and analyzing image collections from the yeast under different environmental or genetic conditions may help to diagnose a new "unseen" situation. Diagnosis here means that retrieval of the relevant information from the image collection is at hand each time a new "sample" is presented. The basidiomycetous yeast Cryptococcus neoformans can cause infections such as meningitis or pneumonia. The presence of an extra-cellular capsule is known to be related to virulence. This paper reports on the approach towards developing classifiers for detecting potentially more or less virulent cells in a sample, i.e. an image, by using a range of features derived from the shape or density distribution. The classifier can henceforth be used for automating screening and annotating existing image collections. In addition we will present our methods for creating samples, collecting images, image preprocessing, identifying "yeast cells" and creating feature extraction from the images. We compare various expertise based and fully automated methods of feature selection and benchmark a range of classification algorithms and illustrate successful application to this particular domain.

  17. Ascomycetous yeasts associated with naturally occurring fruits in a tropical rain forest.

    Science.gov (United States)

    Prada, G M; Pagnocca, F C

    1997-01-01

    Fruits from twenty different species of angiosperms were collected during the period from November, 1991 to January, 1992. Two hundred and two strains of yeasts and yeast-like fungi were isolated, of which 74% showed ascomycetic affinity. Candida was the predominant genus, followed by (in descending order of occurrence): Cryptococcus, Kloeckera, Sporobolomyces, Pichia, Hanseniaspora and Bullera. Black yeasts and other strains showing basidiomycetic affinity were also isolated. The genus Candida represented the highest number of identified species and the greatest variety of associated substrates. Among the ascomycetes and their anamorphs, 38 species were identified, with Kloeckera apiculata being the most frequent among the isolates and the one which occurred in the largest variety of substrates. Some of the biotypes designated as Candida sp. A, B, C, D, E, F, G, H, I, and Pichia sp. did not correspond to the standard species description found in the literature, and may represent new species. The strains of yeasts isolated in this study were characterized and incorporated into the Tropical Culture Collection of the Fundaao Tropical de Pesquisas e Tecnologia Andŕe Tosello, Campinas, São Paulo.

  18. 枇杷黄肉和白肉突变体类胡萝卜素基因的克隆和表达分析%Molecular Cloning and Expression of Carotenogenic Genes in Yellowish and Mutant Whitish Loquat (Eriobotrya japonica) Fruits

    Institute of Scientific and Technical Information of China (English)

    孙淑霞; 谢红江; 陈栋; 李靖; 涂美艳; 江国良

    2013-01-01

    [目的]探索黄肉枇杷果实类胡萝卜积累的调控机制.[方法]该研究以枇杷突变体(黄肉枇杷一枝芽变结出白肉果实)为供试材料,利用高效液相色谱测定成熟果肉中β-胡萝卜素的积累,对野生型和突变型枇杷类胡萝卜素合成途径基因进行同源克隆及表达分析.[结果]野生型黄肉和突变体白肉枇杷成熟果肉中β-胡萝卜素含量分别为60.9和4.6μg/g;利用同源克隆获得的5个枇杷类胡萝卜素合成基因编码区序列在野生型和突变型没有发现核苷酸变异;实时荧光定量PCR分析显示类胡萝卜素β环羟化酶基因在突变体白肉果实中的表达显著降低,其它6个类胡萝卜素合成途径基因在两供试材料中的表达水平没有差异,与β-胡萝卜素的积累没有直接关联.[结论]突变体白肉枇杷缺少β-胡萝卜素的积累可能与类胡萝卜素β环羟化酶基因表达量下调有关.%[Objective] The study aimed to explore the factors regulating carotenoid accumulation in flesh color.[Method] A Ioquat mutation (red-or orange-fleshed plant emerged a bud mutation of white-flesh in trunk) was used as material; HPLC analysis of β-carotene content was conducted.[Result] The β-carotene concentration in the flesh of wild and mutant types was 60.9 and 4.6 μg/g fresh weight,respectively.According to the conserved regions of genes from rose family genome,carotenogenic gene fragments in wild and mutant types were obtained.No nucleotide variation of the carotenogenic gene fragments was observed between wild and mutant genome.Real-time quantitative polymerase chain reaction (Q-PCR) was compared and one carotenogenic gene,β-ring hydroxylase (HYB) were considerably suppressed in mature mutant Ioquat fruits compared with that in wild.The other six carotenogenic genes were also expressed but the expression patterns appeared to be not correlated with the amount of β-carotene concentration in wild Ioquat flesh.[Conclusion] The

  19. In vitro decomposition of Sphagnum-derived acrotelm and mesotelm peat by indigenous and alien basidiomycetous fungi

    Directory of Open Access Journals (Sweden)

    M.N. Thormann

    2011-05-01

    Full Text Available Northern peatlands have accumulated significant quantities of peat, and it has been predicted that rates of peat decomposition may increase due to climate warming. In peatlands, organic matter decomposition in the acrotelm is accomplished primarily by fungi that act differentially through time on various peat constituents. After four months of decomposition in vitro, I show a distinct microbiological limitation to the decomposition of Sphagnum-derived peat (mean mass losses of 1.1–7.1 % by indigenous and alien basidiomycetous fungi of both acrotelm and mesotelm peat (the mesotelm is the lower part of the acrotelm sensu lato, in which conditions fluctuate between oxic and anoxic. Neither acrotelm nor mesotelm Sphagnum peat can be degraded effectively by many fungi (mean mass losses of 2.7 % and 4.3 % for acrotelm and mesotelm peat, respectively, including the ubiquitous wood decomposing basidiomycetes known to decompose some of nature’s most complex polymers. Peatland basidiomycetes caused significantly greater mass losses of acrotelm and mesotelm peat than wood decay basidiomycetes (mean mass losses of 5.7 % and 1.4 %, respectively. Brown rot fungi caused significantly greater mass losses to acrotelm and mesotelm peat than white rot fungi and non-wood-decay fungi (mean mass losses of 10.1 %, 1.7 %, and 2.3 %, respectively. Rates of peat decomposition may not increase to the extent previously predicted, and peatlands may not necessarily be long-term sources of CO2 in response to a warming climate.

  20. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  1. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  2. Novel Root-Fungus Symbiosis in Ericaceae: Sheathed Ericoid Mycorrhiza Formed by a Hitherto Undescribed Basidiomycete with Affinities to Trechisporales

    Science.gov (United States)

    Vohník, Martin; Sadowsky, Jesse J.; Kohout, Petr; Lhotáková, Zuzana; Nestby, Rolf; Kolařík, Miroslav

    2012-01-01

    Ericaceae (the heath family) are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM) fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed ‘sheathed ericoid mycorrhiza’, discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity) to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet remain

  3. Characterisation of yeasts isolated from ‘Nduja of Spilinga

    Directory of Open Access Journals (Sweden)

    Filippo Giarratana

    2014-04-01

    Full Text Available The ‘Nduja of Spilinga protected geographical indication (PGI is a spreadable italian salami, obtained by using fat (50%, lean of pork (25%, chili pepper (25% and NaCl, stuffed into natural pork casing. Its predominant flora is represented by yeasts, reaching at the end of seasoning values of 6 log CFU/g. Considering the need to enhance and protect traditional local products, it seemed interesting to carry out a characterisation of yeasts of the ‘Nduja of Spilinga PGI. A total of 127 strains of yeast isolated from samples of ‘Nduja of Spilinga PGI (79 strains from samples at different days of curing and 48 from samples of commerce was subjected to morphological identification, hydrolysis of urea, lipolytic activity and identification with API 20C AUX, ID 32C and simplified identification systems. One hundred twenty three (96.8% strains were attributable to the phylum Ascomycetes (urease-negative, the remaining 4 strains (3.2% were Basidiomycetes (urease-positive. Debaryomyces hansenii and its anamorph shape, Candida famata, represented the most prevalent species (61.42 and 17.32% respectively, followed by Candida glabrata (8.66%, Pichia (Candida guilliermondii (5.17%, Candida parapsilosis and Rhodotorula glutinis (1.57%. Candida catenulata, Criptococcus uniguttulatus, Rhodotorula minuta, Candida zeylanoides and Candida utilis were observed with 0.79%. The lipolytic activity was observed only in 10 strains of D. hansenii and in one of C. zeylanoides. Further investigation will contribute to the selection of indigenous strains that could be used for the creation of specific starter, useful to improve the process of characterisation of the ‘Nduja of Spilinga and also to guarantee its safety.

  4. Development of Highly Efficient Transformation System of Yeast-Like Conidia of Tremella fuciformis

    Institute of Scientific and Technical Information of China (English)

    GUO Li-qiong; LIU Er-xian; WANG Jie; LIN Jun-fang

    2009-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, which is also called the blastospore by budding. The yeast-like conidia of T. fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. Thus, it is a good recipient cell for exogenous gene expression. In this study, the expression plasmid pAN7-1 (containing promoter gpd-An derived from Aspergillus nidulans and selectable marker gene hph conferring resistance to hygromycin B) and plasmid pLg-hph (containing promoter gpd-Le derived from Lentinula edodes and selectable marker gene hph) were transformed into the yeast-like conidia of T. fuciformis by PEG-mediated protoplast transformation, respectively. The primary putative transformants were selected by the sandwich screening method with the selective medium containing 50 μg mL-1 hygromycin. The putative transformantswere obtained from the primary putative transformants transferred on PDSA plates containing 100 μg mL-1 hygromycin for second round selection. Experimental results showed that the optimal concentration of PEG 4000 for mediating protoplast transformation was 25%. PCR and Southern blotting confirmed that the selectable marker gene hph was integrated effectively into the genome of the yeast-like conidia of T. fuciformis with plasmid pLg-hph transformation.Its transformation efficiency was 110 transformants per μg DNA, and the hph gene was integrated into the genome of some yeast-like conidia with plasmid pAN7-1 transformation. However, its transformation efficiency was only 9 transformants per μg DNA. The presence of hph gene in the genome of transformants after 5 generations of sub-culturing on PDSB medium was confirmed by PCR, suggesting that the foreign gene hph was stable during subculture.

  5. Yeasts associated with plums and their potential for controlling brown rot after harvest.

    Science.gov (United States)

    Janisiewicz, Wojciech J; Jurick, Wayne M; Peter, Kari A; Kurtzman, Cletus P; Buyer, Jeffrey S

    2014-06-01

    Bacterial and yeast antagonists isolated from fruit surfaces have been effective in controlling various post-harvest diseases, and several microbial antagonists have been developed into commercial products. Our knowledge of the fruit microbial community, with the exception of grapes, apples and some citrus fruit, is rudimentary and the potential of the resident yeasts for biocontrol remains largely unknown. We determined the occurrence of yeasts on plum surfaces during fruit development from the pre-hardening stage until harvest for 2 years. A total of 16 species from 13 genera were isolated. Species from three genera, basidiomycetes Rhodotorula (29.5%) and Sporidiobolus (24.7%) and the dimorphic ascomycete genus Aureobasidium (24.7%), constituted 78.7% of all isolations and were recovered throughout fruit development, while Cryptococcus spp. constituted only 6.2% of the total plum isolates. The yeast community in the final sampling was significantly different from the first three samplings, reflecting a rapidly changing fruit habitat during the maturation of fruit. For example, Hanseniaspora, Pichia, Zygosaccharomyces and Wickerhamomyces occurred only on the most mature fruit. Screening of the yeasts for antagonistic activity against Monilinia fructicola, a fungus that causes brown rot, revealed a range of biocontrol activities. Several isolates provided complete control of the decay on plums, challenged with a pathogen suspension of 10(3) conidia/ml and > 90% of control on fruit inoculated with the pathogen at a concentration 10 times higher. Some of the best antagonists included A. pullulans and R. phylloplana. Populations of both of these antagonists increased rapidly by several orders of magnitude in wounds of plums incubated at 24ºC and 4ºC. Our results indicate that plum surfaces harbour several yeast species, with excellent potential for use in biological control of brown rot of stone fruits. PMID:24687564

  6. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  7. Chamigrane Sesquiterpenes from a Basidiomycetous Endophytic Fungus XG8D Associated with Thai Mangrove Xylocarpus granatum

    Science.gov (United States)

    Choodej, Siwattra; Teerawatananond, Thapong; Mitsunaga, Tohru; Pudhom, Khanitha

    2016-01-01

    Six new chamigrane sesquiterpenes, merulinols A‒F (1‒6), and four known metabolites (7‒10) were isolated from the culture of the basidiomycetous fungus XG8D, a mangrove-derived endophyte. Their structures were elucidated mainly by 1D and 2D NMR, while the structures of 1 and 2 were further confirmed by single-crystal X-ray diffraction analysis. The in vitro cytotoxicity of all compounds was evaluated against three human cancer cell lines, MCF-7, Hep-G2, and KATO-3. Compounds 3 and 4 selectively displayed cytotoxicity against KATO-3 cells with IC50 values of 35.0 and 25.3 μM, respectively. PMID:27428984

  8. Chamigrane Sesquiterpenes from a Basidiomycetous Endophytic Fungus XG8D Associated with Thai Mangrove Xylocarpus granatum

    Directory of Open Access Journals (Sweden)

    Siwattra Choodej

    2016-07-01

    Full Text Available Six new chamigrane sesquiterpenes, merulinols A‒F (1‒6, and four known metabolites (7‒10 were isolated from the culture of the basidiomycetous fungus XG8D, a mangrove-derived endophyte. Their structures were elucidated mainly by 1D and 2D NMR, while the structures of 1 and 2 were further confirmed by single-crystal X-ray diffraction analysis. The in vitro cytotoxicity of all compounds was evaluated against three human cancer cell lines, MCF-7, Hep-G2, and KATO-3. Compounds 3 and 4 selectively displayed cytotoxicity against KATO-3 cells with IC50 values of 35.0 and 25.3 μM, respectively.

  9. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  10. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens

    Science.gov (United States)

    Sun, Yuxin; Letsimo, Elizabeth Mpholoseng; Parvez, Mohammad; Yu, Jae-Hyuk; Mashele, Samson Sitheni; Syed, Khajamohiddin

    2015-01-01

    Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s), heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence). Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea), Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis) and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala), revealed the presence of numerous putative P450s ranging from 267 (A. mellea) to 14 (M. osmundae). Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  11. Systematic identification and evolutionary analysis of catalytically versatile cytochrome p450 monooxygenase families enriched in model basidiomycete fungi.

    Directory of Open Access Journals (Sweden)

    Khajamohiddin Syed

    Full Text Available Genome sequencing of basidiomycetes, a group of fungi capable of degrading/mineralizing plant material, revealed the presence of numerous cytochrome P450 monooxygenases (P450s in their genomes, with some exceptions. Considering the large repertoire of P450s found in fungi, it is difficult to identify P450s that play an important role in fungal metabolism and the adaptation of fungi to diverse ecological niches. In this study, we followed Sir Charles Darwin's theory of natural selection to identify such P450s in model basidiomycete fungi showing a preference for different types of plant components degradation. Any P450 family comprising a large number of member P450s compared to other P450 families indicates its natural selection over other P450 families by its important role in fungal physiology. Genome-wide comparative P450 analysis in the basidiomycete species, Phanerochaete chrysosporium, Phanerochaete carnosa, Agaricus bisporus, Postia placenta, Ganoderma sp. and Serpula lacrymans, revealed enrichment of 11 P450 families (out of 68 P450 families, CYP63, CYP512, CYP5035, CYP5037, CYP5136, CYP5141, CYP5144, CYP5146, CYP5150, CYP5348 and CYP5359. Phylogenetic analysis of the P450 family showed species-specific alignment of P450s across the P450 families with the exception of P450s of Phanerochaete chrysosporium and Phanerochaete carnosa, suggesting paralogous evolution of P450s in model basidiomycetes. P450 gene-structure analysis revealed high conservation in the size of exons and the location of introns. P450s with the same gene structure were found tandemly arranged in the genomes of selected fungi. This clearly suggests that extensive gene duplications, particularly tandem gene duplications, led to the enrichment of selective P450 families in basidiomycetes. Functional analysis and gene expression profiling data suggest that members of the P450 families are catalytically versatile and possibly involved in fungal colonization of plant

  12. A single desaturase gene from red yeast Sporidiobolus pararoseus is responsible for both four- and five-step dehydrogenation of phytoene.

    Science.gov (United States)

    Li, Chunji; Zhang, Ning; Song, Jia; Wei, Na; Li, Bingxue; Zou, Hongtao; Han, Xiaori

    2016-09-15

    Carotenoids are one of the most common classes of natural pigments widely occurring within organisms. These structurally diverse pigments are of great importance in different processes such as nutrition, vision, cellular growth and development. While found in various yeast strains, one of the best-studied carotenoid producer is the pigmented species Sporidiobolus pararoseus. However, the precise nature of the genes involved in the biosynthesis of carotenoids in this species remains unclear. Here, we cloned a cDNA copy of the phytoene desaturase gene crtI from Sporidiobolus pararoseus CGMCC 2.5280. The crtI full-length genomic DNA and cDNA are 2330bp and 1683bp, respectively. This gene encodes a 560-amino acid protein with a predicted molecular mass of 62.28 kDa and a pI of 7.27. Functional identification of the gene was performed using heterologous complementation detection in Escherichia coli. Our experimental findings indicate that the enzymatic conversion of phytoene to lycopene (fourth step product) and 3,4-didehydrolycopene (fifth step product) is catalyzed by this phytoene desaturase of S. pararoseus through consecutive dehydrogenation. Furthermore, our findings suggest that the crtI gene of S. pararoseus represents an alternative gene source for the reconstruction of carotenogenic pathways vital for the production of engineered carotenoids. PMID:27346167

  13. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  14. Modeling brewers' yeast flocculation

    Science.gov (United States)

    van Hamersveld EH; van der Lans RG; Caulet; Luyben

    1998-02-01

    Flocculation of yeast cells occurs during the fermentation of beer. Partway through the fermentation the cells become flocculent and start to form flocs. If the environmental conditions, such as medium composition and fluid velocities in the tank, are optimal, the flocs will grow in size large enough to settle. After settling of the main part of the yeast the green beer is left, containing only a small amount of yeast necessary for rest conversions during the next process step, the lagering. The physical process of flocculation is a dynamic equilibrium of floc formation and floc breakup resulting in a bimodal size distribution containing single cells and flocs. The floc size distribution and the single cell amount were measured under the different conditions that occur during full scale fermentation. Influences on flocculation such as floc strength, specific power input, and total number of yeast cells in suspension were studied. A flocculation model was developed, and the measured data used for validation. Yeast floc formation can be described with the collision theory assuming a constant collision efficiency. The breakup of flocs appears to occur mainly via two mechanisms, the splitting of flocs and the erosion of yeast cells from the floc surface. The splitting rate determines the average floc size and the erosion rate determines the number of single cells. Regarding the size of the flocs with respect to the scale of turbulence, only the viscous subrange needs to be considered. With the model, the floc size distribution and the number of single cells can be predicted at a certain point during the fermentation. For this, the bond strength between the cells, the fractal dimension of the yeast, the specific power input in the tank and the number of yeast cells that are in suspension in the tank have to be known. Copyright 1998 John Wiley & Sons, Inc.

  15. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  16. Meiosis in haploid yeast

    OpenAIRE

    Wagstaff, Joseph E.; Klapholz, Sue; Esposito, Rochelle Easton

    1982-01-01

    Haploid yeast cells normally contain either the MATa or MATα mating-type allele and cannot undergo meiosis and spore formation. If both mating-type alleles are present as a consequence of chromosome III disomy (MATa/MATα), haploids initiate meiosis but do not successfully form spores, probably because the haploid chromosome complement is irregularly partitioned during meiotic nuclear division. We have demonstrated that the ochre-suppressible mutation spo13-1 enables haploid yeast cells disomi...

  17. Forces in yeast flocculation

    Science.gov (United States)

    El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Vincent, Stéphane P.; Abellán Flos, Marta; Hols, Pascal; Lipke, Peter N.; Dufrêne, Yves F.

    2015-01-01

    In the baker's yeast Saccharomyces cerevisiae, cell-cell adhesion (``flocculation'') is conferred by a family of lectin-like proteins known as the flocculin (Flo) proteins. Knowledge of the adhesive and mechanical properties of flocculins is important for understanding the mechanisms of yeast adhesion, and may help controlling yeast behaviour in biotechnology. We use single-molecule and single-cell atomic force microscopy (AFM) to explore the nanoscale forces engaged in yeast flocculation, focusing on the role of Flo1 as a prototype of flocculins. Using AFM tips labelled with mannose, we detect single flocculins on Flo1-expressing cells, showing they are widely exposed on the cell surface. When subjected to force, individual Flo1 proteins display two distinct force responses, i.e. weak lectin binding forces and strong unfolding forces reflecting the force-induced extension of hydrophobic tandem repeats. We demonstrate that cell-cell adhesion bonds also involve multiple weak lectin interactions together with strong unfolding forces, both associated with Flo1 molecules. Single-molecule and single-cell data correlate with microscale cell adhesion behaviour, suggesting strongly that Flo1 mechanics is critical for yeast flocculation. These results favour a model in which not only weak lectin-sugar interactions are involved in yeast flocculation but also strong hydrophobic interactions resulting from protein unfolding.

  18. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  19. Better One-Eyed than Blind--Challenges and Opportunities of Biomass Measurement During Solid-State Fermentation of Basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Bley, Thomas

    2015-01-01

    Filamentous fungi, especially basidiomycetes, produce a wide range of metabolites, many of which have potential biotechnological and industrial applications. Solid-state fermentation (SSF) is very suitable for the cultivation of basidiomycetes since it mimics the natural habitat of these fungi. Some of the major advantages of SSF are the robustness of the process, the use of low-cost residual materials as substrates, and the reduced usage of water. However, monitoring key variables is difficult, which makes process control a challenge. Specifically, it is very difficult to determine the biomass during SSF process involving basidiomycetes. This is problematic, as the biomass is normally a key variable in mass and energy balance equations. Further, the success of fungal SSF processes is often evaluated, in part, based on the growth of the fungus. Direct determination of the dry weight of biomass is impossible and indirect quantification techniques must be used. Over the years, various determination techniques have been developed for the quantification of fungal biomass in SSF processes. The current review gives an overview of various direct and indirect biomass determination methods, discussing their advantages and disadvantages.

  20. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment. PMID:20585855

  1. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  2. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  3. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

    2010-12-07

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

  4. Accumulation of cellobiose lipids under nitrogen-limiting conditions by two ustilaginomycetous yeasts, Pseudozyma aphidis and Pseudozyma hubeiensis.

    Science.gov (United States)

    Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai

    2013-02-01

    Some basidiomycetous yeast strains extracellularly produce cellobiose lipids (CLs), glycolipid biosurfactants which have strong fungicidal activity. The representative CL producer Ustilago maydis produces CLs together with the other glycolipids, mannosylerythritol lipids (MELs); the preference of the two glycolipids is affected considerably by the nitrogen source. To develop new CL producers, 12 MEL producers were cultured under the nitrogen-limited conditions. Pseudozyma aphidis and Pseudozyma. hubeiensis were characterized as new CL producers. CL production was induced on three strains, P. aphidis, Pseudozyma graminicola, and P. hubeiensis under these conditions. The putative homologous genes of U. maydis cyp1, which encodes a P450 monooxygenase, essential for CL biosynthesis, were partially amplified from their genomic DNA. The nucleotide sequences of the gene fragments from P. hubeiensis and P. aphidis shared identities with U. maydis cyp1 of 99% and 78%, respectively. Furthermore, all of the deduced translation products are tightly clustered in the phylogenic tree of the monooxygenase. These results suggest that the genes involved with CL biosynthesis must be widely distributed in the basidiomycetous fungi as well as the MEL biosynthesis genes, and thus, the genus Pseudozyma has great potential as a biosurfactant producer. PMID:22985214

  5. Production of gamma-lactones by the brown-rot basidiomycete Piptoporus soloniensis.

    Science.gov (United States)

    Okamoto, Kenji; Chimori, Mieko; Iwanaga, Fumi; Hattori, Tsutomu; Yanase, Hideshi

    2002-01-01

    A wild strain of brown-rot basidiomycete Piptoporus soloniensis produced a sweet flavor similar to tropical fruits in liquid cultures. The major and minor compounds were identified to be gamma-decalactone and gamma-octanolactone by gas chromatography-mass spectrometry analysis, respectively. The growth and production of gamma-decalactone by P. soloniensis in broth to which fatty acids had been added were investigated. The addition of 12-hydroxystearic acid and ricinoleic acid to the culture markedly enhanced the production of gamma-decalactone. On the other hand, addition of myristic acid, palmitic acid, stearic acid and oleic acid to the culture resulted in a higher production of gamma-octanolactone. The addition of hexanoic acid, octanoic acid, decanoic acid, lauric acid, linoleic acid and linolenic acid to the culture reduced the growth of P. soloniensis and production of gamma-decalactone and gamma-octanolactone. This strain accumulated oxalic acid in liquid culture and grew sufficiently under strongly acidic conditions. PMID:16233291

  6. Population genetics of the wood-rotting basidiomycete Armillaria cepistipes in a fragmented forest landscape.

    Science.gov (United States)

    Heinzelmann, Renate; Rigling, Daniel; Prospero, Simone

    2012-09-01

    Armillaria cepistipes is a common wood-rotting basidiomycete fungus found in most forests in Central Europe. In Switzerland, the habitat of A. cepistipes is fragmented because of the presence of major geographical barriers, in particular the Alps, and past deforestation. We analysed the impact of habitat fragmentation on the current spatial genetic structure of the Swiss A. cepistipes population. A total of 167 isolates were sampled across an area of 41 000 km(2) and genotyped at seven microsatellite and four single nucleotide polymorphism (SNP) loci. All isolates belonged to different genotypes which, according to the Bayesian clustering algorithm implemented in Tess, originated from a single gene pool. Our analyses indicate that the overall A. cepistipes population shows little, but significant (F(ST)=0.02), genetic differentiation. Such a situation suggests gene flow is strong, possibly due to long-distance dispersal of airborne basidiospores. This hypothesis is supported by the fact that we could not detect a pattern of isolation by distance. Gene flow is partially restricted by the high mountain ranges of the Alps, as indicated by a signal of spatial autocorrelation detected among genotypes separated by less than about 80-130 km. In contrast, past deforestation seems to have no significant effect on the current spatial population structure of A. cepistipes. This might indicate the existence of a time lag between the current spatial genetic structure and the processes that have induced this specific structure. PMID:22954341

  7. Identification of a gene cluster for biosynthesis of mannosylerythritol lipids in the basidiomycetous fungus Ustilago maydis.

    Science.gov (United States)

    Hewald, Sandra; Linne, Uwe; Scherer, Mario; Marahiel, Mohamed A; Kämper, Jörg; Bölker, Michael

    2006-08-01

    Many microorganisms produce surface-active substances that enhance the availability of water-insoluble substrates. Although many of these biosurfactants have interesting potential applications, very little is known about their biosynthesis. The basidiomycetous fungus Ustilago maydis secretes large amounts of mannosylerythritol lipids (MELs) under conditions of nitrogen starvation. We recently described a putative glycosyltransferase, Emt1, which is essential for MEL biosynthesis and whose expression is strongly induced by nitrogen limitation. We used DNA microarray analysis to identify additional genes involved in MEL biosynthesis. Here we show that emt1 is part of a gene cluster which comprises five open reading frames. Three of the newly identified proteins, Mac1, Mac2, and Mat1, contain short sequence motifs characteristic for acyl- and acetyltransferases. Mutational analysis revealed that Mac1 and Mac2 are essential for MEL production, which suggests that they are involved in the acylation of mannosylerythritol. Deletion of mat1 resulted in the secretion of completely deacetylated MELs, as determined by mass spectrometry. We overexpressed Mat1 in Escherichia coli and demonstrated that this enzyme acts as an acetyl coenzyme A-dependent acetyltransferase. Remarkably, Mat1 displays relaxed regioselectivity and is able to acetylate mannosylerythritol at both the C-4 and C-6 hydroxyl groups. Based on these results, we propose a biosynthesis pathway for the generation of mannosylerythritol lipids in U. maydis. PMID:16885300

  8. Penarines A-F, (nor-)sesquiterpene carboxylic acids from Hygrophorus penarius (Basidiomycetes).

    Science.gov (United States)

    Otto, Alexander; Porzel, Andrea; Schmidt, Jürgen; Wessjohann, Ludger; Arnold, Norbert

    2014-12-01

    Five sesquiterpene carboxylic acids (1-5) and one nor-sesquiterpene carboxylic acid (6) of the very rare ventricosane type, named penarines A-F, were isolated from fruiting bodies of the basidiomycete Hygrophorus penarius (Hygrophoraceae). This is the first report of (nor)-sesquiterpenes isolated from basidiocarps of the family Hygrophoraceae. Their structures were elucidated on the basis of extensive 1D ((1)H, (13)C) and 2D (HSQC, HMBC, COSY, ROESY) NMR spectroscopic analyses as well as high-resolution mass spectrometry studies. Additionally, the only known member of this rare type of sesquiterpenes, ventricos-7(13)-ene (7), could be identified via headspace GC-MS analysis in a fruiting body of H. penarius. Compounds 1-6 were devoid of remarkable antifungal activity against Cladosporium cucumerinum. Additionally, the cytotoxic activities of compounds 1 and 2 were evaluated against the human prostate cancer cell line PC-3 and the colon cancer cell line HT-29 showing no significant cytotoxic activity. PMID:25269661

  9. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  10. Opportunistic Pathogenic Yeasts

    Science.gov (United States)

    Banerjee, Uma

    Advances in medical research, made during the last few decades, have improved the prophylactic, diagnostic and therapeutic capabilities for variety of infections/diseases. However, many of the prophylactic and therapeutic procedures have been seen in many instances to exact a price of host-vulnerability to an expanding group of opportunistic pathogens and yeasts are one of the important members in it. Fortunately amongst the vast majority of yeasts present in nature only few are considered to have the capability to cause infections when certain opportunities predisposes and these are termed as ‘opportunistic pathogenic yeasts.’ However, the term ‘pathogenic’ is quite tricky, as it depends of various factors of the host, the ‘bug’ and the environment to manifest the clinical infection. The borderline is expanding. In the present century with unprecedented increase in number of immune-compromised host in various disciplines of health care settings, where any yeast, which has the capability to grow at 37 ° C (normal body temperature of human), can be pathogenic and cause infection in particular situation

  11. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  12. Highly efficient transformation of intact yeast-like conidium cells of Tremella fuciformin by electroporation

    Institute of Scientific and Technical Information of China (English)

    GUO LiQiong; LIU Yong; ZHAO ShuXian; LIU ErXian; LIU JunFang

    2008-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, also called the blastospore by budding. The yeast-like conidia of T. Fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. So it is a good recipient cell for exogenous gone expression. In this study, two expression vectors pGIg-gfp containing gpd-GI promoter and gfp gone and pGIg-hph containing gpd-GI promoter and hph gone were constructed. The lowest sensitive concentration of hygromycin for the blastospore was determined on three types of media. Our ex-perimenta showed that the lowest sensitive concentration of hygromycin for the blastospore was 5 μg/mL on MA medium. The intact blastospores were transformed with the expression vector pGIg-hph by electroporation. The putative transformants were obtained by the MA selective medium. Experi-mental results showed that the most effective parameters for the electroporation of intact blastospores were obtained by using STM buffer, 1.0×108 cells/mL of blastospores, 200 μL in transformation volume, 6 μg plasmid, 2.0 kV/cm of electric pulse voltage, stillness culturing on MB liquid medium for 48 h after electroporation. In these transformation conditions, the efficiency reached 277 colonies/μg DNA. With the optimal parameters. The putative co-transformants were obtained by the MA selective medium. Eight randomly selected colonies from the vast putative co-transformants were analyzed by PCR de-tection and Southern blotting. The experiments showed that the gfp was integrated into the genomes of three transformants. The co-transformation efficiency was 37.5%. Green fluorescence was observed under laser scanning confocal microscope in these gfp positive transformants. This indicates that the exogenous gfp can be expressed effectively in the yeast-like conidia of T. Fuciformis.

  13. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi.

    Science.gov (United States)

    Riley, Robert; Salamov, Asaf A; Brown, Daren W; Nagy, Laszlo G; Floudas, Dimitrios; Held, Benjamin W; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika A; Sun, Hui; LaButti, Kurt M; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E; Pisabarro, Antonio G; Walton, Jonathan D; Blanchette, Robert A; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David S; Grigoriev, Igor V

    2014-07-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white-rot/brown-rot classification paradigm, we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically informed principal-components analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white-rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown-rot fungi. Our results suggest a continuum rather than a dichotomy between the white-rot and brown-rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay. PMID:24958869

  14. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  15. Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

    Science.gov (United States)

    van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

    Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

  16. Glutathione Production in Yeast

    Science.gov (United States)

    Bachhawat, Anand K.; Ganguli, Dwaipayan; Kaur, Jaspreet; Kasturia, Neha; Thakur, Anil; Kaur, Hardeep; Kumar, Akhilesh; Yadav, Amit

    Glutathione, γ -glutamyl-cysteinyl-glycine, is the most abundant non-protein thiol found in almost all eukaryotic cells (and in some prokaryotes). The tripeptide, which is synthesized non-ribosomally by the consecutive action of two soluble enzymes, is needed for carrying out numerous functions in the cell, most important of which is the maintenance of the redox buffer. The cycle of glutathione biosynthesis and degradation forms part of the γ -glutamyl cycle in most organisms although the latter half of the pathway has not been demonstrated in yeasts. Our current understanding of how glutathione levels are controlled at different levels in the cell is described. Several different routes and processes have been attempted to increase commercial production of glutathione using both yeast and bacteria. In this article we discuss the history of glutathione production in yeast. The current bottlenecks for increased glutathione production are presented based on our current understanding of the regulation of glutathione homeostasis, and possible strategies for overcoming these limitations for further enhancing and improving glutathione production are discussed

  17. Insights into the plant polysaccharide degradation potential of the xylanolytic yeast Pseudozyma brasiliensis.

    Science.gov (United States)

    Kaupert Neto, Antonio Adalberto; Borin, Gustavo Pagotto; Goldman, Gustavo Henrique; Damásio, André Ricardo de Lima; Oliveira, Juliana Velasco de Castro

    2016-03-01

    In second-generation (2G) bioethanol production, plant cell-wall polysaccharides are broken down to release fermentable sugars. The enzymes of this process are classified as carbohydrate-active enzymes (CAZymes) and contribute substantially to the cost of biofuel production. A novel basidiomycete yeast species, Pseudozyma brasiliensis, was recently discovered. It produces an endo-β-1,4-xylanase with a higher specific activity than other xylanases. This enzyme is essential for the hydrolysis of biomass-derived xylan and has an important role in 2G bioethanol production. In spite of the P. brasiliensis biotechnological potential, there is no information about how it breaks down polysaccharides. For the first time, we characterized the secretome of P. brasiliensis grown on different carbon sources (xylose, xylan, cellobiose and glucose) and also under starvation conditions. The growth and consumption of each carbohydrate and the activity of the CAZymes of culture supernatants were analyzed. The CAZymes found in its secretomes, validated by enzymatic assays, have the potential to hydrolyze xylan, mannan, cellobiose and other polysaccharides. The data show that this yeast is a potential source of hydrolases, which can be used for biomass saccharification. PMID:26712719

  18. Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.

    Science.gov (United States)

    Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges

    2015-11-01

    Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. PMID:26226336

  19. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. PMID:25586306

  20. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period.

  1. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  2. Oleaginous yeasts from Ethiopia.

    Science.gov (United States)

    Jiru, Tamene Milkessa; Abate, Dawit; Kiggundu, Nicholas; Pohl, Carolina; Groenewald, Marizeth

    2016-12-01

    Oleaginous microorganisms can produce high amounts of oil (>20 % of their biomass) under suitable cultivation conditions. In this research work 200 samples were collected from soil, plant surfaces (leaves, flowers and fruits), waste oils from traditional oil milling houses and dairy products (cheese, milk and yoghurt) in Ethiopia. Three hundred and forty yeast colonies were isolated from these samples. By applying Sudan III staining tests, 18 strains were selected as possible oleaginous yeasts. The 18 strains were identified and characterized for their lipid production as a feedstock for biodiesel production in the future. They were identified using morphological and physiological methods as well as sequencing the 3'end of the small-subunit rRNA gene, the internal transcribed spacer regions (ITS; ITS 1, ITS 2 and the intervening 5.8S rRNA gene), and the D1/D2 domain of the 26S rRNA gene. The 18 yeasts were identified as Cutaneotrichosporon curvatus (syn, Cryptococcus curvatus) (PY39), Rhodotorula kratochvilovae (syn, Rhodosporidium kratochvilovae) (SY89), Rhodotorula dairenensis (SY94) and Rhodotourula mucilaginosa (SY09, SY18, SY20, PY21, PY23, PY25, SY30, PY32, SY43, PY44, SY52, PY55, PY61, SY75 and PY86). Under nitrogen-limited cultivation conditions, R. mucilaginosa PY44 produced the highest biomass (15.10 ± 0.54 g/L), while R. mucilaginosa PY32 produced the lowest biomass (10.32 ± 0.18 g/L). The highest lipid yield of 6.87 ± 0.62 g/L and lipid content of 46.51 ± 0.70 % were attained by C. curvatus (syn, C. curvatus) PY39. On the other hand, R. mucilaginosa PY61 gave the lowest lipid yield (2.06 ± 0.52 g/L) and R. mucilaginosa SY52 gave the lowest lipid content of 16.99 ± 0.85 %. The results in this research work suggest that much more oleaginous yeasts can be isolated from Ethiopian environment. On the basis of their substantial lipid production abilities, the three oleaginous yeast strains PY39, SY89 and SY18 were selected and

  3. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D;

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  4. Flavour-active wine yeasts

    OpenAIRE

    Cordente, Antonio G.; Curtin, Christopher D.; Varela, Cristian; Pretorius, Isak S.

    2012-01-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can infl...

  5. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD+-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  6. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  7. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  8. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  9. Yeasts preservation: alternatives for lyophilisation

    NARCIS (Netherlands)

    Nyanga, L.K.; Nout, M.J.R.; Smid, E.J.; Boekhout, T.; Zwietering, M.H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts duri

  10. Phage and Yeast Display.

    Science.gov (United States)

    Sheehan, Jared; Marasco, Wayne A

    2015-02-01

    Despite the availability of antimicrobial drugs, the continued development of microbial resistance--established through escape mutations and the emergence of resistant strains--limits their clinical utility. The discovery of novel, therapeutic, monoclonal antibodies (mAbs) offers viable clinical alternatives in the treatment and prophylaxis of infectious diseases. Human mAb-based therapies are typically nontoxic in patients and demonstrate high specificity for the intended microbial target. This specificity prevents negative impacts on the patient microbiome and avoids driving the resistance of nontarget species. The in vitro selection of human antibody fragment libraries displayed on phage or yeast surfaces represents a group of well-established technologies capable of generating human mAbs. The advantage of these forms of microbial display is the large repertoire of human antibody fragments present during a single selection campaign. Furthermore, the in vitro selection environments of microbial surface display allow for the rapid isolation of antibodies--and their encoding genes--against infectious pathogens and their toxins that are impractical within in vivo systems, such as murine hybridomas. This article focuses on the technologies of phage display and yeast display, as these strategies relate to the discovery of human mAbs for the treatment and vaccine development of infectious diseases. PMID:26104550

  11. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  12. Chloride channel-dependent copper acquisition of laccase in the basidiomycetous fungus Cryptococcus neoformans

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH.This study reports that copper homeostasis was impaired in the clc-a mutant.This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry.CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C.neoformans.

  13. BIOSYNTHESIS OF YEAST CAROTENOIDS

    Science.gov (United States)

    Simpson, Kenneth L.; Nakayama, T. O. M.; Chichester, C. O.

    1964-01-01

    Simpson, Kenneth L. (University of California, Davis), T. O. M. Nakayama, and C. O. Chichester. Biosynthesis of yeast carotenoids. J. Bacteriol. 88:1688–1694. 1964.—The biosynthesis of carotenoids was followed in Rhodotorula glutinis and in a new strain, 62-506. The treatment of the growing cultures by methylheptenone, or ionone, vapors permitted observations of the intermediates in the biosynthetic pathway. On the basis of concentration changes and accumulation in blocked pathways, the sequence of carotenoid formation is postulated as phytoene, phytofluene, ζ-carotene, neurosporene, β-zeacarotene, γ-carotene, torulin, a C40 aldehyde, and torularhodin. Torulin and torularhodin were established as the main carotenoids of 62-506. PMID:14240958

  14. Genetic study on yeast

    International Nuclear Information System (INIS)

    Research during the past year has moved ahead on several fronts. A major compilation of all the genetic mapping data for the yeast Saccharomyces cerevisiae has been completed. The map describes the location of over 300 genes on 17 chromosomes. A report on this work will appear in Microbiological Reviews in December 1980. Recombinant DNA procedures have been introduced into the experiments and RAD52 (one of the genes involved in recombination and repair damage), has been successfully cloned. This clone will be used to determine the gene product. Diploid cells homozygous for RAD52 have exceptionally high frequencies of mitotic loss of chromosomes. This loss is stimulated by ionizing radiation. This effect is a very significant finding. The effect has also been seen with certain other RAD mutants

  15. Lager yeast comes of age.

    Science.gov (United States)

    Wendland, Jürgen

    2014-10-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This "web of life" recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  16. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  17. Cryptococcus randhawai sp. nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India.

    Science.gov (United States)

    Khan, Zia U; Ahmad, Suhail; Hagen, Ferry; Fell, Jack W; Kowshik, Tusharantak; Chandy, Rachel; Boekhout, Teun

    2010-03-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region sequences, the isolate belonged to the Cryptococcus albidus cluster (Filobasidiales, Tremellomycetes) and was closely related to Cryptococcus saitoi, Cryptococcus cerealis and Cryptococcus friedmannii with 98% sequence identity. Phenotypically, the species differed from C. saitoi with respect to growth temperature (up to 37degrees C), presence of a thin capsule, ability to grow in the absence of vitamins, and inability to assimilate citrate and ethylamine. With respect to C. friedmannii, it differed in growth temperature, ability to assimilate lactose, raffinose, L: -rhamnose, myo-inositol, and inability to utilize citrate. Furthermore, our isolate also differed from C. cerealis in growth temperature, presence of capsule and inability to assimilate L: -sorbose. In view of the above phenotypic differences and unique rDNA sequences, we consider that our isolate represents a new species of Cryptococcus, and therefore, a new species, Cryptococcus randhawai is proposed for this taxon. The type strain J11/2002 has been deposited in the culture collection of the Centraalbureau voor Schimmelcultures (CBS10160) and CABI Biosciences (IMI 393306). PMID:20091225

  18. Cryptococcus randhawai sp nov., a novel anamorphic basidiomycetous yeast isolated from tree trunk hollow of Ficus religiosa (peepal tree) from New Delhi, India

    NARCIS (Netherlands)

    Khan, Z.U.; Ahmad, S.; Hagen, F.; Fell, J.W.; Kowshik, T.; Chandy, R.; Boekhout, T.

    2010-01-01

    A novel anamorphic Cryptococcus species is described, which was isolated in New Delhi (India) from decaying wood of a tree trunk hollow of Ficus religiosa. On the basis of sequence analysis of the D1/D2 domains of the 26S rRNA gene and the internally transcribed spacer (ITS)-1 and ITS-2 region seque

  19. 21 CFR 172.896 - Dried yeasts.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dried yeasts. 172.896 Section 172.896 Food and... Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis) may be safely used in food provided the total folic...

  20. Conversion of BAC clones into binary BAC (BIBAC) vectors and their delivery into basidiomycete fungal cells using Agrobacterium tumefaciens.

    Science.gov (United States)

    Ali, Shawkat; Bakkeren, Guus

    2015-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi. PMID:25239747

  1. Evidence from Serpula lacrymans that 2,5-dimethoxyhydroquinone Is a lignocellulolytic agent of divergent brown rot basidiomycetes.

    Science.gov (United States)

    Korripally, Premsagar; Timokhin, Vitaliy I; Houtman, Carl J; Mozuch, Michael D; Hammel, Kenneth E

    2013-04-01

    Basidiomycetes that cause brown rot of wood are essential biomass recyclers in coniferous forest ecosystems and a major cause of failure in wooden structures. Recent work indicates that distinct lineages of brown rot fungi have arisen independently from ligninolytic white rot ancestors via loss of lignocellulolytic enzymes. Brown rot thus proceeds without significant lignin removal, apparently beginning instead with oxidative attack on wood polymers by Fenton reagent produced when fungal hydroquinones or catechols reduce Fe(3+) in colonized wood. Since there is little evidence that white rot fungi produce these metabolites, one question is the extent to which independent lineages of brown rot fungi may have evolved different Fe(3+) reductants. Recently, the catechol variegatic acid was proposed to drive Fenton chemistry in Serpula lacrymans, a brown rot member of the Boletales (D. C. Eastwood et al., Science 333:762-765, 2011). We found no variegatic acid in wood undergoing decay by S. lacrymans. We found also that variegatic acid failed to reduce in vitro the Fe(3+) oxalate chelates that predominate in brown-rotting wood and that it did not drive Fenton chemistry in vitro under physiological conditions. Instead, the decaying wood contained physiologically significant levels of 2,5-dimethoxyhydroquinone, a reductant with a demonstrated biodegradative role when wood is attacked by certain brown rot fungi in two other divergent lineages, the Gloeophyllales and Polyporales. Our results suggest that the pathway for 2,5-dimethoxyhydroquinone biosynthesis may have been present in ancestral white rot basidiomycetes but do not rule out the possibility that it appeared multiple times via convergent evolution. PMID:23377930

  2. Marine Yeasts and Their Applications in Mariculture

    Institute of Scientific and Technical Information of China (English)

    CHI Zhenming; LIU Zhiqiang; GAO Lingmei; GONG Fang; MA Chunling; WANG Xianghong; LI Haifeng

    2006-01-01

    The terrestrial yeasts have been receiving great attention in science and industry for over one hundred years because they can produce many kinds of bioactive substances. However, little is known about the bioactive substances of marine yeasts. In recent years, it has been found that marine yeasts have wide applications in mariculture and other fields.Therefore, marine yeasts, the bioactive substances from them and the applications of marine yeasts themselves and the bioactive substances they produced are reviewed in this paper.

  3. Vaginal Yeast Infections (For Parents)

    Science.gov (United States)

    ... infection caused by a type of fungus called candida albicans . Yeast infections usually happen in warm, moist parts of the ... fungus can grow. Doctors call this candida overgrowth candidiasis (pronounced: can-dih-DYE-uh-sis) Candida can ...

  4. Engineering antibodies by yeast display.

    Science.gov (United States)

    Boder, Eric T; Raeeszadeh-Sarmazdeh, Maryam; Price, J Vincent

    2012-10-15

    Since its first application to antibody engineering 15 years ago, yeast display technology has been developed into a highly potent tool for both affinity maturing lead molecules and isolating novel antibodies and antibody-like species. Robust approaches to the creation of diversity, construction of yeast libraries, and library screening or selection have been elaborated, improving the quality of engineered molecules and certainty of success in an antibody engineering campaign and positioning yeast display as one of the premier antibody engineering technologies currently in use. Here, we summarize the history of antibody engineering by yeast surface display, approaches used in its application, and a number of examples highlighting the utility of this method for antibody engineering.

  5. Shuffling Yeast Gene Expression Data

    OpenAIRE

    Bilke, Sven

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent ...

  6. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    Dominika M Wloch-Salamon

    2014-04-01

    Social theory has provided a useful framework for research with microorganisms. Here I describe the advantages and possible risks of using a well-known model organism, the unicellular yeast Saccharomyces cerevisiae, for sociobiological research. I discuss the problems connected with clear classification of yeast behaviour based on the fitness-based Hamilton paradigm. Relevant traits include different types of communities, production of flocculins, invertase and toxins, and the presence of apoptosis.

  7. Seleção de Basidiomycetes da Amazônia para produção de enzimas de interesse biotecnológico Screening of basidiomycetes from Amazonia for the production of biotechnological interest enzymes

    Directory of Open Access Journals (Sweden)

    Helenires Queiroz de Souza

    2008-12-01

    Full Text Available Os fungos têm sido bastante usados como produtores de diferentes substâncias de interesse econômico, tais como: enzimas, antibióticos, vitaminas, aminoácidos e esteróides. Este estudo teve como objetivo detectar a produção de enzimas por linhagens de Basidiomycetes, oriundas de áreas de floresta da Amazônia. Para a produção de enzimas, os fungos foram cultivados em meio líquido adicionado de substrato indutor (0,5%, pH ajustado para cada enzima e incubados a 28 °C, sob agitação a 140 rpm, durante 96 ou 120 horas. A massa micelial foi separada for filtração e os filtrados foram inoculados em cup plates de 6 mm de diâmetro, perfurados na superfície de meios de cultura sólidos, adequados para a detecção das enzimas amilases, proteases, celulases, fenoloxidases e pectinases em placa de Petri. As placas foram incubadas à temperatura de 28 °C por 24 horas, e reveladas para observação dos halos indicativos da atividade enzimática. Foi verificada também a atividade da amilase e protease produzida pelos fungos, crescidos em meio líquido, com diferentes fontes nutricionais. Foi possível detectar a produção de celulases e proteases por todos os isolados, 40% produziram amilases, 50% produziram fenoloxidases e 10% produziram pectinases. Quanto à atividade da amilase, o substrato farelo de trigo foi o que proporcionou os maiores halos de degradação, destacando-se os fungos Daedalea sp. 4E6 e Daedalea sp. 1A, Stereaceae 22B e Pycnoporus sanguineus 12B. Considerando os substratos testados para produção de proteases, o substrato concentrado protéico de peixe se destacou como a melhor fonte protéica. Os fungos P. sanguineus 12B, Stereaceae 22B e Cantharellus guyanensis 4Bl foram os melhores produtores de protease.Mushrooms, edible basidiomycetes, have been extensively used as producers of different substances of economical interest, such as enzymes, antibiotics, vitamins, amino acids, and steroids. The objective of this

  8. Molecular cloning of functional genes for high growth-temperature and salt tolerance of the basidiomycete Fomitopsis pinicola isolated in a mangrove forest in Micronesia.

    Science.gov (United States)

    Miyazaki, Yasumasa; Hiraide, Masakazu; Shibuya, Hajime

    2007-01-01

    Several functional genes encoding putative proteins, heat shock protein 70, sphingosine phosphate lyase, and Na+/H+ antiporter, were cloned from the basidiomycete Fomitopsis pinicola, a wood-rotting fungus isolated in the tropical mangrove forest of Pohnpei Island of the Federated States of Micronesia. The deduced amino acid sequences of the obtained genes involved in heat shock resistance, lipid synthesis, and salt tolerance showed diverse similarities to other homologous proteins. Molecular phylogenetic trees of these proteins suggested that encoded proteins of the cloned genes of F. pinicola differed remarkably from other homologs in various organisms, even fungal proteins. Putative candidates for other genes related to several cellular metabolisms were also amplified, implying the possible existence of those genes in F. pinicola. This is the first report of possibly functional genes derived from a basidiomycetous mushroom growing in tropical islands such as Micronesia. The genes found in this study might play important roles in the cellular survival of the basidiomycete F. pinicola under severe environmental conditions. PMID:17213639

  9. Wood and humus decay strategies by white-rot basidiomycetes correlate with two different dye decolorization and enzyme secretion patterns on agar plates.

    Science.gov (United States)

    Barrasa, José M; Blanco, María N; Esteve-Raventós, Fernando; Altés, Alberto; Checa, Julia; Martínez, Angel T; Ruiz-Dueñas, Francisco J

    2014-11-01

    During several forays for ligninolytic fungi in different Spanish native forests, 35 white-rot basidiomycetes growing on dead wood (16 species from 12 genera) and leaf litter (19 species from 10 genera) were selected for their ability to decolorize two recalcitrant aromatic dyes (Reactive Blue 38 and Reactive Black 5) added to malt extract agar medium. In this study, two dye decolorization patterns were observed and correlated with two ecophysiological groups (wood and humus white-rot basidiomycetes) and three taxonomical groups (orders Polyporales, Hymenochaetales and Agaricales). Depending on the above groups, different decolorization zones were observed on the dye-containing plates, being restricted to the colony area or extending to the surrounding medium, which suggested two different decay strategies. These two strategies were related to the ability to secrete peroxidases and laccases inside (white-rot wood Polyporales, Hymenochaetales and Agaricales) and outside (white-rot humus Agaricales) of the fungal colony, as revealed by enzymatic tests performed directly on the agar plates. Similar oxidoreductases production patterns were observed when fungi were grown in the absence of dyes, although the set of enzyme released was different. All these results suggest that the decolorization patterns observed could be related with the existence of two decay strategies developed by white-rot basidiomycetes adapted to wood and leaf litter decay in the field.

  10. Yeast Genetics and Biotechnological Applications

    Science.gov (United States)

    Mishra, Saroj; Baranwal, Richa

    Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

  11. Highly efficient transformation of intact yeast-like conidium cells of Tremella fuciformis by electroporation

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Tremella fuciformis is one of higher basidiomycetes. Its basidiospore can reproduce yeast-like conidia, also called the blastospore by budding. The yeast-like conidia of T. fuciformis is monokaryotic and easy to culture by submerged fermentation similar to yeast. So it is a good recipient cell for exogenous gene expression. In this study, two expression vectors pGlg-gfp containing gpd-Gl promoter and gfp gene and pGlg-hph containing gpd-Gl promoter and hph gene were constructed. The lowest sensitive concentration of hygromycin for the blastospore was determined on three types of media. Our ex- periments showed that the lowest sensitive concentration of hygromycin for the blastospore was 5 μg/mL on MA medium. The intact blastospores were transformed with the expression vector pGlg-hph by electroporation. The putative transformants were obtained by the MA selective medium. Experi- mental results showed that the most effective parameters for the electroporation of intact blastospores were obtained by using STM buffer, 1.0×108 cells/mL of blastospores, 200 μL in transformation volume, 6 μg plasmid, 2.0 kV/cm of electric pulse voltage, stillness culturing on MB liquid medium for 48 h after electroporation. In these transformation conditions, the efficiency reached 277 colonies/μg DNA. Co-transformation of plasmid pGlg-gfp and pGlg-hph with ratio of 1:1 was performed by electroporation with the optimal parameters. The putative co-transformants were obtained by the MA selective medium. Eight randomly selected colonies from the vast putative co-transformants were analyzed by PCR de- tection and Southern blotting. The experiments showed that the gfp was integrated into the genomes of three transformants. The co-transformation efficiency was 37.5%. Green fluorescence was observed under laser scanning confocal microscope in these gfp positive transformants. This indicates that the exogenous gfp can be expressed effectively in the yeast-like conidia of T. fuciformis.

  12. Emulsifying activity of hydrocarbonoclastic marine yeasts

    Digital Repository Service at National Institute of Oceanography (India)

    Gupta, R.

    Marine yeast growth on four petroleum hydrocarbons induced the production of extracellular emulsifying agents (biosurfactants). Out of the 17 marine yeast isolates tested, 7 isolates, i.e., Candida parapsilosis, C. cantarelli, C. membranae...

  13. Shuffling Yeast Gene Expression Data

    CERN Document Server

    Bilke, S

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent cell clock is identified. The capability of the algorithm to extract information about signal flow in the regulatory network underlying the expression patterns is demonstrated.

  14. 21 CFR 73.355 - Phaffia yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Phaffia yeast. 73.355 Section 73.355 Food and... ADDITIVES EXEMPT FROM CERTIFICATION Foods § 73.355 Phaffia yeast. (a) Identity. (1) The color additive phaffia yeast consists of the killed, dried cells of a nonpathogenic and nontoxicogenic strain of...

  15. Comparative Evaluation of the BD Phoenix Yeast ID Panel and Remel RapID Yeast Plus System for Yeast Identification

    OpenAIRE

    Michelle L. Grant; Shobha Parajuli; Raquel Deleon-Gonsalves; Raghava Potula; Truant, Allan L.

    2016-01-01

    Becton Dickinson Phoenix Yeast ID Panel was compared to the Remel RapID Yeast Plus System using 150 recent clinical yeast isolates and the API 20C AUX system to resolve discrepant results. The concordance rate between the Yeast ID Panel and the RapID Yeast Plus System (without arbitration) was 93.3% with 97.3% (146/150) and 95.3% (143/150) of the isolates correctly identified by the Becton Dickinson Phoenix and the Remel RapID, respectively, with arbitration.

  16. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics.

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-01-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense. PMID:27616058

  17. Biological characteristics of teleomorph and optimized in vitro fruiting conditions of the Hoelen medicinal mushroom, Wolfiporia extensa (Higher Basidiomycetes).

    Science.gov (United States)

    Xu, Zhangyi; Meng, Hu; Xiong, Huan; Bian, Yinbing

    2014-01-01

    Wolfiporia extensa is a basidiomycetous brown rot fungus and is of well-known medicinal import in China, Japan, and other Asiatic countries. Fruiting body induction is of major relevance for basic biological research and for their use in industrial applications. Based on the evaluation of the effects of temperature, time in the dark before induction and culture, and wounding treatment on fruiting, this report describes the most efficient protocol for inducing fruiting of W. extensa growing on agar plates. Furthermore, several biological characteristics of teleomorph, such as the locations of hymenium, the configuration of basidiospores and primary mycelia, and events involved in basidiosporogenesis in W. extensa, were analyzed for the first time using fluorescence microscopy. The results showed that the hymenium born on both sides of the wall of the honeycomb-like structure on the surface of fruiting bodies and the hymenophoral trama situated in the middle. Each basidia has 4 binuclear basidiospores, and the primary mycelia are multinucleate without clamp connections. These results broaden our knowledge about this brown rot fungus and promote further studies of the sexual reproduction, fruiting body development, and advancement of breeding program, new topics related to the contents of pharmacologically active substances in W. extensa fruiting bodies. PMID:25271978

  18. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process. PMID:26797957

  19. Transcription analysis of pyranose dehydrogenase from the basidiomycete Agaricus bisporus and characterization of the recombinantly expressed enzyme.

    Science.gov (United States)

    Gonaus, Christoph; Kittl, Roman; Sygmund, Christoph; Haltrich, Dietmar; Peterbauer, Clemens

    2016-03-01

    Agaricus bisporus is a litter degrading basidiomycete commonly found in humic-rich environments. It is used as model organism and cultivated in large scale for food industry. Due to its ecological niche it produces a variety of enzymes for detoxification and degradation of humified plant litter. One of these, pyranose dehydrogenase, is thought to play a role in detoxification and lignocellulose degradation. It is a member of the glucose-methanol-choline family of flavin-dependent enzymes and oxidizes a wide range of sugars with concomitant reduction of electron acceptors like quinones. In this work, transcription of pdh in A. bisporus was investigated with real-time PCR revealing influence of the carbon source on pdh expression levels. The gene was isolated and heterologously expressed in Pichia pastoris. Characterization of the recombinant enzyme showed a higher affinity towards disaccharides compared to other tested pyranose dehydrogenases from related Agariceae. Homology modeling and sequence alignments indicated that two loops of high sequence variability at substrate access site could play an important role in modulating these substrate specificities. PMID:26616098

  20. Enhanced textile dye decolorization by marine-derived basidiomycete Peniophora sp. CBMAI 1063 using integrated statistical design.

    Science.gov (United States)

    Bonugli-Santos, Rafaella C; Vieira, Gabriela A L; Collins, Catherine; Fernandes, Thaís Cristina C; Marin-Morales, Maria Aparecida; Murray, Patrick; Sette, Lara D

    2016-05-01

    In the present study, the biotechnological potential of the marine-derived fungus Peniophora sp. CBMAI 1063 was investigated in relation to Reactive Black 5 (RB5) dye decolorization and degradation using an integrated statistical design composed of Plackett-Burman design (P&B), central composite design (CCD), and response surface methodology (RSM). RB5 dye was effectively decolorized (94 %) in saline conditions, without any detection of mutagenic compounds, and simultaneously, 57 % of total organic carbon (TOC) was removed in 7 days. The activity of lignin peroxidase (LiP) was not detected during the process. The gene expression of laccase (Lac) and manganese peroxidase (MnP) enzymes produced during the process was evaluated, and results from this experiment coupled with LC-MS analyses revealed that in the early stage of dye decolorization, a higher MnP gene expression and significant enzymatic activity was detected in Peniophora sp. CBMAI 1063 with the formation of p-Base and TAHNDS compounds. This paper reports innovative data related to the textile dye decolorization by the marine-derived basidiomycete Peniophora sp. CBMAI 1063, showing the metabolites formed and enzymatic action throughout the process in saline condition. The strategy used showed to be an efficient statistical approach that provides an attractive solution for the screening and simultaneous optimization of the degradation process.

  1. Root endophyte symbiosis in vitro between the ectomycorrhizal basidiomycete Tricholoma matsutake and the arbuscular mycorrhizal plant Prunus speciosa.

    Science.gov (United States)

    Murata, Hitoshi; Yamada, Akiyoshi; Yokota, Satoru; Maruyama, Tsuyoshi; Endo, Naoki; Yamamoto, Kohei; Ohira, Tatsuro; Neda, Hitoshi

    2014-05-01

    We previously reported that Tricholoma matsutake and Tricholoma fulvocastaneum, ectomycorrhizal basidiomycetes that associate with Pinaceae and Fagaceae, respectively, in the Northern Hemisphere, could interact in vitro as a root endophyte of somatic plants of Cedrela odorata (Meliaceae), which naturally harbors arbuscular mycorrhizal fungi in South America, to form a characteristic rhizospheric colony or "shiro". We questioned whether this phenomenon could have occurred because of plant-microbe interactions between geographically separated species that never encounter one another in nature. In the present study, we document that these fungi formed root endophyte interactions and shiro within 140 days of inoculation with somatic plants of Prunus speciosa (=Cerasus speciosa, Rosaceae), a wild cherry tree that naturally harbors arbuscular mycorrhizal fungi in Japan. Compared with C. odorata, infected P. speciosa plants had less mycelial sheath surrounding the exodermis, and the older the roots, especially main roots, the more hyphae penetrated. In addition, a large number of juvenile roots were not associated with hyphae. We concluded that such root endophyte interactions were not events isolated to the interactions between exotic plants and microbes but could occur generally in vitro. Our pure culture system with a somatic plant allowed these fungi to express symbiosis-related phenotypes that varied with the plant host; these traits are innately programmed but suppressed in nature and could be useful in genetic analyses of plant-fungal symbiosis. PMID:24158697

  2. Molecular cloning and heterologous expression in Pichia pastoris of X-prolyl-dipeptidyl aminopeptidase from basidiomycete Ustilago maydis.

    Science.gov (United States)

    Juárez-Montiel, Margarita; Ibarra, J Antonio; Chávez-Camarillo, Griselda; Hernández-Rodríguez, César; Villa-Tanaca, Lourdes

    2014-03-01

    Dipeptidyl aminopeptidases are enzymes involved in the posttranslational control of bioactive peptides. Here we identified the gene dapUm in Ustilago maydis by homology with other fungal dipeptidyl aminopeptidases. Analysis of the dapUm-deduced amino acid sequence indicated that it encodes for membrane-type serine protease with a characteristic prolyl oligopeptidase catalytic motif triad: Ser, Asp, His. In order to overexpress the DapUm, the gene encoding for it was cloned and transformed into Pichia. Using this system, we observed a ∼ 125-kDa recombinant protein with an optimal enzymatic activity at pH 6.0 and at 40 °C for the Ala-Pro-p-nitroanilide substrate and an experimental pH of 6.9. U. maydis DapUm was specifically inhibited by phenylmethylsulfonyl fluoride and Pefabloc, confirming the presence of a serine residue in the active site. To our knowledge, this study is the first report on the cloning and expression of a DPP IV dipeptidyl aminopeptidase from a basidiomycete organism. Moreover, the use of recombinant DapUm will allow us to further study and characterize this enzyme, in addition to testing chemical compounds for pharmaceutical purposes.

  3. PRODUCING OF ENZYME PREPARATION AND ANALYSIS OF ENZYME PREPARATION OF PEROXIDASE AND CATALASE OF SOME SPECIES OF BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov O.V.

    2013-04-01

    Full Text Available A method for obtaining of enzyme preparations of enzyme preparations (EP of peroxidases and catalases fungal extracellular and inracellular origin from cultures of Basidiomycetes was developed. The strains Flammulina velutipes F-vv, Agrocybe cylindracea167; Fistulina hepatica Fh-08 and Pleurotus ostreatus P-208 and P-01 were used as producers of oxidoreductases. Strains were grown on modified glucose-peptone media. Fractionation was carried out by salting out the enzymes with ammonium sulfate at 40-70% saturation of peroxidases and 80% of saturation - for catalase. These solutions protein fractions was further purified by dialysis and gel filtration on Molselekt granules G-50 and G-75. The enzyme solution was subjected to freeze-drying. The individual characteristics of the enzyme preparations were found. The individual characteristics of the enzyme preparations are the activity of enzymes, the protein content and amino-acid composition of enzyme preparations. It was established that strain F. velutipes F-vv was an active producer of intracellular and strain of A. cylindracea 167 was an active producer of extracellular peroxidase. The strains of P. ostreatus P-01 and P-208 were the active producers of extracellular catalase, and the strainsof F. hepatica Fh-08 were active producers of intracellular catalase. The developed methods for producing of enzymes catalase and peroxidase preparations of extra-and intracellular origin provided new antioxidant enzymes, which have their own properties and application prospects in various sectors of industry and science research.

  4. Yeast as factory and factotum.

    Science.gov (United States)

    Dixon, B

    2000-02-01

    After centuries of vigorous activity in making fine wines, beers and breads, Saccharomyces cerevisiae is now acquiring a rich new portfolio of skills, bestowed by genetic manipulation. As shown in a recent shop-window of research supported by the European Commission, yeasts will soon be benefiting industries as diverse as fish farming, pharmaceuticals and laundering.

  5. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular...... Compartments and Transport. Mating Type Switch. Molecular Genetics and Recombinant DNA....

  6. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  7. Black yeasts in cold habitats

    NARCIS (Netherlands)

    L. Selbmann; G.S. de Hoog; L. Zucconi; D. Isola; S. Onofri

    2014-01-01

    Black yeasts have already been known since the end of the nineteenth century, but for a number of reasons, only few workers were familiar with them. That was since recently, until the wealth of biodiversity, stunning ecologies and potential applications have become apparent. Some remote and extreme

  8. The wine and beer yeast Dekkera bruxellensis.

    Science.gov (United States)

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history.

  9. Purification and characterization of a novel detergent- and organic solvent-resistant endo-beta-1,4-glucanase from a newly isolated basidiomycete Peniophora sp. NDVN01

    OpenAIRE

    TRINH, Dinh Kha; Quyen, Dinh Thi; Do, Thi Tuyen; Nghiem, Ngoc Minh

    2013-01-01

    A novel extracellular endoglucanase from a basidiomycete strain Peniophora sp. NDVN01 was purified 2.8-fold to homogeneity through ammonium sulfate precipitation and gel filtration with Bio-Gel P-100 and Sephadex G-75. The endoglucanase had a specific activity of 163.8 U/mg protein and a molecular mass of 32 kDa. Optimum temperature and pH were at 60 °C and 4.5, respectively. The enzyme was stable at up to 42 °C and in the pH range of 3.5-5.5 with a residual activity of over 80% for 24 h of t...

  10. Combinatorial pathway assembly in yeast

    Directory of Open Access Journals (Sweden)

    Khalil Essani

    2015-10-01

    Full Text Available With the emergence of synthetic biology and the vast knowledge about individual biocatalytic reactions, the challenge nowadays is to implement whole natural or synthetic pathways into microorganisms. For this purpose balanced enzyme activities throughout the pathway need to be achieved in addition to simple functional gene expression to avoid bottlenecks and to obtain high titers of the desired product. As the optimization of pathways in a specific biological context is often hard to achieve by rational design, combinatorial approaches have been developed to address this issue. Here, current strategies and proof of concepts for combinatorial pathway assembly in yeasts are reviewed. By exploiting its ability to join multiple DNA fragments in a very efficient and easy manner, the yeast Saccharomyces cerevisiae does not only constitute an attractive host for heterologous pathway expression, but also for assembling pathways by recombination in vivo.

  11. Mycotoxins - prevention and decontamination by yeasts.

    Science.gov (United States)

    Pfliegler, Walter P; Pusztahelyi, Tünde; Pócsi, István

    2015-07-01

    The application of yeasts has great potential in reducing the economic damage caused by toxigenic fungi in the agriculture. Some yeasts may act as biocontrol agents inhibiting the growth of filamentous fungi. These species may also gain importance in the preservation of agricultural products and in the reduction of their mycotoxin contamination, yet the extent of mycotoxin production in the presence of biocontrol agents is relatively less understood. The application of yeasts in various technological processes may have a direct inhibitory effect on the toxin production of certain molds, which is independent of their growth suppressing effect. Furthermore, several yeast species are capable of accumulating mycotoxins from agricultural products, thereby effectively decontaminating them. Probiotic yeasts or products containing yeast cell wall are also applied to counteract mycotoxicosis in livestock. Several yeast strains are also able to degrade toxins to less-toxic or even non-toxic substances. This intensively researched field would greatly benefit from a deeper knowledge on the genetic and molecular basis of toxin degradation. Moreover, yeasts and their biotechnologically important enzymes may exhibit sensitivity to certain mycotoxins, thereby mounting a considerable problem for the biotechnological industry. It is noted that yeasts are generally regarded as safe; however, there are reports of toxin degrading species that may cause human fungal infections. The aspects of yeast-mycotoxin relations with a brief consideration of strain improvement strategies and genetic modification for improved detoxifying properties and/or mycotoxin resistance are reviewed here.

  12. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Science.gov (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu

    2015-01-01

    Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota) in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) region and fungal internal transcribed spacer 2 (ITS2) region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity. PMID:25884708

  13. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  14. Nuclear Import of Yeast Proteasomes

    Directory of Open Access Journals (Sweden)

    Julianne Burcoglu

    2015-08-01

    Full Text Available Proteasomes are highly conserved protease complexes responsible for the degradation of aberrant and short-lived proteins. In highly proliferating yeast and mammalian cells, proteasomes are predominantly nuclear. During quiescence and cell cycle arrest, proteasomes accumulate in granules in close proximity to the nuclear envelope/ER. With prolonged quiescence in yeast, these proteasome granules pinch off as membraneless organelles, and migrate as stable entities through the cytoplasm. Upon exit from quiescence, the proteasome granules clear and the proteasomes are rapidly transported into the nucleus, a process reflecting the dynamic nature of these multisubunit complexes. Due to the scarcity of studies on the nuclear transport of mammalian proteasomes, we summarised the current knowledge on the nuclear import of yeast proteasomes. This pathway uses canonical nuclear localisation signals within proteasomal subunits and Srp1/Kap95, and the canonical import receptor, named importin/karyopherin αβ. Blm10, a conserved 240 kDa protein, which is structurally related to Kap95, provides an alternative import pathway. Two models exist upon which either inactive precursor complexes or active holo-enzymes serve as the import cargo. Here, we reconcile both models and suggest that the import of inactive precursor complexes predominates in dividing cells, while the import of mature enzymes mainly occurs upon exit from quiescence.

  15. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  16. [Metabolomics analysis of taxadiene producing yeasts].

    Science.gov (United States)

    Yan, Huifang; Ding, Mingzhu; Yuan, Yingjin

    2014-02-01

    In order to study the inherent difference among terpenes producing yeasts from the point of metabolomics, we selected taxadiene producing yeasts as the model system. The changes of cellular metabolites during fermentation log phase of artificial functional yeasts were determined using metabolomics methods. The results represented that compared to W303-1A as a blank control, the metabolites in glycolysis, tricarboxylic acid cycle (TCA) cycle and several amino acids were influenced. And due to the changes of metabolites, the growth of cells was inhibited to a certain extent. Among the metabolites identified, citric acid content in taxadiene producing yeasts changed the most, the decreasing amplitude reached 90% or more. Therefore, citric acid can be a marker metabolite for the future study of artificial functional yeasts. The metabolomics analysis of taxadiene producing yeasts can provide more information in further studies on optimization of terpenes production in heterologous chassis.

  17. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  18. Beer brewing using a fusant between a sake yeast and a brewer's yeast.

    Science.gov (United States)

    Mukai, N; Nishimori, C; Fujishige, I W; Mizuno, A; Takahashi, T; Sato, K

    2001-01-01

    Beer brewing using a fusant between a sake yeast (a lysine auxotrophic mutant of sake yeast K-14) and a brewer's yeast (a respiratory-deficient mutant of the top fermentation yeast NCYC1333) was performed to take advantage of the beneficial characteristics of sake yeasts, i.e., the high productivity of esters, high tolerance to ethanol, and high osmotolerance. The fusant (F-32) obtained was different from the parental yeasts regarding, for example, the assimilation of carbon sources and tolerance to ethanol. A brewing trial with the fusant was carried out using a 100-l pilot-scale plant. The fusant fermented wort more rapidly than the parental brewer's yeast. However, the sedimentation capacity of the fusant was relatively low. The beer brewed using the fusant contained more ethanol and esters compared to that brewed using the parental brewer's yeast. The fusant also obtained osmotolerance in the fermentation of maltose and fermented high-gravity wort well.

  19. Yeast Interacting Proteins Database: YEL005C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available endosome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with th...protein localizes to the endosome; identified as a transcriptional activator in a high-throughput yeast one-

  20. The Application of Enzyme and Yeast

    OpenAIRE

    Zhao, Qing

    2012-01-01

    This bachelor’s thesis concerns the application of enzymes and yeasts for bio-industry. The purpose of this work is to understand the basic knowledge about enzyme and yeast, and meanwhile, to find out their different applications. Through comprehensive study, the knowledge was accumulated which brought a clear understanding for the enzyme structure and yeast microorganism, together with their working principles for the bioprocess. For wood-based industry, the different enzymes used in bi...

  1. Revaluation of Waste Yeast from Beer Production

    OpenAIRE

    Nicoleta Suruceanu; Sonia Socaci; Teodora Coldea; Elena Mudura

    2013-01-01

    Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, ident...

  2. Construction of Killer Wine Yeast Strain

    OpenAIRE

    Seki, Tetsuji; Choi, Eon-Ho; Ryu, Dewey

    1985-01-01

    A double-stranded RNA plasmid which confers the superkiller phenotype was transferred into a wine yeast (Montrachet strain 522) and its leucine-requiring derivative (strain 694) by cytoduction, using the protoplast fusion technique. The killer wine yeast constructed completely suppressed the growth of killer-sensitive strains of Saccharomyces cerevisiae in yeast extract-peptone-glucose medium at pH 4.5, whereas the killer effect was somewhat decreased at pH 3.5. The wine yeast harboring the k...

  3. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied. PMID:26330322

  4. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic characteristics.

    Science.gov (United States)

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    The macro- and micro-morphological features, mycelial extension rate, enzymatic activities and possible genetic changes were studied in 30 selected strains of basidiomycetes after 10-year cryopreservation on perlite in liquid nitrogen (LN). Comparisons with the same strains preserved by serial transfers on nutrient media at 4°C were also conducted. Production of ligninolytic enzymes and hydrogen peroxide was studied by quantitative spectrophotometric methods, whereas semiquantitative API ZYM testing was used to compare the levels of a wide range of hydrolytic enzymes. Our results show that cryopreservation in LN did not cause morphological changes in any isolate. The vitality of all fungi was successfully preserved and none of the physiological features were lost, even though the extension rate and enzyme activity were slightly affected. Moreover, sequence analysis of eight strains did not detect any changes in their genetic features after cryopreservation. These findings suggest that the perlite-based freezing protocol is suitable for long-term preservation of large numbers of basidiomycetes.

  5. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  6. Bioaccumulation of the artificial Cs-137 and the natural radionuclides Th-234, Ra-226, and K-40 in the fruit bodies of Basidiomycetes in Greece.

    Science.gov (United States)

    Kioupi, Vasiliki; Florou, Heleny; Kapsanaki-Gotsi, Evangelia; Gonou-Zagou, Zacharoula

    2016-01-01

    The bioaccumulation of artificial Cs-137 and natural radionuclides Th-234, Ra-226, and K-40 by Basidiomycetes of several species is studied and evaluated in relation to their substratum soils. For this reason, 32 fungal samples, representing 30 species of Basidiomycetes, were collected along with their substratum soil samples, from six selected sampling areas in Greece. The fungal fruit bodies and the soil samples were properly treated and the activity concentrations of the studied radionuclides were measured by gamma spectroscopy. The measured radioactivity levels ranged as follows: Cs-137 from Ra-226 from <0.3 to 1.0 ± 0.5 Bq kg(-1) F.W., and K-40 from 56.4 ± 3.0 to 759.0 ± 28.3 Bq kg(-1) F.W. The analysis of the results supported that the bioaccumulation of the studied natural radionuclides and Cs-137 is dependent on the species and the functional group of the fungi. Fungi were found to accumulate Th-234 and not U-238. What is more, potential bioindicators for each radionuclide among the 32 species studied could be suggested for each habitat, based on their estimated concentration ratios (CRs). The calculation of the CRs' mean values for each radionuclide revealed a rank in decreasing order for all the species studied.

  7. NetPhosYeast: prediction of protein phosphorylation sites in yeast

    DEFF Research Database (Denmark)

    Ingrell, C.R.; Miller, Martin Lee; Jensen, O.N.;

    2007-01-01

    We here present a neural network-based method for the prediction of protein phosphorylation sites in yeast-an important model organism for basic research. Existing protein phosphorylation site predictors are primarily based on mammalian data and show reduced sensitivity on yeast phosphorylation...... sites compared to those in humans, suggesting the need for an yeast-specific phosphorylation site predictor. NetPhosYeast achieves a correlation coefficient close to 0.75 with a sensitivity of 0.84 and specificity of 0.90 and outperforms existing predictors in the identification of phosphorylation sites...... in yeast....

  8. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics.

  9. Yeast cell factories on the horizon

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2015-01-01

    For thousands of years, yeast has been used for making beer, bread, and wine. In modern times, it has become a commercial workhorse for producing fuels, chemicals, and pharmaceuticals such as insulin, human serum albumin, and vaccines against hepatitis virus and human papillomavirus. Yeast has also...... been engineered to make chemicals at industrial scale (e.g., succinic acid, lactic acid, resveratrol) and advanced biofuels (e.g., isobutanol) (1). On page 1095 of this issue, Galanie et al. (2) demonstrate that yeast can now be engineered to produce opioids (2), a major class of compounds used...... for treating severe pain. Their study represents a tour de force in the metabolic engineering of yeast, as it involved the expression of genes for more than 20 enzymatic activities from plants, mammals, bacteria, and yeast itself. It clearly represents a breakthrough advance for making complex natural products...

  10. Ceramide Accumulation in Yeast Yarrowia lipolitica

    Institute of Scientific and Technical Information of China (English)

    周全; 陈国强

    2005-01-01

    Ceramides are a class of lipid molecules widely distributed in eukaryotic cells in small amount. To investigate the possibility of ceramide production by yeast, a yeast strain Yarrowia lipolitica was grown under different conditions including changing carbon/nitrogen ratio, and serine concentration, dissolved oxygen and presence of ethanol. It was found that increased dissolved oxygen supply increased the ceramide content in the yeast 2.5 fold of its normal control level. Ethanol treatment could also enhance ceramide accumulation by 3.3 fold compared with the control although the cell growth was negatively affected. Cellular redox potential was shown to affect ceramide accumulation by the yeast. This was possibly related to the cellular reactive oxygen species presented in the yeast.

  11. Comet assay on tetraploid yeast cells

    DEFF Research Database (Denmark)

    Rank, Jette; Syberg, Kristian; Jensen, Klara

    2009-01-01

    Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from...... three municipal treatment plants were tested for their effect on the yeast-cell DNA. The main problem with using yeast in the comet assay is the necessity to degrade the cell wall. This was achieved by using Zymolase 100 T twice during the procedure, since Zymolase 20 T did not open the cell wall....... Analytical problems that arose due to the small amount of DNA in the yeast nuclei in haploid and diploid cells, which contain 13 Mbp and 26 Mbp DNA per cell, respectively, were solved by using tetraploid yeast cells (52 Mbp) instead. DNA damage was shown after exposure to H2O2 and acrylamide. The lowest dose...

  12. Modeling competition between yeast strains

    Science.gov (United States)

    de Gee, Maarten; van Mourik, Hilda; de Visser, Arjan; Molenaar, Jaap

    2016-04-01

    We investigate toxin interference competition between S. cerevisiae colonies grown on a solid medium. In vivo experiments show that the outcome of this competition depends strongly on nutrient availability and cell densities. Here we present a new model for S. cerevisiae colonies, calculating the local height and composition of the colonies. The model simulates yeast colonies that show a good fit to experimental data. Simulations of colonies that start out with a homogeneous mixture of toxin producing and toxin sensitive cells can display remarkable pattern formation, depending on the initial ratio of the strains. Simulations in which the toxin producing and toxin sensitive species start at nearby positions clearly show that toxin production is advantageous.

  13. Overview of fission yeast septation.

    Science.gov (United States)

    Pérez, Pilar; Cortés, Juan C G; Martín-García, Rebeca; Ribas, Juan C

    2016-09-01

    Cytokinesis is the final process of the vegetative cycle, which divides a cell into two independent daughter cells once mitosis is completed. In fungi, as in animal cells, cytokinesis requires the formation of a cleavage furrow originated by constriction of an actomyosin ring which is connected to the plasma membrane and causes its invagination. Additionally, because fungal cells have a polysaccharide cell wall outside the plasma membrane, cytokinesis requires the formation of a septum coincident with the membrane ingression. Fission yeast Schizosaccharomyces pombe is a unicellular, rod-shaped fungus that has become a popular model organism for the study of actomyosin ring formation and constriction during cell division. Here we review the current knowledge of the septation and separation processes in this fungus, as well as recent advances in understanding the functional interaction between the transmembrane enzymes that build the septum and the actomyosin ring proteins. PMID:27155541

  14. The wine and beer yeast Dekkera bruxellensis.

    Science.gov (United States)

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. PMID:24932634

  15. Accelerating Yeast Prion Biology using Droplet Microfluidics

    Science.gov (United States)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  16. Decolorization of mixtures of different reactive textile dyes by the white-rot basidiomycete Phanerochaete sordida and inhibitory effect of polyvinyl alcohol.

    Science.gov (United States)

    Harazono, Koichi; Nakamura, Kazunori

    2005-03-01

    We tried to decolorize mixtures of four reactive textile dyes, including azo and anthraquinone dyes, by a white-rot basidiomycete Phanerochaete sordida. P. sordida decolorized dye mixtures (200 mg l-1 each) by 90% within 48 h in nitrogen-limited glucose-ammonium media. Decolorization of dye mixtures needed Mn2+ and Tween 80 in the media. Manganese peroxidase (MnP) played a major role in dye decolorization by P. sordida. Decolorization of dye mixtures by P. sordida was partially inhibited by polyvinyl alcohol (PVA) that wastewaters from textile industries often contain. This was caused by an inhibitory effect of PVA on the decolorization of Reactive Red 120 (RR120) with MnP reaction system. Second addition of Tween 80 to the reaction mixtures in the presence of PVA improved the decolorization of RR120. These results suggest that PVA could interfere with lipid peroxidation or subsequent attack to the dye.

  17. [Total Peroxidase and Catalase Activity of Luminous Basidiomycetes Armillaria borealis and Neonothopanus nambi in Comparison with the Level of Light Emission].

    Science.gov (United States)

    Mogil'naya, O A; Ronzhin, N O; Medvedeva, S E; Bondar, V S

    2015-01-01

    The peroxidase and catalase activities in the mycelium of luminous basidiomycetes Armillaria borealis and Neonothopanus nambi in normal conditions and under stress were compared. An increase in the luminescence level was observed under stress, as well as an increase in peroxidase and catalase activities. Moreover, the peroxidase activity in extracts of A. borealis mycelium was found to be almost one and a half orders of magnitude higher, and the catalase activity more than two orders of magnitude higher in comparison with the N. nambi mycelium. It can be suggested that the difference between the brightly luminescent and dimly luminescent mycelium of N. nambi is due to the content of H2O2 or other peroxide compounds.

  18. 21 CFR 172.590 - Yeast-malt sprout extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived...

  19. 21 CFR 172.325 - Bakers yeast protein.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast protein. 172.325 Section 172.325 Food... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be safely used in food in accordance with the following conditions: (a) Bakers yeast protein is...

  20. 21 CFR 184.1983 - Bakers yeast extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b)...

  1. Corning and Kroger turn whey to yeast

    Energy Technology Data Exchange (ETDEWEB)

    1981-11-16

    It is reported that Corning and Kroger intend to build a 35,000 sq. ft. plant in Winchester, Ky., that will turn whey into bakers' yeast. The plant will convert whey from Kroger's dairies into bakers' yeast, supplying about 60% of the yeast needed for nine Kroger bakeries. It will also produce syrups and whey protein concentrate for use in other food processing activities. In addition to making useful products, the project will convert the whey to glucose and galactose. The protein component of the whey will be concentrated and used in various foods and feeds.

  2. Yeast Exocytic v-SNAREs Confer Endocytosis

    OpenAIRE

    Gurunathan, Sangiliyandi; Chapman-Shimshoni, Daphne; Trajkovic, Selena; Gerst, Jeffrey E.

    2000-01-01

    In yeast, homologues of the synaptobrevin/VAMP family of v-SNAREs (Snc1 and Snc2) confer the docking and fusion of secretory vesicles at the cell surface. As no v-SNARE has been shown to confer endocytosis, we examined whether yeast lacking the SNC genes, or possessing a temperature-sensitive allele of SNC1 (SNC1ala43), are deficient in the endocytic uptake of components from the cell surface. We found that both SNC and temperature-shifted SNC1ala43 yeast are d...

  3. Pseudoporphyria associated with consumption of brewers' yeast.

    Science.gov (United States)

    Lim, C K; Rideout, J M; Peters, T J

    1984-06-01

    A case of pseudoporphyria associated with excessive consumption of brewers ' yeast was studied. Detailed analysis of the yeast tablets by high performance liquid chromatography showed the presence of dicarboxylic deuteroporphyrin , mesoporphyrin, and protoporphyrin; coproporphyrin I and III isomers; and uroporphyrin I and III isomers. The faecal porphyrin concentration of the patient taking yeast tablets was significantly increased, resembling the excretion pattern in variegate porphyria. Any patient showing an unusual porphyrin excretion pattern on high performance liquid chromatography should be investigated for a possible dietary cause.

  4. YeastWeb: a workset-centric web resource for gene family analysis in yeast

    Directory of Open Access Journals (Sweden)

    Bao Haihua

    2010-07-01

    Full Text Available Abstract Background Currently, a number of yeast genomes with different physiological features have been sequenced and annotated, which provides invaluable information to investigate yeast genetics, evolutionary mechanism, structure and function of gene families. Description YeastWeb is a novel database created to provide access to gene families derived from the available yeast genomes by assigning the genes into putative families. It has many useful features that complement existing databases, such as SGD, CYGD and Génolevures: 1 Detailed computational annotation was conducted with each entry with InterProScan, EMBOSS and functional/pathway databases, such as GO, COG and KEGG; 2 A well established user-friendly environment was created to allow users to retrieve the annotated genes and gene families using functional classification browser, keyword search or similarity-based search; 3 Workset offers users many powerful functions to manage the retrieved data efficiently, associate the individual items easily and save the intermediate results conveniently; 4 A series of comparative genomics and molecular evolution analysis tools are neatly implemented to allow users to view multiple sequence alignments and phylogenetic tree of gene families. At present, YeastWeb holds the gene families clustered from various MCL inflation values from a total of 13 available yeast genomes. Conclusions Given the great interest in yeast research, YeastWeb has the potential to become a useful resource for the scientific community of yeast biologists and related researchers investigating the evolutionary relationship of yeast gene families. YeastWeb is available at http://centre.bioinformatics.zj.cn/Yeast/.

  5. De Novo Biosynthesis of Vanillin in Fission Yeast (Schizosaccharomyces pombe) and Baker's Yeast (Saccharomyces cerevisiae) ▿

    OpenAIRE

    Hansen, Esben H.; Møller, Birger Lindberg; Kock, Gertrud R.; Bünner, Camilla M.; Kristensen, Charlotte; Jensen, Ole R.; Okkels, Finn T.; Olsen, Carl E.; Motawia, Mohammed S.; Hansen, Jørgen

    2009-01-01

    Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast...

  6. DETERMINATION OF KILLER CHARACTER OF WINE YEAST ISOLATED FROM ISTRA

    OpenAIRE

    Sandi ORLIC; POGAČIĆ, Martina; Ana JEROMEL; Marko KAROGLAN; Kozina, Bernard; IACUMIN, Lucilla; Redžepović, Sulejman

    2008-01-01

    Wild wine yeasts with killer phenotype are widespread in many wine regions of the world. The presence of killer yeasts may become particularly important in wine fermentations conducted by inoculation with selected strains of Saccharomyces cerevisiae. Wild killer yeasts may suppress selected sensitive yeasts inoculated into the must during the fermentation. The goal of this investigation was to identify killer yeast in Istra region using physiological and molecular methods. In total 50 S.cerev...

  7. Enzyme contribution of non-Saccharomyces yeasts to wine production

    OpenAIRE

    Maicas i Prieto, Sergi; Mateo Tolosa, José Juan

    2015-01-01

    The fermentation of grape must to produce wine is a biologically complex process, carried on by yeasts and malolactic bacteria. The yeasts present in spontaneous fermentation may be divided into two groups, the Saccharomyces yeasts, particularly S. cerevisiae, and the non-Saccharomyces yeasts which include members of the genera Rhodotorula, Pichia, Candida, Debaryomyces, Metschtnikowia, Hansenula and Hanseniaspora. S. cerevisiae yeasts are able to convert sugar into ethanol and CO2 via fermen...

  8. Cyanohydrin reactions enhance glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Nielsen, Astrid Gram; Tortzen, Christian;

    2015-01-01

    Synchronous metabolic oscillations can be induced in yeast by addition of glucose and removal of extracellular acetaldehyde (ACAx). Compared to other means of ACAx removal, cyanide robustly induces oscillations, indicating additional cyanide reactions besides ACA to lactonitrile conversion. Here...

  9. Structure and function of yeast alcohol dehydrogenase

    Directory of Open Access Journals (Sweden)

    VLADIMIR LESKOVAC

    2000-04-01

    Full Text Available 1. Introduction 2. Isoenzymes of YADH 3. Substrate specificity 4. Kinetic mechanism 5. Primary structure 6. The active site 7. Mutations in the yeast enzyme 8. Chemical mechanism 9. Binding of coenzymes 10. Hydride transfer

  10. Structure and function of yeast alcohol dehydrogenase

    OpenAIRE

    VLADIMIR LESKOVAC; SVETLANA TRIVIC

    2000-01-01

    1. Introduction 2. Isoenzymes of YADH 3. Substrate specificity 4. Kinetic mechanism 5. Primary structure 6. The active site 7. Mutations in the yeast enzyme 8. Chemical mechanism 9. Binding of coenzymes 10. Hydride transfer

  11. Genomic Evolution of the Ascomycete Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.

  12. Adenosine triphosphate inhibition of yeast trehalase.

    Science.gov (United States)

    Panek, A D

    1969-09-01

    Yeast trehalase has been found to be inhibited non-competitively by adenosine triphosphate. Such a biological control could explain the accumulation of trehalose during the stationary phase of the growth curve. PMID:5370287

  13. Physiological and environmental control of yeast prions

    OpenAIRE

    Chernova, Tatiana A.; Wilkinson, Keith D.; Chernoff, Yury O.

    2013-01-01

    Prions are self-perpetuating protein isoforms that cause fatal and incurable neurodegenerative disease in mammals. Recent evidence indicates that a majority of human proteins involved in amyloid and neural inclusion disorders possess at least some prion properties. In lower eukaryotes, such as yeast, prions act as epigenetic elements, which increase phenotypic diversity by altering a range of cellular processes. While some yeast prions are clearly pathogenic, it is also postulated that prion ...

  14. Production of biopharmaceutical proteins by yeast

    OpenAIRE

    Nielsen, Jens

    2012-01-01

    Production of recombinant proteins for use as pharmaceuticals, so-called biopharmaceuticals, is a multi-billion dollar industry. Many different cell factories are used for the production of biopharmaceuticals, but the yeast Saccharomyces cerevisiae is an important cell factory as it is used for production of several large volume products. Insulin and insulin analogs are by far the dominating biopharmaceuticals produced by yeast, and this will increase as the global insulin market is expected ...

  15. Determination of tritium in wine yeast samples

    International Nuclear Information System (INIS)

    Analytical procedures were developed to determine tritium in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractioning distillation for wine samples and azeotropic distillation/fractional distillation for wine yeast samples. Finally, the water samples were normally distilled with K MO4. The established procedures were successfully applied for wine and wine samples from Murfatlar harvests of the years 1995 and 1996. (authors)

  16. The wine and beer yeast Dekkera bruxellensis

    OpenAIRE

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P.; Piškur, Jure

    2014-01-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beer...

  17. OPTIMIZATION OF YEAST FOR ETHANOL PRODUCTION

    OpenAIRE

    Taghizadeh Ghassem; Delbari Azam Sadat; Kulkarni D. K.

    2012-01-01

    The production of pure ethanol apparently begins in the 12-14th century. Improvements in the distillation process with the condensation of vapors of lower boiling liquids. Ethanol is produced commercially by chemical synthesis or biosynthesis. High ethanol producing yeast exhibits rapid metabolic activity and a high fermentation rate with high product output in less time.Yeasts were isolated from Corn, Curd, Grapes, Water 1, Water 2, and Paneer. Isolation was done on MGYP (Malt Extract Glucos...

  18. Stationary phase in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Werner-Washburne, M; Braun, E.; Johnston, G C; Singer, R A

    1993-01-01

    Growth and proliferation of microorganisms such as the yeast Saccharomyces cerevisiae are controlled in part by the availability of nutrients. When proliferating yeast cells exhaust available nutrients, they enter a stationary phase characterized by cell cycle arrest and specific physiological, biochemical, and morphological changes. These changes include thickening of the cell wall, accumulation of reserve carbohydrates, and acquisition of thermotolerance. Recent characterization of mutant c...

  19. Mapping the functional yeast ABC transporter interactome

    OpenAIRE

    Snider, Jamie; Hanif, Asad; Lee, Mid Eum; Jin, Ke; Yu, Analyn R.; Graham, Chris; Chuk, Matthew; Damjanovic, Dunja; Wierzbicka, Marta; Tang, Priscilla; Balderes, Dina; Wong, Victoria; Jessulat, Matthew; Darowski, Katelyn D.; Luis, Bryan-Joseph San

    2013-01-01

    ABC transporters are a ubiquitous class of integral membrane proteins of immense clinical interest because of their strong association with human disease and pharmacology. To improve our understanding of these proteins, we used Membrane Yeast Two-Hybrid (MYTH) technology to map the protein interactome of all non-mitochondrial ABC transporters in the model organism Saccharomy cescerevisiae, and combined this data with previously reported yeast ABC transporter interactions in the BioGRID databa...

  20. Principles of chromosomal organization: lessons from yeast

    OpenAIRE

    Zimmer, Christophe; Fabre, Emmanuelle

    2011-01-01

    The spatial organization of genes and chromosomes plays an important role in the regulation of several DNA processes. However, the principles and forces underlying this nonrandom organization are mostly unknown. Despite its small dimension, and thanks to new imaging and biochemical techniques, studies of the budding yeast nucleus have led to significant insights into chromosome arrangement and dynamics. The dynamic organization of the yeast genome during interphase argues for both the physica...

  1. Multidrug resistant yeasts in synanthropic wild birds

    Directory of Open Access Journals (Sweden)

    Somanath Sushela

    2010-03-01

    Full Text Available Abstract Background The aim of this study was to investigate the presence of multidrug resistant yeasts in the faeces of synanthropic wild birds from the Bangsar suburb of Kuala Lumpur. Methods Species characterisations of yeast isolates and determinations of antimycotic susceptibility profiles were undertaken using the commercial characterization kit, Integral System Yeasts Plus (Liofilchem, Italy. Results Fourteen species of yeasts were detected in the bird faecal samples.Candida albicans was present in 28.89% of bird faecal samples, Candida krusei (13.33%, Candida tropicalis (4.44%, Candida glabrata (4.44%, Candida parapsilosis (2.22%, Candida lambica (2.22%, Candida stellatoidea (2.22%, Candida rugosa (2.22% and Candida lusitaniae (2.22%. Amongst the non-candidal yeast isolates, Cryptococcus laurentii was present in 6.67% of bird faecal samples, Cryptococcus uniguttulatus (4.44%, Saccharomyces cerevisiae (4.44%, Trichosporon pullulans (2.22%, Trichosporon pullulans/Cryptococcus albidus (8.89% and Rhodotorula rubra/Rhodotorula glutinis (4.44%. Of the isolated yeasts, 18.1% (or 26/144 were found to be resistant to all 11 antimycotic agents they were tested against i.e. Nystatin, Amphotericin B, Flucytosine, Econazole, Ketoconazole, Clotrimazole, Miconazole, Itraconazole, Voriconazole, Fluconazole 16 and Fluconazole 64. 45.8% (or 66/144 of the bird faecal yeast isolates were resistant to four or more of the 11 antimycotic agents they were tested against. Conclusions This finding is of public health significance as these synanthropic wild birds may be reservoirs for transmission of drug resistant yeast infections to humans.

  2. Uniform yeast cell assembly via microfluidics

    OpenAIRE

    Chang, Ya-Wen; He, Peng; Marquez, Samantha M.; Cheng, Zhengdong

    2012-01-01

    This paper reports the use of microfluidic approaches for the fabrication of yeastosomes (yeast-celloidosomes) based on self-assembly of yeast cells onto liquid-solid or liquid-gas interfaces. Precise control over fluidic flows in droplet- and bubble-forming microfluidic devices allows production of monodispersed, size-selected templates. The general strategy to organize and assemble living cells is to tune electrostatic attractions between the template (gel or gas core) and the cells via sur...

  3. Revaluation of Waste Yeast from Beer Production

    Directory of Open Access Journals (Sweden)

    Nicoleta Suruceanu

    2013-11-01

    Full Text Available Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, identification and quantification of xanthohumol by HPLC method. Waste yeast from brewery pilot plant of USAMV Cluj Napoca it was dried by atomization and the powder was analyzed on xanthohumol content by HPLC method. For quantification a calibration curve it was used. The process of drying by atomisation lead to a powder product. It was used malt dextrin powder for stabilisation. The final product it was encapsulated. The xanthohumol content of powdered yeast it was 1.94 µg/ml. In conclusion the slurry yeast from beer production it is an important source of prenylflavonoids compounds.

  4. Flor Yeast: New Perspectives Beyond Wine Aging.

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C; Mannazzu, Ilaria; Coi, Anna L; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air-liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  5. Flor Yeast: New Perspectives Beyond Wine Aging

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  6. Modeling diauxic glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Sørensen, Preben Graae

    2010-01-01

    Glycolytic oscillations in a stirred suspension of starved yeast cells is an excellent model system for studying the dynamics of metabolic switching in living systems. In an open-flow system the oscillations can be maintained indefinitely at a constant operating point where they can be characteri......Glycolytic oscillations in a stirred suspension of starved yeast cells is an excellent model system for studying the dynamics of metabolic switching in living systems. In an open-flow system the oscillations can be maintained indefinitely at a constant operating point where they can...... for investigations of central metabolism dynamics of yeast cells. We have previously proposed a model for the open system comprised of the primary fermentative reactions in yeast that quantitatively describes the oscillatory dynamics. However, this model fails to describe the transient behavior of metabolic...... switching in a closed-system experiment by feeding the yeast suspension with a glucose pulse-notably the initial NADH spike and final NADH rise. Another object of this study is to gain insight into the secondary low-flux metabolic pathways by feeding starved yeast cells with various metabolites...

  7. The yeasts and yeast-like microorganisms in the denitrification unit biocenosis

    Directory of Open Access Journals (Sweden)

    Alena Sláviková

    2014-08-01

    Full Text Available Taxonomic studies of the yeasts and yeast-like microorganisms in the denitrification unit biocenosis were carried out. A set of 13 strains of these microorganisms were examined for their morphological and physiological characters. Considering their special features and some relation to the known species, the isolated microorganisms were classified to the 3 genera: Candida, Geotrichium and Hansenula.

  8. Taxonomical study of yeasts and yeast-like microorganisms isolated from the denitrification unit biocenosis

    Directory of Open Access Journals (Sweden)

    Elena Sláviková

    2014-08-01

    Full Text Available A set of 8 strains of yeasts and yeast-like microorganisms was isolated from the denitrification unit biocenosis fed with a synthetic medium containing methanol as a carbon source. These strains were identified as Candida boidinii, C. maltosa, Rhodotorula rubra and Trichosporon cutaneum.

  9. Taxonomical study of yeasts and yeast-like microorganisms isolated from the denitrification unit biocenosis

    OpenAIRE

    Elena Sláviková; Anna Grabińska-Łoniewska

    2014-01-01

    A set of 8 strains of yeasts and yeast-like microorganisms was isolated from the denitrification unit biocenosis fed with a synthetic medium containing methanol as a carbon source. These strains were identified as Candida boidinii, C. maltosa, Rhodotorula rubra and Trichosporon cutaneum.

  10. Yeast Interacting Proteins Database: YFR015C, YFR015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...ression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary ...tion, nitrogen starvation, environmental stress, and entry into stationary phase Rows with this bait as bait..., the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental

  11. Terroir of yeasts? – Application of FTIR spectroscopy and molecular methods for strain typing of yeasts

    Directory of Open Access Journals (Sweden)

    Gerhards Daniel

    2015-01-01

    Full Text Available The site specific influence on wine (Terroir is an often by wine producers, consumers and scientists discussed topic in the world of wine. A study on grapes and (spontaneous fermentations from six different vineyards was done to investigate the biodiversity of yeasts and to answer the question if there is a terroir of yeast and how it could be influenced. Randomly isolated yeasts were identified by FTIR-spectroscopy and molecular methods on species and strain level. Vineyard specific yeast floras would be observed but they are not such important as expected. Only a few overlapping strain patterns would be identified during both vintages. The yeast flora of the winery had a huge impact on the spontaneous fermentations, but is not really constant and influenced by different factors from outside.

  12. Yeast fuel cell: Application for desalination

    Science.gov (United States)

    Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

    2016-02-01

    Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

  13. Yeast flocculation: what brewers should know.

    Science.gov (United States)

    Verstrepen, K J; Derdelinckx, G; Verachtert, H; Delvaux, F R

    2003-05-01

    For many industrial applications in which the yeast Saccharomyces cerevisiae is used, e.g. beer, wine and alcohol production, appropriate flocculation behaviour is certainly one of the most important characteristics of a good production strain. Yeast flocculation is a very complex process that depends on the expression of specific flocculation genes such as FLO1, FLO5, FLO8 and FLO11. The transcriptional activity of the flocculation genes is influenced by the nutritional status of the yeast cells as well as other stress factors. Flocculation is also controlled by factors that affect cell wall composition or morphology. This implies that, during industrial fermentation processes, flocculation is affected by numerous parameters such as nutrient conditions, dissolved oxygen, pH, fermentation temperature, and yeast handling and storage conditions. Theoretically, rational use of these parameters offers the possibility of gaining control over the flocculation process. However, flocculation is a very strain-specific phenomenon, making it difficult to predict specific responses. In addition, certain genes involved in flocculation are extremely variable, causing frequent changes in the flocculation profile of some strains. Therefore, both a profound knowledge of flocculation theory as well as close monitoring and characterisation of the production strain are essential in order to gain maximal control over flocculation. In this review, the various parameters that influence flocculation in real-scale brewing are critically discussed. However, many of the conclusions will also be useful in various other industrial processes where control over yeast flocculation is desirable.

  14. Production of alpha-amylase by yeast

    Energy Technology Data Exchange (ETDEWEB)

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  15. Anaerobic digestion of food waste using yeast.

    Science.gov (United States)

    Suwannarat, Jutarat; Ritchie, Raymond J

    2015-08-01

    Fermentative breakdown of food waste seems a plausible alternative to feeding food waste to pigs, incineration or garbage disposal in tourist areas. We determined the optimal conditions for the fermentative breakdown of food waste using yeast (Saccharomyces cerevisiae) in incubations up to 30days. Yeast efficiently broke down food waste with food waste loadings as high as 700g FW/l. The optimum inoculation was ≈46×10(6)cells/l of culture with a 40°C optimum (25-40°C). COD and BOD were reduced by ≈30-50%. Yeast used practically all the available sugars and reduced proteins and lipids by ≈50%. Yeast was able to metabolize lipids much better than expected. Starch was mobilized after very long term incubations (>20days). Yeast was effective in breaking down the organic components of food waste but CO2 gas and ethanol production (≈1.5%) were only significant during the first 7days of incubations.

  16. Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.

    Science.gov (United States)

    Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena

    2012-12-01

    Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.

  17. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell.

    Science.gov (United States)

    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan

    2015-01-01

    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells.

  18. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell

    Directory of Open Access Journals (Sweden)

    Yumei Luo

    2015-01-01

    Full Text Available The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C; knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells.

  19. Yeast interactions in inoculated wine fermentation

    Directory of Open Access Journals (Sweden)

    Maurizio eCiani

    2016-04-01

    Full Text Available The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the different yeasts composing the starter culture can led the stability of the final product and the analytical and aromatic profile. In the present review, we will discuss the recent developments regarding yeast interactions in pure and in mixed fermentation, focusing on the influence of interactions on growth and dominance in the process.

  20. Metallic Biosorption Using Yeasts in Continuous Systems

    Directory of Open Access Journals (Sweden)

    Karla Miriam Hernández Mata

    2013-01-01

    Full Text Available Mining effluents were found to be the main source of pollution by heavy metals of the surface water in the San Pedro River in Sonora, Mexico. The overall objective of this study was to determine the biosorption of Zn, Cu, Mn, and Fe with yeasts isolated from San Pedro River in a continuous system. The tests conducted in two reactors packed with zeolite connected in series. The first reactor was inoculated mixing two yeasts species, and the effluent of the first reactor was fed to second reactor. Subsequently, the first reactor was fed with contaminated water of San Pedro River and effluent from this was the second reactor influent. After 40 days of the experiment a reduction of 81.5% zinc, 76.5% copper, manganese 95.5%, and 99.8% of iron was obtained. These results show that the selected yeasts are capable of biosorbing zinc, copper, manganese, and iron under these conditions.

  1. Degradation of 5-hydroxymethylfurfural during yeast fermentation.

    Science.gov (United States)

    Akıllıoglu, Halise Gül; Mogol, Burçe Ataç; Gökmen, Vural

    2011-12-01

    5-Hydroxymethyl furfural (HMF) may occur in malt in high quantities depending on roasting conditions. However, the HMF content of different types of beers is relatively low, indicating its potential for degradation during fermentation. This study investigates the degradation kinetics of HMF in wort during fermentation by Saccharomyces cerevisiae. The results indicated that HMF decreased exponentially as fermentation progressed. The first-order degradation rate of HMF was 0.693 × 10(-2) and 1.397 × 10(-2)min(-1) for wort and sweet wort, respectively, indicating that sugar enhances the activity of yeasts. In wort, HMF was converted into hydroxymethyl furfuryl alcohol by yeasts with a high yield (79-84% conversion). Glucose and fructose were utilised more rapidly by the yeasts in dark roasted malt than in pale malt (pyeast cells, and presence of sugars in the fermentation medium increases this activity. PMID:22010851

  2. Yeast Interactions in Inoculated Wine Fermentation

    Science.gov (United States)

    Ciani, Maurizio; Capece, Angela; Comitini, Francesca; Canonico, Laura; Siesto, Gabriella; Romano, Patrizia

    2016-01-01

    The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the different yeasts composing the starter culture can led the stability of the final product and the analytical and aromatic profile. In the present review, we will discuss the recent developments regarding yeast interactions in pure and in mixed fermentation, focusing on the influence of interactions on growth and dominance in the process. PMID:27148235

  3. Multiple Functions of Sterols in Yeast Endocytosis

    OpenAIRE

    Heese-Peck, Antje; Pichler, Harald; Zanolari, Bettina; Watanabe, Reika; Daum, Günther; Riezman, Howard

    2002-01-01

    Sterols are essential factors for endocytosis in animals and yeast. To investigate the sterol structural requirements for yeast endocytosis, we created a variety of ergΔ mutants, each accumulating a distinct set of sterols different from ergosterol. Mutant erg2Δerg6Δ and erg3Δerg6Δ cells exhibit a strong internalization defect of the α-factor receptor (Ste2p). Specific sterol structures are necessary for pheromone-dependent receptor hyperphosphorylation, a prerequisite for internalization. Th...

  4. Structural Studies of the Yeast Mitochondrial Degradosome

    DEFF Research Database (Denmark)

    Feddersen, Ane; Jonstrup, Anette Thyssen; Brodersen, Ditlev Egeskov

    and nuclear exosome complexes, which consist of 10-12 different nuclease subunits, the mitochondrial degradosome is composed of only two large subunits - an RNase (Dss1p) and a helicase (Suv3p), belonging the Ski2 class of DExH box RNA helicases. Both subunits are encoded on the yeast nuclear genome...... and and Suv3p from the fission yeast, Schizosaccharomyces pombe, have been cloned for heterologous expression in E. coli. Of the two, we have succeeded in purifying the 73kDa Suv3p by Ni2+-affinity chromatography followed by cleavage of the N-terminal His-tag, cation exchange, and gel filtration. Crystals...

  5. Assessing the potential of wild yeasts for bioethanol production

    OpenAIRE

    RUYTERS, Stefan; Mukherjee, Vaskar; Verstrepen, Kevin; Thevelein, Johan; Willems, Kris; Lievens, Bart

    2015-01-01

    Bioethanol fermentations expose yeasts to a new, complex and challenging fermentation medium with specific inhibitors and sugar mixtures depending on the type of carbon source. It is, therefore, suggested that the natural diversity of yeasts should be further exploited in order to find yeasts with good ethanol yield in stressed fermentation media. In this study, we screened more than 50 yeast isolates of which we selected five isolates with promising features. The species Candida bombi, Wicke...

  6. Newly identified prions in budding yeast, and their possible functions

    OpenAIRE

    Crow, Emily T.; Li, Liming

    2011-01-01

    Yeast prions are atypical genetic elements that are transmitted as heritable protein conformations. [PSI+], [URE3], and [PIN+] are three well-studied prions in the budding yeast, Saccharomyces cerevisiae. In the last three years, several additional prions have been reported in yeast, including [SWI+], [OCT+], [MCA], [GAR+], [MOT3+], [ISP+], and [NSI+]. The growing number of yeast prions suggests that protein-based inheritance might be a widespread biological phenomenon. In this review, we sum...

  7. A new methodology to obtain wine yeast strains overproducing mannoproteins

    OpenAIRE

    Quirós Asensio, Manuel; González Ramos, Daniel; Tabera Moreno, Laura; González García, Ramón

    2010-01-01

    Yeast mannoproteins are highly glycosylated proteins that are covalently bound to the β-1,3-glucan present in the yeast cell wall. Among their outstanding enological properties, yeast mannoproteins contribute to several aspects of wine quality by protecting against protein haze, reducing astringency, retaining aroma compounds and stimulating growth of lactic-acid bacteria. The development of a non-recombinant method to obtain enological yeast strains overproducing mannoproteins would therefor...

  8. 21 CFR 573.750 - Pichia pastoris dried yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Pichia pastoris dried yeast. 573.750 Section 573... Food Additive Listing § 573.750 Pichia pastoris dried yeast. (a) Identity. The food additive Pichia pastoris dried yeast may be used in feed formulations of broiler chickens as a source of protein not...

  9. Adhesive interactions between medically important yeasts and bacteria

    NARCIS (Netherlands)

    Millsap, KW; van der Mei, HC; Busscher, HJ; Bos, R.R.M.

    1998-01-01

    Yeasts are being increasingly identified as important organisms in human infections. Adhesive interactions between yeasts and bacteria may contribute to yeast retention al body sites. Methods for studying adhesive interactions between bacterial strains are well known, and range from simple macroscop

  10. Local distribution of ectomycorrhizae-associated basidiomycetes in forest soil correlates with the degree of soil organic matter humification and available electrolytes.

    Science.gov (United States)

    Gryndler, M; Soukupová, L; Gryndlerová, H; Baldrian, P; Hršelová, H

    2010-09-01

    Spatial distribution of ectomycorrhizae-associated basidiomycetes was determined in oakbirch forest using terminal restriction fragment length polymorphism (T-RFLP) analysis. The data were correlated with actual soil humidity, pH, electric conductivity of the soil extract, absorbance A(465) and A(665) of water and alkali soil extracts and with the ratio A(465)/A(665) (parameter A4/A6). Natural non-homogeneity of the soil parameters was used as experimental gradient. Distance-based redundancy analysis of the T-RFLP data (with soil parameters being taken as environmental parameters) provided significant results when ITS1F-terminanted restriction fragments were analyzed. Among other fungi, a Mycena galericulata related fungus was observed to correlate negatively with A4/A6, indicating its association with highly humified soil organic matter. Positive association of other, unidentified fungi with A4/A6 was also observed. Several other unidentified fungi negatively correlated with electric conductivity of the soil extract. The results may explain nonhomogeneity of the spatial distribution of the fungi associated with ectomycorrhizae as a result of their interaction with non-homogeneous soil environment. PMID:20941580

  11. The alpha-tubulin gene AmTuba1: a marker for rapid mycelial growth in the ectomycorrhizal basidiomycete Amanita muscaria.

    Science.gov (United States)

    Tarkka, Mika T; Schrey, Silvia; Nehls, Uwe

    2006-05-01

    The apical extension of hyphae is of central importance for extensive spread of fungal mycelium in forest soils and for effective ectomycorrhiza development. Since the tubulin cytoskeleton is known to be important for fungal tip growth, we have investigated the expression of an alpha-tubulin gene from the ectomycorrhizal basidiomycete Amanita muscaria (AmTuba1). The phylogenetic analysis of protein sequences revealed the existence of two subgroups of alpha-tubulins in homobasidiomycetes, clearly distinguishable by defined amino acids. AmTuba1 belongs to subgroup1. The AmTuba1 transcript level is related to mycelial growth rate. Growth induction of carbohydrate starved (non-growing) hyphae resulted in an enhanced AmTuba1 expression as soon as hyphal growth started, reaching a maximum at highest mycelial growth rate. Bacterium-induced hyphal elongation also leads to increased AmTuba1 transcript levels. In mature A. muscaria/P. abies ectomycorrhizas, where fungal hyphae are highly branched, and slowly growing, AmTuba1 expression were even lower than in carbohydrate-starved mycelium, indicating a further down-regulation of gene expression in symbiosis. In conclusion, our analyses show that the AmTuba1 gene can be used as a marker for active apical extension in fly agaric, and that alpha-tubulin proteins are promising tools for the classification of fungi. PMID:16447071

  12. Molecular analysis of ectomycorrhizal basidiomycete communities in a Pinus sylvestris L. stand reveals long-term increased diversity after removal of litter and humus layers.

    Science.gov (United States)

    Smit, Eric; Veenman, Christiaan; Baar, Jacqueline

    2003-07-01

    Abstract The number of fruiting bodies of ectomycorrhizal species in pine forests in The Netherlands has decreased dramatically in recent decades. This decrease has been attributed to an increase in nitrogen deposition and the accumulation of litter and humus. The effects of sod cutting and the removal of litter and humus, to restore ectomycorrhizal diversity in a Scots pine forest in Dwingeloo, The Netherlands, were investigated previously from 1990 to 1993. Removal of the litter and humus resulted in a significant increase in the numbers of species and fruiting bodies of ectomycorrhizal fungi. However, until now all data were obtained by counting fruiting bodies and the effects on mycelial development below ground were not assessed. To investigate hyphal development, DNA was extracted from bulk soil and polymerase chain reaction products were obtained by amplification using basidiomycete-specific internal transcribed spacer (ITS) primers. The differences in diversity between the control plots and the treated plots were analyzed using denaturing gradient gel electrophoresis. To assess the species composition and differences, ITS regions of the amplified fragments were cloned and sequenced. Sequences were compared with sequences from GenBank and from fruiting bodies collected from the same plots. Data indicated increased below-ground ectomycorrhizal diversity in the plots that had been subjected to removal of the litter and humus layers. PMID:19719606

  13. Effects of Ganoderma lucidum (Higher Basidiomycetes) Extracts on the miRNA Profile and Telomerase Activity of the MCF-7 Breast Cancer Cell Line.

    Science.gov (United States)

    Gonul, Oyku; Aydin, Hikmet Hakan; Kalmis, Erbil; Kayalar, Husniye; Ozkaya, Ali Burak; Atay, Sevcan; Ak, Handan

    2015-01-01

    Ganoderma lucidum is a medicinal higher Basidiomycetes mushroom that exerts anticancer effects through several different mechanisms. This study investigated the effects of G. lucidum on the telomerase activity and microRNA (miRNA) profiles of MCF-7 cells. According to the cytotoxicity results, the G. lucidum ether extract exhibits the highest cytotoxic potency; therefore it was chosen for the subsequent telomerase activity assay and miRNA profiling. The telomerase activity observed in the cells treated with a half-maximal inhibitory concentration of G. lucidum ether extract (100 µg/mL in dimethyl sulfoxide) was 32.2% lower than that of the control cells treated with 1% dimethyl sulfoxide. Among 1066 miRNAs, the most downregulated miRNA was hsa-miR-27a* (4.469-fold), and the most upregulated miRNA was hsa-miR-1285 (10.462-fold). A database search revealed the predicted miRNAs that target the catalytic subunit of the telomerase enzyme telomerase reverse transcriptase, and only miR-3687 (upregulated 2.153-fold) and miR-1207-5p (upregulated 2.895-fold) were changed by at least 2-fold. The miRNA profile changes demonstrated in this study provide a data set regarding their effects on the pathways that regulate telomerase activity in MCF-7 breast cancer cells treated with G. lucidum. These data should aid the development of novel cancer treatment strategies.

  14. Yeast Interacting Proteins Database: YFR015C, YJL137C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...pression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary

  15. Yeast Interacting Proteins Database: YFR015C, YLR258W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into statio

  16. Yeast Interacting Proteins Database: YDR357C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available izes to the endosome; identified as a transcriptional activator in a high-throughput...ome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with this pr

  17. UBA domain containing proteins in fission yeast

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Semple, Colin A M; Ponting, Chris P;

    2003-01-01

    characterised on both the functional and structural levels. One example of a widespread ubiquitin binding module is the ubiquitin associated (UBA) domain. Here, we discuss the approximately 15 UBA domain containing proteins encoded in the relatively small genome of the fission yeast Schizosaccharomyces pombe...

  18. Catalytic site interactions in yeast OMP synthase

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Barr, Eric W.; Jensen, Kaj Frank;

    2014-01-01

    45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal...

  19. Functional differences in yeast protein disulfide isomerases

    DEFF Research Database (Denmark)

    Nørgaard, P; Westphal, V; Tachibana, C;

    2001-01-01

    PDI1 is the essential gene encoding protein disulfide isomerase in yeast. The Saccharomyces cerevisiae genome, however, contains four other nonessential genes with homology to PDI1: MPD1, MPD2, EUG1, and EPS1. We have investigated the effects of simultaneous deletions of these genes. In several...

  20. Yeast improves resistance to environmental challenges

    Science.gov (United States)

    Alphamune™, a yeast extract antibiotic alternative, was added at either 1 lb/ton or 2 lb/ton to a turkey starter diet. Two trials were conducted to evaluate the effects of Alphamune™ on gut maturation of 7 and 21 day old poults. Sections from the mid-point of the duodenum, jejunum and ileum of each ...

  1. Ethanol tolerance of immobilized brewers' yeast cells.

    Science.gov (United States)

    Norton, S; Watson, K; D'Amore, T

    1995-04-01

    A method based on the survival of yeast cells subjected to an ethanol or heat shock was utilized to compare the stress resistance of free and carrageenan-immobilized yeast cells. Results demonstrated a significant increase of yeast survival against ethanol for immobilized cells as compared to free cells, while no marked difference in heat resistance was observed. When entrapped cells were released by mechanical disruption of the gel beads and submitted to the same ethanol stress, they exhibited a lower survival rate than entrapped cells, but a similar or slightly higher survival rate than free cells. The incidence of ethanol- or heat-induced respiratory-deficient mutants of entrapped cells was equivalent to that of control or non-stressed cells (1.3 +/- 0.5%) whereas ethanol- and heat-shocked free and released cells exhibited between 4.4% and 10.9% average incidence of respiration-deficient mutants. It was concluded that the carrageenan gel matrix provided a protection against ethanol, and that entrapped cells returned to normal physiological behaviour as soon as they were released. The cell growth rate was a significant factor in the resistance of yeast to high ethanol concentrations. The optimum conditions to obtain reliable and reproducible results involved the use of slow-growing cells after exhaustion of the sugar substrate.

  2. DNA sequence of the yeast transketolase gene.

    Science.gov (United States)

    Fletcher, T S; Kwee, I L; Nakada, T; Largman, C; Martin, B M

    1992-02-18

    Transketolase (EC 2.2.1.1) is the enzyme that, together with aldolase, forms a reversible link between the glycolytic and pentose phosphate pathways. We have cloned and sequenced the transketolase gene from yeast (Saccharomyces cerevisiae). This is the first transketolase gene of the pentose phosphate shunt to be sequenced from any source. The molecular mass of the proposed translated protein is 73,976 daltons, in good agreement with the observed molecular mass of about 75,000 daltons. The 5'-nontranslated region of the gene is similar to other yeast genes. There is no evidence of 5'-splice junctions or branch points in the sequence. The 3'-nontranslated region contains the polyadenylation signal (AATAAA), 80 base pairs downstream from the termination codon. A high degree of homology is found between yeast transketolase and dihydroxyacetone synthase (formaldehyde transketolase) from the yeast Hansenula polymorpha. The overall sequence identity between these two proteins is 37%, with four regions of much greater similarity. The regions from amino acid residues 98-131, 157-182, 410-433, and 474-489 have sequence identities of 74%, 66%, 83%, and 82%, respectively. One of these regions (157-182) includes a possible thiamin pyrophosphate (TPP) binding domain, and another (410-433) may contain the catalytic domain. PMID:1737042

  3. Phosphorylation site on yeast pyruvate dehydrogenase complex

    International Nuclear Information System (INIS)

    The pyruvate dehydrogenase complex was purified to homogeneity from baker's yeast (Saccharomyces cerevisiae). Yeast cells were disrupted in a Manton-Gaulin laboratory homogenizer. The pyruvate dehydrogenase complex was purified by fractionation with polyethylene glycol, isoelectric precipitation, ultracentrifugation and chromatography on hydroxylapatite. Final purification of the yeast pyruvate dehydrogenase complex was achieved by cation-exchange high pressure liquid chromatography (HPLC). No endogenous pyruvate dehydrogenase kinase activity was detected during the purification. However, the yeast pyruvate dehydrogenase complex was phosphorylated and inactivated with purified pyruvate dehydrogenase kinase from bovine kidney. Tryptic digestion of the 32P-labeled complex yielded a single phosphopeptide which was purified to homogeniety. The tryptic digest was subjected to chromatography on a C-18 reverse phase HPLC column with a linear gradient of acetonitrile. Radioactive fractions were pooled, concentrated, and subjected to anion-exchange HPLC. The column was developed with a linear gradient of ammonium acetate. Final purification of the phosphopeptide was achieved by chromatography on a C-18 reverse phase HPLC column developed with a linear gradient of acetonitrile. The amino acid sequence of the homogeneous peptide was determined by manual modified Edman degradation

  4. Radiation-sensitive mutants of yeast

    International Nuclear Information System (INIS)

    Nomenclature for various radiosensitive mutants of Saccharomyces cerevisiae is briefly discussed. Tables are presented to show results of allelism tests of most of the radiosensitive mutants isolated by various investigators together with a standardized rad locus designation and map positions of a number of rad loci in yeast

  5. Engineering yeast tolerance to inhibitory lignocellulosic biomass

    OpenAIRE

    Cunha, Joana Filipa Torres Pinheiro; Aguiar, Tatiana Quinta; D. Mendes; Pereira, Francisco B.; Domingues, Lucília

    2013-01-01

    In recent years the necessity for biotechnological manufacturing based on lignocellulosic feedstocks has become evident. However, the pre-treatment step in the production of lignocellulosic bioethanol leads to the accumulation of inhibitory byproducts. Robust second generation bioethanol processes require microorganisms able to ferment these inhibitory lignocellulosic hydrolysates. Significant progress has been made in the understanding of the determinants of yeast tolerance to lignocellulose...

  6. Gene Deletion by Synthesis in Yeast.

    Science.gov (United States)

    Kim, Jinsil; Kim, Dong-Uk; Hoe, Kwang-Lae

    2017-01-01

    Targeted gene deletion is a useful tool for understanding the function of a gene and its protein product. We have developed an efficient and robust gene deletion approach in yeast that employs oligonucleotide-based gene synthesis. This approach requires a deletion cassette composed of three modules: a central 1397-bp KanMX4 selection marker module and two 366-bp gene-specific flanking modules. The invariable KanMX4 module can be used in combination with different pairs of flanking modules targeting different genes. The two flanking modules consist of both sequences unique to each cassette (chromosomal homologous regions and barcodes) and those common to all deletion constructs (artificial linkers and restriction enzyme sites). Oligonucleotides for each module and junction regions are designed using the BatchBlock2Oligo program and are synthesized on a 96-well basis. The oligonucleotides are ligated into a single deletion cassette by ligase chain reaction, which is then amplified through two rounds of nested PCR to obtain sufficient quantities for yeast transformation. After removal of the artificial linkers, the deletion cassettes are transformed into wild-type diploid fission yeast SP286 cells. Verification of correct clone and gene deletion is achieved by performing check PCR and tetrad analysis. This method with proven effectiveness, as evidenced by a high success rate of gene deletion, can be potentially applicable to create systematic gene deletion libraries in a variety of yeast species. PMID:27671940

  7. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces cerevi...

  8. Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast.

    OpenAIRE

    Hermanson, G G; Hoekstra, M F; McElligott, D. L.; Evans, G A

    1991-01-01

    Yeast artificial chromosomes (YACs) provide a powerful tool for the isolation and mapping of large regions of mammalian chromosomes. We developed a rapid and efficient method for the isolation of DNA fragments representing the extreme ends of YAC clones by the insertion of a rescue plasmid into the YAC vector by homologous recombination. Two rescue vectors were constructed containing a yeast LYS2 selectable gene, a bacterial origin of replication, an antibiotic resistance gene, a polylinker c...

  9. Effect of yeast storage temperature and flour composition on fermentative activities of baker's yeast

    Directory of Open Access Journals (Sweden)

    Pejin Dušanka J.

    2009-01-01

    Full Text Available Baker's yeast is a set of living cells of Saccharomyces cerevisiae. It contains around 70-72% of water, 42-45% of proteins, around 40% of carbohydrates, around 7.5% of lipids (based on dry matter, and vitamin B-complex. On the basis of yeast cell analysis it can be concluded that yeast is a complex biological system which changes in time. The intensity of the changes depends on temperature. Yeast sample was stored at 4°C i 24°C for 12 days. During storage at 4°C, the content of total carbohydrates decreased from 48.81% to 37.50% (dry matter, whereas carbohydrate loss ranged from 40.81% to 29.28% at 24°C. The content of trehalose was 12.33% in the yeast sample stored at 4°C and 0.24% at 24°C. Loss of fermentative activity was 81.76% in the sample stored at 24°C for 12 days. The composition of five samples of 1st category flour was investigated. It was found that flours containing more reducing sugars and maltose enable higher fermentation activities. The flours with higher ash content (in the range 0.5-0.94% had higher contents of phytic acid. Higher ash and phytic contents in flour increased the yeast fermentative efficiency. In bakery industry, a range of ingredients has been applied to improve the product's quality such as surface active substances (emulsifiers, enzymes, sugars and fats. In the paper, the effect of some ingredients added to dough (margarine, saccharose, sodium chloride and malted barley on the yeast fermentative activity was studied. The mentioned ingredients were added to dough at different doses: 0.5, 1.0, 1.5 and 2.0%, flour basis. It was found that the investigated ingredients affected the fermentative activity of yeast and improved the bread quality.

  10. Occurrence of Killer Yeast Strains in Fruit and Berry Wine Yeast Populations

    OpenAIRE

    Gulbiniene, Gintare; Kondratiene, Laima; Jokantaite, Tautvile; Serviene, Elena; Melvydas, Vytautas; Petkuniene, Giedre

    2004-01-01

    Apple, cranberry, chokeberry and Lithuanian red grape wine yeast populations were used for the determination of killer yeast occurrence. According to the tests of the killer characteristics and immunity the isolated strains were divided into seven groups. In this work the activity of killer toxins purified from some typical strains was evaluated. The analysed strains produced different amounts of active killer toxin and some of them possessed new industrially significant killer properties. To...

  11. Seed yeast cultivation for salad oil manufacturing wastewater treatment

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The mixture of five yeast strains obtained from soil could remove about 85% TOC of oil-rich wastewater in batch test.While the highest MLSS was obtained at an N:C of 1:5, the oil removal decreased with the increase of N:C during yeast sludge cultivation. Ammonium chloride was the best nitrogen source for yeast cultivation from the viewpoint of yeast growth and oil utilization. An ammonia concentration of over 1300 mg l-1 led to mass death of yeast at a pH of 5. The ammonia concentration should be controlled at a level of 1000 mg l-1 or lower.

  12. Baker's yeast: production of D- and L-3-hydroxy esters

    DEFF Research Database (Denmark)

    Dahl, Allan Carsten; Madsen, Jørgen Øgaard

    1998-01-01

    Baker's yeast grown under oxygen limited conditions and used in the reduction of 3-oxo esters results in a shift of the stereoselectivity of the yeast towards D-hydroxy esters as compared with ordinary baker's yeast. The highest degree of stereoselectivity was obtained with growing yeast or yeast...... harvested while growing. In contrast, the stereoselectivity was shifted towards L-hydroxy esters when the oxo esters were added slowly to ordinary baker's yeast supplied with gluconolactone as co-substrate. The reduction rate with gluconolactone was increased by active aeration. Ethyl L-(S)-3......-hydroxybutanoate was afforded in >99% ee. Both enantiomers of ethyl 3-hydroxypentanoate, D-(R) in 96% ee and L-(S) in 93% ee, and of ethyl 4-chloro-3-hydroxybutanoate, D-(S) in 98% ee and L-(R) in 94% ee, were obtained. The results demonstrate that the stereoselectivity of baker's yeast can be controlled...

  13. Application of hybrid yeasts for molasses fermentation during the production of alcohol and bakers' yeast

    Energy Technology Data Exchange (ETDEWEB)

    Raev, Z.A.; Kovalenko, A.D.; Korobkova, L.A.; Sadovnikova, T.A.; Bespalaya, M.K.

    1973-01-01

    Various hybrids of brewers yeasts were studied and their technological properties established. It was shown that hybrid 75 was suitable for increasing alcohol yields from molasses. Hybrid 112 was suitable for increasing the maltase activity of bakers' yeast. Efficient exploitation of the above properties of yeast hybrids may be achieved in a 2 stage molasses fermentation process developed at the Ukrainian Res. Inst. of Distillery Ind. The method is based on 2-stage yeast addition: strain B yeasts in the 1st stage and an appropriate hybrid in the second.

  14. Alternative branch points are selected during splicing of a yeast pre-mRNA in mammalian and yeast extracts.

    OpenAIRE

    Ruskin, B; Pikielny, C W; Rosbash, M; Green, M R

    1986-01-01

    Pre-mRNA splicing in yeast and higher eukaryotes proceeds by similar pathways, in which a probable splicing intermediate and the excised intron are in a lariat configuration. To compare the pre-mRNA splicing mechanisms in yeast and higher eukaryotes, we have analyzed the RNA products resulting from in vitro processing of a yeast intron-containing pre-mRNA in HeLa cell and yeast extracts. In yeast, the RNA branch (2'-5' phosphodiester bond) of the RNA lariat forms at the third adenosine of the...

  15. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  16. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  17. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  18. Laboratory evolution of copper tolerant yeast strains

    Directory of Open Access Journals (Sweden)

    Adamo Giusy

    2012-01-01

    Full Text Available Abstract Background Yeast strains endowed with robustness towards copper and/or enriched in intracellular Cu might find application in biotechnology processes, among others in the production of functional foods. Moreover, they can contribute to the study of human diseases related to impairments of copper metabolism. In this study, we investigated the molecular and physiological factors that confer copper tolerance to strains of baker's yeasts. Results We characterized the effects elicited in natural strains of Candida humilis and Saccharomyces cerevisiae by the exposure to copper in the culture broth. We observed that, whereas the growth of Saccharomyces cells was inhibited already at low Cu concentration, C. humilis was naturally robust and tolerated up to 1 g · L-1 CuSO4 in the medium. This resistant strain accumulated over 7 mg of Cu per gram of biomass and escaped severe oxidative stress thanks to high constitutive levels of superoxide dismutase and catalase. Both yeasts were then "evolved" to obtain hyper-resistant cells able to proliferate in high copper medium. While in S. cerevisiae the evolution of robustness towards Cu was paralleled by the increase of antioxidative enzymes, these same activities decreased in evolved hyper-resistant Candida cells. We also characterized in some detail changes in the profile of copper binding proteins, that appeared to be modified by evolution but, again, in a different way in the two yeasts. Conclusions Following evolution, both Candida and Saccharomyces cells were able to proliferate up to 2.5 g · L-1 CuSO4 and to accumulate high amounts of intracellular copper. The comparison of yeasts differing in their robustness, allowed highlighting physiological and molecular determinants of natural and acquired copper tolerance. We observed that different mechanisms contribute to confer metal tolerance: the control of copper uptake, changes in the levels of enzymes involved in oxidative stress response and

  19. Screening of basidiomycetes for the production of exopolysaccharide and biomass in submerged culture Triagem de basidiomicetos para a produção de exopolissacarídeos e biomassa em cultura líquida

    OpenAIRE

    Rosana Maziero; Valeria Cavazzoni; Vera Lúcia Ramos Bononi

    1999-01-01

    Fifty-six strains of Basidiomycetes, including native Brazilian fungi isolated from different ecosystems and edible mushrooms, were screened for production of exopolysaccharides and biomass in submerged culture. Agaricus sp. (CCB 280) and Oudemansiella canarii (Jungh.) Hohn (CCB 179) were the highest exopolysaccharide producers (6.01 and 3.54 g dry w./l respectively) after 7 days of incubation. The best producer of biomass was Schizophyllum commune Fr.:Fr. (CCB 473) with 16.68 g dry w./l in 1...

  20. Synchronization of the Budding Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Foltman, Magdalena; Molist, Iago; Sanchez-Diaz, Alberto

    2016-01-01

    A number of model organisms have provided the basis for our understanding of the eukaryotic cell cycle. These model organisms are generally much easier to manipulate than mammalian cells and as such provide amenable tools for extensive genetic and biochemical analysis. One of the most common model organisms used to study the cell cycle is the budding yeast Saccharomyces cerevisiae. This model provides the ability to synchronise cells efficiently at different stages of the cell cycle, which in turn opens up the possibility for extensive and detailed study of mechanisms regulating the eukaryotic cell cycle. Here, we describe methods in which budding yeast cells are arrested at a particular phase of the cell cycle and then released from the block, permitting the study of molecular mechanisms that drive the progression through the cell cycle.

  1. Genetics and breeding of brewers yeast

    Energy Technology Data Exchange (ETDEWEB)

    Nilsson-Tillgren, T.; Gjermansen, C.; Petersen, J.G.L.; Holmberg, S.; Kielland-Brandt, M.C.

    1984-01-01

    Yeasts, used for beer production, can be divided into two groups, top fermenters and bottom fermenters and Saccharomyces carlsbergensis has been chosen as the name for the bottom fermenting yeasts which are used in lager beer production. The key for the analysis of the chromosomes of Saccharomyces carlsbergensis was provided by the discovery that single chromosomes of meiotic segregants of these strains can be transferred to genetically marked Saccharomyces cerevisiae strains and subsequently analyzed by tetrad analysis and molecular hybridization. It is proposed that Saccharomyces carlsbergensis is composed of two rather divergent genotypes. Breeding can be accomplished by cross breeding and mutagenesis and possibly by introducing in vitro modified cloned genes into meiotic segregants of Saccharomyces carlsbergensis.

  2. Microcompartments within the yeast plasma membrane.

    Science.gov (United States)

    Merzendorfer, Hans; Heinisch, Jürgen J

    2013-02-01

    Recent research in cell biology makes it increasingly clear that the classical concept of compartmentation of eukaryotic cells into different organelles performing distinct functions has to be extended by microcompartmentation, i.e., the dynamic interaction of proteins, sugars, and lipids at a suborganellar level, which contributes significantly to a proper physiology. As different membrane compartments (MCs) have been described in the yeast plasma membrane, such as those defined by Can1 and Pma1 (MCCs and MCPs), Saccharomyces cerevisiae can serve as a model organism, which is amenable to genetic, biochemical, and microscopic studies. In this review, we compare the specialized microcompartment of the yeast bud neck with other plasma membrane substructures, focusing on eisosomes, cell wall integrity-sensing units, and chitin-synthesizing complexes. Together, they ensure a proper cell division at the end of mitosis, an intricately regulated process, which is essential for the survival and proliferation not only of fungal, but of all eukaryotic cells.

  3. Mapping the functional yeast ABC transporter interactome.

    Science.gov (United States)

    Snider, Jamie; Hanif, Asad; Lee, Mid Eum; Jin, Ke; Yu, Analyn R; Graham, Chris; Chuk, Matthew; Damjanovic, Dunja; Wierzbicka, Marta; Tang, Priscilla; Balderes, Dina; Wong, Victoria; Jessulat, Matthew; Darowski, Katelyn D; San Luis, Bryan-Joseph; Shevelev, Igor; Sturley, Stephen L; Boone, Charles; Greenblatt, Jack F; Zhang, Zhaolei; Paumi, Christian M; Babu, Mohan; Park, Hay-Oak; Michaelis, Susan; Stagljar, Igor

    2013-09-01

    ATP-binding cassette (ABC) transporters are a ubiquitous class of integral membrane proteins of immense clinical interest because of their strong association with human disease and pharmacology. To improve our understanding of these proteins, we used membrane yeast two-hybrid technology to map the protein interactome of all of the nonmitochondrial ABC transporters in the model organism Saccharomyces cerevisiae and combined this data with previously reported yeast ABC transporter interactions in the BioGRID database to generate a comprehensive, integrated 'interactome'. We show that ABC transporters physically associate with proteins involved in an unexpectedly diverse range of functions. We specifically examine the importance of the physical interactions of ABC transporters in both the regulation of one another and in the modulation of proteins involved in zinc homeostasis. The interaction network presented here will be a powerful resource for increasing our fundamental understanding of the cellular role and regulation of ABC transporters. PMID:23831759

  4. Uniform yeast cell assembly via microfluidics.

    Science.gov (United States)

    Chang, Ya-Wen; He, Peng; Marquez, Samantha M; Cheng, Zhengdong

    2012-06-01

    This paper reports the use of microfluidic approaches for the fabrication of yeastosomes (yeast-celloidosomes) based on self-assembly of yeast cells onto liquid-solid or liquid-gas interfaces. Precise control over fluidic flows in droplet- and bubble-forming microfluidic devices allows production of monodispersed, size-selected templates. The general strategy to organize and assemble living cells is to tune electrostatic attractions between the template (gel or gas core) and the cells via surface charging. Layer-by-Layer (LbL) polyelectrolyte deposition was employed to invert or enhance charges of solid surfaces. We demonstrated the ability to produce high-quality, monolayer-shelled yeastosome structures under proper conditions when sufficient electrostatic driving forces are present. The combination of microfluidic fabrication with cell self-assembly enables a versatile platform for designing synthetic hierarchy bio-structures. PMID:22655026

  5. Homocysteine thiolactone affects protein ubiquitination in yeast.

    Science.gov (United States)

    Bretes, Ewa; Zimny, Jarosław

    2013-01-01

    The formation of homocysteine thiolactone (HcyTl) from homocysteine occurs in all examined so far organisms including bacteria, yeast, and humans. Protein N-homocysteinylation at the ε-amino group of lysine is an adverse result of HcyTl accumulation. Since tagging of proteins by ubiquitination before their proteasomal degradation takes place at the same residue, we wondered how N-homocysteinylation may affect the ubiquitination of proteins. We used different yeast strains carrying mutations in genes involved in the homocysteine metabolism. We found positive correlation between the concentration of endogenous HcyTl and the concentration of ubiquitinated proteins. This suggests that N-homocysteinylation of proteins apparently does not preclude but rather promotes their decomposition. PMID:24051443

  6. Effect of Yeast : Saccharomyces cerevisiae and Marine Yeast as probiotic supplement on performance of poultry

    Directory of Open Access Journals (Sweden)

    I Putu Kompiang

    2002-03-01

    Full Text Available An experiment had been conducted to evaluate the effect of marine yeast and Saccharomyces cerevisiae (Sc as probiotic supplement on poultry performance. Marine yeast isolated from rotten sea-weed and commercial Saccharomyces cerevisiae were used. Evaluation was conducted by comparing performance of broiler chicken supplemented with marine yeast or Sc, which were given through drinking water (5 ml/l to negative control (feed without antibiotic growth promotor/GPA, positive control (feed with GPA, and reference commercial probiotic. Forty DOC broiler birds were used for each treatment, divided into 4 replicates (10 birds/replicate and raised in wire cages for 5 weeks. Body weight and feed consumption were measured weekly and mortality was recorded during the trial. The results showed that there were no significant difference on the birds performance among marine yeast, Sc, positive control and probiotic reference control treatments. However their effects on bird performance were better (P<0.05 than treatment of negative control. It is concluded that marine yeast or Saccharomyces cerevisiae could replace the function of antibiotic as a growth promotant.

  7. Yeast Oligo-mediated Genome Engineering (YOGE)

    OpenAIRE

    DiCarlo, JE; Conley, AJ; Penttilä, M; Jäntti, J; Wang, HH; Church, GM

    2013-01-01

    High-frequency oligonucleotide-directed recombination engineering (recombineering) has enabled rapid modification of several prokaryotic genomes to date. Here, we present a method for oligonucleotide-mediated recombineering in the model eukaryote and industrial production host S. cerevisiae, which we call Yeast Oligo-mediated Genome Engineering (YOGE). Through a combination of overexpression and knockouts of relevant genes and optimization of transformation and oligonucleotide designs, we ach...

  8. Yeast mutants auxotrophic for choline or ethanolamine.

    OpenAIRE

    Atkinson, K D; Jensen, B.; Kolat, A I; Storm, E M; Henry, S. A.; Fogel, S

    1980-01-01

    Three mutants of the yeast Saccharomyces cerevisiae which require exogenous ethanolamine or choline were isolated. The mutants map to a single locus (cho1) on chromosome V. The lipid composition suggests that cho1 mutants do not synthesize phosphatidylserine under any growth conditions. If phosphatidylethanolamine or phosphatidylcholine, which are usually derived from phosphatidylserine, were synthesized from exogenous ethanolamine or choline, the mutants grew and divided relatively normally....

  9. Dissection and design of yeast prions.

    OpenAIRE

    Osherovich, Lev Z; Cox, Brian S; Mick F Tuite; Weissman, Jonathan S

    2004-01-01

    Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids). Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p) to examine the requirements for prion formation and inheritance. In both proteins, ...

  10. Vacuole Partitioning during Meiotic Division in Yeast

    OpenAIRE

    Roeder, A D; Shaw, J.M.

    1996-01-01

    We have examined the partitioning of the yeast vacuole during meiotic division. In pulse-chase experiments, vacuoles labeled with the lumenal ade2 fluorophore or the membrane-specific dye FM 4-64 were not inherited by haploid spores. Instead, these fluorescent markers were excluded from spores and trapped between the spore cell walls and the ascus. Serial optical sections using a confocal microscope confirmed that spores did not inherit detectable amounts of fluorescently labeled vacuoles. Mo...

  11. Phyllosphere yeasts rapidly break down biodegradable plastics

    OpenAIRE

    Kitamoto, Hiroko K.; Shinozaki, Yukiko; Cao, Xiao-hong; Morita, Tomotake; Konishi, Masaaki; Tago, Kanako; Kajiwara, Hideyuki; Koitabashi, Motoo; Yoshida, Shigenobu; Watanabe, Takashi; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Tsushima, Seiya

    2011-01-01

    The use of biodegradable plastics can reduce the accumulation of environmentally persistent plastic wastes. The rate of degradation of biodegradable plastics depends on environmental conditions and is highly variable. Techniques for achieving more consistent degradation are needed. However, only a few microorganisms involved in the degradation process have been isolated so far from the environment. Here, we show that Pseudozyma spp. yeasts, which are common in the phyllosphere and are easily ...

  12. Yeast Interactions in Inoculated Wine Fermentation

    OpenAIRE

    Ciani, Maurizio; Capece, Angela; Comitini, Francesca; Canonico, Laura; Siesto, Gabriella; Romano, Patrizia

    2016-01-01

    The use of selected starter culture is widely diffused in winemaking. In pure fermentation, the ability of inoculated Saccharomyces cerevisiae to suppress the wild microflora is one of the most important feature determining the starter ability to dominate the process. Since the wine is the result of the interaction of several yeast species and strains, many studies are available on the effect of mixed cultures on the final wine quality. In mixed fermentation the interactions between the diffe...

  13. Zinc accumulation and utilization by wine yeasts

    OpenAIRE

    Walker, Graeme

    2009-01-01

    Raffaele De Nicola1,3, Nichola Hall2,3, Tatiana Bollag3, Georgios Thermogiannis3, Graeme M Walker31DSM Nutritional Products, Dept. NRD/CX, Basel, Switzerland; 2Vinquiry, Inc. Windsor, CA, USA; 3School of Contemporary Sciences, University of Abertay Dundee, Dundee, UK Abstract: The present study has focused on the accumulation of zinc by wine yeast strains of Saccharomyces cerevisiae during fermentation of both grape juice and chemically defined medium with different carbohydrates and...

  14. Pentose utilization in yeasts: Physiology and biochemistry

    Energy Technology Data Exchange (ETDEWEB)

    Jeppson, H.

    1996-04-01

    The fermentive performance of bacteria, yeasts, and filamentous fungi was investigated in a pentose (xylose)-rich lignocellulosic hydrolyzate. The filamentous fungus Fusarium oxysporum and the xylose-fermenting yeast Pichia stipitis were found to be very sensitive to the inhibiting hydrolyzate. Recombinant xylose-utilizing Saccharomyces cerevisiae showed very poor ethanol formation from xylose; xylitol being the major product formed. The highest ethanol yields were obtained with recombinant Escherichia coli KO11, however, for maximal ethanol yield detoxification of the hydrolyzate was required. The influence of oxygen on the regulation of carbohydrate metabolism in the xylose-fermenting yeast P. stipitis CBS 6054 was investigated. A low and well-controlled level of oxygenation has been found to be required for efficient ethanol formation from xylose by the xylose-fermenting yeasts. The requirement of oxygen is frequently ascribed to the apparent redox imbalance which develops under anaerobic conditions due to the difference in co-factor utilization of the two first enzymes in the xylose metabolism, further reflected in xylitol excretion. However, a low and well controlled level of oxygenation for maximal ethanol production from glucose was also demonstrated, suggesting that the oxygen requirement is not only due to the dual co-factor utilization, but also serves other purposes. Cyanide-insensitive and salicyl hydroxamic acid-sensitive respiration (CIR) was found in P. stipitis. CIR is suggested to act as a redox sink preventing xylitol formation in P. stipitis under oxygen-limited xylose fermentations. Xylitol metabolism by P. stipitis CBS 6054 was strictly respiratory and ethanol was not formed under any conditions. The absence of ethanol formation was not due to a lack of fermentative enzymes, since the addition of glucose to xylitol-pregrown cells resulted in ethanol formation. 277 refs, 5 figs, 7 tabs

  15. Environmental influences on organotin-yeast interactions

    OpenAIRE

    White, Jane S.

    2002-01-01

    As a consequence of the widespread industrial and agricultural applications of organotin compounds, contamination of various ecosystems has occurred in recent decades. Understanding how these compounds interact with cellular membranes is essential in assessing the risks of organotin pollution. The organotins, tributyltin (TBT) and trimethyltin (TMT) and inorganic tin, Sn(IV), were investigated for their physical interactions with non-metabolising cells and protoplasts of the yeast, Candida ma...

  16. Telomere behavior in a hybrid yeast

    Institute of Scientific and Technical Information of China (English)

    Ona C Martin; Christopher G De Sevo; Benjamin Z Guo; Douglas E Koshland; Maiterya J Dunham; Yixian Zheng

    2009-01-01

    @@ Dear Editor, Telomeres and the protein/RNA complexes involved in maintaining them are rapidly evolving systems across eukaryotes.Using two Saccharomyces species, among S.cerevisiae and S.bayanus, we provide evidence that the telomere systems of these two closely related yeasts have evolved significantly apart and that the gene in one spe-cies cannot maintain the set-point of telomere length of the other soecies in the hybrid.

  17. Kinetics of hairpin ribozyme cleavage in yeast.

    OpenAIRE

    Donahue, C P; Fedor, M J

    1997-01-01

    Hairpin ribozymes catalyze a self-cleavage reaction that provides a simple model for quantitative analyses of intracellular mechanisms of RNA catalysis. Decay rates of chimeric mRNAs containing self-cleaving ribozymes give a direct measure of intracellular cleavage kinetics in yeast. Intracellular ribozyme-mediated cleavage occurs at similar rates and shows similar inhibition by ribozyme mutations as ribozyme-mediated reactions in vitro, but only when ribozymes are located in a favorable mRNA...

  18. Comparative genomics of biotechnologically important yeasts.

    Science.gov (United States)

    Riley, Robert; Haridas, Sajeet; Wolfe, Kenneth H; Lopes, Mariana R; Hittinger, Chris Todd; Göker, Markus; Salamov, Asaf A; Wisecaver, Jennifer H; Long, Tanya M; Calvey, Christopher H; Aerts, Andrea L; Barry, Kerrie W; Choi, Cindy; Clum, Alicia; Coughlan, Aisling Y; Deshpande, Shweta; Douglass, Alexander P; Hanson, Sara J; Klenk, Hans-Peter; LaButti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lipzen, Anna M; Meier-Kolthoff, Jan P; Ohm, Robin A; Otillar, Robert P; Pangilinan, Jasmyn L; Peng, Yi; Rokas, Antonis; Rosa, Carlos A; Scheuner, Carmen; Sibirny, Andriy A; Slot, Jason C; Stielow, J Benjamin; Sun, Hui; Kurtzman, Cletus P; Blackwell, Meredith; Grigoriev, Igor V; Jeffries, Thomas W

    2016-08-30

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the clade sister to the known CUG-Ser clade. Our well-resolved yeast phylogeny shows that some traits, such as methylotrophy, are restricted to single clades, whereas others, such as l-rhamnose utilization, have patchy phylogenetic distributions. Gene clusters, with variable organization and distribution, encode many pathways of interest. Genomics can predict some biochemical traits precisely, but the genomic basis of others, such as xylose utilization, remains unresolved. Our data also provide insight into early evolution of ascomycetes. We document the loss of H3K9me2/3 heterochromatin, the origin of ascomycete mating-type switching, and panascomycete synteny at the MAT locus. These data and analyses will facilitate the engineering of efficient biosynthetic and degradative pathways and gateways for genomic manipulation.

  19. Studies on methanol - oxidizing yeast. III. Enzyme.

    Science.gov (United States)

    Volfová, O

    1975-01-01

    Oxidation of methanol, formaldehyde and formic acid was studied in cells and cell-free extract of the yeast Candida boidinii No. 11Bh. Methanol oxidase, an enzyme oxidizing methanol to formaldehyde, was formed inducibly after the addition of methanol to yeast cells. The oxidation of methanol by cell-free extract was dependent on the presence of oxygen and independent of any addition of nicotine-amide nucleotides. Temperature optimum for the oxidation of methanol to formaldehyde was 35 degrees C, pH optimum was 8.5. The Km for methanol was 0.8mM. The cell-free extract exhibited a broad substrate specificity towards primary alcohols (C1--C6). The activity of methanol oxidase was not inhibited by 1mM KCN, EDTA or monoiodoacetic acid. The strongest inhibitory action was exerted by p-chloromercuribenzoate. Both the cells and the cell-free extract contained catalase which participated in the oxidation of methanol to formaldehyde; the enzyme was constitutively formed by the yeast. The pH optimum for the degradation of H2O2 was in the same range as the optimum for methanol oxidation, viz. at 8.5. Catalase was more resistant to high pH than methanol oxidase. The cell-free extract contained also GSH-dependent NAD-formaldehyde dehydrogenase with Km = 0.29mM and NAD-formate dehydrogenase with Km = 55mM. PMID:240764

  20. Comparative genomics of biotechnologically important yeasts.

    Science.gov (United States)

    Riley, Robert; Haridas, Sajeet; Wolfe, Kenneth H; Lopes, Mariana R; Hittinger, Chris Todd; Göker, Markus; Salamov, Asaf A; Wisecaver, Jennifer H; Long, Tanya M; Calvey, Christopher H; Aerts, Andrea L; Barry, Kerrie W; Choi, Cindy; Clum, Alicia; Coughlan, Aisling Y; Deshpande, Shweta; Douglass, Alexander P; Hanson, Sara J; Klenk, Hans-Peter; LaButti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lipzen, Anna M; Meier-Kolthoff, Jan P; Ohm, Robin A; Otillar, Robert P; Pangilinan, Jasmyn L; Peng, Yi; Rokas, Antonis; Rosa, Carlos A; Scheuner, Carmen; Sibirny, Andriy A; Slot, Jason C; Stielow, J Benjamin; Sun, Hui; Kurtzman, Cletus P; Blackwell, Meredith; Grigoriev, Igor V; Jeffries, Thomas W

    2016-08-30

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the clade sister to the known CUG-Ser clade. Our well-resolved yeast phylogeny shows that some traits, such as methylotrophy, are restricted to single clades, whereas others, such as l-rhamnose utilization, have patchy phylogenetic distributions. Gene clusters, with variable organization and distribution, encode many pathways of interest. Genomics can predict some biochemical traits precisely, but the genomic basis of others, such as xylose utilization, remains unresolved. Our data also provide insight into early evolution of ascomycetes. We document the loss of H3K9me2/3 heterochromatin, the origin of ascomycete mating-type switching, and panascomycete synteny at the MAT locus. These data and analyses will facilitate the engineering of efficient biosynthetic and degradative pathways and gateways for genomic manipulation. PMID:27535936

  1. [Determination of riboflavin kinase activity in yeast].

    Science.gov (United States)

    Shavlovsky, G M; Kashchenko, V E

    1975-01-01

    It is established that the main reason of the riboflavin kinase (RFK, EC 2.7.1.26) low specific activity in the cell-free extracts of the yeast Pichia guillermondii Wickerham ATCC 9058 is the presence of alkaline phosphatase (EC 3.1.3.1), effectively destructing flaven mononucleotide. By chromatography of the cell-free extracts of P. guillermondii on DEAE-Sephadex A-50, CM-Sphadex C-50, CM-cellulose, Sephadexes G-75 and G-100 RFK and alkaline phosphatase may be separated completely. Any of these procedures results in a several times increase of the RFK activity as compared with the initial preparation. One failed to obtain a similar effect by fractionation of the extracts with amminium sulphate and by hydroxylapatite chromatography. A simple method is developed for determining the activity of RFK in the cell-free extracts of yeast on the basis of negative adsorption of this enzyme on DEAE-Sephadex A-50. A selective inhibition of alkaline phosphatase by ions Be2+ and F- yields a less satisfactory result. The data are presented on the PFK activity of certain species of flavinogenic (Pichia guillermondii, Torulopsis camdida) and non-flavinogenic (Pichia ohmeri, Candida utilis, Saccharomyces cervisiae) yeast. PMID:174262

  2. YeastMed: an XML-Based System for Biological Data Integration of Yeast

    CERN Document Server

    Briache, Abdelaali; Kerzazi, Amine; Navas-Delgado, Ismael; Montes, Jose F Aldana; Hassani, Badr D Rossi; Lairini, Khalid

    2010-01-01

    A key goal of bioinformatics is to create database systems and software platforms capable of storing and analysing large sets of biological data. Hundreds of biological databases are now available and provide access to huge amount of biological data. SGD, Yeastract, CYGD-MIPS, BioGrid and PhosphoGrid are five of the most visited databases by the yeast community. These sources provide complementary data on biological entities. Biologists are brought systematically to query these data sources in order to analyse the results of their experiments. Because of the heterogeneity of these sources, querying them separately and then manually combining the returned result is a complex and laborious task. To provide transparent and simultaneous access to these sources, we have developed a mediator-based system called YeastMed. In this paper, we present YeastMed focusing on its architecture.

  3. Yeast Endoplasmic Reticulum Sequestration Screening for the Engineering of Proteases from Libraries Expressed in Yeast.

    Science.gov (United States)

    Yi, Li; Taft, Joseph M; Li, Qing; Gebhard, Mark C; Georgiou, George; Iverson, Brent L

    2015-01-01

    There is significant interest in engineering proteases with desired proteolytic properties. We describe a high-throughput fluorescence-activated cell sorting (FACS) assay for detecting altered proteolytic activity of protease in yeast, at the single cell level. This assay relies on coupling yeast endoplasmic reticulum (ER) retention, yeast surface display, and FACS analysis. The method described here allows facile screening of large libraries, and of either protease or substrate variants, including the screening of protease libraries against substrate libraries. We demonstrate the application of this technique in the screening of libraries of Tobacco Etch Virus protease (TEV-P) for altered proteolytic activities. In addition, the generality of this method is also validated by other proteases such as human granzyme K and the hepatitis C virus protease, and the human Abelson tyrosine kinase. PMID:26060071

  4. Black yeast-like fungi in skin and nail

    DEFF Research Database (Denmark)

    Saunte, D M; Tarazooie, B; Arendrup, M C;

    2011-01-01

    Black yeast-like fungi are rarely reported from superficial infections. We noticed a consistent prevalence of these organisms as single isolations from mycological routine specimens. To investigate the prevalence of black yeast-like fungi in skin, hair and nail specimens and to discuss...... the probability of these species to be involved in disease. Slow-growing black yeast-like fungi in routine specimens were prospectively collected and identified. A questionnaire regarding patient information was sent to physicians regarding black yeast-like fungus positive patients. A total of 20 746...... dermatological specimens were examined by culture. Black yeast-like fungi accounted for 2.2% (n = 108) of the positive cultures. Only 31.0% of the samples, culture positive for black yeast-like fungi were direct microscopy positive when compared with overall 68.8% of the culture positive specimens. The most...

  5. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    Science.gov (United States)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  6. Effects of Li+ and PEG on DNA uptake in yeast

    Institute of Scientific and Technical Information of China (English)

    CHEN Ping; LIU Huihui; ZHANG Zhiling; PANG Daiwen; XIE Zhixiong; ZHENG Huzhi; LU Zhexue; TONG Hua

    2005-01-01

    @@ DNA uptake of Saccharomyces cerevisiae known as genetic transformation was firstly described by Oppenoorth in 1960[1], and now the most commonly used efficient protocol for yeast transformation makes use of PEG and Li+, which works well for most laboratory strains and is suitable for high-efficiency transformation of plasmid DNA[2-4]. However, it is still unknown how plasmid DNA enters yeast cells and what roles Li+ and PEG play on DNA uptake in yeast cells until now.

  7. Mediated Electrochemical Measurements of Intracellular Catabolic Activities of Yeast Cells

    Institute of Scientific and Technical Information of China (English)

    Jin Sheng ZHAO; Zhen Yu YANG; Yao LU; Zheng Yu YANG

    2005-01-01

    Coupling with the dual mediator system menadione/ferricyanide, microelectrode voltammetric measurements were undertaken to detect the ferrocyanide accumulations arising from the mediated reduction of ferricyanide by yeast cells. The results indicate that the dual mediator system menadione/ferricyanide could be used as a probe to detect cellular catabolic activities in yeast cells and the electrochemical response has a positive relationship with the specific growth rate of yeast cells.

  8. Measuring Replicative Life Span in the Budding Yeast

    OpenAIRE

    Steffen, Kristan K.; Kennedy, Brian K.; Kaeberlein, Matt

    2009-01-01

    Aging is a degenerative process characterized by a progressive deterioration of cellular components and organelles resulting in mortality. The budding yeast Saccharomyces cerevisiae has been used extensively to study the biology of aging, and several determinants of yeast longevity have been shown to be conserved in multicellular eukaryotes, including worms, flies, and mice 1. Due to the lack of easily quantified age-associated phenotypes, aging in yeast has been assayed almost exclusively by...

  9. Whole Genome Analysis of a Wine Yeast Strain

    OpenAIRE

    Hauser, Nicole C.; Kurt Fellenberg; Rosario Gil; Sonja Bastuck; Hoheisel, Jörg D; Pérez-Ortín, José E.

    2001-01-01

    Saccharomyces cerevisiae strains frequently exhibit rather specific phenotypic features needed for adaptation to a special environment. Wine yeast strains are able to ferment musts, for example, while other industrial or laboratory strains fail to do so. The genetic differences that characterize wine yeast strains are poorly understood, however. As a first search of genetic differences between wine and laboratory strains, we performed DNA-array analyses on the typical wine yeast strain T73 an...

  10. Applications of yeast surface display for protein engineering

    OpenAIRE

    Cherf, Gerald M.; Cochran, Jennifer R.

    2015-01-01

    The method of displaying recombinant proteins on the surface of Saccharomyces cerevisiae via genetic fusion to an abundant cell wall protein, a technology known as yeast surface display, or simply, yeast display, has become a valuable protein engineering tool for a broad spectrum of biotechnology and biomedical applications. This review focuses on the use of yeast display for engineering protein affinity, stability, and enzymatic activity. Strategies and examples for each protein engineering ...

  11. Yeast surface display for protein engineering and characterization

    OpenAIRE

    Gai, S. Annie; Wittrup, K. Dane

    2007-01-01

    Yeast surface display is being employed to engineer desirable properties into proteins for a broad variety of applications. Labeling with soluble ligands enables rapid and quantitative analysis of yeast-displayed libraries by flow cytometry, while libraries with insoluble or even as-yet-uncharacterized binding targets can be screened through cell-surface selections. In parallel, the utilization of yeast surface display for protein characterization, including in particular the mapping of funct...

  12. The complexity and implications of yeast prion domains

    OpenAIRE

    Du, Zhiqiang

    2011-01-01

    Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are genera...

  13. Dietary glucose regulates yeast consumption in adult Drosophila males

    OpenAIRE

    Sebastien eLebreton; Peter eWitzgall; Marie eOlsson; Becher, Paul G.

    2014-01-01

    The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies ...

  14. Gas bubble formation in the cytoplasm of a fermenting yeast

    OpenAIRE

    Swart, Chantel W.; Dithebe, Khumisho; Pohl, Carolina H.; Swart, Hendrik C.; Coetsee, Elizabeth; van Wyk, Pieter WJ; Swarts, Jannie C.; Lodolo, Elizabeth J; Kock, Johan LF

    2012-01-01

    Abstract Current paradigms assume that gas bubbles cannot be formed within yeasts although these workhorses of the baking and brewing industries vigorously produce and release CO2 gas. We show that yeasts produce gas bubbles that fill a significant part of the cell. The missing link between intracellular CO2 production by glycolysis and eventual CO2 release from cells has therefore been resolved. Yeasts may serve as model to study CO2 behavior under pressurized conditions that may impact on f...

  15. Biodiversity of Yeasts During Plum Wegierka Zwykla Spontaneous Fermentation

    OpenAIRE

    Satora, Pawel; Tuszynski, Tadeusz

    2005-01-01

    The study comprises an analysis of the yeast microbiota that participated in the spontaneous fermentation of crushed Wegierka Zwykla plum fruit, which is the raw material for slivovitz production in the mountain region in the south of Poland. Saccharomyces cerevisiae yeast strains were differentiated by means of the killer sensitivity analysis related to a killer reference panel of 9 well-known killer yeast strains. The first phase of the fermentation was dominated by the representatives of K...

  16. Probiotic properties of yeasts occurring in fermented food and beverages

    DEFF Research Database (Denmark)

    Jespersen, Lene

    Besides being able to improve the quality and safety of many fermented food and beverages some yeasts offer a number of probiotic traits. Especially a group of yeast referred to as "Saccharomyces boulardii", though taxonomically belonging to Saccharomyces cerevisiae, has been claimed to have...... probiotic properties. Besides, yeasts naturally occurring globally in food and beverages will have traits that might have a positive impact on human health....

  17. Applications of Yeast Surface Display for Protein Engineering.

    Science.gov (United States)

    Cherf, Gerald M; Cochran, Jennifer R

    2015-01-01

    The method of displaying recombinant proteins on the surface of Saccharomyces cerevisiae via genetic fusion to an abundant cell wall protein, a technology known as yeast surface display, or simply, yeast display, has become a valuable protein engineering tool for a broad spectrum of biotechnology and biomedical applications. This review focuses on the use of yeast display for engineering protein affinity, stability, and enzymatic activity. Strategies and examples for each protein engineering goal are discussed. Additional applications of yeast display are also briefly presented, including protein epitope mapping, identification of protein-protein interactions, and uses of displayed proteins in industry and medicine. PMID:26060074

  18. Yeast as a platform to explore polyglutamine toxicity and aggregation.

    Science.gov (United States)

    Duennwald, Martin L

    2013-01-01

    Protein misfolding is associated with many neurodegenerative diseases, including neurodegenerative diseases caused by polyglutamine expansion proteins, such as Huntington's disease. The model organism baker's yeast (Saccharomyces cerevisiae) has provided important general insights into the basic cellular mechanisms underlying protein misfolding. Furthermore, experiments in yeast have identified cellular factors that modulate the toxicity and the aggregation associated with polyglutamine expansion proteins. Notably, many features discovered in yeast have been proven to be highly relevant in other model organisms and in human pathology. The experimental protocols depicted here serve to reliably determine polyglutamine toxicity and polyglutamine aggregation in yeast. PMID:23719914

  19. Aboveground Deadwood Deposition Supports Development of Soil Yeasts

    Directory of Open Access Journals (Sweden)

    Thorsten Wehde

    2012-12-01

    Full Text Available Unicellular saprobic fungi (yeasts inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil-borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon. Unlike soils underneath logs, yeast communities in adjacent areas harbored a considerable number of transient (phylloplane-related yeasts reaching 30% of the total yeast quantity. We showed that distinguishing autochthonous community members and species transient in soils is essential to estimate appropriate effects of environmental factors on soil fungi. Furthermore, a better understanding of species niches is crucial for analyses of culture-independent data, and may hint to the discovery of unifying patterns of microbial species distribution.

  20. Differential Adsorption of Ochratoxin A and Anthocyanins by Inactivated Yeasts and Yeast Cell Walls during Simulation of Wine Aging

    OpenAIRE

    Leonardo Petruzzi; Antonietta Baiano; Antonio De Gianni; Milena Sinigaglia; Maria Rosaria Corbo; Antonio Bevilacqua

    2015-01-01

    The adsorption of ochratoxin A (OTA) by yeasts is a promising approach for the decontamination of musts and wines, but some potential competitive or interactive phenomena between mycotoxin, yeast cells, and anthocyanins might modify the intensity of the phenomenon. The aim of this study was to examine OTA adsorption by two strains of Saccharomyces cerevisiae (the wild strain W13, and the commercial isolate BM45), previously inactivated by heat, and a yeast cell wall preparation. Experiments w...

  1. Biodiversity of Saccharomyces yeast strains from grape berries of wine-producing areas using starters commercial yeasts

    OpenAIRE

    Valero, Eva; Cambon, Brigitte; Schuller, Dorit Elisabeth; Casal, Margarida; Dequin, Sylvie

    2007-01-01

    The use of commercial wine yeast strains as starters has been extensively generalised over the past two decades. In this study, a large scale sampling plan was devised over a period of three years in three different vineyards in the south of France, to evaluate autochthonous wine yeast biodiversity in vineyards around wineries where active dry yeasts have been used as fermentation starters during more than 5 years. 72 spontaneous fermentations were performed from a total of 106 grape samples,...

  2. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Science.gov (United States)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2013-05-14

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  3. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2016-08-09

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  4. Studies on the yeast nucleus : III. Properties of a deoxyribonucleoprotein complex derived from yeast

    NARCIS (Netherlands)

    Vliet, P.C. van der; Tonino, G.J.M.; Rozijn, Th.H.

    1969-01-01

    1. A deoxyribonucleoprotein complex was isolated from Saccharomyces cerevisiae. It is composed of 36% DNA, 4% RNA and 60% protein. About 70% of the protein is acid-extractable. The complex sediments as a single band with a s°20,w of 27 S. 2. The yeast deoxyribonucleoprotein shows a biphasic melting

  5. Genetically modified yeast species and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet (Kingsport, TN); Koivuranta, Kari (Helsinki, FI); Penttila, Merja (Helsinki, FI); Ilmen, Marja (Helsinki, FI); Suominen, Pirkko (Maple Grove, MN); Aristidou, Aristos (Maple Grove, MN); Miller, Christopher Kenneth (Cottage Grove, MN); Olson, Stacey (St. Bonifacius, MN); Ruohonen, Laura (Helsinki, FI)

    2011-05-17

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  6. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2014-01-07

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  7. Biological Effects of Yeast β-Glucans

    Directory of Open Access Journals (Sweden)

    Vlatka Petravić-tominac

    2010-12-01

    Full Text Available β-Glucans are glucose polymers that naturally occur in yeasts, molds, algae, mushrooms, bacteria, oats and barley. Immunostimulation is one of the most important properties of β-glucans. They are classified as biological response modifiers and because of their biological activities they can be used in human and veterinary medicine and pharmacy. Additionally, β-glucans show interesting physicochemical properties and therefore could be applied in food and feed production as well as in cosmetic and chemical industries. Immunomodulation by β-glucan, both in vitro and in vivo, inhibits cancer cell growth and metastasis and prevents or reduces bacterial infection. In humans, dietary β-glucan lowers blood cholesterol, improves glucose utilization by body cells and also helps wound healing. β-Glucans work, in part, by stimulating the innate immune mechanism to fight a range of foreign challenges and could be used as an adjuvant, in combination with anti infective or antineoplastic agents, radiotherapy, and a range of topical agents and nutrients. The structure of β-glucans depends on the source they are isolated from. Native β-glucan molecules can be linked and branched in several ways. Biological properties of different β-glucan molecules are dependent on their molecular structure. Some authors claim that the β-(1→3, (1→6-glucan derived from yeast Saccharomyces cerevisiae produce the highest biological effects. Thus, in this review the β-glucans and their metabolic activity are discussed, with the special accent on those isolated from yeast. Other possible β-glucan applications, directed to cosmetic production, non-medical application in pharmaceutical and chemical industry, are also discussed.

  8. Studying Functions of All Yeast Genes Simultaneously

    Science.gov (United States)

    Stolc, Viktor; Eason, Robert G.; Poumand, Nader; Herman, Zelek S.; Davis, Ronald W.; Anthony Kevin; Jejelowo, Olufisayo

    2006-01-01

    A method of studying the functions of all the genes of a given species of microorganism simultaneously has been developed in experiments on Saccharomyces cerevisiae (commonly known as baker's or brewer's yeast). It is already known that many yeast genes perform functions similar to those of corresponding human genes; therefore, by facilitating understanding of yeast genes, the method may ultimately also contribute to the knowledge needed to treat some diseases in humans. Because of the complexity of the method and the highly specialized nature of the underlying knowledge, it is possible to give only a brief and sketchy summary here. The method involves the use of unique synthetic deoxyribonucleic acid (DNA) sequences that are denoted as DNA bar codes because of their utility as molecular labels. The method also involves the disruption of gene functions through deletion of genes. Saccharomyces cerevisiae is a particularly powerful experimental system in that multiple deletion strains easily can be pooled for parallel growth assays. Individual deletion strains recently have been created for 5,918 open reading frames, representing nearly all of the estimated 6,000 genetic loci of Saccharomyces cerevisiae. Tagging of each deletion strain with one or two unique 20-nucleotide sequences enables identification of genes affected by specific growth conditions, without prior knowledge of gene functions. Hybridization of bar-code DNA to oligonucleotide arrays can be used to measure the growth rate of each strain over several cell-division generations. The growth rate thus measured serves as an index of the fitness of the strain.

  9. Detection and identification of wild yeasts in lager breweries.

    Science.gov (United States)

    van der Aa Kühle, A; Jespersen, L

    1998-09-01

    Wild yeasts were detected in 41 out of 101 brewery yeast samples investigated using six different selective principles. Malt extract, yeast extract, glucose, peptone (MYGP) agar supplemented with 195 ppm CuSO4 was found to be the most effective selective principle, detecting wild yeasts in 80% of the contaminated samples. Both Saccharomyces and non-Saccharomyces wild yeasts were detected on this medium. Lysine medium, crystal violet medium and incubation of non-selective media at 37 degrees C detected wild yeasts in 46-56% of the contaminated samples. On using actidione medium, only 20% of the wild yeasts were detected. The combined use of MYGP supplemented with 195 ppm CuSO4 and one of the other selective principles did not improve the recovery of the wild yeasts. The wild yeasts found consisted of Saccharomyces cerevisiae (57%), Pichia spp. (28%) and Candida spp. (15%). Using the API ID 32 C kit, 35 different assimilation profiles were obtained for the 124 wild yeast isolates investigated. All isolates were capable of glucose assimilation, whereas only 79% of the isolates assimilated saccharose, 75% maltose, 70% galactose, 65% raffinose and 65% lactate. Lactose, inositol, rhamnose and glucuronate were not assimilated by any of the isolates. The differences in assimilation pattern did not reflect any differences in recovery by the selective principles investigated. The majority of the wild yeast isolates investigated were capable of growth in wort and beer, indicating their possible role as spoilage organisms. The Sacch. cerevisiae isolates were found to be the most hazardous, with some isolates being capable of extensive growth in bottled beer within seventeen days at ambient temperature. PMID:9801196

  10. Biodegradation of reactive textile dyes by basidiomycetous fungi from brazilian ecosystems Biodegradação de corantes têxteis reativos fungos basidiomicetos do ecossistema brasileiro

    Directory of Open Access Journals (Sweden)

    Kátia M.G. Machado

    2006-12-01

    Full Text Available The potential of Trametes villosa and Pycnoporus sanguineus to decolorize reactive textile dyes used for cotton manufacturing in the State of Minas Gerais, Brazil, was evaluated. Growth and decolorization halos were determined on malt extract agar containing 0.002g L-1 of the dye. T. villosa decolorized all 28 of the tested dyes while P. sanguineus decolorized only 9. The effect of culture conditions (shaking and dye and nitrogen concentration on the degradation of Drimaren Brilliant Blue dye was evaluated during growth of the fungi in liquid synthetic medium. Shaking favored degradation and decolorization was not repressed by nitrogen. In pure culture, T. villosa and P. sanguineus decolorized synthetic effluent consisting of a mixture of 10 dyes. Higher decolorization of the synthetic effluent was observed when a mixed culture of the two fungi was used. This study demonstrated differences between tropical basidiomycete species in terms of their ability to degrade reactive dyes, and reinforces the potential of this group of fungi for the decolorization of textile effluents.O potencial de Trametes villosa e Pycnoporus sanguineus de descolorir corantes têxteis reativos utilizados na manufatura de algodão no estado de Minas Gerais foi avaliado. Halos de crescimento e descoloração foram determinados em agar extrato malte (MEA com 0,002g L-1 do corante. T. villosa descoloriu os 28 corantes testados e P. sanguineus apenas 9. A influência de condições de cultivo (agitação, concentração de corante e concentração de nitrogênio na degradação do corante azul brilhante Drimaren foi avaliada durante crescimento dos fungos em meio líquido sintético. Agitação favoreceu a degradação e não foi observada repressão da descoloração pelo nitrogênio. Em cultura pura, T. villosa e P. sanguineus descoloriram efluente sintético constituído por uma mistura de dez corantes. Maior descoloração do efluente sintético foi observada no cultivo

  11. Antioxidant Capacity and Total Phenolics Content of the Fruiting Bodies and Submerged Cultured Mycelia of Sixteen Higher Basidiomycetes Mushrooms from India.

    Science.gov (United States)

    Prasad, Rajendra; Varshney, Vinay K; Harsh, N S K; Kumar, Manoj

    2015-01-01

    The fruiting bodies and the submerged cultured mycelia of 16 higher Basidiomycetes mushrooms- Agaricus bisporus, Armillaria mellea, Auricularia auricula-judae, Ganoderma applanatum, G. lucidum, Laetiporus sulphureus, Lentinus tigrinus, Lycoperdon pyriforme, Phellinus linteus, Pleurotus ostreatus, P. sajor-caju, Polyporus arcularius, Russula brevipes, Schizophyllum commune, Sparassis crispa, and Spongipellis unicolor-from different taxonomic groups were examined for their antioxidant capacity (AOXC) and total phenolics content (TPC). Extraction of the freeze-dried and pulverized fruiting bodies and mycelia with methanol and water (8:2, v/v), followed by evaporation of the solvent under a vacuum, created their extracts, which were analyzed for their AOXC and TPC using a DPPH· scavenging assay and the Folin-Ciocalteu method, respectively. The fruiting bodies and the culture mycelia of all the mushroom species exhibited varied antioxidant capacity; however, the fruiting bodies had more potent DPPH· scavenging than the corresponding mycelia irrespective of the mushroom species, as evident by the effective concentrations of extract that scavenges 50% of DPPH· (EC50) of the former (0.56-1.24 mg mL-1) being lower than those of the latter (2.51-8.39 mg mL-1). TPC in the fruiting bodies (6.08-24.85 mg gallic acid equivalent [GAE] g-1) were higher than those in the mycelia (4.17-13.34 mg GAE g-1). AOXC of the fruiting bodies (r = -0.755) and the culture mycelia (r = -0.903) also was correlated to their TPC. Among the cultured mycelia, A. bisporus, A. mellea, L. tigrinus, P. ostreatus, and S. crispa were highly promising in terms of their highest TPC (10.55, 13.34, 11.00, 10.37, and 10.19 mg GAE g-1, respectively) and the lowest EC50 values (3.33, 2.85, 2.51, 3.65, and 3.17 mg mL-1, respectively) as they relate to the development of antioxidants. PMID:26756185

  12. Flor yeast: new perspectives beyond wine ageing

    OpenAIRE

    Jean-luc eLegras; Jaime eMoreno García; Severino eZara; Giacomo eZara; Teresa eGarcia Martinez; Ilaria Maria Mannazzu; Juan Carlos Mauricio; Anna Lisa Coi; Marc eBou Zeidan; Sylvie eDequin; Juan eMoreno; Marilena eBudroni

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the ageing of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air-liquid biofilm on the wine surface, which is also known as the velum...

  13. Flor yeast: new perspectives beyond wine aging

    OpenAIRE

    Legras, Jean Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    Pas de clé UT The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen andfermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also kno...

  14. Optimized Affinity Capture of Yeast Protein Complexes.

    Science.gov (United States)

    LaCava, John; Fernandez-Martinez, Javier; Hakhverdyan, Zhanna; Rout, Michael P

    2016-01-01

    Here, we describe an affinity isolation protocol. It uses cryomilled yeast cell powder for producing cell extracts and antibody-conjugated paramagnetic beads for affinity capture. Guidelines for determining the optimal extraction solvent composition are provided. Captured proteins are eluted in a denaturing solvent (sodium dodecyl sulfate polyacrylamide gel electrophoresis sample buffer) for gel-based proteomic analyses. Although the procedures can be modified to use other sources of cell extract and other forms of affinity media, to date we have consistently obtained the best results with the method presented. PMID:27371596

  15. Taxonomy Icon Data: Budding yeast [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available Budding yeast Saccharomyces cerevisiae Saccharomyces_cerevisiae_L.png Saccharomyces..._cerevisiae_NL.png Saccharomyces_cerevisiae_S.png Saccharomyces_cerevisiae_NS.png http://biosciencedbc.jp/taxonomy..._icon/icon.cgi?i=Saccharomyces+cerevisiae&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Saccharomy...ces+cerevisiae&t=NL http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Saccharomy...ces+cerevisiae&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Saccharomyces+cerevisiae&t=NS http://togodb.biosciencedbc.jp/togodb/view/taxonomy_icon_comment_en?species_id=216 ...

  16. The economics of ribosome biosynthesis in yeast.

    Science.gov (United States)

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  17. Biofuels. Altered sterol composition renders yeast thermotolerant

    DEFF Research Database (Denmark)

    Caspeta, Luis; Chen, Yun; Ghiaci, Payam;

    2014-01-01

    adaptive laboratory evolution to select yeast strains with improved growth and ethanol production at ≥40°C. Sequencing of the whole genome, genome-wide gene expression, and metabolic-flux analyses revealed a change in sterol composition, from ergosterol to fecosterol, caused by mutations in the C-5 sterol...... desaturase gene, and increased expression of genes involved in sterol biosynthesis. Additionally, large chromosome III rearrangements and mutations in genes associated with DNA damage and respiration were found, but contributed less to the thermotolerant phenotype....

  18. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones Data detail Data name 5'-end sequence...s of budding yeast full-length cDNA clones Description of data contents cDNA sequence...e Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive ...

  19. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  20. Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

    Science.gov (United States)

    Deutch, Charles E.; Marshall, Pamela A.

    2008-01-01

    In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

  1. Overexpression of membrane proteins from higher eukaryotes in yeasts.

    Science.gov (United States)

    Emmerstorfer, Anita; Wriessnegger, Tamara; Hirz, Melanie; Pichler, Harald

    2014-09-01

    Heterologous expression and characterisation of the membrane proteins of higher eukaryotes is of paramount interest in fundamental and applied research. Due to the rather simple and well-established methods for their genetic modification and cultivation, yeast cells are attractive host systems for recombinant protein production. This review provides an overview on the remarkable progress, and discusses pitfalls, in applying various yeast host strains for high-level expression of eukaryotic membrane proteins. In contrast to the cell lines of higher eukaryotes, yeasts permit efficient library screening methods. Modified yeasts are used as high-throughput screening tools for heterologous membrane protein functions or as benchmark for analysing drug-target relationships, e.g., by using yeasts as sensors. Furthermore, yeasts are powerful hosts for revealing interactions stabilising and/or activating membrane proteins. We also discuss the stress responses of yeasts upon heterologous expression of membrane proteins. Through co-expression of chaperones and/or optimising yeast cultivation and expression strategies, yield-optimised hosts have been created for membrane protein crystallography or efficient whole-cell production of fine chemicals. PMID:25070595

  2. Effect of salt hyperosmotic stress on yeast cell viability

    Directory of Open Access Journals (Sweden)

    Logothetis Stelios

    2007-01-01

    Full Text Available During fermentation for ethanol production, yeasts are subjected to different kinds of physico-chemical stresses such as: initially high sugar concentration and low temperature; and later, increased ethanol concentrations. Such conditions trigger a series of biological responses in an effort to maintain cell cycle progress and yeast cell viability. Regarding osmostress, many studies have been focused on transcriptional activation and gene expression in laboratory strains of Saccharomyces cerevisiae. The overall aim of this present work was to further our understanding of wine yeast performance during fermentations under osmotic stress conditions. Specifically, the research work focused on the evaluation of NaCl-induced stress responses of an industrial wine yeast strain S. cerevisiae (VIN 13, particularly with regard to yeast cell growth and viability. The hypothesis was that osmostress conditions energized specific genes to enable yeast cells to survive under stressful conditions. Experiments were designed by pretreating cells with different sodium chloride concentrations (NaCl: 4%, 6% and 10% w/v growing in defined media containing D-glucose and evaluating the impact of this on yeast growth and viability. Subsequent fermentation cycles took place with increasing concentrations of D-glucose (20%, 30%, 40% w/v using salt-adapted cells as inocula. We present evidence that osmostress induced by mild salt pre-treatments resulted in beneficial influences on both cell viability and fermentation performance of an industrial wine yeast strain.

  3. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  4. Dielectric modelling of cell division for budding and fission yeast

    Science.gov (United States)

    Asami, Koji; Sekine, Katsuhisa

    2007-02-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast.

  5. Functional genomics of beer-related physiological processes in yeast

    NARCIS (Netherlands)

    Hazelwood, L.A.

    2009-01-01

    Since the release of the entire genome sequence of the S. cerevisiae laboratory strain S288C in 1996, many functional genomics tools have been introduced in fundamental and application-oriented yeast research. In this thesis, the applicability of functional genomics for the improvement of yeast in b

  6. Determination of adenosine triphosphate in yeast and blood

    NARCIS (Netherlands)

    Steyn-Parvé, Elizabeth P.

    1953-01-01

    A method is described for the determination of ATP in yeast and blood, in which use is made of the decomposition of ATP by myosin adenosinetriphosphatase. ATP is extracted without injury by one minute's boiling at pH 2.5 to 3. Yeast extracts contain myokinase. To destroy this enzyme they are treat

  7. Novel model for wine fermentation including the yeast dying phase

    OpenAIRE

    Borzì, Alfio; Merger, Juri; Müller, Jonas; Rosch, Achim; Schenk, Christina; Schmidt, Dominik; Schmidt, Stephan; Schulz, Volker; Velten, Kai; von Wallbrunn, Christian; Zänglein, Michael

    2014-01-01

    This paper presents a novel model for wine fermentation including a death phase for yeast and the influence of oxygen on the process. A model for the inclusion of the yeast dying phase is derived and compared to a model taken from the literature. The modeling ability of the several models is analyzed by comparing their simulation results.

  8. A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin

    Directory of Open Access Journals (Sweden)

    Zhang Tingting

    2012-12-01

    Full Text Available Abstract Background Yeast Saccharomyces cerevisiae is a widely-used system for protein expression. We previously showed that heat-killed whole recombinant yeast vaccine expressing mammalian myostatin can modulate myostatin function in mice, resulting in increase of body weight and muscle composition in these animals. Foreign DNA introduced into yeast cells can be lost soon unless cells are continuously cultured in selection media, which usually contain antibiotics. For cost and safety concerns, it is essential to optimize conditions to produce quality food and pharmaceutical products. Results We developed a simple but effective method to engineer a yeast strain stably expressing mammalian myostatin. This method utilized high-copy-number integration of myostatin gene into the ribosomal DNA of Saccharomyces cerevisiae. In the final step, antibiotic selection marker was removed using the Cre-LoxP system to minimize any possible side-effects for animals. The resulting yeast strain can be maintained in rich culture media and stably express mammalian myostatin for two years. Oral administration of the recombinant yeast was able to induce immune response to myostatin and modulated the body weight of mice. Conclusions Establishment of such yeast strain is a step further toward transformation of yeast cells into edible vaccine to improve meat production in farm animals and treat human muscle-wasting diseases in the future.

  9. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall betwe

  10. Occurrence and function of yeasts in Asian indigenous fermented foods

    NARCIS (Netherlands)

    Aidoo, K.E.; Nout, M.J.R.; Sarkar, P.K.

    2006-01-01

    In the Asian region, indigenous fermented foods are important in daily life. In many of these foods, yeasts are predominant and functional during the fermentation. The diversity of foods in which yeasts predominate ranges from leavened bread-like products such as nan and idli, to alcoholic beverages

  11. The making of biodiversity across the yeast subphyllum

    Science.gov (United States)

    Goals for this research project are to determine how the functional diversity of the yeast subphylum is encoded, and to reconstruct the history of yeasts to elucidate the tempo and mode of functional diversification. The impact of this work will be to integrate discoveries within broadly disseminate...

  12. Interactions between yeasts, fungicides and apple fruit russeting

    NARCIS (Netherlands)

    Gildemacher, P.R.; Heijne, B.; Silvestri, M.; Houbraken, J.; Hoekstra, E.; Theelen, B.; Boekhout, T.

    2006-01-01

    The effect of inoculations with yeasts occurring on apple surfaces and fungicide treatments on the russeting of Elstar apples was studied. Captan, dithianon and a water treatment were implemented to study the interaction between the fungicides, the inoculated yeast species and Aureobasidium pullulan

  13. Perchlorate Reduction by Yeast for Mars Exploration

    Science.gov (United States)

    Sharma, Alaisha

    2015-01-01

    Martian soil contains high levels (0.6 percentage by mass) of calcium perchlorate (Ca(ClO4)2), which readily dissociates into calcium and the perchlorate ion (ClO4-) in water. Even in trace amounts, perchlorates are toxic to humans and have been implicated in thyroid dysfunction. Devising methods to lessen perchlorate contamination is crucial to minimizing the health risks associated with human exploration and colonization of Mars. We designed a perchlorate reduction pathway, which sequentially reduces perchlorate to chloride (Cl-) and oxygen (O2), for implementation in the yeast Saccharomyces cerevisiae. Using genes obtained from perchlorate reducing bacteria Azospira oryzae and Dechloromonas aromatica, we plan to assemble this pathway directly within S. cerevisiae through recombinational cloning. A perchlorate reduction pathway would enable S. cerevisiae to lower perchlorate levels and produce oxygen, which may be harvested or used directly by S. cerevisiae for aerobic growth and compound synthesis. Moreover, using perchlorate as an external electron acceptor could improve the efficiency of redox-imbalanced production pathways in yeast. Although several perchlorate reducing bacteria have been identified and utilized in water treatment systems on Earth, the widespread use of S. cerevisiae as a synthetic biology platform justifies the development of a perchlorate reducing strain for implementation on Mars.

  14. Parameters affecting methanol utilization by yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Foda, M.S.; El-Masry, H.G.

    1981-01-01

    Screening of 28 yeast cultures, representing 22 species of various yeasts, with respect to their capabilities to assimilate methanol, has shown that this property was mostly found in certain species of the two genera Hansenula and Candida. When methanol was used as a sole carbon source for a methanol-adapted strain of Hansenula polymorpha, a linear yield response could be obtained with increasing alcohol up to 2% concentration. The amount of inoculum proved to be the decisive factor in determining a priori the ability of the organism to grow at 6% methanol as final concentration. The optimum pH values for growth ranged between 4.5-5.5 with no growth at pH 6.5 or higher. A marked growth stimulation was obtained when the medium was supplied with phosphate up to 0.08 M as final concentration. Within the nitrogen sources tested, corn steep liquor concentrate gave the highest yield of cells. The significance of the obtained results are discussed with reference to feasibilities of application.

  15. An overview of macroautophagy in yeast.

    Science.gov (United States)

    Wen, Xin; Klionsky, Daniel J

    2016-05-01

    Macroautophagy is an evolutionarily conserved dynamic pathway that functions primarily in a degradative manner. A basal level of macroautophagy occurs constitutively, but this process can be further induced in response to various types of stress including starvation, hypoxia and hormonal stimuli. The general principle behind macroautophagy is that cytoplasmic contents can be sequestered within a transient double-membrane organelle, an autophagosome, which subsequently fuses with a lysosome or vacuole (in mammals, or yeast and plants, respectively), allowing for degradation of the cargo followed by recycling of the resulting macromolecules. Through this basic mechanism, macroautophagy has a critical role in cellular homeostasis; however, either insufficient or excessive macroautophagy can seriously compromise cell physiology, and thus, it needs to be properly regulated. In fact, a wide range of diseases are associated with dysregulation of macroautophagy. There has been substantial progress in understanding the regulation and molecular mechanisms of macroautophagy in different organisms; however, many questions concerning some of the most fundamental aspects of macroautophagy remain unresolved. In this review, we summarize current knowledge about macroautophagy mainly in yeast, including the mechanism of autophagosome biogenesis, the function of the core macroautophagic machinery, the regulation of macroautophagy and the process of cargo recognition in selective macroautophagy, with the goal of providing insights into some of the key unanswered questions in this field. PMID:26908221

  16. Optimization of Fermentation Condition of Yeast Culture

    Institute of Scientific and Technical Information of China (English)

    WANG Qiuju; XU Li; CUI Yizhe

    2008-01-01

    Culture condition of every phase for fermentation of yeast culture was studied, and its solid and liquid conditions of elaboration were optimized to improve the total counts of living cells.Results showed that microzyme grew best at 30℃ when solid fermented,and the count of the living cells reached the tiptop with pH 5.5.The count of Candida tropicalis could reach 137.96×109 cfu·g-1,the count of Saccharomyces cerevisia could reach 134.62×109 cfu·g-1;the best liquid fermentation condition for cell-wall broken was 50℃ for 28 h,the rate of cell-wall broken could reach 80% at least;the rate of vitamin loss in yeast could be the minimun, the loss rate of vitamin B1 in Candida tropicalis and Saccharomyces cerevisiae was 8.71% and 19.54% respectively, the loss rate of vitamin B2 was 19.39% and 13.18%,respectively,and the loss rate of vitamin B6 was 6.3% and 3.04%,respectively.

  17. The role of red yeast rice for the physician.

    Science.gov (United States)

    Gordon, Ram Y; Becker, David J

    2011-02-01

    Red yeast rice is an ancient Chinese dietary staple and medication used by millions of patients as an alternative therapy for hypercholesterolemia. In recent years, the use of red yeast rice has grown exponentially due to increased public interest in complementary and alternative medications and the publication of several randomized, controlled trials demonstrating its efficacy and safety in different populations. The most promising role for red yeast rice is as an alternative lipid-lowering therapy for patients who refuse to take statins because of philosophical reasons or patients who are unable to tolerate statin therapy due to statin-associated myalgias. However, there is limited government oversight of red yeast rice products, wide variability of active ingredients in available formulations, and the potential of toxic byproducts. Therefore, until red yeast rice products are regulated and standardized, physicians and patients should be cautious in recommending this promising alternative therapy for hyperlipidemia.

  18. Yeast cell factories for fine chemical and API production

    Directory of Open Access Journals (Sweden)

    Glieder Anton

    2008-08-01

    Full Text Available Abstract This review gives an overview of different yeast strains and enzyme classes involved in yeast whole-cell biotransformations. A focus was put on the synthesis of compounds for fine chemical and API (= active pharmaceutical ingredient production employing single or only few-step enzymatic reactions. Accounting for recent success stories in metabolic engineering, the construction and use of synthetic pathways was also highlighted. Examples from academia and industry and advances in the field of designed yeast strain construction demonstrate the broad significance of yeast whole-cell applications. In addition to Saccharomyces cerevisiae, alternative yeast whole-cell biocatalysts are discussed such as Candida sp., Cryptococcus sp., Geotrichum sp., Issatchenkia sp., Kloeckera sp., Kluyveromyces sp., Pichia sp. (including Hansenula polymorpha = P. angusta, Rhodotorula sp., Rhodosporidium sp., alternative Saccharomyces sp., Schizosaccharomyces pombe, Torulopsis sp., Trichosporon sp., Trigonopsis variabilis, Yarrowia lipolytica and Zygosaccharomyces rouxii.

  19. Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production

    Directory of Open Access Journals (Sweden)

    Popov Stevan D.

    2005-01-01

    Full Text Available The waste brewer's yeast S. cerevisiae (activated and non-activated was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positively the quality of produced bread regarding bread volume. The volume of developed gas in dough prepared with the use of non-activated BY was not sufficient, therefore, it should not be used as fermentation agent, but only as an additive in bread production process for bread freshness preservation. Intense mixing of dough results in more compressible crumb 48 hrs after baking compared to high-speed mixing.

  20. Isolation and Identification of Yeasts from Tibet Kefir

    Directory of Open Access Journals (Sweden)

    Yun Li

    2015-02-01

    Full Text Available The occurrence and distribution of yeasts in Tibet kefir were investigated in this study. Five samples of Tibetan kefir from Tibet and surrounding areas were collected for yeast isolation. Based on physiological, biochemical characteristics and molecular identification results, eight species of yeast were isolated and identified from Tibet kefir, including Saccharomyces cerevisiae, Pichia fermentans, Debaryomyces hansenii, Rhodotorula mucilaginosa, Candida zeylanoide, Candida parapsilosis, Kluyveromyces marxianus and Kazachstania unispora. Among the test samples, K. marxianus, Ka. unispora and P. fermentans were the highest three species in frequency of occurrence of yeast isolates. C. zeylanoides, C. parapsilosis and R. mucilaginosa were first found the occurrence in Tibet kefir. The results provided new information of yeast composition and biodiversity of Tibet kefir.

  1. Yeast diversity and native vigor for flavor phenotypes.

    Science.gov (United States)

    Carrau, Francisco; Gaggero, Carina; Aguilar, Pablo S

    2015-03-01

    Saccharomyces cerevisiae, the yeast used widely for beer, bread, cider, and wine production, is the most resourceful eukaryotic model used for genetic engineering. A typical concern about using engineered yeasts for food production might be negative consumer perception of genetically modified organisms. However, we believe the true pitfall of using genetically modified yeasts is their limited capacity to either refine or improve the sensory properties of fermented foods under real production conditions. Alternatively, yeast diversity screening to improve the aroma and flavors could offer groundbreaking opportunities in food biotechnology. We propose a 'Yeast Flavor Diversity Screening' strategy which integrates knowledge from sensory analysis and natural whole-genome evolution with information about flavor metabolic networks and their regulation. PMID:25630239

  2. Yeast systems for the commercial production of heterologous proteins.

    Science.gov (United States)

    Buckholz, R G; Gleeson, M A

    1991-11-01

    Yeasts are attractive hosts for the production of heterologous proteins. Unlike prokaryotic systems, their eukaryotic subcellular organization enables them to carry out many of the post-translational folding, processing and modification events required to produce "authentic" and bioactive mammalian proteins. In addition, they retain the advantages of a unicellular microorganism, with respect to rapid growth and ease of genetic manipulation. The vast majority of yeast expression work has focused on the well-characterized baker's yeast Saccharomyces cerevisiae. However, with the development of DNA transformation technologies, a growing number of non-Saccharomyces yeasts are becoming available as hosts for recombinant polypeptide production. These include Hansenula polymorpha, Kluyveromyces lactis, Pichia pastoris, Schizosaccharomyces pombe, Schwanniomyces occidentalis and Yarrowia lipolytica. The performance of these alternative yeast expression systems is reviewed here relative to S. cerevisiae, and the advantages and limitations of these systems are discussed.

  3. Lipid raft involvement in yeast cell growth and death.

    Science.gov (United States)

    Mollinedo, Faustino

    2012-01-01

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na(+), K(+), and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  4. Lipid raft involvement in yeast cell growth and death

    Directory of Open Access Journals (Sweden)

    Faustino eMollinedo

    2012-10-01

    Full Text Available The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Crytococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na+, K+ and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  5. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    Directory of Open Access Journals (Sweden)

    Jennifer R Bellon

    Full Text Available Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade, has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  6. Biological Effects of Yeast β-Glucans

    Directory of Open Access Journals (Sweden)

    Vlatka Petravić-Tominac

    2014-02-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0pt 5.4pt 0pt 5.4pt; mso-para-margin:0pt; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} β-Glucans are glucose polymers that naturally occur in yeasts, molds, algae, mushrooms, bacteria, oats and barley. Immunostimulation is one of the most important properties of β-glucans. They are classified as biological response modifiers and because of their biological activities they can be used in human and veterinary medicine and pharmacy. Additionally, β-glucans show interesting physicochemical properties and therefore could be applied in food and feed production as well as in cosmetic and chemical industries. Immunomodulation by β-glucan, both in vitro and in vivo, inhibits cancer cell growth and metastasis and prevents or reduces bacterial infection. In humans, dietary β-glucan lowers blood cholesterol, improves glucose utilization by body cells and also helps wound healing. β-Glucans work, in part, by stimulating the innate immune mechanism to fight a range of foreign challenges and could be used as an adjuvant, in combination with anti infective or antineoplastic agents, radiotherapy, and a range of topical agents and nutrients. The structure of β-glucans depends on the source they are isolated from. Native β-glucan molecules can be linked and branched in several ways. Biological properties of different β-glucan molecules are dependent on their molecular structure. Some authors claim that the β-(1→3, (1→6-glucan derived from yeast Saccharomyces cerevisiae produce the highest biological effects. Thus, in this review the β-glucans and their metabolic

  7. Yeast Interacting Proteins Database: YBR288C, YGR261C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available nctions in transport of alkaline phosphatase to the vacuole via the alternate pathway Rows with this bait as...ns in transport of alkaline phosphatase to the vacuole via the alternate pathway;...complex (AP-3); functions in transport of alkaline phosphatase to the vacuole via the alternate pathway Rows...of the yeast AP-3 complex; functions in transport of alkaline phosphatase to the vacuole via the alternate p

  8. YeastMed: an XML-Based System for Biological Data Integration of Yeast

    OpenAIRE

    Briache, Abdelaali; Marrakchi, Kamar; Kerzazi, Amine; Navas-Delgado, Ismael; Montes, Jose F Aldana; Hassani, Badr D. Rossi; Lairini, Khalid

    2010-01-01

    A key goal of bioinformatics is to create database systems and software platforms capable of storing and analysing large sets of biological data. Hundreds of biological databases are now available and provide access to huge amount of biological data. SGD, Yeastract, CYGD-MIPS, BioGrid and PhosphoGrid are five of the most visited databases by the yeast community. These sources provide complementary data on biological entities. Biologists are brought systematically to query these data sources i...

  9. Anhydrobiosis in yeast: cell wall mannoproteins are important for yeast Saccharomyces cerevisiae resistance to dehydration.

    Science.gov (United States)

    Borovikova, Diana; Teparić, Renata; Mrša, Vladimir; Rapoport, Alexander

    2016-08-01

    The state of anhydrobiosis is linked with the reversible delay of metabolism as a result of strong dehydration of cells, and is widely distributed in nature. A number of factors responsible for the maintenance of organisms' viability in these conditions have been revealed. This study was directed to understanding how changes in cell wall structure may influence the resistance of yeasts to dehydration-rehydration. Mutants lacking various cell wall mannoproteins were tested to address this issue. It was revealed that mutants lacking proteins belonging to two structurally and functionally unrelated groups (proteins non-covalently attached to the cell wall, and Pir proteins) possessed significantly lower cell resistance to dehydration-rehydration than the mother wild-type strain. At the same time, the absence of the GPI-anchored cell wall protein Ccw12 unexpectedly resulted in an increase of cell resistance to this treatment; this phenomenon is explained by the compensatory synthesis of chitin. The results clearly indicate that the cell wall structure/composition relates to parameters strongly influencing yeast viability during the processes of dehydration-rehydration, and that damage to cell wall proteins during yeast desiccation can be an important factor leading to cell death. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Biocavity laser spectroscopy of genetically altered yeast cells and isolated yeast mitochondria

    Science.gov (United States)

    Gourley, Paul L.; Hendricks, Judy K.; McDonald, Anthony E.; Copeland, R. Guild; Naviaux, Robert K.; Yaffe, Michael P.

    2006-02-01

    We report an analysis of 2 yeast cell mutants using biocavity laser spectroscopy. The two yeast strains differed only by the presence or absence of mitochondrial DNA. Strain 104 is a wild-type (ρ +) strain of the baker's yeast, Saccharomyces cerevisiae. Strain 110 was derived from strain 104 by removal of its mitochondrial DNA (mtDNA). Removal of mtDNA causes strain 110 to grow as a "petite" (ρ -), named because it forms small colonies (of fewer cells because it grows more slowly) on agar plates supplemented with a variety of different carbon sources. The absence of mitochondrial DNA results in the complete loss of all the mtDNA-encoded proteins and RNAs, and loss of the pigmented, heme-containing cytochromes a and b. These cells have mitochondria, but the mitochondria lack the normal respiratory chain complexes I, III, IV, and V. Complex II is preserved because its subunits are encoded by genes located in nuclear DNA. The frequency distributions of the peak shifts produced by wild-type and petite cells and mitochondria show striking differences in the symmetry and patterns of the distributions. Wild-type ρ + cells (104) and mitochondria produced nearly symmetric, Gaussian distributions. The ρ - cells (110) and mitochondria showed striking asymmetry and skew that appeared to follow a Poisson distribution.

  11. Fission yeast hotspot sequence motifs are also active in budding yeast.

    Directory of Open Access Journals (Sweden)

    Walter W Steiner

    Full Text Available In most organisms, including humans, meiotic recombination occurs preferentially at a limited number of sites in the genome known as hotspots. There has been substantial progress recently in elucidating the factors determining the location of meiotic recombination hotspots, and it is becoming clear that simple sequence motifs play a significant role. In S. pombe, there are at least five unique sequence motifs that have been shown to produce hotspots of recombination, and it is likely that there are more. In S. cerevisiae, simple sequence motifs have also been shown to produce hotspots or show significant correlations with hotspots. Some of the hotspot motifs in both yeasts are known or suspected to bind transcription factors (TFs, which are required for the activity of those hotspots. Here we show that four of the five hotspot motifs identified in S. pombe also create hotspots in the distantly related budding yeast S. cerevisiae. For one of these hotspots, M26 (also called CRE, we identify TFs, Cst6 and Sko1, that activate and inhibit the hotspot, respectively. In addition, two of the hotspot motifs show significant correlations with naturally occurring hotspots. The conservation of these hotspots between the distantly related fission and budding yeasts suggests that these sequence motifs, and others yet to be discovered, may function widely as hotspots in many diverse organisms.

  12. Stability of immobilized yeast alcohol dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Ooshima, H.; Genko, Y.; Harano, Y.

    1981-12-01

    The effects of substrate on stabilities of native (NA) and three kinds of immobilized yeast alcohol dehydrogenase (IMA), namely PGA (the carrier; porous glass), SEA (agarose gel) prepared covalently, and AMA (anion-exchange resin) prepared ionically, were studied. The following results were obtained. 1) The deactivations of NA and IMA free from the substrate or in the presence of ethanol obey the first-order kinetics, whereas, in the presence of butyraldehyde, their deactivation behaviors are explained on the basis of coexistence of two components of YADHs, namely the labile E1 and the comparatively stable E2, with different first-order deactivation constants. (2) A few attempts for stabilization of IMA were carried out from the viewpoint of the effects of crosslinkages among the subunits of YADH for PGA and the multibonding between the carrier and enzyme for SEA. The former is effective for the stabilization, whereas the latter is not. (Refs. 19).

  13. Production of high concentrations of yeast

    Energy Technology Data Exchange (ETDEWEB)

    1981-11-10

    A microbe is aerobically cultured using O/sub 2/ or a gas rich in O/sub 2/. The grown cells are washed, concentrated and a portion of the cells used as a seed culture. Thus, Saccharomyces cerevisiae (bakers' yeast) was cultured in a jar fermentor by flow down system maintaining the dissolved O/sub 2/ at 2-5 mg/L; volume of the initial medium containing 30% glucose was 350 mL and the initial washed cell concentration was 50 g dry cells/L. After 12 hours of cultivation, the volume of the medium increased to 750 mL and the cell concentration rose to 102 g dry cells/L; the yield was 49% with respect to glucose. The cells were washed and the cultivation was repeated by use of the washed cells; cell concentration reached 105 g dry cells/L.

  14. Calling Card Analysis in Budding Yeast.

    Science.gov (United States)

    Mayhew, David; Mitra, Robi D

    2016-02-01

    Calling card analysis is a high-throughput method for identifying the genomic binding sites of multiple transcription factors in a single experiment in budding yeast. By tagging a DNA-binding protein with a targeting domain that directs the insertion of the Ty5 retrotransposon, the genomic binding sites for that transcription factor are marked. The transposition locations are then identified en masse by Illumina sequencing. The calling card protocol allows for simultaneous analysis of multiple transcription factors. By cloning barcodes into the Ty5 transposon, it is possible to pair a unique barcode with every transcription factor in the experiment. The method presented here uses expression of transcription factors from their native loci; however, it can also be altered to measure binding sites of transcription factors overexpressed from a plasmid. PMID:26832687

  15. Development of Industrial Yeast Platform Strains

    DEFF Research Database (Denmark)

    Bergdahl, Basti; Dato, Laura; Förster, Jochen

    2014-01-01

    frequently encounter high substrate concentrations, low pH, high temperatures and various inhibitory compounds originating either from the raw material used or from cellular metabolism. The aim of this research project is to develop robust platform strains of Saccharomyces cerevisiae based on industrial...... main tasks that are interconnected to reach the final goal (Fig. 1).It is highly multidisciplinary and involves several research fields. In this communication, we will present selected results from ongoing activities, such as the whole genomes equencing, intracellular metabolite profiling and tolerance...... screening of the 36 industrial and laboratory yeast strains. In addition, progress in the development of molecular biology methods for generating the new strains will be presented....

  16. TOTAL ANTIOXIDANT ACTIVITY OF YEAST SACCHAROMYCES CEREVISIAE

    Directory of Open Access Journals (Sweden)

    Blažena Lavová

    2013-02-01

    Full Text Available Antioxidants are health beneficial compounds that can protect cells and macromolecules (e.g. fats, lipids, proteins and DNA from the damage of reactive oxygen species (ROS. Sacchamomyces cerevisiae are know as organisms with very important antioxidative enzyme systems such as superoxide dismutase or catalase. The total antioxidant activity (mmol Trolox equivalent – TE.g-1 d.w. of Saccharomyces cerevisiae was measured by 2,2´-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid during the yeast cultivation. It was found that the total antioxidant activity was the highest (1.08 mmol TE.g-1 d.w. in the strain Kolín after 32 hours of cultivation and the lowest (0.26 mmol TE.g-1 d.w. in the strain Gyöng after 12 hours of cultivation.

  17. Genetic and physiological variants of yeast selected from palm wine.

    Science.gov (United States)

    Ezeronye, O U; Okerentugba, P O

    2001-01-01

    Genetic screening of 1200-palm wine yeasts lead to the selection of fourteen isolates with various genetic and physiological properties. Nine of the isolates were identified as Saccharamyces species, three as Candida species, one as Schizosaccharomyces species and one as Kluyveromyces species. Five of the isolates were wild type parents, two were respiratory deficient mutants (rho) and nine were auxotrophic mutants. Four isolates were heterozygous diploid (alphaa) and two were homozygous diploid (aa/alphaalpha) for the mating a mating types were further identified on mating with type loci. Four Mat alpha and four Mat a types were further identified on mating with standard haploid yeast strains. Forty-five percent sporulated on starvation medium producing tetrads. Fifty-two percent of the four-spored asci contained four viable spores. Maximum specific growth rate [micromax] of the fourteen isolates range from 0.13-0.26, five isolates were able to utilize exogenous nitrate for growth. Percentage alcohol production range between 5.8-8.8% for palm wine yeast, 8.5% for bakers' yeast and 10.4% for brewers yeast. The palm wine yeast were more tolerant to exogenous alcohol but had a low alcohol productivity. Hybridization enhanced alcohol productivity and tolerance in the palm wine yeasts.

  18. Rapid isolation of yeast genomic DNA: Bust n' Grab

    Directory of Open Access Journals (Sweden)

    Peterson Kenneth R

    2004-04-01

    Full Text Available Abstract Background Mutagenesis of yeast artificial chromosomes (YACs often requires analysis of large numbers of yeast clones to obtain correctly targeted mutants. Conventional ways to isolate yeast genomic DNA utilize either glass beads or enzymatic digestion to disrupt yeast cell wall. Using small glass beads is messy, whereas enzymatic digestion of the cells is expensive when many samples need to be analyzed. We sought to develop an easier and faster protocol than the existing methods for obtaining yeast genomic DNA from liquid cultures or colonies on plates. Results Repeated freeze-thawing of cells in a lysis buffer was used to disrupt the cells and release genomic DNA. Cell lysis was followed by extraction with chloroform and ethanol precipitation of DNA. Two hundred ng – 3 μg of genomic DNA could be isolated from a 1.5 ml overnight liquid culture or from a large colony. Samples were either resuspended directly in a restriction enzyme/RNase coctail mixture for Southern blot hybridization or used for several PCR reactions. We demonstrated the utility of this method by showing an analysis of yeast clones containing a mutagenized human β-globin locus YAC. Conclusion An efficient, inexpensive method for obtaining yeast genomic DNA from liquid cultures or directly from colonies was developed. This protocol circumvents the use of enzymes or glass beads, and therefore is cheaper and easier to perform when processing large numbers of samples.

  19. Potential Application of Yeast β-Glucans in Food Industry

    Directory of Open Access Journals (Sweden)

    Vesna Zechner-krpan

    2009-12-01

    Full Text Available Different β-glucans are found in a variety of natural sources such as bacteria, yeast, algae, mushrooms, barley and oat. They have potential use in medicine and pharmacy, food, cosmetic and chemical industries, in veterinary medicine and feed production. The use of different β-glucans in food industry and their main characteristics important for food production are described in this paper. This review focuses on beneficial properties and application of β-glucans isolated from different yeasts, especially those that are considered as waste from brewing industry. Spent brewer’s yeast, a by-product of beer production, could be used as a raw-material for isolation of β-glucan. In spite of the fact that large quantities of brewer’s yeast are used as a feedstuff , certain quantities are still treated as a liquid waste. β-Glucan is one of the compounds that can achieve a greater commercial value than the brewer’s yeast itself and maximize the total profitability of the brewing process. β-Glucan isolated from spent brewer’s yeast possesses properties that are benefi cial for food production. Therefore, the use of spent brewer’s yeast for isolation of β-glucan intended for food industry would represent a payable technological and economical choice for breweries.

  20. Yeast Biomass Production in Brewery's Spent Grains Hemicellulosic Hydrolyzate

    Science.gov (United States)

    Duarte, Luís C.; Carvalheiro, Florbela; Lopes, Sónia; Neves, Ines; Gírio, Francisco M.

    Yeast single-cell protein and yeast extract, in particular, are two products which have many feed, food, pharmaceutical, and biotechnological applications. However, many of these applications are limited by their market price. Specifically, the yeast extract requirements for culture media are one of the major technical hurdles to be overcome for the development of low-cost fermentation routes for several top value chemicals in a biorefinery framework. A potential biotechnical solution is the production of yeast biomass from the hemicellulosic fraction stream. The growth of three pentose-assimilating yeast cell factories, Debaryomyces hansenii, Kluyveromyces marxianus, and Pichia stipitis was compared using non-detoxified brewery's spent grains hemicellulosic hydrolyzate supplemented with mineral nutrients. The yeasts exhibited different specific growth rates, biomass productivities, and yields being D. hansenii as the yeast species that presented the best performance, assimilating all sugars and noteworthy consuming most of the hydrolyzate inhibitors. Under optimized conditions, D. hansenii displayed a maximum specific growth rate, biomass yield, and productivity of 0.34 h-1, 0.61 g g-1, and 0.56 g 1-1 h-1, respectively. The nutritional profile of D. hansenii was thoroughly evaluated, and it compares favorably to others reported in literature. It contains considerable amounts of some essential amino acids and a high ratio of unsaturated over saturated fatty acids.

  1. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  2. Medicinal and antimicrobial role of the oyster culinary-medicinal mushroom Pleurotus ostreatus (higher Basidiomycetes) cultivated on banana agrowastes in India.

    Science.gov (United States)

    Kunjadia, Prashant D; Nagee, Anju; Pandya, Parth Y; Mukhopadhyaya, Pratap N; Sanghvi, Gaurav V; Dave, Gaurav S

    2014-01-01

    Oyster mushrooms, species of the genus Pleurotus, are recognized for producing secondary metabolites with important medicinal properties. Investigations were carried out to evaluate the antioxidative and antimicrobial properties of the edible mushroom Pleurotus ostreatus (MTCC142) extracts cultivated on banana agrowastes. Ethanolic extracts showed antimicrobial activities against gram-positive and gram-negative bacteria, and their in vitro antifungal activities against all fungi tested revealed a promising role. Qualitative phytochemical analysis of Pleurotus grown on yeast dextrose broth and banana agrowaste confirmed the presence of steroids, cardiac glycosides, terpenoids, and alkaloids, whereas ethanolic extract after 40 days exhibited a phenol concentration of 521.67 µg/mL in banana waste compared to 155 µg/mL in yeast dextrose broth. The minimum inhibitory concentration of ethanolic extracts ranged from 19.74 to 56.84 mg/mL and 35.53 to 102.31 mg/mL in solid-state and submerged grown mycelium extracts, respectively, after 40 days. Moreover, banana agrowaste could be a significant economic source for the production of the oyster mushroom P. ostreatus. The nutritive, medicinal, and antimicrobial properties of P. ostreatus can be used to develop a new nutraceutical formulation; it can also be used as an additive to routine and fast food.

  3. The manometric determination of thiamine pyrophosphate and the inhibition of the acid yeast phosphatase

    NARCIS (Netherlands)

    Steyn-Parvé, Elizabeth P.

    1962-01-01

    Sodium molybdate is a powerful inhibitor of the acid yeast phosphatase in both fresh baker's yeast and dried brewer's yeast, provided that the yeast is suspended in a suitable buffer. It displays no action in citrate or phosphate buffers, but is active in acetate or maleate buffers, both at the opti

  4. Cadmium biosorption by baker’s yeast in aqueous suspension

    OpenAIRE

    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla

    2012-01-01

    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  5. Biomineralization of iron phosphate nanoparticles in yeast cells

    International Nuclear Information System (INIS)

    Amorphous iron phosphate nanoparticles mineralized in yeast cells are studied by transmission electron microscopy, Fourier transform infrared spectrograph and micro electrophoresis. Iron phosphate nanoparticles in yeast cells show uniform morphology with extensive surface roughness and disperse well. The size distribution of iron phosphate is about 50-200 nm. Fourier transform infrared spectroscopy (FT-IR) is used to analyze the chemical bond linkages between iron phosphate nanoparticles with protein macromolecules in yeast cells. The mechanism of biomineralization was simply discussed by chemical bonds and surface charges.

  6. Mediated amperometry reveals different modes of yeast responses to sugars.

    Science.gov (United States)

    Garjonyte, Rasa; Melvydas, Vytautas; Malinauskas, Albertas

    2016-02-01

    Menadione-mediated amperometry at carbon paste electrodes modified with various yeasts (Saccharomyces cerevisiae, Candida pulcherrima, Pichia guilliermondii and Debaryomyces hansenii) was employed to monitor redox activity inside the yeast cells induced by glucose, fructose, sucrose, maltose or galactose. Continuous measurements revealed distinct modes (transient or gradually increasing) of the current development during the first 2 to 3 min after subjection to glucose, fructose and sucrose at electrodes containing S. cerevisiae and non-Saccharomyces strains. Different modes (increasing or decreasing) of the current development after yeast subjection to galactose at electrodes with S. cerevisiae or D. hansenii and at electrodes with C. pulcherrima and P. guilliermondii suggested different mechanisms of galactose assimilation.

  7. A network of yeast basic helix–loop–helix interactions

    OpenAIRE

    Robinson, Kelly A.; Koepke, Jay I.; Kharodawala, Murtaza; Lopes, John M.

    2000-01-01

    The Ino4 protein belongs to the basic helix–loop–helix (bHLH) family of proteins. It is known to form a dimer with Ino2p, which regulates phospholipid biosynthetic genes. Mammalian bHLH proteins have been shown to form multiple dimer combinations. However, this flexibility in dimerization had not been documented for yeast bHLH proteins. Using the yeast two-hybrid assay and a biochemical assay we show that Ino4p dimerizes with the Pho4p, Rtg1p, Rtg3p and Sgc1p bHLH proteins. Screening a yeast ...

  8. Production of yeast extract from whey using Kluyveromyces marxianus

    Directory of Open Access Journals (Sweden)

    Revillion Jean P. de Palma

    2003-01-01

    Full Text Available The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide rich extract with K. marxianus.

  9. Media composition influences yeast one- and two-hybrid results

    Directory of Open Access Journals (Sweden)

    Gonzalez Kim L

    2011-08-01

    Full Text Available Abstract Although yeast two-hybrid experiments are commonly used to identify protein interactions, the frequent occurrence of false negatives and false positives hampers data interpretation. Using both yeast one-hybrid and two-hybrid experiments, we have identified potential sources of these problems: the media preparation protocol and the source of the yeast nitrogen base may not only impact signal range but also effect whether a result appears positive or negative. While altering media preparation may optimize signal differences for individual experiments, media preparation must be reported in detail to replicate studies and accurately compare results from different experiments.

  10. Occurrence and function of yeasts in Asian indigenous fermented foods.

    Science.gov (United States)

    Aidoo, Kofi E; Nout, M J Rob; Sarkar, Prabir K

    2006-01-01

    In the Asian region, indigenous fermented foods are important in daily life. In many of these foods, yeasts are predominant and functional during the fermentation. The diversity of foods in which yeasts predominate ranges from leavened bread-like products such as nan and idli, to alcoholic beverages such as rice and palm wines, and condiments such as papads and soy sauce. Although several products are obtained by natural fermentation, the use of traditional starter cultures is widespread. This minireview focuses on the diversity and functionality of yeasts in these products, and on opportunities for research and development. PMID:16423068

  11. The occurrence of yeasts in some of the Masurian Lakes

    OpenAIRE

    Stanisław Niewolak

    2014-01-01

    The results are reported of investigations on the abundance of yeasts in the Kortowskie and Iławskle lakes. The amount and qualitative composition of yeasts was studied in the lakes of the Węgorzewo district. The yeasts were least numerous (up to 82 cells per l ml water) in the lakes with relatively unpolluted water and most abundant in bottom deposits with a silty substrate (up to 6200 cells per l g dry weight). Net plankton contained up to 15 000 cells in 1 g of fresh weight.

  12. Selection of functional cDNAs by complementation in yeast.

    OpenAIRE

    McKnight, G L; McConaughy, B L

    1983-01-01

    Yeast cDNA was prepared in a yeast expression plasmid to generate a cDNA plasmid pool composed of approximately 40,000 members. Several yeast mutants were transformed with the cDNA plasmid pool, and the cDNAs for ADC1, HIS3, URA3, and ASP5 were isolated by functional complementation. Restriction enzyme analysis confirmed the genetic identity of the ADC1, HIS3, and URA3 cDNAs and demonstrated that the URA3 cDNA contains 5' noncoding sequences. The relative abundance of the various cDNAs in the...

  13. Production of yeast extract from whey using Kluyveromyces marxianus

    OpenAIRE

    Revillion Jean P. de Palma; Brandelli Adriano; Ayub Marco A. Záchia

    2003-01-01

    The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide ric...

  14. Characterization of Septin Ultrastructure in Budding Yeast Using Electron Tomography

    Science.gov (United States)

    Bertin, Aurélie; Nogales, Eva

    2015-01-01

    Summary Septins are essential for the completion of cytokinesis. In budding yeast, Saccharomyces cerevisiae, septins are located at the bud neck during mitosis and are closely connected to the inner plasma membrane. In vitro, yeast septins have been shown to self-assemble into a variety of filamentous structures, including rods, paired filaments, bundles and rings [1–3]. Using electron tomography of freeze-substituted section and cryo-electron tomography of frozen sections, we determined the three dimensional organization of the septin cytoskeleton in dividing budding yeast with molecular resolution [4,5]. Here we describe the detailed procedures used for our characterization of the septin cellular ultrastructure. PMID:26519309

  15. How do yeast cells become tolerant to high ethanol concentrations?

    Science.gov (United States)

    Snoek, Tim; Verstrepen, Kevin J; Voordeckers, Karin

    2016-08-01

    The brewer's yeast Saccharomyces cerevisiae displays a much higher ethanol tolerance compared to most other organisms, and it is therefore commonly used for the industrial production of bioethanol and alcoholic beverages. However, the genetic determinants underlying this yeast's exceptional ethanol tolerance have proven difficult to elucidate. In this perspective, we discuss how different types of experiments have contributed to our understanding of the toxic effects of ethanol and the mechanisms and complex genetics underlying ethanol tolerance. In a second part, we summarize the different routes and challenges involved in obtaining superior industrial yeasts with improved ethanol tolerance. PMID:26758993

  16. Yeasts isolated from clinical samples of AIDS patients

    Directory of Open Access Journals (Sweden)

    Neves Rejane Pereira

    2002-01-01

    Full Text Available In order to investigate yeasts in oropharyngeal secretion, urine, sputum and inguinal scales from AIDS patients, clinical samples were collected from one hundred patients interned in the Infectious and Parasitic Diseases Sector of the Hospital das Clínicas of the Universidade Federal de Pernambuco and in Hospital Universitário Osvaldo Cruz of the Universidade de Pernambuco. Yeasts were isolated from seventy-two out of one hundred and eight clinical samples. The isolated yeasts were: Candida albicans (sixty-two isolates, Candida tropicalis (four isolates, Candida glabrata (two isolates, Candida parapsilosis (two isolates, Candida krusei (one isolate and Trichosporon pullulans (one isolate.

  17. Production of biopharmaceutical proteins by yeast: Advances through metabolic engineering

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2013-01-01

    by yeast are human serum albumin, hepatitis vaccines and virus like particles used for vaccination against human papillomavirus. Here is given a brief overview of biopharmaceutical production by yeast and it is discussed how the secretory pathway can be engineered to ensure more efficient protein...... for production of several large volume products. Insulin and insulin analogs are by far the dominating biopharmaceuticals produced by yeast, and this will increase as the global insulin market is expected to grow from USD12B in 2011 to more than USD32B by 2018. Other important biopharmaceuticals produced...

  18. Transcription reactions of yeast RNA polymerase II in vitro

    Institute of Scientific and Technical Information of China (English)

    赵宇; 敖世洲

    1995-01-01

    The transcription reactions in vitro of yeast ADHl and PHO5 gene promoters are investigated by means of a yeast crude nuclear extract. Using specific RNA probes, the transcription products of these 2 promoters have been first obtained. A low concentration of α-amanitin is highly inhibitory. The transcription of the PHO5 gene was initiated in vitro at or near the sites used in vim. The transcription products increase with the amount of the template and reach the maximum at certain concentrations of the template. The deletion of the yeast promoter sequences abolishes the reaction.

  19. Construction of a large synthetic human Fab antibody library on yeast cell surface by optimized yeast mating.

    Science.gov (United States)

    Baek, Du-San; Kim, Yong-Sung

    2014-03-28

    Yeast surface-displayed antibody libraries provide an efficient and quantitative screening resource for given antigens, but suffer from typically modest library sizes owing to low yeast transformation efficiency. Yeast mating is an attractive method for overcoming the limit of yeast transformation to construct a large, combinatorial antibody library, but the optimal conditions have not been reported. Here, we report a large synthetic human Fab (antigen binding fragment) yeast surface-displayed library generated by stepwise optimization of yeast mating conditions. We first constructed HC (heavy chain) and LC (light chain) libraries, where all of the six CDRs (complementarity-determining regions) of the variable domains were diversified mimicking the human germline antibody repertoires by degenerate codons, onto single frameworks of VH3-23 and Vkappa1-16 germline sequences, in two haploid cells of opposite mating types. Yeast mating conditions were optimized in the order of cell density, media pH, and cell growth phase, yielding a mating efficiency of ~58% between the two haploid cells carrying HC and LC libraries. We constructed two combinatorial Fab libraries with CDR-H3 of 9 or 11 residues in length with colony diversities of more than 10(9) by one round of yeast mating between the two haploid HC and LC libraries, with modest diversity sizes of ~10(7). The synthetic human Fab yeast-displayed libraries exhibited relative amino acid compositions in each position of the six CDRs that were very similar to those of the designed repertoires, suggesting that they are a promising source for human Fab antibody screening.

  20. The Effect of Different Temperatures on Autolysis of Baker’s Yeast for the Production of Yeast Extract

    OpenAIRE

    TANGÜLER, Hasan; Erten, Hüseyin

    2009-01-01

    This study aimed to determine the optimum autolysis conditions for the production of yeast extract, which is used to give a meaty flavor to food products and to increase their nutritional value. Autolysis was induced by incubating baker’s yeast cell suspensions at different temperatures (45, 50, 55, and 60 °C) with a reaction time ranging from 8 to 72 h. Content and yield of total solids, a-amino nitrogen (a-AN), and protein were determined. Yeast extract powder was obtained by dryi...

  1. Yeast diversity associated to sediments and water from two Colombian artificial lakes

    OpenAIRE

    Silva-Bedoya, L.M.; M. Ramírez-Castrillón; Osorio-Cadavid, E.

    2014-01-01

    In Colombia, knowledge of the yeast and yeast-like fungi community is limited because most studies have focused on species with clinical importance. Sediments and water represent important habitats for the study of yeast diversity, especially for yeast species with industrial, biotechnological, and bioremediation potential. The main purpose of this study was to identify and compare the diversity of yeast species associated with sediment and water samples from two artificial lakes in Universid...

  2. Effect of Yeast Hulls on Stuck and Sluggish Wine Fermentations: Importance of the Lipid Component

    OpenAIRE

    Munoz, Eeva; Ingledew, W. M.

    1989-01-01

    The effect of yeast hulls (yeast ghosts) on sluggish or stuck white wine fermentations was studied. The enhancing effect on yeast growth and fermentation rate displayed by the hulls was shown to be similar to the effect provided by lipid extract from the same hulls. Unsaturated fatty acids and sterols were incorporated into the yeast from lipid extracts during fermentation carried out under oxygen-limited conditions. Adsorption of toxic medium-chain fatty acid (decanoic acid) onto the yeast h...

  3. Probiotic Properties of Non-Saccharomyces Yeasts

    DEFF Research Database (Denmark)

    Smith, Ida Mosbech

    mobilization. In contrast, our findings reveal K. marxianus as a potent inducer of Foxp3+ regulatory T cells, a characteristic that may benefit human health in conditions characterized by excessive inflammation. In a third study, we evaluated non-Saccharomyces yeast modulation of human intestinal epithelial...... cell barrier function in vitro, and explored yeast properties of pathogen inhibition in a challenge assay with enteropathogenic Salmonella Typhimurium. Our findings demonstrate distinct patterns of non-Saccharomyces yeast modulation of epithelial cell barrier function, and identify K. marxianus...... and Metschnikowia gruessii as capable of significantly delaying Salmonella-induced disruption of epithelial cell barrier function. In conclusion, data presented in the current thesis demonstrate significant interactions between non-Saccharomyces yeasts and cells of the human gastrointestinal tract and identify K...

  4. Domestication and Divergence of Saccharomyces cerevisiae Beer Yeasts.

    Science.gov (United States)

    Gallone, Brigida; Steensels, Jan; Prahl, Troels; Soriaga, Leah; Saels, Veerle; Herrera-Malaver, Beatriz; Merlevede, Adriaan; Roncoroni, Miguel; Voordeckers, Karin; Miraglia, Loren; Teiling, Clotilde; Steffy, Brian; Taylor, Maryann; Schwartz, Ariel; Richardson, Toby; White, Christopher; Baele, Guy; Maere, Steven; Verstrepen, Kevin J

    2016-09-01

    Whereas domestication of livestock, pets, and crops is well documented, it is still unclear to what extent microbes associated with the production of food have also undergone human selection and where the plethora of industrial strains originates from. Here, we present the genomes and phenomes of 157 industrial Saccharomyces cerevisiae yeasts. Our analyses reveal that today's industrial yeasts can be divided into five sublineages that are genetically and phenotypically separated from wild strains and originate from only a few ancestors through complex patterns of domestication and local divergence. Large-scale phenotyping and genome analysis further show strong industry-specific selection for stress tolerance, sugar utilization, and flavor production, while the sexual cycle and other phenotypes related to survival in nature show decay, particularly in beer yeasts. Together, these results shed light on the origins, evolutionary history, and phenotypic diversity of industrial yeasts and provide a resource for further selection of superior strains. PAPERCLIP.

  5. Growth of marine yeast on different strength of stress solutes

    Digital Repository Service at National Institute of Oceanography (India)

    Gupta, R.

    Sixteen isolates of marine yeasts belonging to genera Candida, Debaryomyces, Rhodotorula and Saccharomyces, isolated from the (EEZ) of India were screened for their growth on different concentrations of sodium chloride (NaCl). Most of them showed...

  6. Dissecting principles governing actin assembly using yeast extracts.

    Science.gov (United States)

    Michelot, Alphée; Drubin, David G

    2014-01-01

    In this chapter, we describe recent protocols that we have developed to trigger actin assembly and actin-based motility in yeast cell extracts. Our method allows for the fast preparation of yeast extracts that are competent in dynamic assembly of distinct actin filament structures of biologically appropriate protein composition. Compared to previous extract-based systems using other eukaryotic cell types, yeast provides a unique advantage for combining reconstituted assays with the preparation of extracts from genetically modified yeast strains. We present a global strategy for dissecting the functions of individual proteins, where the activities of the proteins are analyzed in systems of variable complexity, ranging from simple mixtures of pure proteins to the full complexity of a cell's cytoplasm.

  7. Determination of tritium in wine and wine yeast samples

    International Nuclear Information System (INIS)

    A sensitive method for evaluating the tritium content in wine and wine yeast was applied to estimate tritium impact on the environment in the surrounding area of nuclear power plant Cernavoda, where the vineyards are part of representative agricultural ecosystem. Analytical procedures were developed to determine HTO in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractionating distillation for wine samples and azeotropic distillation followed by fractional distillation for wine yeast samples. Finally, the water samples obtained after fractional distillation were normally distilled with KMO4. The established procedures were successfully applied for wine and wine yeast samples from Mulfatlar harvests of the years 1995 and 1996. (authors)

  8. Fermenting knowledge: the history of winemaking, science and yeast research

    OpenAIRE

    Paul J Chambers; Pretorius, Isak S.

    2010-01-01

    In the second article of the ‘Food and Science' series, Paul Chambers and Isak Pretorius explain the central role of yeast in wine making and how biotechnology can contribute to improving the quality of wine.

  9. Assay for Spore Wall Integrity Using a Yeast Predator.

    Science.gov (United States)

    Okada, Hiroki; Neiman, Aaron M; Ohya, Yoshikazu

    2016-01-01

    During the budding yeast life cycle, a starved diploid cell undergoes meiosis followed by production of four haploid spores, each surrounded by a spore wall. The wall allows the spores to survive in harsh environments until conditions improve. Spores are also more resistant than vegetative cells to treatments such as ether vapor, glucanases, heat shock, high salt concentrations, and exposure to high or low pH, but the relevance of these treatments to natural environmental stresses remains unclear. This protocol describes a method for assaying the yeast spore wall under natural environmental conditions by quantifying the survival of yeast spores that have passed through the digestive system of a yeast predator, the fruit fly. PMID:27480715

  10. [Overexpression of FKS1 to improve yeast autolysis-stress].

    Science.gov (United States)

    Li, Jia; Wang, Jinjing; Li, Qi

    2015-09-01

    With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing. PMID:26955712

  11. Sensitive detection of yeast using terahertz slot antennas.

    Science.gov (United States)

    Park, S J; Son, B H; Choi, S J; Kim, H S; Ahn, Y H

    2014-12-15

    We demonstrated sensitive detection of individual yeast cells and yeast films by using slot antenna arrays operating in the terahertz frequency range. Microorganisms located at the slot area cause a shift in the resonant frequency of the THz transmission. The shift was investigated as a function of the surface number density for a set of devices fabricated on different substrates. In particular, sensors fabricated on a substrate with relatively low permittivity demonstrate higher sensitivity. The frequency shift decreases with increasing slot antenna width for a fixed coverage of yeast film, indicating a field enhancement effect. Furthermore, the vertical range of the effective sensing volume has been studied by varying the thickness of the yeast film. The resonant frequency shift saturates at 3.5 μm for a slot width of 2 μm. In addition, the results of finite-difference time-domain simulations are in good agreement with our experimental data. PMID:25606992

  12. Domestication and Divergence of Saccharomyces cerevisiae Beer Yeasts.

    Science.gov (United States)

    Gallone, Brigida; Steensels, Jan; Prahl, Troels; Soriaga, Leah; Saels, Veerle; Herrera-Malaver, Beatriz; Merlevede, Adriaan; Roncoroni, Miguel; Voordeckers, Karin; Miraglia, Loren; Teiling, Clotilde; Steffy, Brian; Taylor, Maryann; Schwartz, Ariel; Richardson, Toby; White, Christopher; Baele, Guy; Maere, Steven; Verstrepen, Kevin J

    2016-09-01

    Whereas domestication of livestock, pets, and crops is well documented, it is still unclear to what extent microbes associated with the production of food have also undergone human selection and where the plethora of industrial strains originates from. Here, we present the genomes and phenomes of 157 industrial Saccharomyces cerevisiae yeasts. Our analyses reveal that today's industrial yeasts can be divided into five sublineages that are genetically and phenotypically separated from wild strains and originate from only a few ancestors through complex patterns of domestication and local divergence. Large-scale phenotyping and genome analysis further show strong industry-specific selection for stress tolerance, sugar utilization, and flavor production, while the sexual cycle and other phenotypes related to survival in nature show decay, particularly in beer yeasts. Together, these results shed light on the origins, evolutionary history, and phenotypic diversity of industrial yeasts and provide a resource for further selection of superior strains. PAPERCLIP. PMID:27610566

  13. Culture nutrition key to inhibitor-tolerant yeast performance

    Science.gov (United States)

    Inhibitory compounds generated during acid hydrolysis pretreatment of lignocellulosic biomass interfere with subsequent fermentation to ethanol. A tolerant yeast strain Saccharomyces cerevisiae Y-50049 has recently been developed by targeted evolution in the presence of 5-hydroxymethylfurfural and f...

  14. Reprogrammed Glucose Metabolic Pathways of Inhibitor-Tolerant Yeast

    Science.gov (United States)

    Representative inhibitory compounds such as furfural and 5-hydroxymethylfurfural generated from lignocellulosic biomass pretreatment inhibit yeast growth and interfere with the subsequent ethanol fermentation. Evolutionary engineering under laboratory settings is a powerful tool that can be used to ...

  15. 21 CFR 172.898 - Bakers yeast glycan.

    Science.gov (United States)

    2010-04-01

    ...) Less than 10,000 organisms/gram by aerobic plate count. (2) Less than 10 yeasts and molds/gram. (3... used or intended for use in the following foods when standards of identity established under...

  16. Mathematical model of sugar uptake in fermenting yeasted dough.

    Science.gov (United States)

    Loveday, S M; Winger, R J

    2007-07-25

    Fermentation prior to freezing significantly reduces the shelf life of frozen dough, measured as a decline in proofing power. Changes during fermentation caused by yeast metabolism have previously been described empirically on a dough weight basis and have not been mathematically modeled. In this work, yeast metabolites were quantified in fermenting dough and their concentrations were estimated in the aqueous environment around yeast cells. The osmotic pressure in the aqueous phase increases by 23% during 3 h of fermentation, which depresses the freezing point by 1 degrees C. The rise in osmotic pressure and the accumulation of ethanol may affect phase equilibria in the dough, baking properties, and the shelf life of frozen dough. Predictive modeling equations fitted sugar concentration data accurately. It was found that the preference of baker's yeast for glucose over fructose was stronger in fermenting dough than in liquid fermentations. The usefulness of the model in industrial bakery formulation work was demonstrated. PMID:17595109

  17. Exon structure requirements for yeast tRNA ligase

    Institute of Scientific and Technical Information of China (English)

    刘建华; 金由辛; 王德宝

    1997-01-01

    Different nucleotides were introduced into nucleotides 32, 37 and 38 of yeast tRNAphe precursors via oligonucleotide directed mutations. Pre-tRNAs were prepared using T7-transcription in vitro and spliced with the purified yeast tRNA endonuclease and tRNA ligase. It is demonstrated that tRNA ligase activities will be inhibited by the 5’-double-stranded end of 3’-halves.

  18. Occurrence and Diversity of Marine Yeasts in Antarctica Environments

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xue; HUA Mingxia; SONG Chunli; CHI Zhenming

    2012-01-01

    A total of 28 yeast strains were obtained from the sea sediment of Antarctica.According to the results of routine identification and molecular characterization,the strains belonged to species of Yarrowia lipolytica,Debaryomyces hansenii,Rhodotorula slooffiae,Rhodotorula mucilaginosa,Sporidiobolus salmonicolor,Aureobasidium pullulans,Mrakia frigida and Guehomyces pullulans,respectively.The Antarctica yeasts have wide potential applications in biotechnology,for some of them can produce β-galactosidase and killer toxins.

  19. The sensitive [SWI+] prion: New perspectives on yeast prion diversity

    OpenAIRE

    Hines, Justin K; Craig, Elizabeth A

    2011-01-01

    Yeast prions are heritable protein-based genetic elements which rely on molecular chaperone proteins for stable transmission to cell progeny. Within the past few years, five new prions have been validated and 18 additional putative prions identified in Saccharomyces cerevisiae. The exploration of the physical and biological properties of these “nouveau prions” has begun to reveal the extent of prion diversity in yeast. We recently reported that one such prion, [SWI+], differs from the best st...

  20. Evaluation and Properties of the Budding Yeast Phosphoproteome

    OpenAIRE

    Amoutzias, G. D.; He, Y.; Lilley, K. S.; Van de Peer, Y.; Oliver, S G

    2012-01-01

    We have assembled a reliable phosphoproteomic data set for budding yeast Saccharomyces cerevisiae and have investigated its properties. Twelve publicly available phosphoproteome data sets were triaged to obtain a subset of high-confidence phosphorylation sites (p-sites), free of "noisy" phosphorylations. Analysis of this combined data set suggests that the inventory of phosphoproteins in yeast is close to completion, but that these proteins may have many undiscovered p-sites. Proteins involve...

  1. Experimental study on bread yeast cultured in sweet sorghum juice

    International Nuclear Information System (INIS)

    As a substitute for food supplies, sweet sorghum juice with high grade has demonstrated out- standing advantage in fermentation. To obtain the optimized fermentation conditions, the growth, the bio- mass of bread yeast cultured in sweet sorghum juice and total residual sugar were investigated in the paper. The fermentation was performed and optimized in a 10-100 1 bio-reactor. The results show that the application of sweet sorghum juice in bread yeast production is very potential. (authors)

  2. New insight into translation during yeast programmed cell death

    OpenAIRE

    Silva, Maria Alexandra Oliveira da

    2012-01-01

    Tese de doutoramento em Ciências da Saúde Global mRNA translation impairment has been described during the course of apoptosis in both mammalian and yeast. Nevertheless, the molecular pathways modulating translation during different scenarios of yeast apoptosis are still largely unexplored. Here we show by polysome profile analysis an impairment in capdependent translation initiation, correlated with alterations in translation machinery, such as the decrease in eIF4A levels ...

  3. PREPARATION OF RED WINE BY BAKER’S YEAST

    OpenAIRE

    Rashmi Mishra

    2016-01-01

    Wine is an alcoholic beverage made from fermented grapes or other fruits. The natural chemical balance of grapes lets them ferment without the addition of sugars, acids, enzymes, water, or other nutrients. Yeast consumes the sugars in the grapes and converts them into alcohol. Different varieties of grapes and strains of yeasts produce different types of wine such as red wine ,white wine, sparkling wine, rose wine etc. Study was conducted to produce red wine without using any sugar and making...

  4. Bacterial and yeast counts in Brazilian commodities and spices

    Directory of Open Access Journals (Sweden)

    Freire Francisco das Chagas Oliveira

    2002-01-01

    Full Text Available A total of thirteen genera of bacteria and two genera of yeasts were detected in surface sterilized and unsterilized Brazilian commodities and spices such as cashew kernels, Brazil nut kernels, black and white pepper. The genus Bacillus with eight species was by far the most common. The yeasts isolated were Pichia sp., P. guillermondii and Rhodotorula sp. Bacillus cereus, Salmonella typhimurium and Staphylococcus aureus were detected in cashew and Brazil nut kernels.

  5. Antifungal Susceptibility Testing of Ascomycetous Yeasts Isolated from Animals.

    Science.gov (United States)

    Álvarez-Pérez, Sergio; García, Marta E; Peláez, Teresa; Martínez-Nevado, Eva; Blanco, José L

    2016-08-01

    Recent studies suggest that antifungal resistance in yeast isolates of veterinary origin may be an underdiagnosed threat. We tested a collection of 92 ascomycetous yeast isolates that were obtained in Spain from birds, mammals and insects for antifungal susceptibility. MICs to amphotericin B and azoles were low, and no resistant isolates were detected. Despite these results, and given the potential role of animals as reservoirs of resistant strains, continuous monitoring of antifungal susceptibility in the veterinary setting is recommended. PMID:27216048

  6. Production and characterization of yeast killer toxin monoclonal antibodies

    OpenAIRE

    Polonelli, L; Morace, G

    1987-01-01

    Monoclonal antibodies were obtained after fusion of mouse myeloma cells with spleen cells isolated from mice primed with a crude extract of yeast killer toxin produced by a strain of Hansenula anomala. Hybridomas were selected by specific immunoassay reaction of their fluid with crude yeast killer toxin extract. Among the monoclonal antibodies, which were characterized by the Western blot technique, one (designated KT4) proved to have precipitating properties, thus permitting the neutralizati...

  7. Collaborative evaluation of the Abbott yeast identification system.

    OpenAIRE

    Cooper, B. H.; Prowant, S; B. Alexander; Brunson, D H

    1984-01-01

    The Abbott yeast identification system (Abbott Laboratories, Diagnostics Division, Irving, Tex.) is a 24-h, instrumental method for identifying medically important yeasts, based on matrix analysis of 19 biochemical reactions and the germ tube test. The system was evaluated in two clinical laboratories by using 179 coded isolates, which included a high percentage of the less frequently encountered species. Based upon results with these coded isolates and from previously obtained laboratory dat...

  8. Yeast PPR proteins, watchdogs of mitochondrial gene expression

    OpenAIRE

    Herbert, Christopher J.; Golik, Pawel; Bonnefoy, Nathalie

    2013-01-01

    PPR proteins are a family of ubiquitous RNA-binding factors, found in all the Eukaryotic lineages, and are particularly numerous in higher plants. According to recent bioinformatic analyses, yeast genomes encode from 10 (in S. pombe) to 15 (in S. cerevisiae) PPR proteins. All of these proteins are mitochondrial and very often interact with the mitochondrial membrane. Apart from the general factors, RNA polymerase and RNase P, most yeast PPR proteins are involved in the stability and/or transl...

  9. Opportunistic yeast infections: candidiasis, cryptococcosis, trichosporonosis and geotrichosis.

    Science.gov (United States)

    Vázquez-González, Denisse; Perusquía-Ortiz, Ana María; Hundeiker, Max; Bonifaz, Alexandro

    2013-05-01

    Opportunistic yeast infections are diseases caused by fungi which normally are saprophytic and do not cause disease in humans or animals. The prevalence of these diseases has been increasing due to immunosuppressive, corticosteroid, and long-term antibiotic treatment following organ transplantation or after serious metabolic, hematological, or immunological diseases. We review epidemiological, clinical, diagnostic, and therapeutic aspects of the four "big" opportunistic yeast infections: candidiasis, cryptococcosis, trichosporonosis, and geotrichosis.

  10. The 2 micron plasmid purloins the yeast cohesin complex

    OpenAIRE

    Mehta, Shwetal; Yang, Xian Mei; Chan, Clarence S.; Dobson, Melanie J.; Jayaram, Makkuni; Velmurugan, Soundarapandian

    2002-01-01

    The yeast 2 micron plasmid achieves high fidelity segregation by coupling its partitioning pathway to that of the chromosomes. Mutations affecting distinct steps of chromosome segregation cause the plasmid to missegregate in tandem with the chromosomes. In the absence of the plasmid stability system, consisting of the Rep1 and Rep2 proteins and the STB DNA, plasmid and chromosome segregations are uncoupled. The Rep proteins, acting in concert, recruit the yeast cohesin complex to the STB locu...

  11. Production of intracellular enzymes by enzymatic treatment of yeast

    Energy Technology Data Exchange (ETDEWEB)

    Zomer, E.; Er-El, Z.; Rokem, J.S.

    1987-01-01

    Enzymatic extraction of intracellular enzymes from various yeasts by glucanase was investigated. Favourable conditions for lysis and release of intracellular enzymes were established. The effects of yeast concentration, growth phase of yeast, storage temperature and pretreatment of yeast were studied. The yeasts investigated can be divided into two groups. The first, Kluyveromyces lactis, Saccharomyces cerevisiae, Saccharomyces oviformis, Torulopsis glabrata, Hansenula polymorpha and local bakers' yeast, lysed relatively easily (70-80% of the cells), especially when cells from the logarithmic growth phase were treated. The second, Candida utilis and Candida vini, were more susceptible to lysis (40-50%) when cells were taken from the stationary phase. Release of two enzymes, glycerol kinase from Candida utilis grown on glycerol and formate dehydrogenase from Torulopsis glabrata grown on methanol was examined. The highest specific activities were obtained by incubating the cells with glucanase for 1.5 hours at 37 degrees C. Inactivation of the released enzyme was relatively low. After 12 hours of enzymatic treatment at 28 degrees C glycerol kinase maintained about 50%, and formate dehydrogenase over 80%, of the original activities. (Refs. 12).

  12. The Fermentative and Aromatic Ability of Kloeckera and Hanseniaspora Yeasts

    Science.gov (United States)

    Díaz-Montaño, Dulce M.; de Jesús Ramírez Córdova, J.

    Spontaneous alcoholic fermentation from grape, agave and others musts into an alcoholic beverage is usually characterized by the presence of several non-Saccharomyces yeasts. These genera yeasts are dominant in the early stages of the alcoholic fermentation. However the genera Hanseniaspora and Kloeckera may survive at a significant level during fermentation and can influence the chemical composition of the beverage. Several strains belonging to the species Kloeckera api-culata and Hanseniaspora guilliermondii have been extensively studied in relation to the formation of some metabolic compounds affecting the bouquet of the final product. Indeed some apiculate yeast showed positive oenological properties and their use in the alcoholic fermentations has been suggested to enhance the aroma and flavor profiles. The non- Saccharomyces yeasts have the capability to produce and secrete enzymes in the medium, such as β -glucosidases, which release monoterpenes derived from their glycosylated form. These compounds contribute to the higher fruit-like characteristic of final product. This chapter reviews metabolic activity of Kloeckera and Hanseniaspora yeasts in several aspects: fermentative capability, aromatic compounds production and transformation of aromatic precursor present in the must, also covers the molecular methods for identifying of the yeast

  13. Investigation of zinc biosorption by brewer's yeast cells

    Directory of Open Access Journals (Sweden)

    Dodić Siniša N.

    2005-01-01

    Full Text Available The highest amount of zinc (= 90% is bound after 3 hrs of contact at low initial (total concentrations of zinc in suspension of yeast, 10-100 mg/l at 10-30°C. The equilibrium between bound and free zinc ions is established after 6 hrs of contact time, independently on the total zinc concentration in yeast milk. No bigger changes of content of zinc bound to brewer's yeast cells was determined at temperatures 10°C and 30°C. 40% of bound zinc in the equilibrium state is bound during the first 15 min of contact of zinc ions and brewer's yeast cells at all initial (total zinc concentrations in suspension of yeast both at 10°C and 30°C. The "KEKAM" equation can be used for the description of kinetics of zinc biosorption by waste brewer's yeast cells, for the ranges of zinc concentration 10-100 mg/l at 30°C (mean correlation coefficient 0,96 and 60,0-100 mg/l at 10°C (mean correlation coefficient 0,95.

  14. Yeast diversity on grapes in two German wine growing regions.

    Science.gov (United States)

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-01

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples. PMID:26292165

  15. Determination of Yeasts Antimicrobial Activity in Milk and Meat Products

    Directory of Open Access Journals (Sweden)

    L.B. Roostita

    2011-12-01

    Full Text Available The research was arranged to isolate yeasts from livestock products and then the yeasts antimicrobial activity was tested towards putrefaction and pathogenic bacteria. Yeasts isolated from livestock products using Malt Extract Agar (MEA, the total yeasts population counted with using total plate count method, antimicrobial activity tested using diffusion methods against Pseudomonas aerugenes, Staphylococcus aureus and Escherichia coli and then the chosen isolate identified with using 18s RNA method. The results have shown that the total yeasts population on pasteurized cow’s milk were 1.2×106 cfu/g, fruit yoghurt 5.4×106 cfu/g, lamb meat 1×105 cfu/g, beef 1×105 cfu/g and beef sausages 1×106 cfu/g total yeasts population. Fruit yoghurt isolate shown the best antimicrobial activity with 35 mm clear zone diameter against Pseudomonas aerugenes, 8 mm clear zone diameter against Staphylococcus aureus and 10 mm clear zone diameter against Escherichia coli. The 18 s RNA test shown that fruit yoghurt isolate was 100% (FR3-F primer and 99% (FR3-R primer identical with Candida parapsilosis.

  16. Yeast diversity on grapes in two German wine growing regions.

    Science.gov (United States)

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-01

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples.

  17. Yeast Infection and Diabetes Mellitus among Pregnant Mother in Malaysia

    Science.gov (United States)

    Sopian, Iylia Liyana; Shahabudin, Sa’adiah; Ahmed, Mowaffaq Adam; Lung, Leslie Than Thian; Sandai, Doblin

    2016-01-01

    Background Vaginal yeast infection refers to irritation of the vagina due to the presence of opportunistic yeast of the genus Candida (mostly Candida albicans). About 75% of women will have at least one episode of vaginal yeast infection during their lifetime. Several studies have shown that pregnancy and uncontrolled diabetes increase the infection risk. Reproductive hormone fluctuations during pregnancy and elevated glucose levels characteristic of diabetes provide the carbon needed for Candida overgrowth and infection. The goal of this study was to determine the prevalence of vaginal yeast infection among pregnant women with and without diabetes. Methods This was a case-control study using cases reports from Kepala Batas Health Clinic, Penang State, Malaysia from 2006 to 2012. In total, 740 pregnant ladies were chosen as sample of which 370 were diabetic and 370 were non-diabetic cases. Results No relationship between diabetes and the occurrence of vaginal yeast infection in pregnant women was detected, and there was no significant association between infection and age group, race or education level. Conclusion In conclusion, within radius of this study, vaginal yeast infection can occur randomly in pregnant women.

  18. Yeasts and yeast-like fungal contaminants of water used for domestic purposes in Jos, Nigeria

    Directory of Open Access Journals (Sweden)

    Grace Mebi Ayanbimpe

    2013-01-01

    Full Text Available Water used for domestic purposes is ideally required to be free from contaminants. Various contaminants have frequently affected the quality of such water. Water samples were obtained from 150 sources including 72 wells, 60 streams, 17 taps, and one borehole, randomly selected from five residential areas in Jos, Nigeria. Structured questionnaires and one-to- one interview was used to obtain information on features of location and use of facilities in each area. Eighty (53.3% water sources were contaminated, predominantly wells (70.8%. The locations (identified in code with the highest number of contaminated sources were AGO (60.0%, GBU (56.7% and FGD (56.7%. AGD and FGD also had the highest ratio of households to one water source (25:1. Eighty- two fungi were isolated, predominantly Candida tropicalis (23.2%, Candida lipolytica (10.9% and Rhodotorula sp (9.7%. Candida lipolytica was the highest (42.9% contaminant in tap water. Rhodotorula sp was found in all types of water sources sampled. Type of water source had a significant effect (P<0.05 on the presence of some fungi in the water. The residential area (Location had a significant effect on contamination of water sources by some yeasts. Water sources for domestic use in Jos are contaminated by yeasts and yeast-like fungi. Frequency of use, exposure of the facility to dirt, and contaminations of surroundings contribute to the occurrence of fungi in water sources and, by implication, the prevalence of fungal infections.

  19. In vitro antifungal activity of fluconazole and voriconazole against non-Candida yeasts and yeast-like fungi clinical isolates.

    Science.gov (United States)

    Mandras, Narcisa; Roana, Janira; Scalas, Daniela; Fucale, Giacomo; Allizond, Valeria; Banche, Giuliana; Barbui, Anna; Li Vigni, Nicolò; Newell, Vance A; Cuffini, Anna Maria; Tullio, Vivian

    2015-10-01

    The risk of opportunistic infections caused by non-Candida yeasts and yeast-like fungi is increasingly common, mainly in immunocompromised patients. Appropriate first-line therapy has not been defined and standardized, mainly due to the low number of cases reported. To improve empirical treatment guidelines, we describe the susceptibility profile to fluconazole and voriconazole of 176 non-Candida yeasts and yeast-like fungi collected from hospitals in Piedmont, North West Italy from January 2009 to December 2013. The results showed that most isolates are susceptible to voriconazole (94%), but less susceptible to fluconazole (78%), suggesting that voriconazole could be used as first-line therapy in infections caused by these fungi.

  20. Pulsatile dynamics in the yeast proteome.

    Science.gov (United States)

    Dalal, Chiraj K; Cai, Long; Lin, Yihan; Rahbar, Kasra; Elowitz, Michael B

    2014-09-22

    The activation of transcription factors in response to environmental conditions is fundamental to cellular regulation. Recent work has revealed that some transcription factors are activated in stochastic pulses of nuclear localization, rather than at a constant level, even in a constant environment [1-12]. In such cases, signals control the mean activity of the transcription factor by modulating the frequency, duration, or amplitude of these pulses. Although specific pulsatile transcription factors have been identified in diverse cell types, it has remained unclear how prevalent pulsing is within the cell, how variable pulsing behaviors are between genes, and whether pulsing is specific to transcriptional regulators or is employed more broadly. To address these issues, we performed a proteome-wide movie-based screen to systematically identify localization-based pulsing behaviors in Saccharomyces cerevisiae. The screen examined all genes in a previously developed fluorescent protein fusion library of 4,159 strains [13] in multiple media conditions. This approach revealed stochastic pulsing in ten proteins, all transcription factors. In each case, pulse dynamics were heterogeneous and unsynchronized among cells in clonal populations. Pulsing is the only dynamic localization behavior that we observed, and it tends to occur in pairs of paralogous and redundant proteins. Taken together, these results suggest that pulsatile dynamics play a pervasive role in yeast and may be similarly prevalent in other eukaryotic species.

  1. Phyllosphere yeasts rapidly break down biodegradable plastics.

    Science.gov (United States)

    Kitamoto, Hiroko K; Shinozaki, Yukiko; Cao, Xiao-Hong; Morita, Tomotake; Konishi, Masaaki; Tago, Kanako; Kajiwara, Hideyuki; Koitabashi, Motoo; Yoshida, Shigenobu; Watanabe, Takashi; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Tsushima, Seiya

    2011-01-01

    The use of biodegradable plastics can reduce the accumulation of environmentally persistent plastic wastes. The rate of degradation of biodegradable plastics depends on environmental conditions and is highly variable. Techniques for achieving more consistent degradation are needed. However, only a few microorganisms involved in the degradation process have been isolated so far from the environment. Here, we show that Pseudozyma spp. yeasts, which are common in the phyllosphere and are easily isolated from plant surfaces, displayed strong degradation activity on films made from poly-butylene succinate or poly-butylene succinate-co-adipate. Strains of P. antarctica isolated from leaves and husks of paddy rice displayed strong degradation activity on these films at 30°C. The type strain, P. antarctica JCM 10317, and Pseudozyma spp. strains from phyllosphere secreted a biodegradable plastic-degrading enzyme with a molecular mass of about 22 kDa. Reliable source of biodegradable plastic-degrading microorganisms are now in our hands. PMID:22126328

  2. The Cell Biology of Fission Yeast Septation.

    Science.gov (United States)

    García Cortés, Juan C; Ramos, Mariona; Osumi, Masako; Pérez, Pilar; Ribas, Juan Carlos

    2016-09-01

    In animal cells, cytokinesis requires the formation of a cleavage furrow that divides the cell into two daughter cells. Furrow formation is achieved by constriction of an actomyosin ring that invaginates the plasma membrane. However, fungal cells contain a rigid extracellular cell wall surrounding the plasma membrane; thus, fungal cytokinesis also requires the formation of a special septum wall structure between the dividing cells. The septum biosynthesis must be strictly coordinated with the deposition of new plasma membrane material and actomyosin ring closure and must occur in such a way that no breach in the cell wall occurs at any time. Because of the high turgor pressure in the fungal cell, even a minor local defect might lead to cell lysis and death. Here we review our knowledge of the septum structure in the fission yeast Schizosaccharomyces pombe and of the recent advances in our understanding of the relationship between septum biosynthesis and actomyosin ring constriction and how the two collaborate to build a cross-walled septum able to support the high turgor pressure of the cell. In addition, we discuss the importance of the septum biosynthesis for the steady ingression of the cleavage furrow.

  3. Mechanical feedback stabilizes budding yeast morphogenesis

    Science.gov (United States)

    Banavar, Samhita; Trogdon, Michael; Petzold, Linda; Campas, Otger

    Walled cells have the ability to remodel their shape while sustaining an internal turgor pressure that can reach values up to 10 atmospheres. This requires a tight and simultaneous regulation of cell wall assembly and mechanochemistry, but the underlying mechanisms by which this is achieved remain unclear. Using the growth of mating projections in budding yeast (S. cerevisiae) as a motivating example, we have developed a theoretical description that couples the mechanics of cell wall expansion and assembly via a mechanical feedback. In the absence of a mechanical feedback, cell morphogenesis is inherently unstable. The presence of a mechanical feedback stabilizes changes in cell shape and growth, and provides a mechanism to prevent cell lysis in a wide range of conditions. We solve for the dynamics of the system and obtain the different dynamical regimes. In particular, we show that several parameters affect the stability of growth, including the strength of mechanical feedback in the system. Finally, we compare our results to existing experimental data.

  4. Expansion of Interstitial Telomeric Sequences in Yeast.

    Science.gov (United States)

    Aksenova, Anna Y; Han, Gil; Shishkin, Alexander A; Volkov, Kirill V; Mirkin, Sergei M

    2015-11-24

    Telomeric repeats located within chromosomes are called interstitial telomeric sequences (ITSs). They are polymorphic in length and are likely hotspots for initiation of chromosomal rearrangements that have been linked to human disease. Using our S. cerevisiae system to study repeat-mediated genome instability, we have previously shown that yeast telomeric (Ytel) repeats induce various gross chromosomal rearrangements (GCR) when their G-rich strands serve as the lagging strand template for replication (G orientation). Here, we show that interstitial Ytel repeats in the opposite C orientation prefer to expand rather than cause GCR. A tract of eight Ytel repeats expands at a rate of 4 × 10(-4) per replication, ranking them among the most expansion-prone DNA microsatellites. A candidate-based genetic analysis implicates both post-replication repair and homologous recombination pathways in the expansion process. We propose a model for Ytel repeat expansions and discuss its applications for genome instability and alternative telomere lengthening (ALT). PMID:26586439

  5. Yeast peroxisomes: structure, functions and biotechnological opportunities.

    Science.gov (United States)

    Sibirny, Andriy A

    2016-06-01

    Peroxisomes are ubiquitous organelles found in most eukaryotic cells. In yeasts, peroxisomes play important roles in cell metabolism, especially in different catabolic processes including fatty acid β-oxidation, the glyoxylic shunt and methanol metabolism, as well as some biosynthetic processes. In addition, peroxisomes are the compartment in which oxidases and catalase are localized. New peroxisomes mainly arise by fission of pre-existing ones, although they can also be formed from the endoplasmic reticulum (ER). Peroxisomes consist of matrix-soluble proteins and membrane proteins known as peroxins. A total of 34 PEX peroxin genes and proteins have been identified to date. and their functions have been elucidated. Protein import into peroxisomes depends on peroxins and requires specific signals in the structure of transported proteins: PTS1, PTS2 and mPTS. The mechanisms of metabolite penetration into peroxisomes are still poorly understood. Peroxisome number and the volume occupied by these organelles are tightly regulated. Methanol, fatty acids and methylamine act as efficient peroxisome proliferators, whereas glucose and ethanol induce peroxisome autophagic degradation (pexophagy). To date, 42 Atg proteins involved in pexophagy are known. Catabolism and alcoholic fermentation of the major pentose sugar, xylose, depend on peroxisomal enzymes. Overexpression of peroxisomal transketolase and transaldolase activates xylose fermentation. Peroxisomes could be useful as target organelles for overexpression of foreign toxic proteins. PMID:27189367

  6. [Invasive yeast infections in severely burned patients].

    Science.gov (United States)

    Renau, Ana Isabel; García-Vidal, Carolina; Salavert, Miguel

    2016-01-01

    Currently, there are few studies on candidaemia in the severely burned patient. These patients share the same risk factors for invasive fungal infections as other critically ill patients, but have certain characteristics that make them particularly susceptible. These include the loss of skin barrier due to extensive burns, fungal colonisation of the latter, and the use of hydrotherapy or other topical therapies (occasionally with antimicrobials). In addition, the increased survival rate achieved in recent decades in critically burned patients due to the advances in treatment has led to the increase of invasive Candida infections. This explains the growing interest in making an earlier and more accurate diagnosis, as well as more effective treatments to reduce morbidity and mortality of candidaemia in severe burned patients. A review is presented on all aspects of the burned patient, including the predisposition and risk factors for invasive candidiasis, pathogenesis of candidaemia, underlying immunodeficiency, local epidemiology and antifungal susceptibility, evolution and prognostic factors, as well as other non-Candida yeast infections. Finally, we include specific data on our local experience in the management of candidaemia in severe burned patients, which may serve to quantify the problem, place it in context, and offer a realistic perspective. PMID:27395025

  7. Metals uptake by live yeast and heat-modified yeast residue

    Directory of Open Access Journals (Sweden)

    Geórgia Labuto

    2015-07-01

    Full Text Available This study evaluated the biosorption of Cd2+, Cr3+, Pb2+ and Cu2+ at pHs 3, 4, 5 and 6 for Saccharomyces cerevisiae both alive and biologically inactivated by different heating procedures (oven, autoclave or spray dry technique originated from alcohol industry. The material inactivated by autoclave (IA, at 120°C, 30 min had the best performance for metals uptake: 1.88 ± 0.07 (Cu2+, 2.22 ± 0.02 (Cr3+ and 1.57 ± 0.08 g kg-1 (Pb2+. For Cd2+; while the material inactivated by spray dry (RY presented the higher sorption capacity, 2.30 ± 0.08 g kg-1. The sorption studies showed that the biosorbent materials presented different sorption capacities and an ideal sorption pH. The sorption sites were investigated by potentiometric titration and FT-IR and showed that different heating processes used to inactivate biological samples produce materials with different characteristics and with a diverse sorption capacity due to modification of the available sorption sites. This suggests that inactivation by heating can be an alternative to improve the performance of biosorbents. The main sorption sites for each material were phenolic for live yeast (LY and carboxylic for yeast inactivated by heating in an autoclave (IA.

  8. Mechanisms of uv mutagenesis in yeast and E. coli

    Energy Technology Data Exchange (ETDEWEB)

    Lawrence, C.; Christensen, R.; Christensen, J.R.; O' Brien, T.

    1983-01-01

    Experiments investigating ultraviolet light mutagenesis in either bakers' yeast, Saccharomyces cerevisiae, or E. coli have led to the following conclusions. First, cyclobutane pyrimidine dimers cause most mutations in both organisms; pyrimidine adducts, such as PyC, can account at best for only a small proportion. 86 percent of forward mutations induced at the E. coli lacI locus can be abolished by photoreactivation under conditions which do not alter the level of recA induction. About 75 percent of the forward mutations induced at the CAN1 locus of yeast could be removed by photoreactivation, a value that lies within the range observed previously for the reversion of CYC1 alleles (60 percent - 97 percent). Second, about 10 percent of the lacI forward mutations are untargeted, a smaller fraction than found previously for cycl-91 reversion in yeast. It is not yet clear whether the two species are really different in this respect, of whether the cycl-91 reversion site is a typical of the yeast genome at large. Third, analysis of reversion frequencies of 20 mutant alleles suggests that about 10 to 25 percent of all replication errors produced by mutagenic mechanisms in uv-irradiated yeast involve additions or deletions of base-pairs, indicating that error-prone repair does not just produce substitutions. Last, the REV1 locus in yeast is concerned with the induction of frameshift mutations at some, but not all, genetic sites, just as found previously for substitution mutations. The function of the REV3 gene is more widely, though not universally, required while the function of the RAD6 gene, like that of the recA locus in E. coli, appears to be necessary for all kinds of uv mutagenesis. E coli genes comparable to REV1 and REV3 have not yet been described; conversely, there does not yet appear to be a yeast equivalent of umuC.

  9. Potential Application of Yeast β-Glucans in Food Industry

    Directory of Open Access Journals (Sweden)

    Vesna Zechner-Krpan

    2014-02-01

    Full Text Available Normal 0 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} Different β-glucans are found in a variety of natural sources such as bacteria, yeast, algae, mushrooms, barley and oat. They have potential use in medicine and pharmacy, food, cosmetic and chemical industries, in veterinary medicine and feed production. The use of different β-glucans in food industry and their main characteristics important for food production are described in this paper. This review focuses on beneficial properties and application of β-glucans isolated from different yeasts, especially those that are considered as waste from brewing industry. Spent brewer’s yeast, a by-product of beer production, could be used as a raw-material for isolation of β-glucan. In spite of the fact that large quantities of brewer’s yeast are used as a feedstuff , certain quantities are still treated as a liquid waste. β-Glucan is one of the compounds that can achieve a greater commercial value than the brewer’s yeast itself and maximize the total profitability of the brewing process. β-Glucan isolated from spent brewer’s yeast possesses properties that are benefi cial for food production. Therefore, the use of spent brewer’s yeast for isolation of β-glucan intended for food industry would represent a payable technological and economical choice for breweries.

  10. Solving ethanol production problems with genetically modified yeast strains

    Directory of Open Access Journals (Sweden)

    A. Abreu-Cavalheiro

    2013-09-01

    Full Text Available The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.

  11. Analysis of Arabidopsis glutathione-transferases in yeast.

    Science.gov (United States)

    Krajewski, Matthias P; Kanawati, Basem; Fekete, Agnes; Kowalski, Natalie; Schmitt-Kopplin, Philippe; Grill, Erwin

    2013-07-01

    The genome of Arabidopsis thaliana encodes 54 functional glutathione transferases (GSTs), classified in seven clades. Although plant GSTs have been implicated in the detoxification of xenobiotics, such as herbicides, extensive redundancy within this large gene family impedes a functional analysis in planta. In this study, a GST-deficient yeast strain was established as a system for analyzing plant GSTs that allows screening for GST substrates and identifying substrate preferences within the plant GST family. To this end, five yeast genes encoding GSTs and GST-related proteins were simultaneously disrupted. The resulting yeast quintuple mutant showed a strongly reduced conjugation of the GST substrates 1-chloro-2,4-dinitrobenzene (CDNB) and 4-chloro-7-nitro-2,1,3-benzoxadiazole (NBD-Cl). Consistently, the quintuple mutant was hypersensitive to CDNB, and this phenotype was complemented by the inducible expression of Arabidopsis GSTs. The conjugating activity of the plant GSTs was assessed by in vitro enzymatic assays and via analysis of exposed yeast cells. The formation of glutathione adducts with dinitrobenzene was unequivocally verified by stable isotope labeling and subsequent accurate ultrahigh-resolution mass spectrometry (ICR-FTMS). Analysis of Arabidopsis GSTs encompassing six clades and 42 members demonstrated functional expression in yeast by using CDNB and NBD-Cl as model substrates. Subsequently, the established yeast system was explored for its potential to screen the Arabidopsis GST family for conjugation of the fungicide anilazine. Thirty Arabidopsis GSTs were identified that conferred increased levels of glutathionylated anilazine. Efficient anilazine conjugation was observed in the presence of the phi, tau, and theta clade GSTs including AtGSTF2, AtGSTF4, AtGSTF6, AtGSTF8, AtGSTF10, and AtGSTT2, none of which had previously been known to contribute to fungicide detoxification. ICR-FTMS analysis of yeast extracts allowed the simultaneous detection and

  12. Pollutant removal-oriented yeast biomass production from high-organic-strength industrial wastewater: A review

    International Nuclear Information System (INIS)

    Microbial single-cell-protein (SCP) production from high-organic-strength industrial wastewaters is considered an attractive method for both wastewater purification and resource utilization. In the last two decades, pollutant removal-oriented yeast SCP production processes, i.e., yeast treatment processes, have attracted a great deal of attention from a variety of research groups worldwide. Different from conventional SCP production processes, yeast treatment processes are characterized by higher pollutant removal rates, lower production costs, highly adaptive yeast isolates from nature, no excess nutrient supplements, and are performed under non-sterile conditions. Furthermore, yeast treatment processes are similar to bacteria-dominated conventional activated sludge processes, which offer more choices for yeast SCP production and industrial wastewater treatment. This review discusses why highly adaptive yeast species isolated from nature are used in the yeast treatment process rather than commercial SCP producers. It also describes the application of yeast treatment processes for treating high-carboxyhydrate, oil-rich and high-salinity industrial wastewater, focusing primarily on high-strength biodegradable organic substances, which usually account for the major fraction of biochemical oxygen demand. Also discussed is the biodegradation of xenobiotics, such as color (including dye and pigment) and toxic substances (including phenols, chlorophenols, polycyclic aromatic hydrocarbons, etc.), present in industrial wastewater. Based on molecular information of yeast community structures and their regulation in yeast treatment systems, we also discuss how to maintain efficient yeast species in yeast biomass and how to control bacterial and mold proliferation in yeast treatment systems. - Highlights: • Pollutant removal-oriented yeast SCP production processes offer more choices. • Highly adaptive yeast isolates replace commercial SCP producers. • Yeasts degrade

  13. Yeast retrotransposon particles as antigen delivery systems.

    Science.gov (United States)

    Kingsman, A J; Burns, N R; Layton, G T; Adams, S E

    1995-05-31

    The development of technologies to produce recombinant proteins for use in the pharmaceutical industry has made substantial advances, in particular in the area of generating antigens containing multiple copies of important immunological regions. One such antigen-carrier system is based on the ability of a protein encoded by the yeast retrotransposon, Ty, to self-assemble into virus-like particles. Ty-fusion proteins retain this ability to form particles, and a range of hybrid VLPs carrying a variety of heterologous antigens have been produced and shown to induce potent immune responses. In particular, hybrid VLPs carrying the core protein p24 of HIV (p24-VLPs) have been shown to induce antibody and T-cell proliferative responses in both experimental animals and human volunteers, and immunization of rabbits with VLPs carrying the principal neutralizing determinant of HIV (V3-VLPs) resulted in the induction of neutralizing antibody responses and T-cell proliferation. Further studies with V3-VLPs have shown that this particulate antigen stimulates enhanced V3-specific lymphoproliferative responses as compared to whole recombinant gp120 or to V3 peptide conjugated to albumin. The V3-VLPs also induce potent CTL responses following immunization of mice in the absence of adjuvant. These responses are MHC class I restricted and are mediated by CD8-positive cells. These observations therefore demonstrate that hybrid Ty-VLPs induce both humoral and cellular immune responses against HIV and suggest that these immunogens may be important in combatting AIDS and other infections. PMID:7625653

  14. Intermembrane space proteome of yeast mitochondria.

    Science.gov (United States)

    Vögtle, F-Nora; Burkhart, Julia M; Rao, Sanjana; Gerbeth, Carolin; Hinrichs, Jens; Martinou, Jean-Claude; Chacinska, Agnieszka; Sickmann, Albert; Zahedi, René P; Meisinger, Chris

    2012-12-01

    The intermembrane space (IMS) represents the smallest subcompartment of mitochondria. Nevertheless, it plays important roles in the transport and modification of proteins, lipids, and metal ions and in the regulation and assembly of the respiratory chain complexes. Moreover, it is involved in many redox processes and coordinates key steps in programmed cell death. A comprehensive profiling of IMS proteins has not been performed so far. We have established a method that uses the proapoptotic protein Bax to release IMS proteins from isolated mitochondria, and we profiled the protein composition of this compartment. Using stable isotope-labeled mitochondria from Saccharomyces cerevisiae, we were able to measure specific Bax-dependent protein release and distinguish between quantitatively released IMS proteins and the background efflux of matrix proteins. From the known 31 soluble IMS proteins, 29 proteins were reproducibly identified, corresponding to a coverage of >90%. In addition, we found 20 novel intermembrane space proteins, out of which 10 had not been localized to mitochondria before. Many of these novel IMS proteins have unknown functions or have been reported to play a role in redox regulation. We confirmed IMS localization for 15 proteins using in organello import, protease accessibility upon osmotic swelling, and Bax-release assays. Moreover, we identified two novel mitochondrial proteins, Ymr244c-a (Coa6) and Ybl107c (Mic23), as substrates of the MIA import pathway that have unusual cysteine motifs and found the protein phosphatase Ptc5 to be a novel substrate of the inner membrane protease (IMP). For Coa6 we discovered a role as a novel assembly factor of the cytochrome c oxidase complex. We present here the first and comprehensive proteome of IMS proteins of yeast mitochondria with 51 proteins in total. The IMS proteome will serve as a valuable source for further studies on the role of the IMS in cell life and death.

  15. Ethanol production using nuclear petite yeast mutants

    Energy Technology Data Exchange (ETDEWEB)

    Hutter, A.; Oliver, S.G. [Department of Biomolecular Sciences, UMIST, Manchester (United Kingdom)

    1998-12-31

    Two respiratory-deficient nuclear petites, FY23{Delta}pet191 and FY23{Delta}cox5a, of the yeast Saccharomyces cerevisiae were generated using polymerase-chain-reaction-mediated gene disruption, and their respective ethanol tolerance and productivity assessed and compared to those of the parental grande, FY23WT, and a mitochondrial petite, FY23{rho}{sup 0}. Batch culture studies demonstrated that the parental strain was the most tolerant to exogenously added ethanol with an inhibition constant. K{sub i}, of 2.3% (w/v) and a specific rate of ethanol production, q{sub p}, of 0.90 g ethanol g dry cells{sup -1} h{sup -1}. FY23{rho}{sup 0} was the most sensitive to ethanol, exhibiting a K{sub i} of 1.71% (w/v) and q{sub p} of 0.87 g ethanol g dry cells{sup -1} h{sup -1}. Analyses of the ethanol tolerance of the nuclear petites demonstrate that functional mitochondria are essential for maintaining tolerance to the toxin with the 100% respiratory-deficient nuclear petite, FY23{Delta}pet191, having a K{sub i} of 2.14% (w/v) and the 85% respiratory-deficient FY23{Delta}cox5a, having a K{sub i} of 1.94% (w/v). The retention of ethanol tolerance in the nuclear petites as compared to that of FY23{rho}{sup 0} is mirrored by the ethanol productivities of these nuclear mutants, being respectively 43% and 30% higher than that of the respiratory-sufficient parent strain. This demonstrates that, because of their respiratory deficiency, the nuclear petites are not subject of the Pasteur effect and so exhibit higher rates of fermentation. (orig.)

  16. Performance of dairy females fed dried yeast from sugar cane

    Directory of Open Access Journals (Sweden)

    Marcia de Oliveira Franco

    2016-05-01

    Full Text Available This study was performed in order to evaluate the effect of dried yeast from sugar cane when replacing soybean meal in dairy heifers’ diets. Twenty-four heifers, with an initial body weight (BW of 178 kg, were distributed in a completely randomized design. The treatments were four levels of inclusion of dried yeast from sugar cane replacing to soybean meal (0, 33, 67 and 100% on a dry matter (DM basis. While there was no difference in DM, neutral detergent fiber (NDF, metabolizable energy or roughage intakes, the intakes of non-fiber carbohydrates and concentrate were increased. The crude protein intake decreased according to the dried yeast from sugar cane when replacing soybean meal. The digestibility coefficients of DM and NDF showed no difference. Replacement of soybean meal with dried yeast from sugar cane had no effect on performance, because average daily gain and body measurements studied were similar for all animals and inclusion levels. Soybean meal can be completely replaced with dried yeast from sugar cane in diets for growing dairy heifers without restrictions; this will not affect the intake, digestibility, physical development of animals or metabolization of protein compounds.

  17. Discovery of a nucleocytoplasmic O-mannose glycoproteome in yeast

    DEFF Research Database (Denmark)

    Halim, Adnan; Larsen, Ida Signe Bohse; Neubert, Patrick;

    2015-01-01

    Dynamic cycling of N-Acetylglucosamine (GlcNAc) on serine and threonine residues (O-GlcNAcylation) is an essential process in all eukaryotic cells except yeast, including Saccharomyces cerevisiae and Schizosaccharomyces pombe. O-GlcNAcylation modulates signaling and cellular processes in an intri......Dynamic cycling of N-Acetylglucosamine (GlcNAc) on serine and threonine residues (O-GlcNAcylation) is an essential process in all eukaryotic cells except yeast, including Saccharomyces cerevisiae and Schizosaccharomyces pombe. O-GlcNAcylation modulates signaling and cellular processes...... in an intricate interplay with protein phosphorylation and serves as a key sensor of nutrients by linking the hexosamine biosynthetic pathway to cellular signaling. A longstanding conundrum has been how yeast survives without O-GlcNAcylation in light of its similar phosphorylation signaling system. We previously...... the workflow to yeast with the aim to characterize the yeast O-Man glycoproteome, and in doing so, we discovered hitherto unknown O-Man glycosites on nuclear, cytoplasmic, and mitochondrial proteins in S. cerevisiae and S. pombe. Such O-Man glycoproteins were not found in our analysis of human cell lines...

  18. Yeast selection for fuel ethanol production in Brazil.

    Science.gov (United States)

    Basso, Luiz C; de Amorim, Henrique V; de Oliveira, Antonio J; Lopes, Mario L

    2008-11-01

    Brazil is one of the largest ethanol biofuel producers and exporters in the world and its production has increased steadily during the last three decades. The increasing efficiency of Brazilian ethanol plants has been evident due to the many technological contributions. As far as yeast is concerned, few publications are available regarding the industrial fermentation processes in Brazil. The present paper reports on a yeast selection program performed during the last 12 years aimed at selecting Saccharomyces cerevisiae strains suitable for fermentation of sugar cane substrates (cane juice and molasses) with cell recycle, as it is conducted in Brazilian bioethanol plants. As a result, some evidence is presented showing the positive impact of selected yeast strains in increasing ethanol yield and reducing production costs, due to their higher fermentation performance (high ethanol yield, reduced glycerol and foam formation, maintenance of high viability during recycling and very high implantation capability into industrial fermenters). Results also suggest that the great yeast biodiversity found in distillery environments could be an important source of strains. This is because during yeast cell recycling, selective pressure (an adaptive evolution) is imposed on cells, leading to strains with higher tolerance to the stressful conditions of the industrial fermentation. PMID:18752628

  19. Influence of sodium chloride on wine yeast fermentation performance

    Directory of Open Access Journals (Sweden)

    Stilianos Logothetis

    2010-06-01

    Full Text Available Stilianos Logothetis1, Elias T Nerantzis2, Anna Gioulioti3, Tasos Kanelis2, Tataridis Panagiotis2, Graeme Walker11University of Abertay Dundee, School of Contemporary Sciences, Dundee, Scotland; 2TEI of Athens Department of Oenology and Spirit Technology, Biotechnology and Industrial Fermentations Lab Agiou Spiridonos, Athens, Greece; 3Ampeloiniki SA Industrial Park Thermi, Thessaloniki, GreeceAbstract: This paper concerns research into the influence of salt (sodium chloride on growth, viability and fermentation performance in a winemaking strain of the yeast, Saccharomyces cerevisiae. Experimental fermentations were conducted in both laboratory-scale and industrial-scale experiments. Preculturing yeasts in elevated levels of sodium chloride, or salt “preconditioning” led to improved fermentation performance. This was manifest by preconditioned yeasts having an improved capability to ferment high-sugar containing media with increased cell viability and with elevated levels of produced ethanol. Salt-preconditioning most likely influenced the stress-tolerance of yeasts by inducing the synthesis of key metabolites such as trehalose and glycerol. These compounds may act to improve cells’ ability to withstand osmostress and ethanol toxicity during fermentations of grape must. Industrial-scale trials using salt-preconditioned yeasts verified the benefit of this novel physiological cell engineering approach to practical winemaking fermentations.Keywords: salt, preconditioning, fermentation performance, Saccharomyces cerevisiae, wine

  20. New lager yeast strains generated by interspecific hybridization.

    Science.gov (United States)

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2015-05-01

    The interspecific hybrid Saccharomyces pastorianus is the most commonly used yeast in brewery fermentations worldwide. Here, we generated de novo lager yeast hybrids by mating a domesticated and strongly flocculent Saccharomyces cerevisiae ale strain with the Saccharomyces eubayanus type strain. The hybrids were characterized with respect to the parent strains in a wort fermentation performed at temperatures typical for lager brewing (12 °C). The resulting beers were analysed for sugar and aroma compounds, while the yeasts were tested for their flocculation ability and α-glucoside transport capability. These hybrids inherited beneficial properties from both parent strains (cryotolerance, maltotriose utilization and strong flocculation) and showed apparent hybrid vigour, fermenting faster and producing beer with higher alcohol content (5.6 vs 4.5 % ABV) than the parents. Results suggest that interspecific hybridization is suitable for production of novel non-GM lager yeast strains with unique properties and will help in elucidating the evolutionary history of industrial lager yeast. PMID:25682107