WorldWideScience

Sample records for carotenogenic basidiomycetous yeasts

  1. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  2. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  3. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  4. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  5. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    Science.gov (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  6. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  7. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  8. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  9. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

    Science.gov (United States)

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

    2015-07-01

    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  10. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  11. Cryptococcus haglerorum, sp. nov., an anamorphic basidiomycetous yeast isolated from nests of the leaf-cutting ant Atta sexdens.

    NARCIS (Netherlands)

    Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.

    2003-01-01

    A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus

  12. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  13. Fungicide selective for basidiomycetes.

    Science.gov (United States)

    Edgington, L V; Walton, G S; Miller, P M

    1966-07-15

    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  14. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  15. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  16. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea

    OpenAIRE

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-01-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, th...

  17. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  18. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  19. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.

  20. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

    Science.gov (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

    2014-01-01

    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  1. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  2. Ethylene regulation of carotenoid accumulation and carotenogenic gene expression in colour-contrasted apricot varieties (Prunus armeniaca).

    Science.gov (United States)

    Marty, I; Bureau, S; Sarkissian, G; Gouble, B; Audergon, J M; Albagnac, G

    2005-07-01

    In order to elucidate the regulation mechanisms of carotenoid biosynthesis in apricot fruit (Prunus armeniaca), carotenoid content and carotenogenic gene expression were analysed as a function of ethylene production in two colour-contrasted apricot varieties. Fruits from Goldrich (GO) were orange, while Moniqui (MO) fruits were white. Biochemical analysis showed that GO accumulated precursors of the uncoloured carotenoids, phytoene and phytofluene, and the coloured carotenoid, beta-carotene, while Moniqui (MO) fruits only accumulated phytoene and phytofluene but no beta-carotene. Physiological analysis showed that ethylene production was clearly weaker in GO than in MO. Carotenogenic gene expression (Psy-1, Pds, and Zds) and carotenoid accumulation were measured with respect to ethylene production which is initiated in mature green fruits at the onset of the climacteric stage or following exo-ethylene or ethylene-receptor inhibitor (1-MCP) treatments. Results showed (i) systematically stronger expression of carotenogenic genes in white than in orange fruits, even for the Zds gene involved in beta-carotene synthesis that is undetectable in MO fruits, (ii) ethylene-induction of Psy-1 and Pds gene expression and the corresponding product accumulation, (iii) Zds gene expression and beta-carotene production independent of ethylene. The different results obtained at physiological, biochemical, and molecular levels revealed the complex regulation of carotenoid biosynthesis in apricots and led to suggestions regarding some possible ways to regulate it.

  3. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  4. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  5. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  6. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  7. Proteomic analysis of Rhodotorula mucilaginosa: dealing with the issues of a non-conventional yeast.

    Science.gov (United States)

    Addis, Maria Filippa; Tanca, Alessandro; Landolfo, Sara; Abbondio, Marcello; Cutzu, Raffaela; Biosa, Grazia; Pagnozzi, Daniela; Uzzau, Sergio; Mannazzu, Ilaria

    2016-08-01

    Red yeasts ascribed to the species Rhodotorula mucilaginosa are gaining increasing attention, due to their numerous biotechnological applications, spanning carotenoid production, liquid bioremediation, heavy metal biotransformation and antifungal and plant growth-promoting actions, but also for their role as opportunistic pathogens. Nevertheless, their characterization at the 'omic' level is still scarce. Here, we applied different proteomic workflows to R. mucilaginosa with the aim of assessing their potential in generating information on proteins and functions of biotechnological interest, with a particular focus on the carotenogenic pathway. After optimization of protein extraction, we tested several gel-based (including 2D-DIGE) and gel-free sample preparation techniques, followed by tandem mass spectrometry analysis. Contextually, we evaluated different bioinformatic strategies for protein identification and interpretation of the biological significance of the dataset. When 2D-DIGE analysis was applied, not all spots returned a unambiguous identification and no carotenogenic enzymes were identified, even upon the application of different database search strategies. Then, the application of shotgun proteomic workflows with varying levels of sensitivity provided a picture of the information depth that can be reached with different analytical resources, and resulted in a plethora of information on R. mucilaginosa metabolism. However, also in these cases no proteins related to the carotenogenic pathway were identified, thus indicating that further improvements in sequence databases and functional annotations are strictly needed for increasing the outcome of proteomic analysis of this and other non-conventional yeasts. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  9. Differential expression of carotenogenic genes, associated changes on astaxanthin production and photosynthesis features induced by JA in H. pluvialis.

    Directory of Open Access Journals (Sweden)

    Zhengquan Gao

    Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.

  10. Production of β-ionone by combined expression of carotenogenic and plant CCD1 genes in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Lopez, Javiera; Essus, Karen; Kim, Il-Kwon

    2015-01-01

    cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods.......Background: Apocarotenoids, like the C13-norisoprenoids, are natural compounds that contribute to the flavor and/or aroma of flowers and foods. They are produced in aromatic plants-like raspberries and roses-by the enzymatic cleavage of carotenes. Due to their pleasant aroma and flavour...

  11. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  12. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  13. CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.

    Science.gov (United States)

    Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria

    2018-01-01

    A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.

  14. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  15. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  16. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  17. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  18. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    OpenAIRE

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-01-01

    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  19. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  20. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

    Science.gov (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

    2007-04-01

    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  1. The yeast flora of some decaying mushrooms on trunks of living trees

    OpenAIRE

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

  2. Functional analysis of multiple carotenogenic genes from Lycium barbarum and Gentiana lutea L. for their effects on beta-carotene production in transgenic tobacco.

    Science.gov (United States)

    Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping

    2009-02-01

    Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.

  3. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  4. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Manipulation of culture conditions alters lipid content and fatty acid profiles of a wide variety of known and new oleaginous yeasts species

    Science.gov (United States)

    Sitepu, Irnayuli R.; Sestric, Ryan; Ignatia, Laura; Levin, David; German, J. Bruce; Gillies, Laura A.; Almada, Luis A.G.; Boundy-Mills, Kyria L.

    2013-01-01

    Oleaginous yeasts have been studied for oleochemical production for over 80 years. Only a few species have been studied intensely. To expand the diversity of oleaginous yeasts available for lipid research, we surveyed a broad diversity of yeasts with indicators of oleaginicity including known oleaginous clades, and buoyancy. Sixty-nine strains representing 17 genera and 50 species were screened for lipid production. Yeasts belonged to Ascomycota families, Basidiomycota orders, and the yeast-like algal genus Prototheca. Total intracellular lipids and fatty acid composition were determined under different incubation times and nitrogen availability. Thirteen new oleaginous yeast species were discovered, representing multiple ascomycete and basidiomycete clades. Nitrogen starvation generally increased intracellular lipid content. The fatty acid profiles varied with the growth conditions regardless of taxonomic affiliation. The dominant fatty acids were oleic acid, palmitic acid, linoleic acid, and stearic acid. Yeasts and culture conditions that produced fatty acids appropriate for biodiesel were identified. PMID:23891835

  6. Manipulation of culture conditions alters lipid content and fatty acid profiles of a wide variety of known and new oleaginous yeast species.

    Science.gov (United States)

    Sitepu, Irnayuli R; Sestric, Ryan; Ignatia, Laura; Levin, David; German, J Bruce; Gillies, Laura A; Almada, Luis A G; Boundy-Mills, Kyria L

    2013-09-01

    Oleaginous yeasts have been studied for oleochemical production for over 80 years. Only a few species have been studied intensely. To expand the diversity of oleaginous yeasts available for lipid research, we surveyed a broad diversity of yeasts with indicators of oleaginicity including known oleaginous clades, and buoyancy. Sixty-nine strains representing 17 genera and 50 species were screened for lipid production. Yeasts belonged to Ascomycota families, Basidiomycota orders, and the yeast-like algal genus Prototheca. Total intracellular lipids and fatty acid composition were determined under different incubation times and nitrogen availability. Thirteen new oleaginous yeast species were discovered, representing multiple ascomycete and basidiomycete clades. Nitrogen starvation generally increased intracellular lipid content. The fatty acid profiles varied with the growth conditions regardless of taxonomic affiliation. The dominant fatty acids were oleic acid, palmitic acid, linoleic acid, and stearic acid. Yeasts and culture conditions that produced fatty acids appropriate for biodiesel were identified. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Two yeast species Cystobasidium psychroaquaticum f.a. sp. nov. and Cystobasidium rietchieii f.a. sp. nov. isolated from natural environments, and the transfer of Rhodotorula minuta clade members to the genus Cystobasidium

    NARCIS (Netherlands)

    Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D

    Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic

  8. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

    Science.gov (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

    2008-07-01

    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

  9. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  10. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  11. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  12. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  13. Yeasts associated with fresh and frozen pulps of Brazilian tropical fruits.

    Science.gov (United States)

    Trindade, Rita C; Resende, Maria Aparecida; Silva, Claudia M; Rosa, Carlos A

    2002-08-01

    The occurrence of yeasts on ripe fruits and frozen pulps of pitanga (Eugenia uniflora L), mangaba (Hancornia speciosa Gom.), umbu (Spondias tuberosa Avr. Cam.), and acerola (Malpighia glaba L) was verified. The incidence of proteolytic, pectinolytic, and mycocinogenic yeasts on these communities was also determined. A total of 480 colonies was isolated and grouped in 405 different strains. These corresponded to 42 ascomycetous and 28 basidiomycetous species. Candida sorbosivorans, Pseudozyma antarctica, C. spandovensis-like, C. spandovensis, Kloeckera apis, C. parapsilosis, Rhodotorula graminis, Kluyveromyces marxianus, Cryptococcus laurentii, Metchnikowia sp (isolated only from pitanga ripe fruits), Issatchenkia occidentalis and C. krusei (isolated only from mangaba frozen pulps), were the most frequent species. The yeast communities from pitanga ripe fruits exhibited the highest frequency of species, followed by communities from acerola ripe fruits and mangaba frozen pulps. Yeast communities from frozen pulp and ripe fruits of umbu had the lowest number of species. Except the yeasts from pitanga, yeast communities from frozen pulp exhibited higher number of yeasts than ripe fruit communities. Mycocinogenic yeasts were found in all of the substrates studied except in communities from umbu ripe fruits and pitanga frozen pulps. Most of the yeasts found to produce mycocins were basidiomycetes and included P. antarctica, Cryptococcus albidus, C. bhutanensis-like, R. graminis and R. mucilaginosa-like from pitanga ripe fruits as well as black yeasts from pitanga and acerola ripe fruits. The umbu frozen pulps community had the highest frequency of proteolytic species. Yeasts able to hydrolyse casein at pH 5.0 represented 38.5% of the species isolated. Thirty-seven percent of yeast isolates were able to hydrolyse casein at pH 7.0. Pectinolytic yeasts were found in all of the communities studied, excepted for those of umbu frozen pulps. The highest frequency of

  14. Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, J R; An, C H; Yuan, J M

    2005-01-01

    The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

  15. Polyphenolic substrates and dyes degradation by yeasts from 25 de Mayo/King George Island (Antarctica).

    Science.gov (United States)

    Rovati, José I; Pajot, Hipólito F; Ruberto, Lucas; Mac Cormack, Walter; Figueroa, Lucía I C

    2013-11-01

    Antarctica offers a range of extreme climatic conditions, such as low temperatures, high solar radiation and low nutrient availability, and constitutes one of the harshest environments on Earth. Despite that, it has been successfully colonized by ’cold-loving’ fungi, which play a key role in decomposition cycles in cold ecosystems. However, knowledge about the ecological role of yeasts in nutrient or organic matter recycling/mineralization remains highly fragmentary. The aim of this work was to study the yeast microbiota in samples collected on 25 de Mayo/King George Island regarding the scope of their ability to degrade polyphenolic substrates such as lignin and azo dyes. Sixty-one yeast isolates were obtained from 37 samples, including soil, rocks, wood and bones. Molecular analyses based on rDNA sequences revealed that 35 yeasts could be identified at the species level and could be classified in the genera Leucosporidiella, Rhodotorula, Cryptococcus, Bullera and Candida. Cryptococcus victoriae was by far the most ubiquitous species. In total, 33% of the yeast isolates examined showed significant activity for dye decolorization, 25% for laccase activity and 38% for ligninolytic activity. Eleven yeasts did not show positive activity in any of the assays performed and no isolates showed positive activity across all tested substrates. A high diversity of yeasts were isolated in this work, possibly including undescribed species and conspicuous Antarctic yeasts, most of them belonging to oligotrophic, slow-growing and metabolically diverse basidiomycetous genera.

  16. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  17. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

    Science.gov (United States)

    Terekhova, V A; Semenova, T A

    2005-01-01

    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  18. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  19. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  20. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  1. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  2. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  3. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  5. Cystobasidiomycetes yeasts from Patagonia (Argentina): description of Rhodotorula meli sp. nov. from glacial meltwater.

    Science.gov (United States)

    Libkind, Diego; Sampaio, José Paulo; van Broock, Maria

    2010-09-01

    A basidiomycetous yeast, strain CRUB 1032(T), which formed salmon-pink colonies, was isolated from glacial meltwater in Patagonia, Argentina. Morphological, physiological and biochemical characterization indicated that this strain belonged to the genus Rhodotorula. Molecular taxonomic analysis based on the 26S rDNA D1/D2 domain and internal transcribed spacer region sequences showed that strain CRUB 1032(T) represents an undescribed yeast species, for which the name Rhodotorula meli sp. nov. is proposed (type strain is CRUB 1032(T)=CBS 10797(T)=JCM 15319(T)). Phylogenetic analysis showed that Rhodotorula lamellibrachii was the closest known species, which, together with R. meli, formed a separate cluster related to the Sakaguchia clade within the Cystobasidiomycetes. Additional Patagonian yeast isolates of the class Cystobasidiomycetes are also investigated in the present work.

  6. Genome sequence of the oleaginous yeast Rhodotorula toruloides strain CGMCC 2.1609

    Directory of Open Access Journals (Sweden)

    Christine Sambles

    2017-09-01

    Full Text Available Most eukaryotic oleaginous species are yeasts and among them the basidiomycete red yeast, Rhodotorula (Rhodosporidium toruloides (Pucciniomycotina is known to produce high quantities of lipids when grown in nitrogen-limiting media, and has potential for biodiesel production. The genome of the CGMCC 2.1609 strain of this oleaginous red yeast was sequenced using a hybrid of Roche 454 and Illumina technology generating 13× coverage. The de novo assembly was carried out using MIRA and scaffolded using MAQ and BAMBUS. The sequencing and assembly resulted in 365 scaffolds with total genome size of 33.4 Mb. The complete genome sequence of this strain was deposited in GenBank and the accession number is LKER00000000. The annotation is available on Figshare (doi:10.6084/m9.figshare.4754251.

  7. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species.

    Directory of Open Access Journals (Sweden)

    Patricia Valente

    Full Text Available BACKGROUND: Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. METHODOLOGY/PRINCIPAL FINDINGS: The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. CONCLUSIONS/SIGNIFICANCE: In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364(T  =  DBVPG 4489(T, Bandoniozyma aquatica sp. nov. (UFMG-DH4.20(T  =  CBS 12527(T  =  ATCC MYA-4876(T, Bandoniozyma complexa sp. nov. (CBS 11570(T  =  ATCC MYA-4603(T  =  MA28a(T, Bandoniozyma fermentans sp. nov. (CBS 12399(T  =  NU7M71(T  =  BCRC 23267(T, Bandoniozyma glucofermentans sp. nov. (CBS 10381(T  =  NRRL Y-48076(T  =  ATCC MYA-4760(T  =  BG 02-7-15-015A-1-1(T, Bandoniozyma tunnelae sp. nov. (CBS 8024(T  =  DBVPG 7000(T, and Bandoniozyma visegradensis sp. nov. (CBS 12505(T  =  NRRL Y-48783(T  =  NCAIM Y.01952(T.

  8. Prions in yeast

    OpenAIRE

    Bezdíčka, Martin

    2013-01-01

    The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...

  9. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  10. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  11. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  12. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  13. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  14. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  15. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

    Science.gov (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

    2004-01-01

    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  16. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  17. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  18. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  19. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  20. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  1. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts ...

  2. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

    Science.gov (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

    2017-08-25

    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  3. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  4. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.

    1980-01-01

    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  5. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

    OpenAIRE

    Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

    2006-01-01

    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  6. Yeast for virus research

    Science.gov (United States)

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  7. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  8. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Presence and changes in populations of yeasts on raw and processed poultry products stored at refrigeration temperature.

    Science.gov (United States)

    Ismail, S A; Deak, T; El-Rahman, H A; Yassien, M A; Beuchat, L R

    2000-12-05

    A study was undertaken to determine populations and profiles of yeast species on fresh and processed poultry products upon purchase from retail supermarkets and after storage at 5 degrees C until shelf life expiration, and to assess the potential role of these yeasts in product spoilage. Fifty samples representing 15 commercial raw, marinated, smoked, or roasted chicken and turkey products were analyzed. Yeast populations were determined by plating on dichloran rose bengal chloramphenicol (DRBC) agar and tryptone glucose yeast extract (TGY) agar. Proteolytic activity was determined using caseinate and gelatin agars and lipolytic activity was determined on plate count agar supplemented with tributyrin. Populations of aerobic microorganisms were also determined. Initial populations of yeasts (log10 cfu/g) ranged from less than 1 (detection limit) to 2.89, and increased by the expiration date to 0.37-5.06, indicating the presence of psychrotrophic species. Highest initial populations were detected in raw chicken breast, wings, and ground chicken, as well as in turkey necks and legs, whereas roasted chicken and turkey products contained less than 1 log10 cfu/g. During storage, yeast populations increased significantly (P chicken, ground chicken, liver, heart and gizzard, and in ground turkey and turkey sausage. Isolates (152 strains) of yeasts from poultry products consisted of 12 species. Yarrowia lipolytica and Candida zeylanoides were predominant, making up 39 and 26% of the isolates, respectively. Six different species of basidiomycetous yeasts representing 24% of the isolates were identified. Most Y. lipolytica strains showed strong proteolytic and lipolytic activities, whereas C. zeylanoides was weakly lipolytic. Results suggest that yeasts, particularly Y. lipolytica, may play a more prominent role than previously recognized in the spoilage of fresh and processed poultry stored at 5 degrees C.

  10. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  11. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  12. [Oil degradation by basidiomycetes in soil and peat at low temperatures].

    Science.gov (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

    2016-01-01

    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  13. Yeasts and coliform bacteria of water accumulated in bromeliads of mangrove and sand dune ecosystems of southeast Brazil.

    Science.gov (United States)

    Hagler, A N; Rosa, C A; Morais, P B; Mendonça-Hagler, L C; Franco, G M; Araujo, F V; Soares, C A

    1993-10-01

    Yeasts and coliform bacteria were isolated from water that accumulated in the central cups and adjacent leaf axilae of two bromeliads, Neoregelia cruenta of a coastal sand dune and Quesnelia quesneliana of a mangrove ecosystem near the city of Rio de Janeiro, Brazil. The mean total coliform counts were above 10,000 per 100 mL for waters of both plants, but the mean fecal coliform counts were only 74 per 100 mL for Q. quesneliana and mostly undetected in water from N. cruenta. Of 90 fecal coliform isolates, 51 were typical of Escherichia coli in colony morphology and indol, methyl red, Volges-Proskauer, and citrate (IMViC) tests. Seven representatives of the typical E. coli cultures were identified as this species, but the identifications of nine other coliform bacteria were mostly dubious. The yeast community of N. cruenta was typical of plant surfaces with basidiomycetous yeasts anamorphs, and the black yeast Aureobasidium pullulans was prevalent. Quesnelia quesneliana had a substantial proportion of ascomycetous yeasts and their anamorphs, including a probable new biotype of Saccharomyces unisporus. Our results suggested that the microbial communities in bromeliad waters are typically autochtonous and not contaminants.

  14. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  15. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  16. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  17. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  18. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  19. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  20. Four inducible promoters for controlled gene expression in the oleaginous yeast Rhodotorula toruloides

    Directory of Open Access Journals (Sweden)

    Alexander Michael Bedford Johns

    2016-10-01

    Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.

  1. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  2. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  3. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze

    2016-09-01

    Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  5. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  6. [Evaluation of mass spectrometry for the identification of clinically interesting yeasts].

    Science.gov (United States)

    Galán, Fátima; García-Agudo, Lidia; Guerrero, Inmaculada; Marín, Pilar; García-Tapia, Ana; García-Martos, Pedro; Rodríguez-Iglesias, Manuel

    2015-01-01

    Identification of yeasts is based on morphological, biochemical and nutritional characteristics, and using molecular methods. Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, a new method for the identification of microorganisms, has demonstrated to be very useful. The aim of this study is to evaluate this new method in the identification of yeasts. A total of 600 strains of yeasts isolated from clinical specimens belonging to 9 genera and 43 species were tested. Identification was made by sequencing of the ITS regions of ribosomal DNA, assimilation of carbon compounds (ID 32C), and mass spectrometry on a Microflex spectrometer (Bruker Daltonics GmbH, Germany). A total of 569 strains (94.8%) were identified to species level by ID 32C, and 580 (96.7%) by MALDI-TOF. Concordance between both methods was observed for 553 strains (92.2%), with 100% in clinically relevant species: C. albicans, C. glabrata, C. parapsilosis, C. tropicalis, and almost 100% in C. krusei. MALDI-TOF identified species requiring molecular methods: Candida dubliniensis, C. nivariensis, C. metapsilosis and C. orthopsilosis. Some irregularities were observed in the identification of arthroconidia yeast and basidiomycetes. MALDI-TOF is a rapid, effective and economic method, which enables the identification of most clinically important yeasts and the differentiation of closely related species. It would be desirable to include more species in its database to expand its performance. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  7. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  8. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

    2010-12-07

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

  9. Developing a set of strong intronic promoters for robust metabolic engineering in oleaginous Rhodotorula (Rhodosporidium) yeast species.

    Science.gov (United States)

    Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui

    2016-11-25

    excellent promoters for metabolic engineering in the oleaginous and carotenogenic yeast, R. toruloides.

  10. Yeast Infection during Pregnancy

    Science.gov (United States)

    ... disrupt the pH balance of the vagina. Common yeast infection symptoms include vaginal itching and a white, thick discharge that looks ... and Prevention. http://www.cdc.gov/std/tg2015/candidiasis.htm. Accessed Aug. 27, ... Vagina, Cervix, Toxic Shock Syndrome, Endometritis, and Salpingitis. In: ...

  11. Polysome Profile Analysis - Yeast

    Czech Academy of Sciences Publication Activity Database

    Pospíšek, M.; Valášek, Leoš Shivaya

    2013-01-01

    Roč. 530, č. 2013 (2013), s. 173-181 ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013

  12. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  13. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  14. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  15. Yeast ecology of Kombucha fermentation.

    Science.gov (United States)

    Teoh, Ai Leng; Heard, Gillian; Cox, Julian

    2004-09-01

    Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.

  16. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  17. Yeast glycolipid biosurfactants.

    Science.gov (United States)

    Jezierska, Sylwia; Claus, Silke; Van Bogaert, Inge

    2017-10-25

    Various yeasts, both conventional and exotic ones, are known to produce compounds useful to mankind. Ethanol is the most known of these compounds, but more complex molecules such as amphiphilic biosurfactants can also be derived from eukaryotic microorganisms at an industrially and commercially relevant scale. Among them, glycolipids are the most promising, due to their attractive properties and high product titers. Many of these compounds can be considered as secondary metabolites with a specific function for the host. Hence, a dedicated biosynthetic process enables regulation and combines pathways delivering the lipidic moiety and the hydrophilic carbohydrate part of the glycolipid. In this Review, we will discuss the biosynthetic and regulatory aspects of the yeast-derived sophorolipids, mannosylerythritol lipids, and cellobiose lipids, with special emphasis on the relation between glycolipid synthesis and the general lipid metabolism. © 2017 Federation of European Biochemical Societies.

  18. Genetically engineered yeast

    DEFF Research Database (Denmark)

    2014-01-01

    A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate semialde......A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate...... semialdehyde. The yeast may also express a 3-hydroxyisobutyrate dehydrogenase (HIBADH) and a 3-hydroxypropanoate dehydrogenase (3-HPDH) and aspartate 1-decarboxylase. Additionally the yeast may express pyruvate carboxylase and aspartate aminotransferase....

  19. Tapping into yeast diversity.

    Science.gov (United States)

    Fay, Justin C

    2012-11-01

    Domesticated organisms demonstrate our capacity to influence wild species but also provide us with the opportunity to understand rapid evolution in the context of substantially altered environments and novel selective pressures. Recent advances in genetics and genomics have brought unprecedented insights into the domestication of many organisms and have opened new avenues for further improvements to be made. Yet, our ability to engineer biological systems is not without limits; genetic manipulation is often quite difficult. The budding yeast, Saccharomyces cerevisiae, is not only one of the most powerful model organisms, but is also the premier producer of fermented foods and beverages around the globe. As a model system, it entertains a hefty workforce dedicated to deciphering its genome and the function it encodes at a rich mechanistic level. As a producer, it is used to make leavened bread, and dozens of different alcoholic beverages, such as beer and wine. Yet, applying the awesome power of yeast genetics to understanding its origins and evolution requires some knowledge of its wild ancestors and the environments from which they were derived. A number of surprisingly diverse lineages of S. cerevisiae from both primeval and secondary forests in China have been discovered by Wang and his colleagues. These lineages substantially expand our knowledge of wild yeast diversity and will be a boon to elucidating the ecology, evolution and domestication of this academic and industrial workhorse.

  20. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  1. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

    Science.gov (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

    2018-05-03

    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  2. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K

    1978-01-01

    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  3. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  4. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  5. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  6. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  7. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.

    1981-01-01

    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  8. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  9. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  10. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  11. Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.

    Science.gov (United States)

    Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges

    2015-11-01

    Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  12. Entropy analysis in yeast DNA

    International Nuclear Information System (INIS)

    Kim, Jongkwang; Kim, Sowun; Lee, Kunsang; Kwon, Younghun

    2009-01-01

    In this article, we investigate the language structure in yeast 16 chromosomes. In order to find it, we use the entropy analysis for codons (or amino acids) of yeast 16 chromosomes, developed in analysis of natural language by Montemurro et al. From the analysis, we can see that there exists a language structure in codons (or amino acids) of yeast 16 chromosomes. Also we find that the grammar structure of amino acids of yeast 16 chromosomes has a deep relationship with secondary structure of protein.

  13. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    Science.gov (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  14. Rhodosporidium BANNO: Inactivation of yeast phase cells by ultraviolet light and N-methyl-N'-nitro-N-nitrosoguanidine

    International Nuclear Information System (INIS)

    Boettcher, F.; Samsonova, I.A.

    1977-01-01

    The inactivation of stationary phase cells by ultraviolet light (UV) and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was examined in eight wild strains of Rhodotorula, six of which are the sporidial yeast phase of Rhodosporidium, a basidiomycetous fungus. It thas been found that (1) the UV-resistance of Rhodosporidium and Rhodotorula yeasts is higher and the MNNG-resistance lower than the resistance of Candida and Hansenula yeasts, (2) the shape of the survival curves is sigmoid in the case of UV and two-phase exponential in the case of MNNG, (3) the mutagen sensitivities but not the inactivation kinetics of the strains are different, (4) the UV- and MNNG-sensitivities for each of the strains are correlated, (5) the relatively high resistance to UV cannot be due to the carotenoid pigments of the cells, (6) mutations to UV-sensitivity can be induced with a high rate, (7) the sigmoidal character of the UV survival curves were reduced or transformed to an exponential shape by the UVS-mutations. (author)

  15. Biocontrol of Alternaria alternata on cherry tomato fruit by use of marine yeast Rhodosporidium paludigenum Fell & Tallman.

    Science.gov (United States)

    Wang, Yifei; Bao, Yihong; Shen, Danhong; Feng, Wu; Yu, Ting; Zhang, Jia; Zheng, Xiao Dong

    2008-04-30

    The basidiomycetous yeast Rhodosporidium paludigenum Fell & Tallman isolated from the south of East China Sea was evaluated for its activity in reducing postharvest decay of cherry tomatoes caused by Alternaria alternata in vitro and in vivo tests. The results showed that washed cell suspension of R. paludigenum provided better control of A. alternata than any other treatment, while the autoclaved cell culture failed to provide protection against the pathogen. The concentration of antagonist had significant effect on biocontrol effectiveness in vivo: when the concentration of the washed yeast cell suspension was used at 1 x 10(9)cells/ml, the percentage rate of black rot of cherry tomato fruit was only 37%, which was remarkably lower than that treated with water (the control) after 5days of incubation at 25 degrees C. Furthermore, a great biocontrol efficacy of R. paludigenum was observed when it was applied prior to inoculation with A. alternata: the longer the incubation time of R. paludigenum, the lower disease incidence would be. However, there was little efficacy when R. paludigenum was applied after A. alternata inoculation. In addition, on the wounds of cherry tomato, it was observed that R. paludigenum grew rapidly increasing 50-fold during the first 12h at 25 degrees C. To the best of our knowledge, this is a first report concerning that the marine yeast R. paludigenum could be used as a biocontrol agent of postharvest fungal disease.

  16. Genomics and the making of yeast biodiversity

    NARCIS (Netherlands)

    Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

    2015-01-01

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces

  17. Current awareness on yeast.

    Science.gov (United States)

    2002-02-01

    In order to keep subscribers up-to-date with the latest developments in their field, this current awareness service is provided by John Wiley & Sons and contains newly-published material on yeasts. Each bibliography is divided into 10 sections. 1 Books, Reviews & Symposia; 2 General; 3 Biochemistry; 4 Biotechnology; 5 Cell Biology; 6 Gene Expression; 7 Genetics; 8 Physiology; 9 Medical Mycology; 10 Recombinant DNA Technology. Within each section, articles are listed in alphabetical order with respect to author. If, in the preceding period, no publications are located relevant to any one of these headings, that section will be omitted. (3 weeks journals - search completed 5th. Dec. 2001)

  18. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  19. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  20. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  1. Yeasts preservation: alternatives for lyophilisation

    NARCIS (Netherlands)

    Nyanga, L.K.; Nout, M.J.R.; Smid, E.J.; Boekhout, T.; Zwietering, M.H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts

  2. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

    Science.gov (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

    2015-01-01

    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  3. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  4. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  5. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

    2003-07-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  6. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  7. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  8. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  9. Production of Food Grade Yeasts

    Directory of Open Access Journals (Sweden)

    Argyro Bekatorou

    2006-01-01

    Full Text Available Yeasts have been known to humans for thousands of years as they have been used in traditional fermentation processes like wine, beer and bread making. Today, yeasts are also used as alternative sources of high nutritional value proteins, enzymes and vitamins, and have numerous applications in the health food industry as food additives, conditioners and flavouring agents, for the production of microbiology media and extracts, as well as livestock feeds. Modern scientific advances allow the isolation, construction and industrial production of new yeast strains to satisfy the specific demands of the food industry. Types of commercial food grade yeasts, industrial production processes and raw materials are highlighted. Aspects of yeast metabolism, with respect to carbohydrate utilization, nutritional aspects and recent research advances are also discussed.

  10. Evolutionary History of Ascomyceteous Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Haridas, Sajeet; Riley, Robert; Salamov, Asaf; Goker, Markus; Klenk, Hans-Peter; Kurtzman, Cletus P.; Blackwell, Meredith; Grigoriev, Igor; Jeffries, Thomas W.

    2014-06-06

    Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.

  11. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  12. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

    Science.gov (United States)

    2010-01-01

    Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1), lipid/biomass (68%) and lipid/glucose yields (16%). Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils. PMID:20863365

  13. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

    Directory of Open Access Journals (Sweden)

    De Lucia Marzia

    2010-09-01

    Full Text Available Abstract Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1, lipid/biomass (68% and lipid/glucose yields (16%. Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils.

  14. Genetic study on yeast

    International Nuclear Information System (INIS)

    Mortimer, R.K.

    1981-01-01

    Research during the past year has moved ahead on several fronts. A major compilation of all the genetic mapping data for the yeast Saccharomyces cerevisiae has been completed. The map describes the location of over 300 genes on 17 chromosomes. A report on this work will appear in Microbiological Reviews in December 1980. Recombinant DNA procedures have been introduced into the experiments and RAD52 (one of the genes involved in recombination and repair damage), has been successfully cloned. This clone will be used to determine the gene product. Diploid cells homozygous for RAD52 have exceptionally high frequencies of mitotic loss of chromosomes. This loss is stimulated by ionizing radiation. This effect is a very significant finding. The effect has also been seen with certain other RAD mutants

  15. Lager Yeast Comes of Age

    Science.gov (United States)

    2014-01-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  16. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  17. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  18. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A

    2000-12-01

    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  19. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner

    2013-01-01

    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  20. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  1. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  2. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. Yeasts preservation: alternatives for lyophilisation

    OpenAIRE

    Nyanga, Loveness K.; Nout, Martinus J. R.; Smid, Eddy J.; Boekhout, Teun; Zwietering, Marcel H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts during 6 months storage at 4 and 25 °C. None of the yeast cultures showed a significant loss in viable cell count during 6 months of storage at 4 °C upon lyophilisation and preservation in dry rice cak...

  4. [Distiller Yeasts Producing Antibacterial Peptides].

    Science.gov (United States)

    Klyachko, E V; Morozkina, E V; Zaitchik, B Ts; Benevolensky, S V

    2015-01-01

    A new method of controlling lactic acid bacteria contamination was developed with the use of recombinant Saccharomyces cerevisiae strains producing antibacterial peptides. Genes encoding the antibacterial peptides pediocin and plantaricin with codons preferable for S. cerevisiae were synthesized, and a system was constructed for their secretory expression. Recombinant S. cerevisiae strains producing antibacterial peptides effectively inhibit the growth of Lactobacillus sakei, Pediacoccus pentasaceus, Pediacoccus acidilactici, etc. The application of distiller yeasts producing antibacterial peptides enhances the ethanol yield in cases of bacterial contamination. Recombinant yeasts producing the antibacterial peptides pediocin and plantaricin can successfully substitute the available industrial yeast strains upon ethanol production.

  5. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  6. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  7. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  8. Yeast strains and methods of use thereof

    OpenAIRE

    Goddard, Matthew Robert; Gardner, Richard Clague; Anfang, Nicole

    2013-01-01

    The present invention relates to yeast strains and, in particular, to yeast stains for use in fermentation processes. The invention also relates to methods of fermentation using the yeast strains of the invention either alone or in combination with other yeast strains. The invention thither relates to methods for the selection of yeast strains suitable for fermentation cultures by screening for various metabolic products and the use of specific nutrient sources.

  9. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  10. Structural investigations of yeast mannans

    International Nuclear Information System (INIS)

    Rademacher, K.H.

    1983-01-01

    Cell wall mannans were isolated from 8 different Candida species and separated in oligosaccharides by partial acetolysis. After gel chromatography specific acetolysis patterns were obtained. The 13 C NMR spectra of mannans and oligosaccharides were recorded. Signals at delta = 93.1 - 105.4 were assigned to certain chemical structures. Both the spectral patterns and the acetolysis patterns of the yeast mannans can be used for the discrimination of related yeasts. (author)

  11. Oral yeast colonization throughout pregnancy.

    Science.gov (United States)

    Rio, R; Simões-Silva, L; Garro, S; Silva, M-J; Azevedo, Á; Sampaio-Maia, B

    2017-03-01

    Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with non-pregnant women. The oral yeast colonization was assessed in saliva of 30 pregnant and non-pregnant women longitudinally over a 6-months period. Demographic information was collected, a non-invasive intra-oral examination was performed and saliva flow and pH were determined. Pregnant and non-pregnant groups were similar regarding age and level of education. Saliva flow rate did not differ, but saliva pH was lower in pregnant than in non-pregnant women. Oral yeast prevalence was higher in pregnant than in non-pregnant women, either in the first or in the third trimester, but did not attain statistical significance. In individuals colonized with yeast, the total yeast quantification (Log10CFU/mL) increase from the 1st to the 3rd trimester in pregnant women, but not in non-pregnant women. Pregnancy may favour oral yeast growth that may be associated with an acidic oral environment.

  12. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  13. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  14. Metabolic regulation of yeast

    Science.gov (United States)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  15. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

    1990-01-01

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  16. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  17. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  18. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina

    2017-05-01

    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  19. Yeast Flocculation—Sedimentation and Flotation

    Directory of Open Access Journals (Sweden)

    Graham G. Stewart

    2018-04-01

    Full Text Available Unlike most fermentation alcohol beverage production processes, brewers recycle their yeast. This is achieved by employing a yeast culture’s: flocculation, adhesion, sedimentation, flotation, and cropping characteristics. As a consequence of yeast recycling, the quality of the cropped yeast culture’s characteristics is critical. However, the other major function of brewer’s yeast is to metabolise wort into ethanol, carbon dioxide, glycerol, and other fermentation products, many of which contribute to beer’s overall flavour characteristics. This review will only focus on brewer’s yeast flocculation characteristics.

  20. Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides

    Science.gov (United States)

    Geiselman, Gina M; Ito, Masakazu; Mondo, Stephen J; Reilly, Morgann C; Cheng, Ya-Fang; Bauer, Stefan; Grigoriev, Igor V; Gladden, John M; Simmons, Blake A; Brem, Rachel B

    2018-01-01

    The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted function in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. These results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi. PMID:29521624

  1. The yeast replicative aging model.

    Science.gov (United States)

    He, Chong; Zhou, Chuankai; Kennedy, Brian K

    2018-03-08

    It has been nearly three decades since the budding yeast Saccharomyces cerevisiae became a significant model organism for aging research and it has emerged as both simple and powerful. The replicative aging assay, which interrogates the number of times a "mother" cell can divide and produce "daughters", has been a stalwart in these studies, and genetic approaches have led to the identification of hundreds of genes impacting lifespan. More recently, cell biological and biochemical approaches have been developed to determine how cellular processes become altered with age. Together, the tools are in place to develop a holistic view of aging in this single-celled organism. Here, we summarize the current state of understanding of yeast replicative aging with a focus on the recent studies that shed new light on how aging pathways interact to modulate lifespan in yeast. Copyright © 2018. Published by Elsevier B.V.

  2. [Yeast species in vulvovaginitis candidosa].

    Science.gov (United States)

    Nemes-Nikodém, Éva; Tamási, Béla; Mihalik, Noémi; Ostorházi, Eszter

    2015-01-04

    Vulvovaginal candidiasis is the most common mycosis, however, the available information about antifungal susceptibilities of these yeasts is limited. To compare the gold standard fungal culture with a new molecular identification method and report the incidence of yeast species in vulvovaginitis candidosa. The authors studied 370 yeasts isolated from vulvovaginal candidiasis and identified them by phenotypic and molecular methods. The most common species was Candida albicans (85%), followed by Candida glabrata, and other Candida species. At present there are no recommendations for the evaluation of antifungal susceptibility of pathogenic fungal species occurring in vulvovaginal candidiasis and the natural antifungal resistance of the different species is known only. Matrix Assisted Laser Desorption Ionization Time of Flight identification can be used to differentiate the fluconazole resistant Candida dubliniensis and the sensitive Candida albicans strains.

  3. Radiation stimulation of yeast crops for increasing output of alcohol and baker yeasts

    International Nuclear Information System (INIS)

    Vlad, E.; Marsheu, P.

    1974-01-01

    The purpose of this study was to stimulate by gamma radiation the existing commercial types of yeast so as to obtain yeasts that would better reflect the substrate and have improved reproductive capacity. The experiments were conducted under ordinary conditions using commercial yeasts received from one factory producing alcohol and bakery yeasts and isolated as pure cultures. Irradiating yeast cultures with small doses (up to 10 krad) was found to stimulate the reproduction and fermenting activity of yeast cells as manifested in increased accumulation of yeast biomass and greater yield of ethyl alcohol. (E.T.)

  4. Surplus yeast tank failing catastrophically

    DEFF Research Database (Denmark)

    Hedlund, Frank Huess

    2016-01-01

    GOOD REASON FOR CAUTION I A large surplus yeast tank shot into the air leaving the floor plate and the contents behind. Although not designed for overpressure, the tank was kept at “very slight overpressure” to suppress nuisance foaming. The brewery was unaware of the hazards of compressed air...

  5. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  6. Yeast genomics on food flavours

    NARCIS (Netherlands)

    Schoondermark-Stolk, Sung Ah

    2005-01-01

    The appearance and concentration of the fusel alcohol 3-methyl-1-butanol is important for the flavour of fermented foods. 3-Methyl-1-butanol is formed by yeast during the conversion of L-leucine. Identification of the enzymes and genes involved in the formation of 3-methyl-1-butanol is a major

  7. Endoplasmic reticulum involvement in yeast cell death

    International Nuclear Information System (INIS)

    Nicanor Austriaco, O.

    2012-01-01

    Yeast cells undergo programed cell death (PCD) with characteristic markers associated with apoptosis in mammalian cells including chromatin breakage, nuclear fragmentation, reactive oxygen species generation, and metacaspase activation. Though significant research has focused on mitochondrial involvement in this phenomenon, more recent work with both Saccharomyces cerevisiae and Schizosaccharomyces pombe has also implicated the endoplasmic reticulum (ER) in yeast PCD. This minireview provides an overview of ER stress-associated cell death (ER-SAD) in yeast. It begins with a description of ER structure and function in yeast before moving to a discussion of ER-SAD in both mammalian and yeast cells. Three examples of yeast cell death associated with the ER will be highlighted here including inositol starvation, lipid toxicity, and the inhibition of N-glycosylation. It closes by suggesting ways to further examine the involvement of the ER in yeast cell death.

  8. Brewing characteristics of piezosensitive sake yeasts

    Science.gov (United States)

    Nomura, Kazuki; Hoshino, Hirofumi; Igoshi, Kazuaki; Onozuka, Haruka; Tanaka, Erika; Hayashi, Mayumi; Yamazaki, Harutake; Takaku, Hiroaki; Iguchi, Akinori; Shigematsu, Toru

    2018-04-01

    Application of high hydrostatic pressure (HHP) treatment to food processing is expected as a non-thermal fermentation regulation technology that supresses over fermentation. However, the yeast Saccharomyces cerevisiae used for Japanese rice wine (sake) brewing shows high tolerance to HHP. Therefore, we aimed to generate pressure-sensitive (piezosensitive) sake yeast strains by mating sake with piezosensitive yeast strains to establish an HHP fermentation regulation technology and extend the shelf life of fermented foods. The results of phenotypic analyses showed that the generated yeast strains were piezosensitive and exhibited similar fermentation ability compared with the original sake yeast strain. In addition, primary properties of sake brewed using these strains, such as ethanol concentration, sake meter value and sake flavor compounds, were almost equivalent to those obtained using the sake yeast strain. These results suggest that the piezosensitive strains exhibit brewing characteristics essentially equivalent to those of the sake yeast strain.

  9. Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth.

    Science.gov (United States)

    Mata, Juan Luis; Mishra, Nutan Tulapurkar

    2015-01-01

    Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

  10. Yeast Isolation for Bioethanol Production

    Directory of Open Access Journals (Sweden)

    EKA RURIANI

    2012-09-01

    Full Text Available We have isolated 12 yeast isolates from five different rotten fruits by using a yeast glucose chloramphenicol agar (YGCA medium supplemented with tetracycline. From pre-screening assay, four isolates exhibited higher substrate (glucose-xylose consumption efficiency in the reaction tube fermentation compared to Saccharomyces cerevisiae dan Saccharomyces ellipsoids as the reference strains. Based on the fermentation process in gooseneck flasks, we observed that two isolates (K and SB showed high fermentation efficiency both in sole glucose and mixed glucose-xylose substrate. Moreover, isolates K and SB produced relatively identical level of ethanol concentration compared to the reference strains. Isolates H and MP could only produce high levels of ethanol in glucose fermentation, while only half of that amount of ethanol was detected in glucose-xylose fermentation. Isolate K and SB were identified as Pichia kudriavzeevii (100% based on large sub unit (LSU ribosomal DNA D1/D2 region.

  11. Oral yeast colonization throughout pregnancy

    OpenAIRE

    Rio, Rute; Sim?es-Silva, Liliana; Garro, Sofia; Silva, M?rio-Jorge; Azevedo, ?lvaro; Sampaio-Maia, Benedita

    2017-01-01

    Background Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with n...

  12. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  13. Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, Jianrong

    2003-01-15

    The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

  14. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  15. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  16. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  17. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  18. Cryptococcus lacticolor sp. nov. and Rhodotorula oligophaga sp. nov., novel yeasts isolated from the nasal smear microbiota of Queensland koalas kept in Japanese zoological parks.

    Science.gov (United States)

    Satoh, Kazuo; Maeda, Mari; Umeda, Yoshiko; Sugamata, Miho; Makimura, Koichi

    2013-07-01

    A total of 515 yeast strains were isolated from the nasal smears of Queensland koalas and their breeding environments in Japanese zoological parks between 2005 and 2012. The most frequent species in the basidiomycetous yeast biota isolated from koala nasal passages was Cryptococcus neoformans, followed by Rhodotorula minuta. R. minuta was the most frequent species in the breeding environments, while C. neoformans was rare. Seven strains representing two novel yeast species were identified. Analyses of the 26S rDNA (LSU) D1/D2 domain and nuclear ribosomal DNA internal transcribed spacer region sequences indicated that these strains represent new species with close phylogenetic relationships to Cryptococcus and Rhodotorula. A sexual state was not found for either of these two novel yeasts. Key phenotypic characters confirmed that these strains could be placed in Cryptococcus and Rhodotorula. The names Cryptococcus lacticolor sp. nov. (type strain TIMM 10013(T) = JCM 15449(T) = CBS 10915(T) = DSM 21093(T), DDBJ/EMBL/Genbank Accession No.; AB375774 (ITS) and AB375775 (26S rDNA D1/D2 region), MycoBank ID; MB 802688, Fungal Barcoding Database ID; 3174), and Rhodotorula oligophaga sp. nov. (type strain TIMM 10017(T) = JCM 18398(T) = CBS 12623(T) = DSM 25814(T), DDBJ/EMBL/Genbank Accession No.; AB702967 (ITS) and AB702967 (26S rDNA D1/D2 region), MycoBank ID; MB 802689, Fungal Barcoding Database ID; 3175) are proposed for these new species.

  19. Yeast flocculation: New story in fuel ethanol production.

    Science.gov (United States)

    Zhao, X Q; Bai, F W

    2009-01-01

    Yeast flocculation has been used in the brewing industry to facilitate biomass recovery for a long time, and thus its mechanism of yeast flocculation has been intensively studied. However, the application of flocculating yeast in ethanol production garnered attention mainly in the 1980s and 1990s. In this article, updated research progress in the molecular mechanism of yeast flocculation and the impact of environmental conditions on yeast flocculation are reviewed. Construction of flocculating yeast strains by genetic approach and utilization of yeast flocculation for ethanol production from various feedstocks were presented. The concept of self-immobilized yeast cells through their flocculation is revisited through a case study of continuous ethanol fermentation with the flocculating yeast SPSC01, and their technical and economic advantages are highlighted by comparing with yeast cells immobilized with supporting materials and regular free yeast cells as well. Taking the flocculating yeast SPSC01 as an example, the ethanol tolerance of the flocculating yeast was also discussed.

  20. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  1. Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

    OpenAIRE

    Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.

    2012-01-01

    Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast densit...

  2. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  3. YMDB: the Yeast Metabolome Database

    Science.gov (United States)

    Jewison, Timothy; Knox, Craig; Neveu, Vanessa; Djoumbou, Yannick; Guo, An Chi; Lee, Jacqueline; Liu, Philip; Mandal, Rupasri; Krishnamurthy, Ram; Sinelnikov, Igor; Wilson, Michael; Wishart, David S.

    2012-01-01

    The Yeast Metabolome Database (YMDB, http://www.ymdb.ca) is a richly annotated ‘metabolomic’ database containing detailed information about the metabolome of Saccharomyces cerevisiae. Modeled closely after the Human Metabolome Database, the YMDB contains >2000 metabolites with links to 995 different genes/proteins, including enzymes and transporters. The information in YMDB has been gathered from hundreds of books, journal articles and electronic databases. In addition to its comprehensive literature-derived data, the YMDB also contains an extensive collection of experimental intracellular and extracellular metabolite concentration data compiled from detailed Mass Spectrometry (MS) and Nuclear Magnetic Resonance (NMR) metabolomic analyses performed in our lab. This is further supplemented with thousands of NMR and MS spectra collected on pure, reference yeast metabolites. Each metabolite entry in the YMDB contains an average of 80 separate data fields including comprehensive compound description, names and synonyms, structural information, physico-chemical data, reference NMR and MS spectra, intracellular/extracellular concentrations, growth conditions and substrates, pathway information, enzyme data, gene/protein sequence data, as well as numerous hyperlinks to images, references and other public databases. Extensive searching, relational querying and data browsing tools are also provided that support text, chemical structure, spectral, molecular weight and gene/protein sequence queries. Because of S. cervesiae's importance as a model organism for biologists and as a biofactory for industry, we believe this kind of database could have considerable appeal not only to metabolomics researchers, but also to yeast biologists, systems biologists, the industrial fermentation industry, as well as the beer, wine and spirit industry. PMID:22064855

  4. Experimental evolution in budding yeast

    Science.gov (United States)

    Murray, Andrew

    2012-02-01

    I will discuss our progress in analyzing evolution in the budding yeast, Saccharomyces cerevisiae. We take two basic approaches. The first is to try and examine quantitative aspects of evolution, for example by determining how the rate of evolution depends on the mutation rate and the population size or asking whether the rate of mutation is uniform throughout the genome. The second is to try to evolve qualitatively novel, cell biologically interesting phenotypes and track the mutations that are responsible for the phenotype. Our efforts include trying to alter cell morphology, evolve multicellularity, and produce a biological oscillator.

  5. Chemostat Culture for Yeast Physiology.

    Science.gov (United States)

    Kerr, Emily O; Dunham, Maitreya J

    2017-07-05

    The use of chemostat culture facilitates the careful comparison of different yeast strains growing in well-defined conditions. Variations in physiology can be measured by examining gene expression, metabolite levels, protein content, and cell morphology. In this protocol, we show how a combination of sample types can be collected during harvest from a single 20-mL chemostat in a ministat array, with special attention to coordinating the handling of the most time-sensitive sample types. © 2017 Cold Spring Harbor Laboratory Press.

  6. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

    Science.gov (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

    2017-04-01

    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  7. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  8. Biodiesel generation from oleaginous yeast Rhodotorula glutinis ...

    African Journals Online (AJOL)

    Biodiesel generation from oleaginous yeast Rhodotorula glutinis with xylose assimilating capacity. ... Biodiesel generation from oleaginous yeast Rhodotorula glutinis with xylose assimilating capacity. C Dai, J Tao, F Xie, Y Dai, M Zhao. Abstract. This study explored a strategy to convert agricultural and forestry residues into ...

  9. Yeasts in sustainable bioethanol production: A review.

    Science.gov (United States)

    Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis

    2017-07-01

    Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

  10. The wine and beer yeast Dekkera bruxellensis.

    Science.gov (United States)

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd.

  11. Biodiesel generation from oleaginous yeast Rhodotorula glutinis ...

    African Journals Online (AJOL)

    SERVER

    2007-09-19

    Sep 19, 2007 ... This study explored a strategy to convert agricultural and forestry residues into microbial lipid, which could be further transformed into biodiesel. Among the 250 yeast strains screened for xylose assimilating capacity, eight oleaginous yeasts were selected by Sudan Black B test. The lipid content of these 8 ...

  12. 21 CFR 73.355 - Phaffia yeast.

    Science.gov (United States)

    2010-04-01

    ... stabilized color additive mixture. Color additive mixtures for fish feed use made with phaffia yeast may... additive mixtures for coloring foods. (b) Specifications. Phaffia yeast shall conform to the following... § 501.4 of this chapter. (3) The presence of the color additive in salmonid fish that have been fed...

  13. Biosynthesis of polyhydroxyalkanotes in wildtype yeasts | Desuoky ...

    African Journals Online (AJOL)

    Biosynthesis of the biodegradable polymers polyhydroxyalkanotes (PHAs) are studied extensively in wild type and genetically modified prokaryotic cells, however the content and structure of PHA in wild type yeasts are not well documented. The purpose of this study was to screen forty yeast isolates collected from different ...

  14. Virgin olive oil yeasts: A review.

    Science.gov (United States)

    Ciafardini, Gino; Zullo, Biagi Angelo

    2018-04-01

    This review summarizes current knowledge on virgin olive oil yeasts. Newly produced olive oil contains solid particles and micro drops of vegetation water in which yeasts reproduce to become the typical microbiota of olive oil. To date, about seventeen yeast species have been isolated from different types of olive oils and their by-products, of which six species have been identified as new species. Certain yeast species contribute greatly to improving the sensorial characteristics of the newly produced olive oil, whereas other species are considered harmful as they can damage the oil quality through the production of unpleasant flavors and triacylglycerol hydrolysis. Studies carried out in certain yeast strains have demonstrated the presence of defects in olive oil treated with Candida adriatica, Nakazawaea wickerhamii and Candida diddensiae specific strains, while other olive oil samples treated with other Candida diddensiae strains were defect-free after four months of storage and categorized as extra virgin. A new acetic acid producing yeast species, namely, Brettanomyces acidodurans sp. nov., which was recently isolated from olive oil, could be implicated in the wine-vinegary defect of the product. Other aspects related to the activity of the lipase-producing yeasts and the survival of the yeast species in the flavored olive oils are also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Yeasts in sustainable bioethanol production: A review

    Directory of Open Access Journals (Sweden)

    Siti Hajar Mohd Azhar

    2017-07-01

    Full Text Available Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

  16. The essence of yeast quiescence.

    Science.gov (United States)

    De Virgilio, Claudio

    2012-03-01

    Like all microorganisms, yeast cells spend most of their natural lifetime in a reversible, quiescent state that is primarily induced by limitation for essential nutrients. Substantial progress has been made in defining the features of quiescent cells and the nutrient-signaling pathways that shape these features. A view that emerges from the wealth of new data is that yeast cells dynamically configure the quiescent state in response to nutritional challenges by using a set of key nutrient-signaling pathways, which (1) regulate pathway-specific effectors, (2) converge on a few regulatory nodes that bundle multiple inputs to communicate unified, graded responses, and (3) mutually modulate their competences to transmit signals. Here, I present an overview of our current understanding of the architecture of these pathways, focusing on how the corresponding core signaling protein kinases (i.e. PKA, TORC1, Snf1, and Pho85) are wired to ensure an adequate response to nutrient starvation, which enables cells to tide over decades, if not centuries, of famine. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Comet assay on tetraploid yeast cells

    DEFF Research Database (Denmark)

    Rank, Jette; Syberg, Kristian; Jensen, Klara

    2009-01-01

    Tetraploid yeast cells (Saccharomyces cerevisiae) were used in the comet assay with the intention of developing a new, fast and easy assay for detecting environmental genotoxic agents without using higher organisms. Two DNA-damaging chemicals, H2O2 and acrylamide, together with wastewater from...... three municipal treatment plants were tested for their effect on the yeast-cell DNA. The main problem with using yeast in the comet assay is the necessity to degrade the cell wall. This was achieved by using Zymolase 100 T twice during the procedure, since Zymolase 20 T did not open the cell wall....... Analytical problems that arose due to the small amount of DNA in the yeast nuclei in haploid and diploid cells, which contain 13 Mbp and 26 Mbp DNA per cell, respectively, were solved by using tetraploid yeast cells (52 Mbp) instead. DNA damage was shown after exposure to H2O2 and acrylamide. The lowest dose...

  18. Electron transport chain in a thermotolerant yeast.

    Science.gov (United States)

    Mejía-Barajas, Jorge A; Martínez-Mora, José A; Salgado-Garciglia, Rafael; Noriega-Cisneros, Ruth; Ortiz-Avila, Omar; Cortés-Rojo, Christian; Saavedra-Molina, Alfredo

    2017-04-01

    Yeasts capable of growing and surviving at high temperatures are regarded as thermotolerant. For appropriate functioning of cellular processes and cell survival, the maintenance of an optimal redox state is critical of reducing and oxidizing species. We studied mitochondrial functions of the thermotolerant Kluyveromyces marxianus SLP1 and the mesophilic OFF1 yeasts, through the evaluation of its mitochondrial membrane potential (ΔΨ m ), ATPase activity, electron transport chain (ETC) activities, alternative oxidase activity, lipid peroxidation. Mitochondrial membrane potential and the cytoplasmic free Ca 2+ ions (Ca 2+ cyt) increased in the SLP1 yeast when exposed to high temperature, compared with the mesophilic yeast OFF1. ATPase activity in the mesophilic yeast diminished 80% when exposed to 40° while the thermotolerant SLP1 showed no change, despite an increase in the mitochondrial lipid peroxidation. The SLP1 thermotolerant yeast exposed to high temperature showed a diminution of 33% of the oxygen consumption in state 4. The uncoupled state 3 of oxygen consumption did not change in the mesophilic yeast when it had an increase of temperature, whereas in the thermotolerant SLP1 yeast resulted in an increase of 2.5 times when yeast were grown at 30 o , while a decrease of 51% was observed when it was exposed to high temperature. The activities of the ETC complexes were diminished in the SLP1 when exposed to high temperature, but also it was distinguished an alternative oxidase activity. Our results suggest that the mitochondria state, particularly ETC state, is an important characteristic of the thermotolerance of the SLP1 yeast strain.

  19. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  20. Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.

    Science.gov (United States)

    Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo

    2016-10-24

    Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Genomics and the making of yeast biodiversity.

    Science.gov (United States)

    Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

    2015-12-01

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces cerevisiae; the common human commensal and opportunistic pathogen, Candida albicans; and over 1000 other known species (with more continuing to be discovered). Yeasts are found in every biome and continent and are more genetically diverse than angiosperms or chordates. Ease of culture, simple life cycles, and small genomes (∼10-20Mbp) have made yeasts exceptional models for molecular genetics, biotechnology, and evolutionary genomics. Here we discuss recent developments in understanding the genomic underpinnings of the making of yeast biodiversity, comparing and contrasting natural and human-associated evolutionary processes. Only a tiny fraction of yeast biodiversity and metabolic capabilities has been tapped by industry and science. Expanding the taxonomic breadth of deep genomic investigations will further illuminate how genome function evolves to encode their diverse metabolisms and ecologies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Yeast-based biosensors: design and applications.

    Science.gov (United States)

    Adeniran, Adebola; Sherer, Michael; Tyo, Keith E J

    2015-02-01

    Yeast-based biosensing (YBB) is an exciting research area, as many studies have demonstrated the use of yeasts to accurately detect specific molecules. Biosensors incorporating various yeasts have been reported to detect an incredibly large range of molecules including but not limited to odorants, metals, intracellular metabolites, carcinogens, lactate, alcohols, and sugars. We review the detection strategies available for different types of analytes, as well as the wide range of output methods that have been incorporated with yeast biosensors. We group biosensors into two categories: those that are dependent upon transcription of a gene to report the detection of a desired molecule and those that are independent of this reporting mechanism. Transcription-dependent biosensors frequently depend on heterologous expression of sensing elements from non-yeast organisms, a strategy that has greatly expanded the range of molecules available for detection by YBBs. Transcription-independent biosensors circumvent the problem of sensing difficult-to-detect analytes by instead relying on yeast metabolism to generate easily detected molecules when the analyte is present. The use of yeast as the sensing element in biosensors has proven to be successful and continues to hold great promise for a variety of applications. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  3. Accelerating Yeast Prion Biology using Droplet Microfluidics

    Science.gov (United States)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  4. Yeast cell factories on the horizon

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2015-01-01

    For thousands of years, yeast has been used for making beer, bread, and wine. In modern times, it has become a commercial workhorse for producing fuels, chemicals, and pharmaceuticals such as insulin, human serum albumin, and vaccines against hepatitis virus and human papillomavirus. Yeast has also...... been engineered to make chemicals at industrial scale (e.g., succinic acid, lactic acid, resveratrol) and advanced biofuels (e.g., isobutanol) (1). On page 1095 of this issue, Galanie et al. (2) demonstrate that yeast can now be engineered to produce opioids (2), a major class of compounds used...

  5. 21 CFR 172.590 - Yeast-malt sprout extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...

  6. 21 CFR 184.1983 - Bakers yeast extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b) The...

  7. 21 CFR 172.898 - Bakers yeast glycan.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast glycan. 172.898 Section 172.898 Food... Multipurpose Additives § 172.898 Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized, and...

  8. Immobilization of yeast cells by radiation-induced polymerization

    International Nuclear Information System (INIS)

    Fujimura, T.; Kaetsu, I.

    1982-01-01

    Radiation-induced polymerization method was applied to the immobilization of yeast cells. The effects of irradiation, cooling and monomer, which are neccessary for polymerization, were recovered completely by subsequent aerobical incubation of yeast cells. The ethanol productive in immobilized yeast cells increased with the increase of aerobical incubation period. The growth of yeast cells in immobilized yeast cells was indicated. The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. (orig.)

  9. Fatty acids from oleaginous yeasts and yeast-like fungi and their potential applications.

    Science.gov (United States)

    Xue, Si-Jia; Chi, Zhe; Zhang, Yu; Li, Yan-Feng; Liu, Guang-Lei; Jiang, Hong; Hu, Zhong; Chi, Zhen-Ming

    2018-02-01

    Oleaginous yeasts, fatty acids biosynthesis and regulation in the oleaginous yeasts and the fatty acids from the oleaginous yeasts and their applications are reviewed in this article. Oleaginous yeasts such as Rhodosporidium toruloides, Yarrowia lipolytica, Rhodotorula mucilaginosa, and Aureobasidium melanogenum, which can accumulate over 50% lipid of their cell dry weight, have many advantages over other oleaginous microorganisms. The fatty acids from the oleaginous yeasts have many potential applications. Many oleaginous yeasts have now been genetically modified to over-produce fatty acids and their derivatives. The most important features of the oleaginous yeasts are that they have special enzymatic systems for enhanced biosynthesis and regulation of fatty acids in their lipid particles. Recently, some oleaginous yeasts such as R. toruloides have been found to have a unique fatty acids synthetase and other oleaginous yeasts such as A. melanogenum have a unique highly reducing polyketide synthase (HR-PKS) involved in the biosynthesis of hydroxyl fatty acids. It is necessary to further enhance lipid biosynthesis using metabolic engineering and explore new applications of fatty acids in biotechnology.

  10. Isolation and identification of radiation resistant yeasts from sea water

    International Nuclear Information System (INIS)

    Park, Jong Cheon; Jeong, Yong Uk; Kim, Du Hong; Jo, Eun A

    2011-12-01

    This study was conducted to isolate radiation-resistant yeasts from sea water for development of application technology of radiation-resistant microorganism. · Isolation of 656 yeasts from sea water and selection of 2 radiation-resistant yeasts (D 10 value >3) · Identification of isolated yeasts as Filobasidium elegans sharing 99% sequence similarity · Characterization of isolated yeast with ability to repair of the DNA damage and membrane integrity to irradiation

  11. Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production

    OpenAIRE

    Popov Stevan D.; Dodić Siniša N.; Mastilović Jasna S.; Dodić Jelena M.; Popov-Raljić Jovanka V.

    2005-01-01

    The waste brewer's yeast S. cerevisiae (activated and non-activated) was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positive...

  12. Regulatory aspects of methanol metabolism in yeasts

    International Nuclear Information System (INIS)

    Trotsenko, Y.A.; Bystrykh, L.V.; Ubiyvovk, V.M.

    1984-01-01

    Formaldehyde is the first and key intermediate in the metabolism of methylotrophic yeasts since it stands at a branch point of pathways for methanol oxidation and assimilation. Methanol and, formaldehyde are toxic compounds which severely affect the growth rate, yield coefficient, etc., of yeasts. Two questions arise when considering regulation of methanol metabolism in yeasts how a nontoxic level of formaldehyde is maintained in the cell and how the formaldehyde flow is distributed into oxidation and assimilation. To answer these questions we studied the role of GSH, which spontaneously binds formaldehyde, yielding S-hydroxymethylglutathione; in vivo rates of formaldehyde dissimilation and assimilation by using [ 14 C]methanol; profiles of enzymes responsible for production and utilization of formaldehyde; and levels of metabolites affecting dissimilation and assimilation of formaldehyde. All of the experiments were carried out with the methylotrophic yeast Candida boidinii KD1. 19 refs., 4 figs., 1 tab

  13. Propagation of Mammalian Prions in Yeast

    National Research Council Canada - National Science Library

    Harris, David A

    2006-01-01

    ...: the budding yeast Saccharomyces cerevisiae. This unicellular organism offers a number of potential advantages for the study of prion biology, including rapid generation time, ease of culturing, and facile genetics...

  14. Structure and function of yeast alcohol dehydrogenase

    Directory of Open Access Journals (Sweden)

    VLADIMIR LESKOVAC

    2000-04-01

    Full Text Available 1. Introduction 2. Isoenzymes of YADH 3. Substrate specificity 4. Kinetic mechanism 5. Primary structure 6. The active site 7. Mutations in the yeast enzyme 8. Chemical mechanism 9. Binding of coenzymes 10. Hydride transfer

  15. yeast transformation of Mucor circinelloides Tieghe

    African Journals Online (AJOL)

    GRACE

    2006-05-02

    May 2, 2006 ... A nested model analysis of variance of growth data of induced yeast .... Figure 2. Mean biomass and relative growth rates of M. circinelloides cultivated in treatments in ..... Pullman B (ed) Frontiers in Physicochemical Biology.

  16. Genomic Evolution of the Ascomycete Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf; Boundy-Mills, Kyria; Goker, Markus; Hittinger, Chris; Klenk, Hans-Peter; Lopes, Mariana; Meir-Kolthoff, Jan P.; Rokas, Antonis; Rosa, Carlos; Scheuner, Carmen; Soares, Marco; Stielow, Benjamin; Wisecaver, Jennifer H.; Wolfe, Ken; Blackwell, Meredith; Kurtzman, Cletus; Grigoriev, Igor; Jeffries, Thomas

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and a tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.

  17. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  18. Transcriptional Waves in the Yeast Cell Cycle

    OpenAIRE

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve; Futcher, Bruce; Leatherwood, Janet

    2005-01-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillat...

  19. Determination of tritium in wine yeast samples

    International Nuclear Information System (INIS)

    Cotarlea, Monica-Ionela; Paunescu Niculina; Galeriu, D; Mocanu, N.; Margineanu, R.; Marin, G.

    1998-01-01

    Analytical procedures were developed to determine tritium in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractioning distillation for wine samples and azeotropic distillation/fractional distillation for wine yeast samples. Finally, the water samples were normally distilled with K MO 4 . The established procedures were successfully applied for wine and wine samples from Murfatlar harvests of the years 1995 and 1996. (authors)

  20. The growth of solar radiated yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kraft, T.

    1995-09-01

    This researcher plans to determine if solar radiation affects the growth of yeast. The irradiated yeast was obtained from a sample exposed in space during a Space Shuttle flight of September 9-20, 1994. Further, the control groups were held at: (1) Goddard Space Flight Center (GSFC) in Greenbelt, Maryland; and (2) South Dakota School of Mines and Technology. The procedure used was based on the fact that yeast is most often used in consumable baked goods. Therefore, the yeast was incorporated into a basic Betty Crocker bread recipe. Data was collected by placing measured amounts of dough into sample containers with fifteen minute growth in height measurements collected and recorded. This researcher assumed the viability of yeast to be relative to its ability to produce carbon dioxide gas and cause the dough to rise. As all ingredients and surroundings were equal, this researcher assumed the yeast will produce the only significant difference in data collected. This researcher noted the approximate use date on all sample packages to be prior to arrival and experiment date. All dates equal, it was then assumed each would act in a similar manner of response. This assumption will allow for equally correct data collection.

  1. The growth of solar radiated yeast

    Science.gov (United States)

    Kraft, Tyrone

    1995-01-01

    This researcher plans to determine if solar radiation affects the growth of yeast. The irradiated yeast was obtained from a sample exposed in space during a Space Shuttle flight of September 9-20, 1994. Further, the control groups were held at: (1) Goddard Space Flight Center (GSFC) in Greenbelt, Maryland; and (2) South Dakota School of Mines and Technology. The procedure used was based on the fact that yeast is most often used in consumable baked goods. Therefore, the yeast was incorporated into a basic Betty Crocker bread recipe. Data was collected by placing measured amounts of dough into sample containers with fifteen minute growth in height measurements collected and recorded. This researcher assumed the viability of yeast to be relative to its ability to produce carbon dioxide gas and cause the dough to rise. As all ingredients and surroundings were equal, this researcher assumed the yeast will produce the only significant difference in data collected. This researcher noted the approximate use date on all sample packages to be prior to arrival and experiment date. All dates equal, it was then assumed each would act in a similar manner of response. This assumption will allow for equally correct data collection.

  2. History of genome editing in yeast.

    Science.gov (United States)

    Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela

    2018-05-01

    For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.

  3. Radiodiagnosis of yeast alveolits (a clinicoexperimental study)

    International Nuclear Information System (INIS)

    Amosov, I.S.; Smirnov, V.A.

    1984-01-01

    A clinicoroetgenological study was made of 115 workers engaged in the yeast production for different periods of time. Disorders of the respiration biomechanics were revealed depending on the period of service. These data were obtained as a result of the use of roentgenopneumopolygraphy. An experimental study was conducted to establish the nature of lesions in the bronchopulmonary system in allergic alveolitis. The effect of finely divided yeast dust on the bronchopulmonary system was studied on 132 guinea-pigs usinq microbronchography and morphological examination. As a result of the study it has been established that during the inhalation of yeast dust, notnceable dystrophy of the bronchi develops, the sizes of alveoli enlarge and part of them undergo emphysematous distension with the rupture of the interalveolar septa. In the course of the study, it has been shown that yeast dust is little agreessive, yeast alveolitis develops after many years of work. The clinical symptoms are non-specific and insignificant. X-ray and morphological changes are followed by the physical manifestations of yeast alveolitis

  4. Novel brewing yeast hybrids: creation and application.

    Science.gov (United States)

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2017-01-01

    The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.

  5. Making Sense of the Yeast Sphingolipid Pathway.

    Science.gov (United States)

    Megyeri, Márton; Riezman, Howard; Schuldiner, Maya; Futerman, Anthony H

    2016-12-04

    Sphingolipids (SL) and their metabolites play key roles both as structural components of membranes and as signaling molecules. Many of the key enzymes and regulators of SL metabolism were discovered using the yeast Saccharomyces cerevisiae, and based on the high degree of conservation, a number of mammalian homologs were identified. Although yeast continues to be an important tool for SL research, the complexity of SL structure and nomenclature often hampers the ability of new researchers to grasp the subtleties of yeast SL biology and discover new modulators of this intricate pathway. Moreover, the emergence of lipidomics by mass spectrometry has enabled the rapid identification of SL species in yeast and rendered the analysis of SL composition under various physiological and pathophysiological conditions readily amenable. However, the complex nomenclature of the identified species renders much of the data inaccessible to non-specialists. In this review, we focus on parsing both the classical SL nomenclature and the nomenclature normally used during mass spectrometry analysis, which should facilitate the understanding of yeast SL data and might shed light on biological processes in which SLs are involved. Finally, we discuss a number of putative roles of various yeast SL species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Revaluation of Waste Yeast from Beer Production

    Directory of Open Access Journals (Sweden)

    Nicoleta Suruceanu

    2013-11-01

    Full Text Available Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, identification and quantification of xanthohumol by HPLC method. Waste yeast from brewery pilot plant of USAMV Cluj Napoca it was dried by atomization and the powder was analyzed on xanthohumol content by HPLC method. For quantification a calibration curve it was used. The process of drying by atomisation lead to a powder product. It was used malt dextrin powder for stabilisation. The final product it was encapsulated. The xanthohumol content of powdered yeast it was 1.94 µg/ml. In conclusion the slurry yeast from beer production it is an important source of prenylflavonoids compounds.

  7. Flor Yeast: New Perspectives Beyond Wine Aging

    Science.gov (United States)

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  8. Spermidine cures yeast of prions

    Directory of Open Access Journals (Sweden)

    Shaun H. Speldewinde

    2015-12-01

    Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN­+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.

  9. NetPhosYeast: prediction of protein phosphorylation sites in yeast

    DEFF Research Database (Denmark)

    Ingrell, C.R.; Miller, Martin Lee; Jensen, O.N.

    2007-01-01

    sites compared to those in humans, suggesting the need for an yeast-specific phosphorylation site predictor. NetPhosYeast achieves a correlation coefficient close to 0.75 with a sensitivity of 0.84 and specificity of 0.90 and outperforms existing predictors in the identification of phosphorylation sites...

  10. Differences between flocculating yeast and regular industrial yeast in transcription and metabolite profiling during ethanol fermentation

    Directory of Open Access Journals (Sweden)

    Lili Li

    2017-03-01

    Full Text Available Objectives: To improve ethanolic fermentation performance of self-flocculating yeast, difference between a flocculating yeast strain and a regular industrial yeast strain was analyzed by transcriptional and metabolic approaches. Results: The number of down-regulated (industrial yeast YIC10 vs. flocculating yeast GIM2.71 and up-regulated genes were 4503 and 228, respectively. It is the economic regulation for YIC10 that non-essential genes were down-regulated, and cells put more “energy” into growth and ethanol production. Hexose transport and phosphorylation were not the limiting-steps in ethanol fermentation for GIM2.71 compared to YIC10, whereas the reaction of 1,3-disphosphoglycerate to 3-phosphoglycerate, the decarboxylation of pyruvate to acetaldehyde and its subsequent reduction to ethanol were the most limiting steps. GIM2.71 had stronger stress response than non-flocculating yeast and much more carbohydrate was distributed to other bypass, such as glycerol, acetate and trehalose synthesis. Conclusions: Differences between flocculating yeast and regular industrial yeast in transcription and metabolite profiling will provide clues for improving the fermentation performance of GIM2.71.

  11. Yeast Interacting Proteins Database: YFR015C, YFR015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...ression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary ...tion, nitrogen starvation, environmental stress, and entry into stationary phase Rows with this bait as bait..., the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental

  12. Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

    Science.gov (United States)

    Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

    2013-06-01

    Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

  13. Increasing the yeast yield in alcohol fermentation

    Energy Technology Data Exchange (ETDEWEB)

    Pelc, A; Vamos, E; Varga, L; Gavalya, S; Dolanszky, F

    1964-02-01

    The yeast and ethanol yields (the latter being based on the substrate) are enhanced by adding the substrate (molasses) gradually to the suspension of inoculating yeast during the main fermentation period, passing air through the mash, ceasing both substrate addition and aeration at the end of the main period, and allowing the process to come to an end. This way 12 to 14 kg yeast (dry weight)/100 l ethanol could be obtained within 16 to 24 hours and the yeast obtained could be used as the inoculum for the next charge. For example: 11 to 16 kg yeast (or 18 to 25 l yeast suspension from the preceding charge, containing 18 to 20% dry matter) is kept in 30 to 35 l H/sub 2/SO/sub 4/ (0.74 g/100 ml) for 1 hour, diluted with H/sub 2/O and 30 kg sterile molasses to 300 l, kept at 30 to 32/sup 0/ with mild aeration for 2 hours, 1900 l 30/sup 0/ H/sub 2/O added, then 1 m/sup 3/ air/m/sup 2//hour is passed through the mixture, with the addition of 270 kg sterile molasses, and a solution of 8 kg superphosphate and 5 kg (NH/sub 4/)/sub 2/SO/sub 4/ in 100 l H/sub 2/O, the latter being added in 5 portions over 2 hours. Molasses (600 kg) is added during the main period, maintaining the pH at 5 (H/sub 2/SO/sub 4/), and the temperature at 30/sup 0/, then aeration is ceased and the mixture kept until fermentation proceeds. The 3000 l medium contains 9.6% ethanol and 1.38% yeast, respectively.

  14. Schizosaccharomyces japonicus: the fission yeast is a fusion of yeast and hyphae.

    Science.gov (United States)

    Niki, Hironori

    2014-03-01

    The clade of Schizosaccharomyces includes 4 species: S. pombe, S. octosporus, S. cryophilus, and S. japonicus. Although all 4 species exhibit unicellular growth with a binary fission mode of cell division, S. japonicus alone is dimorphic yeast, which can transit from unicellular yeast to long filamentous hyphae. Recently it was found that the hyphal cells response to light and then synchronously activate cytokinesis of hyphae. In addition to hyphal growth, S. japonicas has many properties that aren't shared with other fission yeast. Mitosis of S. japonicas is referred to as semi-open mitosis because dynamics of nuclear membrane is an intermediate mode between open mitosis and closed mitosis. Novel genetic tools and the whole genomic sequencing of S. japonicas now provide us with an opportunity for revealing unique characters of the dimorphic yeast. © 2013 The Author. Yeast Published by John Wiley & Sons Ltd.

  15. Terroir of yeasts? – Application of FTIR spectroscopy and molecular methods for strain typing of yeasts

    Directory of Open Access Journals (Sweden)

    Gerhards Daniel

    2015-01-01

    Full Text Available The site specific influence on wine (Terroir is an often by wine producers, consumers and scientists discussed topic in the world of wine. A study on grapes and (spontaneous fermentations from six different vineyards was done to investigate the biodiversity of yeasts and to answer the question if there is a terroir of yeast and how it could be influenced. Randomly isolated yeasts were identified by FTIR-spectroscopy and molecular methods on species and strain level. Vineyard specific yeast floras would be observed but they are not such important as expected. Only a few overlapping strain patterns would be identified during both vintages. The yeast flora of the winery had a huge impact on the spontaneous fermentations, but is not really constant and influenced by different factors from outside.

  16. Protein patterns of yeast during sporulation

    International Nuclear Information System (INIS)

    Litske Petersen, J.G.; Kielland-Brandt, M.C.; Nilsson-Tillgren, T.

    1979-01-01

    High resolution two-dimensional gel electrophoresis was used to study protein synthesis during synchronous meiosis and ascospore formation of Saccharomyces cerevisiae. The stained protein patterns of samples harvested at any stage between meiotic prophase and the four-spore stage in two sporulating strains showed the same approximately 250 polypeptides. Of these only a few seemed to increase or decrease in concentration during sporulation. The characteristic pattern of sporulating yeast was identical to the pattern of glucose-grown staitonary yeast cells adapted to respiration. The latter type of cells readily initiates meiosis when transferred to sporulation medium. This pattern differed from the protein patterns of exponentially growing cells in glucose or acetate presporulation medium. Five major proteins in stationary and sporulating yeast cells were not detected in either type of exponential culture. Two-dimensional autoradiograms of [ 35 S]methionine-labelled yeast proteins revealed that some proteins were preferentially labelled during sporulation, while other proteins were labelled at later stages. These patterns differed from the auroradiograms of exponentially growing yeast cells in glucose presporulation medium in a number of spots. No differences were observed when stained gels or autoradiograms of sporulating cultures and non-sporulating strains in sporulation medium were compared. (author)

  17. Yeast genetics. A manual of methods

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.F.T.; Spencer, D.M.; Bruce, I.J.

    1989-01-01

    This is a bench-top manual of methods needed both for classical genetics as related to yeasts, such as mating, sporulation, isolation of hybrids, microdissection of asci for the isolation of single-spore clones, as well as for mapping of genes and the construction of new strains by protoplast fusion. Special emphasis is on mutations in general, and on methods of isolating a number of important classes of mutants in particular. Basic techniques for the separation of chromosomes by electrophoresis, such as OFAGE, FIGE, and CHEF, are discussed, with detailed protocols for the first two. Furthermore, new methods, e.g. for the isolation of high molecular weight DNA from yeast, isolation of RNA, and techniques for transformation of yeasts, are also described in detail. (orig.) With 10 figs.

  18. Modeling diauxic glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Sørensen, Preben Graae

    2010-01-01

    for investigations of central metabolism dynamics of yeast cells. We have previously proposed a model for the open system comprised of the primary fermentative reactions in yeast that quantitatively describes the oscillatory dynamics. However, this model fails to describe the transient behavior of metabolic......Glycolytic oscillations in a stirred suspension of starved yeast cells is an excellent model system for studying the dynamics of metabolic switching in living systems. In an open-flow system the oscillations can be maintained indefinitely at a constant operating point where they can....... Experimental and computational results strongly suggest that regulation of acetaldehyde explains the observed behavior. We have extended the original model with regulation of pyruvate decarboxylase, a reversible alcohol dehydrogenase, and drainage of pyruvate. Using the method of time rescaling in the extended...

  19. [Urinary infection by Saccharomyces cerevisiae: Emerging yeast?].

    Science.gov (United States)

    Elkhihal, B; Elhalimi, M; Ghfir, B; Mostachi, A; Lyagoubi, M; Aoufi, S

    2015-12-01

    Saccharomyces cerevisiae is a commensal yeast of the digestive, respiratory and genito-urinary tract. It is widely used as a probiotic for the treatment of post-antibiotic diarrhea. It most often occurs in immunocompromised patients frequently causing fungemia. We report the case of an adult diabetic patient who had a urinary tract infection due to S. cerevisiae. The disease started with urination associated with urinary frequency burns without fever. The diagnosis was established by the presence of yeasts on direct examination and positivity of culture on Sabouraud-chloramphenicol three times. The auxanogramme gallery (Auxacolor BioRad(®)) allowed the identification of S. cerevisiae. The patient was put on fluconazole with good outcome. This observation points out that this is an opportunistic yeast in immunocompromised patients. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Structural Studies of the Yeast Mitochondrial Degradosome

    DEFF Research Database (Denmark)

    Feddersen, Ane; Jonstrup, Anette Thyssen; Brodersen, Ditlev Egeskov

    The yeast mitochondrial degradosome/exosome (mtExo) is responsible for most RNA turnover in mitochondria and has been proposed to form a central part of a mitochondrial RNA surveillance system responsible for degradation of aberrant and unprocessed RNA ([1], [2]). In contrast to the cytoplasmic...... and nuclear exosome complexes, which consist of 10-12 different nuclease subunits, the mitochondrial degradosome is composed of only two large subunits - an RNase (Dss1p) and a helicase (Suv3p), belonging the Ski2 class of DExH box RNA helicases. Both subunits are encoded on the yeast nuclear genome...... and and Suv3p from the fission yeast, Schizosaccharomyces pombe, have been cloned for heterologous expression in E. coli. Of the two, we have succeeded in purifying the 73kDa Suv3p by Ni2+-affinity chromatography followed by cleavage of the N-terminal His-tag, cation exchange, and gel filtration. Crystals...

  1. Flux control through protein phosphorylation in yeast

    DEFF Research Database (Denmark)

    Chen, Yu; Nielsen, Jens

    2016-01-01

    Protein phosphorylation is one of the most important mechanisms regulating metabolism as it can directly modify metabolic enzymes by the addition of phosphate groups. Attributed to such a rapid and reversible mechanism, cells can adjust metabolism rapidly in response to temporal changes. The yeast...... as well as identify mechanisms underlying human metabolic diseases. Here we collect functional phosphorylation events of 41 enzymes involved in yeast metabolism and demonstrate functional mechanisms and the application of this information in metabolic engineering. From a systems biology perspective, we...... describe the development of phosphoproteomics in yeast as well as approaches to analysing the phosphoproteomics data. Finally, we focus on integrated analyses with other omics data sets and genome-scale metabolic models. Despite the advances, future studies improving both experimental technologies...

  2. Biofuels. Altered sterol composition renders yeast thermotolerant

    DEFF Research Database (Denmark)

    Caspeta, Luis; Chen, Yun; Ghiaci, Payam

    2014-01-01

    adaptive laboratory evolution to select yeast strains with improved growth and ethanol production at ≥40°C. Sequencing of the whole genome, genome-wide gene expression, and metabolic-flux analyses revealed a change in sterol composition, from ergosterol to fecosterol, caused by mutations in the C-5 sterol......Ethanol production for use as a biofuel is mainly achieved through simultaneous saccharification and fermentation by yeast. Operating at ≥40°C would be beneficial in terms of increasing efficiency of the process and reducing costs, but yeast does not grow efficiently at those temperatures. We used...... desaturase gene, and increased expression of genes involved in sterol biosynthesis. Additionally, large chromosome III rearrangements and mutations in genes associated with DNA damage and respiration were found, but contributed less to the thermotolerant phenotype....

  3. Probiotic Properties of Non-Saccharomyces Yeasts

    DEFF Research Database (Denmark)

    Smith, Ida Mosbech

    to harmless luminal substances is a key feature of the intestinal immune system. In this context, dendritic cells (DCs) present in the tissues lining the human gut are central players involved in microbial sensing and shaping of appropriate adaptive immune responses. Probiotics are live microorganisms which...... when administered in adequate amounts confer a health benefit on the host. While the majority of probiotic microorganisms studied to date are lactic acid bacteria, research in yeasts with potentially beneficial influences on human health has mainly revolved around Saccharomyces boulardii. This yeast...... has shown a positive impact on disease outcome in clinical studies of inflammatory bowel disease, indicating an ability of S. boulardii to influence human immune responses underlying intestinal inflammation. Consequent to this focus on S. boulardii as the fundamental probiotic yeast, very little...

  4. Metallic Biosorption Using Yeasts in Continuous Systems

    Directory of Open Access Journals (Sweden)

    Karla Miriam Hernández Mata

    2013-01-01

    Full Text Available Mining effluents were found to be the main source of pollution by heavy metals of the surface water in the San Pedro River in Sonora, Mexico. The overall objective of this study was to determine the biosorption of Zn, Cu, Mn, and Fe with yeasts isolated from San Pedro River in a continuous system. The tests conducted in two reactors packed with zeolite connected in series. The first reactor was inoculated mixing two yeasts species, and the effluent of the first reactor was fed to second reactor. Subsequently, the first reactor was fed with contaminated water of San Pedro River and effluent from this was the second reactor influent. After 40 days of the experiment a reduction of 81.5% zinc, 76.5% copper, manganese 95.5%, and 99.8% of iron was obtained. These results show that the selected yeasts are capable of biosorbing zinc, copper, manganese, and iron under these conditions.

  5. Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.

    Science.gov (United States)

    Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena

    2012-12-01

    Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.

  6. New yeasts-new brews: modern approaches to brewing yeast design and development.

    Science.gov (United States)

    Gibson, B; Geertman, J-M A; Hittinger, C T; Krogerus, K; Libkind, D; Louis, E J; Magalhães, F; Sampaio, J P

    2017-06-01

    The brewing industry is experiencing a period of change and experimentation largely driven by customer demand for product diversity. This has coincided with a greater appreciation of the role of yeast in determining the character of beer and the widespread availability of powerful tools for yeast research. Genome analysis in particular has helped clarify the processes leading to domestication of brewing yeast and has identified domestication signatures that may be exploited for further yeast development. The functional properties of non-conventional yeast (both Saccharomyces and non-Saccharomyces) are being assessed with a view to creating beers with new flavours as well as producing flavoursome non-alcoholic beers. The discovery of the psychrotolerant S. eubayanus has stimulated research on de novo S. cerevisiae × S. eubayanus hybrids for low-temperature lager brewing and has led to renewed interest in the functional importance of hybrid organisms and the mechanisms that determine hybrid genome function and stability. The greater diversity of yeast that can be applied in brewing, along with an improved understanding of yeasts' evolutionary history and biology, is expected to have a significant and direct impact on the brewing industry, with potential for improved brewing efficiency, product diversity and, above all, customer satisfaction. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Yeast Infection Test: MedlinePlus Lab Test Information

    Science.gov (United States)

    ... cheese-like discharge Painful urination Redness in the vagina Yeast infection of the penis may cause: Redness Scaling Rash ... on the location of your symptoms: If a vaginal yeast infection is suspected , your health care provider will perform ...

  8. Autophagy: one more Nobel Prize for yeast

    Directory of Open Access Journals (Sweden)

    Andreas Zimmermann

    2016-12-01

    Full Text Available The recent announcement of the 2016 Nobel Prize in Physiology or Medicine, awarded to Yoshinori Ohsumi for the discoveries of mechanisms governing autophagy, underscores the importance of intracellular degradation and recycling. At the same time, it further cements yeast, in which this field decisively developed, as a prolific model organism. Here we provide a quick historical overview that mirrors both the importance of autophagy as a conserved and essential process for cellular life and death as well as the crucial role of yeast in its mechanistic characterization.

  9. Characterization of wine yeasts for ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez, J.; Benitez, T.

    1986-11-01

    Selected wine yeasts were tested for their ethanol and sugar tolerance, and for their fermentative capacity. Growth (..mu..) and fermentation rates (..nu..) were increasingly inhibited by increasing ethanol and glucose concentrations, ''flor'' yeasts being the least inhibited. Except in the latter strains, the ethanol production rate was accelerated by adding the glucose stepwise. The best fermenting strains selected in laboratory medium were also the best at fermenting molasses. Invertase activity was not a limiting step in ethanol production, ..nu.. being accelerated by supplementing molasses with ammonia and biotine, and by cell recycle.

  10. Occurrence of Killer Yeast Strains in Fruit and Berry Wine Yeast Populations

    Directory of Open Access Journals (Sweden)

    Gintare Gulbiniene

    2004-01-01

    Full Text Available Apple, cranberry, chokeberry and Lithuanian red grape wine yeast populations were used for the determination of killer yeast occurrence. According to the tests of the killer characteristics and immunity the isolated strains were divided into seven groups. In this work the activity of killer toxins purified from some typical strains was evaluated. The analysed strains produced different amounts of active killer toxin and some of them possessed new industrially significant killer properties. Total dsRNA extractions in 11 killer strains of yeast isolated from spontaneous fermentations revealed that the molecular basis of the killer phenomenon was not only dsRNAs, but also unidentified genetic determinants.

  11. Guidelines and recommendations on yeast cell death nomenclature

    OpenAIRE

    Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andres; Austriaco, Nicanor; Sigrist, Stephan J.

    2018-01-01

    Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of mor...

  12. Effect of increasing growth temperature on yeast fermentation ...

    African Journals Online (AJOL)

    The effect of increasing growth temperature on yeast fermentation was studied at approximately 5 oC intervals over a range of 18 – 37 oC, using one strain each of ale, lager and wine yeast. The ale and wine yeasts grew at all the temperatures tested, but lager yeast failed to grow at 37 oC. All these strains gave lower ...

  13. Guidelines and recommendations on yeast cell death nomenclature

    NARCIS (Netherlands)

    Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J; Breitenbach, Michael; Burhans, William C; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W; Grant, Chris M; Greenwood, Michael T; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D; Outeiro, Tiago F; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F; Sharon, Amir; Sigrist, Stephan J; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B; Tuite, Mick; Vögtle, F-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J; Zhao, Richard Y; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

    2018-01-01

    Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cel-lular demise. However, the investigation of yeast cell death is a relatively young field, and a widely

  14. Selection of oleaginous yeasts for fatty acid production

    NARCIS (Netherlands)

    Lamers, Dennis; Biezen, van Nick; Martens, Dirk; Peters, Linda; Zilver, van de Eric; Jacobs-van Dreumel, Nicole; Wijffels, René H.; Lokman, Christien

    2016-01-01

    Background: Oleaginous yeast species are an alternative for the production of lipids or triacylglycerides (TAGs). These yeasts are usually non-pathogenic and able to store TAGs ranging from 20 % to 70 % of their cell mass depending on culture conditions. TAGs originating from oleaginous yeasts

  15. Performance of baker's yeast produced using date syrup substrate ...

    African Journals Online (AJOL)

    Baker's yeast was produced from three selected baker's yeast strains using date syrup as a substrate at low and high flow rate compared to those produced using molasses substrates. Performance of the produced baker's yeasts on Arabic bread quality was investigated. Baking tests showed a positive relationship between ...

  16. Triacetic acid lactone production in industrial Saccharomyces yeast strains

    Science.gov (United States)

    Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...

  17. 21 CFR 573.750 - Pichia pastoris dried yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Pichia pastoris dried yeast. 573.750 Section 573... Food Additive Listing § 573.750 Pichia pastoris dried yeast. (a) Identity. The food additive Pichia pastoris dried yeast may be used in feed formulations of broiler chickens as a source of protein not to...

  18. Yeast Interacting Proteins Database: YFR015C, YJL137C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...pression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary

  19. Yeast mother cell-specific aging

    Czech Academy of Sciences Publication Activity Database

    Breitenbach, M.; Laun, P.; Pichová, Alena; Madeo, F.; Heeren, G.; Kohlwein, S. D.; Froehlich, K. U.; Dawes, I.

    2001-01-01

    Roč. 18, - (2001), s. 21 ISSN 0749-503X. [International Conference on Yeast Genetics and Molecular Biology /20./. 26.08.2001-31.08.2001, Prague] Institutional research plan: CEZ:AV0Z5020903 Subject RIV: EB - Genetics ; Molecular Biology

  20. Xylitol production from colombian native yeast strains

    Directory of Open Access Journals (Sweden)

    Isleny Andrea Vanegas Córdoba

    2004-07-01

    Full Text Available Xylitol is an alternative sweetener with similar characteristics to sucrose that has become of great interest, due mainly to its safe use in diabetic patients and those deficient in glucose-6-phosphate-dehydrogenase. Its chemical production is expensive and generates undesirable by-products, whereas biotechnological process, which uses different yeasts genera, is a viable production alternative because it is safer and specific. Colombia has a privilege geographic location and offers a great microbial variety, this can be taken advantage of with academic and commercial goals. Because of this, some native microorganisms with potential to produce xylitol were screened in this work. It were isolated 25 yeasts species, from which was possible to identify 84% by the kit API 20C-AUX. Three yeasts: Candida kefyr, C. tropicalis y C. parapsilosis presented greater capacity to degrade xylose compared to the others, therefore they were selected for the later evaluation of its productive capacity. Discontinuous cellular cultures were developed in shaken flasks at 200 rpm and 35°C by 30 hours, using synthetic media with xylose as carbon source. Xylose consumption and xylitol production were evaluated by thin layer chromatography and high performance liquid chromatography. The maximal efficiency were obtained with Candida kefyr and C. tropicalis (Yp/s 0.5 y 0.43 g/g, respectively, using an initial xylose concentration of 20 g/L. Key words: Xylitol, xylose, yeasts, Candida kefyr, C. tropicalis, C. parapsilosis.

  1. Yeast metabolic engineering for hemicellulosic ethanol production

    Science.gov (United States)

    Jennifer Van Vleet; Thomas W. Jeffries

    2009-01-01

    Efficient fermentation of hemicellulosic sugars is critical for the bioconversion of lignocellulosics to ethanol. Efficient sugar uptake through the heterologous expression of yeast and fungal xylose/glucose transporters can improve fermentation if other metabolic steps are not rate limiting. Rectification of cofactor imbalances through heterologous expression of...

  2. Uncommon opportunistic yeast bloodstream infections from Qatar

    NARCIS (Netherlands)

    Taj-Aldeen, S.J.; AbdulWahab, A.; Kolecka, A.; Deshmukh, A.; Meis, J.F.G.M.; Boekhout, T.

    2014-01-01

    Eleven uncommon yeast species that are associated with high mortality rates irrespective of antifungal therapy were isolated from 17/187 (201 episodes) pediatric and elderly patients with fungemia from Qatar. The samples were taken over a 6-year period (January 2004-December 2010). Isolated species

  3. Ethanol fermentation with a flocculating yeast

    Energy Technology Data Exchange (ETDEWEB)

    Admassu, W; Korus, R A; Heimsch, R C

    1985-08-01

    A 100 cm x 5.7 cm internal diameter tower fermentor was fabricated and operated continuously for 11 months using the floc-forming yeast, Saccharomyces cerevisiae (American Type Culture Collection 4097). Steady state operation of the system was characterized at 32/sup 0/C and pH 4.0 for glucose concentrations ranging from 105 to 215 g l/sup -1/. The height of the yeast bed in the tower was maintained at 80 cm. The high yeast density, ethanol concentration and low pH prevented bacterial contamination in the reactor. The concentration profiles of glucose and ethanol within the bed were described by a dispersion model. Modeling parameters were determined for the yeast by batch kinetics and tracer experiments. The kinetic model included ethanol inhibition and substrate limitation. A tracer study with step input of D-xylose (a non-metabolizable sugar for S. cerevisiae) determined the dispersion number (D/uL=0.16) and liquid voidage (epsilonsub(L)=0.25). Measurements taken after 6 months of continuous operation indicated that there was no significant change in fermentor performance.

  4. Analysis of RNA metabolism in fission yeast

    DEFF Research Database (Denmark)

    Wise, Jo Ann; Nielsen, Olaf

    2017-01-01

    Here we focus on the biogenesis and function of messenger RNA (mRNA) in fission yeast cells. Following a general introduction that also briefly touches on other classes of RNA, we provide an overview of methods used to analyze mRNAs throughout their life cycles....

  5. UBA domain containing proteins in fission yeast

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Semple, Colin A M; Ponting, Chris P

    2003-01-01

    characterised on both the functional and structural levels. One example of a widespread ubiquitin binding module is the ubiquitin associated (UBA) domain. Here, we discuss the approximately 15 UBA domain containing proteins encoded in the relatively small genome of the fission yeast Schizosaccharomyces pombe...

  6. Vaginal yeast infections in diabetic women

    African Journals Online (AJOL)

    could we implicate either trichomoniasis or candidiasis as causes ofthese symptoms (Table I). It is possible that in some instances yeasts may have been missed on cul- ture since it has been estimated that at least 10' cfu/m! are required for a culture to be positive.15 Gardnerella vaginalis was not sought in this study and ...

  7. Phosphorylation site on yeast pyruvate dehydrogenase complex

    International Nuclear Information System (INIS)

    Uhlinger, D.J.

    1986-01-01

    The pyruvate dehydrogenase complex was purified to homogeneity from baker's yeast (Saccharomyces cerevisiae). Yeast cells were disrupted in a Manton-Gaulin laboratory homogenizer. The pyruvate dehydrogenase complex was purified by fractionation with polyethylene glycol, isoelectric precipitation, ultracentrifugation and chromatography on hydroxylapatite. Final purification of the yeast pyruvate dehydrogenase complex was achieved by cation-exchange high pressure liquid chromatography (HPLC). No endogenous pyruvate dehydrogenase kinase activity was detected during the purification. However, the yeast pyruvate dehydrogenase complex was phosphorylated and inactivated with purified pyruvate dehydrogenase kinase from bovine kidney. Tryptic digestion of the 32 P-labeled complex yielded a single phosphopeptide which was purified to homogeniety. The tryptic digest was subjected to chromatography on a C-18 reverse phase HPLC column with a linear gradient of acetonitrile. Radioactive fractions were pooled, concentrated, and subjected to anion-exchange HPLC. The column was developed with a linear gradient of ammonium acetate. Final purification of the phosphopeptide was achieved by chromatography on a C-18 reverse phase HPLC column developed with a linear gradient of acetonitrile. The amino acid sequence of the homogeneous peptide was determined by manual modified Edman degradation

  8. Functional differences in yeast protein disulfide isomerases

    DEFF Research Database (Denmark)

    Nørgaard, P; Westphal, V; Tachibana, C

    2001-01-01

    PDI1 is the essential gene encoding protein disulfide isomerase in yeast. The Saccharomyces cerevisiae genome, however, contains four other nonessential genes with homology to PDI1: MPD1, MPD2, EUG1, and EPS1. We have investigated the effects of simultaneous deletions of these genes. In several...

  9. Catalytic site interactions in yeast OMP synthase

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Barr, Eric W.; Jensen, Kaj Frank

    2014-01-01

    45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal...

  10. Hybridization of Palm Wine Yeasts ( Saccharomyces Cerevisiae ...

    African Journals Online (AJOL)

    Haploid auxotrophic strains of Saccharomyces cerevisiae were selected from palm wine and propagated by protoplast fusion with Brewers yeast. Fusion resulted in an increase in both ethanol production and tolerance against exogenous ethanol. Mean fusion frequencies obtained for a mating types ranged between 8 x ...

  11. Actin and Endocytosis in Budding Yeast

    Science.gov (United States)

    Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

    2015-01-01

    Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

  12. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  13. Effect of yeast storage temperature and flour composition on fermentative activities of baker's yeast

    Directory of Open Access Journals (Sweden)

    Pejin Dušanka J.

    2009-01-01

    Full Text Available Baker's yeast is a set of living cells of Saccharomyces cerevisiae. It contains around 70-72% of water, 42-45% of proteins, around 40% of carbohydrates, around 7.5% of lipids (based on dry matter, and vitamin B-complex. On the basis of yeast cell analysis it can be concluded that yeast is a complex biological system which changes in time. The intensity of the changes depends on temperature. Yeast sample was stored at 4°C i 24°C for 12 days. During storage at 4°C, the content of total carbohydrates decreased from 48.81% to 37.50% (dry matter, whereas carbohydrate loss ranged from 40.81% to 29.28% at 24°C. The content of trehalose was 12.33% in the yeast sample stored at 4°C and 0.24% at 24°C. Loss of fermentative activity was 81.76% in the sample stored at 24°C for 12 days. The composition of five samples of 1st category flour was investigated. It was found that flours containing more reducing sugars and maltose enable higher fermentation activities. The flours with higher ash content (in the range 0.5-0.94% had higher contents of phytic acid. Higher ash and phytic contents in flour increased the yeast fermentative efficiency. In bakery industry, a range of ingredients has been applied to improve the product's quality such as surface active substances (emulsifiers, enzymes, sugars and fats. In the paper, the effect of some ingredients added to dough (margarine, saccharose, sodium chloride and malted barley on the yeast fermentative activity was studied. The mentioned ingredients were added to dough at different doses: 0.5, 1.0, 1.5 and 2.0%, flour basis. It was found that the investigated ingredients affected the fermentative activity of yeast and improved the bread quality.

  14. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

    Science.gov (United States)

    Palková, Zdena; Váchová, Libuše

    2016-09-01

    Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  16. Baker's yeast: production of D- and L-3-hydroxy esters

    DEFF Research Database (Denmark)

    Dahl, Allan Carsten; Madsen, Jørgen Øgaard

    1998-01-01

    harvested while growing. In contrast, the stereoselectivity was shifted towards L-hydroxy esters when the oxo esters were added slowly to ordinary baker's yeast supplied with gluconolactone as co-substrate. The reduction rate with gluconolactone was increased by active aeration. Ethyl L-(S)-3......Baker's yeast grown under oxygen limited conditions and used in the reduction of 3-oxo esters results in a shift of the stereoselectivity of the yeast towards D-hydroxy esters as compared with ordinary baker's yeast. The highest degree of stereoselectivity was obtained with growing yeast or yeast......-hydroxybutanoate was afforded in >99% ee. Both enantiomers of ethyl 3-hydroxypentanoate, D-(R) in 96% ee and L-(S) in 93% ee, and of ethyl 4-chloro-3-hydroxybutanoate, D-(S) in 98% ee and L-(R) in 94% ee, were obtained. The results demonstrate that the stereoselectivity of baker's yeast can be controlled...

  17. Between science and industry-applied yeast research.

    Science.gov (United States)

    Korhola, Matti

    2018-03-01

    I was fortunate to enter yeast research at the Alko Research Laboratories with a strong tradition in yeast biochemistry and physiology studies. At the same time in the 1980s there was a fundamental or paradigm change in molecular biology research with discoveries in DNA sequencing and other analytical and physical techniques for studying macromolecules and cells. Since that time biotechnological research has expanded the traditional fermentation industries to efficient production of industrial and other enzymes and specialty chemicals. Our efforts were directed towards improving the industrial production organisms: minerals enriched yeasts (Se, Cr, Zn) and high glutathione content yeast, baker´s, distiller´s, sour dough and wine yeasts, and the fungal Trichoderma reesei platform for enzyme production. I am grateful for the trust of my colleagues in several leadership positions at the Alko Research Laboratories, Yeast Industry Platform and at the international yeast community.

  18. Full Data of Yeast Interacting Proteins Database (Original Version) - Yeast Interacting Proteins Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Yeast Interacting Proteins Database Full Data of Yeast Interacting Proteins Database (Origin...al Version) Data detail Data name Full Data of Yeast Interacting Proteins Database (Original Version) DOI 10....18908/lsdba.nbdc00742-004 Description of data contents The entire data in the Yeast Interacting Proteins Database...eir interactions are required. Several sources including YPD (Yeast Proteome Database, Costanzo, M. C., Hoga...ematic name in the SGD (Saccharomyces Genome Database; http://www.yeastgenome.org /). Bait gene name The gen

  19. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    Science.gov (United States)

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  20. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

    Science.gov (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

    2017-10-01

    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Game dynamic model for yeast development.

    Science.gov (United States)

    Huang, Yuanyuan; Wu, Zhijun

    2012-07-01

    Game theoretic models, along with replicator equations, have been applied successfully to the study of evolution of populations of competing species, including the growth of a population, the reaching of the population to an equilibrium state, and the evolutionary stability of the state. In this paper, we analyze a game model proposed by Gore et al. (Nature 456:253-256, 2009) in their recent study on the co-development of two mixed yeast strains. We examine the mathematical properties of this model with varying experimental parameters. We simulate the growths of the yeast strains and compare them with the experimental results. We also compute and analyze the equilibrium state of the system and prove that it is asymptotically and evolutionarily stable.

  2. Mapping replication origins in yeast chromosomes.

    Science.gov (United States)

    Brewer, B J; Fangman, W L

    1991-07-01

    The replicon hypothesis, first proposed in 1963 by Jacob and Brenner, states that DNA replication is controlled at sites called origins. Replication origins have been well studied in prokaryotes. However, the study of eukaryotic chromosomal origins has lagged behind, because until recently there has been no method for reliably determining the identity and location of origins from eukaryotic chromosomes. Here, we review a technique we developed with the yeast Saccharomyces cerevisiae that allows both the mapping of replication origins and an assessment of their activity. Two-dimensional agarose gel electrophoresis and Southern hybridization with total genomic DNA are used to determine whether a particular restriction fragment acquires the branched structure diagnostic of replication initiation. The technique has been used to localize origins in yeast chromosomes and assess their initiation efficiency. In some cases, origin activation is dependent upon the surrounding context. The technique is also being applied to a variety of eukaryotic organisms.

  3. Stochasticity in the yeast mating pathway

    International Nuclear Information System (INIS)

    Hong-Li, Wang; Zheng-Ping, Fu; Xin-Hang, Xu; Qi, Ouyang

    2009-01-01

    We report stochastic simulations of the yeast mating signal transduction pathway. The effects of intrinsic and external noise, the influence of cell-to-cell difference in the pathway capacity, and noise propagation in the pathway have been examined. The stochastic temporal behaviour of the pathway is found to be robust to the influence of inherent fluctuations, and intrinsic noise propagates in the pathway in a uniform pattern when the yeasts are treated with pheromones of different stimulus strengths and of varied fluctuations. In agreement with recent experimental findings, extrinsic noise is found to play a more prominent role than intrinsic noise in the variability of proteins. The occurrence frequency for the reactions in the pathway are also examined and a more compact network is obtained by dropping most of the reactions of least occurrence

  4. [Invasive yeast infections in neutropenic patients].

    Science.gov (United States)

    Ruiz Camps, Isabel; Jarque, Isidro

    2016-01-01

    Invasive fungal diseases caused by yeasts still play an important role in the morbidity and mortality in neutropenic patients with haematological malignancies. Although the overall incidence of invasive candidiasis has decreased due to widespread use of antifungal prophylaxis, the incidence of non-Candida albicans Candida species is increasing compared with that of C.albicans, and mortality of invasive candidiasis continues to be high. In addition, there has been an increase in invasive infections caused by an array of uncommon yeasts, including species of the genus Malassezia, Rhodotorula, Trichosporon and Saprochaete, characterised by their resistance to echinocandins and poor prognosis. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Isolation and characterization of phenol degrading yeast.

    Science.gov (United States)

    Patel, Riddhi; Rajkumar, Shalini

    2009-04-01

    A phenol degrading yeast isolate was identified and characterized from the soil sample collected from a landfill site, in Ahmedabad, India, by plating the soil dilutions on Sabouraud's Dextrose Agar. The microscopic studies and biochemical tests indicated the isolate to be Saccharomyces cerevisiae. The phenol degrading potential of the isolate was measured by inoculation of pure culture in the mineral medium containing various phenol concentrations ranging from 100 to 800 mg l(-1 )and monitoring phenol disappearance rate at regular intervals of time. Growth of the isolate in mineral medium with various phenol concentrations was monitored by measuring the turbidity (OD(600) nm). The results showed that the isolated yeast was tolerant to phenol up to 800 mg(-1). The phenol degradation ranged from 8.57 to 100% for the concentration of phenol from 800 mg l(-1 )to 200 mg l(-1), respectively. ((c) 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim).

  6. Made for Each Other: Ascomycete Yeasts and Insects.

    Science.gov (United States)

    Blackwell, Meredith

    2017-06-01

    Fungi and insects live together in the same habitats, and many species of both groups rely on each other for success. Insects, the most successful animals on Earth, cannot produce sterols, essential vitamins, and many enzymes; fungi, often yeast-like in growth form, make up for these deficits. Fungi, however, require constantly replenished substrates because they consume the previous ones, and insects, sometimes lured by volatile fungal compounds, carry fungi directly to a similar, but fresh, habitat. Yeasts associated with insects include Ascomycota (Saccharomycotina, Pezizomycotina) and a few Basidiomycota. Beetles, homopterans, and flies are important associates of fungi, and in turn the insects carry yeasts in pits, specialized external pouches, and modified gut pockets. Some yeasts undergo sexual reproduction within the insect gut, where the genetic diversity of the population is increased, while others, well suited to their stable environment, may never mate. The range of interactions extends from dispersal of yeasts on the surface of insects (e.g., cactus- Drosophila -yeast and ephemeral flower communities, ambrosia beetles, yeasts with holdfasts) to extremely specialized associations of organisms that can no longer exist independently, as in the case of yeast-like symbionts of planthoppers. In a few cases yeast-like fungus-insect associations threaten butterflies and other species with extinction. Technical advances improve discovery and identification of the fungi but also inform our understanding of the evolution of yeast-insect symbioses, although there is much more to learn.

  7. De novo biosynthesis of vanillin in fission yeast (Schizosaccharomyces pombe) and baker's yeast (Saccharomyces cerevisiae).

    Science.gov (United States)

    Hansen, Esben H; Møller, Birger Lindberg; Kock, Gertrud R; Bünner, Camilla M; Kristensen, Charlotte; Jensen, Ole R; Okkels, Finn T; Olsen, Carl E; Motawia, Mohammed S; Hansen, Jørgen

    2009-05-01

    Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin beta-D-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity.

  8. MALDI-TOF MS as a tool to identify foodborne yeasts and yeast-like fungi.

    Science.gov (United States)

    Quintilla, Raquel; Kolecka, Anna; Casaregola, Serge; Daniel, Heide M; Houbraken, Jos; Kostrzewa, Markus; Boekhout, Teun; Groenewald, Marizeth

    2018-02-02

    Since food spoilage by yeasts causes high economic losses, fast and accurate identifications of yeasts associated with food and food-related products are important for the food industry. In this study the efficiency of the matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify food related yeasts was evaluated. A CBS in-house MALDI-TOF MS database was created and later challenged with a blinded test set of 146 yeast strains obtained from food and food related products. Ninety eight percent of the strains were correctly identified with log score values>1.7. One strain, Mrakia frigida, gained a correct identification with a score value1.7. Ambiguous identifications were observed due to two incorrect reference mass spectra's found in the commercial database BDAL v.4.0, namely Candida sake DSM 70763 which was re-identified as Candida oleophila, and Candida inconspicua DSM 70631 which was re-identified as Pichia membranifaciens. MALDI-TOF MS can distinguish between most of the species, but for some species complexes, such as the Kazachstania telluris and Mrakia frigida complexes, MALDI-TOF MS showed limited resolution and identification of sibling species was sometimes problematic. Despite this, we showed that the MALDI-TOF MS is applicable for routine identification and validation of foodborne yeasts, but a further update of the commercial reference databases is needed. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Phyllosphere yeasts rapidly break down biodegradable plastics

    OpenAIRE

    Kitamoto, Hiroko K; Shinozaki, Yukiko; Cao, Xiao-hong; Morita, Tomotake; Konishi, Masaaki; Tago, Kanako; Kajiwara, Hideyuki; Koitabashi, Motoo; Yoshida, Shigenobu; Watanabe, Takashi; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Tsushima, Seiya

    2011-01-01

    The use of biodegradable plastics can reduce the accumulation of environmentally persistent plastic wastes. The rate of degradation of biodegradable plastics depends on environmental conditions and is highly variable. Techniques for achieving more consistent degradation are needed. However, only a few microorganisms involved in the degradation process have been isolated so far from the environment. Here, we show that Pseudozyma spp. yeasts, which are common in the phyllosphere and are easily ...

  10. An engineered yeast efficiently secreting penicillin.

    Directory of Open Access Journals (Sweden)

    Loknath Gidijala

    Full Text Available This study aimed at developing an alternative host for the production of penicillin (PEN. As yet, the industrial production of this beta-lactam antibiotic is confined to the filamentous fungus Penicillium chrysogenum. As such, the yeast Hansenula polymorpha, a recognized producer of pharmaceuticals, represents an attractive alternative. Introduction of the P. chrysogenum gene encoding the non-ribosomal peptide synthetase (NRPS delta-(L-alpha-aminoadipyl-L-cysteinyl-D-valine synthetase (ACVS in H. polymorpha, resulted in the production of active ACVS enzyme, when co-expressed with the Bacillus subtilis sfp gene encoding a phosphopantetheinyl transferase that activated ACVS. This represents the first example of the functional expression of a non-ribosomal peptide synthetase in yeast. Co-expression with the P. chrysogenum genes encoding the cytosolic enzyme isopenicillin N synthase as well as the two peroxisomal enzymes isopenicillin N acyl transferase (IAT and phenylacetyl CoA ligase (PCL resulted in production of biologically active PEN, which was efficiently secreted. The amount of secreted PEN was similar to that produced by the original P. chrysogenum NRRL1951 strain (approx. 1 mg/L. PEN production was decreased over two-fold in a yeast strain lacking peroxisomes, indicating that the peroxisomal localization of IAT and PCL is important for efficient PEN production. The breakthroughs of this work enable exploration of new yeast-based cell factories for the production of (novel beta-lactam antibiotics as well as other natural and semi-synthetic peptides (e.g. immunosuppressive and cytostatic agents, whose production involves NRPS's.

  11. Chronological aging-induced apoptosis in yeast

    OpenAIRE

    Fabrizio, Paola; Longo, Valter D.

    2008-01-01

    Saccharomyces cerevisiae is the simplest among the major eukaryotic model organisms for aging and diseases. Longevity in the chronological life span paradigm is measured as the mean and maximum survival period of populations of non-dividing yeast. This paradigm has been used successfully to identify several life-regulatory genes and three evolutionary conserved pro-aging pathways. More recently, Schizosaccharomyces pombe has been shown to age chronologically in a manner that resembles that of...

  12. Environmental influences on organotin-yeast interactions

    OpenAIRE

    White, Jane S.

    2002-01-01

    As a consequence of the widespread industrial and agricultural applications of organotin compounds, contamination of various ecosystems has occurred in recent decades. Understanding how these compounds interact with cellular membranes is essential in assessing the risks of organotin pollution. The organotins, tributyltin (TBT) and trimethyltin (TMT) and inorganic tin, Sn(IV), were investigated for their physical interactions with non-metabolising cells and protoplasts of the yeast, Candida ma...

  13. Beneficial properties of probiotic yeast Saccharomyces boulardii

    OpenAIRE

    Tomičić Zorica M.; Čolović Radmilo R.; Čabarkapa Ivana S.; Vukmirović Đuro M.; Đuragić Olivera M.; Tomičić Ružica M.

    2016-01-01

    Saccharomyces boulardii is unique probiotic and biotherapeutic yeast, known to survive in gastric acidity and it is not adversely affected or inhibited by antibiotics or does not alter or adversely affect the normal microbiota. S. boulardii has been utilized worldwide as a probiotic supplement to support gastrointestinal health. The multiple mechanisms of action of S. boulardii and its properties may explain its efficacy and beneficial effects in acute and chronic gastrointestinal diseases th...

  14. Taxonomy Icon Data: fission yeast [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available fission yeast Schizosaccharomyces pombe Schizosaccharomyces_pombe_L.png Schizosaccharomyce...s_pombe_NL.png Schizosaccharomyces_pombe_S.png Schizosaccharomyces_pombe_NS.png http://biosciencedbc....jp/taxonomy_icon/icon.cgi?i=Schizosaccharomyces+pombe&t=L http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Schizosaccharomyce...s+pombe&t=NL http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Schizosaccharomyce...s+pombe&t=S http://biosciencedbc.jp/taxonomy_icon/icon.cgi?i=Schizosaccharomyces+pombe&t=NS

  15. Pentose utilization in yeasts: Physiology and biochemistry

    Energy Technology Data Exchange (ETDEWEB)

    Jeppson, H.

    1996-04-01

    The fermentive performance of bacteria, yeasts, and filamentous fungi was investigated in a pentose (xylose)-rich lignocellulosic hydrolyzate. The filamentous fungus Fusarium oxysporum and the xylose-fermenting yeast Pichia stipitis were found to be very sensitive to the inhibiting hydrolyzate. Recombinant xylose-utilizing Saccharomyces cerevisiae showed very poor ethanol formation from xylose; xylitol being the major product formed. The highest ethanol yields were obtained with recombinant Escherichia coli KO11, however, for maximal ethanol yield detoxification of the hydrolyzate was required. The influence of oxygen on the regulation of carbohydrate metabolism in the xylose-fermenting yeast P. stipitis CBS 6054 was investigated. A low and well-controlled level of oxygenation has been found to be required for efficient ethanol formation from xylose by the xylose-fermenting yeasts. The requirement of oxygen is frequently ascribed to the apparent redox imbalance which develops under anaerobic conditions due to the difference in co-factor utilization of the two first enzymes in the xylose metabolism, further reflected in xylitol excretion. However, a low and well controlled level of oxygenation for maximal ethanol production from glucose was also demonstrated, suggesting that the oxygen requirement is not only due to the dual co-factor utilization, but also serves other purposes. Cyanide-insensitive and salicyl hydroxamic acid-sensitive respiration (CIR) was found in P. stipitis. CIR is suggested to act as a redox sink preventing xylitol formation in P. stipitis under oxygen-limited xylose fermentations. Xylitol metabolism by P. stipitis CBS 6054 was strictly respiratory and ethanol was not formed under any conditions. The absence of ethanol formation was not due to a lack of fermentative enzymes, since the addition of glucose to xylitol-pregrown cells resulted in ethanol formation. 277 refs, 5 figs, 7 tabs

  16. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

    OpenAIRE

    Padilla, Beatriz; Garc?a-Fern?ndez, David; Gonz?lez, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of...

  17. Raman Microspectroscopy of the Yeast Vacuoles

    Czech Academy of Sciences Publication Activity Database

    Bednárová, Lucie; Palacký, J.; Bauerová, Václava; Hrušková-Heidingsfeldová, Olga; Pichová, Iva; Mojzeš, P.

    2012-01-01

    Roč. 27, 5-6 (2012), s. 503-507 ISSN 0712-4813 R&D Projects: GA ČR GAP208/10/0376; GA ČR GA310/09/1945 Institutional research plan: CEZ:AV0Z40550506 Keywords : Raman microspectroscopy * living cell * yeast * vacuole * chemical composition * polyphospate * Candida albicans Subject RIV: CE - Biochemistry Impact factor: 0.530, year: 2012

  18. Development of Industrial Yeast Platform Strains

    DEFF Research Database (Denmark)

    Bergdahl, Basti; Dato, Laura; Förster, Jochen

    2014-01-01

    Most of the current metabolic engineering projects are carried out using laboratory strains as the starting host. Although such strains are easily manipulated genetically, their robustness does not always meet the requirements set by industrial fermentation conditions. In such conditions, the cells...... screening of the 36 industrial and laboratory yeast strains. In addition, progress in the development of molecular biology methods for generating the new strains will be presented....

  19. Cyanohydrin reactions enhance glycolytic oscillations in yeast

    DEFF Research Database (Denmark)

    Hald, Bjørn Olav; Nielsen, Astrid Gram; Tortzen, Christian

    2015-01-01

    Synchronous metabolic oscillations can be induced in yeast by addition of glucose and removal of extracellular acetaldehyde (ACAx). Compared to other means of ACAx removal, cyanide robustly induces oscillations, indicating additional cyanide reactions besides ACA to lactonitrile conversion. Here......: a) by reducing [ACAx] relative to oscillation amplitude, b) by targeting multiple intracellular carbonyl compounds during fermentation, and c) by acting as a phase resetting stimulus....

  20. Enzymes of Candida tropicalis yeast biodegrading phenol

    OpenAIRE

    Koubková, Zuzana

    2011-01-01

    Effluents of industrial wastewaters from oil refineries, paper mills, dyes, ceramic factories, resins, textiles and plastic contain high concentrations of aromatic compounds, which are toxic to organisms. Degradation of these compounds to tolerant limits before releasing them into the environment is an urgent requirement. Candida tropicalis yeast is an important representative of eucaryotic microorganisms that are able to utilize phenol. During the first phase of phenol biodegradation, cytopl...

  1. In situ rheology of yeast biofilms.

    Science.gov (United States)

    Brugnoni, Lorena I; Tarifa, María C; Lozano, Jorge E; Genovese, Diego

    2014-01-01

    The aim of the present work was to investigate the in situ rheological behavior of yeast biofilms growing on stainless steel under static and turbulent flow. The species used (Rhodototula mucilaginosa, Candida krusei, Candida kefyr and Candida tropicalis) were isolated from a clarified apple juice industry. The flow conditions impacted biofilm composition over time, with a predominance of C. krusei under static and turbulent flow. Likewise, structural variations occurred, with a tighter appearance under dynamic flow. Under turbulent flow there was an increase of 112 μm in biofilm thickness at 11 weeks (p < 0.001) and cell morphology was governed by hyphal structures and rounded cells. Using the in situ growth method introduced here, yeast biofilms were determined to be viscoelastic materials with a predominantly solid-like behavior, and neither this nor the G'0 values were significantly affected by the flow conditions or the growth time, and at large deformations their weak structure collapsed beyond a critical strain of about 1.5-5%. The present work could represent a starting point for developing in situ measurements of yeast rheology and contribute to a thin body of knowledge about fungal biofilm formation.

  2. Determination of Proteinaceous Selenocysteine in Selenized Yeast

    Directory of Open Access Journals (Sweden)

    Katarzyna Bierla

    2018-02-01

    Full Text Available A method for the quantitation of proteinaceous selenocysteine (SeCys in Se-rich yeast was developed. The method is based on the reduction of the Se-Se and S-Se bridges with dithiotretiol, derivatization with iodoacetamide (carbamidomethylation, followed by HPLC-ICP MS. The chromatographic conditions were optimized for the total recovery of the proteinaceous selenocysteine, the minimum number of peaks in the chromatogram (reduction of derivatization products of other Se-species present and the baseline separation. A typical chromatogram of a proteolytic digest of selenized yeast protein consisted of up to five peaks (including SeMet, carbamidomethylated (CAM-SeCys, and Se(CAM2 identified by retention time matching with available standards and electrospray MS. Inorganic selenium non-specifically attached to proteins and selenomethionine could be quantified (in the form of Se(CAM2 along with SeCys. Selenocysteine, selenomethionine, inorganic selenium, and the water soluble-metabolite fraction accounted for the totality of selenium species in Se-rich yeast.

  3. How do yeast sense mitochondrial dysfunction?

    Directory of Open Access Journals (Sweden)

    Dmitry A. Knorre

    2016-09-01

    Full Text Available Apart from energy transformation, mitochondria play important signaling roles. In yeast, mitochondrial signaling relies on several molecular cascades. However, it is not clear how a cell detects a particular mitochondrial malfunction. The problem is that there are many possible manifestations of mitochondrial dysfunction. For example, exposure to the specific antibiotics can either decrease (inhibitors of respiratory chain or increase (inhibitors of ATP-synthase mitochondrial transmembrane potential. Moreover, even in the absence of the dysfunctions, a cell needs feedback from mitochondria to coordinate mitochondrial biogenesis and/or removal by mitophagy during the division cycle. To cope with the complexity, only a limited set of compounds is monitored by yeast cells to estimate mitochondrial functionality. The known examples of such compounds are ATP, reactive oxygen species, intermediates of amino acids synthesis, short peptides, Fe-S clusters and heme, and also the precursor proteins which fail to be imported by mitochondria. On one hand, the levels of these molecules depend not only on mitochondria. On the other hand, these substances are recognized by the cytosolic sensors which transmit the signals to the nucleus leading to general, as opposed to mitochondria-specific, transcriptional response. Therefore, we argue that both ways of mitochondria-to-nucleus communication in yeast are mostly (if not completely unspecific, are mediated by the cytosolic signaling machinery and strongly depend on cellular metabolic state.

  4. [Mitochondria inheritance in yeast saccharomyces cerevisiae].

    Science.gov (United States)

    Fizikova, A Iu

    2011-01-01

    The review is devoted to the main mechanisms of mitochondria inheritance in yeast Saccharonmyces cerevisiae. The genetic mechanisms of functionally active mitochondria inheritance in eukaryotic cells is one of the most relevant in modem researches. A great number of genetic diseases are associated with mitochondria dysfunction. Plasticity of eukaryotic cell metabolism according to the environmental changes is ensured by adequate mitochondria functioning by means of ATP synthesis coordination, reactive oxygen species accumulation, apoptosis regulation and is an important factor of cell adaptation to stress. Mitochondria participation in important for cell vitality processes masters the presence of accurate mechanisms of mitochondria functions regulation according to environment fluctuations. The mechanisms of mitochondria division and distribution are highly conserved. Baker yeast S. cerevisiae is an ideal model object for mitochondria researches due to energetic metabolism lability, ability to switch over respiration to fermentation, and petite-positive phenotype. Correction of metabolism according to the environmental changes is necessary for cell vitality. The influence of respiratory, carbon, amino acid and phosphate metabolism on mitochondria functions was shown. As far as the mechanisms that stabilize functions of mitochondria and mtDNA are highly conserve, we can project yeast regularities on higher eukaryotes systems. This makes it possible to approximate understanding the etiology and pathogenesis of a great number of human diseases.

  5. Biomedical applications of yeast- a patent view, part one: yeasts as workhorses for the production of therapeutics and vaccines.

    Science.gov (United States)

    Roohvand, Farzin; Shokri, Mehdi; Abdollahpour-Alitappeh, Meghdad; Ehsani, Parastoo

    2017-08-01

    Yeasts, as Eukaryotes, offer unique features for ease of growth and genetic manipulation possibilities, making it an exceptional microbial host. Areas covered: This review provides general and patent-oriented insights into production of biopharmaceuticals by yeasts. Patents, wherever possible, were correlated to the original or review articles. The review describes applications of major GRAS (generally regarded as safe) yeasts for the production of therapeutic proteins and subunit vaccines; additionally, immunomodulatory properties of yeast cell wall components were reviewed for use of whole yeast cells as a new vaccine platform. The second part of the review will discuss yeast- humanization strategies and innovative applications. Expert opinion: Biomedical applications of yeasts were initiated by utilization of Saccharomyces cerevisiae, for production of leavened (fermented) products, and advanced to serve to produce biopharmaceuticals. Higher biomass production and expression/secretion yields, more similarity of glycosylation patterns to mammals and possibility of host-improvement strategies through application of synthetic biology might enhance selection of Pichia pastoris (instead of S. cerevisiae) as a host for production of biopharmaceutical in future. Immunomodulatory properties of yeast cell wall β-glucans and possibility of intracellular expression of heterologous pathogen/tumor antigens in yeast cells have expanded their application as a new platform, 'Whole Yeast Vaccines'.

  6. Taming wild yeast: potential of conventional and nonconventional yeasts in industrial fermentations.

    Science.gov (United States)

    Steensels, Jan; Verstrepen, Kevin J

    2014-01-01

    Yeasts are the main driving force behind several industrial food fermentation processes, including the production of beer, wine, sake, bread, and chocolate. Historically, these processes developed from uncontrolled, spontaneous fermentation reactions that rely on a complex mixture of microbes present in the environment. Because such spontaneous processes are generally inconsistent and inefficient and often lead to the formation of off-flavors, most of today's industrial production utilizes defined starter cultures, often consisting of a specific domesticated strain of Saccharomyces cerevisiae, S. bayanus, or S. pastorianus. Although this practice greatly improved process consistency, efficiency, and overall quality, it also limited the sensorial complexity of the end product. In this review, we discuss how Saccharomyces yeasts were domesticated to become the main workhorse of food fermentations, and we investigate the potential and selection of nonconventional yeasts that are often found in spontaneous fermentations, such as Brettanomyces, Hanseniaspora, and Pichia spp.

  7. Not your ordinary yeast: non-Saccharomyces yeasts in wine production uncovered.

    Science.gov (United States)

    Jolly, Neil P; Varela, Cristian; Pretorius, Isak S

    2014-03-01

    Saccharomyces cerevisiae and grape juice are 'natural companions' and make a happy wine marriage. However, this relationship can be enriched by allowing 'wild' non-Saccharomyces yeast to participate in a sequential manner in the early phases of grape must fermentation. However, such a triangular relationship is complex and can only be taken to 'the next level' if there are no spoilage yeast present and if the 'wine yeast' - S. cerevisiae - is able to exert its dominance in time to successfully complete the alcoholic fermentation. Winemakers apply various 'matchmaking' strategies (e.g. cellar hygiene, pH, SO2 , temperature and nutrient management) to keep 'spoilers' (e.g. Dekkera bruxellensis) at bay, and allow 'compatible' wild yeast (e.g. Torulaspora delbrueckii, Pichia kluyveri, Lachancea thermotolerans and Candida/Metschnikowia pulcherrima) to harmonize with potent S. cerevisiae wine yeast and bring the best out in wine. Mismatching can lead to a 'two is company, three is a crowd' scenario. More than 40 of the 1500 known yeast species have been isolated from grape must. In this article, we review the specific flavour-active characteristics of those non-Saccharomyces species that might play a positive role in both spontaneous and inoculated wine ferments. We seek to present 'single-species' and 'multi-species' ferments in a new light and a new context, and we raise important questions about the direction of mixed-fermentation research to address market trends regarding so-called 'natural' wines. This review also highlights that, despite the fact that most frontier research and technological developments are often focussed primarily on S. cerevisiae, non-Saccharomyces research can benefit from the techniques and knowledge developed by research on the former. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  8. Black yeast-like fungi in skin and nail

    DEFF Research Database (Denmark)

    Saunte, D M; Tarazooie, B; Arendrup, M C

    2011-01-01

    Black yeast-like fungi are rarely reported from superficial infections. We noticed a consistent prevalence of these organisms as single isolations from mycological routine specimens. To investigate the prevalence of black yeast-like fungi in skin, hair and nail specimens and to discuss...... the probability of these species to be involved in disease. Slow-growing black yeast-like fungi in routine specimens were prospectively collected and identified. A questionnaire regarding patient information was sent to physicians regarding black yeast-like fungus positive patients. A total of 20 746...... dermatological specimens were examined by culture. Black yeast-like fungi accounted for 2.2% (n = 108) of the positive cultures. Only 31.0% of the samples, culture positive for black yeast-like fungi were direct microscopy positive when compared with overall 68.8% of the culture positive specimens. The most...

  9. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    Science.gov (United States)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  10. A new methodology to obtain wine yeast strains overproducing mannoproteins.

    Science.gov (United States)

    Quirós, Manuel; Gonzalez-Ramos, Daniel; Tabera, Laura; Gonzalez, Ramon

    2010-04-30

    Yeast mannoproteins are highly glycosylated proteins that are covalently bound to the beta-1,3-glucan present in the yeast cell wall. Among their outstanding enological properties, yeast mannoproteins contribute to several aspects of wine quality by protecting against protein haze, reducing astringency, retaining aroma compounds and stimulating growth of lactic-acid bacteria. The development of a non-recombinant method to obtain enological yeast strains overproducing mannoproteins would therefore be very useful. Our previous experience on the genetic determinants of the release of these molecules by Saccharomyces cerevisiae has allowed us to propose a new methodology to isolate and characterize wine yeast that overproduce mannoproteins. The described methodology is based on the resistance of the killer 9 toxin produced by Williopsis saturnus, a feature linked to an altered biogenesis of the yeast cell wall. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Yeast hulls: effect on spontaneous fermentation in different vinification conditions

    Directory of Open Access Journals (Sweden)

    Rosa López

    2000-09-01

    Full Text Available The effect of the addition of yeast hulls in vinification was investigated during three consecutive years. The study was carried out in the experimental winery of C.I.D.A in La Rioja (Spain with free running white grape juice of the Viura variety. Four different vinifications were studied. In two of these vinifications, stuck fermentations were detected. In all the studies, the addition of yeast hulls (yeast ghosts improved the fermentation kinetics, increasing the number of viable yeasts at the end of the exponential stage and decreasing the final content of reducing sugars. This work revealed a new effect of yeast hull addition which had not been identified previously; their selection effect on the wild yeast strain in spontaneous fermentation.

  12. Differentiation of enzymatic activity of yeasts and yeast-like microorganisms isolated from various environments

    Directory of Open Access Journals (Sweden)

    Elżbieta Bogusławska-Wąs

    2014-08-01

    Full Text Available The aim of study was to determinate enzymatic activity of yeast-like organisms - Candida lipolytica, Rhodotorula rubra, Trichosporon beigelii, Zygosaccharomyces sp. - isolated from the Szczecin Lagoon and herring salads. We have shown that lipolytic activity was higher than protcolytic for every strain tested. The lowest activity level was found out for amylolytic hydrolases. The results also demonstrated that yeast-like organisms isolated from the Szczecin Lagoon revealed much higher average enzymatic activity compared to tbe same species isolated from herring salads, excepting C. lipolytica.

  13. Determination of the autolysis of champagne yeast by using 14C-labelled yeast

    International Nuclear Information System (INIS)

    Molnar, I.; Oura, E.; Suomalainen, H.

    1980-01-01

    The degree of autolysis of 14 C-labelled Champagne Hautvillers yeast was studied in the function of different temperatures of storage. A linear relationship was found between the length of the storage and the degree of autolysis. The rate of autolysis increased with raising the temperature of storage. The raising of the temperature by 10 deg C was followed by a 6-7% increase in the rate of autolysis. Shaking up the yeast sediment at 20-day intervals raised the rate of autolysis by 1.5-4.2%. (author)

  14. Determination of the autolysis of champagne yeast by using /sup 14/C-labelled yeast

    Energy Technology Data Exchange (ETDEWEB)

    Molnar, I [Orszagos Szoeleszeti es Boraszati Kutatointezet, Budapest (Hungary); Oura, E; Suomalainen, H [Research Laboratories of the State Alcohol Monopoly, Helsinki (Finland)

    1980-01-01

    The degree of autolysis of /sup 14/C-labelled Champagne Hautvillers yeast was studied in the function of different temperatures of storage. A linear relationship was found between the length of the storage and the degree of autolysis. The rate of autolysis increased with raising the temperature of storage. The raising of the temperature by 10 deg C was followed by a 6-7% increase in the rate of autolysis. Shaking up the yeast sediment at 20-day intervals raised the rate of autolysis by 1.5-4.2%.

  15. Effect of heat treatment on brewer's yeast fermentation activity

    OpenAIRE

    Kharandiuk, Tetiana; Kosiv, Ruslana; Palianytsia, Liubov; Berezovska, Natalia

    2015-01-01

    The influence of temperature treatment of brewer's yeast strain Saflager W-34/70 at temperatures of -17, 20, 25, 30, 35, 40 °C on their fermentative activity was studied. It was established that the freezing of yeast leads to a decrease of fermentation activity in directly proportional to the duration way. Fermentative activity of yeast samples can be increased by 20-24% by heat treatment at 35 °C during 15-30 minutes.

  16. Using Microsatellites to Identify Yeast Strains in Beer

    OpenAIRE

    Bruke, Alexandria; Van Brocklin, Jennifer; Rivest, Jason; Prenni, Jessica E.; Ibrahim, Hend

    2012-01-01

    Yeast is an integral part of the brewing process and is responsible for much of the taste and characteristics of beer. During the brewing process, yeast is subject to ageing and stress factors that can result in growth inhibition, decreased genetic stability, and changes in cell membrane stability. Characterization of yeast species used in industrial fermentation (e.g. S. cerevisiae) is of great importance to the brewing industry. The objective of this study was to develop an assay to identif...

  17. Yeast replicative aging: a paradigm for defining conserved longevity interventions

    OpenAIRE

    Wasko, Brian M.; Kaeberlein, Matt

    2013-01-01

    The finite replicative life span of budding yeast mother cells was demonstrated as early as 1959, but the idea that budding yeast could be used to model aging of multicellular eukaryotes did not enter the scientific mainstream until relatively recently. Despite continued skepticism by some, there are now abundant data that several interventions capable of extending yeast replicative life span have a similar effect in multicellular eukaryotes including nematode worms, fruit flies, and rodents....

  18. Yeast species associated with the spontaneous fermentation of cider.

    OpenAIRE

    Suárez, Belén; Pando, Rosa; Fernández, Norman; Querol, Amparo; Rodríguez, Roberto

    2018-01-01

    This paper reports the influence of cider-making technology (pneumatic and traditional pressing) on the dynamics of wild yeast populations. Yeast colonies isolated from apple juice before and throughout fermentation at a cider cellar of Asturias (Spain), during two consecutive years were studied. The yeast strains were identified by restriction fragment length polymorphism analysis of the 5.8S rRNA gene and the two flanking internal transcribed sequences (ITS). The musts obtained by ...

  19. Probiotic properties of yeasts occurring in fermented food and beverages

    DEFF Research Database (Denmark)

    Jespersen, Lene

    Besides being able to improve the quality and safety of many fermented food and beverages some yeasts offer a number of probiotic traits. Especially a group of yeast referred to as "Saccharomyces boulardii", though taxonomically belonging to Saccharomyces cerevisiae, has been claimed to have...... probiotic properties. Besides, yeasts naturally occurring globally in food and beverages will have traits that might have a positive impact on human health....

  20. Study on ionizing radiosensitivity of respiratory deficiency yeast mutants

    International Nuclear Information System (INIS)

    Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei

    2006-01-01

    The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)

  1. Aboveground Deadwood Deposition Supports Development of Soil Yeasts

    Directory of Open Access Journals (Sweden)

    Thorsten Wehde

    2012-12-01

    Full Text Available Unicellular saprobic fungi (yeasts inhabit soils worldwide. Although yeast species typically occupy defined areas on the biome scale, their distribution patterns within a single type of vegetation, such as forests, are more complex. In order to understand factors that shape soil yeast communities, soils collected underneath decaying wood logs and under forest litter were analyzed. We isolated and identified molecularly a total of 25 yeast species, including three new species. Occurrence and distribution of yeasts isolated from these soils provide new insights into ecology and niche specialization of several soil-borne species. Although abundance of typical soil yeast species varied among experimental plots, the analysis of species abundance and community composition revealed a strong influence of wood log deposition and leakage of organic carbon. Unlike soils underneath logs, yeast communities in adjacent areas harbored a considerable number of transient (phylloplane-related yeasts reaching 30% of the total yeast quantity. We showed that distinguishing autochthonous community members and species transient in soils is essential to estimate appropriate effects of environmental factors on soil fungi. Furthermore, a better understanding of species niches is crucial for analyses of culture-independent data, and may hint to the discovery of unifying patterns of microbial species distribution.

  2. The ecology of the Drosophila-yeast mutualism in wineries

    Science.gov (United States)

    2018-01-01

    The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila. PMID:29768432

  3. Effect of fungicides on epiphytic yeasts associated with strawberry

    Science.gov (United States)

    Debode, Jane; Van Hemelrijck, Wendy; Creemers, Piet; Maes, Martine

    2013-01-01

    We studied the effect of two commonly used fungicides on the epiphytic yeast community of strawberry. Greenhouse and field experiments were conducted applying Switch (cyprodinil plus fludioxonil) or Signum (boscalid plus pyraclostrobin) to strawberry plants. Yeasts on leaves and fruits were assessed on treated and untreated plants at several time points via plating and denaturing gradient gel electrophoresis (DGGE) analysis. The yeast counts on plates of the treated plants were similar to the control plants. Unripe fruits had 10 times larger yeast concentrations than ripe fruits or leaves. Some dominant yeast types were isolated and in vitro tests showed that they were at least 10 times less sensitive to Switch and Signum as compared with two important fungal strawberry pathogens Botrytis cinerea and Colletotrichum acutatum, which are the targets for the fungicide control. DGGE analysis showed that the applied fungicides had no effect on the composition of the yeast communities, while the growing system, strawberry tissue, and sampling time did affect the yeast communities. The yeast species most commonly identified were Cryptococcus, Rhodotorula, and Sporobolomyces. These results point toward the potential applicability of natural occurring yeast antagonists into an integrated disease control strategy for strawberry diseases.

  4. Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2007-08-01

    Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

  5. Genetically modified yeast species and fermentation processes using genetically modified yeast

    Science.gov (United States)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2011-05-17

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  6. Yeast Interacting Proteins Database: YFR015C, YLR258W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entr...n synthase, similar to Gsy1p; expression induced by glucose limitation, nitrogen ...; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into statio...ogen synthase, similar to Gsy1p; expression induced by glucose limitation, nitrogen starvation, heat shock,

  7. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts

    Czech Academy of Sciences Publication Activity Database

    Pálková, Z.; Váchová, Libuše

    2016-01-01

    Roč. 57, SEP (2016), s. 110-119 ISSN 1084-9521 R&D Projects: GA ČR GA13-08605S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Pathogenic yeasts * Biofilms and colonies * Cell differentiation Subject RIV: EE - Microbiology, Virology Impact factor: 6.614, year: 2016

  8. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2014-01-07

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  9. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2017-09-12

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  10. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2016-08-09

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  11. Genetically modified yeast species and fermentation processes using genetically modified yeast

    Energy Technology Data Exchange (ETDEWEB)

    Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

    2011-05-17

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  12. Genetically modified yeast species, and fermentation processes using genetically modified yeast

    Science.gov (United States)

    Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

    2013-05-14

    Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

  13. Yeast production from cellulase hydrolyzed furfural industrial waste. II. Conditions for the cultivation of yeast

    Energy Technology Data Exchange (ETDEWEB)

    1977-01-01

    Three yeast strains, Candida AS 2-121, C. utilis AS 2-1180, and C. tropicalis AS 2-637 were selected as being capable of growing on cellulase-hydrolyzed furfural industrial waste. Cell mass yields with respect to C source were approximately 50%. Fermentation conditions are given.

  14. Utilization of spent brewer’s yeast Saccharomyces cerevisiae for the production of yeast enzymatic hydrolysate

    Directory of Open Access Journals (Sweden)

    M Bayarjargal

    2014-09-01

    Full Text Available Spent brewer’s yeast (Saccharomyces cerevisiae is a rich source of protein, vitamins and widely used as a raw material for production of food supplements. The autolysis and enzymatic treatment of spent brewer’s yeast using Pancreatin (2.5% and Flavourzyme (2.5% were performed at 45 °C and 50 °C, respectively. The autolysis and hydrolysis processes were evaluated by determining a soluble solids, soluble protein concentration and α-amino nitrogen content in a reaction mixture. The yield of pancreatic digest and α-amino nitrogen content was high in comparison with autolysis and Flavourzyme treatment. The total solids recovery in dry Yeast hydrolysate was about 50%, a protein and α-amino nitrogen content was 55.9 and 4.8%, respectively. These results show the possibility of utilizing the spent brewer’s yeast as hydrolysate using hydrolytic enzymes and use it as a food supplement after biological experiments.DOI: http://dx.doi.org/10.5564/mjc.v12i0.179 Mongolian Journal of Chemistry Vol.12 2011: 88-91

  15. Studying Functions of All Yeast Genes Simultaneously

    Science.gov (United States)

    Stolc, Viktor; Eason, Robert G.; Poumand, Nader; Herman, Zelek S.; Davis, Ronald W.; Anthony Kevin; Jejelowo, Olufisayo

    2006-01-01

    A method of studying the functions of all the genes of a given species of microorganism simultaneously has been developed in experiments on Saccharomyces cerevisiae (commonly known as baker's or brewer's yeast). It is already known that many yeast genes perform functions similar to those of corresponding human genes; therefore, by facilitating understanding of yeast genes, the method may ultimately also contribute to the knowledge needed to treat some diseases in humans. Because of the complexity of the method and the highly specialized nature of the underlying knowledge, it is possible to give only a brief and sketchy summary here. The method involves the use of unique synthetic deoxyribonucleic acid (DNA) sequences that are denoted as DNA bar codes because of their utility as molecular labels. The method also involves the disruption of gene functions through deletion of genes. Saccharomyces cerevisiae is a particularly powerful experimental system in that multiple deletion strains easily can be pooled for parallel growth assays. Individual deletion strains recently have been created for 5,918 open reading frames, representing nearly all of the estimated 6,000 genetic loci of Saccharomyces cerevisiae. Tagging of each deletion strain with one or two unique 20-nucleotide sequences enables identification of genes affected by specific growth conditions, without prior knowledge of gene functions. Hybridization of bar-code DNA to oligonucleotide arrays can be used to measure the growth rate of each strain over several cell-division generations. The growth rate thus measured serves as an index of the fitness of the strain.

  16. How does yeast respond to pressure?

    Directory of Open Access Journals (Sweden)

    Fernandes P.M.B.

    2005-01-01

    Full Text Available The brewing and baking yeast Saccharomyces cerevisiae has been used as a model for stress response studies of eukaryotic cells. In this review we focus on the effect of high hydrostatic pressure (HHP on S. cerevisiae. HHP exerts a broad effect on yeast cells characteristic of common stresses, mainly associated with protein alteration and lipid bilayer phase transition. Like most stresses, pressure induces cell cycle arrest. Below 50 MPa (500 atm yeast cell morphology is unaffected whereas above 220 MPa wild-type cells are killed. S. cerevisiae cells can acquire barotolerance if they are pretreated with a sublethal stress due to temperature, ethanol, hydrogen peroxide, or pressure. Nevertheless, pressure only leads to protection against severe stress if, after pressure pretreatment, the cells are also re-incubated at room pressure. We attribute this effect to the inhibition of the protein synthesis apparatus under HHP. The global genome expression analysis of S. cerevisiae cells submitted to HHP revealed a stress response profile. The majority of the up-regulated genes are involved in stress defense and carbohydrate metabolism while most repressed genes belong to the cell cycle progression and protein synthesis categories. However, the signaling pathway involved in the pressure response is still to be elucidated. Nitric oxide, a signaling molecule involved in the regulation of a large number of cellular functions, confers baroprotection. Furthermore, S. cerevisiae cells in the early exponential phase submitted to 50-MPa pressure show induction of the expression level of the nitric oxide synthase inducible isoform. As pressure becomes an important biotechnological tool, studies concerning this kind of stress in microorganisms are imperative.

  17. Specificity of transmembrane protein palmitoylation in yeast.

    Directory of Open Access Journals (Sweden)

    Ayelén González Montoro

    Full Text Available Many proteins are modified after their synthesis, by the addition of a lipid molecule to one or more cysteine residues, through a thioester bond. This modification is called S-acylation, and more commonly palmitoylation. This reaction is carried out by a family of enzymes, called palmitoyltransferases (PATs, characterized by the presence of a conserved 50- aminoacids domain called "Asp-His-His-Cys- Cysteine Rich Domain" (DHHC-CRD. There are 7 members of this family in the yeast Saccharomyces cerevisiae, and each of these proteins is thought to be responsible for the palmitoylation of a subset of substrates. Substrate specificity of PATs, however, is not yet fully understood. Several yeast PATs seem to have overlapping specificity, and it has been proposed that the machinery responsible for palmitoylating peripheral membrane proteins in mammalian cells, lacks specificity altogether.Here we investigate the specificity of transmembrane protein palmitoylation in S. cerevisiae, which is carried out predominantly by two PATs, Swf1 and Pfa4. We show that palmitoylation of transmembrane substrates requires dedicated PATs, since other yeast PATs are mostly unable to perform Swf1 or Pfa4 functions, even when overexpressed. Furthermore, we find that Swf1 is highly specific for its substrates, as it is unable to substitute for other PATs. To identify where Swf1 specificity lies, we carried out a bioinformatics survey to identify amino acids responsible for the determination of specificity or Specificity Determination Positions (SDPs and showed experimentally, that mutation of the two best SDP candidates, A145 and K148, results in complete and partial loss of function, respectively. These residues are located within the conserved catalytic DHHC domain suggesting that it could also be involved in the determination of specificity. Finally, we show that modifying the position of the cysteines in Tlg1, a Swf1 substrate, results in lack of palmitoylation, as

  18. Population FBA predicts metabolic phenotypes in yeast.

    Directory of Open Access Journals (Sweden)

    Piyush Labhsetwar

    2017-09-01

    Full Text Available Using protein counts sampled from single cell proteomics distributions to constrain fluxes through a genome-scale model of metabolism, Population flux balance analysis (Population FBA successfully described metabolic heterogeneity in a population of independent Escherichia coli cells growing in a defined medium. We extend the methodology to account for correlations in protein expression arising from the co-regulation of genes and apply it to study the growth of independent Saccharomyces cerevisiae cells in two different growth media. We find the partitioning of flux between fermentation and respiration predicted by our model agrees with recent 13C fluxomics experiments, and that our model largely recovers the Crabtree effect (the experimentally known bias among certain yeast species toward fermentation with the production of ethanol even in the presence of oxygen, while FBA without proteomics constraints predicts respirative metabolism almost exclusively. The comparisons to the 13C study showed improvement upon inclusion of the correlations and motivated a technique to systematically identify inconsistent kinetic parameters in the literature. The minor secretion fluxes for glycerol and acetate are underestimated by our method, which indicate a need for further refinements to the metabolic model. For yeast cells grown in synthetic defined (SD medium, the calculated broad distribution of growth rates matches experimental observations from single cell studies, and we characterize several metabolic phenotypes within our modeled populations that make use of diverse pathways. Fast growing yeast cells are predicted to perform significant amount of respiration, use serine-glycine cycle and produce ethanol in mitochondria as opposed to slow growing cells. We use a genetic algorithm to determine the proteomics constraints necessary to reproduce the growth rate distributions seen experimentally. We find that a core set of 51 constraints are essential but

  19. Alteration of yeast activity by gamma radiation

    International Nuclear Information System (INIS)

    Chacharkar, M.P.; Tak, B.B.; Bhati, J.

    1996-01-01

    Yeast is an important component in microbe based industrial technologies. Due to the techno-economic reasons, the fermentation technique has acquired renewed interest. The effect of γ-radiation on the fermentation reaction has been investigated. The studies show that exposure of the fermentation mixture to γ-radiation at 5 kGy enhance alcohol production, whereas irradiation at higher doses, viz., 10 kGy and 25 kGy caused a considerable reduction in the alcohol yield. Therefore, low dose irradiation of fermentation mixtures can be applied for increasing the alcohol production by about 25%. (author). 13 refs., 1 fig

  20. Does Probiotic Yeast Act as Antigenotoxin?

    Directory of Open Access Journals (Sweden)

    Jekabs Raipulis

    2005-01-01

    Full Text Available The effect of probiotic yeast Saccharomyces boulardii on genotoxicity induced by the well-known mutagen 4-nitroquinoline-N-oxide (4-NQO, as well as antibacterial (furazolidone and antibiotic (nalidixic acid drugs, has been studied using the short-term bacterial assay, SOS chromotest, with Escherichia coli PQ 37 as the test organism. It has been shown that S. boulardii possesses antigenotoxic activity, revealed by SOS chromotest, when coincubated with these genotoxins. A weaker antigenotoxic activity against the same compounds was observed with S. carlsbergensis, too.

  1. Replication dynamics of the yeast genome.

    Science.gov (United States)

    Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

    2001-10-05

    Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

  2. Enhancing the performance of brewing yeasts.

    Science.gov (United States)

    Karabín, Marcel; Jelínek, Lukáš; Kotrba, Pavel; Cejnar, Rudolf; Dostálek, Pavel

    2017-12-22

    Beer production is one of the oldest known traditional biotechnological processes, but is nowadays facing increasing demands not only for enhanced product quality, but also for improved production economics. Targeted genetic modification of a yeast strain is one way to increase beer quality and to improve the economics of beer production. In this review we will present current knowledge on traditional approaches for improving brewing strains and for rational metabolic engineering. These research efforts will, in the near future, lead to the development of a wider range of industrial strains that should increase the diversity of commercial beers. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. mRNA processing in yeast

    International Nuclear Information System (INIS)

    Stevens, A.

    1982-01-01

    Investigations in this laboratory center on basic enzymatic reactions of RNA. Still undefined are reactions involved in the conversion of precursors of mRA (pre-mRNA) to mRNA in eukaryotes. The pre-mRNA is called heterogeneous nuclear RNA and is 2 to 6 times larger than mRNA. The conversion, called splicing, involves a removal of internal sequences called introns by endoribonuclease action followed by a rejoining of the 3'- and 5'-end fragments, called exons, by ligating activity. It has not been possible yet to study the enzymes involved in vitro. Also undefined are reactions involved in the turnover or discarding of certain of the pre-mRNA molecules. Yeast is a simple eukaryote and may be expected to have the same, but perhaps simpler, processing reactions as the higher eukaryotes. Two enzymes involved in the processing of pre-mRNA and mRNA in yeast are under investigation. Both enzymes have been partially purified from ribonucleoprotein particles of yeast. The first is a unique decapping enzyme which cleaves [ 3 H]m 7 Gppp [ 14 C]RNA-poly (A) of yeast, yielding [ 3 H]m 7 GDP and is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed. The second enzyme is an endoribonuclease which converts both the [ 3 H] and [ 14 C] labels of [ 3 H]m 7 Gppp[ 14 C]RNA-poly(A) from an oligo(dT)-cellulose bound form to an unbound, acid-insoluble form. Results show that the stimulation involves an interaction of the labeled RNA with the small nuclear RNA. The inhibition of the enzyme by ethidium bromide and its stimulation by small nuclear RNA suggest that it may be a processing ribonuclease, requiring specific double-stranded features in its substrate. The characterization of the unique decapping enzyme and endoribonuclease may help to understand reactions involved in the processing of pre-mRNA and mRNA in eukaryotes

  4. Chromosomal Aneuploidy Improves the Brewing Characteristics of Sake Yeast.

    Science.gov (United States)

    Kadowaki, Masafumi; Fujimaru, Yuki; Taguchi, Seiga; Ferdouse, Jannatul; Sawada, Kazutaka; Kimura, Yuta; Terasawa, Yohei; Agrimi, Gennaro; Anai, Toyoaki; Noguchi, Hideki; Toyoda, Atsushi; Fujiyama, Asao; Akao, Takeshi; Kitagaki, Hiroshi

    2017-12-15

    The effect of chromosomal aneuploidy on the brewing characteristics of brewery yeasts has not been studied. Here we report that chromosomal aneuploidy in sake brewery yeast ( Saccharomyces cerevisiae ) leads to the development of favorable brewing characteristics. We found that pyruvate-underproducing sake yeast, which produces less off-flavor diacetyl, is aneuploid and trisomic for chromosomes XI and XIV. To confirm that this phenotype is due to aneuploidy, we obtained 45 haploids with various chromosomal additions and investigated their brewing profiles. A greater number of chromosomes correlated with a decrease in pyruvate production. Especially, sake yeast haploids with extra chromosomes in addition to chromosome XI produced less pyruvate than euploids. Mitochondrion-related metabolites and intracellular oxygen species in chromosome XI aneuploids were higher than those in euploids, and this effect was canceled in their "petite" strains, suggesting that an increase in chromosomes upregulated mitochondrial activity and decreased pyruvate levels. These findings suggested that an increase in chromosome number, including chromosome XI, in sake yeast haploids leads to pyruvate underproduction through the augmentation of mitochondrial activity. This is the first report proposing that aneuploidy in brewery yeasts improves their brewing profile. IMPORTANCE Chromosomal aneuploidy has not been evaluated in development of sake brewing yeast strains. This study shows the relationship between chromosomal aneuploidy and brewing characteristics of brewery yeast strains. High concentrations of pyruvate during sake storage give rise to α-acetolactate and, in turn, to high concentrations of diacetyl, which is considered an off-flavor. It was demonstrated that pyruvate-underproducing sake yeast is trisomic for chromosome XI and XIV. Furthermore, sake yeast haploids with extra chromosomes produced reduced levels of pyruvate and showed metabolic processes characteristic of

  5. De Novo Biosynthesis of Vanillin in Fission Yeast (Schizosaccharomyces pombe) and Baker's Yeast (Saccharomyces cerevisiae) ▿

    Science.gov (United States)

    Hansen, Esben H.; Møller, Birger Lindberg; Kock, Gertrud R.; Bünner, Camilla M.; Kristensen, Charlotte; Jensen, Ole R.; Okkels, Finn T.; Olsen, Carl E.; Motawia, Mohammed S.; Hansen, Jørgen

    2009-01-01

    Vanillin is one of the world's most important flavor compounds, with a global market of 180 million dollars. Natural vanillin is derived from the cured seed pods of the vanilla orchid (Vanilla planifolia), but most of the world's vanillin is synthesized from petrochemicals or wood pulp lignins. We have established a true de novo biosynthetic pathway for vanillin production from glucose in Schizosaccharomyces pombe, also known as fission yeast or African beer yeast, as well as in baker's yeast, Saccharomyces cerevisiae. Productivities were 65 and 45 mg/liter, after introduction of three and four heterologous genes, respectively. The engineered pathways involve incorporation of 3-dehydroshikimate dehydratase from the dung mold Podospora pauciseta, an aromatic carboxylic acid reductase (ACAR) from a bacterium of the Nocardia genus, and an O-methyltransferase from Homo sapiens. In S. cerevisiae, the ACAR enzyme required activation by phosphopantetheinylation, and this was achieved by coexpression of a Corynebacterium glutamicum phosphopantetheinyl transferase. Prevention of reduction of vanillin to vanillyl alcohol was achieved by knockout of the host alcohol dehydrogenase ADH6. In S. pombe, the biosynthesis was further improved by introduction of an Arabidopsis thaliana family 1 UDP-glycosyltransferase, converting vanillin into vanillin β-d-glucoside, which is not toxic to the yeast cells and thus may be accumulated in larger amounts. These de novo pathways represent the first examples of one-cell microbial generation of these valuable compounds from glucose. S. pombe yeast has not previously been metabolically engineered to produce any valuable, industrially scalable, white biotech commodity. PMID:19286778

  6. Performance of baker's yeast produced using date syrup substrate ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... evaluate the effect of using Baker's yeast produced using date syrup as .... Gas production power (ml/20g dough) for baker's yeasts (LSD Test*). Incubation ... Brain (2005) indicated that a falling number value of 350 s or longer ...

  7. Some Metabolites Act as Second Messengers in Yeast Chronological Aging

    Directory of Open Access Journals (Sweden)

    Karamat Mohammad

    2018-03-01

    Full Text Available The concentrations of some key metabolic intermediates play essential roles in regulating the longevity of the chronologically aging yeast Saccharomyces cerevisiae. These key metabolites are detected by certain ligand-specific protein sensors that respond to concentration changes of the key metabolites by altering the efficiencies of longevity-defining cellular processes. The concentrations of the key metabolites that affect yeast chronological aging are controlled spatially and temporally. Here, we analyze mechanisms through which the spatiotemporal dynamics of changes in the concentrations of the key metabolites influence yeast chronological lifespan. Our analysis indicates that a distinct set of metabolites can act as second messengers that define the pace of yeast chronological aging. Molecules that can operate both as intermediates of yeast metabolism and as second messengers of yeast chronological aging include reduced nicotinamide adenine dinucleotide phosphate (NADPH, glycerol, trehalose, hydrogen peroxide, amino acids, sphingolipids, spermidine, hydrogen sulfide, acetic acid, ethanol, free fatty acids, and diacylglycerol. We discuss several properties that these second messengers of yeast chronological aging have in common with second messengers of signal transduction. We outline how these second messengers of yeast chronological aging elicit changes in cell functionality and viability in response to changes in the nutrient, energy, stress, and proliferation status of the cell.

  8. Functional genomics of beer-related physiological processes in yeast

    NARCIS (Netherlands)

    Hazelwood, L.A.

    2009-01-01

    Since the release of the entire genome sequence of the S. cerevisiae laboratory strain S288C in 1996, many functional genomics tools have been introduced in fundamental and application-oriented yeast research. In this thesis, the applicability of functional genomics for the improvement of yeast in

  9. Improving industrial yeast strains: exploiting natural and artificial diversity.

    Science.gov (United States)

    Steensels, Jan; Snoek, Tim; Meersman, Esther; Picca Nicolino, Martina; Voordeckers, Karin; Verstrepen, Kevin J

    2014-09-01

    Yeasts have been used for thousands of years to make fermented foods and beverages, such as beer, wine, sake, and bread. However, the choice for a particular yeast strain or species for a specific industrial application is often based on historical, rather than scientific grounds. Moreover, new biotechnological yeast applications, such as the production of second-generation biofuels, confront yeast with environments and challenges that differ from those encountered in traditional food fermentations. Together, this implies that there are interesting opportunities to isolate or generate yeast variants that perform better than the currently used strains. Here, we discuss the different strategies of strain selection and improvement available for both conventional and nonconventional yeasts. Exploiting the existing natural diversity and using techniques such as mutagenesis, protoplast fusion, breeding, genome shuffling and directed evolution to generate artificial diversity, or the use of genetic modification strategies to alter traits in a more targeted way, have led to the selection of superior industrial yeasts. Furthermore, recent technological advances allowed the development of high-throughput techniques, such as 'global transcription machinery engineering' (gTME), to induce genetic variation, providing a new source of yeast genetic diversity. © 2014 The Authors. FEMS Microbiology Reviews published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.

  10. Quality evaluation of some commercial baker's yeasts in Nigeria ...

    African Journals Online (AJOL)

    55.8 to161.6mlh g , respectively. Bread baked from different baker's yeasts were not significantly different (p>0.05) in their crumb structure and texture. However, significant differences were found in terms of crust color, loaf symmetry and overall acceptability. The staling rate of bread samples correlated positively with yeast's ...

  11. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  12. Metabolic engineering of yeast for fermentative production of flavonoids

    DEFF Research Database (Denmark)

    Rodriguez Prado, Edith Angelica; Strucko, Tomas; Stahlhut, Steen Gustav

    2017-01-01

    Yeast Saccharomyces cerevisiae was engineered for de novo production of six different flavonoids (naringenin, liquiritigenin, kaempferol, resokaempferol, quercetin, and fisetin) directly from glucose, without supplementation of expensive intermediates. This required reconstruction of long...... demonstrates the potential of flavonoid-producing yeast cell factories....

  13. Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

    Science.gov (United States)

    Deutch, Charles E.; Marshall, Pamela A.

    2008-01-01

    In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

  14. The making of biodiversity across the yeast subphyllum

    Science.gov (United States)

    Goals for this research project are to determine how the functional diversity of the yeast subphylum is encoded, and to reconstruct the history of yeasts to elucidate the tempo and mode of functional diversification. The impact of this work will be to integrate discoveries within broadly disseminate...

  15. 21 CFR 172.325 - Bakers yeast protein.

    Science.gov (United States)

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be...

  16. Improving industrial yeast strains: exploiting natural and artificial diversity

    Science.gov (United States)

    Steensels, Jan; Snoek, Tim; Meersman, Esther; Nicolino, Martina Picca; Voordeckers, Karin; Verstrepen, Kevin J

    2014-01-01

    Yeasts have been used for thousands of years to make fermented foods and beverages, such as beer, wine, sake, and bread. However, the choice for a particular yeast strain or species for a specific industrial application is often based on historical, rather than scientific grounds. Moreover, new biotechnological yeast applications, such as the production of second-generation biofuels, confront yeast with environments and challenges that differ from those encountered in traditional food fermentations. Together, this implies that there are interesting opportunities to isolate or generate yeast variants that perform better than the currently used strains. Here, we discuss the different strategies of strain selection and improvement available for both conventional and nonconventional yeasts. Exploiting the existing natural diversity and using techniques such as mutagenesis, protoplast fusion, breeding, genome shuffling and directed evolution to generate artificial diversity, or the use of genetic modification strategies to alter traits in a more targeted way, have led to the selection of superior industrial yeasts. Furthermore, recent technological advances allowed the development of high-throughput techniques, such as ‘global transcription machinery engineering’ (gTME), to induce genetic variation, providing a new source of yeast genetic diversity. PMID:24724938

  17. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    Asami, Koji; Sekine, Katsuhisa

    2007-01-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  18. Interactions between yeasts, fungicides and apple fruit russeting

    NARCIS (Netherlands)

    Gildemacher, P.R.; Heijne, B.; Silvestri, M.; Houbraken, J.; Hoekstra, E.; Theelen, B.; Boekhout, T.

    2006-01-01

    The effect of inoculations with yeasts occurring on apple surfaces and fungicide treatments on the russeting of Elstar apples was studied. Captan, dithianon and a water treatment were implemented to study the interaction between the fungicides, the inoculated yeast species and Aureobasidium

  19. New yeast-based approaches in production of palmitoleic acid

    Czech Academy of Sciences Publication Activity Database

    Kolouchová, I.; Sigler, Karel; Schreiberová, O.; Masák, J.; Řezanka, Tomáš

    2015-01-01

    Roč. 192, SEP 2015 (2015), s. 726-734 ISSN 0960-8524 R&D Projects: GA ČR(CZ) GAP503/11/0215; GA ČR GA14-00227S Institutional support: RVO:61388971 Keywords : Oleaginous yeasts * Non-oleaginous yeasts * Palmitoleic acid Subject RIV: EE - Microbiology, Virology Impact factor: 4.917, year: 2015

  20. Occurrence and function of yeasts in Asian indigenous fermented foods

    NARCIS (Netherlands)

    Aidoo, K.E.; Nout, M.J.R.; Sarkar, P.K.

    2006-01-01

    In the Asian region, indigenous fermented foods are important in daily life. In many of these foods, yeasts are predominant and functional during the fermentation. The diversity of foods in which yeasts predominate ranges from leavened bread-like products such as nan and idli, to alcoholic beverages

  1. Specialist nectar-yeasts decline with urbanization in Berlin

    Science.gov (United States)

    Wehner, Jeannine; Mittelbach, Moritz; Rillig, Matthias C.; Verbruggen, Erik

    2017-03-01

    Nectar yeasts are common inhabitants of insect-pollinated flowers but factors determining their distribution are not well understood. We studied the influence of host identity, environmental factors related to pollution/urbanization, and the distance to a target beehive on local distribution of nectar yeasts within Robinia pseudoacacia L. and Tilia tomentosa Moench in Berlin, Germany. Nectar samples of six individuals per species were collected at seven sites in a 2 km radius from each target beehive and plated on YM-Agar to visualise the different morphotypes, which were then identified by sequencing a section of the 26S rDNA gene. Multivariate linear models were used to analyze the effects of all investigated factors on yeast occurrence per tree. Yeast distribution was mainly driven by host identity. The influence of the environmental factors (NO2, height of construction, soil sealing) strongly depended on the radius around the tree, similar to the distance of the sampled beehive. Incidence of specialist nectar-borne yeast species decreased with increasing pollution/urbanization index. Given that specialist yeast species gave way to generalist yeasts that have a reduced dependency on pollinators for between-flower dispersal, our results indicate that increased urbanization may restrict the movement of nectar-specialized yeasts, via limitations of pollinator foraging behavior.

  2. DNA repair and the genetic control of radiosensitivity in yeast

    International Nuclear Information System (INIS)

    Haynes, R.H.

    1975-01-01

    The following topics are discussed: advantages of yeasts for easily manipulated model systems for studies on molecular biology of eukaryotes; induction of x-ray-resistant mutants by radiations and chemicals; genetics of uv-sensitive mutants; loci of genes affecting radiosensitivity; gene interactions in multiple mutants; liquid-holding recovery; mitotic and meiotic recombination; and repair of yeast mitochondrial DNA

  3. How do yeast cells become tolerant to high ethanol concentrations?

    DEFF Research Database (Denmark)

    Snoek, Tim; Verstrepen, Kevin J.; Voordeckers, Karin

    2016-01-01

    The brewer’s yeast Saccharomyces cerevisiae displays a much higher ethanol tolerance compared to most other organisms, and it is therefore commonly used for the industrial production of bioethanol and alcoholic beverages. However, the genetic determinants underlying this yeast’s exceptional ethanol...... and challenges involved in obtaining superior industrial yeasts with improved ethanol tolerance....

  4. Glycosylceramide modifies the flavor and metabolic characteristics of sake yeast

    Directory of Open Access Journals (Sweden)

    Jannatul Ferdouse

    2018-05-01

    Full Text Available In the manufacture of sake, Japanese traditional rice wine, sake yeast is fermented with koji, which is steamed rice fermented with the non-pathogenic fungus Aspergillus oryzae. During fermentation, sake yeast requires lipids, such as unsaturated fatty acids and sterols, in addition to substances provided by koji enzymes for fermentation. However, the role of sphingolipids on the brewing characteristics of sake yeast has not been studied. In this study, we revealed that glycosylceramide, one of the sphingolipids abundant in koji, affects yeast fermentation. The addition of soy, A. oryzae, and Grifola frondosa glycosylceramide conferred a similar effect on the flavor profiles of sake yeast. In particular, the addition of A. oryzae and G. frondosa glycosylceramide were very similar in terms of the decreases in ethyl caprylate and ethyl 9-decenoate. The addition of soy glycosylceramide induced metabolic changes to sake yeast such as a decrease in glucose, increases in ethanol and glycerol and changes in several amino acids and organic acids concentrations. Tricarboxylic acid (TCA cycle, pyruvate metabolism, starch and sucrose metabolism, and glycerolipid metabolism were overrepresented in the cultures incubated with sake yeast and soy glycosylceramide. This is the first study of the effect of glycosylceramide on the flavor and metabolic profile of sake yeast.

  5. Industrial relevance of chromosomal copy number variation in Saccharomyces yeasts

    NARCIS (Netherlands)

    Gorter de Vries, A.R.; Pronk, J.T.; Daran, J.G.

    2017-01-01

    Chromosomal copy number variation (CCNV) plays a key role in evolution and health of eukaryotes. The unicellular yeast Saccharomyces cerevisiae is an important model for studying the generation, physiological impact, and evolutionary significance of CCNV. Fundamental studies of this yeast have

  6. Conversion of defective molasses into alcohol and yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Luchev, S.

    1966-01-01

    The addition of small quantities (0.05 to 0.75%) of dried malt roots, green malt roots, green malt, yeast hydrolyzate, corn extraction, and tomato juice improved the quality and accelerated the brewing process in defective molasses. Dried malt roots and yeast hydrolyzate were the least expensive preparations.

  7. Effect of salt hyperosmotic stress on yeast cell viability

    Directory of Open Access Journals (Sweden)

    Logothetis Stelios

    2007-01-01

    Full Text Available During fermentation for ethanol production, yeasts are subjected to different kinds of physico-chemical stresses such as: initially high sugar concentration and low temperature; and later, increased ethanol concentrations. Such conditions trigger a series of biological responses in an effort to maintain cell cycle progress and yeast cell viability. Regarding osmostress, many studies have been focused on transcriptional activation and gene expression in laboratory strains of Saccharomyces cerevisiae. The overall aim of this present work was to further our understanding of wine yeast performance during fermentations under osmotic stress conditions. Specifically, the research work focused on the evaluation of NaCl-induced stress responses of an industrial wine yeast strain S. cerevisiae (VIN 13, particularly with regard to yeast cell growth and viability. The hypothesis was that osmostress conditions energized specific genes to enable yeast cells to survive under stressful conditions. Experiments were designed by pretreating cells with different sodium chloride concentrations (NaCl: 4%, 6% and 10% w/v growing in defined media containing D-glucose and evaluating the impact of this on yeast growth and viability. Subsequent fermentation cycles took place with increasing concentrations of D-glucose (20%, 30%, 40% w/v using salt-adapted cells as inocula. We present evidence that osmostress induced by mild salt pre-treatments resulted in beneficial influences on both cell viability and fermentation performance of an industrial wine yeast strain.

  8. Biotechnology of non-Saccharomyces yeasts--the ascomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-01-01

    Saccharomyces cerevisiae and several other yeast species are among the most important groups of biotechnological organisms. S. cerevisiae and closely related ascomycetous yeasts are the major producer of biotechnology products worldwide, exceeding other groups of industrial microorganisms in productivity and economic revenues. Traditional industrial attributes of the S. cerevisiae group include their primary roles in food fermentations such as beers, cider, wines, sake, distilled spirits, bakery products, cheese, sausages, and other fermented foods. Other long-standing industrial processes involving S. cerevisae yeasts are production of fuel ethanol, single-cell protein (SCP), feeds and fodder, industrial enzymes, and small molecular weight metabolites. More recently, non-Saccharomyces yeasts (non-conventional yeasts) have been utilized as industrial organisms for a variety of biotechnological roles. Non-Saccharomyces yeasts are increasingly being used as hosts for expression of proteins, biocatalysts and multi-enzyme pathways for the synthesis of fine chemicals and small molecular weight compounds of medicinal and nutritional importance. Non-Saccharomyces yeasts also have important roles in agriculture as agents of biocontrol, bioremediation, and as indicators of environmental quality. Several of these products and processes have reached commercial utility, while others are in advanced development. The objective of this mini-review is to describe processes currently used by industry and those in developmental stages and close to commercialization primarily from non-Saccharomyces yeasts with an emphasis on new opportunities. The utility of S. cerevisiae in heterologous production of selected products is also described.

  9. A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin

    Directory of Open Access Journals (Sweden)

    Zhang Tingting

    2012-12-01

    Full Text Available Abstract Background Yeast Saccharomyces cerevisiae is a widely-used system for protein expression. We previously showed that heat-killed whole recombinant yeast vaccine expressing mammalian myostatin can modulate myostatin function in mice, resulting in increase of body weight and muscle composition in these animals. Foreign DNA introduced into yeast cells can be lost soon unless cells are continuously cultured in selection media, which usually contain antibiotics. For cost and safety concerns, it is essential to optimize conditions to produce quality food and pharmaceutical products. Results We developed a simple but effective method to engineer a yeast strain stably expressing mammalian myostatin. This method utilized high-copy-number integration of myostatin gene into the ribosomal DNA of Saccharomyces cerevisiae. In the final step, antibiotic selection marker was removed using the Cre-LoxP system to minimize any possible side-effects for animals. The resulting yeast strain can be maintained in rich culture media and stably express mammalian myostatin for two years. Oral administration of the recombinant yeast was able to induce immune response to myostatin and modulated the body weight of mice. Conclusions Establishment of such yeast strain is a step further toward transformation of yeast cells into edible vaccine to improve meat production in farm animals and treat human muscle-wasting diseases in the future.

  10. Glycosylceramide modifies the flavor and metabolic characteristics of sake yeast.

    Science.gov (United States)

    Ferdouse, Jannatul; Yamamoto, Yuki; Taguchi, Seiga; Yoshizaki, Yumiko; Takamine, Kazunori; Kitagaki, Hiroshi

    2018-01-01

    In the manufacture of sake, Japanese traditional rice wine, sake yeast is fermented with koji, which is steamed rice fermented with the non-pathogenic fungus Aspergillus oryzae . During fermentation, sake yeast requires lipids, such as unsaturated fatty acids and sterols, in addition to substances provided by koji enzymes for fermentation. However, the role of sphingolipids on the brewing characteristics of sake yeast has not been studied. In this study, we revealed that glycosylceramide, one of the sphingolipids abundant in koji, affects yeast fermentation. The addition of soy, A. oryzae , and Grifola frondosa glycosylceramide conferred a similar effect on the flavor profiles of sake yeast. In particular, the addition of A. oryzae and G. frondosa glycosylceramide were very similar in terms of the decreases in ethyl caprylate and ethyl 9-decenoate. The addition of soy glycosylceramide induced metabolic changes to sake yeast such as a decrease in glucose, increases in ethanol and glycerol and changes in several amino acids and organic acids concentrations. Tricarboxylic acid (TCA) cycle, pyruvate metabolism, starch and sucrose metabolism, and glycerolipid metabolism were overrepresented in the cultures incubated with sake yeast and soy glycosylceramide. This is the first study of the effect of glycosylceramide on the flavor and metabolic profile of sake yeast.

  11. Analysis of volatiles from irradiated yeast extract

    International Nuclear Information System (INIS)

    Liao Tao; Li Xin; Zu Xiaoyan; Chen Yuxia; Geng Shengrong

    2013-01-01

    The method for determination volatiles from irradiated yeast extract (YE) using headspace solid phase microextraction (HS-SPME) and gas chromatography-mass spectrometry (GC-MS) was developed in this paper. The extraction conditions were optimized with reference to the peak area and number of volatiles as aldehyde, ketone, alcohol, acid, ester and sulfur compounds. The optimized conditions of HS-SPME for volatiles in irradiated YE were: divinyl benzene/Carboxen/polydimethylsiloxane (DVB/CAR/PDMS) fiber, extration time 40 min, extraction temperature 40℃. The volatiles from YE irradiated by 0-19.8 kGy were detected using HS-SPME coupled with GC-MS. The results showed that only 15 volatiles were detected from no irradiated YE and main compounds were acetic acid, 2, 3-butanediol and 1-hexanol, 2-ethyl-. There were 40 volatiles detected from irradiated YE and the main compounds were acetic acid, phenylethyl alcohol, heptanal and nonanal. Compare to no irradiated yeast extract, the aldehyde, ketone, alkene and disulfide, dimethyl were produced by irradiating process. (authors)

  12. Pyrene degradation by yeasts and filamentous fungi.

    Science.gov (United States)

    Romero, M Cristina; Salvioli, Mónica L; Cazau, M Cecilia; Arambarri, A M

    2002-01-01

    The saprotrophic soil fungi Fusarium solani (Mart.) Sacc., Cylindrocarpon didymum (Hartig) Wollenw, Penicillium variabile Sopp. and the yeasts Rhodotorula glutinis (Fresenius) Harrison and Rhodotorula minuta (Saito) Harrison were cultured in mineral medium with pyrene. The remaining pyrene concentrations were periodically determined during 20 incubation days, using HPLC. To assess the metabolism of pyrene degradation we added 0.1 microCi of [4,5,9,10] 14C-pyrene to each fungi culture and measured the radioactivity in the volatile organic substances, extractable, aqueous phase, biomass and 14CO2 fractions. The assays demonstrated that F. solani and R. glutinis metabolized pyrene as a sole source of carbon. Differences in their activities at the beginning of the cultures disappeared by the end of the experiment, when 32 and 37% of the original pyrene concentration was detected, for the soil fungi and yeasts, respectively. Among the filamentous fungi, F. solani was highly active and oxidized pyrene; moreover, small but significant degradation rates were observed in C. didymum and P. variahile cultures. An increase in the 14CO2 evolution was observed at the 17th day with cosubstrate. R. glutinis and R. minuta cultures showed similar ability to biotransform pyrene, and that 35% of the initial concentration was consumed at the end of the assay. The same results were obtained in the experiments with or without glucose as cosubstrate.

  13. Parameters affecting methanol utilization by yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Foda, M.S.; El-Masry, H.G.

    1981-01-01

    Screening of 28 yeast cultures, representing 22 species of various yeasts, with respect to their capabilities to assimilate methanol, has shown that this property was mostly found in certain species of the two genera Hansenula and Candida. When methanol was used as a sole carbon source for a methanol-adapted strain of Hansenula polymorpha, a linear yield response could be obtained with increasing alcohol up to 2% concentration. The amount of inoculum proved to be the decisive factor in determining a priori the ability of the organism to grow at 6% methanol as final concentration. The optimum pH values for growth ranged between 4.5-5.5 with no growth at pH 6.5 or higher. A marked growth stimulation was obtained when the medium was supplied with phosphate up to 0.08 M as final concentration. Within the nitrogen sources tested, corn steep liquor concentrate gave the highest yield of cells. The significance of the obtained results are discussed with reference to feasibilities of application.

  14. Transporter engineering in biomass utilization by yeast.

    Science.gov (United States)

    Hara, Kiyotaka Y; Kobayashi, Jyumpei; Yamada, Ryosuke; Sasaki, Daisuke; Kuriya, Yuki; Hirono-Hara, Yoko; Ishii, Jun; Araki, Michihiro; Kondo, Akihiko

    2017-11-01

    Biomass resources are attractive carbon sources for bioproduction because of their sustainability. Many studies have been performed using biomass resources to produce sugars as carbon sources for cell factories. Expression of biomass hydrolyzing enzymes in cell factories is an important approach for constructing biomass-utilizing bioprocesses because external addition of these enzymes is expensive. In particular, yeasts have been extensively engineered to be cell factories that directly utilize biomass because of their manageable responses to many genetic engineering tools, such as gene expression, deletion and editing. Biomass utilizing bioprocesses have also been developed using these genetic engineering tools to construct metabolic pathways. However, sugar input and product output from these cells are critical factors for improving bioproduction along with biomass utilization and metabolic pathways. Transporters are key components for efficient input and output activities. In this review, we focus on transporter engineering in yeast to enhance bioproduction from biomass resources. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Methods to Measure Lipophagy in Yeast.

    Science.gov (United States)

    Cristobal-Sarramian, A; Radulovic, M; Kohlwein, S D

    2017-01-01

    Maintenance of cellular and organismal lipid homeostasis is critical for life, and any deviation from a balanced equilibrium between fat uptake and degradation may have deleterious consequences, resulting in severe lipid-associated disorders. Excess fat is typically stored in cytoplasmic organelles termed "lipid droplets" (LDs); to adjust for a constantly fluctuating supply of and demand for cellular fat, these organelles are metabolically highly dynamic and subject to multiple levels of regulation. In addition to a well-described cytosolic lipid degradation pathway, recent evidence underscores the importance of "lipophagy" in cellular lipid homeostasis, i.e., the degradation of LD by autophagy in the lysosome/vacuole. Pioneering work in yeast mutant models has unveiled the requirement of key components of the autophagy machinery, providing evidence for a highly conserved process of lipophagy from yeast to man. However, further work is required to unveil the intricate metabolic interaction between LD metabolism and autophagy to sustain membrane homeostasis and cellular survival. © 2017 Elsevier Inc. All rights reserved.

  16. Production of baker's yeast using date juice.

    Science.gov (United States)

    Beiroti, A; Hosseini, S N

    2007-07-01

    Baker's yeast is an important additive among the products which improves bread quality and for present time is being produced in different countries by batch, fed batch or continuous cultures. Saccharomyces cerevisiae is used in fermentation of starch in dough, giving a favourable taste and produces a variety of vitamins and proteins. The main ingredient in yeast production is carbon source such as beet molasses, cane molasses, and so on. Since beet molasses has other major function as in high yield alcohol production and also due to the bioenvironmental issues and related wastewater treatment, the use of other carbohydrate sources may be considered. One of these carbohydrate sources is date which is wasted a great deal annually in this country (Iran) . In this study, the capability of date to act as a suitable carbon sources was investigated. The waste date turned into juice and consequently production and growth rate of Sacchromyces cervisiae were studied with this juice. A maximum possible yield of 50% was obtained by the optimum medium (P3), at pH 3.4, 30 degrees C, 1.4 vvm aeration rate and agitation of 500 r/min.

  17. Yeast diversity and native vigor for flavor phenotypes.

    Science.gov (United States)

    Carrau, Francisco; Gaggero, Carina; Aguilar, Pablo S

    2015-03-01

    Saccharomyces cerevisiae, the yeast used widely for beer, bread, cider, and wine production, is the most resourceful eukaryotic model used for genetic engineering. A typical concern about using engineered yeasts for food production might be negative consumer perception of genetically modified organisms. However, we believe the true pitfall of using genetically modified yeasts is their limited capacity to either refine or improve the sensory properties of fermented foods under real production conditions. Alternatively, yeast diversity screening to improve the aroma and flavors could offer groundbreaking opportunities in food biotechnology. We propose a 'Yeast Flavor Diversity Screening' strategy which integrates knowledge from sensory analysis and natural whole-genome evolution with information about flavor metabolic networks and their regulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

    International Nuclear Information System (INIS)

    Baldikova, Eva; Prochazkova, Jitka; Stepanek, Miroslav; Hajduova, Jana; Pospiskova, Kristyna; Safarikova, Mirka; Safarik, Ivo

    2017-01-01

    A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles. - Highlights: • New types of magnetically responsive yeast biocomposites were prepared. • Recently developed PMAA-stabilized magnetic fluid was used. • Three yeast species were entrapped into magnetic chitosan gel during its formation. • All biocatalysts were efficiently employed for invert sugar formation.

  19. Oral yeast carriage in patients with advanced cancer.

    Science.gov (United States)

    Davies, A N; Brailsford, S; Broadley, K; Beighton, D

    2002-04-01

    The aim of this study was to investigate oral yeast carriage amongst patients with advanced cancer. Oral rinse samples were obtained from 120 subjects. Yeasts were isolated using Sabouraud's dextrose agar and CHROMagar Candida, and were identified using a combination of the API 20 C AUX yeast identification system, species-specific PCR and 26S rDNA gene sequencing. Oral yeast carriage was present in 66% of subjects. The frequency of isolation of individual species was: Candida albicans, 46%; Candida glabrata, 18%; Candida dubliniensis, 5%; others, yeast carriage was associated with denture wearing (P = 0.006), and low stimulated whole salivary flow rate (P = 0.009). Identification of these risk factors offers new strategies for the prevention of oral candidosis in this group of patients.

  20. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  1. Genetic and phenotypic characteristics of baker's yeast: relevance to baking.

    Science.gov (United States)

    Randez-Gil, Francisca; Córcoles-Sáez, Isaac; Prieto, José A

    2013-01-01

    Yeasts rarely encounter ideal physiological conditions during their industrial life span; therefore, their ability to adapt to changing conditions determines their usefulness and applicability. This is especially true for baking strains of Saccharomyces cerevisiae. The success of this yeast in the ancient art of bread making is based on its capacity to rapidly transform carbohydrates into CO2 rather than its unusual resistance to environmental stresses. Moreover, baker's yeast must exhibit efficient respiratory metabolism during yeast manufacturing, which determines biomass yield. However, optimal growth conditions often have negative consequences in other commercially important aspects, such as fermentative power or stress tolerance. This article reviews the genetic and physiological characteristics of baking yeast strains, emphasizing the activation of regulatory mechanisms in response to carbon source and stress signaling and their importance in defining targets for strain selection and improvement.

  2. The yeast stands alone: the future of protein biologic production.

    Science.gov (United States)

    Love, Kerry R; Dalvie, Neil C; Love, J Christopher

    2017-12-22

    Yeasts are promising alternative hosts for the manufacturing of recombinant protein therapeutics because they simply and efficiently meet needs for both platform and small-market drugs. Fast accumulation of biomass and low-cost media reduce the cost-of-goods when using yeast, which in turn can enable agile, small-volume manufacturing facilities. Small, tractable yeast genomes are amenable to rapid process development, facilitating strain and product quality by design. Specifically, Pichia pastoris is becoming a widely accepted yeast for biopharmaceutical manufacturing in much of the world owing to a clean secreted product and the rapidly expanding understanding of its cell biology as a host organism. We advocate for a near term partnership spanning industry and academia to promote open source, timely development of yeast hosts. Copyright © 2017. Published by Elsevier Ltd.

  3. PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

    Energy Technology Data Exchange (ETDEWEB)

    Baldikova, Eva, E-mail: baldie@email.cz [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Applied Chemistry, Faculty of Agriculture, University of South Bohemia, Branisovska 1457, 370 05 Ceske Budejovice (Czech Republic); Prochazkova, Jitka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Stepanek, Miroslav; Hajduova, Jana [Department of Physical and Macromolecular Chemistry, Faculty of Science, Charles University, Hlavova 2030, 128 40 Prague 2 (Czech Republic); Pospiskova, Kristyna [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Safarikova, Mirka [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Department of Nanobiotechnology, Biology Centre, CAS, ISB, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Safarik, Ivo [Global Change Research Institute, CAS, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic); Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 27, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Biology Centre, CAS, ISB, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)

    2017-04-01

    A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles. - Highlights: • New types of magnetically responsive yeast biocomposites were prepared. • Recently developed PMAA-stabilized magnetic fluid was used. • Three yeast species were entrapped into magnetic chitosan gel during its formation. • All biocatalysts were efficiently employed for invert sugar formation.

  4. New lager yeast strains generated by interspecific hybridization.

    Science.gov (United States)

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2015-05-01

    The interspecific hybrid Saccharomyces pastorianus is the most commonly used yeast in brewery fermentations worldwide. Here, we generated de novo lager yeast hybrids by mating a domesticated and strongly flocculent Saccharomyces cerevisiae ale strain with the Saccharomyces eubayanus type strain. The hybrids were characterized with respect to the parent strains in a wort fermentation performed at temperatures typical for lager brewing (12 °C). The resulting beers were analysed for sugar and aroma compounds, while the yeasts were tested for their flocculation ability and α-glucoside transport capability. These hybrids inherited beneficial properties from both parent strains (cryotolerance, maltotriose utilization and strong flocculation) and showed apparent hybrid vigour, fermenting faster and producing beer with higher alcohol content (5.6 vs 4.5 % ABV) than the parents. Results suggest that interspecific hybridization is suitable for production of novel non-GM lager yeast strains with unique properties and will help in elucidating the evolutionary history of industrial lager yeast.

  5. Activation of waste brewer's yeast Saccharomyces cerevisiae for bread production

    Directory of Open Access Journals (Sweden)

    Popov Stevan D.

    2005-01-01

    Full Text Available The waste brewer's yeast S. cerevisiae (activated and non-activated was compared with the commercial baker's yeast regarding the volume of developed gas in dough, volume and freshness stability of produced bread. The activation of waste brewer's yeast resulted in the increased volume of developed gas in dough by 100% compared to non-activated brewer's yeast, and the obtained bread is of more stable freshness compared to bread produced with baker's yeast. The activation of BY affects positively the quality of produced bread regarding bread volume. The volume of developed gas in dough prepared with the use of non-activated BY was not sufficient, therefore, it should not be used as fermentation agent, but only as an additive in bread production process for bread freshness preservation. Intense mixing of dough results in more compressible crumb 48 hrs after baking compared to high-speed mixing.

  6. Antimicrobial activity of yeasts against some pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Gamal Younis

    2017-08-01

    Full Text Available Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR for detection of khs (kievitone hydratase and pelA (pectate degrading enzyme genes. Results: The recovery rate of yeasts from sausage was 20% (2/10 followed by kareish cheese, processed cheese, and butter 10% (1/10 each as well as raw milk 9% (9/100, and fruit yoghurt 30% (6/20. Different yeast species were recovered, namely, Candida kefyr (5 isolates, Saccharomyces cerevisiae (4 isolates, Candida intermedia (3 isolates, Candida tropicalis (2 isolates, Candida lusitaniae (2 isolates, and Candida krusei (1 isolate. khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food.

  7. Lipid raft involvement in yeast cell growth and death

    Energy Technology Data Exchange (ETDEWEB)

    Mollinedo, Faustino, E-mail: fmollin@usal.es [Instituto de Biología Molecular y Celular del Cáncer, Centro de Investigación del Cáncer, Consejo Superior de Investigaciones Científicas - Universidad de Salamanca, Salamanca (Spain)

    2012-10-10

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na{sup +}, K{sup +}, and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  8. Lipid raft involvement in yeast cell growth and death

    International Nuclear Information System (INIS)

    Mollinedo, Faustino

    2012-01-01

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na + , K + , and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  9. Yeast species associated with wine grapes in China.

    Science.gov (United States)

    Li, Shuang-Shi; Cheng, Chao; Li, Zheng; Chen, Jing-Yu; Yan, Bin; Han, Bei-Zhong; Reeves, Malcolm

    2010-03-31

    Having more information on the yeast ecology of grapes is important for wine-makers to produce wine with high quality and typical attributes. China is a significant wine-consuming country and is becoming a serious wine-producer, but little has been reported about the yeast ecology of local ecosystems. This study provides the first step towards the exploitation of the yeast wealth in China's vine-growing regions. The aim of this study was to investigate the yeast population density and diversity on three grape varieties cultivated in four representative vine-growing regions of China. Yeast species diversity was evaluated by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequence analysis of the 5.8S internal transcribed spacer (ITS) ribosomal DNA (rDNA) region of cultivable yeasts. The grapes harbored yeast populations at 10(2)-10(6)CFU/mL, consisting mostly of non-Saccharomyces species. Seventeen different yeast species belonging to eight genera were detected on the grape samples tested, including Hanseniaspora uvarum, Cryptococcus flavescens, Pichia fermentans, Candida zemplinina, Cryptococcus carnescens, Candida inconpicua, Zygosaccharomyces fermentati, Issatchenkia terricola, Candida quercitrusa, Hanseniaspora guilliermondii, Candida bombi, Zygosaccharomyces bailii, Sporidiobolus pararoseus, Cryptococcus magnus, Metschnikowia pulcherrima, Issatchenkia orientalis and Pichia guilliermondii. H. uvarum and C. flavescens were the dominant species present on the grapes. For the first time Sporidiobolus pararoseus was discovered as an inhabitant of the grape ecosystem. The yeast community on grape berries was influenced by the grape chemical composition, vine-variety and vine-growing region. This study is the first to identify the yeast communities associated with grapes in China using molecular methods. The results enrich our knowledge of wine-related microorganisms, and can be used to promote the development of the local wine

  10. Performance of non-conventional yeasts in co-culture with brewers’ yeast for steering ethanol and aroma production

    NARCIS (Netherlands)

    Rijswijck, van Irma M.H.; Wolkers - Rooijackers, Judith C.M.; Abee, Tjakko; Smid, Eddy J.

    2017-01-01

    Increasing interest in new beer types has stimulated the search for approaches to extend the metabolic variation of brewers’ yeast. Therefore, we tested two approaches using non-conventional yeast to create a beer with lower ethanol content and a complex aroma bouquet. First, the mono-culture

  11. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    Science.gov (United States)

    Bellon, Jennifer R; Schmid, Frank; Capone, Dimitra L; Dunn, Barbara L; Chambers, Paul J

    2013-01-01

    Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  12. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    Directory of Open Access Journals (Sweden)

    Jennifer R Bellon

    Full Text Available Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade, has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  13. Introducing a New Breed of Wine Yeast: Interspecific Hybridisation between a Commercial Saccharomyces cerevisiae Wine Yeast and Saccharomyces mikatae

    Science.gov (United States)

    Bellon, Jennifer R.; Schmid, Frank; Capone, Dimitra L.; Dunn, Barbara L.; Chambers, Paul J.

    2013-01-01

    Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment. PMID:23614011

  14. Sporulation in the Budding Yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Neiman, Aaron M.

    2011-01-01

    In response to nitrogen starvation in the presence of a poor carbon source, diploid cells of the yeast Saccharomyces cerevisiae undergo meiosis and package the haploid nuclei produced in meiosis into spores. The formation of spores requires an unusual cell division event in which daughter cells are formed within the cytoplasm of the mother cell. This process involves the de novo generation of two different cellular structures: novel membrane compartments within the cell cytoplasm that give rise to the spore plasma membrane and an extensive spore wall that protects the spore from environmental insults. This article summarizes what is known about the molecular mechanisms controlling spore assembly with particular attention to how constitutive cellular functions are modified to create novel behaviors during this developmental process. Key regulatory points on the sporulation pathway are also discussed as well as the possible role of sporulation in the natural ecology of S. cerevisiae. PMID:22084423

  15. Synchronization of Budding Yeast by Centrifugal Elutriation.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    In yeast, cell size is normally tightly linked to cell cycle progression. Centrifugal elutriation is a method that fractionates cells based on the physical properties of cell size-fluid drag and buoyant density. Using a specially modified centrifuge and rotor system, cells can be physically separated into one or more cohorts of similar size and therefore cell cycle position. Small G 1 daughters are collected first, followed by successively larger cells. Elutriated populations can be analyzed immediately or can be returned to medium and permitted to synchronously progress through the cell cycle. This protocol describes two different elutriation methods. In the first, one or more fractions of synchronized cells are obtained from an asynchronous starting population, reincubated, and followed prospectively across a time series. In the second, an asynchronous starting population is separated into multiple fractions of similarly sized cells, and each cohort of similarly sized cells can be analyzed separately without further growth. © 2017 Cold Spring Harbor Laboratory Press.

  16. Phyllosphere yeasts rapidly break down biodegradable plastics.

    Science.gov (United States)

    Kitamoto, Hiroko K; Shinozaki, Yukiko; Cao, Xiao-Hong; Morita, Tomotake; Konishi, Masaaki; Tago, Kanako; Kajiwara, Hideyuki; Koitabashi, Motoo; Yoshida, Shigenobu; Watanabe, Takashi; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Tsushima, Seiya

    2011-11-29

    The use of biodegradable plastics can reduce the accumulation of environmentally persistent plastic wastes. The rate of degradation of biodegradable plastics depends on environmental conditions and is highly variable. Techniques for achieving more consistent degradation are needed. However, only a few microorganisms involved in the degradation process have been isolated so far from the environment. Here, we show that Pseudozyma spp. yeasts, which are common in the phyllosphere and are easily isolated from plant surfaces, displayed strong degradation activity on films made from poly-butylene succinate or poly-butylene succinate-co-adipate. Strains of P. antarctica isolated from leaves and husks of paddy rice displayed strong degradation activity on these films at 30°C. The type strain, P. antarctica JCM 10317, and Pseudozyma spp. strains from phyllosphere secreted a biodegradable plastic-degrading enzyme with a molecular mass of about 22 kDa. Reliable source of biodegradable plastic-degrading microorganisms are now in our hands.

  17. Preparation of Total RNA from Fission Yeast.

    Science.gov (United States)

    Bähler, Jürg; Wise, Jo Ann

    2017-04-03

    Treatment with hot phenol breaks open fission yeast cells and begins to strip away bound proteins from RNA. Deproteinization is completed by multiple extractions with chloroform/isoamyl alcohol and separation of the aqueous and organic phases using MaXtract gel, an inert material that acts as a physical barrier between the phases. The final step is concentration of the RNA by ethanol precipitation. The protocol can be used to prepare RNA from several cultures grown in parallel, but it is important not to process too many samples at once because delays can be detrimental to RNA quality. A reasonable number of samples to process at once would be three to four for microarray or RNA sequencing analyses and six for preliminary investigations of mutants implicated in RNA metabolism. © 2017 Cold Spring Harbor Laboratory Press.

  18. Beneficial properties of probiotic yeast Saccharomyces boulardii

    Directory of Open Access Journals (Sweden)

    Tomičić Zorica M.

    2016-01-01

    Full Text Available Saccharomyces boulardii is unique probiotic and biotherapeutic yeast, known to survive in gastric acidity and it is not adversely affected or inhibited by antibiotics or does not alter or adversely affect the normal microbiota. S. boulardii has been utilized worldwide as a probiotic supplement to support gastrointestinal health. The multiple mechanisms of action of S. boulardii and its properties may explain its efficacy and beneficial effects in acute and chronic gastrointestinal diseases that have been confirmed by clinical trials. Caution should be taken in patients with risk factors for adverse events. Its potential application in various dairy foods could offer an alternative probiotic product to people suffering from antibiotic-associated diarrhea. This review discusses the evidence for efficacy and safety of S. boulardii as a probiotic for the prevention and therapy of gastrointestinal disorders in humans.

  19. Regularities of radiorace formation in yeasts

    International Nuclear Information System (INIS)

    Korogodin, V.I.; Bliznik, K.M.; Kapul'tsevich, Yu.G.; Petin, V.G.; Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel'skij Inst. Meditsinskoj Radiologii)

    1977-01-01

    Two strains of diploid yeast, namely, Saccharomyces ellipsoides, Megri 139-B, isolated under natural conditions, and Saccharomyces cerevisiae 5a x 3Bα, heterozygous by genes ade 1 and ade 2, were exposed to γ-quanta of Co 60 . The content of cells-saltants forming colonies with changed morphology, that of the nonviable cells, cells that are respiration mutants, and cells-recombinants by gene ade 1 and ade 2, has been determined. A certain regularity has been revealed in the distribution among the colonies of cells of the four types mentioned above: the higher the content of cells of some one of the types, the higher that of the cells having other hereditary changes

  20. Systematic identification of yeast proteins extracted into model wine during aging on the yeast lees.

    Science.gov (United States)

    Rowe, Jeffrey D; Harbertson, James F; Osborne, James P; Freitag, Michael; Lim, Juyun; Bakalinsky, Alan T

    2010-02-24

    Total protein and protein-associated mannan concentrations were measured, and individual proteins were identified during extraction into model wines over 9 months of aging on the yeast lees following completion of fermentations by seven wine strains of Saccharomyces cerevisiae. In aged wines, protein-associated mannan increased about 6-fold (+/-66%), while total protein only increased 2-fold (+/-20%), which resulted in a significantly greater protein-associated mannan/total protein ratio for three strains. A total of 219 proteins were identified among all wine samples taken over the entire time course. Of the 17 "long-lived" proteins detected in all 9 month samples, 13 were cell wall mannoproteins, and four were glycolytic enzymes. Most cytosolic proteins were not detected after 6 months. Native mannosylated yeast invertase was assayed for binding to wine tannin and was found to have a 10-fold lower affinity than nonglycosylated bovine serum albumin. Enrichment of mannoproteins in the aged model wines implies greater solution stability than other yeast proteins and the possibility that their contributions to wine quality may persist long after bottling.

  1. Anhydrobiosis in yeast: cell wall mannoproteins are important for yeast Saccharomyces cerevisiae resistance to dehydration.

    Science.gov (United States)

    Borovikova, Diana; Teparić, Renata; Mrša, Vladimir; Rapoport, Alexander

    2016-08-01

    The state of anhydrobiosis is linked with the reversible delay of metabolism as a result of strong dehydration of cells, and is widely distributed in nature. A number of factors responsible for the maintenance of organisms' viability in these conditions have been revealed. This study was directed to understanding how changes in cell wall structure may influence the resistance of yeasts to dehydration-rehydration. Mutants lacking various cell wall mannoproteins were tested to address this issue. It was revealed that mutants lacking proteins belonging to two structurally and functionally unrelated groups (proteins non-covalently attached to the cell wall, and Pir proteins) possessed significantly lower cell resistance to dehydration-rehydration than the mother wild-type strain. At the same time, the absence of the GPI-anchored cell wall protein Ccw12 unexpectedly resulted in an increase of cell resistance to this treatment; this phenomenon is explained by the compensatory synthesis of chitin. The results clearly indicate that the cell wall structure/composition relates to parameters strongly influencing yeast viability during the processes of dehydration-rehydration, and that damage to cell wall proteins during yeast desiccation can be an important factor leading to cell death. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Conventional and Non-Conventional Yeasts in Beer Production

    Directory of Open Access Journals (Sweden)

    Angela Capece

    2018-06-01

    Full Text Available The quality of beer relies on the activity of fermenting yeasts, not only for their good fermentation yield-efficiency, but also for their influence on beer aroma, since most of the aromatic compounds are intermediate metabolites and by-products of yeast metabolism. Beer production is a traditional process, in which Saccharomyces is the sole microbial component, and any deviation is considered a flaw. However, nowadays the brewing sector is faced with an increasing demand for innovative products, and it is diffusing the use of uncharacterized autochthonous starter cultures, spontaneous fermentation, or non-Saccharomyces starters, which leads to the production of distinctive and unusual products. Attempts to obtain products with more complex sensory characteristics have led one to prospect for non-conventional yeasts, i.e., non-Saccharomyces yeasts. These generally are characterized by low fermentation yields and are more sensitive to ethanol stress, but they provide a distinctive aroma and flavor. Furthermore, non-conventional yeasts can be used for the production of low-alcohol/non-alcoholic and light beers. This review aims to present the main findings about the role of traditional and non-conventional yeasts in brewing, demonstrating the wide choice of available yeasts, which represents a new biotechnological approach with which to target the characteristics of beer and to produce different or even totally new beer styles.

  3. The impact of yeast fermentation on dough matrix properties.

    Science.gov (United States)

    Rezaei, Mohammad N; Jayaram, Vinay B; Verstrepen, Kevin J; Courtin, Christophe M

    2016-08-01

    Most studies on dough properties are performed on yeastless dough to exclude the complicating, time-dependent effect of yeast. Baker's yeast, however, impacts dough matrix properties during fermentation, probably through the production of primary (CO2 and ethanol) and secondary (glycerol, acetic acid and succinic acid) metabolites. The aim of this study is to obtain a better understanding of the changes in yeasted dough behavior introduced by fermentation, by investigating the impact of yeast fermentation on Farinograph dough consistency, dough spread, Kieffer rig dough extensibility and gluten agglomeration behavior in a fermented dough-batter gluten starch separation system. Results show that fermentation leads to a dough with less flow and lower extensibility that breaks more easily under stress and strain. The dough showed less elastic and more plastic deformation behavior. Gluten agglomerates were smaller for yeasted dough than for the unyeasted control. These changes probably have to be attributed to metabolites generated during fermentation. Indeed, organic acids and also ethanol in concentrations produced by yeast were previously shown to have similar effects in yeastless dough. These findings imply the high importance of yeast fermentation metabolites on dough matrix properties in industrial bread production. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  4. Yeast Biomass Production in Brewery's Spent Grains Hemicellulosic Hydrolyzate

    Science.gov (United States)

    Duarte, Luís C.; Carvalheiro, Florbela; Lopes, Sónia; Neves, Ines; Gírio, Francisco M.

    Yeast single-cell protein and yeast extract, in particular, are two products which have many feed, food, pharmaceutical, and biotechnological applications. However, many of these applications are limited by their market price. Specifically, the yeast extract requirements for culture media are one of the major technical hurdles to be overcome for the development of low-cost fermentation routes for several top value chemicals in a biorefinery framework. A potential biotechnical solution is the production of yeast biomass from the hemicellulosic fraction stream. The growth of three pentose-assimilating yeast cell factories, Debaryomyces hansenii, Kluyveromyces marxianus, and Pichia stipitis was compared using non-detoxified brewery's spent grains hemicellulosic hydrolyzate supplemented with mineral nutrients. The yeasts exhibited different specific growth rates, biomass productivities, and yields being D. hansenii as the yeast species that presented the best performance, assimilating all sugars and noteworthy consuming most of the hydrolyzate inhibitors. Under optimized conditions, D. hansenii displayed a maximum specific growth rate, biomass yield, and productivity of 0.34 h-1, 0.61 g g-1, and 0.56 g 1-1 h-1, respectively. The nutritional profile of D. hansenii was thoroughly evaluated, and it compares favorably to others reported in literature. It contains considerable amounts of some essential amino acids and a high ratio of unsaturated over saturated fatty acids.

  5. Hybridization of halotolerant yeast for alcohol fermentation

    International Nuclear Information System (INIS)

    Limtong, S.

    1991-01-01

    Attempt have been made to construct a new yeast strain from alcohol fermenting strains and salt tolerant strains. It is anticipated that the new yeast strain will be able to ferment alcohol in molasses mash with high salinity, up to 3% of NaCl. Another characteristics is its ability to tolerate up to 40 C temperature which is desirable for alcohol fermentation in tropical countries. Commercial and wild strains of Saccharomyces cerevisiae were screened for their fermenting ability and strain SC90, 191 TJ3, and AM12 were selected as parental strains for fusion among themselves and with other halo tolerant species. Halo tolerant strains selected at 5% NaCl in molasses mash were tentatively identified as Torulopsis grabrata, T. candida, T. Bovina and S. Rouxii whereas all of those strains selected at 17% NaCl were Citeromyces sp. It was found that fusant TA73 derived from wild strain and sake fermenting strain performed best among 4,087 fusants investigated. This fusant fermented much better than their parental strains when salt concentrations were increased to 5 and 7% NaCl. Experiment was carried out in fermentor, 1.5 liter working volume using molasses mash with 3% NaCl and temperature was controlled at 35 degree C. Fermentation rate of TA73, TJ3 and AM12 were 2.17, 1.50 and 1.87 g/L/hr respectively, Maximum ethanol concentration obtained were 7.6, 6.7 and 7.4% by weight after 60 and 78 hours respectively. Other fusants derived from fusion of Saccharomyces cerevisiae with other halo tolerant species were mostly inferior to their parental strains and only 7 fusants were slightly better than parental strains. (author)

  6. S-adenosylmethionine decarboxylase from baker's yeast.

    Science.gov (United States)

    Pösö, H; Sinervirta, R; Jänne, J

    1975-01-01

    1. S-Adenosyl-L-methionine decarboxylase (S-adenosyl-L-methionine carboxy-lyase, EC 4.1.1.50) was purified more than 1100-fold from extracts of Saccharomyces cerevisiae by affinity chromatography on columns of Sepharose containing covalently bound methylglyoxal bis(guanylhydrazone) (1,1'[(methylethanediylidene)dinitrilo]diguanidine) [Pegg, (1974) Biochem J. 141, 581-583]. The final preparation appeared to be homogeneous on polyacrylamide-gel electrophoresis at pH 8.4. 2. S-Adenosylmethionine decarboxylase activity was completely separated from spermidine synthase activity [5'-deoxyadenosyl-(5'),3-aminopropyl-(1),methylsulphonium-salt-putrescine 3-aminopropyltransferase, EC 2.5.1.16] during the purification procedure. 3. Adenosylmethionine decarboxylase activity from crude extracts of baker's yeast was stimulated by putrescine, 1,3-diamino-propane, cadaverine (1,5-diaminopentane) and spermidine; however, the purified enzyme, although still stimulated by the diamines, was completely insensitive to spermidine. 4. Adenosylmethionine decarboxylase has an apparent Km value of 0.09 mM for adenosylmethionine in the presence of saturating concentrations of putrescine. The omission of putrescine resulted in a five-fold increase in the apparent Km value for adenosylmethionine. 5. The apparent Ka value for putrescine, as the activator of the reaction, was 0.012 mM. 6. Methylglyoxal bis(guanylhydrazone) and S-methyladenosylhomocysteamine (decarboxylated adenosylmethionine) were powerful inhibitors of the enzyme. 7. Adenosylmethionine decarboxylase from baker's yeast was inhibited by a number of conventional carbonyl reagents, but in no case could the inhibition be reversed with exogenous pyridoxal 5'-phosphate. PMID:1108876

  7. Mechanisms of uv mutagenesis in yeast

    International Nuclear Information System (INIS)

    Lawrence, C.W.; Christensen, R.; Schwartz, A.

    1982-01-01

    The uv mutagenesis in yeast depends on the function of the RAD6 locus, a gene that is also responsible for a substantial fraction of wild-type resistance, suggesting that this eukaryote may possess a misrepair mechanism analogous to that proposed for Escherichia coli. The molecular mechanism responsible for RAD6 repair or recovery is not yet known, but it is different from either excision or recombination-dependent repair, processes carried out by the other two main repair pathways in yeast. RAD6-dependent mutagenesis has been found to have the following characteristics. It is associated at best with only a small fraction of RAD6-dependent repair, the majority of the sensitivity of rad6 mutants being due to their lack of nonmutagenic repair. SRS2 metabolic suppressors restore a substantial fraction of uv resistance to rad6 mutants but do not restore their uv mutability. Strains containing mutations at loci (rev, umr) that are probably more directly involved in mutagenesis are only mildly sensitive, and there is a poor correlation between their sensitivity and mutational deficiency. The uv mutagenesis appears to require a large number of gene functions, perhaps ten or more. Where examined in detail, these genes have been found to be concerned in the production of only a specific range of mutational events, not all of them. Mating experiments have shown that a substantial fraction, probably 40% or more, of uv-induced mutations are untargeted, that is, occur in lesion-free regions of DNA. The uv irradiation, therefore, produces a general reduction in the normally high fidelity with which DNA is replicated on undamaged templates. It does not appear to be necessary for the causal lesion to be present in the same chromosome as the mutation it induces. The reduction in fidelity may be the consequence of the production of a diffusible factor in uv-irradiated cells, but definite evidence supporting this proposal has not yet been obtained

  8. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  9. The yeast spectrum of the 'tea fungus Kombucha'.

    Science.gov (United States)

    Mayser, P; Fromme, S; Leitzmann, C; Gründer, K

    1995-01-01

    The tea fungus 'Kombucha' is a symbiosis of Acetobacter, including Acetobacter xylinum as a characteristic species, and various yeasts. A characteristic yeast species or genus has not yet been identified. Kombucha is mainly cultivated in sugared black tea to produce a slightly acidulous effervescent beverage that is said to have several curative effects. In addition to sugar, the beverage contains small amounts of alcohol and various acids, including acetic acid, gluconic acid and lactic acid, as well as some antibiotic substances. To characterize the yeast spectrum with special consideration given to facultatively pathogenic yeasts, two commercially available specimens of tea fungus and 32 from private households in Germany were analysed by micromorphological and biochemical methods. Yeasts of the genera Brettanomyces, Zygosaccharomyces and Saccharomyces were identified in 56%, 29% and 26% respectively. The species Saccharomycodes ludwigii and Candida kefyr were only demonstrated in isolated cases. Furthermore, the tests revealed pellicle-forming yeasts such as Candida krusei or Issatchenkia orientalis/occidentalis as well as species of the apiculatus yeasts (Kloeckera, Hanseniaspora). Thus, the genus Brettanomyces may be a typical group of yeasts that are especially adapted to the environment of the tea fungus. However, to investigate further the beneficial effects of tea fungus, a spectrum of the other typical genera must be defined. Only three specimens showed definite contaminations. In one case, no yeasts could be isolated because of massive contamination with Penicillium spp. In the remaining two samples (from one household), Candida albicans was demonstrated. The low rate of contamination might be explained by protective mechanisms, such as formation of organic acids and antibiotic substances. Thus, subjects with a healthy metabolism do not need to be advised against cultivating Kombucha. However, those suffering from immunosuppression should preferably

  10. Production of yeast extract from whey using Kluyveromyces marxianus

    Directory of Open Access Journals (Sweden)

    Revillion Jean P. de Palma

    2003-01-01

    Full Text Available The yeast Kluyveromyces marxianus CBS 6556 was grown on whey to produce nucleotide-rich yeast extracts. Thermal treatments of cells at 35 or 50ºC for 15-30h resulted in yeast extracts containing about 20 g/L protein, with only the second treatment resulting in the presence of small amounts of RNA. In contrast, autolysis in buffered solution was the unique treatment that resulted in release of high amounts of intracellular RNA, being, therefore, the better procedure to produce 5'-nucletide rich extract with K. marxianus.

  11. [Antivirus effect of polysaccharides of brewer yeast in vitro].

    Science.gov (United States)

    Li, F; Shi, Y; Guan, X; Zhang, S; Tian, T

    1998-03-01

    The antivirus effect of polysaccharides of brewer yeast from yeast mud on 13 kinds of viruses including DNA and RNA virus along with their mechanisms were studied. The result showed that this effect was remarkable on the infections with poliovirus III, adenovirus III, ECHO6 virus, enterovirus 71, vesicular stomatitis virus, herpesvirus I, II, coxsackie A16 virus and coxsackie B3 virus. The polysaccharides of brewer yeast could also inhibit the development of cytopathic effect(CPE) and protect cultural cells from being infected with the above viruses.

  12. The complexity and implications of yeast prion domains

    Science.gov (United States)

    2011-01-01

    Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731

  13. Yeast biotechnology: teaching the old dog new tricks

    Science.gov (United States)

    2014-01-01

    Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature. PMID:24602262

  14. Biochemical composition of the biomass of some yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Filippova, T.V.; Tyurina, Z.P.

    1981-01-01

    The biochemical composition of Rhodotorula gracilis was dependent on the culture medium. Cultivation of the yeast on molasses, starch, and plant hydrolyzates gave a high biomass yield with high protein and carbohydrate contents and relatively low nucleic acid contents. Similar results were obtained with fodder yeasts: Candida tropicalis, C. scotti, and Sporobolomyces pararoseus. There were 17 amino acids in yeast biomass. The amino acid content of R. gracilis and C. scotti was 29-30 percent and 39 percent respectively. Both species were deficient in methionine.

  15. Yeast biotechnology: teaching the old dog new tricks.

    Science.gov (United States)

    Mattanovich, Diethard; Sauer, Michael; Gasser, Brigitte

    2014-03-06

    Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature.

  16. Kinetics of alcoholic fermentation during the culturing of bakers' yeast

    Energy Technology Data Exchange (ETDEWEB)

    Franz, B

    1961-01-01

    A synthesis was made of the effects of various factors on the rate of fermentation by Saccharomyces cerevisiae. The rate obeyed the Michaelis-Menten equation, was independent of the concentration of yeast, was maximal at 20/sup 0/ (0.61 ml ethanol/g dry yeast/h), was not significantly affected between pH 6.5 and 3.0 but declined at 3.0, was inhibited by ethanol at a rate proportional to the concentration squared (at ethanol = 12 volume %, the fermentation rate was practically zero), and was enhanced by the addition of phosphorus when a P-poor yeast was employed.

  17. Conditions of activation of yeast plasma membrane ATPase.

    Science.gov (United States)

    Sychrová, H; Kotyk, A

    1985-04-08

    The in vivo activation of the H+-ATPase of baker's yeast plasma membrane found by Serrano in 1983 was demonstrated with D-glucose aerobically and anaerobically (as well as in a respiration-deficient mutant) and, after suitable induction, with maltose, trehalose, and galactose. The activated but not the control ATPase was sensitive to oligomycin. No activation was possible in a cell-free extract with added glucose. The ATPase was not activated in yeast protoplasts which may account for the absence of glucose-stimulated secondary active transports in these wall-less cells and provide support for a microscopic coupling between ATPase activity and these transports in yeast cells.

  18. Yeasts: providing questions and answers for modern biology.

    Science.gov (United States)

    Dickinson, J R

    2000-01-01

    Yeasts are to be found in virtually every conceivable niche on this planet and are amazingly varied in their shapes ('morphologies'), life cycles, metabolic capabilities, potentials for use in industrial processes, abilities to spoil food and drink or to act as dangerous human pathogens. This review describes four very different species of yeast to illustrate some of the diversity which exists and, in the case of one of them, Saccharomyces cerevisiae (the familiar baker's or brewer's yeast), the extent of both our knowledge and ignorance.

  19. Brettanomyces bruxellensis yeasts: impact on wine and winemaking.

    Science.gov (United States)

    Agnolucci, Monica; Tirelli, Antonio; Cocolin, Luca; Toffanin, Annita

    2017-09-21

    Yeasts belonging to the Brettanomyces/Dekkera genus are non-conventional yeasts, which affect winemaking by causing wine spoilage all over the world. This mini-review focuses on recent results concerning the presence of Brettanomyces bruxellensis throughout the wine processing chain. Here, culture-dependent and independent methods to detect this yeast on grapes and at the very early stage of wine production are encompassed. Chemical, physical and biological tools, devised for the prevention and control of such a detrimental species during winemaking are also presented. Finally, the mini-review identifies future research areas relevant to the improvement of wine safety and sensory profiles.

  20. Construction of gateway-compatible yeast two-hybrid vectors for ...

    African Journals Online (AJOL)

    Yeast two-hybrid system combined with the gateway technology will greatly facilitate the cloning of interested DNA fragment into yeast two-hybrid vectors and therefore increase the efficiency of yeast two-hybrid analysis. In this study, we constructed a pair of Gateway-compatible yeast two-hybrid vectors pBTM116GW and ...

  1. The manometric determination of thiamine pyrophosphate and the inhibition of the acid yeast phosphatase

    NARCIS (Netherlands)

    Steyn-Parvé, Elizabeth P.

    1962-01-01

    Sodium molybdate is a powerful inhibitor of the acid yeast phosphatase in both fresh baker's yeast and dried brewer's yeast, provided that the yeast is suspended in a suitable buffer. It displays no action in citrate or phosphate buffers, but is active in acetate or maleate buffers, both at the

  2. Polyglutamine toxicity in yeast induces metabolic alterations and mitochondrial defects

    KAUST Repository

    Papsdorf, Katharina; Kaiser, Christoph J. O.; Drazic, Adrian; Grö tzinger, Stefan W.; Haeß ner, Carmen; Eisenreich, Wolfgang; Richter, Klaus

    2015-01-01

    formation. Indeed, we find that in vivo iron concentrations are misbalanced and observe a reduction in the activity of the prominent Fe-S cluster containing protein aconitase. Like in other yeast strains with impaired mitochondria, non-fermentative growth

  3. Antioxidant and Anticancer activities of yeast grown on commercial ...

    African Journals Online (AJOL)

    E-mail: chemist_aml_said@yahoo.com. ABSTRACT ... INTRODUCTION. Yeasts have a positive image with ... production of antioxidant activity compounds. However, the .... were analyzed using an inverted microscope. (Nikon-Japan).

  4. [Overexpression of FKS1 to improve yeast autolysis-stress].

    Science.gov (United States)

    Li, Jia; Wang, Jinjing; Li, Qi

    2015-09-01

    With the development of high gravity brewing, yeast cells are exposed to multiple brewing-associated stresses, such as increased osmotic pressure, enhanced alcohol concentration and nutritional imbalance. These will speed up yeast autolysis, which seriously influence beer flavor and quality. To increase yeast anti-autolytic ability, FKS1 overexpression strain was constructed by 18S rDNA. The concentration of β-1,3-glucan of overexpression strain was 62% higher than that of wild type strain. Meantime, FKS1 overexpression strain increased anti-stress ability at 8% ethanol, 0.4 mol/L NaCl and starvation stress. Under simulated autolysis, FKS1 showed good anti-autolytic ability by slower autolysis. These results confirms the potential of FKS1 overexpression to tackle yeast autolysis in high-gravity brewing.

  5. Animal vaccines based on orally presented yeast recombinants.

    Science.gov (United States)

    Shin, Min-Kyoung; Yoo, Han Sang

    2013-09-13

    In veterinary vaccinology, the oral route of administration is an attractive alternative compared to the commonly used parenteral route. Yeasts have a number of properties that make them potential live delivery systems for oral vaccination purposes such as their high expression levels, their GRAS status, adjuvant properties, and post-translational modification possibilities. Consequently, yeasts have been employed for the expression of heterologous genes and for the production of therapeutic proteins. Yeast-based vaccines are reviewed with regard to their ability to express and produce antigens from pathogens for veterinary use. Many of these vaccines have been shown to elicit protective immune responses following oral immunization in animals. Ultimately, yeast-based oral vaccines may offer a potential opportunity for the development of novel ideal vaccines in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Effects of Selenium Yeast on Blood Glucose and Antioxidant ...

    African Journals Online (AJOL)

    olayemitoyin

    Biomarkers in Cholesterol Fed Diet Induced Type 2 Diabetes. Mellitus in Wistar Rats. ... Keywords: Cholesterol diet; Diabetes Mellitus; Selenium yeast; SOD; CAT; GPx. ©Physiological ..... relationship with different diseases. Science Tot.

  7. Ethanol production potential of local yeast strains isolated from ripe ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... ... of these studies, the preferred candidate for industrial production of ethanol ... The yeast strains were isolated using the method of Ameh et al. (1989), on ... gas in the Durham tube during the incubation period. Fermentation ...

  8. Screening of yeasts capable of producing cellulase-free xylanase

    African Journals Online (AJOL)

    Professor

    2015-06-10

    Jun 10, 2015 ... of their ability to degrade xylan, which was found in the medium by using agar degradation halos, the ... These enzymes are produced by molds, bacteria, yeasts ... collected, stored in sterile plastic bags and transported under.

  9. Selection of oleaginous yeasts for fatty acid production.

    Science.gov (United States)

    Lamers, Dennis; van Biezen, Nick; Martens, Dirk; Peters, Linda; van de Zilver, Eric; Jacobs-van Dreumel, Nicole; Wijffels, René H; Lokman, Christien

    2016-05-27

    Oleaginous yeast species are an alternative for the production of lipids or triacylglycerides (TAGs). These yeasts are usually non-pathogenic and able to store TAGs ranging from 20 % to 70 % of their cell mass depending on culture conditions. TAGs originating from oleaginous yeasts can be used as the so-called second generation biofuels, which are based on non-food competing "waste carbon sources". In this study the selection of potentially new interesting oleaginous yeast strains is described. Important selection criteria were: a broad maximum temperature and pH range for growth (robustness of the strain), a broad spectrum of carbon sources that can be metabolized (preferably including C-5 sugars), a high total fatty acid content in combination with a low glycogen content and genetic accessibility. Based on these selection criteria, among 24 screened species, Schwanniomyces occidentalis (Debaromyces occidentalis) CBS2864 was selected as a promising strain for the production of high amounts of lipids.

  10. Biodiversity of Yeasts During Plum Wegierka Zwykla Spontaneous Fermentation

    Directory of Open Access Journals (Sweden)

    Tadeusz Tuszynski

    2005-01-01

    Full Text Available The study comprises an analysis of the yeast microbiota that participated in the spontaneous fermentation of crushed Wegierka Zwykla plum fruit, which is the raw material for slivovitz production in the mountain region in the south of Poland. Saccharomyces cerevisiae yeast strains were differentiated by means of the killer sensitivity analysis related to a killer reference panel of 9 well-known killer yeast strains. The first phase of the fermentation was dominated by the representatives of Kloeckera apiculata and Candida pulcherrima species, which reached their maximum concentration (1.4·106 CFU/mL after 48 h of the process. Almost all yeasts isolated during the following days were classified as S. cerevisiae and the killer sensitivity analysis revealed a high population diversity of this species and the presence of 14 different strains that changed quantitatively and qualitatively throughout the fermentation period.

  11. Tools for genetic engineering of the yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Saraya, Ruchi; Gidijala, Loknath; Veenhuis, Marten; van der Klei, Ida J; Mapelli, Valeria

    2014-01-01

    Hansenula polymorpha is a methylotrophic yeast species that has favorable properties for heterologous protein production and metabolic engineering. It provides an attractive expression platform with the capability to secrete high levels of commercially important proteins. Over the past few years

  12. Effect of extracellular calcium chloride on sporangiospore-yeast ...

    African Journals Online (AJOL)

    User

    2011-05-16

    May 16, 2011 ... Dimorphism is the conversion of a microorganism from one growth habit to .... formation in media designated for yeast production, while it led to a reduction of ..... on morphological development and biopolymer synthesis in the.

  13. Experimental operation of a yeast-production shop

    Energy Technology Data Exchange (ETDEWEB)

    Ol' shanskaya, M I

    1981-01-01

    Fodder yeast is obtained from the mash left over after alcohol fermentation by cooling under vacuum in special columns, followed by various chemical and technology treatments including neutralization and lysine enrichment.

  14. Industrial Relevance of Chromosomal Copy Number Variation in Saccharomyces Yeasts

    Science.gov (United States)

    Gorter de Vries, Arthur R.; Pronk, Jack T.

    2017-01-01

    ABSTRACT Chromosomal copy number variation (CCNV) plays a key role in evolution and health of eukaryotes. The unicellular yeast Saccharomyces cerevisiae is an important model for studying the generation, physiological impact, and evolutionary significance of CCNV. Fundamental studies of this yeast have contributed to an extensive set of methods for analyzing and introducing CCNV. Moreover, these studies provided insight into the balance between negative and positive impacts of CCNV in evolutionary contexts. A growing body of evidence indicates that CCNV not only frequently occurs in industrial strains of Saccharomyces yeasts but also is a key contributor to the diversity of industrially relevant traits. This notion is further supported by the frequent involvement of CCNV in industrially relevant traits acquired during evolutionary engineering. This review describes recent developments in genome sequencing and genome editing techniques and discusses how these offer opportunities to unravel contributions of CCNV in industrial Saccharomyces strains as well as to rationally engineer yeast chromosomal copy numbers and karyotypes. PMID:28341679

  15. The role of mitochondria in yeast programmed cell death

    International Nuclear Information System (INIS)

    Guaragnella, Nicoletta; Ždralević, Maša; Antonacci, Lucia; Passarella, Salvatore; Marra, Ersilia; Giannattasio, Sergio

    2012-01-01

    Mammalian apoptosis and yeast programmed cell death (PCD) share a variety of features including reactive oxygen species production, protease activity and a major role played by mitochondria. In view of this, and of the distinctive characteristics differentiating yeast and multicellular organism PCD, the mitochondrial contribution to cell death in the genetically tractable yeast Saccharomyces cerevisiae has been intensively investigated. In this mini-review we report whether and how yeast mitochondrial function and proteins belonging to oxidative phosphorylation, protein trafficking into and out of mitochondria, and mitochondrial dynamics, play a role in PCD. Since in PCD many processes take place over time, emphasis will be placed on an experimental model based on acetic acid-induced PCD (AA-PCD) which has the unique feature of having been investigated as a function of time. As will be described there are at least two AA-PCD pathways each with a multifaceted role played by mitochondrial components, in particular by cytochrome c.

  16. Determination of tritium in wine and wine yeast samples

    International Nuclear Information System (INIS)

    Cotarlea, Monica-Ionela; Paunescu, Niculina; Galeriu, D.; Mocanu, N.; Margineanu, R.; Marin, G.

    1997-01-01

    A sensitive method for evaluating the tritium content in wine and wine yeast was applied to estimate tritium impact on the environment in the surrounding area of nuclear power plant Cernavoda, where the vineyards are part of representative agricultural ecosystem. Analytical procedures were developed to determine HTO in wine and wine yeast samples. The content of organic compounds affecting the LSC measurement is reduced by fractionating distillation for wine samples and azeotropic distillation followed by fractional distillation for wine yeast samples. Finally, the water samples obtained after fractional distillation were normally distilled with KMO 4 . The established procedures were successfully applied for wine and wine yeast samples from Mulfatlar harvests of the years 1995 and 1996. (authors)

  17. Genetic Screens in Yeast to Identify BRCA1 Modifiers

    National Research Council Canada - National Science Library

    Plon, Sharon E

    2005-01-01

    .... The yeast RAD9 protein has similar functions and sequence motifs as BRCA1 and we proposed to identify haploinsufficient mutations at a second locus that alters the chromosome loss rate of our rad9-/- diploid strains...

  18. Genetic Screens in Yeast to Identify BRCA1 Modifiers

    National Research Council Canada - National Science Library

    Plon, Sharon E

    2004-01-01

    .... The yeast RAD9 protein has similar functions and sequence motifs as BRCA1 and we proposed to identify candidate modifier loci by identifying haploinsufficient mutations at a second locus that alters...

  19. Yeast Communities of Chestnut Soils under Vineyards in Dagestan

    Science.gov (United States)

    Abdullabekova, D. A.; Magomedova, E. S.; Magomedov, G. G.; Aliverdieva, D. A.; Kachalkin, A. V.

    2017-12-01

    The study of yeast communities in chestnut soils (Kastanozems) under vineyards in the Republic of Dagestan made it possible to isolate 20 yeast species. Most of the yeasts under vineyards belonged to ascomycetes, among which species of the Saccharomycetaceae family (in particular, Saccharomyces cerevisiae) comprised a significant part. The obtained results indicate that the soils under vineyards keep the pool of microbial diversity and ensure preservation of many species typical for grapes. The method of enrichment culture on grape juice medium proved to be more efficient than other methods of analysis with respect to the number of isolated species and the rate of their detection. However, implementation of different techniques to study yeasts' diversity can give somewhat different results; a set of methods should be used for an integrated analysis.

  20. Phylogenetic classification of yeasts and related taxa within Pucciniomycotina

    NARCIS (Netherlands)

    Wang, Q. -M.; Yurkov, A. M.; Goeker, M.; Lumbsch, H. T.; Leavitt, S. D.; Groenewald, M.; Theelen, B.; Liu, X. -Z.; Boekhout, T.; Bai, F. -Y.

    Most small genera containing yeast species in the Pucciniomycotina (Basidiomycota, Fungi) are monophyletic, whereas larger genera including Bensingtonia, Rhodosporidium, Rhodotorula, Sporidiobolus and Sporobolomyces are polyphyletic. With the implementation of the “One Fungus = One Name”

  1. Oxidative Stress and Programmed Cell Death in Yeast

    International Nuclear Information System (INIS)

    Farrugia, Gianluca; Balzan, Rena

    2012-01-01

    Yeasts, such as Saccharomyces cerevisiae, have long served as useful models for the study of oxidative stress, an event associated with cell death and severe human pathologies. This review will discuss oxidative stress in yeast, in terms of sources of reactive oxygen species (ROS), their molecular targets, and the metabolic responses elicited by cellular ROS accumulation. Responses of yeast to accumulated ROS include upregulation of antioxidants mediated by complex transcriptional changes, activation of pro-survival pathways such as mitophagy, and programmed cell death (PCD) which, apart from apoptosis, includes pathways such as autophagy and necrosis, a form of cell death long considered accidental and uncoordinated. The role of ROS in yeast aging will also be discussed.

  2. Checkpoint independence of most DNA replication origins in fission yeast.

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-12-19

    In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (approximately 3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in checkpoint

  3. Checkpoint independence of most DNA replication origins in fission yeast

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in

  4. Checkpoint independence of most DNA replication origins in fission yeast

    Directory of Open Access Journals (Sweden)

    Scott Donna

    2007-12-01

    Full Text Available Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU, which limits the pool of deoxyribonucleoside triphosphates (dNTPs and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR or cds1 (which encodes the fission yeast homologue of Chk2. Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3% behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild

  5. Experimental study on bread yeast cultured in sweet sorghum juice

    International Nuclear Information System (INIS)

    Wang Jufang; Dong Xicun; Li Wenjian; Xiao Guoqing; Ma Liang; Gao Feng

    2008-01-01

    As a substitute for food supplies, sweet sorghum juice with high grade has demonstrated out- standing advantage in fermentation. To obtain the optimized fermentation conditions, the growth, the bio- mass of bread yeast cultured in sweet sorghum juice and total residual sugar were investigated in the paper. The fermentation was performed and optimized in a 10-100 1 bio-reactor. The results show that the application of sweet sorghum juice in bread yeast production is very potential. (authors)

  6. Mammalian amyloidogenic proteins promote prion nucleation in yeast.

    Science.gov (United States)

    Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

    2018-03-02

    Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. On the mechanism of rapid postirradiation recovery of yeast

    International Nuclear Information System (INIS)

    Glazunov, A.V.; Kapul'tsevich, Yu.G.

    1983-01-01

    Rapid postirradiation recovery of diploid yeast Saccharomyces cerevisiae is equally effective both in water and in a liquid nutrition medium. In the haploid strains, rapid recovery occurs more readily in the log phase than in the stationary phase of growth. In the diploid strains, rapid recovery is more effective in the log phase than in the stationary phase. Rapid recovery of yeast does not require an additional protein synthesis. Damages induced by UV-light are not sub ected to rapid recovery

  8. Environmental assessment of different strategies for production of stabilized yeast

    OpenAIRE

    Monclus, Vincent; Pénicaud, Caroline; Perret, Bruno; Fonseca, Fernanda

    2016-01-01

    Yeast are widely used for producing fermented (bread, beer...) and health benefit (probiotics) products. The production of stable and active yeast involves fermentation, concentration, protection, drying (stabilization) and storage. During the stabilization and storage steps, the cells face numerous stress which may deteriorate functional properties and cause cell death. Different strategies can be used to preserve cell survival, such as changing growth medium for fermentation or adapting pro...

  9. Bacterial and yeast counts in Brazilian commodities and spices

    Directory of Open Access Journals (Sweden)

    Freire Francisco das Chagas Oliveira

    2002-01-01

    Full Text Available A total of thirteen genera of bacteria and two genera of yeasts were detected in surface sterilized and unsterilized Brazilian commodities and spices such as cashew kernels, Brazil nut kernels, black and white pepper. The genus Bacillus with eight species was by far the most common. The yeasts isolated were Pichia sp., P. guillermondii and Rhodotorula sp. Bacillus cereus, Salmonella typhimurium and Staphylococcus aureus were detected in cashew and Brazil nut kernels.

  10. Cytolethal Distending Toxin Demonstrates Genotoxic Activity in a Yeast Model

    OpenAIRE

    Hassane, Duane C.; Lee, Robert B.; Mendenhall, Michael D.; Pickett, Carol L.

    2001-01-01

    Cytolethal distending toxins (CDTs) are multisubunit proteins produced by a variety of bacterial pathogens that cause enlargement, cell cycle arrest, and apoptosis in mammalian cells. While their function remains uncertain, recent studies suggest that they can act as intracellular DNases in mammalian cells. Here we establish a novel yeast model for understanding CDT-associated disease. Expression of the CdtB subunit in yeast causes a G2/M arrest, as seen in mammalian cells. CdtB toxicity is n...

  11. Radiosensitivity of yeast cells as a function of radiation LET

    International Nuclear Information System (INIS)

    Lobachevskij, P.N.; Krasavin, E.A.

    1988-01-01

    A model is proposed for interpreting the radiosensitivity of yeast cells as a function of linear energy transfer (LET) of ionizing radiation. The model takes into account the role of repair processes in sensitivity of yeast cells to ionizing radiation of different LET. Two types of repair are discussed: (1) a nonspecific repair (characteristic of both haploid and diploid cells), and (2) a diploid - soecific repair (characteristic of diploid cells only)

  12. Occurrence and diversity of marine yeasts in Antarctica environments

    Science.gov (United States)

    Zhang, Xue; Hua, Mingxia; Song, Chunli; Chi, Zhenming

    2012-03-01

    A total of 28 yeast strains were obtained from the sea sediment of Antarctica. According to the results of routine identification and molecular characterization, the strains belonged to species of Yarrowia lipolytica, Debaryomyces hansenii, Rhodotorula slooffiae, Rhodotorula mucilaginosa, Sporidiobolus salmonicolor, Aureobasidium pullulans, Mrakia frigida and Guehomyces pullulans, respectively. The Antarctica yeasts have wide potential applications in biotechnology, for some of them can produce β-galactosidase and killer toxins.

  13. Spent yeast as natural source of functional food additives

    Science.gov (United States)

    Rakowska, Rita; Sadowska, Anna; Dybkowska, Ewa; Świderski, Franciszek

    Spent yeasts are by-products arising from beer and wine production which over many years have been chiefly used as feed additives for livestock. They contain many valuable and bioactive substances which has thereby generated much interest in their exploitation. Up till now, the main products obtained from beer-brewing yeasts are β-glucans and yeast extracts. Other like foodstuffs include dried brewer’s yeast, where this is dried and the bitterness removed to be fit for human consumption as well as mannan-oligosaccharides hitherto used in the feed industry. β-glucans constitute the building blocks of yeast cell walls and can thus be used in human nutrition as dietary supplements or serving as food additives in functional foods. β-glucans products obtained via post-fermentation of beer also exhibit a high and multi-faceted biological activity where they improve the blood’s lipid profile, enhance immunological status and have both prebiotic and anti-oxidant properties. Yeast extracts are currently being used more and more to enhance flavour in foodstuffs, particularly for meat and its products. Depending on how autolysis is carried out, it is possible to design extracts of various meat flavours characteristic of specific meats. Many different flavour profiles can be created which may be additionally increased in combination with vegetable extracts. Within the food market, yeast extracts can appear in various guises such as liquids, pastes or powders. They all contain significant amounts of glutamic acid, 5’-GMP and 5’-IMP nucleotides together with various amino acids and peptides that act synergistically for enhancing the flavour of foodstuff products. Recent studies have demonstrated additional benefits of yeast extracts as valuable sources of amino acids and peptides which can be used in functional foods and dietary supplements. These products possess GRAS status (Generally Recognised As Safe) which thereby also adds further as to why they should be used

  14. Inducibility of error-prone DNA repair in yeast

    International Nuclear Information System (INIS)

    Siede, W.; Eckardt, F.

    1984-01-01

    Whereas some experimental evidence suggests that mutagenesis in yeast after treatment with DNA-damaging agents involves inducible functions, a general-acting error-prone repair activity analogous to the SOS system of Escherichia coli has not yet been demonstrated. The current literature on the problem of inducibility of mutagenic repair in yeast is reviewed with emphasis on the differences in the experimental procedures applied. (orig.)

  15. Collaborative evaluation of the Abbott yeast identification system.

    OpenAIRE

    Cooper, B H; Prowant, S; Alexander, B; Brunson, D H

    1984-01-01

    The Abbott yeast identification system (Abbott Laboratories, Diagnostics Division, Irving, Tex.) is a 24-h, instrumental method for identifying medically important yeasts, based on matrix analysis of 19 biochemical reactions and the germ tube test. The system was evaluated in two clinical laboratories by using 179 coded isolates, which included a high percentage of the less frequently encountered species. Based upon results with these coded isolates and from previously obtained laboratory dat...

  16. [The homogeneity of a population of yeasts from Camembert cheeses].

    Science.gov (United States)

    Schmidt, J L; Daudin, J J

    1983-01-01

    Yeasts are found to a large extent in cheeses, more particularly in soft cheeses such as Camembert. The proximity between two species previously identified by standard methods was studied using a factorial discriminant analysis on 326 strains. Twenty-three fermentation and assimilation tests (discriminant variables) gave a fairly good discrimination between species. This treatment has allowed us to confirm the present tendencies noticed in yeast classification and has also enabled us to group some of the species.

  17. Yeast biofilm colony as an orchestrated multicellular organism

    Czech Academy of Sciences Publication Activity Database

    Šťovíček, V.; Váchová, Libuše; Palková, Zdena

    2012-01-01

    Roč. 5, č. 2 (2012), s. 203-205 ISSN 1942-0889 R&D Projects: GA ČR GA204/08/0718; GA MŠk(CZ) LC531 Grant - others:GA MŠk(CZ) LC06063 Program:LC Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast biofilm * yeast cell Subject RIV: EE - Microbiology, Virology

  18. Visible light alters yeast metabolic rhythms by inhibiting respiration

    OpenAIRE

    Robertson, James Brian; Davis, Chris R.; Johnson, Carl Hirschie

    2013-01-01

    In some organisms, respiration fluctuates cyclically, and these rhythms can be a sensitive gauge of metabolism. Constant or pulsatile exposure of yeast to visible wavelengths of light significantly alters and/or initiates these respiratory oscillations, revealing a further dimension of the challenges to yeast living in natural environments. Our results also have implications for the use of light as research tools—e.g., for excitation of fluorescence microscopically—even in organisms such as y...

  19. Determination of Glucose Concentration in Yeast Culture Medium

    Science.gov (United States)

    Hara, Seiichi; Kishimoto, Tomokazu; Muraji, Masafumi; Tsujimoto, Hiroaki; Azuma, Masayuki; Ooshima, Hiroshi

    The present paper describes a sensor for measuring the glucose concentration of yeast culture medium. The sensor determines glucose concentration by measuring the yield of hydrogen peroxide produced by glucose oxidase, which is monitored as luminescence using photomultiplier. The present sensor is able to measure low glucose concentration in media in which yeast cells keep respiration state. We herein describe the system and the characteristics of the glucose sensor.

  20. Kinetics of growth and sugar consumption in yeasts.

    Science.gov (United States)

    van Dijken, J P; Weusthuis, R A; Pronk, J T

    1993-01-01

    An overview is presented of the steady- and transient state kinetics of growth and formation of metabolic byproducts in yeasts. Saccharomyces cerevisiae is strongly inclined to perform alcoholic fermentation. Even under fully aerobic conditions, ethanol is produced by this yeast when sugars are present in excess. This so-called 'Crabtree effect' probably results from a multiplicity of factors, including the mode of sugar transport and the regulation of enzyme activities involved in respiration and alcoholic fermentation. The Crabtree effect in S. cerevisiae is not caused by an intrinsic inability to adjust its respiratory activity to high glycolytic fluxes. Under certain cultivation conditions, for example during growth in the presence of weak organic acids, very high respiration rates can be achieved by this yeast. S. cerevisiae is an exceptional yeast since, in contrast to most other species that are able to perform alcoholic fermentation, it can grow under strictly anaerobic conditions. 'Non-Saccharomyces' yeasts require a growth-limiting supply of oxygen (i.e. oxygen-limited growth conditions) to trigger alcoholic fermentation. However, complete absence of oxygen results in cessation of growth and therefore, ultimately, of alcoholic fermentation. Since it is very difficult to reproducibly achieve the right oxygen dosage in large-scale fermentations, non-Saccharomyces yeasts are therefore not suitable for large-scale alcoholic fermentation of sugar-containing waste streams. In these yeasts, alcoholic fermentation is also dependent on the type of sugar. For example, the facultatively fermentative yeast Candida utilis does not ferment maltose, not even under oxygen-limited growth conditions, although this disaccharide supports rapid oxidative growth.

  1. Checkpoint independence of most DNA replication origins in fission yeast

    OpenAIRE

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleo...

  2. Metabolic diversification of cells during the development of yeast colonies

    Czech Academy of Sciences Publication Activity Database

    Váchová, Libuše; Kučerová, Helena; Devaux, F.; Úlehlová, M.; Palková, Z.

    2009-01-01

    Roč. 11, č. 2 (2009), s. 494-504 ISSN 1462-2912 R&D Projects: GA ČR GA204/05/0294; GA ČR GA204/08/0718; GA MŠk(CZ) LC531 Grant - others:GB(GB) Howard Hughes Medical Institute International Research Award Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast * yeast colonies * saccharomyces cerevisiae Subject RIV: EE - Microbiology, Virology Impact factor: 4.909, year: 2009

  3. Heuristic Sensitivity Analysis for Baker's Yeast Model Parameters

    OpenAIRE

    Leão, Celina P.; Soares, Filomena O.

    2004-01-01

    The baker's yeast, essentially composed by living cells of Saccharomyces cerevisiae, used in the bread making and beer industries as a microorganism, has an important industrial role. The simulation procedure represents then a necessary tool to understand clearly the baker's yeast fermentation process. The use of mathematical models based on mass balance equations requires the knowledge of the reaction kinetics, thermodynamics, and transport and physical properties. Models may be more or less...

  4. The Yeast Deletion Collection: A Decade of Functional Genomics

    Science.gov (United States)

    Giaever, Guri; Nislow, Corey

    2014-01-01

    The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

  5. Guidelines and recommendations on yeast cell death nomenclature

    Directory of Open Access Journals (Sweden)

    Didac Carmona-Gutierrez

    2018-01-01

    Full Text Available Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research.

  6. Characterization of the interaction of yeast enolase with polynucleotides.

    Science.gov (United States)

    al-Giery, A G; Brewer, J M

    1992-09-23

    Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

  7. [Yeast microbiota in artisanal cheeses from Corrientes, Argentina].

    Science.gov (United States)

    Cardozo, Marina C; Fusco, Ángel J V; Carrasco, Marta S

    The artisanal cheese from Corrientes (from the Spanish acronym QAC-Queso Artesanal de Corrientes/Artisanal Cheese from Corrientes) is a soft cheese elaborated with raw cow milk and an artisanal coagulant agent. Lactic bacteria contitute the main flora of this cheese although yeasts are also present in high quantities as secondary microbiota and might play a relevant role in cheese ripening. The aim of this work was to evaluate yeast occurrence during QAC elaboration and ripening, and the effect of seasonal variation. Yeasts were isolated and purified from raw materials and cheese at different ripening stagesl elaborated during the different seasons. Yeast sample counts were in the order of 10 3 - 10 7 UFC/ml o UFC/g. Ninety yeast strains were classified: 9 from milk, 28 from the coagulant agent, 10 from curd and 43 from cheese. Candida predominated in milk samples while other yeast genera had low incidence. Candida also predominated in the coagulant agent samples, followed by genera Myxozyma and Debaryomyces. The isolates obtained from cheese belonged to the same genera predominating in the coagulant agent, and showed the same order of prevalence. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. The Slime Production by Yeasts Isolated from Subclinical Mastitic Cows

    Directory of Open Access Journals (Sweden)

    Süheyla Türkyılmaz

    2010-01-01

    Full Text Available The aim of this study was to isolate yeasts from subclinical mastitic cows and to investigate the slime production by the isolated yeasts. The material used in this study included 339 milk samples from 152 dairy cattle with subclinical mastitis. Milk was plated onto blood agar, MacConkey agar and Sabouraud dextrose agar. Forty-one samples (12.1% of total milk samples were found positive for the yeast by API 20 C AUX identification system. The isolated yeasts were classified into four genera of Candida, Trichosporon, Cryptococcus and Saccharomyces. The Candida species were following: C. krusei, C. kefyr, C. guilliermondii, C. famata, C. rugosa and C. utulis. Other yeasts were identified as Trichosporon mucoides, T. asahii, Cryptococcus laurentii, C.  neoformans and Saccharomyces cerevisiae. Slime production was tested on Congo red brain heart infusion agar and evaluated according to Congo red phenomenon. Fifteen (36.6% strains were slime factor positive: seven were C. krusei, four C. kefyr, one C. guilliermondii, one C. famata, one T. asahii, and one C. laurentii. The results of the present study indicate that yeast mastitis is significant for causing economic losses and slime production is mostly found in non-albicans Candida species. Therefore, non-albicans Candida species should be examined for slime production.

  9. Yeast synthetic biology for the production of recombinant therapeutic proteins.

    Science.gov (United States)

    Kim, Hyunah; Yoo, Su Jin; Kang, Hyun Ah

    2015-02-01

    The production of recombinant therapeutic proteins is one of the fast-growing areas of molecular medicine and currently plays an important role in treatment of several diseases. Yeasts are unicellular eukaryotic microbial host cells that offer unique advantages in producing biopharmaceutical proteins. Yeasts are capable of robust growth on simple media, readily accommodate genetic modifications, and incorporate typical eukaryotic post-translational modifications. Saccharomyces cerevisiae is a traditional baker's yeast that has been used as a major host for the production of biopharmaceuticals; however, several nonconventional yeast species including Hansenula polymorpha, Pichia pastoris, and Yarrowia lipolytica have gained increasing attention as alternative hosts for the industrial production of recombinant proteins. In this review, we address the established and emerging genetic tools and host strains suitable for recombinant protein production in various yeast expression systems, particularly focusing on current efforts toward synthetic biology approaches in developing yeast cell factories for the production of therapeutic recombinant proteins. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  10. Yeasts from Different Habitats and Their Potential as Biocontrol Agents

    Directory of Open Access Journals (Sweden)

    Julia Pretscher

    2018-04-01

    Full Text Available Ever since plant diseases began causing losses in viticulture, the control of phytopathogenic fungi has become of vital interest for winemakers. The occurrence of novel pests, fungicide resistance, and changed consumer expectations have led to an enormous demand for novel plant protection strategies. As part of integrated protection measures, antagonistic microorganisms have been investigated to a large extent. Such microorganisms can be applied not only in conventional, but also in organic farming as biological control agents (BCA. Particularly, yeasts were found to be interesting candidates for the development of BCA. Many of these eukaryotic microorganisms are found as part of the phylloplane microflora. In this study, we assessed a set of 38 yeast isolates from different habitats, including the guts of termites, for inhibitory effects against some phytopathogenic fungi that have received less attention in earlier studies. The majority of yeasts were found to interfere with fungi infecting grapevine (Eutypa lata, Botrytis cinerea, and Roesleria subterranea, stone fruits (Monilinia fructicola, or rice (Magnaporte oryzae, as well in vitro and in model experiment on fruits. Although most yeast strains secreted glycoside hydrolases and proteases, attempts to demonstrate direct antagonistic activities of lytic enzymes failed. However, in culture filtrates of the termite yeast Papiliotrema odontotermitis OO5, a low molecular thermostable antagonistic factor was detected. Iron depletion as a BCA mechanism was confirmed for strains of Metschnikowia pulcherrima but not for other yeasts.

  11. Immobilisation increases yeast cells' resistance to dehydration-rehydration treatment.

    Science.gov (United States)

    Borovikova, Diana; Rozenfelde, Linda; Pavlovska, Ilona; Rapoport, Alexander

    2014-08-20

    This study was performed with the goal of revealing if the dehydration procedure used in our new immobilisation method noticeably decreases the viability of yeast cells in immobilised preparations. Various yeasts were used in this research: Saccharomyces cerevisiae cells that were rather sensitive to dehydration and had been aerobically grown in an ethanol-containing medium, a recombinant strain of S. cerevisiae grown in aerobic conditions which were completely non-resistant to dehydration and an anaerobically grown bakers' yeast strain S. cerevisiae, as well as a fairly resistant Pichia pastoris strain. Experiments performed showed that immobilisation of all these strains essentially increased their resistance to a dehydration-rehydration treatment. The increase of cells' viability (compared with control cells dehydrated in similar conditions) was from 30 to 60%. It is concluded that a new immobilisation method, which includes a dehydration stage, does not lead to an essential loss of yeast cell viability. Correspondingly, there is no risk of losing the biotechnological activities of immobilised preparations. The possibility of producing dry, active yeast preparations is shown, for those strains that are very sensitive to dehydration and which can be used in biotechnology in an immobilised form. Finally, the immobilisation approach can be used for the development of efficient methods for the storage of recombinant yeast strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Yeast signaling pathways in the oxidative stress response

    Energy Technology Data Exchange (ETDEWEB)

    Ikner, Aminah [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States); Shiozaki, Kazuhiro [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States)]. E-mail: kshiozaki@ucdavis.edu

    2005-01-06

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed.

  13. Yeast signaling pathways in the oxidative stress response

    International Nuclear Information System (INIS)

    Ikner, Aminah; Shiozaki, Kazuhiro

    2005-01-01

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed

  14. Guidelines and recommendations on yeast cell death nomenclature

    Science.gov (United States)

    Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J.; Breitenbach, Michael; Burhans, William C.; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F.; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B.; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W.; Grant, Chris M.; Greenwood, Michael T.; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M.; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P.; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A.; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D.; Outeiro, Tiago F.; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F.; Sharon, Amir; Sigrist, Stephan J.; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M.; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B.; Tuite, Mick; Vögtle, F.-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J.; Zhao, Richard Y.; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

    2018-01-01

    Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research. PMID:29354647

  15. The relationship between salivary histatin levels and oral yeast carriage.

    Science.gov (United States)

    Jainkittivong, A; Johnson, D A; Yeh, C K

    1998-06-01

    Candida species are common commensal inhabitants of the oral cavity. Human saliva contains antifungal proteins called histatins. We tested the hypothesis that oral yeast status is related to salivary histatin levels. Thirty subjects were divided into two groups based on the presence (n = 15) or absence (n = 15) of yeast on oral mucosa surfaces. Unstimulated and stimulated submandibular and sublingual and parotid saliva was collected from each subject. Salivary flow rates were measured and histatin concentrations were determined in the stimulated saliva samples. The yeast colony positive group showed lower median unstimulated parotid saliva flow rates as well as lower median concentrations of total histatins in submandibular and sublingual saliva. There was a negative correlation between yeast colony-forming units and unstimulated parotid saliva flow rates and between yeast colony-forming units and submandibular and sublingual saliva histatin concentration and secretion. The results suggest that oral yeast status may be influenced by unstimulated parotid saliva flow rates and by submandibular and sublingual histatin concentration and secretion.

  16. The Fermentative and Aromatic Ability of Kloeckera and Hanseniaspora Yeasts

    Science.gov (United States)

    Díaz-Montaño, Dulce M.; de Jesús Ramírez Córdova, J.

    Spontaneous alcoholic fermentation from grape, agave and others musts into an alcoholic beverage is usually characterized by the presence of several non-Saccharomyces yeasts. These genera yeasts are dominant in the early stages of the alcoholic fermentation. However the genera Hanseniaspora and Kloeckera may survive at a significant level during fermentation and can influence the chemical composition of the beverage. Several strains belonging to the species Kloeckera api-culata and Hanseniaspora guilliermondii have been extensively studied in relation to the formation of some metabolic compounds affecting the bouquet of the final product. Indeed some apiculate yeast showed positive oenological properties and their use in the alcoholic fermentations has been suggested to enhance the aroma and flavor profiles. The non- Saccharomyces yeasts have the capability to produce and secrete enzymes in the medium, such as β -glucosidases, which release monoterpenes derived from their glycosylated form. These compounds contribute to the higher fruit-like characteristic of final product. This chapter reviews metabolic activity of Kloeckera and Hanseniaspora yeasts in several aspects: fermentative capability, aromatic compounds production and transformation of aromatic precursor present in the must, also covers the molecular methods for identifying of the yeast

  17. Prevalence of candida and non-candida yeasts isolated from patients with yeast fungal infections in Tehran labs

    Directory of Open Access Journals (Sweden)

    Hashemi SJ

    2011-04-01

    Full Text Available "n 800x600 Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Background: Infections caused by opportunistic yeasts such as Candida species, Trichosporon, Rhodotorula and Saccharomyces have increased in immunocompromis-ed patients and their identification is crucial as intrinsic and acquired resistance of some yeast species to antifungal agents are on the rise. The aim of this study was to identify the organisms to the species level in order to suggest accurate and effective antifungal therapies."n"nMethods: In this study that carried out in Tehran, Iran in 2009, 200 patients with yeast infection were medically examined and clinical specimens were prepared for direct examination and culture on Sabouraud dextrose agar. Subsequently, the isolated yeast colonies were identified using various tests including culture on Corn Meal agar with Tween 80, CHROMagar Candida and casein agar. For the definite identification of organisms some biochemical tests were done based on carbohydrate assimilation by RapID Yeast Plus System kit, and, finally, a molecular method, PCR-RFLP, using Hpa II enzyme, was performed for the remaining unknown yeast species."n"nResults: A total of 211 yeast isolates were identified in 200 patients with yeast infections. The most frequent isolated yeasts were Candida albicans, 124 (58.77%, followed by Candida parapsilosis, 36 (17.06%, Candida tropicalis, 17 (8.06%, Candida glabrata, 13 (6.16%, Candida krusei, 8 (3.79%, Candida guilliermondii, 2 (0.96%, Trichosporon, 3 (1.14%, Rhodotorula, 1 (0.47%, Saccaromyces cerevisiae, 1 (0.47% and other

  18. Instrumental neutron activation analysis of brewer's yeast

    International Nuclear Information System (INIS)

    Bergerioux, C.; Zikovsky, L.

    1978-01-01

    Instrumental neutron activation was used for the determination of 23 trace and minor elements in 4 different samples of brewer's yeast. Detection limits vary from 2 ppb to 100 ppm. The following average concentrations were found (ppm, dry weight): Al 597, Br 0.36, Cl 1473, Co 0.21, Cu 19, Fe 285, K 16400, Mg 1355, Mn 8.4, Na 2330, Rb 19, Sb 0.053, Se 1.2, V 2.2 and Zn 80. NBS standard 1569 was also analyzed and the following concentrations (in ppm) were measured: Al 2300, Br 0.65, Ce 0.23, Cl 460, Co 0.26, Cr 2.12, Cu 11, Fe 707, Gd 7.1, Hf 0.13, K 15500, Mg 1780, Mn 7, Na 510, Rb 16, Sb 0.075, Sc 0.18, Se 0.92, Th 3.7, Ti 38, U 0.49, V 4.1 and Zn 70. (author)

  19. X-ray irradiation of yeast cells

    Science.gov (United States)

    Masini, Alessandra; Batani, Dimitri; Previdi, Fabio; Conti, Aldo; Pisani, Francesca; Botto, Cesare; Bortolotto, Fulvia; Torsiello, Flavia; Turcu, I. C. Edmond; Allott, Ric M.; Lisi, Nicola; Milani, Marziale; Costato, Michele; Pozzi, Achille; Koenig, Michel

    1997-10-01

    Saccharomyces Cerevisiae yeast cells were irradiated using the soft X-ray laser-plasma source at Rutherford Laboratory. The aim was to produce a selective damage of enzyme metabolic activity at the wall and membrane level (responsible for fermentation) without interfering with respiration (taking place in mitochondria) and with nuclear and DNA activity. The source was calibrated by PIN diodes and X-ray spectrometers. Teflon stripes were chosen as targets for the UV laser, emitting X-rays at about 0.9 keV, characterized by a very large decay exponent in biological matter. X-ray doses to the different cell compartments were calculated following a Lambert-Bouguet-Beer law. After irradiation, the selective damage to metabolic activity at the membrane level was measured by monitoring CO2 production with pressure silicon detectors. Preliminary results gave evidence of pressure reduction for irradiated samples and non-linear response to doses. Also metabolic oscillations were evidenced in cell suspensions and it was shown that X-ray irradiation changed the oscillation frequency.

  20. Computational Modeling of Lipid Metabolism in Yeast

    Directory of Open Access Journals (Sweden)

    Vera Schützhold

    2016-09-01

    Full Text Available Lipid metabolism is essential for all major cell functions and has recently gained increasing attention in research and health studies. However, mathematical modeling by means of classical approaches such as stoichiometric networks and ordinary differential equation systems has not yet provided satisfactory insights, due to the complexity of lipid metabolism characterized by many different species with only slight differences and by promiscuous multifunctional enzymes.Here, we present a object-oriented stochastic model approach as a way to cope with the complex lipid metabolic network. While all lipid species are treated objects in the model, they can be modified by the respective converting reactions based on reaction rules, a hybrid method that integrates benefits of agent-based and classical stochastic simulation. This approach allows to follow the dynamics of all lipid species with different fatty acids, different degrees of saturation and different headgroups over time and to analyze the effect of parameter changes, potential mutations in the catalyzing enzymes or provision of different precursors. Applied to yeast metabolism during one cell cycle period, we could analyze the distribution of all lipids to the various membranes in time-dependent manner.The presented approach allows to efficiently treat the complexity of cellular lipid metabolism and to derive conclusions on the time- and location-dependent distributions of lipid species and their properties such as saturation. It is widely applicable, easily extendable and will provide further insights in healthy and diseased states of cell metabolism.