WorldWideScience

Sample records for carbon degradation pathways

  1. Use of dual carbon-chlorine isotope analysis to assess the degradation pathways of 1,1,1-trichloroethane in groundwater.

    Science.gov (United States)

    Palau, Jordi; Jamin, Pierre; Badin, Alice; Vanhecke, Nicolas; Haerens, Bruno; Brouyère, Serge; Hunkeler, Daniel

    2016-04-01

    Compound-specific isotope analysis (CSIA) is a powerful tool to track contaminant fate in groundwater. However, the application of CSIA to chlorinated ethanes has received little attention so far. These compounds are toxic and prevalent groundwater contaminants of environmental concern. The high susceptibility of chlorinated ethanes like 1,1,1-trichloroethane (1,1,1-TCA) to be transformed via different competing pathways (biotic and abiotic) complicates the assessment of their fate in the subsurface. In this study, the use of a dual C-Cl isotope approach to identify the active degradation pathways of 1,1,1-TCA is evaluated for the first time in an aerobic aquifer impacted by 1,1,1-TCA and trichloroethylene (TCE) with concentrations of up to 20 mg/L and 3.4 mg/L, respectively. The reaction-specific dual carbon-chlorine (C-Cl) isotope trends determined in a recent laboratory study illustrated the potential of a dual isotope approach to identify contaminant degradation pathways of 1,1,1-TCA. Compared to the dual isotope slopes (Δδ(13)C/Δδ(37)Cl) previously determined in the laboratory for dehydrohalogenation/hydrolysis (DH/HY, 0.33 ± 0.04) and oxidation by persulfate (∞), the slope determined from field samples (0.6 ± 0.2, r(2) = 0.75) is closer to the one observed for DH/HY, pointing to DH/HY as the predominant degradation pathway of 1,1,1-TCA in the aquifer. The observed deviation could be explained by a minor contribution of additional degradation processes. This result, along with the little degradation of TCE determined from isotope measurements, confirmed that 1,1,1-TCA is the main source of the 1,1-dichlorethylene (1,1-DCE) detected in the aquifer with concentrations of up to 10 mg/L. This study demonstrates that a dual C-Cl isotope approach can strongly improve the qualitative and quantitative assessment of 1,1,1-TCA degradation processes in the field. PMID:26874254

  2. Lysosome: regulator of lipid degradation pathways

    OpenAIRE

    Settembre, Carmine; Ballabio, Andrea

    2014-01-01

    Autophagy is a catabolic pathway that has a fundamental role in the adaptation to fasting and primarily relies on the activity of the endolysosomal system, to which the autophagosome targets substrates for degradation. Recent studies have revealed that the lysosomal–autophagic pathway plays an important part in the early steps of lipid degradation. In this review, we discuss the transcriptional mechanisms underlying co-regulation between lysosome, autophagy, and other steps of lipid catabolis...

  3. Structure of PhnP: a phosphodiesterase of the carbon-phosphorous lyase pathway for phosphonate degradation

    DEFF Research Database (Denmark)

    Podzelinska, Kateryna; He, Shu-Mei; Wathier, Matthew;

    2009-01-01

    Carbon-phosphorus lyase is a multienzyme system encoded by the phn operon that enables bacteria to metabolize organophosphonates when the preferred nutrient, inorganic phosphate, is scarce. One of the enzymes encoded by this operon, PhnP, is predicted by sequence homology to be a metal-dependent ...

  4. Degradation of endogenous hepatic heme by pathways not yielding carbon monoxide. Studies in normal rat liver and in primary hepatocyte culture.

    OpenAIRE

    Bissell, D. M.; Guzelian, P S

    1980-01-01

    The conversion of endogenous hepatic heme to bilirubin and CO is established. However, it is unknown whether this process is quantitative or whether heme may be degraded to other products as well. To study this question, we administered the heme precursor, delta-amino-[5-14C]levulinic acid to rats in vivo. In liver, [14C]heme was predominately associated with microsomal cytochromes, and its degradation was examined over a period of 12--14 h; concurrently, excretion of labeled carbon monoxide ...

  5. Proteogenomic Characterization of Monocyclic Aromatic Hydrocarbon Degradation Pathways in the Aniline-Degrading Bacterium Burkholderia sp. K24

    Science.gov (United States)

    Yun, Sung Ho; Choi, Chi-Won; Yi, Yoon-Sun; Kim, Jonghyun; Chung, Young-Ho; Park, Edmond Changkyun; Kim, Seung Il

    2016-01-01

    Burkholderia sp. K24, formerly known as Acinetobacter lwoffii K24, is a soil bacterium capable of utilizing aniline as its sole carbon and nitrogen source. Genomic sequence analysis revealed that this bacterium possesses putative gene clusters for biodegradation of various monocyclic aromatic hydrocarbons (MAHs), including benzene, toluene, and xylene (BTX), as well as aniline. We verified the proposed MAH biodegradation pathways by dioxygenase activity assays, RT-PCR, and LC/MS-based quantitative proteomic analyses. This proteogenomic approach revealed four independent degradation pathways, all converging into the citric acid cycle. Aniline and p-hydroxybenzoate degradation pathways converged into the β-ketoadipate pathway. Benzoate and toluene were degraded through the benzoyl-CoA degradation pathway. The xylene isomers, i.e., o-, m-, and p-xylene, were degraded via the extradiol cleavage pathways. Salicylate was degraded through the gentisate degradation pathway. Our results show that Burkholderia sp. K24 possesses versatile biodegradation pathways, which may be employed for efficient bioremediation of aniline and BTX. PMID:27124467

  6. Improving Carbon Fixation Pathways

    OpenAIRE

    Ducat, Daniel C.; Silver, Pamela A.

    2012-01-01

    A recent resurgence in basic and applied research on photosynthesis has been driven in part by recognition that fulfilling future food and energy requirements will necessitate improvements in crop carbon-fixation efficiencies. Photosynthesis in traditional terrestrial crops is being reexamined in light of molecular strategies employed by photosynthetic microbes to enhance the activity of the Calvin cycle. Synthetic biology is well-situated to provide original approaches for compartmentalizing...

  7. Degradation of multiwall carbon nanotubes by bacteria

    International Nuclear Information System (INIS)

    Understanding the environmental transformation of multiwall carbon nanotubes (MWCNTs) is important to their life cycle assessment and potential environmental impacts. We report that a bacterial community is capable of degrading 14C-labeled MWCNTs into 14CO2 in the presence of an external carbon source via co-metabolism. Multiple intermediate products were detected, and genotypic characterization revealed three possible microbial degraders: Burkholderia kururiensis, Delftia acidovorans, and Stenotrophomonas maltophilia. This result suggests that microbe/MWCNTs interaction may impact the long-term fate of MWCNTs. Highlights: •Mineralization of MWCNTs by a bacterial community was observed. •The mineralization required an external carbon source. •Multiple intermediate products were identified in the MWCNT degrading culture. •Three bacterial species were found likely responsible for MWCNT degradation. -- The 14C-labeled multiwall carbon nanotubes can be degraded to 14CO2 and other byproducts by a bacteria community under natural conditions

  8. Fluvial carbon dynamics in degraded peatland catchments

    OpenAIRE

    Stimson, Andrew Graham

    2016-01-01

    Inland waters including streams, rivers, reservoirs and lakes are regarded as a significant site of Organic Carbon (OC) cycling, and greenhouse gas production. As a result, there has been significant recent interest in the rates and fate of fluvial carbon exported from organic soils, such as peatlands. Additionally, peatlands can be subject to substantial degradation resulting in high rates of fluvial OC export, and this has led to efforts to repair degraded peatlands through restoration pr...

  9. Characterization of a novel oxyfluorfen-degrading bacterial strain Chryseobacterium aquifrigidense and its biochemical degradation pathway.

    Science.gov (United States)

    Zhao, Huanhuan; Xu, Jun; Dong, Fengshou; Liu, Xingang; Wu, Yanbing; Wu, Xiaohu; Zheng, Yongquan

    2016-08-01

    Persistent use of the diphenyl ether herbicides oxyfluorfen may seriously increase the health risks and ecological safety problems. A newly bacterium R-21 isolated from active soil was able to degrade and utilize oxyfluorfen as the sole carbon source. R-21 was identified as Chryseobacterium aquifrigidense by morphology, physiobiochemical characteristics, and genetic analysis. Under the optimum cultural conditions (pH 6.9, temperature 33.4 °C, and inoculum size 0.2 g L(-1)), R-21 could degrade 92.1 % of oxyfluorfen at 50 mg L(-1) within 5 days. During oxyfluorfen degradation, six metabolites were detected and identified by atmospheric pressure gas chromatography coupled to quadrupole-time of flight mass spectrometry and ultra-performance liquid chromatography coupled to quadrupole-time of flight mass spectrometry, and a plausible degradation pathway was deduced. Strain R-21 is a promising potential in bioremediation of oxyfluorfen-contaminated environments. PMID:27079576

  10. Photo-fenton degradation of diclofenac: identification of main intermediates and degradation pathway.

    Science.gov (United States)

    Pérez-Estrada, Leónidas A; Malato, Sixto; Gernjak, Wolfgang; Agüera, Ana; Thurman, E Michael; Ferrer, Imma; Fernández-Alba, Amadeo R

    2005-11-01

    In recent years, the presence of pharmaceuticals in the aquatic environment has been of growing interest. These new contaminants are important because many of them are not degraded under the typical biological treatments applied in the wastewater treatment plants and represent a continuous input into the environment. Thus, compounds such as diclofenac are present in surface waters in all Europe and a crucial need for more enhanced technologies that can reduce its presence in the environment has become evident. In this sense, advanced oxidation processes (AOPs) represent a good choice for the treatment of hazardous nonbiodegradable pollutants. This work deals with the solar photodegradation of diclofenac, an antiinflammatory drug, in aqueous solutions by photo-Fenton reaction. A pilot-scale facility using a compound parabolic collector (CPC) reactor was used for this study. Results obtained show rapid and complete oxidation of diclofenac after 60 min, and total mineralization (disappearance of dissolved organic carbon, DOC) after 100 min of exposure to sunlight. Although diclofenac precipitates during the process at low pH, its degradation takes place in the homogeneous phase governed by a precipitation-redissolution-degradation process. Establishment of the reaction pathway was made possible by a thorough analysis of the reaction mixture identifying the main intermediate products generated. Gas chromatography-mass spectrometry (GC/ MS) and liquid chromatography coupled with time-of-flight mass spectrometry (LC/TOF-MS) were used to identify 18 intermediates, in two tentative degradation routes. The main one was based on the initial hydroxylation of the phenylacetic acid moiety in the C-4 position and subsequent formation of a quinone imine derivative that was the starting point for further multistep degradation involving hydroxylation, decarboxylation, and oxidation reactions. An alternative route was based on the transient preservation of the biphenyl amino moiety

  11. Microbial PAH-Degradation in Soil: Degradation Pathways and Contributing Factors

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xu-Xiang; CHENG Shu-Pei; ZHU Cheng-Jun; SUN Shi-Lei

    2006-01-01

    Adverse effects on the environment and high persistence in the microbial degradation and environmental fate of polycyclic aromatic hydrocarbons (PAHs) are motivating interest. Many soil microorganisms can degrade PAHs and use various metabolic pathways to do so. However, both the physio-chemical characteristics of compounds as well as the physical, chemical, and biological properties of soils can drastically influence the degradation capacity of naturally occurring microorganisms for field bioremediation. Modern biological techniques have been widely used to promote the efficiency of microbial PAH-degradation and make the biodegradation metabolic pathways more clear. In this review microbial degradation of PAHs in soil is discussed, with emphasis placed on the main degradation pathways and the environmental factors affecting biodegradation.

  12. Enzymatic description of the anhydrofructose pathway of glycogen degradation. I

    DEFF Research Database (Denmark)

    Yu, Shukun; Refdahl, Charlotte; Lundt, Inge

    2004-01-01

    The anhydrofructose pathway describes the degradation of glycogen and starch to metabolites via 1,5-anhydro-D-fructose (1,5AnFru). The enzyme catalyzing the first reaction step of this pathway, i.e., a-1,4-glucan lyase (EC 4.2.1.13), has been purified, cloned and characterized from fungi and red ...

  13. Metabolic pathway engineering of the toluene degradation pathway

    OpenAIRE

    Regan, L.

    1995-01-01

    This thesis addresses the problem of how to examine a metabolic pathway and identify what are the key elements, specifically with respect to rate-limitation. The aim is to be able to analyze a pathway, identify the bottlenecks and implement genetic modifications to remove these bottlenecks. This is done by defining the system of interest and developing a predictive model using kinetic data. The model predictions can then be verified using fermentation data and genetic technique...

  14. Phenanthrene-degrading pathway of Agrobacterium sp. Phx1

    Institute of Scientific and Technical Information of China (English)

    ZHANG Lei; YUAN Hongli; WANG Shuangqing; HUANG Huaizeng

    2005-01-01

    The metabolic pathway of phenanthrene-degrading strain Agrobacterium sp. Phx1 was investigated. Phx1 almost was able to transform 100 υg/mL of phenanthrene completely in 1 day in broth media of beef extract-peptone (BP), Luria-Bertani (LB) and mineral salts media (MS), and LB and BP could promote the growth and degradation efficiency of Phx1. The GC-MS was employed to analyze the metabolites of the 1st, 3rd, 7th days of phenanthrene degradation in MS. As a result, the 1-Hydroxy-2-naphthoic acid (1H2N) and 1-naphthol (NOL) were detected in the metabolites of the 1st day. Only NOL was observed on the 3rd day and it disappeared on the 7th day. The accumulated NOL did not pertain to the defined pathway of phenanthrene degradation by bacteria. The further HPLC study confirmed the finding in GC-MS analysis and found the production of catechol (CAT) from o-phthalic acid (OPA) in the phenanthrene metabolizing, which has never been reported in the defined degrading pathways. This production was also evidenced by the production of CAT using OPA as substrate. All of our results showed that the Agrobacterium sp. Phx1 had a novel phenanthrene-degrading pathway.

  15. Metabolic pathway for degradation of 2-chloro-4-aminophenol by Arthrobacter sp. SPG

    OpenAIRE

    Arora, Pankaj Kumar; Mohanta, Tapan Kumar; Srivastava, Alok; Bae, Hanhong; Singh, Vijay Pal

    2014-01-01

    A degradation pathway of 2-chloro-4-aminophenol (2C4AP) was studied in an Arthrobacter sp. SPG that utilized 2C4AP as its sole source of carbon and energy. The 2C4AP degradation was initiated by a 2C4AP-deaminase that catalyzed the conversion of 2C4AP into chlorohydroquinone (CHQ) with removal of ammonium ion. In the next step, a CHQ-dehalogenase dehalogenated CHQ to hydroquinone (HQ) that cleaved into γ-hydroxymuconic semialdehyde by a HQ-dioxygenase. The 2C4AP degradation was also investiga...

  16. Growth of carbon nanotubes on carbon fibers without strength degradation

    Energy Technology Data Exchange (ETDEWEB)

    De Greef, Niels [Department of Metallurgy and Materials Engineering, KU Leuven, Kasteelpark Arenberg 44, B-3001 Heverlee (Belgium); Magrez, Arnaud; Forro, Laszlo [Institute of Condensed Matter Physics, Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Couteau, Edina; Locquet, Jean-Pierre [Laboratory of Solid-State Physics and Magnetism, KU Leuven, Celestijnenlaan 200D, B-3001 Heverlee (Belgium); Seo, Jin Won [Department of Metallurgy and Materials Engineering, KU Leuven, Kasteelpark Arenberg 44, B-3001 Heverlee (Belgium); Institute of Condensed Matter Physics, Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2012-12-15

    Carbon nanotubes (CNTs) are grown on PAN-based carbon fibers by means of catalytic chemical vapor deposition technique. By using catalytic thermal decomposition of hydrocarbon, CNTs can be grown in the temperature range of 650-750 C. However, carbon fibers suffer significant damages resulting in decrease of initial tensile strength. By applying the oxidative dehydrogenation reaction of C{sub 2}H{sub 2} with CO{sub 2}, we found an alternative way to grow CNTs on carbon fibers at low temperatures, such as 500 C. Scanning electron microscope results combined with single fiber tests indicate that this low temperature growth enables homogeneous grafting of CNTs onto carbon fibers without degradation of tensile strength. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. Trichloroethylene degradation by two independent aromatic-degrading pathways in Alcaligenes eutrophus JMP134.

    OpenAIRE

    Harker, A R; Kim, Y.

    1990-01-01

    The bacterium Alcaligenes eutrophus JMP134(pJP4) degrades trichloroethylene (TCE) by a chromosomal phenol-dependent pathway and by the plasmid-encoded 2,4-dichlorophenoxyacetic acid pathway. The two pathways were independent and exhibited different rates of removal and capacities for quantity of TCE removed. The phenol-dependent pathway was more rapid (0.2 versus 0.06 nmol of TCE removed per min per mg of protein) and consumed all detectable TCE. The 2,4-dichlorophenoxyacetic acid-dependent p...

  18. Enzyme-catalyzed degradation of carbon nanomaterials

    Science.gov (United States)

    Kotchey, Gregg P.

    Carbon nanotubes and graphene, the nanoscale sp 2 allotropes of carbon, have garnered widespread attention as a result of their remarkable electrical, mechanical, and optical properties and the promise of new technologies that harness these properties. Consequently, these carbon nanomaterials (CNMs) have been employed for diverse applications such as electronics, sensors, composite materials, energy conversion devices, and nanomedicine. The manufacture and eventual disposal of these products may result in the release of CNMs into the environment and subsequent exposure to humans, animals, and vegetation. Given the possible pro-inflammatory and toxic effects of CNMs, much attention has been focused on the distribution, toxicity, and persistence of CNMs both in living systems and the environment. This dissertation will guide the reader though recent studies aimed at elucidating fundamental insight into the persistence of CNMs such as carbon nanotubes (CNTs) and graphene derivatives (i.e., graphene oxide and reduced graphene oxide). In particular, in-testtube oxidation/degradation of CNMs catalyzed by peroxidase enzymes will be examined, and the current understanding of the mechanisms underlying these processes will be discussed. Finally, an outlook of the current field including in vitro and in vivo biodegradation experiments, which have benefits in terms of human health and environmental safety, and future directions that could have implications for nanomedical applications such as imaging and drug delivery will be presented. Armed with an understanding of how and why CNMs undergo enzyme-catalyzed oxidation/biodegradation, researchers can tailor the structure of CNMs to either promote or inhibit these processes. For example, in nanomedical applications such as drug delivery, the incorporation of carboxylate functional groups could facilitate biodegradation of the nanomaterial after delivery of the cargo. Also, the incorporation of CNMs with defect sites in consumer

  19. Autophagy: a pathway that contributes to connexin degradation

    OpenAIRE

    Lichtenstein, Alexandra; Minogue, Peter J.; Beyer, Eric C.; Berthoud, Viviana M.

    2011-01-01

    The function of connexins, which form gap junctions, can be rapidly modulated by degradation, because they have half-lives of only a few hours. Autophagy is a degradation pathway that has been implicated in several diseases and can be induced by cellular stresses such as starvation. We investigated the involvement of autophagy in proteolysis of the wild-type connexins CX50 and CX43, and a cataract-associated connexin mutant, CX50P88S, which forms cytoplasmic accumulations. We observed that cy...

  20. Vacuole import and degradation pathway:Insights into a specialized autophagy pathway

    Institute of Scientific and Technical Information of China (English)

    Abbas; A; Alibhoy; Hui-Ling; Chiang

    2011-01-01

    Glucose deprivation induces the synthesis of pivotagluconeogenic enzymes such as fructose-1,6-bisphos-phatase, malate dehydrogenase, phosphoenolpyruvatecarboxykinase and isocitrate lyase in Saccharomycescerevisiae. However, following glucose replenishment,these gluconeogenic enzymes are inactivated and de-graded. Studies have characterized the mechanismsby which these enzymes are inactivated in response toglucose. The site of degradation of these proteins hasalso been ascertained to be dependent on the dura-tion of starvation. Glucose replenishment of short-termstarved cells results in these proteins being degradedin the proteasome. In contrast, addition of glucose tocells starved for a prolonged period results in theseproteins being degraded in the vacuole. In the vacuoledependent pathway, these proteins are sequestered inspecialized vesicles termed vacuole import and degra-dation (Vid). These vesicles converge with the endo-cytic pathway and deliver their cargo to the vacuolefor degradation. Recent studies have identified thatinternalization, as mediated by actin polymerization, isessential for delivery of cargo proteins to the vacuolefor degradation. In addition, components of the targetof rapamycin complex 1 interact with cargo proteins during glucose starvation. Furthermore, Tor1p dissoci-ates from cargo proteins following glucose replenish-ment. Future studies will be needed to elaborate on the importance of internalization at the plasma membrane and the subsequent import of cargo proteins into Vid vesicles in the vacuole dependent degradation pathway.

  1. Enzymatic description of the anhydrofructose pathway of glycogen degradation. I

    DEFF Research Database (Denmark)

    Yu, Shukun; Refdahl, Charlotte; Lundt, Inge

    2004-01-01

    The anhydrofructose pathway describes the degradation of glycogen and starch to metabolites via 1,5-anhydro-D-fructose (1,5AnFru). The enzyme catalyzing the first reaction step of this pathway, i.e., a-1,4-glucan lyase (EC 4.2.1.13), has been purified, cloned and characterized from fungi and red...... algae in our laboratory earlier. In the present study, two 1,5AnFru metabolizing enzymes were discovered in the fungus Anthracobia melaloma for the formation of ascopyrone P (APP), a fungal secondary metabolite exhibiting antibacterial and antioxidant activity. These are 1,5AnFru dehydratase (AFDH) and...

  2. Kynurenine pathway in psychosis: evidence of increased tryptophan degradation.

    LENUS (Irish Health Repository)

    Barry, Sandra

    2009-05-01

    The kynurenine pathway of tryptophan degradation may serve to integrate disparate abnormalities heretofore identified in research aiming to elucidate the complex aetiopathogenesis of psychotic disorders. Post-mortem brain tissue studies have reported elevated kynurenine and kynurenic acid in the frontal cortex and upregulation of the first step of the pathway in the anterior cingulate cortex of individuals with schizophrenia. In this study, we examined kynurenine pathway activity by measuring tryptophan breakdown, a number of pathway metabolites and interferon gamma (IFN-gamma), which is the preferential activator of the first-step enzyme, indoleamine dioxygenase (IDO), in the plasma of patients with major psychotic disorder. Plasma tryptophan, kynurenine pathway metabolites were measured using high-performance liquid chromatography (HPLC) in 34 patients with a diagnosis on the psychotic spectrum (schizophrenia or schizoaffective disorder) and in 36 healthy control subjects. IFN-gamma was measured using enzyme-linked immunosorbent assay (ELISA). The mean tryptophan breakdown index (kynurenine\\/tryptophan) was significantly higher in the patient group compared with controls (P < 0.05). IFN-gamma measures did not differ between groups (P = 0.23). No relationship was found between measures of psychopathology, symptom severity and activity in the first step in the pathway. A modest correlation was established between the tryptophan breakdown index and illness duration. These results provide evidence for kynurenine pathway upregulation, specifically involving the first enzymatic step, in patients with major psychotic disorder. Increased tryptophan degradation in psychoses may have potential consequences for the treatment of these disorders by informing the development of novel therapeutic compounds.

  3. Iodinated contrast media electro-degradation: Process performance and degradation pathways

    Energy Technology Data Exchange (ETDEWEB)

    Del Moro, Guido; Pastore, Carlo; Di Iaconi, Claudio; Mascolo, Giuseppe, E-mail: giuseppe.mascolo@ba.irsa.cnr.it

    2015-02-15

    The electrochemical degradation of six of the most widely used iodinated contrast media was investigated. Batch experiments were performed under constant current conditions using two DSA® electrodes (titanium coated with a proprietary and patented mixed metal oxide solution of precious metals such as iridium, ruthenium, platinum, rhodium and tantalum). The degradation removal never fell below 85% (at a current density of 64 mA/cm{sup 2} with a reaction time of 150 min) when perchlorate was used as the supporting electrolyte; however, when sulphate was used, the degradation performance was above 80% (at a current density of 64 mA/cm{sup 2} with a reaction time of 150 min) for all of the compounds studied. Three main degradation pathways were identified, namely, the reductive de-iodination of the aromatic ring, the reduction of alkyl aromatic amides to simple amides and the de-acylation of N-aromatic amides to produce aromatic amines. However, as amidotrizoate is an aromatic carboxylate, this is added via the decarboxylation reaction. The investigation did not reveal toxicity except for the lower current density used, which has shown a modest toxicity, most likely for some reaction intermediates that are not further degraded. In order to obtain total removal of the contrast media, it was necessary to employ a current intensity between 118 and 182 mA/cm{sup 2} with energy consumption higher than 370 kWh/m{sup 3}. Overall, the electrochemical degradation was revealed to be a reliable process for the treatment of iodinated contrast media that can be found in contaminated waters such as hospital wastewater or pharmaceutical waste-contaminated streams. - Highlights: • The electrochemical degradation of six iodinated contrast media were investigated. • Treatment feasibility as well as reaction by-products and toxicity were investigated. • In all the investigated cases, the removal efficiency was higher than 80%. • Two main degradation pathways were identified.

  4. Iodinated contrast media electro-degradation: Process performance and degradation pathways

    International Nuclear Information System (INIS)

    The electrochemical degradation of six of the most widely used iodinated contrast media was investigated. Batch experiments were performed under constant current conditions using two DSA® electrodes (titanium coated with a proprietary and patented mixed metal oxide solution of precious metals such as iridium, ruthenium, platinum, rhodium and tantalum). The degradation removal never fell below 85% (at a current density of 64 mA/cm2 with a reaction time of 150 min) when perchlorate was used as the supporting electrolyte; however, when sulphate was used, the degradation performance was above 80% (at a current density of 64 mA/cm2 with a reaction time of 150 min) for all of the compounds studied. Three main degradation pathways were identified, namely, the reductive de-iodination of the aromatic ring, the reduction of alkyl aromatic amides to simple amides and the de-acylation of N-aromatic amides to produce aromatic amines. However, as amidotrizoate is an aromatic carboxylate, this is added via the decarboxylation reaction. The investigation did not reveal toxicity except for the lower current density used, which has shown a modest toxicity, most likely for some reaction intermediates that are not further degraded. In order to obtain total removal of the contrast media, it was necessary to employ a current intensity between 118 and 182 mA/cm2 with energy consumption higher than 370 kWh/m3. Overall, the electrochemical degradation was revealed to be a reliable process for the treatment of iodinated contrast media that can be found in contaminated waters such as hospital wastewater or pharmaceutical waste-contaminated streams. - Highlights: • The electrochemical degradation of six iodinated contrast media were investigated. • Treatment feasibility as well as reaction by-products and toxicity were investigated. • In all the investigated cases, the removal efficiency was higher than 80%. • Two main degradation pathways were identified

  5. Combination of degradation pathways for naphthalene utilization in Rhodococcus sp. strain TFB.

    Science.gov (United States)

    Tomás-Gallardo, Laura; Gómez-Álvarez, Helena; Santero, Eduardo; Floriano, Belén

    2014-03-01

    Rhodococcus sp. strain TFB is a metabolic versatile bacterium able to grow on naphthalene as the only carbon and energy source. Applying proteomic, genetic and biochemical approaches, we propose in this paper that, at least, three coordinated but independently regulated set of genes are combined to degrade naphthalene in TFB. First, proteins involved in tetralin degradation are also induced by naphthalene and may carry out its conversion to salicylaldehyde. This is the only part of the naphthalene degradation pathway showing glucose catabolite repression. Second, a salicylaldehyde dehydrogenase activity that converts salicylaldehyde to salicylate is detected in naphthalene-grown cells but not in tetralin- or salicylate-grown cells. Finally, we describe the chromosomally located nag genes, encoding the gentisate pathway for salicylate conversion into fumarate and pyruvate, which are only induced by salicylate and not by naphthalene. This work shows how biodegradation pathways in Rhodococcus sp. strain TFB could be assembled using elements from different pathways mainly because of the laxity of the regulatory systems and the broad specificity of the catabolic enzymes. PMID:24325207

  6. Degradation changes stable carbon isotope depth profiles in palsa peatlands

    Directory of Open Access Journals (Sweden)

    J. P. Krüger

    2014-01-01

    Full Text Available Palsa peatlands are a significant carbon pool in the global carbon cycle and are projected to change by global warming due to accelerated permafrost thaw. Our aim was to use stable carbon isotopes as indicators of palsa degradation. Depth profiles of stable carbon isotopes generally reflect organic matter dynamics in soils with an increase of δ13C values during aerobic decomposition and stable or decreasing δ13C values with depth during anaerobic decomposition. Stable carbon isotope depth profiles of undisturbed and degraded sites of hummocks as well as hollows at three palsa peatlands in northern Sweden were used to investigate the degradation processes. The depth patterns of stable isotopes clearly differ between intact and degraded hummocks at all sites. Erosion and cryoturbation at the degraded sites significantly changes the stable carbon isotope depth profiles. At the intact hummocks the uplifting of peat material by permafrost is indicated by a turning in the δ13C depth trend and this assessment is supported by a change in the C / N ratios. For hollows isotope patterns were less clear, but some hollows and degraded hollows in the palsa peatlands show differences in their stable carbon isotope depth profiles indicating enhanced degradation rates. We conclude that the degradation of palsa peatlands by accelerated permafrost thawing could be identified with stable carbon isotope depth profiles. At intact hummocks δ13C depth patterns display the uplifting of peat material by a change in peat decomposition processes.

  7. E1AF degradation by a ubiquitin-proteasome pathway

    International Nuclear Information System (INIS)

    E1AF is a member of the ETS family of transcription factors. In mammary tumors, overexpression of E1AF is associated with tumorigenesis, but E1AF protein has hardly been detected and its degradation mechanism is not yet clear. Here we show that E1AF protein is stabilized by treatment with the 26S protease inhibitor MG132. We found that E1AF was modified by ubiquitin through the C-terminal region and ubiquitinated E1AF aggregated in nuclear dots, and that the inhibition of proteasome-activated transcription from E1AF target promoters. These results suggest that E1AF is degraded via the ubiquitin-proteasome pathway, which has some effect on E1AF function

  8. New metabolic pathway for degradation of 2-nitrobenzoate by Arthrobacter sp. SPG

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Arora

    2015-06-01

    Full Text Available Arthrobacter sp. SPG utilized 2-nitrobenzoate as its sole source of carbon and energy and degraded it with accumulation of stoichiometric amounts of nitrite ions. Salicylate and catechol were detected as metabolites of the 2-nitrobenzoate degradation using high performance liquid chromatography and gas chromatography-mass spectrometry. Enzyme activities for 2-nitrobenzoate-2-monooxygenase, salicylate hydroxylase, and catechol-1,2-dioxygenase were detected in the crude extracts of the 2-nitrobenzoate-induced cells of strain SPG. The 2-nitrobenzoate-monooxygenase activity resulted in formation of salicylate and nitrite from 2-nitrobenzoate whereas salicylate hydroxylase catalyzed the conversion of salicylate to catechol. The ring-cleaving enzyme, catechol-1,2-dioxygenase cleaved catechol to cis, cis-muconic acid. Cells of strain SPG were able to degrade 2-nitrobenzoate in sterile as well as non-sterile soil microcosms. The results of microcosm studies showed that strain SPG degraded more than 90% of 2-nitrobenzoate within 10-12 days. This study clearly shows that Arthrobacter sp. SPG degraded 2-nitrobenzoate via a new pathway with formation of salicylate and catechol as metabolites. Arthrobacter sp. SPG may be used for bioremediation of 2-nitrobenzoate-contaminated sites due to its ability to degrade 2-nitrobenzoate in soil.

  9. Blue Light Induces a Distinct Starch Degradation Pathway in Guard Cells for Stomatal Opening.

    Science.gov (United States)

    Horrer, Daniel; Flütsch, Sabrina; Pazmino, Diana; Matthews, Jack S A; Thalmann, Matthias; Nigro, Arianna; Leonhardt, Nathalie; Lawson, Tracy; Santelia, Diana

    2016-02-01

    Stomatal pores form a crucial interface between the leaf mesophyll and the atmosphere, controlling water and carbon balance in plants [1]. Major advances have been made in understanding the regulatory networks and ion fluxes in the guard cells surrounding the stomatal pore [2]. However, our knowledge on the role of carbon metabolism in these cells is still fragmentary [3-5]. In particular, the contribution of starch in stomatal opening remains elusive [6]. Here, we used Arabidopsis thaliana as a model plant to provide the first quantitative analysis of starch turnover in guard cells of intact leaves during the diurnal cycle. Starch is present in guard cells at the end of night, unlike in the rest of the leaf, but is rapidly degraded within 30 min of light. This process is critical for the rapidity of stomatal opening and biomass production. We exploited Arabidopsis molecular genetics to define the mechanism and regulation of guard cell starch metabolism, showing it to be mediated by a previously uncharacterized pathway. This involves the synergistic action of β-amylase 1 (BAM1) and α-amylase 3 (AMY3)-enzymes that are normally not required for nighttime starch degradation in other leaf tissues. This pathway is under the control of the phototropin-dependent blue-light signaling cascade and correlated with the activity of the plasma membrane H(+)-ATPase. Our results show that guard cell starch degradation has an important role in plant growth by driving stomatal responses to light. PMID:26774787

  10. Novel degradation pathway and kinetic analysis for buprofezin removal by newly isolated Bacillus sp.

    Science.gov (United States)

    Wang, Guangli; Xu, Dayong; Xiong, Minghua; Zhang, Hui; Li, Feng; Liu, Yuan

    2016-09-15

    Given the intensive and widespread application of the pesticide, buprofezin, its environmental residues potentially pose a problem; yet little is known about buprofezin's kinetic and metabolic behaviors. In this study, a novel gram-positive strain, designated BF-5, isolated from aerobic activated sludge, was found to be capable of metabolizing buprofezin as its sole energy, carbon, and nitrogen source. Based on its physiological and biochemical characteristics, other aspects of its phenotype, and a phylogenetic analysis, strain BF-5 was identified as Bacillus sp. This study investigated the effect of culture conditions on bacterial growth and substrate degradation, such as pH, temperature, initial concentration, different nitrogen source, and additional nitrogen sources as co-substrates. The degradation rate parameters, qmax, Ks, Ki and Sm were determined to be 0.6918 h(-1), 105.4 mg L(-1), 210.5 mg L(-1), and 148.95 mg L(-1) respectively. The capture of unpublished potential metabolites by gas chromatography-mass spectrometry (GC-MS) analysis has led to the proposal of a novel degradation pathway. Taken together, our results clarify buprofezin's biodegradation pathway(s) and highlight the promising potential of strain BF-5 in bioremediation of buprofezin-contaminated environments. PMID:27208995

  11. Iodinated contrast media electro-degradation: process performance and degradation pathways.

    Science.gov (United States)

    Del Moro, Guido; Pastore, Carlo; Di Iaconi, Claudio; Mascolo, Giuseppe

    2015-02-15

    The electrochemical degradation of six of the most widely used iodinated contrast media was investigated. Batch experiments were performed under constant current conditions using two DSA® electrodes (titanium coated with a proprietary and patented mixed metal oxide solution of precious metals such as iridium, ruthenium, platinum, rhodium and tantalum). The degradation removal never fell below 85% (at a current density of 64 mA/cm(2) with a reaction time of 150 min) when perchlorate was used as the supporting electrolyte; however, when sulphate was used, the degradation performance was above 80% (at a current density of 64 mA/cm(2) with a reaction time of 150 min) for all of the compounds studied. Three main degradation pathways were identified, namely, the reductive de-iodination of the aromatic ring, the reduction of alkyl aromatic amides to simple amides and the de-acylation of N-aromatic amides to produce aromatic amines. However, as amidotrizoate is an aromatic carboxylate, this is added via the decarboxylation reaction. The investigation did not reveal toxicity except for the lower current density used, which has shown a modest toxicity, most likely for some reaction intermediates that are not further degraded. In order to obtain total removal of the contrast media, it was necessary to employ a current intensity between 118 and 182 mA/cm(2) with energy consumption higher than 370 kWh/m(3). Overall, the electrochemical degradation was revealed to be a reliable process for the treatment of iodinated contrast media that can be found in contaminated waters such as hospital wastewater or pharmaceutical waste-contaminated streams. PMID:25433384

  12. Entner-Doudoroff pathway for sulfoquinovose degradation in Pseudomonas putida SQ1.

    Science.gov (United States)

    Felux, Ann-Katrin; Spiteller, Dieter; Klebensberger, Janosch; Schleheck, David

    2015-08-01

    Sulfoquinovose (SQ; 6-deoxy-6-sulfoglucose) is the polar head group of the plant sulfolipid SQ-diacylglycerol, and SQ comprises a major proportion of the organosulfur in nature, where it is degraded by bacteria. A first degradation pathway for SQ has been demonstrated recently, a "sulfoglycolytic" pathway, in addition to the classical glycolytic (Embden-Meyerhof) pathway in Escherichia coli K-12; half of the carbon of SQ is abstracted as dihydroxyacetonephosphate (DHAP) and used for growth, whereas a C3-organosulfonate, 2,3-dihydroxypropane sulfonate (DHPS), is excreted. The environmental isolate Pseudomonas putida SQ1 is also able to use SQ for growth, and excretes a different C3-organosulfonate, 3-sulfolactate (SL). In this study, we revealed the catabolic pathway for SQ in P. putida SQ1 through differential proteomics and transcriptional analyses, by in vitro reconstitution of the complete pathway by five heterologously produced enzymes, and by identification of all four organosulfonate intermediates. The pathway follows a reaction sequence analogous to the Entner-Doudoroff pathway for glucose-6-phosphate: It involves an NAD(+)-dependent SQ dehydrogenase, 6-deoxy-6-sulfogluconolactone (SGL) lactonase, 6-deoxy-6-sulfogluconate (SG) dehydratase, and 2-keto-3,6-dideoxy-6-sulfogluconate (KDSG) aldolase. The aldolase reaction yields pyruvate, which supports growth of P. putida, and 3-sulfolactaldehyde (SLA), which is oxidized to SL by an NAD(P)(+)-dependent SLA dehydrogenase. All five enzymes are encoded in a single gene cluster that includes, for example, genes for transport and regulation. Homologous gene clusters were found in genomes of other P. putida strains, in other gamma-Proteobacteria, and in beta- and alpha-Proteobacteria, for example, in genomes of Enterobacteria, Vibrio, and Halomonas species, and in typical soil bacteria, such as Burkholderia, Herbaspirillum, and Rhizobium. PMID:26195800

  13. Metabolic pathway for degradation of 2-chloro-4-aminophenol by Arthrobacter sp. SPG.

    Science.gov (United States)

    Arora, Pankaj Kumar; Mohanta, Tapan Kumar; Srivastava, Alok; Bae, Hanhong; Singh, Vijay Pal

    2014-01-01

    A degradation pathway of 2-chloro-4-aminophenol (2C4AP) was studied in an Arthrobacter sp. SPG that utilized 2C4AP as its sole source of carbon and energy. The 2C4AP degradation was initiated by a 2C4AP-deaminase that catalyzed the conversion of 2C4AP into chlorohydroquinone (CHQ) with removal of ammonium ion. In the next step, a CHQ-dehalogenase dehalogenated CHQ to hydroquinone (HQ) that cleaved into γ-hydroxymuconic semialdehyde by a HQ-dioxygenase. The 2C4AP degradation was also investigated in sterile and non-sterile soil microcosms using strain SPG. The results show that the SPG cells degraded 2C4AP more rapidly in sterile soil than non-sterile soil. Our studies showed that strain SPG may be used for bioremediation of 2C4AP-contaminated sites. This is the first report of the 2C4AP degradation by any bacteria. PMID:25427856

  14. Effects of reforesting degraded grassland on hydrological flow pathways on Leyte, the Philippines

    Science.gov (United States)

    van Meerveld, Ilja; Zhang, Jun; Bruijnzeel, Sampurno

    2014-05-01

    Reforestation of degraded land in the tropics is promoted for a wide range of expected benefits, including carbon sequestration and streamflow regulation. However, how reforestation of degraded land affects runoff generation mechanisms and catchment water yield is still poorly understood as most experimental work pertains to non-degraded terrain. We set out to study the differences in hydrological functioning of a small degraded grassland catchment and a similar catchment that was reforested 15 years ago. Both catchments are located near Tacloban, Leyte, the Philippines. Stream stage, EC and temperature are measured continuously since June 2013. Precipitation, soil moisture content, and groundwater levels are monitored as well. Samples are taken from streamflow, precipitation, groundwater, and soil water prior to and during rainfall events for geochemical and stable isotope analysis to elucidate source contributions to storm runoff. Streamflow and event water contributions increase rapidly during almost every rainfall event in the grassland. In the reforested catchment, event water contributions to streamflow are much smaller and only increase during large events. These tracer results suggest that overland flow occurs much less frequently and is much less widespread in the reforested catchment compared to the grassland catchment. Our results thus indicate that the dominant flow pathways have changed as a result of reforestation and suggest that reforestation can largely restore the hydrological functioning of degraded sites if the forest is allowed to develop over a sufficiently long period without subsequent disturbance.

  15. From ether to acid: A plausible degradation pathway of glycerol dialkyl glycerol tetraethers

    Science.gov (United States)

    Liu, Xiao-Lei; Birgel, Daniel; Elling, Felix J.; Sutton, Paul A.; Lipp, Julius S.; Zhu, Rong; Zhang, Chuanlun; Könneke, Martin; Peckmann, Jörn; Rowland, Steven J.; Summons, Roger E.; Hinrichs, Kai-Uwe

    2016-06-01

    Glycerol dialkyl glycerol tetraethers (GDGTs) are ubiquitous microbial lipids with extensive demonstrated and potential roles as paleoenvironmental proxies. Despite the great attention they receive, comparatively little is known regarding their diagenetic fate. Putative degradation products of GDGTs, identified as hydroxyl and carboxyl derivatives, were detected in lipid extracts of marine sediment, seep carbonate, hot spring sediment and cells of the marine thaumarchaeon Nitrosopumilus maritimus. The distribution of GDGT degradation products in environmental samples suggests that both biotic and abiotic processes act as sinks for GDGTs. More than a hundred newly recognized degradation products afford a view of the stepwise degradation of GDGT via (1) ether bond hydrolysis yielding hydroxyl isoprenoids, namely, GDGTol (glycerol dialkyl glycerol triether alcohol), GMGD (glycerol monobiphytanyl glycerol diether), GDD (glycerol dibiphytanol diether), GMM (glycerol monobiphytanol monoether) and bpdiol (biphytanic diol); (2) oxidation of isoprenoidal alcohols into corresponding carboxyl derivatives and (3) chain shortening to yield C39 and smaller isoprenoids. This plausible GDGT degradation pathway from glycerol ethers to isoprenoidal fatty acids provides the link to commonly detected head-to-head linked long chain isoprenoidal hydrocarbons in petroleum and sediment samples. The problematic C80 to C82 tetraacids that cause naphthenate deposits in some oil production facilities can be generated from H-shaped glycerol monoalkyl glycerol tetraethers (GMGTs) following the same process, as indicated by the distribution of related derivatives in hydrothermally influenced sediments.

  16. Aqueous photodegradation of antibiotic florfenicol: kinetics and degradation pathway studies.

    Science.gov (United States)

    Zhang, Ya; Li, Jianhua; Zhou, Lei; Wang, Guoqing; Feng, Yanhong; Wang, Zunyao; Yang, Xi

    2016-04-01

    The occurrence of antibacterial agents in natural environment was of scientific concern in recent years. As endocrine disrupting chemicals, they had potential risk on ecology system and human beings. In the present study, the photodegradation kinetics and pathways of florfenicol were investigated under solar and xenon lamp irradiation in aquatic systems. Direct photolysis half-lives of florfenicol were determined as 187.29 h under solar irradiation and 22.43 h under xenon lamp irradiation, respectively. Reactive oxygen species (ROS), such as hydroxyl radical (·OH) and singlet oxygen ((1)O2) were found to play an important role in indirect photolysis process. The presence of nitrate and dissolved organic matters (DOMs) could affect photolysis of florfenicol in solutions through light screening effect, quenching effect, and photoinduced oxidization process. Photoproducts of florfenicol in DOMs solutions were identified by solid phase extraction-liquid chromatography-mass spectrometry (SPE-LC-MS) analysis techniques, and degradation pathways were proposed, including photoinduced hydrolysis, oxidation by (1)O2 and ·OH, dechlorination, and cleavage of the side chain. PMID:26705756

  17. Tetracycline degradation by ozonation in the aqueous phase: Proposed degradation intermediates and pathway

    International Nuclear Information System (INIS)

    During the ozonation of tetracycline (TC) in aqueous media at pHs 2.2 and 7.0, the effects of pH variations, protonation and dissociation of functional groups and variation in free radical exposure were investigated to elucidate the transformation pathway. Liquid chromatography-triple quadrupole mass spectrometry detected around 15 ozonation products, and uncovered their production and subsequent degradation patterns. During ozonation at pH 2.2, the TC degradation pathway was proposed on the basis of the structure, ozonation chemistry and mass spectrometry data of TC. Ozonation of TC at the C11a-C12 and C2-C3 double bonds, aromatic ring and amino group generated products of m/z 461, 477, 509 and 416, respectively. Further ozonation at the above mentioned sites gave products of m/z 432, 480, 448, 525 and 496. The removal of TOC reached a maximum of ∼40% after 2 h of ozonation, while TC was completely removed within 4-6 min at both pHs. The low TOC removal efficiency might be due to the generation of recalcitrant products and the low ozone supply for high TC concentration. Ozonation decreased the acute toxicity of TC faster at pH 7.0 than pH 2.2, but the maximum decrease was only about 40% at both pHs after 2 h of ozonation. In this study, attempts were made to understand the correlation between the transformation products, pathway, acute toxicity and quantity of residual organics in solution. Overall, ozonation was found to be a promising process for removing TC and the products initially generated.

  18. Tetracycline degradation by ozonation in the aqueous phase: Proposed degradation intermediates and pathway

    Energy Technology Data Exchange (ETDEWEB)

    Khan, M. Hammad; Bae, Hyokwan [Water Environment Center, Korea Institute of Science and Technology, 39-1 Hawolgok-Dong, Seongbuk-Gu, Seoul 136-791 (Korea, Republic of); Jung, Jin-Young, E-mail: jinjung@ynu.ac.kr [Department of Environmental Engineering, Yeungnam University, 214-1 Dae-Dong, Gyeongsan-Si, Gyeongsangbuk-Do 712-749 (Korea, Republic of)

    2010-09-15

    During the ozonation of tetracycline (TC) in aqueous media at pHs 2.2 and 7.0, the effects of pH variations, protonation and dissociation of functional groups and variation in free radical exposure were investigated to elucidate the transformation pathway. Liquid chromatography-triple quadrupole mass spectrometry detected around 15 ozonation products, and uncovered their production and subsequent degradation patterns. During ozonation at pH 2.2, the TC degradation pathway was proposed on the basis of the structure, ozonation chemistry and mass spectrometry data of TC. Ozonation of TC at the C11a-C12 and C2-C3 double bonds, aromatic ring and amino group generated products of m/z 461, 477, 509 and 416, respectively. Further ozonation at the above mentioned sites gave products of m/z 432, 480, 448, 525 and 496. The removal of TOC reached a maximum of {approx}40% after 2 h of ozonation, while TC was completely removed within 4-6 min at both pHs. The low TOC removal efficiency might be due to the generation of recalcitrant products and the low ozone supply for high TC concentration. Ozonation decreased the acute toxicity of TC faster at pH 7.0 than pH 2.2, but the maximum decrease was only about 40% at both pHs after 2 h of ozonation. In this study, attempts were made to understand the correlation between the transformation products, pathway, acute toxicity and quantity of residual organics in solution. Overall, ozonation was found to be a promising process for removing TC and the products initially generated.

  19. Naphthalene degradation and incorporation of naphthalene-derived carbon into biomass by the thermophile Bacillus thermoleovorans

    Energy Technology Data Exchange (ETDEWEB)

    Annweiler, E.; Richnow, H.H.; Antranikian, G.; Hebenbrock, S.; Garms, C.; Franke, S.; Francke, W.; Michaelis, W.

    2000-02-01

    The thermophilic aerobic bacterium Bacillus thermoleovorans Hamburg 2 grows at 60 C on naphthalene as the sole source of carbon and energy. In batch cultures, an effective substrate degradation was observed. The carbon balance, including naphthalene, metabolites, biomass, and CO{sub 2}, was determined by the application of [1-{sup 13}C]naphthalene. The incorporation of naphthalene-derived carbon into the bulk biomass as well as into specified biomass fractions such as fatty acids and amino acids was confirmed by coupled gas chromatography-mass spectrometry (GC-MS) and isotope analyses. Metabolites were characterized by GC-MS; the established structures allow tracing the degradation pathway under thermophilic conditions. Apart from typical metabolites of naphthalene degradation known from mesophiles, intermediates such as 2,3-dihydroxynaphthalene, 2-carboxycinnamic acid, and phthalic and benzoic acid were identified for the pathway of this bacterium. These compounds indicate that naphthalene degradation by the thermophilic B. thermoleovorans differs from the known pathways found for mesophilic bacteria.

  20. Enhanced degradation in soil of the herbicide EPTC and determination of its degradative pathway by an isolated soil microorganism

    International Nuclear Information System (INIS)

    A series of experiments was conducted to examine the ability of Ohio soils to develop enhanced degradation of the herbicide EPTC (s-ethyl N,N-dipropyl carbamothiaote) and to determine its metabolism by an isolated soil microorganism. Three soils selected to obtain an range in pH, texture, and organic carbon were treated with EPTC for 4 consecutive applications (6 weeks between applications). EPTC concentrations as measured by gas chromatography, decreased 80% or more one week after the second application in all three soils. Metabolism of unlabelled and labelled EPTC by an isolated soil microbe was followed by GC/MS and TLC/LSC analysis, respectively. Rapid decrease in 14-C activity in the organic fraction corresponded with rapid 14CO2 evolution and transient increase in 14-C activity in the aqueous fraction. Four metabolites were observed in the TLC analysis. Two were identified as EPTC-sulfoxide and N-depropyl EPTC with N-depropyl EPTC being confirmed by GC/MS analysis. The availability of different pathways for EPTC metabolism by soil microbes after repeated applications to the soil results in its very rapid degradation and loss of efficacy

  1. Insights from 14C into C loss pathways in degraded peatlands

    Science.gov (United States)

    Evans, Martin; Evans, Chris; Allott, Tim; Stimson, Andrew; Goulsbra, Claire

    2016-04-01

    Peatlands are important global stores of terrestrial carbon. Lowered water tables due to changing climate and direct or indirect human intervention produce a deeper aerobic zone and have the potential to enhance loss of stored carbon from the peat profile. The quasi continuous accumulation of organic matter in active peatlands means that the age of fluvial dissolved organic carbon exported from peatland systems is related to the source depth in the peat profile. Consequently 14C analysis of DOC in waters draining peatlands has the potential not only to tell us about the source of fluvial carbon and the stability of the peatland but also about the dominant hydrological pathways in the peatland system. This paper will present new radiocarbon determinations from peatland streams draining the heavily eroded peatlands of the southern Pennine uplands in the UK. These blanket peatland systems are highly degraded, with extensive bare peat and gully erosion resulting from air pollution during the industrial revolution, overgrazing, wildfire and climatic changes. Deep and extensive gullying has significantly modified the hydrology of these systems leading to local and more widespread drawdown of water table. 14C data from DOC in drainage waters are presented from two catchments; one with extensive gully erosion and the other with a combination of gully erosion and sheet erosion of the peat. At the gully eroded site DOC in drainage waters is as old as 160 BP but at the site with extensive sheet erosion dates of up to 1069 BP are amongst the oldest recorded from blanket peatland globally These data indicate significant degradation of stored carbon from the eroding peatlands. Initial comparisons of the 14C data with modelled water table for the catchments and depth-age curves for catchment peats suggests that erosion of the peat surface, allowing decomposition of exposed older organic material is a potential mechanism producing aged carbon from the eroded catchment. This

  2. Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?

    OpenAIRE

    Alberto Scoma; Marta Barbato; Emma Hernandez-Sanabria; Francesca Mapelli; Daniele Daffonchio; Sara Borin; Nico Boon

    2016-01-01

    Oil spills represent an overwhelming carbon input to the marine environment that immediately impacts the sea surface ecosystem. Microbial communities degrading the oil fraction that eventually sinks to the seafloor must also deal with hydrostatic pressure, which linearly increases with depth. Piezosensitive hydrocarbonoclastic bacteria are ideal candidates to elucidate impaired pathways following oil spills at low depth. In the present paper, we tested two strains of the ubiquitous Alcanivora...

  3. Degradation of triclosan in aqueous solution by dielectric barrier discharge plasma combined with activated carbon fibers.

    Science.gov (United States)

    Xin, Lu; Sun, Yabing; Feng, Jingwei; Wang, Jian; He, Dong

    2016-02-01

    The degradation of triclosan (TCS) in aqueous solution by dielectric barrier discharge (DBD) plasma with activated carbon fibers (ACFs) was investigated. In this study, ACFs and DBD plasma coexisted in a planar DBD plasma reactor, which could synchronously achieve degradation of TCS, modification and in situ regeneration of ACFs, enhancing the effect of recycling of ACFs. The properties of ACFs before and after modification by DBD plasma were characterized by BET and XPS. Various processing parameters affecting the synergetic degradation of TCS were also investigated. The results exhibited excellent synergetic effects in DBD plasma-ACFs system on TCS degradation. The degradation efficiency of 120 mL TCS with initial concentration of 10 mg L(-1) could reach 93% with 1 mm thick ACFs in 18 min at input power of 80 W, compared with 85% by single DBD plasma. Meanwhile, the removal rate of total organic carbon increased from 12% at pH 6.26-24% at pH 3.50. ACFs could ameliorate the degradation efficiency for planar DBD plasma when treating TCS solution at high flow rates or at low initial concentrations. A possible degradation pathway of TCS was investigated according to the detected intermediates, which were identified by liquid chromatography-hybrid quadrupole time-of-flight mass spectrometry (LC-QTOF-MS) combined with theoretical calculation of Gaussian 09 program. PMID:26421625

  4. Deadwood biomass: an underestimated carbon stock in degraded tropical forests?

    Science.gov (United States)

    Pfeifer, Marion; Lefebvre, Veronique; Turner, Edgar; Cusack, Jeremy; Khoo, MinSheng; Chey, Vun K.; Peni, Maria; Ewers, Robert M.

    2015-04-01

    Despite a large increase in the area of selectively logged tropical forest worldwide, the carbon stored in deadwood across a tropical forest degradation gradient at the landscape scale remains poorly documented. Many carbon stock studies have either focused exclusively on live standing biomass or have been carried out in primary forests that are unaffected by logging, despite the fact that coarse woody debris (deadwood with ≥10 cm diameter) can contain significant portions of a forest’s carbon stock. We used a field-based assessment to quantify how the relative contribution of deadwood to total above-ground carbon stock changes across a disturbance gradient, from unlogged old-growth forest to severely degraded twice-logged forest, to oil palm plantation. We measured in 193 vegetation plots (25 × 25 m), equating to a survey area of >12 ha of tropical humid forest located within the Stability of Altered Forest Ecosystems Project area, in Sabah, Malaysia. Our results indicate that significant amounts of carbon are stored in deadwood across forest stands. Live tree carbon storage decreased exponentially with increasing forest degradation 7-10 years after logging while deadwood accounted for >50% of above-ground carbon stocks in salvage-logged forest stands, more than twice the proportion commonly assumed in the literature. This carbon will be released as decomposition proceeds. Given the high rates of deforestation and degradation presently occurring in Southeast Asia, our findings have important implications for the calculation of current carbon stocks and sources as a result of human-modification of tropical forests. Assuming similar patterns are prevalent throughout the tropics, our data may indicate a significant global challenge to calculating global carbon fluxes, as selectively-logged forests now represent more than one third of all standing tropical humid forests worldwide.

  5. Sunlight-Induced Photochemical Degradation of Methylene Blue by Water-Soluble Carbon Nanorods

    Directory of Open Access Journals (Sweden)

    Anshu Bhati

    2016-01-01

    Full Text Available Water-soluble graphitic hollow carbon nanorods (wsCNRs are exploited for their light-driven photochemical activities under outdoor sunlight. wsCNRs were synthesized by a simple pyrolysis method from castor seed oil, without using any metal catalyst or template. wsCNRs exhibited the light-induced photochemical degradation of methylene blue used as a model pollutant by the generation of singlet oxygen species. Herein, we described a possible degradation mechanism of methylene blue under the irradiation of visible photons via the singlet oxygen-superoxide anion pathway.

  6. Multivariate Analysis of Rangeland Vegetation and Soil Organic Carbon Describes Degradation, Informs Restoration and Conservation

    Directory of Open Access Journals (Sweden)

    Devan Allen McGranahan

    2013-07-01

    Full Text Available Agricultural expansion has eliminated a high proportion of native land cover and severely degraded remaining native vegetation. Managers must determine where degradation is severe enough to merit restoration action, and what action, if any, is necessary. We report on grassland degraded by multiple factors, including grazing, soil disturbance, and exotic plant species introduced in response to agriculture management. We use a multivariate method to categorize plant communities by degradation state based on floristic and biophysical degradation associated with historical land use. The variables we associate with degradation include abundance of the invasive cool-season grass, tall fescue (Schedonorus phoenix (Scop. Holub; soil organic carbon (SOC; and heavy livestock grazing. Using a series of multivariate analyses (ordination, hierarchical clustering, and multiple regression, we identify patterns in plant community composition and describe floristic degradation states. We found vegetation states to be described largely by vegetation composition associated primarily with tall fescue and secondarily by severe grazing, but not soil organic carbon. Categorizing grasslands by vegetation states helps managers efficiently apply restoration inputs that optimize ecosystem response, so we discuss potential restoration pathways in a state-and-transition model. Reducing stocking rate on grassland where grazing is actively practiced is an important first step that might be sufficient for restoring grassland with high native species richness and minimal degradation from invasive plants. More severe degradation likely requires multiple approaches to reverse degradation. Of these, we recommend restoration of ecological processes and disturbance regimes such as fire and grazing. We suggest old-field grasslands in North America, which are similar to European semi-natural grassland in composition and function, deserve more attention by conservation biologists.

  7. A second pathway to degrade pyrimidine nucleic acid precursors in eukaryotes

    DEFF Research Database (Denmark)

    Andersen, Gorm; Bjornberg, Olof; Polakova, Silvia;

    2008-01-01

    Pyrimidine bases are the central precursors for RNA and DNA, and their intracellular pools are determined by de novo, salvage and catabolic pathways. In eukaryotes, degradation of uracil has been believed to proceed only via the reduction to dihydrouracil. Using a yeast model, Saccharomyces kluyv...... of the eukaryotic or prokaryotic genes involved in pyrimidine degradation described to date....

  8. Restoring degraded tropical forests for carbon and biodiversity

    Science.gov (United States)

    Budiharta, Sugeng; Meijaard, Erik; Erskine, Peter D.; Rondinini, Carlo; Pacifici, Michela; Wilson, Kerrie A.

    2014-11-01

    The extensive deforestation and degradation of tropical forests is a significant contributor to the loss of biodiversity and to global warming. Restoration could potentially mitigate the impacts of deforestation, yet knowledge on how to efficiently allocate funding for restoration is still in its infancy. We systematically prioritize investments in restoration in the tropical landscape of East Kalimantan, Indonesia, and through this application demonstrate the capacity to account for a diverse suite of restoration techniques and forests of varying condition. To achieve this we develop a map of forest degradation for the region, characterized on the basis of aboveground biomass and differentiated by broad forest types. We estimate the costs of restoration as well as the benefits in terms of carbon sequestration and improving the suitability of habitat for threatened mammals through time. When the objective is solely to enhance carbon stocks, then restoration of highly degraded lowland forest is the most cost-effective activity. However, if the objective is to improve the habitat of threatened species, multiple forest types should be restored and this reduces the accumulated carbon by up to 24%. Our analysis framework provides a transparent method for prioritizing where and how restoration should occur in heterogeneous landscapes in order to maximize the benefits for carbon and biodiversity.

  9. Restoring degraded tropical forests for carbon and biodiversity

    International Nuclear Information System (INIS)

    The extensive deforestation and degradation of tropical forests is a significant contributor to the loss of biodiversity and to global warming. Restoration could potentially mitigate the impacts of deforestation, yet knowledge on how to efficiently allocate funding for restoration is still in its infancy. We systematically prioritize investments in restoration in the tropical landscape of East Kalimantan, Indonesia, and through this application demonstrate the capacity to account for a diverse suite of restoration techniques and forests of varying condition. To achieve this we develop a map of forest degradation for the region, characterized on the basis of aboveground biomass and differentiated by broad forest types. We estimate the costs of restoration as well as the benefits in terms of carbon sequestration and improving the suitability of habitat for threatened mammals through time. When the objective is solely to enhance carbon stocks, then restoration of highly degraded lowland forest is the most cost-effective activity. However, if the objective is to improve the habitat of threatened species, multiple forest types should be restored and this reduces the accumulated carbon by up to 24%. Our analysis framework provides a transparent method for prioritizing where and how restoration should occur in heterogeneous landscapes in order to maximize the benefits for carbon and biodiversity. (letter)

  10. The oxalate-carbonate pathway: at the interface between biology and geology

    Science.gov (United States)

    Junier, P.; Cailleau, G.; Martin, G.; Guggiari, M.; Bravo, D.; Clerc, M.; Aragno, M.; Job, D.; Verrecchia, E.

    2012-04-01

    The formation of calcite in otherwise carbonate-free acidic soils through the biological degradation of oxalate is a mechanism termed oxalate-carbonate pathway. This pathway lies at the interface between biological and geological systems and constitutes an important, although underestimated, soil mineral carbon sink. In this case, atmospheric CO2 is fixed by the photosynthetic activity of oxalogenic plants, which is partly destined to the production of oxalate used for the chelation of metals, and particularly, calcium. Fungi are also able to produce oxalate to cope with elevated concentrations of metals. In spite of its abundance as a substrate, oxalate is a very stable organic anion that can be metabolized only by a group of bacteria that use it as carbon and energy sources. These bacteria close the biological cycle by degrading calcium oxalate, releasing Ca2+ and inducing a change in local soil pH. If parameters are favourable, the geological part of the pathway begins, because this change in pH will indirectly lead to the precipitation of secondary calcium carbonate (calcite) in unexpected geological conditions. Due to the initial acidic soil conditions, and the absence of geological carbonate in the basement, it is unexpected to find C in the form of calcite. The activity of the oxalate-carbonate pathway has now been demonstrated in several places around the world, suggesting that its importance can be even greater than expected. In addition, new roles for each of the biological players of the pathway have been revealed recently forcing us to reconsider a global biogeochemical model for oxalate cycling.

  11. Electrochemical degradation of malachite green using nanoporous carbon paste electrode

    Science.gov (United States)

    Harsini, Muji; Fitria, Faizatul; Pudjiastuti, Pratiwi

    2016-03-01

    Malachite green is a dye which is often used in the textile industry which potentially generates hazardous compound to the environment. Electrochemical degradation is a method that can decipher malachite green into harmless compounds. In this study, nanoporous carbon paste used as the anode and silver wire as the cathode. A number of the sample solution with a certain concentration containing supporting electrolyte inserted into a electrolysis cell, certain potential and current is passed through the electrode into the solution. During the degradation process, the solution stirred by a magnetic stirrer. The results showed that the optimum state of degradation at 10 volts potential with an electrolyte solution of 0.1 M NaCl, pH does not affect the results of degradation. The optimum time to degrade 50 ppm malachite green is 30 to 40 minutes to produce a harmless compound that can be indicated from the impairment COD that up to 95,05%. Results of UV-Vis spectra showed that malachite green has been degraded completely.

  12. ORGANOPHOSPHORUS PESTICIDE DEGRADATION PATHWAYS DURING DRINKING WATER TREATMENT

    Science.gov (United States)

    The objective of this work was to investigate organophosphorus (OP) pesticide transformation pathways as a class in the presence of aqueous chlorine. Seven priority OP pesticides were examined for their reactivity with aqueous chlorine: chlorpyrifos (CP), parathion (PA), diazino...

  13. Physiology of deletion mutants in the anaerobic β-myrcene degradation pathway in Castellaniella defragrans

    Directory of Open Access Journals (Sweden)

    Lüddeke Frauke

    2012-09-01

    Full Text Available Abstract Background Monoterpenes present a large and versatile group of unsaturated hydrocarbons of plant origin with widespread use in the fragrance as well as food industry. The anaerobic β-myrcene degradation pathway in Castellaniella defragrans strain 65Phen differs from well known aerobic, monooxygenase-containing pathways. The initial enzyme linalool dehydratase-isomerase ldi/LDI catalyzes the hydration of β-myrcene to (S-(+-linalool and its isomerization to geraniol. A high-affinity geraniol dehydrogenase geoA/GeDH and a geranial dehydrogenase geoB/GaDH contribute to the formation of geranic acid. A genetic system was for the first time applied for the betaproteobacterium to prove in vivo the relevance of the linalool dehydratase-isomerase and the geraniol dehydrogenase. In-frame deletion cassettes were introduced by conjugation and two homologous recombination events. Results Polar effects were absent in the in-frame deletion mutants C. defragrans Δldi and C. defragrans ΔgeoA. The physiological characterization of the strains demonstrated a requirement of the linalool dehydratase-isomerase for growth on acyclic monoterpenes, but not on cyclic monoterpenes. The deletion of geoA resulted in a phenotype with hampered growth rate on monoterpenes as sole carbon and energy source as well as reduced biomass yields. Enzyme assays revealed the presence of a second geraniol dehydrogenase. The deletion mutants were in trans complemented with the broad-host range expression vector pBBR1MCS-4ldi and pBBR1MCS-2geoA, restoring in both cases the wild type phenotype. Conclusions In-frame deletion mutants of genes in the anaerobic β-myrcene degradation revealed novel insights in the in vivo function. The deletion of a high-affinity geraniol dehydrogenase hampered, but did not preclude growth on monoterpenes. A second geraniol dehydrogenase activity was present that contributes to the β-myrcene degradation pathway. Growth on cyclic monoterpenes

  14. Degraded tropical rain forests possess valuable carbon storage opportunities in a complex, forested landscape.

    Science.gov (United States)

    Alamgir, Mohammed; Campbell, Mason J; Turton, Stephen M; Pert, Petina L; Edwards, Will; Laurance, William F

    2016-01-01

    Tropical forests are major contributors to the terrestrial global carbon pool, but this pool is being reduced via deforestation and forest degradation. Relatively few studies have assessed carbon storage in degraded tropical forests. We sampled 37,000 m(2) of intact rainforest, degraded rainforest and sclerophyll forest across the greater Wet Tropics bioregion of northeast Australia. We compared aboveground biomass and carbon storage of the three forest types, and the effects of forest structural attributes and environmental factors that influence carbon storage. Some degraded forests were found to store much less aboveground carbon than intact rainforests, whereas others sites had similar carbon storage to primary forest. Sclerophyll forests had lower carbon storage, comparable to the most heavily degraded rainforests. Our findings indicate that under certain situations, degraded forest may store as much carbon as intact rainforests. Strategic rehabilitation of degraded forests could enhance regional carbon storage and have positive benefits for tropical biodiversity. PMID:27435389

  15. 3'-5' RNA degradation pathways in human cells

    DEFF Research Database (Denmark)

    Lubas, Michal Szymon

    revealed the interaction network of the main 3'-5' RNA degradation machinery – the RNA exosome complex. One of the key findings was the identification and characterisation of the Nuclear Exosome Targeting (NEXT) complex, important for nuclear functions of the exosome. Michal Lubas also studied the role...

  16. Chemotaxis and degradation of organophosphate compound by a novel moderately thermo-halo tolerant Pseudomonas sp. strain BUR11: evidence for possible existence of two pathways for degradation.

    Science.gov (United States)

    Pailan, Santanu; Saha, Pradipta

    2015-01-01

    An organophosphate (OP) degrading chemotactic bacterial strain BUR11 isolated from an agricultural field was identified as a member of Pseudomonas genus on the basis of its 16S rRNA gene sequence. The strain could utilize parathion, chlorpyrifos and their major hydrolytic intermediates as sole source of carbon for its growth and exhibited positive chemotactic response towards most of them. Optimum concentration of parathion for its growth was recorded to be 200 ppm and 62% of which was degraded within 96 h at 37 °C. Growth studies indicated the strain to be moderately thermo-halo tolerant in nature. Investigation based on identification of intermediates of parathion degradation by thin layer chromatography (TLC), high performance liquid chromatography (HPLC), gas chromatography (GC) and liquid chromatography mass spectrometry (LC-MS/MS) provided evidence for possible existence of two pathways. The first pathway proceeds via 4-nitrophenol (4-NP) while the second proceeds through formation of 4-aminoparathion (4-APar), 4-aminophenol (4-AP) and parabenzoquinone (PBQ). This is the first report of chemotaxis towards organophosphate compound by a thermo-halo tolerant bacterium. PMID:26587344

  17. Tissue factor pathway inhibitor relates to fibrin degradation in patients with acute deep venous thrombosis

    DEFF Research Database (Denmark)

    Sidelmann, Johannes J; Bladbjerg, Else-Marie; Gram, Jørgen;

    2008-01-01

    studied the association between inflammation, endothelial cell perturbation, fibrin degradation and the concentration of tissue factor pathway inhibitor in patients suspected for acute deep venous thrombosis. We determined the tissue factor pathway inhibitor -33T/C polymorphism, free and total tissue....... The significant relationship is not associated with the -33T/C polymorphism, inflammation or endothelial cell perturbation, but is most likely related to release of tissue factor pathway inhibitor from fibrin deposits....

  18. Degradation Mechanism in a Direct Carbon Fuel Cell Operated with Demineralised Brown Coal

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • Degradation mechanism studied for demineralised coal in a direct carbon fuel cell. • Diffusion limited processes dominate the electrode polarisation losses in pure N2. • Major fuel cell performance loss occurred due to loss of carbon/anode contacts. • The anode retained its phase structure with minor other phases formed in operation. - Abstract: The performance of a demineralised and devolatilised coal from the Morwell mine in the Latrobe Valley, Victoria, has been investigated in a direct carbon fuel cell (DCFC) operated at 850 °C. The focus of the investigation has been on understanding degradation issues as a function of time involving a sequence of electrochemical impedance spectroscopy and voltage-current characteristic. Diffusion limited processes dominate the electrode polarisation losses in pure N2 atmosphere, however, these decrease substantially in the presence of CO2 as the anode chamber purge gas, due to in situ generation of fuel species by the reaction of CO2 with carbon. Post-mortem analysis of anode by SEM and XRD revealed only a minor degradation due to its reduction, particle agglomeration as well as the formation of small quantity of new phases. However, major fuel cell performance degradation (increase of ohmic resistive and electrode polarisation losses) occurred due to loss of carbon/anode contacts and a reduction in the electron-conducting pathways as the fuel was consumed. The investigations revealed that the demineralised coal char can be used as a viable fuel for DCFC, however, further developments on anode materials and fuel feed mechanism would be required to achieve long-term sustained performance

  19. Controlled degradation pattern of hydroxyapatite/calcium carbonate composite microspheres.

    Science.gov (United States)

    Yang, Ning; Zhong, Qiwei; Zhou, Ying; Kundu, Subhas C; Yao, Juming; Cai, Yurong

    2016-06-01

    Hydroxyapatite (HAP) is widely used in clinic due to its good biocompatibility and osteoconductivity except for its slow degradation speed. In the present study, spherical calcium carbonate (CaCO3 ) is fabricated in the presence of silk protein sericin, which is transmuted into HAP microsphere in phosphate solution with the assistance of microwave irradiation. The effect of reaction conditions on the conversion of CaCO3 is investigated including reaction time, chemical composition of phosphate solution, and microwave power to get a series of HAP/CaCO3 composites. The degradation property of the composites is evaluated in vitro. Results show the degradation speed of the composite with higher HAP content is slower. The degradation rate of the composite could be changed effectively by modulating the proportion of HAP and CaCO3 . This work provides a feasible method for the preparation of spherical HAP/CaCO3 composite with controllable degradability. The composite thus obtained may be an ideal material for bone tissue engineering application. Microsc. Res. Tech. 79:518-524, 2016. © 2016 Wiley Periodicals, Inc. PMID:27037606

  20. PHOSPHOLIPIDS OF FIVE PSEUDOMONAD ARCHETYPES FOR DIFFERENT TOLUENE DEGRADATION PATHWAYS

    Science.gov (United States)

    Liquid chromatography/electrospray ionization/mass spectrometry (LC/ESI/MS) was used to determine phospholipid profiles for five reference pseudomonad strains harboring distinct toluene catabolic pathways: Pseudomonas putida mt-2, Pseudomonas putida F1, Burkholderia cepacia G4, B...

  1. Characterization of the novel dimethyl sulfide-degrading bacterium Alcaligenes sp. SY1 and its biochemical degradation pathway.

    Science.gov (United States)

    Sun, Yiming; Qiu, Jiguo; Chen, Dongzhi; Ye, Jiexu; Chen, Jianmeng

    2016-03-01

    Recently, the biodegradation of volatile organic sulfur compounds (VOSCs) has become a burgeoning field, with a growing focus on the reduction of VOSCs. The reduction of VOSCs encompasses both organic emission control and odor control. Herein, Alcaligenes sp. SY1 was isolated from active sludge and found to utilize dimethyl sulfide (DMS) as a growth substrate in a mineral salt medium. Response surface methodology (RSM) analysis was applied to optimize the incubation conditions. The following conditions for optimal degradation were identified: temperature 27.03°C; pH 7.80; inoculum salinity 0.84%; and initial DMS concentration 1585.39 μM. Under these conditions, approximately 99% of the DMS was degraded within 30 h of incubation. Two metabolic compounds were detected and identified by gas chromatography-mass spectrometry (GC-MS): dimethyl disulfide (DMDS) and dimethyl trisulfide (DMTS). The DMS degradation kinetics for different concentrations were evaluated using the Haldane-Andrews model and the pseudo first-order model. The maximum specific growth rate and degradation rate of Alcaligenes sp. SY1 were 0.17 h(-1) and 0.63 gs gx(-1)h(-1). A possible degradation pathway is proposed, and the results suggest that Alcaligenes sp. SY1 has the potential to control odor emissions under aerobic conditions. PMID:26623933

  2. Connecting Lignin-Degradation Pathway with Pre-Treatment Inhibitor Sensitivity of Cupriavidus necator

    Energy Technology Data Exchange (ETDEWEB)

    Wang, W. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Yang, S. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hunsinger, G. B. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Pienkos, P. T. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Johnson, D. K. [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2014-05-27

    In order to produce lignocellulosic biofuels economically, the complete release of monomers from the plant cell wall components, cellulose, hemicellulose, and lignin, through pre-treatment and hydrolysis (both enzymatic and chemical), and the efficient utilization of these monomers as carbon sources, is crucial. In addition, the identification and development of robust microbial biofuel production strains that can tolerate the toxic compounds generated during pre-treatment and hydrolysis is also essential. In this work, Cupriavidus necator was selected due to its capabilities for utilizing lignin monomers and producing polyhydroxylbutyrate (PHB), a bioplastic as well as an advanced biofuel intermediate. We characterized the growth kinetics of C. necator in pre-treated corn stover slurry as well as individually in the pre-sence of 11 potentially toxic compounds in the saccharified slurry. We found that C. necator was sensitive to the saccharified slurry produced from dilute acid pre-treated corn stover. Five out of 11 compounds within the slurry were characterized as toxic to C. necator, namely ammonium acetate, furfural, hydroxymethylfurfural (HMF), benzoic acid, and p-coumaric acid. Aldehydes (e.g., furfural and HMF) were more toxic than the acetate and the lignin degradation products benzoic acid and p-coumaric acid; furfural was identified as the most toxic compound. Although toxic to C. necator at high concentration, ammonium acetate, benzoic acid, and p-coumaric acid could be utilized by C. necator with a stimulating effect on C. necator growth. Consequently, the lignin degradation pathway of C. necator was reconstructed based on genomic information and literature. The efficient conversion of intermediate catechol to downstream products of cis,cis-muconate or 2-hydroxymuconate-6-semialdehyde may help improve the robustness of C. necator to benzoic acid and p-coumaric acid as well as improve PHB productivity.

  3. Connecting lignin-degradation pathway with pretreatment inhibitor sensitivity of Cupriavidus necator

    Directory of Open Access Journals (Sweden)

    Wei eWang

    2014-05-01

    Full Text Available To produce lignocellulosic biofuels economically, the complete release of monomers from the plant cell wall components, cellulose, hemicellulose and lignin, through pretreatment and hydrolysis (both enzymatic and chemical, and the efficient utilization of these monomers as carbon sources, is crucial. In addition, the identification and development of robust microbial biofuel production strains that can tolerate the toxic compounds generated during pretreatment and hydrolysis is also essential. In this work, Cupriavidus necator was selected due to its capabilities for utilizing lignin monomers and producing polyhydroxylbutyrate (PHB, a bioplastic as well as an advanced biofuel intermediate. We characterized the growth kinetics of C. necator in pretreated corn stover slurry as well as individually in the presence of 11 potentially toxic compounds in the saccharified slurry. We found that C. necator was sensitive to the saccharified slurry produced from dilute acid pretreated corn stover. Five out of 11 compounds within the slurry were characterized as toxic to C. necator, namely ammonium acetate, furfural, hydroxymethylfurfural (HMF, benzoic acid, and p-coumaric acid. Aldehydes (e.g., furfural and HMF were more toxic than the acetate and the lignin degradation products benzoic acid and p-coumaric acid; furfural was identified as the most toxic compound. Although toxic to C. necator at high concentration, ammonium acetate, benzoic acid, and p-coumaric acid could be utilized by C. necator with a stimulating effect on C. necator growth. Consequently, the lignin degradation pathway of C. necator was reconstructed based on genomic information and literature. The efficient conversion of intermediate catechol to downstream products of cis,cis-muconate or 2-hydroxymuconate-6-semialdehyde may help improve the robustness of C. necator to benzoic acid and p-coumaric acid as well as improve PHB productivity.

  4. Study of SEY degradation of amorphous carbon coatings

    CERN Document Server

    Bundaleski, N; Santos, A; Teodoro, O M N D; Silva, A G

    2013-01-01

    Deposition of low secondary electron yield (SEY) carbon coatings by magnetron sputtering onto the inner walls of the accelerator seems to be the most promising solution for suppressing the electron cloud problem. However, these coatings change their electron emission properties during long term exposure to air. The ageing process of carbon coated samples with initial SEY of about 0.9 received from CERN is studied as a function of exposure to different environments. It is shown that samples having the same initial SEY may age with different rates. The SEY increase can be correlated with the surface concentration of oxygen. Annealing of samples in air at 100-200 {\\deg}C reduces the ageing rate and even recovers previously degraded samples. The result of annealing is reduction of the hydrogen content in the coatings by triggering its surface segregation followed by desorption.

  5. Metabolism of 2-Chloro-4-Nitroaniline via Novel Aerobic Degradation Pathway by Rhodococcus sp. Strain MB-P1

    Science.gov (United States)

    Khan, Fazlurrahman; Pal, Deepika; Vikram, Surendra; Cameotra, Swaranjit Singh

    2013-01-01

    2-chloro-4-nitroaniline (2-C-4-NA) is used as an intermediate in the manufacture of dyes, pharmaceuticals, corrosion inhibitor and also used in the synthesis of niclosamide, a molluscicide. It is marked as a black-listed substance due to its poor biodegradability. We report biodegradation of 2-C-4-NA and its pathway characterization by Rhodococcus sp. strain MB-P1 under aerobic conditions. The strain MB-P1 utilizes 2-C-4-NA as the sole carbon, nitrogen, and energy source. In the growth medium, the degradation of 2-C-4-NA occurs with the release of nitrite ions, chloride ions, and ammonia. During the resting cell studies, the 2-C-4-NA-induced cells of strain MB-P1 transformed 2-C-4-NA stoichiometrically to 4-amino-3-chlorophenol (4-A-3-CP), which subsequently gets transformed to 6-chlorohydroxyquinol (6-CHQ) metabolite. Enzyme assays by cell-free lysates prepared from 2-C-4-NA-induced MB-P1 cells, demonstrated that the first enzyme in the 2-C-4-NA degradation pathway is a flavin-dependent monooxygenase that catalyzes the stoichiometric removal of nitro group and production of 4-A-3-CP. Oxygen uptake studies on 4-A-3-CP and related anilines by 2-C-4-NA-induced MB-P1 cells demonstrated the involvement of aniline dioxygenase in the second step of 2-C-4-NA degradation. This is the first report showing 2-C-4-NA degradation and elucidation of corresponding metabolic pathway by an aerobic bacterium. PMID:23614030

  6. Metabolism of 2-chloro-4-nitroaniline via novel aerobic degradation pathway by Rhodococcus sp. strain MB-P1.

    Directory of Open Access Journals (Sweden)

    Fazlurrahman Khan

    Full Text Available 2-chloro-4-nitroaniline (2-C-4-NA is used as an intermediate in the manufacture of dyes, pharmaceuticals, corrosion inhibitor and also used in the synthesis of niclosamide, a molluscicide. It is marked as a black-listed substance due to its poor biodegradability. We report biodegradation of 2-C-4-NA and its pathway characterization by Rhodococcus sp. strain MB-P1 under aerobic conditions. The strain MB-P1 utilizes 2-C-4-NA as the sole carbon, nitrogen, and energy source. In the growth medium, the degradation of 2-C-4-NA occurs with the release of nitrite ions, chloride ions, and ammonia. During the resting cell studies, the 2-C-4-NA-induced cells of strain MB-P1 transformed 2-C-4-NA stoichiometrically to 4-amino-3-chlorophenol (4-A-3-CP, which subsequently gets transformed to 6-chlorohydroxyquinol (6-CHQ metabolite. Enzyme assays by cell-free lysates prepared from 2-C-4-NA-induced MB-P1 cells, demonstrated that the first enzyme in the 2-C-4-NA degradation pathway is a flavin-dependent monooxygenase that catalyzes the stoichiometric removal of nitro group and production of 4-A-3-CP. Oxygen uptake studies on 4-A-3-CP and related anilines by 2-C-4-NA-induced MB-P1 cells demonstrated the involvement of aniline dioxygenase in the second step of 2-C-4-NA degradation. This is the first report showing 2-C-4-NA degradation and elucidation of corresponding metabolic pathway by an aerobic bacterium.

  7. Metabolism of 2-chloro-4-nitroaniline via novel aerobic degradation pathway by Rhodococcus sp. strain MB-P1.

    Science.gov (United States)

    Khan, Fazlurrahman; Pal, Deepika; Vikram, Surendra; Cameotra, Swaranjit Singh

    2013-01-01

    2-chloro-4-nitroaniline (2-C-4-NA) is used as an intermediate in the manufacture of dyes, pharmaceuticals, corrosion inhibitor and also used in the synthesis of niclosamide, a molluscicide. It is marked as a black-listed substance due to its poor biodegradability. We report biodegradation of 2-C-4-NA and its pathway characterization by Rhodococcus sp. strain MB-P1 under aerobic conditions. The strain MB-P1 utilizes 2-C-4-NA as the sole carbon, nitrogen, and energy source. In the growth medium, the degradation of 2-C-4-NA occurs with the release of nitrite ions, chloride ions, and ammonia. During the resting cell studies, the 2-C-4-NA-induced cells of strain MB-P1 transformed 2-C-4-NA stoichiometrically to 4-amino-3-chlorophenol (4-A-3-CP), which subsequently gets transformed to 6-chlorohydroxyquinol (6-CHQ) metabolite. Enzyme assays by cell-free lysates prepared from 2-C-4-NA-induced MB-P1 cells, demonstrated that the first enzyme in the 2-C-4-NA degradation pathway is a flavin-dependent monooxygenase that catalyzes the stoichiometric removal of nitro group and production of 4-A-3-CP. Oxygen uptake studies on 4-A-3-CP and related anilines by 2-C-4-NA-induced MB-P1 cells demonstrated the involvement of aniline dioxygenase in the second step of 2-C-4-NA degradation. This is the first report showing 2-C-4-NA degradation and elucidation of corresponding metabolic pathway by an aerobic bacterium. PMID:23614030

  8. Photocatalytic degradation of triazophos in aqueous titanium dioxide suspension: Identification of intermediates and degradation pathways

    International Nuclear Information System (INIS)

    The photocatalytic degradation of triazophos in aqueous TiO2 suspension has been studied in a photoreactor operating with simulated solar radiation. The decrease in triazophos concentration followed first-order kinetics with a half-life of 4.76 ± 0.42 h at a TiO2 suspension concentration of 10 mg/L. Seventeen degradation products were identified using HPLC-UV, HPLC/MS/MS, GC/MS/MS and IC, and by comparing retention times and spectra with commercially available authentic standards. On the basis of the observed transformation products, two routes were proposed, one based on the initial oxidative cleavage of P = S bond to P = O bond, and the other on initial cleavage of the ester P-O bonds. Photocatalysis holds promise for the solar treatment of pesticide-contaminated waters

  9. Transition pathways for a UK low carbon electricity future

    International Nuclear Information System (INIS)

    Achieving long-term targets for greenhouse gas emissions reductions, such as the UK's legally-binding target of reducing its emissions by 80% by 2050, will require a transition in systems for meeting and shaping energy service demands, involving radical substitution to low-carbon supply technologies and improvements in end-use energy efficiency. This paper describes the development and high-level analysis of a set of transition pathways to a UK low carbon electricity system, explaining key features of the core pathways developed and the distinctiveness and value of the approach. The pathways use an ‘action space’ concept to explore the dynamic interactions between choices made by actors, which are influenced by the competing governance ‘framings’ or ‘logics’ that different actors pursue. The paper sets out three core transition pathways – Market Rules, Central Co-ordination and Thousand Flowers, in which market, government and civil society logics respectively dominate. It summarises the key technological and institutional changes in these pathways, and the roles of actors in bringing these about. This leads to an identification of the key risks to the realisation of each of the pathways, and of the challenges for individuals, businesses, social movements and policy-makers in taking action to bring them about and sustain them. - Highlights: ► Development of a set of transition pathways to a UK low carbon electricity system. ► Action space to explore the dynamic interactions between choices made by actors. ► Three core pathways in which market, government and civil society logics dominate. ► Key technological and institutional changes, and the roles of actors in pathways. ► Challenges for different actors in realising pathways.

  10. Community diversity, structure and carbon footprint of nematode food web following reforestation on degraded Karst soil.

    Science.gov (United States)

    Hu, Ning; Li, Hui; Tang, Zheng; Li, Zhongfang; Tian, Jing; Lou, Yilai; Li, Jianwei; Li, Guichun; Hu, Xiaomin

    2016-01-01

    We examined community diversity, structure and carbon footprint of nematode food web along a chronosequence of T. Sinensis reforestation on degraded Karst. In general, after the reforestation: a serious of diversity parameters and community indices (Shannon-Weinier index (H'), structure index (SI), etc.) were elevated; biomass ratio of fungivores to bacterivores (FFC/BFC), and fungi to bacteria (F/B) were increased, and nematode channel ratio (NCR) were decreased; carbon footprints of all nematode trophic groups, and biomass of bacteria and fungi were increased. Our results indicate that the Karst aboveground vegetation restoration was accompanied with belowground nematode food web development: increasing community complexity, function and fungal dominance in decomposition pathway, and the driving forces included the bottom-up effect (resource control), connectedness of functional groups, as well as soil environments. PMID:27311984

  11. Community diversity, structure and carbon footprint of nematode food web following reforestation on degraded Karst soil

    Science.gov (United States)

    Hu, Ning; Li, Hui; Tang, Zheng; Li, Zhongfang; Tian, Jing; Lou, Yilai; Li, Jianwei; Li, Guichun; Hu, Xiaomin

    2016-06-01

    We examined community diversity, structure and carbon footprint of nematode food web along a chronosequence of T. Sinensis reforestation on degraded Karst. In general, after the reforestation: a serious of diversity parameters and community indices (Shannon-Weinier index (H‧), structure index (SI), etc.) were elevated; biomass ratio of fungivores to bacterivores (FFC/BFC), and fungi to bacteria (F/B) were increased, and nematode channel ratio (NCR) were decreased; carbon footprints of all nematode trophic groups, and biomass of bacteria and fungi were increased. Our results indicate that the Karst aboveground vegetation restoration was accompanied with belowground nematode food web development: increasing community complexity, function and fungal dominance in decomposition pathway, and the driving forces included the bottom-up effect (resource control), connectedness of functional groups, as well as soil environments.

  12. Combination of degradation pathways for naphthalene utilization in Rhodococcus sp. strain TFB

    OpenAIRE

    Tomás-Gallardo, Laura; Gómez-Álvarez, Helena; Santero, Eduardo; Floriano, Belén

    2013-01-01

    R hodococcus sp. strain TFB is a metabolic versatile bacterium able to grow on naphthalene as the only carbon and energy source. Applying proteomic, genetic and biochemical approaches, we propose in this paper that, at least, three coordinated but independently regulated set of genes are combined to degrade naphthalene in TFB. First, proteins involved in tetralin degradation are also induced by naphthalene and may carry out its conversion to salicylaldehyde. This is the only part of the napht...

  13. Carbon pathways in the Seine river system

    Science.gov (United States)

    Marescaux, Audrey; Garnier, Josette; Thieu, Vincent

    2016-04-01

    Many papers have recently suggested that the anthropogenic perturbations of the carbon cycle have led to a significant increase in carbon export from terrestrial ecosystems to inland waters. The quantification of the carbon cascade (including fate of CO2 emissions) in highly anthropized river systems is thus essential to understand the response of aquatic systems. The Seine Basin where Paris and its environs represent 2/3 of its population, and agriculture is particularly intensive, is a eutrophic system. The main aim of this research is to understand and quantify how an excess of anthropogenic nutrients entering the Seine River system may locally enhance primary production, C sequestration, C respiration and CO2 emissions. The development of a new CO2 module in the pre-existing biogeochemical Riverstrahler model (Billen et al., 2007) should enable a refined calculation of the carbon budget. Besides calculation of the Respiration and Production activities along the entire river continuum, it will directly associate CO2 emissions. The CO2 modelling results will be confronted to (i) direct (in-situ) measurements with a non-dispersive infrared gas analyzer and (ii) indirect measurements based on total alkalinity, carbonate and pH along the Seine river system during the last decades, and (iii) calculations of a C metabolism budget. Billen, G., Garnier, J., Némery, J., Sebilo, M., Sferratore, A., Barles, S., Benoit P., Benoît, M. (2007). A long-term view of nutrient transfers through the Seine river continuum. Science of the Total Environment, 375(1-3), 80-97. http://doi.org/10.1016/j.scitotenv.2006.12.005

  14. Bis(2-chloroethoxy)methane degradation by TiO2 photocatalysis: Parameter and reaction pathway investigations

    International Nuclear Information System (INIS)

    Haloethers are widely used in industry, and the release of these species into the environment is of great concern because of their toxicity and carcinogenicity. The present study deals with the photocatalytic degradation of the haloether, bis(2-chloroethoxy)methane (BCEXM), in the presence of TiO2 particles and UV-A (λ = 365 nm) radiation. About 99.5% of BCEXM was degraded after UV irradiation for 16 h. Factors such as solution pH, TiO2 dosage, and the presence of anions were found to influence the degradation rate. To obtain a better understanding of the mechanistic details of this TiO2-assisted photodegradation of BCEXM with UV irradiation, the intermediates of the processes were separated, identified, and characterized by the solid-phase microextraction (SPME) and gas chromatography/mass spectrometry (GC/MS) technique. To the best of our knowledge, this is the first report on the degradation pathways of BCEXM. The first step in the destruction of BCEXM is thought to be abstraction of a hydrogen by ·OH to form a carbon-centered radical which then reacts with O2 to form a peroxyl radical. Peroxyl radicals react with one another and produce an alkoxy radical. The β-bond fragmentation of the alkoxy radical produces different intermediates.

  15. Bis(2-chloroethoxy)methane degradation by TiO{sub 2} photocatalysis: Parameter and reaction pathway investigations

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Chiing-Chang [Department of Science Application and Dissemination, National Taichung University, Taichung 403, Taiwan (China); Wu, Ren-Jang; Yao, I.-Chun [Department of Applied Chemistry, Providence University, Taichung 433, Taiwan (China); Lu, Chung-Shin, E-mail: cslu6@ntcnc.edu.tw [Department of General Education, National Taichung Nursing College, No. 193, Sec. 1, San-Min Road, Taichung 403, Taiwan (China)

    2009-12-30

    Haloethers are widely used in industry, and the release of these species into the environment is of great concern because of their toxicity and carcinogenicity. The present study deals with the photocatalytic degradation of the haloether, bis(2-chloroethoxy)methane (BCEXM), in the presence of TiO{sub 2} particles and UV-A ({lambda} = 365 nm) radiation. About 99.5% of BCEXM was degraded after UV irradiation for 16 h. Factors such as solution pH, TiO{sub 2} dosage, and the presence of anions were found to influence the degradation rate. To obtain a better understanding of the mechanistic details of this TiO{sub 2}-assisted photodegradation of BCEXM with UV irradiation, the intermediates of the processes were separated, identified, and characterized by the solid-phase microextraction (SPME) and gas chromatography/mass spectrometry (GC/MS) technique. To the best of our knowledge, this is the first report on the degradation pathways of BCEXM. The first step in the destruction of BCEXM is thought to be abstraction of a hydrogen by {sup {center_dot}}OH to form a carbon-centered radical which then reacts with O{sub 2} to form a peroxyl radical. Peroxyl radicals react with one another and produce an alkoxy radical. The {beta}-bond fragmentation of the alkoxy radical produces different intermediates.

  16. Degradation of oxcarbazepine by UV-activated persulfate oxidation: kinetics, mechanisms, and pathways.

    Science.gov (United States)

    Bu, Lingjun; Zhou, Shiqing; Shi, Zhou; Deng, Lin; Li, Guangchao; Yi, Qihang; Gao, Naiyun

    2016-02-01

    The degradation kinetics and mechanism of the antiepileptic drug oxcarbazepine (OXC) by UV-activated persulfate oxidation were investigated in this study. Results showed that UV/persulfate (UV/PS) process appeared to be more effective in degrading OXC than UV or PS alone. The OXC degradation exhibited a pseudo-first order kinetics pattern and the degradation rate constants (k obs) were affected by initial OXC concentration, PS dosage, initial pH, and humic acid concentration to different degrees. It was found that low initial OXC concentration, high persulfate dosage, and initial pH enhanced the OXC degradation. Additionally, the presence of humic acid in the solution could greatly inhibit the degradation of OXC. Moreover, hydroxyl radical (OH•) and sulfate radical (SO4 (-)••) were identified to be responsible for OXC degradation and SO4 (-)• made the predominant contribution in this study. Finally, major intermediate products were identified and a preliminary degradation pathway was proposed. Results demonstrated that UV/PS system is a potential technology to control the water pollution caused by emerging contaminants such as OXC. PMID:26452660

  17. Phosphoketolase Pathway Engineering for Carbon-Efficient Biocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Henard, Calvin Andrew [National Renewable Energy Lab. (NREL), Golden, CO (United States); Freed, Emily Frances [National Renewable Energy Lab. (NREL), Golden, CO (United States); Guarnieri, Michael Thomas [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2015-09-08

    Recent advances in metabolic engineering have facilitated the development of microbial biocatalysts capable of producing an array of bio-products, ranging from fuels to drug molecules. These bio-products are commonly generated through an acetyl-CoA intermediate, which serves as a key precursor in the biological conversion of carbon substrates. Moreover, conventional biocatalytic upgrading strategies proceeding through this route are limited by low carbon efficiencies, in large part due to carbon losses associated with pyruvate decarboxylation to acetyl-CoA. Bypass of pyruvate decarboxylation offers a means to dramatically enhance carbon yields and, in turn, bioprocess economics. Here, we discuss recent advances and prospects for employing the phosphoketolase pathway for direct biosynthesis of acetyl-CoA from carbon substrates, and phosphoketolase-based metabolic engineering strategies for carbon efficient biocatalysis.

  18. Transitions in pathways of human development and carbon emissions

    International Nuclear Information System (INIS)

    Countries are known to follow diverse pathways of life expectancy and carbon emissions, but little is known about factors driving these dynamics. In this letter we estimate the cross-sectional economic, demographic and geographic drivers of consumption-based carbon emissions. Using clustering techniques, countries are grouped according to their drivers, and analysed with respect to a criteria of one tonne of carbon emissions per capita and a life expectancy over 70 years (Goldemberg’s Corner). Five clusters of countries are identified with distinct drivers and highly differentiated outcomes of life expectancy and carbon emissions. Representatives from four clusters intersect within Goldemberg’s Corner, suggesting diverse combinations of drivers may still lead to sustainable outcomes, presenting many countries with an opportunity to follow a pathway towards low-carbon human development. By contrast, within Goldemberg’s Corner, there are no countries from the core, wealthy consuming nations. These results reaffirm the need to address economic inequalities within international agreements for climate mitigation, but acknowledge plausible and accessible examples of low-carbon human development for countries that share similar underlying drivers of carbon emissions. In addition, we note differences in drivers between models of territorial and consumption-based carbon emissions, and discuss interesting exceptions to the drivers-based cluster analysis. (paper)

  19. Carbon emissions from tropical forest degradation caused by logging

    International Nuclear Information System (INIS)

    The focus of land-use related efforts in developing countries to reduce carbon emissions has been on slowing deforestation, yet international agreements are to reduce emissions from both deforestation and forest degradation (REDD). The second ‘D’ is poorly understood and accounted for a number of technical and policy reasons. Here we introduce a complete accounting method for estimating emission factors from selective timber harvesting, a substantial form of forest degradation in many tropical developing countries. The method accounts separately for emissions from the extracted log, from incidental damage to the surrounding forest, and from logging infrastructure, and emissions are expressed as units of carbon per cubic meter of timber extracted to allow for simple application to timber harvesting statistics. We applied the method in six tropical countries (Belize, Bolivia, Brazil, Guyana, Indonesia, and Republic of Congo), resulting in total emission factors of 0.99−2.33 Mg C m−3. In all cases, emissions were dominated by damage to surrounding vegetation and the infrastructure rather than the logs themselves, and total emissions represented about 3–15% of the biomass carbon stocks of the associated unlogged forests. We then combined the emission factors with country level logging statistics for nine key timber producing countries represented by our study areas to gain an understanding of the order of magnitude of emissions from degradation compared to those recently reported for deforestation in the same countries. For the nine countries included, emissions from logging were on average equivalent to about 12% of those from deforestation. For those nine countries with relatively low emissions from deforestation, emissions from logging were equivalent to half or more of those from deforestation, whereas for those countries with the highest emissions from deforestation, emissions from logging were equivalent to <10% of those from deforestation

  20. Nuclear mRNA degradation pathway(s are implicated in Xist regulation and X chromosome inactivation.

    Directory of Open Access Journals (Sweden)

    Constance Ciaudo

    2006-06-01

    Full Text Available A critical step in X-chromosome inactivation (XCI, which results in the dosage compensation of X-linked gene expression in mammals, is the coating of the presumptive inactive X chromosome by the large noncoding Xist RNA, which then leads to the recruitment of other factors essential for the heterochromatinisation of the inactive X and its transcriptional silencing. In an approach aimed at identifying genes implicated in the X-inactivation process by comparative transcriptional profiling of female and male mouse gastrula, we identified the Eif1 gene involved in translation initiation and RNA degradation. We show here that female embryonic stem cell lines, silenced by RNA interference for the Eif1 gene, are unable to form Xist RNA domains upon differentiation and fail to undergo X-inactivation. To probe further an effect involving RNA degradation pathways, the inhibition by RNA interference of Rent1, a factor essential for nonsense-mediated decay and Exosc10, a specific nuclear component of the exosome, was analysed and shown to similarly impair Xist upregulation and XCI. In Eif1-, Rent1-, and Exosc10-interfered clones, Xist spliced form(s are strongly downregulated, while the levels of unspliced form(s of Xist and the stability of Xist RNA remain comparable to that of the control cell lines. Our data suggests a role for mRNA nuclear degradation pathways in the critical regulation of spliced Xist mRNA levels and the onset of the X-inactivation process.

  1. Degradation of Dissolved Organic Carbon from Discontinuous Permafrost Due to Photolysis and Different Inoculants

    Science.gov (United States)

    Aukes, P.; Schiff, S. L.

    2013-12-01

    Northern areas with permafrost are very susceptible to a warming climate. Temperature increases can alter hydrologic flow paths, increase the depth and biogeochemistry of the active layer, and degrade and reduce the amount of remaining permafrost. Particularly, loss of permafrost will release large stores of previously unavailable frozen carbon to the environment. Dissolved organic carbon (DOC) plays many important roles that affect both ecosystem health and drinking water quality. Comprised of countless different molecules, DOC absorbs harmful ultra-violet (UV) radiation and controls thermal regimes of lakes, is an important energy and nutrient source for heterotrophic microbes, complexes with and transports heavy metals, and reacts during chlorination of drinking water to form carcinogenic disinfection by-products. Since the ultimate fate of DOC depends on its reactivity with the surrounding environment, the implications of DOC released from permafrost for ecosystems and drinking water quality will vary across the landscape. We used 90-day lab incubations to assess the differences in quality of DOC by observing the susceptibility for DOC to degrade among various discontinuous-permafrost sources. Specifically, UV-photolysis and two surface water inoculants (pond and creek water filtered to 2.0μm) were used to represent the dominant degradation pathways encountered within the environment. Samples were taken in July 2013 from three locations (pond, creek, and wetland porewater) in a region of discontinuous permafrost near Yellowknife, NWT, Canada. We observed changes to the composition and quality of DOC resulting from photolysis and degradation by two inoculants over 90 days, where DOC quality was determined by Liquid Chromatography - Organic Carbon Detection, DOC:DON, UV-absorbance, and changes to other constituents (DIC, δ13C-DIC, CO2). We hypothesize that UV-photolysis and microbial degradation will readily degrade easily accessible and reactive components of

  2. Pathways for implementing REDD+. Experiences from carbon markets and communities

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, X.; Ravnkilde Moeller, L.; Lopez, T. De; Romero, M.Z.

    2011-07-01

    This issue of Carbon Market Perspectives on 'Pathways for implementing REDD+: Experience from carbon markets and communities' discusses the role of carbon markets in scaling up investments for REDD+ in developing countries. Nine articles authored by experienced negotiators on REDD+, carbon market actors, project developers and other leading experts share experiences and make suggestions on the key elements of a future international REDD+ regime: Architecture and underlying principles, measuring, reporting and verification (MRV), private-sector involvement, the rights of indigenous people and local communities, biodiversity conservation and environmental integrity. The articles are grouped under three main topics: the lessons of existing REDD+ projects; the future REDD+ regime and the role of carbon markets; and experiences and ideas about the involvement of indigenous people and local communities. (LN)

  3. Differential impact of diverse anticancer chemotherapeutics on the Cdc25A-degradation checkpoint pathway

    International Nuclear Information System (INIS)

    When exposed to DNA-damaging insults such as ionizing radiation (IR) or ultraviolet light (UV), mammalian cells activate checkpoint pathways to halt cell cycle progression or induce cell death. Here we examined the ability of five commonly used anticancer drugs with different mechanisms of action to activate the Chk1/Chk2-Cdc25A-CDK2/cyclin E cell cycle checkpoint pathway, previously shown to be induced by IR or UV. Whereas exposure of human cells to topoisomerase inhibitors camptothecin, etoposide, or adriamycin resulted in rapid (within 1 h) activation of the pathway including degradation of the Cdc25A phosphatase and inhibition of cyclin E/CDK2 kinase activity, taxol failed to activate this checkpoint even after a prolonged treatment. Unexpectedly, although the alkylating agent cisplatin also induced degradation of Cdc25A (albeit delayed, after 8-12 h), cyclin E/CDK2 activity was elevated and DNA synthesis continued, a phenomena that correlated with increased E2F1 protein levels and consequently enhanced expression of cyclin E. These results reveal a differential impact of various classes of anticancer chemotherapeutics on the Cdc25A-degradation pathway, and indicate that the kinetics of checkpoint induction, and the relative balance of key components within the DNA damage response network may dictate whether the treated cells arrest their cell cycle progression

  4. Elucidating the Pseudomonas aeruginosa fatty acid degradation pathway: identification of additional fatty acyl-CoA synthetase homologues.

    Directory of Open Access Journals (Sweden)

    Jan Zarzycki-Siek

    Full Text Available The fatty acid (FA degradation pathway of Pseudomonas aeruginosa, an opportunistic pathogen, was recently shown to be involved in nutrient acquisition during BALB/c mouse lung infection model. The source of FA in the lung is believed to be phosphatidylcholine, the major component of lung surfactant. Previous research indicated that P. aeruginosa has more than two fatty acyl-CoA synthetase genes (fadD; PA3299 and PA3300, which are responsible for activation of FAs using ATP and coenzyme A. Through a bioinformatics approach, 11 candidate genes were identified by their homology to the Escherichia coli FadD in the present study. Four new homologues of fadD (PA1617, PA2893, PA3860, and PA3924 were functionally confirmed by their ability to complement the E. coli fadD mutant on FA-containing media. Growth phenotypes of 17 combinatorial fadD mutants on different FAs, as sole carbon sources, indicated that the four new fadD homologues are involved in FA degradation, bringing the total number of P. aeruginosa fadD genes to six. Of the four new homologues, fadD4 (PA1617 contributed the most to the degradation of different chain length FAs. Growth patterns of various fadD mutants on plant-based perfumery substances, citronellic and geranic acids, as sole carbon and energy sources indicated that fadD4 is also involved in the degradation of these plant-derived compounds. A decrease in fitness of the sextuple fadD mutant, relative to the ΔfadD1D2 mutant, was only observed during BALB/c mouse lung infection at 24 h.

  5. Elucidating the Pseudomonas aeruginosa fatty acid degradation pathway: identification of additional fatty acyl-CoA synthetase homologues.

    Science.gov (United States)

    Zarzycki-Siek, Jan; Norris, Michael H; Kang, Yun; Sun, Zhenxin; Bluhm, Andrew P; McMillan, Ian A; Hoang, Tung T

    2013-01-01

    The fatty acid (FA) degradation pathway of Pseudomonas aeruginosa, an opportunistic pathogen, was recently shown to be involved in nutrient acquisition during BALB/c mouse lung infection model. The source of FA in the lung is believed to be phosphatidylcholine, the major component of lung surfactant. Previous research indicated that P. aeruginosa has more than two fatty acyl-CoA synthetase genes (fadD; PA3299 and PA3300), which are responsible for activation of FAs using ATP and coenzyme A. Through a bioinformatics approach, 11 candidate genes were identified by their homology to the Escherichia coli FadD in the present study. Four new homologues of fadD (PA1617, PA2893, PA3860, and PA3924) were functionally confirmed by their ability to complement the E. coli fadD mutant on FA-containing media. Growth phenotypes of 17 combinatorial fadD mutants on different FAs, as sole carbon sources, indicated that the four new fadD homologues are involved in FA degradation, bringing the total number of P. aeruginosa fadD genes to six. Of the four new homologues, fadD4 (PA1617) contributed the most to the degradation of different chain length FAs. Growth patterns of various fadD mutants on plant-based perfumery substances, citronellic and geranic acids, as sole carbon and energy sources indicated that fadD4 is also involved in the degradation of these plant-derived compounds. A decrease in fitness of the sextuple fadD mutant, relative to the ΔfadD1D2 mutant, was only observed during BALB/c mouse lung infection at 24 h. PMID:23737986

  6. Catalytic thermolysis in treating Cibacron Blue in aqueous solution: Kinetics and degradation pathway.

    Science.gov (United States)

    Su, Claire Xin-Hui; Teng, Tjoon-Tow; Wong, Yee-Shian; Morad, Norhashimah; Rafatullah, Mohd

    2016-03-01

    A thermal degradation pathway of the decolourisation of Reactive Cibacron Blue F3GA (RCB) in aqueous solution through catalytic thermolysis is established. Catalytic thermolysis is suitable for the removal of dyes from wastewater as it breaks down the complex dye molecules instead of only transferring them into another phase. RCB is a reactive dye that consists of three main groups, namely anthraquinone, benzene and triazine groups. Through catalytic thermolysis, the bonds that hold the three groups together were effectively broken and at the same time, the complex molecules degraded to form simple molecules of lower molecular weight. The degradation pathway and products were characterized and determined through UV-Vis, FT-IR and GCMS analysis. RCB dye molecule was successfully broken down into simpler molecules, namely, benzene derivatives, amines and triazine. The addition of copper sulphate, CuSO4, as a catalyst, hastens the thermal degradation of RCB by aiding in the breakdown of large, complex molecules. At pH 2 and catalyst mass loading of 5 g/L, an optimum colour removal of 66.14% was observed. The degradation rate of RCB is well explained by first order kinetics model. PMID:26741557

  7. Toward an integrated monitoring framework to assess the effects of tropical forest degradation and recovery on carbon stocks and biodiversity.

    Science.gov (United States)

    Bustamante, Mercedes M C; Roitman, Iris; Aide, T Mitchell; Alencar, Ane; Anderson, Liana O; Aragão, Luiz; Asner, Gregory P; Barlow, Jos; Berenguer, Erika; Chambers, Jeffrey; Costa, Marcos H; Fanin, Thierry; Ferreira, Laerte G; Ferreira, Joice; Keller, Michael; Magnusson, William E; Morales-Barquero, Lucia; Morton, Douglas; Ometto, Jean P H B; Palace, Michael; Peres, Carlos A; Silvério, Divino; Trumbore, Susan; Vieira, Ima C G

    2016-01-01

    Tropical forests harbor a significant portion of global biodiversity and are a critical component of the climate system. Reducing deforestation and forest degradation contributes to global climate-change mitigation efforts, yet emissions and removals from forest dynamics are still poorly quantified. We reviewed the main challenges to estimate changes in carbon stocks and biodiversity due to degradation and recovery of tropical forests, focusing on three main areas: (1) the combination of field surveys and remote sensing; (2) evaluation of biodiversity and carbon values under a unified strategy; and (3) research efforts needed to understand and quantify forest degradation and recovery. The improvement of models and estimates of changes of forest carbon can foster process-oriented monitoring of forest dynamics, including different variables and using spatially explicit algorithms that account for regional and local differences, such as variation in climate, soil, nutrient content, topography, biodiversity, disturbance history, recovery pathways, and socioeconomic factors. Generating the data for these models requires affordable large-scale remote-sensing tools associated with a robust network of field plots that can generate spatially explicit information on a range of variables through time. By combining ecosystem models, multiscale remote sensing, and networks of field plots, we will be able to evaluate forest degradation and recovery and their interactions with biodiversity and carbon cycling. Improving monitoring strategies will allow a better understanding of the role of forest dynamics in climate-change mitigation, adaptation, and carbon cycle feedbacks, thereby reducing uncertainties in models of the key processes in the carbon cycle, including their impacts on biodiversity, which are fundamental to support forest governance policies, such as Reducing Emissions from Deforestation and Forest Degradation. PMID:26390852

  8. A novel denitrifying bacterial isolate that degrades trimethylamine both aerobically and anaerobically via two different pathways.

    Science.gov (United States)

    Kim, S G; Bae, H S; Lee, S T

    2001-10-01

    The aerobic and anaerobic degradation of trimethylamine by a newly isolated denitrifying bacterium from an enrichment culture with trimethylamine inoculated with activated sludge was studied. Based on 16S rDNA analysis, this strain was identified as a Paracoccus sp. The isolate, strain T231, aerobically degraded trimethylamine, dimethylamine and methylamine and released a stoichiometric amount of ammonium ion into the culture fluid as a metabolic product, indicating that these methylated amines were completely degraded to formaldehyde and ammonia. The strain degraded trimethylamine also under denitrifying conditions and consumed a stoichiometric amount of nitrate, demonstrating that complete degradation of trimethylamine was coupled with nitrate reduction. Cell-free extract prepared from cells grown aerobically on trimethylamine exhibited activities of trimethylamine mono-oxygenase, trimethylamine N-oxide demethylase, dimethylamine mono-oxygenase, and methylamine mono-oxygenase. Cell-free extract from cells grown anaerobically on trimethylamine and nitrate exhibited activities of trimethylamine dehydrogenase and dimethylamine dehydrogenase. These results indicate that strain T231 had two different pathways for aerobic and anaerobic degradation of trimethylamine. This is a new feature for trimethylamine metabolism in denitrifying bacteria. PMID:11685371

  9. Sodium persulfate-assisted mechanochemical degradation of tetrabromobisphenol A: Efficacy, products and pathway.

    Science.gov (United States)

    Liu, Xitao; Zhang, Xiaohui; Zhang, Kunlun; Qi, Chengdu

    2016-05-01

    In recent years, activated persulfate (PS) oxidation has been developed as a new advanced oxidation process for the degradation of organic pollutants. On the other hand, the mechanochemical method has exhibited a unique advantage in dealing with chemical wastes. The degradation of tetrabromobisphenol A (TBBPA), a widely used brominated flame retardant (BFR), in wastes has attracted considerable attention. In this study, the efficacy of a CaO-mechanochemical (CaO-MC) treatment system assisted by the addition of PS for the degradation of TBBPA was investigated. Under the optimum reaction conditions with a mole ratio of PS:CaO = 1:4 and less than 12.5% of TBBPA by mass, the degradation and debromination of TBBPA were completed within 2 h, while the mineralization was completed within 4 h. Characterization of the milled sample by XRD revealed that CaSO4 crystallization occurred. The TG results illustrate that there was little organic matter left after 4 h of milling. Raman and FT-IR spectra exhibited the TBBPA destruction process and disappearance of the organic groups. Through analysis by LC/MS/MS, seventeen intermediates were identified. The mechanism of TBBPA degradation by the PS-assisted CaO-MC treatment system was explained from two aspects, the course of crystallization and the degradation of TBBPA by activated PS, and two parallel initiation pathways were proposed. PMID:26359264

  10. Impacts of management practices on soil organic carbon in degraded alpine meadows on the Tibetan Plateau

    OpenAIRE

    X. F. Chang; Wang, S.P.; X. X. ZHU; Cui, S. J.; Luo, C. Y.; Zhang, Z. H.; A. Wilkes

    2014-01-01

    Grassland soil organic carbon (SOC) is sensitive to anthropogenic activities. Increased anthropogenic disturbance related to overgrazing has led to widespread alpine grassland degradation on the Tibetan Plateau. The degraded grasslands are considered to have great potential for carbon sequestration after adoption of improved management practices. Here, we calibrated and employed the Century model to investigate the effects of overgrazing and improved managem...

  11. Molecular and biochemical characterization of the tetralin degradation pathway in Rhodococcus sp. strain TFB

    OpenAIRE

    Tomás‐Gallardo, Laura; Santero, Eduardo; Camafeita, Emilio; Calvo, Enrique; Schlömann, Michael; Floriano, Belén

    2009-01-01

    Summary The tetralin biodegradation pathway in Rhodococcus sp. strain TFB, a Gram‐positive bacterium resistant to genetic manipulation, was characterized using a proteomic approach. Relative protein expression in cell free extracts from tetralin‐ and glucose‐grown cells was compared using the 2D‐DIGE technique. Identification of proteins specifically expressed in tetralin‐grown cells was used to characterize a complete set of genes involved in tetralin degradation by reverse genetics. We prop...

  12. Metabolic pathway of 3,6-anhydro-D-galactose in carrageenan-degrading microorganisms.

    Science.gov (United States)

    Lee, Sun Bok; Kim, Jeong Ah; Lim, Hyun Seung

    2016-05-01

    Complete hydrolysis of κ-carrageenan produces two sugars, D-galactose and 3,6-anhydro-D-galactose (D-AnG). At present, however, we do not know how carrageenan-degrading microorganisms metabolize D-AnG. In this study, we investigated the metabolic pathway of D-AnG degradation by comparative genomic analysis of Cellulophaga lytica LIM-21, Pseudoalteromonas atlantica T6c, and Epulopiscium sp. N.t. morphotype B, which represent the classes Flavobacteria, Gammaproteobacteria, and Clostridia, respectively. In this bioinformatic analysis, we found candidate common genes that were believed to be involved in D-AnG metabolism. We then experimentally confirmed the enzymatic function of each gene product in the D-AnG cluster. In all three microorganisms, D-AnG metabolizing genes were clustered and organized in operon-like arrangements, which we named as the dan operon (3,6-d-anhydro-galactose). Combining bioinformatic analysis and experimental data, we showed that D-AnG is metabolized to pyruvate and D-glyceraldehyde-3-phosphate via four enzyme-catalyzed reactions in the following route: 3,6-anhydro-D-galactose → 3,6-anhydro-D-galactonate → 2-keto-3-deoxy-D-galactonate (D-KDGal) → 2-keto-3-deoxy-6-phospho-D-galactonate → pyruvate + D-glyceraldehyde-3-phosphate. The pathway of D-AnG degradation is composed of two parts: transformation of D-AnG to D-KDGal using two D-AnG specific enzymes and breakdown of D-KDGal to two glycolysis intermediates using two DeLey-Doudoroff pathway enzymes. To our knowledge, this is the first report on the metabolic pathway of D-AnG degradation. PMID:26875872

  13. Pathways of organic carbon oxidation in three continental margin sediments

    DEFF Research Database (Denmark)

    Canfield, Donald Eugene; Jørgensen, Bo Barker; Fossing, Henrik;

    1993-01-01

    important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and......We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that...... O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated...

  14. Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?

    Science.gov (United States)

    Scoma, Alberto; Barbato, Marta; Hernandez-Sanabria, Emma; Mapelli, Francesca; Daffonchio, Daniele; Borin, Sara; Boon, Nico

    2016-01-01

    Oil spills represent an overwhelming carbon input to the marine environment that immediately impacts the sea surface ecosystem. Microbial communities degrading the oil fraction that eventually sinks to the seafloor must also deal with hydrostatic pressure, which linearly increases with depth. Piezosensitive hydrocarbonoclastic bacteria are ideal candidates to elucidate impaired pathways following oil spills at low depth. In the present paper, we tested two strains of the ubiquitous Alcanivorax genus, namely A. jadensis KS_339 and A. dieselolei KS_293, which is known to rapidly grow after oil spills. Strains were subjected to atmospheric and mild pressure (0.1, 5 and 10 MPa, corresponding to a depth of 0, 500 and 1000 m, respectively) providing n-dodecane as sole carbon source. Pressures equal to 5 and 10 MPa significantly lowered growth yields of both strains. However, in strain KS_293 grown at 10 MPa CO2 production per cell was not affected, cell integrity was preserved and PO4(3-) uptake increased. Analysis of its transcriptome revealed that 95% of its genes were downregulated. Increased transcription involved protein synthesis, energy generation and respiration pathways. Interplay between these factors may play a key role in shaping the structure of microbial communities developed after oil spills at low depth and limit their bioremediation potential. PMID:27020120

  15. Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?

    Science.gov (United States)

    Scoma, Alberto; Barbato, Marta; Hernandez-Sanabria, Emma; Mapelli, Francesca; Daffonchio, Daniele; Borin, Sara; Boon, Nico

    2016-03-01

    Oil spills represent an overwhelming carbon input to the marine environment that immediately impacts the sea surface ecosystem. Microbial communities degrading the oil fraction that eventually sinks to the seafloor must also deal with hydrostatic pressure, which linearly increases with depth. Piezosensitive hydrocarbonoclastic bacteria are ideal candidates to elucidate impaired pathways following oil spills at low depth. In the present paper, we tested two strains of the ubiquitous Alcanivorax genus, namely A. jadensis KS_339 and A. dieselolei KS_293, which is known to rapidly grow after oil spills. Strains were subjected to atmospheric and mild pressure (0.1, 5 and 10 MPa, corresponding to a depth of 0, 500 and 1000 m, respectively) providing n-dodecane as sole carbon source. Pressures equal to 5 and 10 MPa significantly lowered growth yields of both strains. However, in strain KS_293 grown at 10 MPa CO2 production per cell was not affected, cell integrity was preserved and PO43‑ uptake increased. Analysis of its transcriptome revealed that 95% of its genes were downregulated. Increased transcription involved protein synthesis, energy generation and respiration pathways. Interplay between these factors may play a key role in shaping the structure of microbial communities developed after oil spills at low depth and limit their bioremediation potential.

  16. Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?

    KAUST Repository

    Scoma, Alberto

    2016-03-29

    Oil spills represent an overwhelming carbon input to the marine environment that immediately impacts the sea surface ecosystem. Microbial communities degrading the oil fraction that eventually sinks to the seafloor must also deal with hydrostatic pressure, which linearly increases with depth. Piezosensitive hydrocarbonoclastic bacteria are ideal candidates to elucidate impaired pathways following oil spills at low depth. In the present paper, we tested two strains of the ubiquitous Alcanivorax genus, namely A. jadensis KS_339 and A. dieselolei KS_293, which is known to rapidly grow after oil spills. Strains were subjected to atmospheric and mild pressure (0.1, 5 and 10 MPa, corresponding to a depth of 0, 500 and 1000 m, respectively) providing n-dodecane as sole carbon source. Pressures equal to 5 and 10 MPa significantly lowered growth yields of both strains. However, in strain KS_293 grown at 10 MPa CO2 production per cell was not affected, cell integrity was preserved and PO43− uptake increased. Analysis of its transcriptome revealed that 95% of its genes were downregulated. Increased transcription involved protein synthesis, energy generation and respiration pathways. Interplay between these factors may play a key role in shaping the structure of microbial communities developed after oil spills at low depth and limit their bioremediation potential.

  17. Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?

    Science.gov (United States)

    Scoma, Alberto; Barbato, Marta; Hernandez-Sanabria, Emma; Mapelli, Francesca; Daffonchio, Daniele; Borin, Sara; Boon, Nico

    2016-01-01

    Oil spills represent an overwhelming carbon input to the marine environment that immediately impacts the sea surface ecosystem. Microbial communities degrading the oil fraction that eventually sinks to the seafloor must also deal with hydrostatic pressure, which linearly increases with depth. Piezosensitive hydrocarbonoclastic bacteria are ideal candidates to elucidate impaired pathways following oil spills at low depth. In the present paper, we tested two strains of the ubiquitous Alcanivorax genus, namely A. jadensis KS_339 and A. dieselolei KS_293, which is known to rapidly grow after oil spills. Strains were subjected to atmospheric and mild pressure (0.1, 5 and 10 MPa, corresponding to a depth of 0, 500 and 1000 m, respectively) providing n-dodecane as sole carbon source. Pressures equal to 5 and 10 MPa significantly lowered growth yields of both strains. However, in strain KS_293 grown at 10 MPa CO2 production per cell was not affected, cell integrity was preserved and PO43− uptake increased. Analysis of its transcriptome revealed that 95% of its genes were downregulated. Increased transcription involved protein synthesis, energy generation and respiration pathways. Interplay between these factors may play a key role in shaping the structure of microbial communities developed after oil spills at low depth and limit their bioremediation potential. PMID:27020120

  18. Cadmium interferes with the degradation of ATF5 via a post-ubiquitination step of the proteasome degradation pathway

    International Nuclear Information System (INIS)

    ATF5 is a member of the CREB/ATF family of transcription factors. In the current study, using a transient transfection system to express FLAG epitope fusion proteins of ATF5, we have shown that CdCl2 or NaAsO3 increases the protein levels of ATF5 in cells, and that cadmium stabilizes the ATF5 protein. Proteasome inhibitors had a similar effect to cadmium on the cellular accumulation of ATF5. Proteasome inhibition led to an increase in ubiquitinated ATF5, while cadmium did not appear to reduce the extent of ATF5 ubiquitination. ATF5 contains a putative nuclear export signal within its N-terminus. We demonstrated that whereas deletion of N-terminal region resulted in a increase of ATF5 levels, this region does not appear to be involved in the ubiquitination of ATF5. These results indicate that ATF5 is targeted for degradation by the ubiquitin-proteasome pathway, and that cadmium slows the rate of ATF5 degradation via a post-ubiquitination mechanism.

  19. Role of activated carbon features on the photocatalytic degradation of phenol

    International Nuclear Information System (INIS)

    In this work we have investigated the role of porous carbon material used as a photocatalyst and a catalyst support in the carbon/titania composite in the photodegradation of phenol, and compared the results to those of bare titanium oxide. The immobilization of titania on an activated carbon provoked acceleration of the degradation rate under UV irradiation, which is likely to be attributed to the porosity of the carbon support. The identification of the degradation intermediates detected in the solution showed that the presence of the carbon support affects the nature of phenol degradation mechanism through the formation of different intermediates. Additionally, phenol photodecomposition rate over the carbon support outperformed that attained in the carbon/titania composite, suggesting an important self-photoactivity of the carbon support.

  20. The structure of uncertainty in future low carbon pathways

    International Nuclear Information System (INIS)

    Low carbon scenario and transition pathway analysis involves the consideration of uncertainties around future technological and social changes. This paper argues that uncertainty can be better understood, and the strategic and policy effectiveness of scenarios or pathways thereby improved, through a systematic categorisation of the different kinds of certain and uncertain elements of which the future is comprised. To achieve this, this paper makes two novel methodological contributions. First it proposes a system conceptualisation which is based on a detailed description of the dynamics of the actors and institutions relevant to the system under study, iteratively linked to a detailed representation of the technological system. Second, it argues that as a result of developing this actor-based low carbon scenarios approach it is possible to characterise future elements of the system as either pre-determined, actor contingent or non-actor contingent. An outline scenario approach is presented, based on these two contributions. It emerges that the different categories of future element are associated with different types of uncertainty and each prompt different strategic policy responses. This categorisation of future elements therefore clarifies the relationship of scenario content to specific types of policy response, and thus improves the policy tractability of resulting scenarios. - Highlights: ► Aims, uncertainties and challenges of low carbon scenarios/pathways summarized. ► Importance of defining actors and describing sociotechnical evolution emphasised. ► Categorisation of different kinds of future uncertainties explained. ► A framework combining actors, institutions and co-evolving systems presented. ► Process for strategically effective low carbon scenarios/pathways presented.

  1. Oxidative degradation of N-Nitrosopyrrolidine by the ozone/UV process: Kinetics and pathways.

    Science.gov (United States)

    Chen, Zhi; Fang, Jingyun; Fan, Chihhao; Shang, Chii

    2016-05-01

    N-Nitrosopyrrolidine (NPYR) is an emerging contaminant in drinking water and wastewater. The degradation kinetics and mechanisms of NPYR degradation by the O3/UV process were investigated and compared with those of UV direct photolysis and ozonation. A synergistic effect of ozone and UV was observed in the degradation of NPYR due to the accelerated production of OH• by ozone photolysis. This effect was more pronounced at higher ozone dosages. The second-order rate constants of NPYR reacting with OH• and ozone was determined to be 1.38 (± 0.05) × 10(9) M(-1) s(-1) and 0.31 (± 0.02) M(-1) s(-1), respectively. The quantum yield by direct UV photolysis was 0.3 (± 0.01). An empirical model using Rct (the ratio of the exposure of OH• to that of ozone) was established for NPYR degradation in treated drinking water and showed that the contributions of direct UV photolysis and OH• oxidation on NPYR degradation were both significant. As the reaction proceeded, the contribution by OH• became less important due to the exhausting of ozone. Nitrate was the major product in the O3/UV process by two possible pathways. One is through the cleavage of nitroso group to form NO• followed by hydrolysis, and the other is the oxidation of the intermediates of amines by ozonation. PMID:26733013

  2. Identification of the degradation pathways of alkanolamines with TiO{sub 2} photocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chung-Shin, E-mail: cslu6@ntcnc.edu.tw [Department of General Education, National Taichung Nursing College, Taichung 403, Taiwan (China); Chen, Chiing-Chang [Department of Science Application and Dissemination, National Taichung University, Taichung 403, Taiwan (China); Mai, Fu-Der [Department of Biochemistry, School of Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Li, Hua-Kuang [Department of General Education, National Taichung Nursing College, Taichung 403, Taiwan (China)

    2009-06-15

    The present study deals with the photocatalytic degradation of the alkanolamine, 2-dimethylamino-2-methyl-1-propanol (DMAMP), in the presence of TiO{sub 2} particles and UV-A ({lambda} = 365 nm) radiation. The obtained results show complete oxidation of DMAMP after 20 h, and a little over 90% of DMAMP was mineralization after 64-h of treatment. The effects of the solution pH, catalyst loading, and anions on the photocatalytic degradation of DMAMP were investigated, as well as the reaction intermediates that were formed during treatment. To the best of our knowledge, this is the first time that reports the degradation pathways of DMAMP. A number of intermediates were identified by GC/MS techniques during the treatment of DMAMP, following three tentative degradation routes. The first one is based on the oxidation of the primary alcohol group leading to the formation of corresponding aldehyde and carboxylic acid. The second route is based on the rupture of the N-C bond to form 2-methylpropanal and acetone. The last degradation route is based on the cyclization of the {beta}-amino alcohol group to form the oxazolidine derivatives.

  3. Identification of the degradation pathways of alkanolamines with TiO2 photocatalysis

    International Nuclear Information System (INIS)

    The present study deals with the photocatalytic degradation of the alkanolamine, 2-dimethylamino-2-methyl-1-propanol (DMAMP), in the presence of TiO2 particles and UV-A (λ = 365 nm) radiation. The obtained results show complete oxidation of DMAMP after 20 h, and a little over 90% of DMAMP was mineralization after 64-h of treatment. The effects of the solution pH, catalyst loading, and anions on the photocatalytic degradation of DMAMP were investigated, as well as the reaction intermediates that were formed during treatment. To the best of our knowledge, this is the first time that reports the degradation pathways of DMAMP. A number of intermediates were identified by GC/MS techniques during the treatment of DMAMP, following three tentative degradation routes. The first one is based on the oxidation of the primary alcohol group leading to the formation of corresponding aldehyde and carboxylic acid. The second route is based on the rupture of the N-C bond to form 2-methylpropanal and acetone. The last degradation route is based on the cyclization of the β-amino alcohol group to form the oxazolidine derivatives.

  4. Degradation of poly(carbonate urethane) by gamma irradiation

    Science.gov (United States)

    Özdemir, T.; Usanmaz, A.

    2007-06-01

    Poly(carbonate urethane) (PCU), is a valuable commercial engineering polymer. In order to understand the possible use of PCU in radioactive waste management as a solidifying agent or as a disposal container, radiation stability of the PCU is studied by Co-60 gamma irradiations at two different dose rates of 1540 and 82.8 Gy/h. The total dose of irradiation was up to 6.24 MGy. Degradation nature was tested by studying the changes in mechanical and thermal properties with rate and total dose of irradiation. Ultimate tensile strength and toughness first increased and then decreased with the irradiation dose. Half value dose (HVD) for elongation was 4010 kGy and for tensile strength 6010 kGy at the dose rate of 1540 Gy/h. The non-irradiated PCU transparent color changed to yellow and then brown with increased irradiation dose. The FTIR spectral analysis showed a random scission of polymer with irradiation. From the experimental observation, it was shown that PCU can be used for embedding radioactive waste for about 300 years.

  5. KCTD1 suppresses canonical Wnt signaling pathway by enhancing β-catenin degradation.

    Directory of Open Access Journals (Sweden)

    Xinxin Li

    Full Text Available The canonical Wnt signaling pathway controls normal embryonic development, cellular proliferation and growth, and its aberrant activity results in human carcinogenesis. The core component in regulation of this pathway is β-catenin, but molecular regulation mechanisms of β-catenin stability are not completely known. Here, our recent studies have shown that KCTD1 strongly inhibits TCF/LEF reporter activity. Moreover, KCTD1 interacted with β-catenin both in vivo by co-immunoprecipitation as well as in vitro through GST pull-down assays. We further mapped the interaction regions to the 1-9 armadillo repeats of β-catenin and the BTB domain of KCTD1, especially Position Ala-30 and His-33. Immunofluorescence analysis indicated that KCTD1 promotes the cytoplasmic accumulation of β-catenin. Furthermore, protein stability assays revealed that KCTD1 enhances the ubiquitination/degradation of β-catenin in a concentration-dependent manner in HeLa cells. And the degradation of β-catenin mediated by KCTD1 was alleviated by the proteasome inhibitor, MG132. In addition, KCTD1-mediated β-catenin degradation was dependent on casein kinase 1 (CK1- and glycogen synthase kinase-3β (GSK-3β-mediated phosphorylation and enhanced by the E3 ubiquitin ligase β-transducin repeat-containing protein (β-TrCP. Moreover, KCTD1 suppressed the expression of endogenous Wnt downstream genes and transcription factor AP-2α. Finally, we found that Wnt pathway member APC and tumor suppressor p53 influence KCTD1-mediated downregulation of β-catenin. These results suggest that KCTD1 functions as a novel inhibitor of Wnt signaling pathway.

  6. Degradation of retinoid X receptor α by TPA through proteasome pathway in gastric cancer cells

    Institute of Scientific and Technical Information of China (English)

    Xiao-Feng Ye; Su Liu; Qiao Wu; Xiao-Feng Lin; Bing Zhang; Jia-Fa Wu; Ming-Qing Zhang; Wen-Jin Su

    2003-01-01

    AIM: To investigate and determine the mechanism and signal pathway of tetradecanoylphorbol-1, 3-acetate (TPA) in degradation of RXRα.METHODS: Gastric cancer cell line, BGC-823 was used in the experiments. The expression level of R XRα protein was detected by Western blot. Nuclear and cytoplasmic protein fractions were prepared through lysis of cell and centrifugation.Localization and translocation of RXRα were observed under laser-scanning confocal microscope through labeling specific anti-RXRα antibody and corresponding immunofiuorescent antibody as secondary antibody. Different inhibitors were used as required.RESULTS: In BGC-823 cells, RXRα was expressed in the nucleus. When cells were treated with TPA, expression of RXRα was repressed in a time-dependent and TPAconcentration-dependent manner. Meanwhile, translocation of RXR from the nucleus to the cytoplasm occurred, also in a time-dependent manner. When cells were pre-incubated with proteasome inhibitor MG132 for 3 hrs, followed by TPA for another 12 hrs, TPA-induced RXRα degradation was inhibited. Further observation of RXRα translocation in the presence of MG132 showed that MG-132 could block TPAinduced RXRα redistribution. Conversely, when RXRαtranslocation was inhibited by LMB, an inhibitor for blocking protein export from the nucleus, TPA could not repress expression of RXRα.CONCLUSION: TPA could induce the degradation of RXRα protein in BGC-823 cells, and this degradation is time-and TPA-concentration-dependent. Furthermore, the degradation of RXRα by TPA is via a proteasome pathway and associated with RXRα translocation from the nucleus to the cytoplasm.

  7. It's all about talking: two-way communication between proteasomal and lysosomal degradation pathways via ubiquitin.

    Science.gov (United States)

    Liebl, Martina P; Hoppe, Thorsten

    2016-08-01

    Selective degradation of proteins requires a fine-tuned coordination of the two major proteolytic pathways, the ubiquitin-proteasome system (UPS) and autophagy. Substrate selection and proteolytic activity are defined by a plethora of regulatory cofactors influencing each other. Both proteolytic pathways are initiated by ubiquitylation to mark substrate proteins for degradation, although the size and/or topology of the modification are different. In this context E3 ubiquitin ligases, ensuring the covalent attachment of activated ubiquitin to the substrate, are of special importance. The regulation of E3 ligase activity, competition between different E3 ligases for binding E2 conjugation enzymes and substrates, as well as their interplay with deubiquitylating enzymes (DUBs) represent key events in the cross talk between the UPS and autophagy. The coordination between both degradation routes is further influenced by heat shock factors and ubiquitin-binding proteins (UBPs) such as p97, p62, or optineurin. Mutations in enzymes and ubiquitin-binding proteins or a general decline of both proteolytic systems during aging result in accumulation of damaged and aggregated proteins. Thus further mechanistic understanding of how UPS and autophagy communicate might allow therapeutic intervention especially against age-related diseases. PMID:27225656

  8. Organelle interactions and possible degradation pathways visualized in high-pressure frozen algal cells.

    Science.gov (United States)

    Aichinger, N; Lütz-Meindl, U

    2005-08-01

    Summary Organelle interactions, although essential for both anabolic and catabolic pathways in plant cells have not been examined in detail so far. In the present study the structure of different organelle-organelle, organelle-vesicle and organelle-membrane interactions were investigated in growing and nongrowing cells of the green alga Micrasterias denticulata by use of high pressure freeze fixation and energy filtering transmission electron microscopy. It became clear that contacts between mitochondria always occur by formation of a cone-shaped protuberance of one of the mitochondria which penetrates into its fusion partner. In the same way, structural interactions between mitochondria and mucilage vesicles and between microbodies and mucilage vesicles are achieved. Lytic compartments contact mitochondria or mucilage vesicles again by forming protuberances and by extending their contents into the respective compartment. Detached portions of mitochondria are found inside lytic compartments as a consequence of such interactions. Mitochondria found in contact with the plasma membrane reveal structural disintegration. Our study shows that interactions of organelles and vesicles are frequent events in Micrasterias cells of different ages. The interactive contacts between lytic compartments and organelles or vesicles suggest a degradation pathway different from autophagy processes described in the literature. Both the interactions between vesicles and organelles and the degradation pathways occur independently from cytoskeleton function as demonstrated by use of cytochalasin D and the microtubule inhibitor amiprophos-methyl. PMID:16159344

  9. Genetic immunization based on the ubiquitin-fusion degradation pathway against Trypanosoma cruzi

    International Nuclear Information System (INIS)

    Cytotoxic CD8+ T cells are particularly important to the development of protective immunity against the intracellular protozoan parasite, Trypanosoma cruzi, the etiological agent of Chagas disease. We have developed a new effective strategy of genetic immunization by activating CD8+ T cells through the ubiquitin-fusion degradation (UFD) pathway. We constructed expression plasmids encoding the amastigote surface protein-2 (ASP-2) of T. cruzi. To induce the UFD pathway, a chimeric gene encoding ubiquitin fused to ASP-2 (pUB-ASP-2) was constructed. Mice immunized with pUB-ASP-2 presented lower parasitemia and longer survival period, compared with mice immunized with pASP-2 alone. Depletion of CD8+ T cells abolished protection against T. cruzi in mice immunized with pUB-ASP-2 while depletion of CD4+ T cells did not influence the effective immunity. Mice deficient in LMP2 or LMP7, subunits of immunoproteasomes, were not able to develop protective immunity induced. These results suggest that ubiquitin-fused antigens expressed in antigen-presenting cells were effectively degraded via the UFD pathway, and subsequently activated CD8+ T cells. Consequently, immunization with pUB-ASP-2 was able to induce potent protective immunity against infection of T. cruzi.

  10. Genetic immunization based on the ubiquitin-fusion degradation pathway against Trypanosoma cruzi

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Bin [Department of Microbiology and Immunology, Faculty of Medicine, Fukuoka University, 7-45-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan); Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Hiromatsu, Kenji, E-mail: khiromatsu@fukuoka-u.ac.jp [Department of Microbiology and Immunology, Faculty of Medicine, Fukuoka University, 7-45-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan); Hisaeda, Hajime; Duan, Xuefeng; Imai, Takashi [Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Murata, Shigeo; Tanaka, Keiji [Department of Molecular Oncology, The Tokyo Metropolitan Institute of Medical Science, Tokyo 113-8613 (Japan); Himeno, Kunisuke [Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan)

    2010-02-12

    Cytotoxic CD8{sup +} T cells are particularly important to the development of protective immunity against the intracellular protozoan parasite, Trypanosoma cruzi, the etiological agent of Chagas disease. We have developed a new effective strategy of genetic immunization by activating CD8{sup +} T cells through the ubiquitin-fusion degradation (UFD) pathway. We constructed expression plasmids encoding the amastigote surface protein-2 (ASP-2) of T. cruzi. To induce the UFD pathway, a chimeric gene encoding ubiquitin fused to ASP-2 (pUB-ASP-2) was constructed. Mice immunized with pUB-ASP-2 presented lower parasitemia and longer survival period, compared with mice immunized with pASP-2 alone. Depletion of CD8{sup +} T cells abolished protection against T. cruzi in mice immunized with pUB-ASP-2 while depletion of CD4{sup +} T cells did not influence the effective immunity. Mice deficient in LMP2 or LMP7, subunits of immunoproteasomes, were not able to develop protective immunity induced. These results suggest that ubiquitin-fused antigens expressed in antigen-presenting cells were effectively degraded via the UFD pathway, and subsequently activated CD8{sup +} T cells. Consequently, immunization with pUB-ASP-2 was able to induce potent protective immunity against infection of T. cruzi.

  11. Titanium dioxide-mediated heterogeneous photocatalytic degradation of terbufos: Parameter study and reaction pathways

    Energy Technology Data Exchange (ETDEWEB)

    Wu, R.-J. [Department of Applied Chemistry, Providence University, Taichung 433, Taiwan (China); Chen, C.-C. [Department of General Education, National Taichung Nursing College, Taichung 403, Taiwan (China); Chen, M.-H. [Department of Applied Chemistry, Providence University, Taichung 433, Taiwan (China); Lu, C.-S. [Department of General Education, National Taichung Nursing College, Taichung 403, Taiwan (China)], E-mail: cslu6@ntcnc.edu.tw

    2009-03-15

    The photocatalytic degradation of terbufos in aqueous suspensions was investigated by using titanium dioxide (TiO{sub 2}) as a photocatalyst. About 99% of terbufos was degraded after UV irradiation for 90 min. Factors such as pH of the system, TiO{sub 2} dosage, and presence of anions were found to influence the degradation rate. Photodegradation of terbufos by TiO{sub 2}/UV exhibited pseudo-first-order reaction kinetics, and a reaction quantum yield of 0.289. The electrical energy consumption per order of magnitude for photocatalytic degradation of terbufos was calculated and showed that a moderated efficiency (E{sub EO} = 71 kWh/(m{sup 3} order)) was obtained in TiO{sub 2}/UV process. To obtain a better understanding of the mechanistic details of this TiO{sub 2}-assisted photodegradation of terbufos with UV irradiation, the intermediates of the processes were separated, identified, and characterized by the solid-phase microextraction (SPME) and gas chromatography/mass spectrometry (GC/MS) technique. The probable photodegradation pathways were proposed and discussed.

  12. Titanium dioxide-mediated heterogeneous photocatalytic degradation of terbufos: Parameter study and reaction pathways

    International Nuclear Information System (INIS)

    The photocatalytic degradation of terbufos in aqueous suspensions was investigated by using titanium dioxide (TiO2) as a photocatalyst. About 99% of terbufos was degraded after UV irradiation for 90 min. Factors such as pH of the system, TiO2 dosage, and presence of anions were found to influence the degradation rate. Photodegradation of terbufos by TiO2/UV exhibited pseudo-first-order reaction kinetics, and a reaction quantum yield of 0.289. The electrical energy consumption per order of magnitude for photocatalytic degradation of terbufos was calculated and showed that a moderated efficiency (EEO = 71 kWh/(m3 order)) was obtained in TiO2/UV process. To obtain a better understanding of the mechanistic details of this TiO2-assisted photodegradation of terbufos with UV irradiation, the intermediates of the processes were separated, identified, and characterized by the solid-phase microextraction (SPME) and gas chromatography/mass spectrometry (GC/MS) technique. The probable photodegradation pathways were proposed and discussed

  13. Dysfunction of two lysosome degradation pathways of α-synuclein in Parkinson's disease: potential therapeutic targets?

    Institute of Scientific and Technical Information of China (English)

    Tian-Fang Jiang; Sheng-Di Chen

    2012-01-01

    Parkinson's disease (PD) is pathologically characterized by the presence of α-synuclein (α-syn)-positive intracytoplasmic inclusions named Lewy bodies in the dopaminergic neurons of the substantia nigra.A series of morbid consequences are caused by pathologically high amounts or mutant forms of α-syn,such as defects of membrane trafficking and lipid metabolism.In this review,we consider evidence that both point mutation and overexpression of α-syn result in aberrant degradation in neurons and microglia,and this is associated with the autophagy-lysosome pathway and endosomelysosome system,leading directly to pathological intracellular aggregation,abnormal externalization and re-internalization cycling (and,in turn,internalization and re-externalization),and exocytosis.Based on these pathological changes,an increasing number of researchers have focused on these new therapeutic targets,aiming at alleviating the pathological accumulation of α-syn and re-establishing normal degradation.

  14. Tyrosol degradation via the homogentisic acid pathway in a newly isolated Halomonas strain from olive processing effluents

    OpenAIRE

    Liebgott, Pierre-Pol; Labat, Marc; Amouric, Agnès; Tholozan, Jean-Luc; LORQUIN, Jean

    2008-01-01

    To isolate a new Halomonas sp. strain capable of degrading tyrosol, a toxic compound present in olive mill wastewater, through the homogentisic acid (HGA) pathway. A moderately halophilic Gram-negative bacterium belonging to the Halomonas genus and designated strain TYRC17 was isolated from olive processing effluents. This strain was able to completely degrade tyrosol (2-(p-hydroxyphenyl)-ethanol), a toxic compound found in such effluent. Tyrosol degradation begins by an oxidation to 4-hydrox...

  15. Pathways of organic carbon oxidation in three continental margin sediments

    Science.gov (United States)

    Canfield, D. E.; Jorgensen, B. B.; Fossing, H.; Glud, R.; Gundersen, J.; Ramsing, N. B.; Thamdrup, B.; Hansen, J. W.; Nielsen, L. P.; Hall, P. O.

    1993-01-01

    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and Mn reduction) has probably been well underestimated.

  16. Impacts of management practices on soil organic carbon in degraded alpine meadows on the Tibetan Plateau

    Directory of Open Access Journals (Sweden)

    X. F. Chang

    2014-01-01

    Full Text Available Grassland soil organic carbon (SOC is sensitive to anthropogenic activities. Increased anthropogenic disturbance related to overgrazing has led to widespread alpine grassland degradation on the Tibetan Plateau. The degraded grasslands are considered to have great potential for carbon sequestration after adoption of improved management practices. Here, we calibrated and employed the Century model to investigate the effects of overgrazing and improved managements on the SOC dynamics in alpine meadows. We calibrated Century model against plant productivity at Haibei Research Station. SOC stocks for validation were obtained in 2009–2010 from degraded alpine meadows in two communes. We found that Century model can successfully capture grassland SOC changes. Overall, our simulation suggests that degraded alpine meadow SOC significantly increased with the advent of restoration managements from 2011 to 2030. Carbon sequestration rates ranged between 0.04 Mg C ha−1 yr−1 in lightly degraded winter grasslands and 2.0 Mg C ha−1 yr−1 in moderately degraded summer grasslands. Our modeling work also predicts that improve management in Tibetan degraded grasslands will contribute to an annual carbon sink of 0.022–0.059 Pg C yr−1. These results imply that restoration of degraded grasslands in Tibetan Plateau has great potential for soil carbon sequestration to mitigate greenhouse gases.

  17. Impacts of management practices on soil organic carbon in degraded alpine meadows on the Tibetan Plateau

    Science.gov (United States)

    Chang, X. F.; Zhu, X. X.; Wang, S. P.; Cui, S. J.; Luo, C. Y.; Zhang, Z. H.; Wilkes, A.

    2014-07-01

    Grassland soil organic carbon (SOC) is sensitive to anthropogenic activities. Increased anthropogenic disturbance related to overgrazing has led to widespread alpine grassland degradation on the Tibetan Plateau. The degraded grasslands are considered to have great potential for carbon sequestration after adoption of improved management practices. Here, we calibrated and employed the Century model to investigate the effects of overgrazing and improved managements on the SOC dynamics in alpine meadows. We calibrated the Century model against plant productivity at the Haibei Research Station. SOC stocks for validation were obtained in 2009-2010 from degraded alpine meadows in two communes. We found that Century model can successfully capture grassland SOC changes. Overall, our simulation suggests that degraded alpine meadow SOC significantly increased with the advent of restoration management from 2011 to 2030. Carbon sequestration rates ranged between 0.04 Mg C ha-1 yr-1 in lightly degraded winter grazing grasslands and 2.0 Mg C ha-1 yr-1 in moderately degraded summer grazing grasslands. Our modelling work also predicts that improve management in degraded Tibetan grasslands will contribute to an annual carbon sink of 0.022-0.059 Pg C yr-1. These results imply that restoration of degraded grasslands in the Tibetan Plateau has great potential for soil carbon sequestration to mitigate greenhouse gases.

  18. Insulin-degrading enzyme is exported via an unconventional protein secretion pathway

    Directory of Open Access Journals (Sweden)

    Leissring Malcolm A

    2009-01-01

    Full Text Available Abstract Insulin-degrading enzyme (IDE is a ubiquitously expressed zinc-metalloprotease that degrades several pathophysiologically significant extracellular substrates, including insulin and the amyloid β-protein (Aβ, and accumulating evidence suggests that IDE dysfunction may be operative in both type 2 diabetes mellitus and Alzheimer disease (AD. Although IDE is well known to be secreted by a variety of cell types, the underlying trafficking pathway(s remain poorly understood. To address this topic, we investigated the effects of known inhibitors or stimulators of protein secretion on the secretion of IDE from murine hepatocytes and HeLa cells. IDE secretion was found to be unaffected by the classical secretion inhibitors brefeldin A (BFA, monensin, or nocodazole, treatments that readily inhibited the secretion of α1-antitrypsin (AAT overexpressed in the same cells. Using a novel cell-based Aβ-degradation assay, we show further that IDE secretion was similarly unaffected by multiple stimulators of protein secretion, including glyburide and 3'-O-(4-benzoylbenzoyl-ATP (Bz-ATP. The calcium ionophore, A23187, increased extracellular IDE activity, but only under conditions that also elicited cytotoxicity. Our results provide the first biochemical evidence that IDE export is not dependent upon the classical secretion pathway, thereby identifying IDE as a novel member of the select class of unconventionally secreted proteins. Further elucidation of the mechanisms underlying IDE secretion, which would be facilitated by the assays described herein, promises to uncover processes that might be defective in disease or manipulated for therapeutic benefit.

  19. Cystic fibrosis transmembrane conductance regulator degradation: cross-talk between the ubiquitylation and SUMOylation pathways.

    Science.gov (United States)

    Ahner, Annette; Gong, Xiaoyan; Frizzell, Raymond A

    2013-09-01

    Defining the significant checkpoints in cystic fibrosis transmembrane conductance regulator (CFTR) biogenesis should identify targets for therapeutic intervention with CFTR folding mutants such as F508del. Although the role of ubiquitylation and the ubiquitin proteasome system is well established in the degradation of this common CFTR mutant, the part played by SUMOylation is a novel aspect of CFTR biogenesis/quality control. We identified this post-translational modification of CFTR as resulting from its interaction with small heat shock proteins (Hsps), which were found to selectively facilitate the degradation of F508del through a physical interaction with the SUMO (small ubiquitin-like modifier) E2 enzyme, Ubc9. Hsp27 promoted the SUMOylation of mutant CFTR by the SUMO-2 paralogue, which can form poly-chains. Poly-SUMO chains are then recognized by the SUMO-targeted ubiquitin ligase, RNF4, which elicited F508del degradation in a Hsp27-dependent manner. This work identifies a sequential connection between the SUMO and ubiquitin modifications of the CFTR mutant: Hsp27-mediated SUMO-2 modification, followed by ubiquitylation via RNF4 and degradation of the mutant via the proteasome. Other examples of the intricate cross-talk between the SUMO and ubiquitin pathways are discussed with reference to other substrates; many of these are competitive and lead to different outcomes. It is reasonable to anticipate that further research on SUMO-ubiquitin pathway interactions will identify additional layers of complexity in the process of CFTR biogenesis and quality control. PMID:23809253

  20. Ubiquitin initiates sorting of Golgi and plasma membrane proteins into the vacuolar degradation pathway

    Directory of Open Access Journals (Sweden)

    Scheuring David

    2012-09-01

    Full Text Available Abstract Background In yeast and mammals, many plasma membrane (PM proteins destined for degradation are tagged with ubiquitin. These ubiquitinated proteins are internalized into clathrin-coated vesicles and are transported to early endosomal compartments. There, ubiquitinated proteins are sorted by the endosomal sorting complex required for transport (ESCRT machinery into the intraluminal vesicles of multivesicular endosomes. Degradation of these proteins occurs after endosomes fuse with lysosomes/lytic vacuoles to release their content into the lumen. In plants, some PM proteins, which cycle between the PM and endosomal compartments, have been found to be ubiquitinated, but it is unclear whether ubiquitin is sufficient to mediate internalization and thus acts as a primary sorting signal for the endocytic pathway. To test whether plants use ubiquitin as a signal for the degradation of membrane proteins, we have translationally fused ubiquitin to different fluorescent reporters for the plasma membrane and analyzed their transport. Results Ubiquitin-tagged PM reporters localized to endosomes and to the lumen of the lytic vacuole in tobacco mesophyll protoplasts and in tobacco epidermal cells. The internalization of these reporters was significantly reduced if clathrin-mediated endocytosis was inhibited by the coexpression of a mutant of the clathrin heavy chain, the clathrin hub. Surprisingly, a ubiquitin-tagged reporter for the Golgi was also transported into the lumen of the vacuole. Vacuolar delivery of the reporters was abolished upon inhibition of the ESCRT machinery, indicating that the vacuolar delivery of these reporters occurs via the endocytic transport route. Conclusions Ubiquitin acts as a sorting signal at different compartments in the endomembrane system to target membrane proteins into the vacuolar degradation pathway: If displayed at the PM, ubiquitin triggers internalization of PM reporters into the endocytic transport route

  1. Electrochemical treatment of trypan blue synthetic wastewater and its degradation pathway

    Directory of Open Access Journals (Sweden)

    ANANTHA N. SUBBA RAO

    2013-11-01

    Full Text Available The trypan blue (TB dye synthetic wastewater was treated in presence of chloride ions by electrochemical method. The effect of current density, pH, initial concentration of dye and supporting electrolyte on color and COD removal were investigated. The UV-Vis ab­sorption intensity, chemical oxygen demand (COD, cyclic voltammetry (CV, Fourier transform- infrared spectroscopy (FT-IR, gas chromatography – mass spectrometry (GC-MS analysis were conducted to investigate the kinetics and degradation pathway of TB dye.

  2. Elimination of paternal mitochondria through the lysosomal degradation pathway in C. elegans.

    Science.gov (United States)

    Zhou, Qinghua; Li, Haimin; Xue, Ding

    2011-12-01

    In mammals, the inheritance of mitochondrion and its DNA (mtDNA) is strictly maternal, despite the fact that a sperm can inject up to 100 functional mitochondria into the oocyte during fertilization. The mechanisms responsible for the elimination of the paternal mitochondria remain largely unknown. We report here that this paternal mitochondrial elimination process is conserved in Caenorhabditis elegans, and that the lysosomal pathway actively participates in this process. Molecular and cell biological analyses indicate that in wild-type animals paternal mitochondria and mtDNA are destroyed within two hours after fertilization. In animals with compromised lysosomes, paternal mitochondria persist until late embryonic stages. Therefore, the lysosomal pathway plays an important role in degrading paternal mitochondria introduced into the oocyte during fertilization. Our study indicates that C. elegans is an excellent animal model for understanding and dissecting this conserved biological process critical for animal development and reproduction. PMID:22105480

  3. Elimination of paternal mitochondria through the lysosomal degradation pathway in C.elegans

    Institute of Scientific and Technical Information of China (English)

    Qinghua Zhou; Haimin Li; Ding Xue

    2011-01-01

    In mammals,the inheritance of mitochondrion and its DNA (mtDNA) is strictly maternal,despite the fact that a sperm can inject up to 100 functional mitochondria into the oocyte during fertilization.The mechanisms responsible for the elimination of the paternal mitochondria remain largely unknown.We report here that this paternal mitochondrial elimination process is conserved in Caenorhabditis elegans,and that the lysosomal pathway actively participates in this process.Molecular and cell biological analyses indicate that in wild-type animals paternal mitoehondria and mtDNA are destroyed within two hours after fertilization.In animals with compromised lysosomes,paternal mitochondria persist until late embryonic stages.Therefore,the lysosomal pathway plays an important role in degrading paternal mitochondria introduced into the oocyte during fertilization.Our study indicates that C.elegans is an excellent animal model for understanding and dissecting this conserved biological process critical for animal development and reproduction.

  4. Characterization of the KstR2 regulator responsible of the lower cholesterol degradative pathway in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Galán, Beatriz; Medrano, Francisco J; García, José L

    2015-02-01

    The interaction of KstR2-dependent promoters of the divergon constituted by the MSMEG_6000-5999 and MSMEG_6001-6004 operons of Mycobacterium smegmatis which encode the genes involved in the lower cholesterol degradative pathway has been characterized. Footprint analyses have demonstrated experimentally for the first time that KstR2 specifically binds to an operator region of 29 nucleotides containing the palindromic sequence AAGCAAGNNCTTGCTT. This region overlaps with the -10 and -35 boxes of the putative P(6000) and P(6001) divergent promoters, suggesting that KstR2 represses their transcription by preventing the binding of the ribonucleic acid polymerase. A three-dimensional model of the KstR2 protein revealed a typical TetR-type regulator folding with two domains, a deoxyribonucleic acid (DNA)-binding N-terminal domain and a regulator-binding C-terminal domain composed by three and six helices respectively. KstR2 is an all alpha protein as confirmed by circular dichroism. We have determined that M. smegmatis is able to grow using sitolactone (HIL) as the only carbon source and that this compound induces the kstR2 regulon in vivo. HIL or its open form 5OH-HIP were unable to release in vitro the KstR2-DNA operator interaction, suggesting that 5OH-HIP-CoA or a further derivative would induce the lower cholesterol catabolic pathway. PMID:25511435

  5. Key enzymes of the protocatechuate branch of the β-ketoadipate pathway for aromatic degradation in Corynebacterium glutamicum

    Institute of Scientific and Technical Information of China (English)

    SHEN Xihui; LIU Shuangjiang

    2005-01-01

    Although the protocatechuate branch of the β-ketoadipate pathway in Gram bacteria has been well studied, this branch is less understood in Gram+ bacteria. In this study,Corynebacterium glutamicum was cultivated with protocatechuate, p-cresol, vanillate and 4-hydroxybenzoate as sole carbon and energy sources for growth. Enzymatic assays indicated that growing cells on these aromatic compounds exhibited protocatechuate 3,4-dioxygenase activities. Data-mining of the genome of this bacterium revealed that the genetic locus ncg12314-ncg12315 encoded a putative protocatechuate 3,4-dioxygenase. The genes,ncg12314 and ncg12315, were amplified by PCR technique and were cloned into plasmid (pET21aP34D). Recombinant Escherichia coli strain harboring this plasmid actively expressed protocatechuate 3,4-dioxygenase activity. Further, when this locus was disrupted in C. glutamicum, the ability to degrade and assimilate protocatechuate, p-cresol, vanillate or 4-hydroxybenzoate was lost and protocatechuate 3,4-dioxygenase activity was disappeared. The ability to grow with these aromatic compounds and protocatechuate 3,4-dioxygenase activity of C.glutamicum mutant could be restored by gene complementation. Thus, it is clear that the key enzyme for ring-cleavage, protocatechuate 3,4-dioxygenase, was encoded by ncg12314 and ncg12315. The additional genes involved in the protocatechuate branch of the β-ketoadipate pathway were identified by mining the genome data publically available in the GenBank. The functional identification of genes and their unique organization in C. glutamicum provided new insight into the genetic diversity of aromatic compound degradation.

  6. Current-induced strength degradation of activated carbon spheres in carbon supercapacitors

    Science.gov (United States)

    Sun, Yuan; Chen, Rong; Lipka, Stephen M.; Yang, Fuqian

    2016-05-01

    Activated carbon microspheres (ACSs), which are prepared using hydrothermal synthesis and ammonia activation, are used as the active materials in the anode and cathode of electric double layer capacitors (EDLCs). The ACS-based EDLCs of symmetrical electrodes exhibit good stability and a high degree of reversibility over 2000 charge-discharge cycles for electric current up to 10 A g‑1. The ACSs maintain a nongraphitized carbon structure after over 2000 charge-discharge cycles. Nanoindentation experiments are performed on the ACSs, which are electrochemically cycled in a voltage window of 0–1 V at three electric currents of 0.5, 5, and 10 A g‑1. For the same indentation load, both the contact modulus and indentation hardness of the ACSs decrease with the increase of the electric current used in the electrical charging and discharging. These results suggest that there exists strength degradation introduced by the electric current. A larger electric current will cause more strength degradation than a smaller electric current.

  7. Activation of peroxymonosulfate by graphitic carbon nitride loaded on activated carbon for organic pollutants degradation.

    Science.gov (United States)

    Wei, Mingyu; Gao, Long; Li, Jun; Fang, Jia; Cai, Wenxuan; Li, Xiaoxia; Xu, Aihua

    2016-10-01

    Graphitic carbon nitride supported on activated carbon (g-C3N4/AC) was prepared through an in situ thermal approach and used as a metal free catalyst for pollutants degradation in the presence of peroxymonosulfate (PMS) without light irradiation. It was found that g-C3N4 was highly dispersed on the surface of AC with the increase of surface area and the exposition of more edges and defects. The much easier oxidation of C species in g-C3N4 to CO was also observed from XPS spectra. Acid Orange 7 (AO7) and other organic pollutants could be completely degraded by the g-C3N4/AC catalyst within 20min with PMS, while g-C3N4+PMS and AC+PMS showed no significant activity for the reaction. The performance of the catalyst was significantly influenced by the amount of g-C3N4 loaded on AC; but was nearly not affected by the initial solution pH and reaction temperature. In addition, the catalysts presented good stability. A nonradical mechanism accompanied by radical generation (HO and SO4(-)) in AO7 oxidation was proposed in the system. The CO groups play a key role in the process; while the exposure of more N-(C)3 group can further increase its electron density and basicity. This study can contribute to the development of green materials for sustainable remediation of aqueous organic pollutants. PMID:27214000

  8. Carbon isotope effects associated with Fenton-like degradation of toluene: Potential for differentiation of abiotic and biotic degradation

    International Nuclear Information System (INIS)

    Hydrogen peroxide (H2O2)-mediated oxygenation to enhance subsurface aerobic biodegradation is a frequently employed remediation technique. However, it may be unclear whether observed organic contaminant mass loss is caused by biodegradation or chemical oxidation via hydroxyl radicals generated during catalyzed Fenton-like reactions. Compound-specific carbon isotope analysis has the potential to discriminate between these processes. Here we report laboratory experiments demonstrating no significant carbon isotope fractionation during Fenton-like hydroxyl radical oxidation of toluene. This implies that observation of significant isotopic fractionation of toluene at a site undergoing H2O2-mediated remediation would provide direct evidence of biodegradation. We applied this approach at a field site that had undergone 27 months of H2O2-mediated subsurface oxygenation. Despite substantial decreases (> 68%) in groundwater toluene concentrations carbon isotope signatures of toluene (δ13Ctol) showed no significant variation (mean = - 27.5 ±0.3 per mille, n = 13) over a range of concentrations from 11.1 to 669.0 mg L-1. Given that aerobic degradation by ring attack has also been shown to result in no significant isotopic fractionation during degradation, at this site we were unable to discern the mechanism of degradation. However, such differentiation is possible at sites where aerobic degradation by methyl group attack results in significant isotopic fractionation

  9. Def defines a conserved nucleolar pathway that leads p53 to proteasome-independent degradation

    Institute of Scientific and Technical Information of China (English)

    Ting Tao; Hui Shi; Yihong Guan; Delai Huang; Ye Chen; David P Lane; Jun Chen

    2013-01-01

    p53 protein turnover through the ubiquitination pathway is a vital mechanism in the regulation of its transcriptional activity; however,little is known about p53 turnover through proteasome-independent pathway(s).The digestive organ expansion factor (Def) protein is essential for the development of digestive organs.In zebrafish,loss of function of defselectively upregulates the expression of p53 response genes,which raises a question as to what is the relationship between Def and p53.We report here that Def is a nucleolar protein and that loss of function of defleads to the upregulation of p53 protein,which surprisingly accumulates in the nucleoli.Our extensive studies have demonstrated that Def can mediate the degradation of p53 protein and that this process is independent of the proteasome pathway,but dependent on the activity of Calpain3,a cysteine protease.Our findings define a novel nucleolar pathway that regulates the turnover function of p53,which will advance our understanding of p53's role in organogenesis and tumorigenesis.

  10. Influence of bicarbonate and carbonate ions on sonochemical degradation of Rhodamine B in aqueous phase.

    Science.gov (United States)

    Merouani, Slimane; Hamdaoui, Oualid; Saoudi, Fethi; Chiha, Mahdi; Pétrier, Christian

    2010-03-15

    The influence of bicarbonate and carbonate ions on sonolytic degradation of cationic dye, Rhodamine B (RhB), in water was investigated. As a consequence of ultrasonic cavitation that generates .OH radicals, carbonate radicals were secondary products of water sonochemistry when it contains dissolved bicarbonate or carbonate ions. The results clearly demonstrated the significant intensification of sonolytic destruction of RhB in the presence of bicarbonate and carbonate, especially at lower dye concentrations. Degradation intensification occurs because carbonate radicals sonochemically formed undergo radical-radical recombination at a lesser extent than hydroxyl radicals. The generated carbonate radicals are likely able to migrate far from the cavitation bubbles towards the solution bulk and are suitable for degradation of an organic dye such as RhB. Therefore, at low dye concentrations, carbonate radical presents a more selective reactivity towards RhB molecules than hydroxyl radical. In the presence of bicarbonate, degradation rate reached a maximum at 3 g L(-1) bicarbonate, but subsequent addition retards the destruction process. In RhB solutions containing carbonate, the oxidation rate gradually increased with increasing carbonate concentration up to 10 g L(-1) and slightly decreased afterward. Carbonate radicals sonochemically generated are suitable for total removal of COD of sonicated RhB solutions. PMID:19910116

  11. (13)C Tracers for Glucose Degrading Pathway Discrimination in Gluconobacter oxydans 621H.

    Science.gov (United States)

    Ostermann, Steffen; Richhardt, Janine; Bringer, Stephanie; Bott, Michael; Wiechert, Wolfgang; Oldiges, Marco

    2015-01-01

    Gluconobacter oxydans 621H is used as an industrial production organism due to its exceptional ability to incompletely oxidize a great variety of carbohydrates in the periplasm. With glucose as the carbon source, up to 90% of the initial concentration is oxidized periplasmatically to gluconate and ketogluconates. Growth on glucose is biphasic and intracellular sugar catabolism proceeds via the Entner-Doudoroff pathway (EDP) and the pentose phosphate pathway (PPP). Here we studied the in vivo contributions of the two pathways to glucose catabolism on a microtiter scale. In our approach we applied specifically (13)C labeled glucose, whereby a labeling pattern in alanine was generated intracellularly. This method revealed a dynamic growth phase-dependent pathway activity with increased activity of EDP in the first and PPP in the second growth phase, respectively. Evidence for a growth phase-independent decarboxylation-carboxylation cycle around the pyruvate node was obtained from (13)C fragmentation patterns of alanine. For the first time, down-scaled microtiter plate cultivation together with (13)C-labeled substrate was applied for G. oxydans to elucidate pathway operation, exhibiting reasonable labeling costs and allowing for sufficient replicate experiments. PMID:26404385

  12. 13C Tracers for Glucose Degrading Pathway Discrimination in Gluconobacter oxydans 621H

    Directory of Open Access Journals (Sweden)

    Steffen Ostermann

    2015-09-01

    Full Text Available Gluconobacter oxydans 621H is used as an industrial production organism due to its exceptional ability to incompletely oxidize a great variety of carbohydrates in the periplasm. With glucose as the carbon source, up to 90% of the initial concentration is oxidized periplasmatically to gluconate and ketogluconates. Growth on glucose is biphasic and intracellular sugar catabolism proceeds via the Entner–Doudoroff pathway (EDP and the pentose phosphate pathway (PPP. Here we studied the in vivo contributions of the two pathways to glucose catabolism on a microtiter scale. In our approach we applied specifically 13C labeled glucose, whereby a labeling pattern in alanine was generated intracellularly. This method revealed a dynamic growth phase-dependent pathway activity with increased activity of EDP in the first and PPP in the second growth phase, respectively. Evidence for a growth phase-independent decarboxylation-carboxylation cycle around the pyruvate node was obtained from 13C fragmentation patterns of alanine. For the first time, down-scaled microtiter plate cultivation together with 13C-labeled substrate was applied for G. oxydans to elucidate pathway operation, exhibiting reasonable labeling costs and allowing for sufficient replicate experiments.

  13. Options for monitoring and estimating historical carbon emissions from forest degradation in the context of REDD+

    OpenAIRE

    Herold Martin; Román-Cuesta Rosa; Mollicone Danilo; Hirata Yasumasa; Van Laake Patrick; Asner Gregory P; Souza Carlos de; Skutsch Margaret; Avitabile Valerio; MacDicken Ken

    2011-01-01

    Abstract Measuring forest degradation and related forest carbon stock changes is more challenging than measuring deforestation since degradation implies changes in the structure of the forest and does not entail a change in land use, making it less easily detectable through remote sensing. Although we anticipate the use of the IPCC guidance under the United Framework Convention on Climate Change (UNFCCC), there is no one single method for monitoring forest degradation for the case of REDD+ po...

  14. Options for monitoring and estimating historical carbon emissions from forest degradation in the context of REDD+

    OpenAIRE

    Herold, M; Román-Cuesta, R.M.; Hirata, Y; Laake, Van, P.; Asner, G.; C. Souza; Avitabile, V.; Skutsch, M.; MacDicken, K.

    2011-01-01

    Measuring forest degradation and related forest carbon stock changes is more challenging than measuring deforestation since degradation implies changes in the structure of the forest and does not entail a change in land use, making it less easily detectable through remote sensing. Although we anticipate the use of the IPCC guidance under the United Framework Convention on Climate Change (UNFCCC), there is no one single method for monitoring forest degradation for the case of REDD+ policy. In ...

  15. Impacts of management practices on soil organic carbon in degraded alpine meadows on the Tibetan Plateau

    OpenAIRE

    X. F. Chang; X. X. ZHU; Wang, S.P.; Cui, S. J.; Luo, C. Y.; Zhang, Z. H.; A. Wilkes

    2014-01-01

    Grassland soil organic carbon (SOC) is sensitive to anthropogenic activities. Increased anthropogenic disturbance related to overgrazing has led to widespread alpine grassland degradation on the Tibetan Plateau. The degraded grasslands are considered to have great potential for carbon sequestration after adoption of improved management practices. Here, we calibrated and employed the Century model to investigate the effects of overgrazing and improved managements on the SOC d...

  16. Pathways and Determinants of Early Spontaneous Vegetation Succession in Degraded Lowland of South China

    Institute of Scientific and Technical Information of China (English)

    Wen-Jun Duan; Hai Ran; Sheng-Lei Fu; Qin-Feng Guo; Jun Wang

    2008-01-01

    Continuous and prolonged human disturbances have caused severe degradation of a large portion of lowland in South China, and how to restore such degraded ecosystems becomes an increasing concern. The process and mechanisms of spontaneous succession, which plays an important role in vegetation restoration, have not been adequately examined. To identify the pathways of early spontaneous vegetation succession, 41 plots representing plant communities abandoned over different times were established and Investigated. The communities and indicator species of the vegetation were classified by analyzing the important values of plant species using multivariate analyses. The reaults indicated that the plant species could be classified into nine plant communities repreaenting six succession staages. The pathway and species composition alao changed in the process of succession. We also meaeurad 13 environmental variables of microtopography, soil structure and soil nutrition in each plot to examine the driving forces of auccession and the vegetation-environment relationships. Our resulta ahowed that the environmental variables changed in diverse directions, and that aoil bulk density, soil water capacity and soU acidity were the most important factors.

  17. Chemotaxis and degradation of organophosphate compound by a novel moderately thermo-halo tolerant Pseudomonas sp. strain BUR11: evidence for possible existence of two pathways for degradation

    OpenAIRE

    Pailan, Santanu; Saha, Pradipta

    2015-01-01

    An organophosphate (OP) degrading chemotactic bacterial strain BUR11 isolated from an agricultural field was identified as a member of Pseudomonas genus on the basis of its 16S rRNA gene sequence. The strain could utilize parathion, chlorpyrifos and their major hydrolytic intermediates as sole source of carbon for its growth and exhibited positive chemotactic response towards most of them. Optimum concentration of parathion for its growth was recorded to be 200 ppm and 62% of which was degrad...

  18. Aqueous photodegradation of 4-tert-butylphenol: By-products, degradation pathway and theoretical calculation assessment.

    Science.gov (United States)

    Wu, Yanlin; Shi, Jin; Chen, Hongche; Zhao, Jianfu; Dong, Wenbo

    2016-10-01

    4-tert-butylphenol (4-t-BP), an endocrine disrupting chemical, is widely distributed in natural bodies of water but is difficult to biodegrade. In this study, we focused on the transformation of 4-t-BP in photo-initiated degradation processes. The steady-state photolysis and laser flash photolysis (LFP) experiments were conducted in order to elucidate its degradation mechanism. Identification of products was performed using the GC-MS, LC-MS and theoretical calculation techniques. The oxidation pathway of 4-t-BP by hydroxyl radical (HO) was also studied and H2O2 was added to produce HO. 4-tert-butylcatechol and 4-tert-butylphenol dimer were produced in 4-t-BP direct photolysis. 4-tert-butylcatechol and hydroquinone were produced by the oxidation of HO. But the formation mechanism of 4-tert-butylcatechol in the two processes was different. The benzene ring was fractured in 4-t-BP oxidation process and 29% of TOC was degraded after 16h irradiation. PMID:27213674

  19. Degradation pathway of quinolines in a biofilm system under denitrifying conditions

    Energy Technology Data Exchange (ETDEWEB)

    Johansen, S.S.; Arvin, E.; Mosbaek, H. [Technical Univ. of Denmark, Lyngby (Denmark). Dept. of Environmental Science and Engineering; Hansen, A.B. [National Environmental Research Inst., Roskilde (Denmark). Dept. of Environmental Chemistry

    1997-09-01

    This article reports for the first time the degradation pathways of quinoline, isoquinoline, and methylquinolines by a mixed culture in a biofilm under nitrate-reducing conditions. A simple reverse-phase high-performance liquid chromatography method using ultraviolet detection at 223 nm for determination of seven quinoline analogues and 15 metabolites was developed, and gas chromatography--mass spectrometry and thin-layer chromatography analyses were used for identification. The inhibition of nitrification by the parent compounds and their degradation products was assessed by a nitrification toxicity test called MINNTOX. Quinoline and 3-, 4-, 6-, and 8-methylquinoline were all transformed by hydroxylation into their 2-hydroxyquinoline analogues (2-quinolinones), and isoquinoline was transformed into 1-hydroxyisoquinoline. 2-Methylquinoline was not transformed by this microcosm, likely due to the blockage at position 2 by the methyl group. The hydroxylated metabolites of isoquinoline and quinolines methylated at the heterocyclic ring were not transformed further, whereas metabolites of quinoline and quinolines methylated at the homocyclic ring were hydrogenated at position 3 and 4, and the resulting 3,4-dihydro-2-quinolinone analogues accumulated. Of these metabolites, only 3,4-dihydro-2-quinolinone from the degradation of quinoline was further transformed into unidentified products. All quinolines and their metabolites had inhibiting effects on the nitrifying bacteria at the same level (ppm) in the applied bioassay, indicating that the inhibition of the compounds was not influenced by the initial transformation reactions.

  20. Identification of Genes and Pathways Related to Phenol Degradation in Metagenomic Libraries from Petroleum Refinery Wastewater

    Science.gov (United States)

    Silva, Cynthia C.; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; De Paula, Sérgio O.; Silva, Lívia C. F.; Vidigal, Pedro M. P.; Vicentini, Renato; Sousa, Maíra P.; Torres, Ana Paula R.; Santiago, Vânia M. J.; Oliveira, Valéria M.

    2013-01-01

    Two fosmid libraries, totaling 13,200 clones, were obtained from bioreactor sludge of petroleum refinery wastewater treatment system. The library screening based on PCR and biological activity assays revealed more than 400 positive clones for phenol degradation. From these, 100 clones were randomly selected for pyrosequencing in order to evaluate the genetic potential of the microorganisms present in wastewater treatment plant for biodegradation, focusing mainly on novel genes and pathways of phenol and aromatic compound degradation. The sequence analysis of selected clones yielded 129,635 reads at an estimated 17-fold coverage. The phylogenetic analysis showed Burkholderiales and Rhodocyclales as the most abundant orders among the selected fosmid clones. The MG-RAST analysis revealed a broad metabolic profile with important functions for wastewater treatment, including metabolism of aromatic compounds, nitrogen, sulphur and phosphorus. The predicted 2,276 proteins included phenol hydroxylases and cathecol 2,3- dioxygenases, involved in the catabolism of aromatic compounds, such as phenol, byphenol, benzoate and phenylpropanoid. The sequencing of one fosmid insert of 33 kb unraveled the gene that permitted the host, Escherichia coli EPI300, to grow in the presence of aromatic compounds. Additionally, the comparison of the whole fosmid sequence against bacterial genomes deposited in GenBank showed that about 90% of sequence showed no identity to known sequences of Proteobacteria deposited in the NCBI database. This study surveyed the functional potential of fosmid clones for aromatic compound degradation and contributed to our knowledge of the biodegradative capacity and pathways of microbial assemblages present in refinery wastewater treatment system. PMID:23637911

  1. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Directory of Open Access Journals (Sweden)

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  2. Abiotic degradation rates for carbon tetrachloride and chloroform: Final report.

    Energy Technology Data Exchange (ETDEWEB)

    Amonette, James E.; Jeffers, Peter M.; Qafoku, Odeta; Russell, Colleen K.; Humphrys, Daniel R.; Wietsma, Thomas W.; Truex, Michael J.

    2012-12-01

    This report documents the objectives, technical approach, and progress made through FY 2012 on a project initiated in FY 2006 to help address uncertainties related to the rates of hydrolysis in groundwater for carbon tetrachloride (CT) and chloroform (CF). The project also sought to explore the possible effects of contact with minerals and sediment (i.e., heterogeneous hydrolysis) on these rates. We conducted 114 hydrolysis rate experiments in sealed vessels across a temperature range of 20-93 °C for periods as long as 6 years, and used the Arrhenius equation to estimate activation energies and calculate half-lives for typical Hanford groundwater conditions (temperature of 16 °C and pH of 7.75). We calculated a half-life of 630 years for hydrolysis for CT under these conditions and found that CT hydrolysis was unaffected by contact with sterilized, oxidized minerals or Hanford sediment within the sensitivity of our experiments. In contrast to CT, hydrolysis of CF was generally slower and very sensitive to pH due to the presence of both neutral and base-catalyzed hydrolysis pathways. We calculated a half-life of 3400 years for hydrolysis of CF in homogeneous solution at 16 °C and pH 7.75. Experiments in suspensions of Hanford sediment or smectite, the dominant clay mineral in Hanford sediment, equilibrated to an initial pH of 7.2, yielded calculated half-lives of 1700 years and 190 years, respectively, at 16 °C. Experiments with three other mineral phases at the same pH (muscovite mica, albite feldspar, and kaolinite) showed no change from the homogeneous solution results (i.e., a half-life of 3400 years). The strong influence of Hanford sediment on CF hydrolysis was attributed to the presence of smectite and its ability to adsorb protons, thereby buffering the solution pH at a higher level than would otherwise occur. The project also determined liquid-vapor partition coefficients for CT under the temperatures and pressures encountered in the sealed vessels that

  3. Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chlorobenzoate in Alcaligenes eutrophus JMP134(pJP4).

    OpenAIRE

    Don, R H; Weightman, A J; Knackmuss, H J; Timmis, K N

    1985-01-01

    Plasmid pJP4 permits its host bacterium, strain JMP134, to degrade and utilize as sole sources of carbon and energy 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (R. H. Don and J. M. Pemberton, J. Bacteriol. 145:681-686, 1981). Mutagenesis of pJP4 by transposons Tn5 and Tn1771 enabled localization of five genes for enzymes involved in these catabolic pathways. Four of the genes, tfdB, tfdC, tfdD, and tfdE, encoded 2,4-dichlorophenol hydroxylase, dichlorocatechol 1,2-dioxygenase, chlorom...

  4. Computational protein design enables a novel one-carbon assimilation pathway

    Energy Technology Data Exchange (ETDEWEB)

    Siegel, JB; Smith, AL; Poust, S; Wargacki, AJ; Bar-Even, A; Louw, C; Shen, BW; Eiben, CB; Tran, HM; Noor, E; Gallaher, JL; Bale, J; Yoshikuni, Y; Gelb, MH; Keasling, JD; Stoddard, BL; Lidstrom, ME; Baker, D

    2015-03-09

    We describe a computationally designed enzyme, formolase (FLS), which catalyzes the carboligation of three one-carbon formaldehyde molecules into one three-carbon dihydroxyacetone molecule. The existence of FLS enables the design of a new carbon fixation pathway, the formolase pathway, consisting of a small number of thermodynamically favorable chemical transformations that convert formate into a three-carbon sugar in central metabolism. The formolase pathway is predicted to use carbon more efficiently and with less backward flux than any naturally occurring one-carbon assimilation pathway. When supplemented with enzymes carrying out the other steps in the pathway, FLS converts formate into dihydroxyacetone phosphate and other central metabolites in vitro. These results demonstrate how modern protein engineering and design tools can facilitate the construction of a completely new biosynthetic pathway.

  5. Thermogravimetric analysis and thermal degradation behaviour of advanced PMR-X carbon fiber composites

    International Nuclear Information System (INIS)

    Thermal degradation behavior of sized and unsized carbon fibers in polyimide matrix was investigated. Degradation of neat resin and unidirectional laminates were investigated by thermogravimetric analysis technique at temperatures between 470 digC-650 digC and up to 250 h rs. Isothermal ageing of the PMR-X composite samples under different test conditions (i. e. different temperatures and prolonged aging times), showed that oxidation and degradation occurs in stage three different rates. Thermogravimetric analysis showed that the cured PMR-X composite panels are more stable in an inert atmosphere (nitrogen atmosphere)than in air and the degradation of neat resin is much higher than the composite samples. However, the rate of degradation of the unsized untreated carbon fibers in nitrogen environment is much higher than that for the PMR-X composites containing sized fibers

  6. Removal and Degradation Pathways of Sulfamethoxazole Present in Synthetic Municipal Wastewater via an Anaerobic Membrane Bioreactor

    KAUST Repository

    Sanchez Huerta, Claudia

    2016-05-01

    The current global water crisis in addition to continues contamination of natural water bodies with harmful organic micropollutants (OMPs) have driven the development of new water treatment technologies that allow the efficient removal of such compounds. Among a long list of OMPs, antibiotics are considered as top priority pollutants to be treated due to their great resistance to biological treatments and their potential to develop bacterial resistance. Different approaches, such as membrane-based and advance oxidation processes have been proposed to alleviate or minimize antibiotics discharge into aquatic environments. However most of these processes are costly and generate either matrices with high concentration of OMPs or intermediate products with potentially greater toxicity or persistence. Therefore, this thesis proposes the study of an anaerobic membrane bioreactor (AnMBR) for the treatment of synthetic municipal wastewater containing sulfamethoxazole (SMX), a world widely used antibiotic. Besides the general evaluation of AnMBR performance in the COD removal and biogas production, this research mainly focuses on the SMX removal and its degradation pathway. Thus 5 SMX quantification was performed through solid phase extraction-liquid chromatography/mass spectrometry and the identification of its transformation products (TPs) was assessed by gas chromatography/mass spectrometry technique. The results achieved showed that, working under optimal conditions (35°C, pH 7 and ORP around -380 to -420 mV) and after a biomass adaptation period (maintaining 0.85 VSS/TSS ratio), the AnMBR process provided over 95% COD removal and 95-98% SMX removal, while allowing stable biogas composition and methane production (≈130 mL CH4/g CODremoved). Kinetic analysis through a batch test showed that after 24 h of biological reaction, AnMBR process achieved around 94% SMX removal, indicating a first order kinetic reaction with K= 0.119, which highlights the high degradation

  7. Latitudinal gradients in degradation of marine dissolved organic carbon

    DEFF Research Database (Denmark)

    Arnosti, Carol; Steen, Andrew; Ziervogel, Kai;

    2011-01-01

    Heterotrophic microbial communities cycle nearly half of net primary productivity in the ocean, and play a particularly important role in transformations of dissolved organic carbon (DOC). The specific means by which these communities mediate the transformations of organic carbon are largely unkn...

  8. Peroxi-coagulation degradation of C.I. Basic Yellow 2 based on carbon-PTFE and carbon nanotube-PTFE electrodes as cathode

    International Nuclear Information System (INIS)

    The electrochemical treatment of solutions containing C.I. Basic Yellow 2 (BY2) in aqueous solutions with carbon-PTFE (polytetrafluoroethylene) and carbon nanotube (CNT)-PTFE electrodes as cathode has been studied. The fabricated electrodes were characterized by scanning electron microscopy (SEM) and atomic force microscopy (AFM). The amount of electrogenerated H2O2 on the surface of these electrodes was investigated, too. The results showed that the amount of H2O2 obtained with the CNT-PTFE electrode was nearly three times higher than that of carbon-PTFE electrode. The decolorization efficiency of BY2 in peroxi-coagulation process reached 62% and 96% in the first 10 min by carbon-PTFE and CNT-PTFE electrodes at 100 mA, respectively. The effect of operational parameters such as applied current, initial pH and initial dye concentration was studied in an attempt to reach higher decolorization efficiency. The degradation and mineralization of BY2 using CNT-PTFE electrode were followed by total organic carbon (TOC) and GC-MS analysis. The results of TOC measurements indicated that peroxi-coagulation with carbon-PTFE allowed 81% mineralization after 6 h of electrolysis; whereas peroxi-coagulation with CNT-PTFE yields 92% mineralization under the same conditions. GC-MS analysis verified the identity of intermediates and a reaction pathway based on them was proposed.

  9. Peroxi-coagulation degradation of C.I. Basic Yellow 2 based on carbon-PTFE and carbon nanotube-PTFE electrodes as cathode

    Energy Technology Data Exchange (ETDEWEB)

    Zarei, Mahmoud [Department of Applied Chemistry, University of Tabriz, Tabriz (Iran, Islamic Republic of)], E-mail: Zarei90211@yahoo.com; Salari, Darioush [Department of Applied Chemistry, University of Tabriz, Tabriz (Iran, Islamic Republic of)], E-mail: Darioush_salari@yahoo.com; Niaei, Aligoli [Department of Applied Chemistry, University of Tabriz, Tabriz (Iran, Islamic Republic of)], E-mail: Niaei@yahoo.com; Khataee, Alireza [Department of Applied Chemistry, University of Tabriz, Tabriz (Iran, Islamic Republic of)], E-mail: a_khataee@tabrizu.ac.ir

    2009-11-01

    The electrochemical treatment of solutions containing C.I. Basic Yellow 2 (BY2) in aqueous solutions with carbon-PTFE (polytetrafluoroethylene) and carbon nanotube (CNT)-PTFE electrodes as cathode has been studied. The fabricated electrodes were characterized by scanning electron microscopy (SEM) and atomic force microscopy (AFM). The amount of electrogenerated H{sub 2}O{sub 2} on the surface of these electrodes was investigated, too. The results showed that the amount of H{sub 2}O{sub 2} obtained with the CNT-PTFE electrode was nearly three times higher than that of carbon-PTFE electrode. The decolorization efficiency of BY2 in peroxi-coagulation process reached 62% and 96% in the first 10 min by carbon-PTFE and CNT-PTFE electrodes at 100 mA, respectively. The effect of operational parameters such as applied current, initial pH and initial dye concentration was studied in an attempt to reach higher decolorization efficiency. The degradation and mineralization of BY2 using CNT-PTFE electrode were followed by total organic carbon (TOC) and GC-MS analysis. The results of TOC measurements indicated that peroxi-coagulation with carbon-PTFE allowed 81% mineralization after 6 h of electrolysis; whereas peroxi-coagulation with CNT-PTFE yields 92% mineralization under the same conditions. GC-MS analysis verified the identity of intermediates and a reaction pathway based on them was proposed.

  10. Degradation-by-design: Surface modification with functional substrates that enhance the enzymatic degradation of carbon nanotubes.

    Science.gov (United States)

    Sureshbabu, Adukamparai Rajukrishnan; Kurapati, Rajendra; Russier, Julie; Ménard-Moyon, Cécilia; Bartolini, Isacco; Meneghetti, Moreno; Kostarelos, Kostas; Bianco, Alberto

    2015-12-01

    Biodegradation of carbon-based nanomaterials has been pursued intensively in the last few years, as one of the most crucial issues for the design of safe, clinically relevant conjugates for biomedical applications. In this paper it is demonstrated that specific functional molecules can enhance the catalytic activity of horseradish peroxidase (HRP) and xanthine oxidase (XO) for the degradation of carbon nanotubes. Two different azido coumarins and one cathecol derivative are linked to multi-walled carbon nanotubes (MWCNTs). These molecules are good reducing substrates and strong redox mediators to enhance the catalytic activity of HRP. XO, known to metabolize various molecules mainly in the mammalian liver, including human, was instead used to test the biodegradability of MWCNTs modified with an azido purine. The products of the biodegradation process are characterized by transmission electron microscopy and Raman spectroscopy. The results indicate that coumarin and catechol moieties have enhanced the biodegradation of MWCNTs compared to oxidized nanotubes, likely due to the capacity of these substrates to better interact with and activate HRP. Although azido purine-MWCNTs are degraded less effectively by XO than oxidized nanotubes, the data uncover the importance of XO in the biodegradation of carbon-nanomaterials leading to their better surface engineering for biomedical applications. PMID:26342557

  11. Naphthalene Degradation and Incorporation of Naphthalene-Derived Carbon into Biomass by the Thermophile Bacillus thermoleovorans

    OpenAIRE

    Annweiler, E.; Richnow, H.H.; Antranikian, G.; Hebenbrock, S.; Garms, C.; Franke, S; Francke, W.; Michaelis, W

    2000-01-01

    The thermophilic aerobic bacterium Bacillus thermoleovorans Hamburg 2 grows at 60°C on naphthalene as the sole source of carbon and energy. In batch cultures, an effective substrate degradation was observed. The carbon balance, including naphthalene, metabolites, biomass, and CO2, was determined by the application of [1-13C]naphthalene. The incorporation of naphthalene-derived carbon into the bulk biomass as well as into specified biomass fractions such as fatty acids and amino acids was conf...

  12. Excretion pathways and ruminal disappearance of glyphosate and its degradation product aminomethylphosphonic acid in dairy cows.

    Science.gov (United States)

    von Soosten, D; Meyer, U; Hüther, L; Dänicke, S; Lahrssen-Wiederholt, M; Schafft, H; Spolders, M; Breves, G

    2016-07-01

    From 6 balance experiments with total collection of feces and urine, samples were obtained to investigate the excretion pathways of glyphosate (GLY) in lactating dairy cows. Each experiment lasted for 26d. The first 21d served for adaptation to the diet, and during the remaining 5d collection of total feces and urine was conducted. Dry matter intake and milk yield were recorded daily and milk and feed samples were taken during the sampling periods. In 2 of the 6 experiments, at the sampling period for feces and urine, duodenal contents were collected for 5d. Cows were equipped with cannulas at the dorsal sac of the rumen and the proximal duodenum. Duodenal contents were collected every 2h over 5 consecutive days. The daily duodenal dry matter flow was measured by using chromium oxide as a volume marker. All samples (feed, feces, urine, milk and duodenal contents were analyzed for GLY and aminomethylphosphonic acid (AMPA). Overall, across the 6 experiments (n=32) the range of GLY intake was 0.08 to 6.67mg/d. The main proportion (61±11%; ±SD) of consumed GLY was excreted with feces; whereas excretion by urine was 8±3% of GLY intake. Elimination via milk was negligible. The GLY concentrations above the limit of quantification were not detected in any of the milk samples. A potential ruminal degradation of GLY to AMPA was derived from daily duodenal GLY flow. The apparent ruminal disappearance of GLY intake was 36 and 6%. In conclusion, the results of the present study indicate that the gastrointestinal absorption of GLY is of minor importance and fecal excretion represents the major excretion pathway. A degradation of GLY to AMPA by rumen microbes or a possible retention in the body has to be taken into account. PMID:27108173

  13. Photocatalytic degradation of metoprolol tartrate in suspensions of two TiO{sub 2}-based photocatalysts with different surface area. Identification of intermediates and proposal of degradation pathways

    Energy Technology Data Exchange (ETDEWEB)

    Abramovic, Biljana, E-mail: biljana.abramovic@dh.uns.ac.rs [Department of Chemistry, Biochemistry and Environmental Protection, Faculty of Sciences, University of Novi Sad, Trg D. Obradovica 3, 21000 Novi Sad (Serbia); Kler, Sanja, E-mail: sanja.kler@dh.uns.ac.rs [Department of Chemistry, Biochemistry and Environmental Protection, Faculty of Sciences, University of Novi Sad, Trg D. Obradovica 3, 21000 Novi Sad (Serbia); Sojic, Daniela, E-mail: daniela.sojic@dh.uns.ac.rs [Department of Chemistry, Biochemistry and Environmental Protection, Faculty of Sciences, University of Novi Sad, Trg D. Obradovica 3, 21000 Novi Sad (Serbia); Lausevic, Mila, E-mail: milal@tmf.bg.ac.rs [Faculty of Technology and Metallurgy, University of Belgrade, Karnegijeva 4, 11120 Belgrade (Serbia); Radovic, Tanja, E-mail: tradovic@tmf.bg.ac.rs [Faculty of Technology and Metallurgy, University of Belgrade, Karnegijeva 4, 11120 Belgrade (Serbia); Vione, Davide, E-mail: davide.vione@unito.it [Dipartimento di Chimica Analitica, Universita di Torino, Via Pietro Giuria 5, 10125 Torino (Italy)

    2011-12-30

    Highlights: Black-Right-Pointing-Pointer Kinetics and efficiency of photocatalytic degradation of the {beta}{sub 1}-blocker metoprolol tartrate (MET). Black-Right-Pointing-Pointer Two TiO{sub 2} specimens employed. Black-Right-Pointing-Pointer Faster degradation of MET, but slower mineralization, obtained with the TiO{sub 2} specimen having lower surface area. Black-Right-Pointing-Pointer Photocatalytic transformation pathways of MET including mineralization. - Abstract: This study investigates the efficiency of the photocatalytic degradation of metoprolol tartrate (MET), a widely used {beta}{sub 1}-blocker, in TiO{sub 2} suspensions of Wackherr's 'Oxyde de titane standard' and Degussa P25. The study encompasses transformation kinetics and efficiency, identification of intermediates and reaction pathways. In the investigated range of initial concentrations (0.01-0.1 mM), the photocatalytic degradation of MET in the first stage of the reaction followed approximately a pseudo-first order kinetics. The TiO{sub 2} Wackherr induced a significantly faster MET degradation compared to TiO{sub 2} Degussa P25 when relatively high substrate concentrations were used. By examining the effect of ethanol as a scavenger of hydroxyl radicals ({center_dot}OH), it was shown that the reaction with {center_dot}OH played the main role in the photocatalytic degradation of MET. After 240 min of irradiation the reaction intermediates were almost completely mineralized to CO{sub 2} and H{sub 2}O, while the nitrogen was predominantly present as NH{sub 4}{sup +}. Reaction intermediates were studied in detail and a number of them were identified using LC-MS/MS (ESI+), which allowed the proposal of a tentative pathway for the photocatalytic transformation of MET as a function of the TiO{sub 2} specimen.

  14. Photocatalytic degradation of metoprolol tartrate in suspensions of two TiO2-based photocatalysts with different surface area. Identification of intermediates and proposal of degradation pathways

    International Nuclear Information System (INIS)

    Highlights: ► Kinetics and efficiency of photocatalytic degradation of the β1-blocker metoprolol tartrate (MET). ► Two TiO2 specimens employed. ► Faster degradation of MET, but slower mineralization, obtained with the TiO2 specimen having lower surface area. ► Photocatalytic transformation pathways of MET including mineralization. - Abstract: This study investigates the efficiency of the photocatalytic degradation of metoprolol tartrate (MET), a widely used β1-blocker, in TiO2 suspensions of Wackherr's “Oxyde de titane standard” and Degussa P25. The study encompasses transformation kinetics and efficiency, identification of intermediates and reaction pathways. In the investigated range of initial concentrations (0.01–0.1 mM), the photocatalytic degradation of MET in the first stage of the reaction followed approximately a pseudo-first order kinetics. The TiO2 Wackherr induced a significantly faster MET degradation compared to TiO2 Degussa P25 when relatively high substrate concentrations were used. By examining the effect of ethanol as a scavenger of hydroxyl radicals (·OH), it was shown that the reaction with ·OH played the main role in the photocatalytic degradation of MET. After 240 min of irradiation the reaction intermediates were almost completely mineralized to CO2 and H2O, while the nitrogen was predominantly present as NH4+. Reaction intermediates were studied in detail and a number of them were identified using LC–MS/MS (ESI+), which allowed the proposal of a tentative pathway for the photocatalytic transformation of MET as a function of the TiO2 specimen.

  15. Anaerobic degradation of carbon capture reclaimer MEA waste.

    Science.gov (United States)

    Wang, S; Hovland, J; Bakke, R

    2013-01-01

    The anaerobic biodegradation of reclaimer MEA (monoethanolamine) waste (MEAw) with easily degradable co-substrates was investigated in a laboratory-scale bioreactor at room temperature during a 160 d experimental run. The reactor that was constructed with three phases to facilitate attached biofilm and suspended biomass retention for degradation of the complex and challenging MEAw performed well. A feed strategy of step-wise increasing organic loading rate (OLR) by either increasing feed MEAw concentration or the hydraulic loading rate was applied. The system performance was evaluated by chemical oxygen demand (COD) removal efficiency, methane yield, MEA removal, and the accumulation of ammonia and volatile fatty acid (VFA). The total COD removal efficiency initially was 93% when the feed was mainly easily degradable co-substrate. The total removal dropped to 75% at the end when MEAw constituted 60% of the feed COD. Ion chromatography results show that the MEA and some unidentified feed chemicals were almost completely consumed. The main products of MEAw degradation were ammonia, VFAs and biogas. The ammonia nitrogen concentration reached about 2.0 g/L, which may explain the observed inhibition of acetoclastic methanogenesis leading to acetate accumulation. Methane accounted for up to 80% of the biogas generated. The highest methane yield was 0.34 L/g-COD while the yield was 0.16 L/g-COD at the highest load. This study shows that more than 80% reclaimer MEAw COD degradation with a co-substrate can be maintained in a hybrid anaerobic bioreactor operated in a wide loading range. PMID:23752388

  16. The histamine degradative uptake pathway in human vascular endothelial cells and skin fibroblasts is dependent on extracellular Na+ and Cl-

    International Nuclear Information System (INIS)

    We have previously reported that human vascular endothelial cells and skin fibroblasts carry out degradation of [3H]histamine by a mechanism involving two successive enzymatic steps: imidazole ring tele-methylation by the cells' endogenous methyltransferase and subsequent amine oxidation by an exogenous diamine oxidase. Both histamine and the exogenous second enzyme in the pathway associate with the cells via separate binding sites or receptors. The enzymatic degradation process results in cellular accumulation of the proximal and distal metabolites tele-methylhistamine and 1-methyl-4-imidazoleacetic acid (MIAA). We have now demonstrated that this two-stage histamine degradative pathway is dependent on Na+ and Cl- in the extracellular environment. Accumulation of [3H] histamine-derived products is partially inhibited under conditions of Na+ deprivation and more substantially when Cl- is also withdrawn. The individual tele-methylation and amine oxidation enzymatic reactions themselves are unaffected or actually facilitated under these conditions. This indicates that it is the cellular mechanism for uptake coupled to the degradative pathway which reflects the cation and anion dependency. Restoration of degradative uptake displays a biphasic Na+ concentration curve, suggesting that the uptake process may be driven by multiple components. These findings indicate a role for both inward Na+ and Cl- ion movement in this cellular degradative uptake mechanism

  17. Enhanced degradation of carbon tetrachloride by surfactant-modified zero-valent iron

    Institute of Scientific and Technical Information of China (English)

    MENG Ya-feng; GUAN Bao-hong; WU Zhong-biao; WANG Da-hui

    2006-01-01

    Sorption of carbon tetrachloride (CT) by zero-valent iron (ZVI) is the rate-limiting step in the degradation of CT, so the sorption capacity of ZVI is of great importance. This experiment was aimed at enhancing the sorption of CT by ZVI and the degradation rate of CT by modification of surfactants. This study showed that ZVI modified by cationic surfactants has favorable synergistic effect on the degradation of CT. The CT degradation rate of ZVI modified by cetyl pyridinium bromide (CPB) was higher than that of the unmodified ZVI by 130%, and the CT degradation rate of ZVI modified by cetyl trimethyl ammonium bromide (CTAB) was higher than that of the unmodified ZVI by 81%. This study also showed that the best degradation effect is obtained at the near critical micelle concentrations (CMC) and that high loaded cationic surfactant does not have good synergistic effect on the degradation due to its hydrophilicity and the block in surface reduction sites. Furthermore degradation of CT by ZVI modified by nonionic surfactant has not positive effect on the degradation as the ionic surfactant and the ZVI modified by anionic surfactant has hardly any obvious effects on the degradation.

  18. Anoxic carbon degradation in Arctic sediments: Microbial transformations of complex substrates

    DEFF Research Database (Denmark)

    Arnosti, Carol; Finke, Niko; Larsen, Ole;

    2005-01-01

    Complex substrates are degraded in anoxic sediments by the concerted activities of diverse microbial communities. To explore the effects of substrate complexity on carbon transformations in permanently cold anoxic sediments, four substrates—Spirulina cells, Isochrysis cells, and soluble high...... of carbon degradation diverged, with an additional 43%, 32%, 33%, and 8% of Isochrysis, Iso-Ex, Spirulina, and Spir-Ex carbon respired to CO2 over the next 750 h of incubation. Somewhat surprisingly, the soluble, carbohydrate-rich extracts did not prove to be more labile substrates than the whole...... cells from which they were derived. Although Spirulina and Iso-Ex differed in physical and chemical characteristics (solid/soluble, C/N ratio, lipid and carbohydrate content), nearly identical quantities of carbon were respired to CO2. In contrast, only 15% of Spir-Ex carbon was respired, despite the...

  19. Ni-YSZ Substrate Degradation during Carbon Deposition

    Energy Technology Data Exchange (ETDEWEB)

    Marinsek, M.

    2011-07-01

    Carbon deposition on various Ni-YSZ catalytic composites with average Ni particle size from 0.44 {mu}m to 0.98 mm was studied under dry CH{sub 4}-Ar and humidified CH{sub 4}-Ar conditions. The change in the catalytic activity was monitored both as a mass gain due to carbon deposition and hydrogen evolution due to CH{sub 4} dehydrogenation on Ni-YSZ. Regarding the start of methane decomposition and subsequent catalyst deactivation rate, composites with smaller Ni-grains were much more active in comparison to those with relatively large grains. Dry methane conditions always caused coking of the catalyst substrate with substantial activity loss. In contrast, under humidified methane atmosphere conditions with a steam to carbon (S/C) ratio of 0.82, catalytic activity of the Ni-YSZ composites remained nearly undiminished after 2,000 minutes at chosen deposition temperatures (600-800 degree centigrade). On the catalyst surface, some encapsulation of Ni with the deposited carbon was noticed while carbon filaments grew inside the treated samples. The dimensions of C-filaments were influenced by treatment conditions and Ni-YSZ substrate morphology. (Author) 42 refs.

  20. Phosphorus, carbon- and nitrogen interactions in productive and degraded tropical pastures

    Science.gov (United States)

    Oberson, A.; Hegglin, D. D.; Nesper, M.; Rao, I.; Fonte, S.; Ramirez, B.; Velasquez, J.; Tamburini, F.; Bünemann, E. K.; Frossard, E.

    2011-12-01

    Pastures are the main land use in deforested areas of tropical South America. The highly weathered soils of these regions usually have low total and available phosphorus (P) contents. Low P availability can strongly limit plant and animal productivity and other soil ecosystem functions. Most introduced pastures of Brachiaria spp. are grass-alone (GA) while some are grass-legume (GL) pastures. The majority of the introduced pastures, particularly the grass-alone are at some state of degradation (GD). Pasture degradation induces severe loss of plant biomass production, with drastic ecological and economic implications. Although the importance of P deficiency in pasture degradation has been recognized, the knowledge generated on stoichiometry of carbon (C), nitrogen (N) and P along pathways of the nutrient cycles of pastures, with different botanical composition and productivity, has been very limited. We will present results of a case study realized during 2010 to 2011 in the forest margins agro-ecosystem of the department of Caquetá, Colombia. Our objectives were to determine: i) whether P availability is lower in degraded compared to productive pastures, and ii) whether the introduction of legumes in the pasture increases P availability through enhanced biological P cycling through plant growth, plant litter decomposition and the soil microbial biomass; and iii) whether pasture types (GA vs GL) and the state of pasture degradation affect the C:N:P ratios in nutrient pools of the soil-plant system. An on-farm study was conducted on nine farms in the department of Caquetá, Colombia. On every farm three different pasture types were studied: degraded grass alone pastures (GD), productive grass-alone pastures (GA) and productive grass-legume pastures (GL). Basic soil characteristics and indicators on soil P status, microbial P cycling, plant biomass production, plant litter deposition and nutrient concentrations in plant tissue were determined. Analysis of P, C and N

  1. Photocatalytic degradation of indigo carmine dye using TiO2 impregnated activated carbon

    Indian Academy of Sciences (India)

    A K Subramani; K Byrappa; S Ananda; K M Lokanatha Rai; C Ranganathaiah; M Yoshimura

    2007-02-01

    The photocatalytic degradation of indigo carmine dye was studied using hydrothermally prepared TiO2 impregnated activated carbon (TiO2 : AC). A comparison between the degradation of the indigo carmine dye using commercial TiO2 and TiO2 : AC revealed the efficiency of the title compound. The degradation reaction was optimized with respect to the dye concentration and catalyst amount. The reduction in the chemical oxygen demand (COD) revealed the mineralization of dye along with colour removal. The active compound like TiO2 was impregnated onto the activated carbon surface under mild hydrothermal conditions (< 250°C, P ∼ 40 bars). The impregnated activated carbon samples were characterized using powder X-ray diffraction (XRD) and scanning electron microscope (SEM).

  2. Degradation in carbon stocks near tropical forest edges

    OpenAIRE

    Chaplin-Kramer, Rebecca; Ramler, Ivan; Sharp, Richard; Haddad, Nick M.; Gerber, James S.; West, Paul C.; Mandle, Lisa; Engstrom, Peder; Baccini, Alessandro; Sim, Sarah; Mueller, Carina; King, Henry

    2015-01-01

    Carbon stock estimates based on land cover type are critical for informing climate change assessment and landscape management, but field and theoretical evidence indicates that forest fragmentation reduces the amount of carbon stored at forest edges. Here, using remotely sensed pantropical biomass and land cover data sets, we estimate that biomass within the first 500 m of the forest edge is on average 25% lower than in forest interiors and that reductions of 10% extend to 1.5 km from the for...

  3. Ni-YSZ Substrate Degradation during Carbon Deposition

    OpenAIRE

    2011-01-01

    Carbon deposition on various Ni-YSZ catalytic composites with average Ni particle size from 0.44 mm to 0.98 mm was studied under dry CH4-Ar and humidified CH4-Ar conditions. The change in the catalytic activity was monitored both as a mass gain due to carbon deposition and hydrogen evolution due to CH4 dehydrogenation on Ni-YSZ. Regarding the start of methane decomposition and subsequent catalyst deactivation rate, composites with smaller Ni-grains were much more active in compari...

  4. Pasture degradation modifies the water and carbon cycles of the Tibetan highlands

    Directory of Open Access Journals (Sweden)

    W. Babel

    2014-12-01

    Full Text Available The Tibetan Plateau has a significant role with regard to atmospheric circulation and the monsoon in particular. Changes between a closed plant cover and open bare soil are one of the striking effects of land use degradation observed with unsustainable range management or climate change, but experiments investigating changes of surface properties and processes together with atmospheric feedbacks are rare and have not been undertaken in the world's two largest alpine ecosystems, the alpine steppe and the Kobresia pygmaea pastures of the Tibetan Plateau. We connected measurements of micro-lysimeter, chamber, 13C labelling, and eddy covariance and combined the observations with land surface and atmospheric models, adapted to the highland conditions. This allowed us to analyse how three degradation stages affect the water and carbon cycle of pastures on the landscape scale within the core region of the Kobresia pygmaea ecosystem. The study revealed that increasing degradation of the Kobresia turf affects carbon allocation and strongly reduces the carbon uptake, compromising the function of Kobresia pastures as a carbon sink. Pasture degradation leads to a shift from transpiration to evaporation while a change in the sum of evapotranspiration over a longer period cannot be confirmed. The results show an earlier onset of convection and cloud generation, likely triggered by a shift in evapotranspiration timing when dominated by evaporation. Consequently, precipitation starts earlier and clouds decrease the incoming solar radiation. In summary, the changes in surface properties by pasture degradation found on the highland have a significant influence on larger scales.

  5. Pasture degradation modifies the water and carbon cycles of the Tibetan highlands

    Directory of Open Access Journals (Sweden)

    W. Babel

    2014-06-01

    Full Text Available The Tibetan Plateau has a significant role with regard to atmospheric circulation and the monsoon in particular. Changes between a closed plant cover and open bare soil are one of the striking effects of land use degradation observed with unsustainable range management or climate change, but experiments coupling changes of surface properties and processes with atmospheric feedbacks are rare and have not been undertaken in the world's two largest alpine ecosystems, the alpine steppe and the Kobresia pygmaea pastures of the Tibetan plateau. We coupled measurements of micro-lysimeter, chamber, 13C labeling, and eddy-covariance and combined the observations with land surface and atmospheric models, adapted to the highland conditions. This allowed us to analyze how three degradation stages affect the water and carbon cycle of pastures on the landscape scale within the core region of the Kobresia pygmaea ecosystem. The study revealed that increasing degradation of the Kobresia turf affects carbon allocation and strongly reduces the carbon uptake, compromising the function of Kobresia pastures as a carbon sink. Pasture degradation leads to a shift from transpiration to evaporation while the total sum of evapotranspiration remains unaffected. The results show an earlier onset of convection and cloud generation, likely triggered by enhanced evaporation. Consequently, precipitation starts earlier and clouds decrease the incoming solar radiation. In summary, the changes in surface properties by pasture degradation found on the highland have a~significant influence on larger scales.

  6. Pasture degradation modifies the water and carbon cycles of the Tibetan highlands

    Science.gov (United States)

    Babel, W.; Biermann, T.; Coners, H.; Falge, E.; Seeber, E.; Ingrisch, J.; Schleuß, P.-M.; Gerken, T.; Leonbacher, J.; Leipold, T.; Willinghöfer, S.; Schützenmeister, K.; Shibistova, O.; Becker, L.; Hafner, S.; Spielvogel, S.; Li, X.; Xu, X.; Sun, Y.; Zhang, L.; Yang, Y.; Ma, Y.; Wesche, K.; Graf, H.-F.; Leuschner, C.; Guggenberger, G.; Kuzyakov, Y.; Miehe, G.; Foken, T.

    2014-12-01

    The Tibetan Plateau has a significant role with regard to atmospheric circulation and the monsoon in particular. Changes between a closed plant cover and open bare soil are one of the striking effects of land use degradation observed with unsustainable range management or climate change, but experiments investigating changes of surface properties and processes together with atmospheric feedbacks are rare and have not been undertaken in the world's two largest alpine ecosystems, the alpine steppe and the Kobresia pygmaea pastures of the Tibetan Plateau. We connected measurements of micro-lysimeter, chamber, 13C labelling, and eddy covariance and combined the observations with land surface and atmospheric models, adapted to the highland conditions. This allowed us to analyse how three degradation stages affect the water and carbon cycle of pastures on the landscape scale within the core region of the Kobresia pygmaea ecosystem. The study revealed that increasing degradation of the Kobresia turf affects carbon allocation and strongly reduces the carbon uptake, compromising the function of Kobresia pastures as a carbon sink. Pasture degradation leads to a shift from transpiration to evaporation while a change in the sum of evapotranspiration over a longer period cannot be confirmed. The results show an earlier onset of convection and cloud generation, likely triggered by a shift in evapotranspiration timing when dominated by evaporation. Consequently, precipitation starts earlier and clouds decrease the incoming solar radiation. In summary, the changes in surface properties by pasture degradation found on the highland have a significant influence on larger scales.

  7. Hetero-atom doped carbon nanotubes for dye degradation and oxygen reduction reaction

    International Nuclear Information System (INIS)

    We report the synthesis of nitrogen doped vertically aligned multi-walled (MWNCNTs) carbon nanotubes by pyrolysis and its catalytic performance for degradation of methylene blue (MB) dye & oxygen reduction reaction (ORR). The degradation of MB was monitored spectrophotometrically with time. Kinetic studies show the degradation of MB follows a first order kinetic with rate constant k=0.0178 min−1. The present rate constant is better than that reported for various supported/non-supported semiconducting nanomaterials. Further ORR performance in alkaline media makes MWNCNTs a promising cost-effective, fuel crossover tolerance, metal-free, eco-friendly cathode catalyst for direct alcohol fuel cell

  8. The Whole Genome Sequence of Sphingobium chlorophenolicum L-1: Insights into the Evolution of the Pentachlorophenol Degradation Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Copley, Shelley D. [University of Colorado; Rokicki, Joseph [University of Colorado; Turner, Pernilla [University of Colorado; Daligault, Hajnalka E. [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL

    2012-01-01

    Sphingobium chlorophenolicum Strain L-1 can mineralize the toxic pesticide pentachlorophenol (PCP). We have sequenced the genome of S. chlorophenolicum Strain L-1. The genome consists of a primary chromosome that encodes most of the genes for core processes, a secondary chromosome that encodes primarily genes that appear to be involved in environmental adaptation, and a small plasmid. The genes responsible for degradation of PCP are found on chromosome 2. We have compared the genomes of S. chlorophenolicum Strain L-1 and Sphingobium japonicum, a closely related Sphingomonad that degrades lindane. Our analysis suggests that the genes encoding the first three enzymes in the PCP degradation pathway were acquired via two different horizontal gene transfer events, and the genes encoding the final two enzymes in the pathway were acquired from the most recent common ancestor of these two bacteria.

  9. Branching points for transition pathways: assessing responses of actors to challenges on pathways to a low carbon future

    International Nuclear Information System (INIS)

    This paper describes initial analysis of branching points on a set of transition pathways to a UK low carbon electricity future by 2050. As described in other papers in this special issue, we are exploring and analysing a set of core transition pathways, based on alternative governance patterns in which the ‘logics’ of market actors, government actors and civil society actors, respectively dominate. This core pathway analysis is enhanced by analyses of branching points within and across the pathways, which informs how competition between different logics plays out at key decision points. Branching points are defined as key decision points at which choices made by actors, in response to internal or external stresses or triggers, determine whether and in what ways the pathway is followed. A set of initial branching points for our three core transition pathways is identified through project and stakeholder workshops, and drawing on analysis of actors’ choices and responses at past branching points in energy system transitions. The potential responses of the actors are identified at these branching points, and risk mitigation strategies are formulated for the dominant actors to reinforce that pathway, as well as opportunities for actors to move away from the pathway. - Highlights: Transition Pathways is analysing three potential pathways to a low carbon future. ► Stresses lead to branching points, where actors make choices, creating pathways. ► These choices may lead to path-dependency. ► Differences in governance logics within transition pathways are also analysed. ► Studying branching points adds theoretical understanding and policy relevance to TP.

  10. Community diversity, structure and carbon footprint of nematode food web following reforestation on degraded Karst soil

    OpenAIRE

    Ning Hu; Hui Li; Zheng Tang; Zhongfang Li; Jing Tian; Yilai Lou; Jianwei Li; Guichun Li; Xiaomin Hu

    2016-01-01

    We examined community diversity, structure and carbon footprint of nematode food web along a chronosequence of T. Sinensis reforestation on degraded Karst. In general, after the reforestation: a serious of diversity parameters and community indices (Shannon-Weinier index (H′), structure index (SI), etc.) were elevated; biomass ratio of fungivores to bacterivores (FFC/BFC), and fungi to bacteria (F/B) were increased, and nematode channel ratio (NCR) were decreased; carbon footprints of all nem...

  11. Reducing emissions from deforestation and degradation: What contribution from carbon markets?

    OpenAIRE

    Bellassen, Valentin; Crassous, R.; Dietzsch, L.; Schwartzman, S.

    2008-01-01

    Tropical deforestation is responsible for 15-20% of total man-made emissions of greenhouse gases. In December 2007, at the international conference of Bali, the United Nations acknowledged that a viable solution to climate change must include a mechanism to limit deforestation and forest degradation. Today, the most widely used economic tool to reduce emissions is carbon markets: caps on emitters, and trade allowed between emitters and reducers, drive a price signal on carbon and provide ince...

  12. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    OpenAIRE

    G. Cailleau; Braissant, O; E. P. Verrecchia

    2011-01-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from fi...

  13. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    OpenAIRE

    G. Cailleau; Braissant, O; E. P. Verrecchia

    2011-01-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and e...

  14. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    OpenAIRE

    G. Cailleau; Braissant, O.; Verrecchia, E.P.

    2011-01-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and ev...

  15. REGγ regulates ERα degradation via ubiquitin–proteasome pathway in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chai, Fan; Liang, Yan [Breast Disease Center, Southwest Hospital, Third Military Medical University, Chongqing 400038 (China); Bi, Jiong [Laboratory of General Surgery, First Affiliated Hospital, Sun Yet-sen University, Guangzhou 510080 (China); Chen, Li; Zhang, Fan [Breast Disease Center, Southwest Hospital, Third Military Medical University, Chongqing 400038 (China); Cui, Youhong [Institute of Pathology and Southwest Cancer Center, Southwest Hospital, Third Military Medical University, Chongqing 400038 (China); Jiang, Jun, E-mail: jcbd@medmail.com.cn [Breast Disease Center, Southwest Hospital, Third Military Medical University, Chongqing 400038 (China)

    2015-01-02

    Highlights: • High expression of REGγ is correlated with ERα status and poor clinical features. • Cell growth, mobility and invasion are significantly impaired by REGγ knockdown. • REGγ indirectly regulates ERα protein expression. - Abstract: REGγ is a proteasome coactivator which regulates proteolytic activity in eukaryotic cells. Abundant lines of evidence have showed that REGγ is over expressed in a number of human carcinomas. However, its precise role in the pathogenesis of cancer is still unclear. In this study, by examining 200 human breast cancer specimens, we demonstrated that REGγ was highly expressed in breast cancers, and the expression of REGγ was positively correlated with breast cancer patient estrogen receptor alpha (ERα) status. Moreover, the expression of REGγ was found positively associated with poor clinical features and low survival rates in ERα positive breast cancer patients. Further cell culture studies using MCF7 and BT474 breast cancer cell lines showed that cell proliferation, motility, and invasion capacities were decreased significantly by REGγ knockdown. Lastly, we demonstrated that REGγ indirectly regulates the degradation of ERα protein via ubiquitin–proteasome pathway. In conclusion, our findings provide the evidence that REGγ expression was positively correlated with ERα status and poor clinical prognosis in ERα positive breast cancer patients. As well, we disclose a new connection between the two molecules that are both highly expressed in most breast cancer cases.

  16. Carbon and nitrogen stable isotope ratios can estimate anionic polyacrylamide degradation in soil

    Science.gov (United States)

    Water soluble anionic polyacrylamide (PAM) is a highly effective erosion-preventing and infiltration-enhancing polymer, when applied at rates of 1 to 10 g/m-3 in furrow irrigation water. PAM degradation has not directly been measured in soil or water. Natural abundance of the carbon (13C/12C) isoto...

  17. Carbon storage in degraded cork oak (Quercus suber) forests on flat lowlands in Morocco

    OpenAIRE

    Oubrahim H; Boulmane M; Bakker MR; Augusto L; Halim M

    2016-01-01

    The present study aims to quantify the carbon stored in a degraded cork oak (Quercus suber L.) ecosystem in the north west of Morocco, in view of potential management implications. To this end, carbon stocks were evaluated in the first 100 cm of the soil, the cork oak trees, and the understorey species (both above- and belowground). Results show that the total carbon stocks in the cork oak ecosystem ranges from 65 to 237 Mg ha-1 with a mean value of 121 Mg ha-1. The first 100 cm of the soil (...

  18. Degradative intracellular transport of antisecretory component in cultured hepatocytes. An alternate pathway for the immunoglobulin A receptor

    International Nuclear Information System (INIS)

    The liver efficiently transports dimeric immunoglobulin A (dIgA) from blood to bile in a direct, nonlysosomal pathway involving smooth-surfaced vesicles. Secretory component (SC), the plasma membrane receptor for dIgA, is released into bile still bound to its ligand by disulfide bridges. Rabbit IgG antirat SC binds specifically to plasma membrane SC, yet the biliary secretion of anti-SC is markedly lower than that of dIgA, suggesting that the IgG antibodies utilize an alternate transhepatocellular pathway. Uptake of commercially available antihuman SC conjugated to horseradish peroxidase was examined by quantitative electron microscopic immunocytochemistry using primary rat hepatocyte monolayer cultures. Coincubation with human polymeric IgA, rabbit antiserum to rat SC, free human SC, human secretory IgA, and rat bile, all significantly suppressed uptake of anti-SC-horseradish peroxidase, thus demonstrating the specificity of the labeled antibody. Coated vesicles accounted for greater than 70% of the total uptake of either the anti-SC-horseradish peroxidase preparation or colloidal gold-labeled IgG antirat SC. Both compounds could also be observed in other structures associated with the degradative pathway, i.e., multivesicular bodies and lysosomes. Moreover, the extent to which 125I-anti-SC was degraded was significantly greater than that of 125I-dIgA. These data demonstrate that dIgA and anti-SC utilize different intracellular pathways, with anti-SC undergoing lysosomal degradation

  19. Sulfamethoxazole in poultry wastewater: Identification, treatability and degradation pathway determination in a membrane-photocatalytic slurry reactor.

    Science.gov (United States)

    Asha, Raju C; Kumar, Mathava

    2015-01-01

    The presence of sulfamethoxazole (SMX) in a real-time poultry wastewater was identified via HPLC analysis. Subsequently, SMX removal from the poultry wastewater was investigated using a continuous-mode membrane-photocatalytic slurry reactor (MPSR). The real-time poultry wastewater was found to have an SMX concentration of 0-2.3 mg L(-1). A granular activated carbon supported TiO2 (GAC-TiO2) was synthesized, characterized and used in MPSR experiments. The optimal MPSR condition, i.e., HRT ∼ 125 min and catalyst dosage 529.3 mg L(-1), for complete SMX removal was found out using unconstrained optimization technique. Under the optimized condition, the effect of SMX concentration on MPSR performance was investigated by synthetic addition of SMX (i.e., 1, 25, 50, 75 and 100 mg L(-1)) into the wastewater. Interestingly, complete removals of total volatile solids (TVS), biochemical oxygen demand (BOD) and SMX were observed under all SMX concentrations investigated. However, a decline in SMX removal rate and proportionate increase in transmembrane-pressure (TMP) were observed when the SMX concentration was increased to higher levels. In the MPSR, the SMX mineralization was through one of the following degradation pathways: (i) fragmentation of the isoxazole ring and (ii) the elimination of methyl and amide moieties followed by the formation of phenyl sulfinate ion. These results show that the continuous-mode MPSR has great potential in the removal for SMX contaminated real-time poultry wastewater and similar organic micropollutants from wastewater. PMID:26121016

  20. Androgens upregulate Cdc25C protein by inhibiting its proteasomal and lysosomal degradation pathways.

    Directory of Open Access Journals (Sweden)

    Yu-Wei Chou

    Full Text Available Cdc25C is a cell cycle protein of the dual specificity phosphatase family essential for activating the cdk1/Cyclin B1 complex in cells entering into mitosis. Since altered cell cycle is a hallmark of human cancers, we investigated androgen regulation of Cdc25C protein in human prostate cancer (PCa cells, including androgen-sensitive (AS LNCaP C-33 cells and androgen-independent (AI LNCaP C-81 as well as PC-3 cells. In the regular culture condition containing fetal bovine serum (FBS, Cdc25C protein levels were similar in these PCa cells. In a steroid-reduced condition, Cdc25C protein was greatly decreased in AS C-33 cells but not AI C-81 or PC-3 cells. In androgen-treated C-33 cells, the Cdc25C protein level was greatly elevated, following a dose- and a time-dependent manner, correlating with increased cell proliferation. This androgen effect was blocked by Casodex, an androgen receptor blocker. Nevertheless, epidermal growth factor (EGF, a growth stimulator of PCa cells, could only increase Cdc25C protein level by about 1.5-fold. Altered expression of Cdc25C in C-33 cells and PC-3 cells by cDNA and/or shRNA transfection is associated with the corresponding changes of cell growth and Cyclin B1 protein level. Actinomycin D and cycloheximide could only partially block androgen-induced Cdc25C protein level. Treatments with both proteasomal and lysosomal inhibitors resulted in elevated Cdc25C protein levels. Immunoprecipitation revealed that androgens reduced the ubiquitination of Cdc25C proteins. These results show for the first time that Cdc25C protein plays a role in regulating PCa cell growth, and androgen treatments, but not EGF, greatly increase Cdc25C protein levels in AS PCa cells, which is in part by decreasing its degradation. These results can lead to advanced PCa therapy via up-regulating the degradation pathways of Cdc25C protein.

  1. Simulation of permeability evolution of leakage pathway in carbonate-rich caprocks in carbon sequestration

    Science.gov (United States)

    Guo, B.; Fitts, J. P.; Dobossy, M. E.; Peters, C. A.

    2013-12-01

    Geologic carbon sequestration in deep saline aquifers is a promising strategy for mitigating climate change. A major concern is the possibility of brine and CO2 migration through the caprock such as through fractures and faults. In this work, we examine the extent to which mineral dissolution will substantially alter the porosity and permeability of caprock leakage pathways as CO2-acidified brine flows through them. Three models were developed. Firstly, a reactive transport model, Permeability Evolution of Leakage pathway (PEL), was developed to simulate permeability evolution of a leakage pathway during the injection period, and assumes calcite is the only reactive mineral. The system domain is a 100 m long by 0.2 m diameter cylindrical flow path with fixed boundaries containing a rock matrix with an initial porosity of 30% and initial permeability of 1×10-13 m2. One example result is for an initial calcite volume fraction (CVF) of 0.20, in which all the calcite is dissolved after 50 years and the permeability reaches 3.2×10-13 m2. For smaller values of CVF, the permeability reaches its final value earlier but the increase in permeability is minimal. For a large value of CVF such as 0.50, the permeability could eventually reach 1×10-12 m2, but the large amount of dissolved calcium buffers the solution and slows the reaction. After 50 years the permeability change is negligible. Thus, there is a non-monotonic relationship between the amount of calcite in the rock and the resulting permeability change because of the competing dynamics of calcite dissolution and alkalinity build-up. In the second model, PEL was coupled to an existing basin-scale multiphase flow model, Princeton's Estimating Leakage Semi-Analytical (ELSA) model. The new model, ELSA-PEL, estimates the brine and CO2 leakage rates during the injection period under conditions of permeability evolution. The scenario considered in this work is for 50 years of CO2 injection into the Mt. Simon formation in

  2. One-step synthesis of fluorescent carbon nanoparticles for degradation of naphthol green under visible light

    International Nuclear Information System (INIS)

    A novel solvothermal approach to synthesize fluorescent carbon nanoparticles (CNPs) was developed by using citric acid and ammonium oxalateas as the carbon source, glycol as the solvent. The solution of the as-prepared CNPs emitted strong blue fluorescence under UV 365 nm, and the particles were well- dispersed with an average diameter of about 30–40 nm. The solution of the obtained CNPs was applied to photocatalytic degradation of naphthol green, and the decolorization rate is over 91% when the reaction time reaches more than 5 h under visible light in the presence of hydrogen peroxide. - Highlights: • A one-step synthesis of carbon nanoparticles method was developed. • The citric acid and ammoniumoxalate were used as carbon source for the first time. • The photocatalytic activity of carbon nanoparticles under visible light was evaluated

  3. Porcine arterivirus activates the NF-κB pathway through IκB degradation

    International Nuclear Information System (INIS)

    Nuclear factor-kappaB (NF-κB) is a critical regulator of innate and adaptive immune function as well as cell proliferation and survival. The present study demonstrated for the first time that a virus belonging to the Arteriviridae family activates NF-κB in MARC-145 cells and alveolar macrophages. In porcine reproductive and respiratory syndrome virus (PRRSV)-infected cells, NF-κB activation was characterized by translocation of NF-κB from the cytoplasm to the nucleus, increased DNA binding activity, and NF-κB-regulated gene expression. NF-κB activation was increased as PRRSV infection progressed and in a viral dose-dependent manner. UV-inactivation of PRRSV significantly reduced the level of NF-κB activation. Degradation of IκB protein was detected late in PRRSV infection, and overexpression of the dominant negative form of IκBα (IκBαDN) significantly suppressed NF-κB activation induced by PRRSV. However, IκBαDN did not affect viral replication and viral cytopathic effect. PRRSV infection induced oxidative stress in cells by generating reactive oxygen species (ROS), and antioxidants inhibited NF-κB DNA binding activity in PRRSV-infected cells, suggesting ROS as a mechanism by which NF-κB was activated by PRRSV infection. Moreover, NF-κB-dependent expression of matrix metalloproteinase (MMP)-2 and MMP-9 was observed in PRRSV-infected cells, an observation which implies that NF-κB activation is a biologically significant aspect of PRRSV pathogenesis. The results presented here provide a basis for understanding molecular pathways of pathology and immune evasion associated with disease caused by PRRSV

  4. Surface and sub-surface degradation of unidirectional carbon fiber reinforced epoxy composites under dry and wet reciprocating sliding

    OpenAIRE

    Dhieb, H.; Buijnsters, J. G.; Eddoumy, F.; Vázquez, Luis; Celis, J. P.

    2013-01-01

    The role of water on the sub-surface degradation of unidirectional carbon fiber reinforced epoxy composite is examined. The correlation between the debonding of carbon fibers at the fiber-epoxy interface, and the wear behavior of the carbon fiber composite are discussed based on an in-depth analysis of the worn surfaces. We demonstrate that a reciprocating sliding performed along an anti-parallel direction to the fiber orientation under dry conditions results in a large degradation by debondi...

  5. Different pathways of degradation of SP-A and saturated phosphatidylcholine by alveolar macrophages.

    Science.gov (United States)

    Baritussio, A; Alberti, A; Armanini, D; Meloni, F; Bruttomesso, D

    2000-07-01

    Alveolar macrophages degrade surfactant protein (SP) A and saturated phosphatidycholine [dipalmitoylphosphatidylcholine (DPPC)]. To clarify this process, using rabbit alveolar macrophages, we analyzed the effect of drugs known to affect phagocytosis, pinocytosis, clathrin-mediated uptake, caveolae, the cytoskeleton, lysosomal pH, protein kinase C, and phosphatidylinositol 3-kinase (PI3K) on the degradation of SP-A and DPPC. We found the following: 1) SP-A binds to the plasma membrane, is rapidly internalized, and then moves toward degradative compartments. Uptake could be clathrin mediated, whereas phagocytosis, pinocytosis, or the use of caveolae are less likely. An intact cytoskeleton and an acidic milieu are necessary for the degradation of SP-A. 2) Stimulation of protein kinase C increases the degradation of SP-A. 3) PI3K influences the degradation of SP-A by regulating both the speed of internalization and subsequent intracellular steps, but its inhibition does not prevent SP-A from reaching the lysosomal compartment. 4) The degradation of DPPC is unaffected by most of the treatments able to influence the degradation of SP-A. Thus it appears that DPPC is degraded by alveolar macrophages through mechanisms very different from those utilized for the degradation of SP-A. PMID:10893207

  6. Effects of Deforestation and Forest Degradation on Forest Carbon Stocks in Collaborative Forests, Nepal

    Directory of Open Access Journals (Sweden)

    Ram Asheshwar MANDAL

    2012-12-01

    Full Text Available There are some key drivers that favor deforestation and forest degradation. Consequently, levels of carbon stock are affected in different parts of same forest types. But the problem lies in exploring the extent of the effects on level of carbon stocking. This paper highlights the variations in levels of carbon stocks in three different collaborative forests of same forest type i.e. tropical sal (Shorea robusta forest in Mahottari district of the central Terai in Nepal. Three collaborative forests namely Gadhanta-Bardibas Collaborative Forest (CFM, Tuteshwarnath CFM and Banke- Maraha CFM were selected for research site. Interview and workshops were organized with the key informants that include staffs, members and representatives of CFMs to collect the socio-economic data and stratified random sampling was applied to collect the bio-physical data to calculate the carbon stocks. Analysis was carried out using statistical tools. It was found five major drivers namely grazing, fire, logging, growth of invasive species and encroachment. It was found highest carbon 269.36 ton per ha in Gadhanta- Bardibash CFM. The findings showed that the levels of carbon stocks in the three studied CFMs are different depending on how the drivers of deforestation and forest degradation influence over them.

  7. New pathway for degradation of sulfonated azo dyes by microbial peroxidases of Phanerochaete chrysosporium and Streptomyces chromofuscus.

    OpenAIRE

    Goszczynski, S; Paszczynski, A; Pasti-Grigsby, M B; Crawford, R L; Crawford, D. L.

    1994-01-01

    Pathways for the degradation of 3,5-dimethyl-4-hydroxy-azobenzene-4'-sulfonic acid (I) and 3-methoxy-4-hydroxyazobenzene-4'-sulfonamide (II) by the manganese peroxidase and ligninase of Phanerochaete chrysosporium and by the peroxidase of Streptomyces chromofuscus have been proposed. Twelve metabolic products were found, and their mechanisms of formation were explained. Preliminary oxidative activation of the dyes resulted in the formation of cationic species, making the molecules vulnerable ...

  8. Regulation of enzymes of the 3,5-xylenol-degradative pathway in Pseudomonas putida: evidence for a plasmid.

    OpenAIRE

    Hopper, D. J.; Kemp, P D

    1980-01-01

    Constitutive synthesis of enzymes responsible for methyl group oxidation in 3,5-xylenol degradation and an associated p-cresol methylhydroxylase in Pseudomonas putida NCIB 9869 was shown by their retention at high specific activities in cells transferred from 3,5-xylenol medium to glutamate medium. The specific activities of other enzymes of the 3,5-xylenol pathway declined upon removal of aromatic substrate, consistent with their inducible control. Specific activities of the methyl-oxidizing...

  9. Hydrogen and Carbon Black Production from the Degradation of Methane by Thermal Plasma

    Directory of Open Access Journals (Sweden)

    Leila Cottet

    2014-05-01

    Full Text Available Methane gas (CH4 is the main inducer of the so called greenhouse gases effect. Recent scientific research aims to minimize the accumulation of this gas in the atmosphere and to develop processes capable of producing stable materials with added value. Thermal plasma technology is a promising alternative to these applications, since it allows obtaining H2 and solid carbon from CH4, without the parallel formation of byproducts such as CO2 and NOx. In this work, CH4 was degraded by thermal plasma in order to produce hydrogen (H2 and carbon black. The degradation efficiency of CH4, selectivity for H2 production as well as the characterization of carbon black were studied. The best results were obtained in the CH4 flow rate of 5 L min-1 the degradation percentage and the selectivity for H2 production reached 98.8 % and 48.4 %, respectively. At flow rates of less than 5 L min-1 the selectivity for H2 production increases and reaches 91.9 %. The carbon black has obtained amorphous with hydrophobic characteristics and can be marketed to be used in composite material, and can also be activated chemically and/or physically and used as adsorbent material.

  10. Use of 13C NMR and ftir for elucidation of degradation pathways during natural litter decomposition and composting I. early stage leaf degradation

    Science.gov (United States)

    Wershaw, R. L.; Leenheer, J.A.; Kennedy, K.R.; Noyes, T.I.

    1996-01-01

    Oxidative degradation of plant tissue leads to the formation of natural dissolved organic carbon (DOC) and humus. Infrared (IR) and 13C nuclear magnetic resonance (NMR) spectrometry have been used to elucidate the chemical reactions of the early stages of degradation that give rise to DOC derived from litter and compost. The results of this study indicate that oxidation of the lignin components of plant tissue follows the sequence of O-demethylation, and hydroxylation followed by ring-fission, chain-shortening, and oxidative removal of substituents. Oxidative ring-fission leads to the formation of carboxylic acid groups on the cleaved ends of the rings and, in the process, transforms phenolic groups into aliphatic alcoholic groups. The carbohydrate components are broken down into aliphatic hydroxy acids and aliphatic alcohols.

  11. Use of 13C NMR and FTIR for elucidation of degradation pathways during natural litter decomposition and composting. I. Early stage leaf degradation

    International Nuclear Information System (INIS)

    Oxidative degradation of plant tissue leads to the formation of natural dissolved organic carbon (DOC) and humus. Infrared (IR) and 13C nuclear magnetic resonance (NMR) spectrometry have been used to elucidate the chemical reactions of the early stages of degradation that give rise to DOC derived from litter and compost. The results of this study indicate that oxidation of the lignin components of plant tissue follows the sequence of O-demethylation, and hydroxylation followed by ring-fission, chain-shortening, and oxidative removal of substituents. Oxidative ring-fission leads to the formation of carboxylic acid groups on the cleaved ends of the rings and, in the process, transforms phenolic groups into aliphatic alcoholic groups. The carbohydrate components are broken down into aliphatic hydroxy acids and aliphatic alcohols. (author)

  12. TRIM22 Inhibits the TRAF6-stimulated NF-κB Pathway by Targeting TAB2 for Degradation

    Institute of Scientific and Technical Information of China (English)

    Hui Qiu; Fang Huang; Han Xiao; Binlian Sun; Rongge Yang

    2013-01-01

    Tripartite motif containing 22 (TRIM22),a member of the TRIM/RBCC family,has been reported to activate the nuclear factor-kappa B (NF-κB) pathway in unstimulated macrophage cell lines,but the detailed mechanisms governing this activation remains unclear.We investigated this mechanism in HEK293T cells.We found that overexpression of TRIM22 could activate the NF-κB pathway and conversely,could inhibit the tumor necrosis factor receptor-associated factor 6 (TRAF6)-stimulated NF-κB pathway in HEK293T cells.Further experiments showed that TRIM22 could decrease the self-ubiquitination of TRAF6,and interact with and degrade transforming growth factor-β activated kinase 1 binding protein 2 (TAB2),and that these effects could be partially rescued by a TRIM22 RING domain deletion mutant.Collectively,our data indicate that overexpression of TRIM22 may negatively regulate the TRAF6-stimulated NF-κB pathway by interacting with and degrading TAB2.

  13. Tissue Response to, and Degradation Rate of, Photocrosslinked Trimethylene Carbonate-Based Elastomers Following Intramuscular Implantation

    Directory of Open Access Journals (Sweden)

    Brian G. Amsden

    2010-02-01

    Full Text Available Cylindrical elastomers were prepared through the UV-initiated crosslinking of terminally acrylated, 8,000 Da star-poly(trimethylene carbonate-co-ε-caprolactone and star-poly(trimethylene carbonate-co-D,L-lactide. These elastomers were implanted intramuscularly into the hind legs of male Wistar rats to determine the influence of the comonomer on the weight loss, tissue response, and change in mechanical properties of the elastomer. The elastomers exhibited only a mild inflammatory response that subsided after the first week; the response was greater for the stiffer D,L-lactide-containing elastomers. The elastomers exhibited weight loss and sol content changes consistent with a bulk degradation mechanism. The D,L-lactide-containing elastomers displayed a nearly zeroorder change in Young’s modulus and stress at break over the 30 week degradation time, while the ε-caprolactone-containing elastomers exhibited little change in modulus or stress at break.

  14. Adsorption and Photocatalytic Decomposition of the β-Blocker Metoprolol in Aqueous Titanium Dioxide Suspensions: Kinetics, Intermediates, and Degradation Pathways

    Directory of Open Access Journals (Sweden)

    Violette Romero

    2013-01-01

    Full Text Available This study reports the photocatalytic degradation of the β-blocker metoprolol (MET using TiO2 suspended as catalyst. A series of photoexperiments were carried out by a UV lamp, emitting in the 250–400 nm range, providing information about the absorption of radiation in the photoreactor wall. The influence of the radiation wavelength on the MET photooxidation rate was investigated using a filter cutting out wavelengths shorter than 280 nm. Effects of photolysis and adsorption at different initial pH were studied to evaluate noncatalytic degradation for this pharmaceutical. MET adsorption onto titania was fitted to two-parameter Langmuir isotherm. From adsorption results it appears that the photocatalytic degradation can occur mainly on the surface of TiO2. MET removed by photocatalysis was 100% conditions within 300 min, while only 26% was achieved by photolysis at the same time. TiO2 photocatalysis degradation of MET in the first stage of the reaction followed approximately a pseudo-first-order model. The major reaction intermediates were identified by LC/MS analysis such as 3-(propan-2-ylaminopropane-1,2-diol or 3-aminoprop-1-en-2-ol. Based on the identified intermediates, a photocatalytic degradation pathway was proposed, including the cleavage of side chain and the hydroxylation addition to the parent compounds.

  15. Ultrasonic degradation of acetaminophen and naproxen in the presence of single-walled carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Im, Jong-Kwon; Heo, Jiyong; Boateng, Linkel K. [Department of Civil and Environmental Engineering, University of South Carolina, Columbia, SC 29208 (United States); Her, Namguk [Department of Chemistry and Environmental Sciences, Korea Army Academy at Young-Cheon, 135-1, Changhari, Kokyungmeon, Young-cheon, Gyeongbuk 770-849 (Korea, Republic of); Flora, Joseph R.V. [Department of Civil and Environmental Engineering, University of South Carolina, Columbia, SC 29208 (United States); Yoon, Jaekyung [Korea Institute of Energy Research, New and Renewable Energy Research Division, 71-2 Jang-Dong, Yuseong-Gu, Daejeon 305-343 (Korea, Republic of); Zoh, Kyung-Duk [Department of Environmental Health, School of Public Health, Seoul National University, Seoul 151-742 (Korea, Republic of); Yoon, Yeomin, E-mail: yoony@cec.sc.edu [Department of Civil and Environmental Engineering, University of South Carolina, Columbia, SC 29208 (United States)

    2013-06-15

    Highlights: • Sonodegradation of acetaminophen and naproxen was performed. • Degradation was enhanced with the dispersion of SWNTs under US irradiation. • Synergistic effect on the degradation PhACs was observed in US/SWNT process. • Significant removal of dissolved organic carbon was achieved. -- Abstract: Ultrasonic (US) and single-walled carbon nanotube (SWNT)-catalyzed ultrasonic (US/SWNT) degradation of a pharmaceutical (PhAC) mixture of acetaminophen (AAP) and naproxen (NPX) used as analgesics was carried out in water. In the absence of SWNTs, maximum degradations of AAP and NPX occurred at a high frequency (1000 kHz) and under acidic conditions (pH 3) and different solution temperatures (25 °C at 28 kHz and 35 °C at 1000 kHz) during US reactions. Rapid degradation of PhACs occurred within 10 min at 28 kHz (44.5% for AAP; 90.3% for NPX) and 1000 kHz (39.2% for AAP; 74.8% for NPX) at a SWNT concentration of 45 mg L{sup −1} under US/SWNT process, compared with 28 kHz (5.2% for AAP; 10.6% for NPX) and 1000 kHz (29.1% for AAP; 46.2% for NPX) under US process. Degradation was associated with the dispersion of SWNTs; small particles acted as nuclei during US reactions, enhancing the H{sub 2}O{sub 2} production yield. NPX removal was greater than AAP removal under all US-induced reaction and SWNT adsorption conditions, which is governed by the chemical properties of PhACs. Based on the results, the optimal treatment performance was observed at 28 kHz with 45 mg L{sup −1} SWNTs (US/SWNT) within 10 min.

  16. Ultrasonic degradation of acetaminophen and naproxen in the presence of single-walled carbon nanotubes

    International Nuclear Information System (INIS)

    Highlights: • Sonodegradation of acetaminophen and naproxen was performed. • Degradation was enhanced with the dispersion of SWNTs under US irradiation. • Synergistic effect on the degradation PhACs was observed in US/SWNT process. • Significant removal of dissolved organic carbon was achieved. -- Abstract: Ultrasonic (US) and single-walled carbon nanotube (SWNT)-catalyzed ultrasonic (US/SWNT) degradation of a pharmaceutical (PhAC) mixture of acetaminophen (AAP) and naproxen (NPX) used as analgesics was carried out in water. In the absence of SWNTs, maximum degradations of AAP and NPX occurred at a high frequency (1000 kHz) and under acidic conditions (pH 3) and different solution temperatures (25 °C at 28 kHz and 35 °C at 1000 kHz) during US reactions. Rapid degradation of PhACs occurred within 10 min at 28 kHz (44.5% for AAP; 90.3% for NPX) and 1000 kHz (39.2% for AAP; 74.8% for NPX) at a SWNT concentration of 45 mg L−1 under US/SWNT process, compared with 28 kHz (5.2% for AAP; 10.6% for NPX) and 1000 kHz (29.1% for AAP; 46.2% for NPX) under US process. Degradation was associated with the dispersion of SWNTs; small particles acted as nuclei during US reactions, enhancing the H2O2 production yield. NPX removal was greater than AAP removal under all US-induced reaction and SWNT adsorption conditions, which is governed by the chemical properties of PhACs. Based on the results, the optimal treatment performance was observed at 28 kHz with 45 mg L−1 SWNTs (US/SWNT) within 10 min

  17. In-vivo degradation of poly(carbonate-urethane) based spine implants

    OpenAIRE

    Cipriani, E.; Bracco, P.; Kurtz, S.M.; Costa, L.; Zanetti, M.

    2013-01-01

    Fourteen explanted Dynesys® spinal devices were analyzed for biostability and compared with a reference, never implanted, control. Both poly(carbonate-urethane) (PCU) spacers and polyethylene-terephthalate (PET) cords were analyzed. The effect of implantation was evaluated through the observation of physical alterations of the device surfaces, evaluation of the chemical degradation and fluids absorption on the devices and examination of the morphological and mechanical features. PCU spacers e...

  18. Effective Degradation of Aqueous Tetracycline Using a Nano-TiO2/Carbon Electrocatalytic Membrane

    OpenAIRE

    Zhimeng Liu; Mengfu Zhu; Zheng Wang; Hong Wang; Cheng Deng; Kui Li

    2016-01-01

    In this work, an electrocatalytic membrane was prepared to degrade aqueous tetracycline (TC) using a carbon membrane coated with nano-TiO2 via a sol-gel process. SEM, XRD, EDS, and XPS were used to characterize the composition and structure of the electrocatalytic membrane. The effect of operating conditions on the removal rate of tetracycline was investigated systematically. The results show that the chemical oxygen demand (COD) removal rate increased with increasing residence time while it ...

  19. Recovery of energy, water and carbon exchange in degraded forests in eastern Amazonia

    Science.gov (United States)

    Trumbore, Susan; Brando, Paulo; Oliveira dos Santos, Claudinei; Silvério, Divino; Coe, Michael

    2016-04-01

    Large regions in the state of Mato Grosso in Brazil have been deforested and converted to pasture and soy agriculture. In addition to deforestation, remnant forests in the region are degraded by repeated fire and edge related effects. We are combining eddy covariance with other measures to study the impact of these changes in land cover on energy, water and carbon balance, in a region that sits at the ecotone between continuous forest and savanna. The degraded forest plot is part of a multi-year experimental fire treatment and had experienced large-scale mortality in the years prior to tower installation. Leaf area was strongly reduced in degraded forest, but surprisingly latent energy fluxes nearly equaled those in the intact forest. Carbon uptake rates in the intact forest exceeded those in the degraded forest, though not when expressed on a leaf-area basis. Overall, these results corroborate those found in experimentally logged tropical forest showing rapid recovery of fluxes, despite losses of biomass. Compared to both forests, the soy field reflected more incoming energy, and lost a greater proportion of absorbed radiation as sensible rather than latent heat.

  20. Carbon Assimilation Pathways, Water Relationships and Plant Ecology.

    Science.gov (United States)

    Etherington, John R.

    1988-01-01

    Discusses between-species variation in adaptation of the photosynthetic mechanism to cope with wide fluctuations of environmental water regime. Describes models for water conservation in plants and the role of photorespiration in the evolution of the different pathways. (CW)

  1. Characterization of a new degradation product of nifedipine formed on catalysis by atenolol: A typical case of alteration of degradation pathway of one drug by another.

    Science.gov (United States)

    Handa, Tarun; Singh, Saranjit; Singh, Inder Pal

    2014-02-01

    An increasing interest is being shown throughout the world on the use of fixed-dose combinations of drugs in the therapy of select diseases, like cardiovascular diseases, due to their multiple advantages. Though the main criterion for combining drugs in a single dosage form is the rationale, but consideration like stability of formulation is equally important, due to an added aspect of drug-drug interaction. The objective of this study was to evaluate interaction among the drugs in an antihypertensive combination of nifedipine and atenolol. Nifedipine is a known light sensitive drug, which degrades via intra-molecular mechanisms to nitro- and nitroso-pyridine analogs, along with a few minor secondary products that are formed through inter-molecular interactions amongst primary degradation products and their intermediates. Atenolol is reasonably stable weakly basic drug that is mainly hydrolyzed at acetamide terminal amide moiety to its corresponding carboxylic acid. To the best of our knowledge, there is no known information on chemical compatibility among the two drugs. The present study involved subjecting of nifedipine, atenolol and their combination to a variety of accelerated and stress conditions. HPLC studies revealed formation of a new product in the mixture of two drugs (∼2%), which was also generated from nifedipine alone, but at trace levels (<0.1%). The product was isolated by preparative chromatography and subjected to indepth studies for its characterization. Ultra-violet, FT-IR, mass spectrometric and nuclear magnetic resonance spectroscopic studies highlighted that the principal photo-degradation pathway of nifedipine was modified and diverted in the presence of atenolol. To verify the same, a study was conducted employing two other β-blockers with similar structures to atenolol, and the same product was formed in relatively higher quantity therein also. The new product is postulated to be produced as a result of rearrangement of hydroxylamine

  2. Def defines a conserved nucleolar pathway that leads p53 to proteasome-independent degradation

    OpenAIRE

    Tao, Ting; Hui SHI; Guan, Yihong; Huang, Delai; Chen, Ye; Lane, David P; Chen, Jun; Peng, Jinrong

    2013-01-01

    p53 protein turnover through the ubiquitination pathway is a vital mechanism in the regulation of its transcriptional activity; however, little is known about p53 turnover through proteasome-independent pathway(s). The digestive organ expansion factor (Def) protein is essential for the development of digestive organs. In zebrafish, loss of function of def selectively upregulates the expression of p53 response genes, which raises a question as to what is the relationship between Def and p53. W...

  3. Degraded peatlands as a source of riverine organic carbon and enhanced river outgassing in Sumatra, Indonesia

    Science.gov (United States)

    Wit, Francisca; Rixen, Tim

    2014-05-01

    Sumatra, Indonesia, is well known for its widespread tropical peat lands. However, silvi- and agricultural purposes are currently inducing large-scale degradation of peat lands, transforming the landscape into mainly palm-oil plantations. The degradation induces loss of carbon via direct CO2 emissions, but also via riverine outflow of dissolved and particulate organic carbon (DOC and POC, respectively) due to leaching. This organic carbon is then decomposed along the way towards the coast and is hypothesized to enhance coastal and river outgassing of CO2. In the framework of SPICE III, Science for the Protection of Indonesian Coastal Ecosystems, we are quantifying these carbon budgets and fluxes in the rivers and coastal areas of northeast Sumatra. Using underway instruments, we have gathered continuous measurements of various parameters, including pCO2, pH, temperature, salinity and oxygen. In addition, water samples were obtained for DOC, POC, δ13CDIC, alkalinity and nutrient analyses. The results of the first analyses show that pCO2 values in the coastal areas range between 400-600 μatm. However, in the vicinity of the rivers pCO2 concentrations increase tremendously, ranging from 600 near the estuaries to a staggering 9000 μatm further upstream. These values are much higher than the marine pCO2 value of 390 μatm in the South China Sea. When adding carbon isotope results into the story, while knowing that upstream river life is greatly reduced due to oxygen depletion as a result of high DOC decomposition, it appears to be clear from the values, which range between -20 to -24‰ δ13CDIC, that the main source of the organic carbon is indeed originating from the degrading peat lands. In conclusion, our hypothesis can be deemed correct: degrading peat lands enhance organic carbon outflow and therefore elevated decomposition in the rivers, which results in increased river outgassing of CO2. Further analyses will be conducted to precisely quantify the budgets and

  4. Dependency of climate change and carbon cycle on CO2 emission pathways

    International Nuclear Information System (INIS)

    Previous research has indicated that the response of globally average temperature is approximately proportional to cumulative CO2 emissions, yet evidence of the robustness of this relationship over a range of CO2 emission pathways is lacking. To address this, we evaluate the dependency of climate and carbon cycle change on CO2 emission pathways using a fully coupled climate–carbon cycle model. We design five idealized pathways (including an overshoot scenario for cumulative emissions), each of which levels off to final cumulative emissions of 2000 GtC. The cumulative emissions of the overshoot scenario reach 4000 GtC temporarily, subsequently reducing to 2000 GtC as a result of continuous negative emissions. Although we find that responses of climatic variables and the carbon cycle are largely independent of emission pathways, a much weakened Atlantic meridional overturning circulation (AMOC) is projected in the overshoot scenario despite cessation of emissions. This weakened AMOC is enhanced by rapid warming in the Arctic region due to considerable temporary elevation of atmospheric CO2 concentration and induces the decline of surface air temperature and decrease of precipitation over the northern Atlantic and Europe region. Moreover, the weakened AMOC reduces CO2 uptake by the Atlantic and Arctic oceans. However, the weakened AMOC contributes little to the global carbon cycle. In conclusion, although climate variations have been found to be dependent on emission pathways, the global carbon cycle is relatively independent of these emission pathways, at least superficially. (letter)

  5. Carbon storage in degraded cork oak (Quercus suber forests on flat lowlands in Morocco

    Directory of Open Access Journals (Sweden)

    Oubrahim H

    2016-02-01

    Full Text Available The present study aims to quantify the carbon stored in a degraded cork oak (Quercus suber L. ecosystem in the north west of Morocco, in view of potential management implications. To this end, carbon stocks were evaluated in the first 100 cm of the soil, the cork oak trees, and the understorey species (both above- and belowground. Results show that the total carbon stocks in the cork oak ecosystem ranges from 65 to 237 Mg ha-1 with a mean value of 121 Mg ha-1. The first 100 cm of the soil (including the forest floor represents the largest carbon pool (~51% of the total organic carbon of the ecosystem. Tree biomass (above- and belowground tissues of cork oak represents the second largest pool (47%, whereas the contribution of the understorey is less than 2%. Within the first 100 cm of the soil, over 87% of all the soil organic carbon is situated in the first 40 cm of the soil depth. The amount of carbon stored here ranges from 30 to 110 Mg ha-1and these organic carbon stocks vary considerably with the stand basal area of the cork oak (R2 = 0.82. In practice, the carbon stocks of the different pools considered are strongly correlated with the stand density of the cork oak stands. In the semi-arid forest ecosystems of our study, management prescriptions aiming at increasing the standing biomass of the cork oak should thus considerably contribute, both directly through tree biomass and indirectly through increased soil organic matter, to efficient carbon sequestration.

  6. Degradation of Perchloroethene by zero-valent iron evaluated by carbon isotope fractionation

    Science.gov (United States)

    Leitner, Simon; Watzinger, Andrea; Reichenauer, Thomas G.

    2014-05-01

    Perchloroethene (PCE) is a widely spread groundwater contaminant in formally used industrial sites. Zero valent iron (ZVI) is used for in situ chemical reduction (ISCR) of PCE contaminants in the groundwater. A key factor in the application of in situ remediation technologies is a proper monitoring of contaminant reduction. The measurement of the stable isotope ratio is a promising method that is already used for quantifying microbial degradation of chlorinated contaminants. The carbon isotope ratio of PCE, measured by - isotope ratio mass spectrometry coupled to a gas chromatograph via a combustion interface (GC-C-IRMS), increases during degradation of PCE and can be directly related to the degree of degradation. It can be used to directly quantify chemical degradation and thus serves as a useful monitoring tool for groundwater remediation. An experiment to determine the carbon isotopic fractionation factor was performed as a lab experiment using Nanofer Star (NANOIRON). Two different PCE concentrations (c1: 220mgL-1, c2: 110mgL-1) mixed with 0.5 g of ZVI were sealed under deoxygenated conditions in 250 ml glas bottles locked with mininert caps. The bottles were incubated on a shaker for 865 h. Samples were taken weekly to measure the change in the carbon isotopic ratio of PCE as well as its concentration. Results showed a strong increase in the carbon isotope ratio (δ-value) of PCE (start: -27 o end: -4 ), which indicates a significant dechlorination process of PCE. Beside PCE also one degradation product (Trichloroethylene - TCE) was measured. TCE was further dechlorinated as indicated by the δ-value change of TCE from -26 o to -4 oȦn unexpected intermediate value of -45 o for TCE was observed in the experiment. This fluctuation could be induced by the time depending concentration due to degradation and conversation processes. Furthermore, it seems that the progress of the δ-value is affected by the starting concentration of PCE (δ-value of c1 < c2) as

  7. The Rtr1p CTD phosphatase autoregulates its mRNA through a degradation pathway involving the REX exonucleases

    Science.gov (United States)

    Hodko, Domagoj; Ward, Taylor; Chanfreau, Guillaume

    2016-01-01

    Rtr1p is a phosphatase that impacts gene expression by modulating the phosphorylation status of the C-terminal domain of the large subunit of RNA polymerase II. Here, we show that Rtr1p is a component of a novel mRNA degradation pathway that promotes its autoregulation through turnover of its own mRNA. We show that the 3′UTR of the RTR1 mRNA contains a cis element that destabilizes this mRNA. RTR1 mRNA turnover is achieved through binding of Rtr1p to the RTR1 mRNP in a manner that is dependent on this cis element. Genetic evidence shows that Rtr1p-mediated decay of the RTR1 mRNA involves the 5′-3′ DExD/H-box RNA helicase Dhh1p and the 3′-5′ exonucleases Rex2p and Rex3p. Rtr1p and Rex3p are found associated with Dhh1p, suggesting a model for recruiting the REX exonucleases to the RTR1 mRNA for degradation. Rtr1p-mediated decay potentially impacts additional transcripts, including the unspliced BMH2 pre-mRNA. We propose that Rtr1p may imprint its RNA targets cotranscriptionally and determine their downstream degradation mechanism by directing these transcripts to a novel turnover pathway that involves Rtr1p, Dhh1p, and the REX family of exonucleases. PMID:26843527

  8. The regulatory role of reversible phosphorylation in the chlorophyll degradation pathway

    Science.gov (United States)

    Senescence represents the final stage of plant development and is characterized by several processes including the systematic degradation of the photosynthetic apparatus and chlorophyll molecules inside chloroplasts. Normally, chlorophyll is catabolized to colorless compounds through a series of enz...

  9. Electrochemical degradation of benzene in natural water using silver nanoparticle-decorated carbon nanotubes

    International Nuclear Information System (INIS)

    In this study, a novel methodology for the electrochemical degradation of benzene in natural water using silver nanoparticle-decorated carbon nanotubes has been investigated. The morphology, the structure, and the electrochemical performance of the multi-walled carbon nanotubes-silver (MWCNT-Ag) nanocomposite film were characterised by transmission electron microscopy (TEM), X-ray diffraction (XRD), and cyclic voltammetry (CV), respectively. Electrocatalytic oxidation of benzene in an aqueous solution was studied to evaluate potential applications of the MWCNT-Ag modified glassy carbon (GC) electrode in environmental science. The benzene removal efficiency in natural water containing 10 mg L−1 benzene yielded 77.9% at an applied potential of +2.0 V for 2 h using the MWCNT-Ag-GC electrode. In comparison, the removal efficiency reached only 8.0% with the bare GC electrode, showing the suitability of the MWCNT-Ag nanocomposite modified GC electrode for electro-oxidation of benzene in natural water. - Graphical abstract: Display Omitted - Highlights: • A novel methodology for the electrochemical degradation of benzene was developed. • Sensor based on silver nanoparticle-decorated carbon nanotubes was used. • The proposed method is suitable and efficient for the removal of benzene

  10. Electrochemical degradation of benzene in natural water using silver nanoparticle-decorated carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Cesarino, Ivana, E-mail: ivana@iqsc.usp.br [Instituto de Química de São Carlos, Universidade de São Paulo, C.P. 780, 13560-970, São Carlos, SP (Brazil); Cesarino, Vivian; Moraes, Fernando C.; Ferreira, Tanare C.R.; Lanza, Marcos R.V. [Instituto de Química de São Carlos, Universidade de São Paulo, C.P. 780, 13560-970, São Carlos, SP (Brazil); Mascaro, Lucia H. [Departamento de Química, Universidade Federal de São Carlos, C.P. 676, 13560-970, São Carlos, SP (Brazil); Machado, Sergio A.S. [Instituto de Química de São Carlos, Universidade de São Paulo, C.P. 780, 13560-970, São Carlos, SP (Brazil)

    2013-08-15

    In this study, a novel methodology for the electrochemical degradation of benzene in natural water using silver nanoparticle-decorated carbon nanotubes has been investigated. The morphology, the structure, and the electrochemical performance of the multi-walled carbon nanotubes-silver (MWCNT-Ag) nanocomposite film were characterised by transmission electron microscopy (TEM), X-ray diffraction (XRD), and cyclic voltammetry (CV), respectively. Electrocatalytic oxidation of benzene in an aqueous solution was studied to evaluate potential applications of the MWCNT-Ag modified glassy carbon (GC) electrode in environmental science. The benzene removal efficiency in natural water containing 10 mg L{sup −1} benzene yielded 77.9% at an applied potential of +2.0 V for 2 h using the MWCNT-Ag-GC electrode. In comparison, the removal efficiency reached only 8.0% with the bare GC electrode, showing the suitability of the MWCNT-Ag nanocomposite modified GC electrode for electro-oxidation of benzene in natural water. - Graphical abstract: Display Omitted - Highlights: • A novel methodology for the electrochemical degradation of benzene was developed. • Sensor based on silver nanoparticle-decorated carbon nanotubes was used. • The proposed method is suitable and efficient for the removal of benzene.

  11. Effects of inorganic anions on carbon isotope fractionation during Fenton-like degradation of trichloroethene.

    Science.gov (United States)

    Liu, Yunde; Zhou, Aiguo; Gan, Yiqun; Li, Xiaoqian

    2016-05-01

    Understanding the magnitude and variability in isotope fractionation with respect to specific processes is crucial to the application of stable isotopic analysis as a tool to infer and quantify transformation processes. The variability of carbon isotope fractionation during Fenton-like degradation of trichloroethene (TCE) in the presence of different inorganic ions (nitrate, sulfate, and chloride), was investigated to evaluate the potential effects of inorganic anions on carbon isotope enrichment factor (ε value). A comparison of ε values obtained in deionized water, nitrate solution, and sulfate solution demonstrated that the ε values were identical and not affected by the presence of nitrate and sulfate. In the presence of chloride, however, the ε values (ranging from -6.3±0.8 to 10±1.3‰) were variable and depended on the chloride concentration, indicating that chloride could significantly affect carbon isotope fractionation during Fenton-like degradation of TCE. Thus, caution should be exercised in selecting appropriate ε values for the field application of stable isotope analysis, as various chloride concentrations may be present due to naturally present or introduced with pH adjustment and iron salts during Fenton-like remediation. Furthermore, the effects of chloride on carbon isotope fractionation may be able to provide new insights about reaction mechanisms of Fenton-like processes. PMID:26835895

  12. Alteration of Dynein Function Affects α-Synuclein Degradation via the Autophagosome-Lysosome Pathway

    OpenAIRE

    Da Li; Ji-Jun Shi; Cheng-Jie Mao; Sha Liu; Jian-Da Wang; Jing Chen; Fen Wang; Ya-Ping Yang; Wei-Dong Hu; Li-Fang Hu; Chun-Feng Liu

    2013-01-01

    Growing evidence suggests that dynein dysfunction may be implicated in the pathogenesis of neurodegeneration. It plays a central role in aggresome formation, the delivery of autophagosome to lysosome for fusion and degradation, which is a pro-survival mechanism essential for the bulk degradation of misfolded proteins and damaged organells. Previous studies reported that dynein dysfuntion was associated with aberrant aggregation of α-synuclein, which is a major component of inclusion bodies in...

  13. Novel Pathway of Salicylate Degradation by Streptomyces sp. Strain WA46

    OpenAIRE

    Ishiyama, Daisuke; Vujaklija, Dusica; Davies, Julian

    2004-01-01

    A novel salicylate-degrading Streptomyces sp., strain WA46, was identified by UV fluorescence on solid minimal medium containing salicylate; trace amounts of gentisate were detected by high-pressure liquid chromatography when strain WA46 was grown with salicylate. PCR amplification of WA46 DNA with degenerate primers for gentisate 1,2-dioxygenase (GDO) genes produced an amplicon of the expected size. Sequential PCR with nested GDO primers was then used to identify a salicylate degradation gen...

  14. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    OpenAIRE

    Suryawan, Agus; Davis, Teresa A.

    2014-01-01

    Background The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the current study, we identified mechanisms involved in protein degradation regulation. In experiment 1, 6- and 26-d-old pigs were studied during 1) euinsulinemic-euglycemic-euaminoacidemic, 2) e...

  15. Liver mitochondria contain an ATP-dependent, vanadate-sensitive pathway for the degradation of proteins.

    OpenAIRE

    Desautels, M; Goldberg, A L

    1982-01-01

    A large fraction (30-50%) of the various proteins synthesized within isolated rat liver mitochondria were degraded to amino acids within 60 min after synthesis. Incomplete mitochondrial polypeptides resulting from the incorporation of puromycin were degraded even more extensively (80% per hr). Protein breakdown was measured by the appearance of acid-soluble radioactivity and by the disappearance of labeled polypeptides detected on NaDodSO4/polyacrylamide gel electrophoresis. The amino acids g...

  16. Intracellular degradation of chemically functionalized carbon nanotubes using a long-term primary microglial culture model

    Science.gov (United States)

    Bussy, Cyrill; Hadad, Caroline; Prato, Maurizio; Bianco, Alberto; Kostarelos, Kostas

    2015-12-01

    Chemically functionalized carbon nanotubes (f-CNTs) have been used in proof-of-concept studies to alleviate debilitating neurological conditions. Previous in vivo observations in brain tissue have suggested that microglia - acting as resident macrophages of the brain - play a critical role in the internalization of f-CNTs and their partial in situ biodegradation following a stereotactic administration in the cortex. At the same time, several reports have indicated that immune cells such as neutrophils, eosinophils and even macrophages could participate in the processing of carbon nanomaterials via oxidation processes leading to degradation, with surface properties acting as modulators of CNT biodegradability. In this study we questioned whether degradability of f-CNTs within microglia could be modulated depending on the type of surface functionalization used. We investigated the kinetics of degradation of multi-walled carbon nanotubes (MWNTs) functionalized via different chemical strategies that were internalized within isolated primary microglia over three months. A cellular model of rat primary microglia that can be maintained in cell culture for a long period of time was first developed. The Raman structural signature of the internalized f-CNTs was then studied directly in cells over a period of up to three months, following a single exposure to a non-cytotoxic concentration of three different f-CNTs (carboxylated, aminated and both carboxylated and aminated). Structural modifications suggesting partial but continuous degradation were observed for all nanotubes irrespective of their surface functionalization. Carboxylation was shown to promote more pronounced structural changes inside microglia over the first two weeks of the study.Chemically functionalized carbon nanotubes (f-CNTs) have been used in proof-of-concept studies to alleviate debilitating neurological conditions. Previous in vivo observations in brain tissue have suggested that microglia - acting as

  17. Mechanisms of soil degradation and consequences for carbon stocks on Tibetan grasslands

    Science.gov (United States)

    Kuzyakov, Yakov; Schleuss, Per-Marten; Miehe, Georg; Heitkamp, Felix; Sebeer, Elke; Spielvogel, Sandra; Xu, Xingliang; Guggenberger, Georg

    2016-04-01

    Tibetan grasslands provide tremendous sinks for carbon (C) and represent important grazing ground. Strong degradation - the destroying the upper root-mat/soil horizon of Kobresia pastures, has dramatic consequences for soil organic carbon (SOC) and nutrient storage. To demonstrate specific degradation patterns and elucidate mechanisms, as well as to assess consequences for SOC storage, we investigated a sequence of six degradation stages common over the whole Kobresia ecosystem. The soil degradation sequence consists of following mechanisms: Overgrazing and trampling by livestock provide the prerequisite for grassland degradation as both (a) cause plant dying, (b) reduce grassland recovery and (c) destroy protective Kobresia root-mats. These anthropogenic induced processes are amplified by naturally occurring degradation in harsh climate. The frequently repeated soil moisture and temperature fluctuations induce volume changes and tensions leading to polygonal cracking of the root mats. Then the plants die and erosion gradually extend the surface cracks. Soil erosion cause a high SOC loss from the upper horizons (0-10 cm: ~5.1 kg C m-2), whereas SOC loss beneath the surface cracks is caused by both, decreasing root C-input and SOC mineralization (SOC losses by mineralization: ~2.5 kg C m-2). Root biomass decreases with degradation and indicated lower C input. The negative δ13C shift of SOC reflects intensive decomposition and corresponds to a relative enrichment of 13C depleted lignin components. We conclude that the combined effects of overgrazing and harsh climate reduce root C input, increase SOC decomposition and initiate erosion leading to SOC loss up to 70% of intact soil (0-30 cm: ~7.6 kg C m-2). Consequently, a high amount of C is released back to the atmosphere as CO2, or is deposited in depressions and river beds creating a potential source of N2O and CH4. Concluding, anthropogenically induced overgrazing makes the Kobresia root-mat sensitive to natural

  18. Carbon dioxide concentration dictates alternative methanogenic pathways in oil reservoirs

    OpenAIRE

    Mayumi, Daisuke; Dolfing, Jan; Sakata, Susumu; Maeda, Haruo; Miyagawa, Yoshihiro; Ikarashi, Masayuki; Tamaki, Hideyuki; Takeuchi, Mio; Nakatsu, Cindy H.; Kamagata, Yoichi

    2013-01-01

    Deep subsurface formations (for example, high-temperature oil reservoirs) are candidate sites for carbon capture and storage technology. However, very little is known about how the subsurface microbial community would respond to an increase in CO2 pressure resulting from carbon capture and storage. Here we construct microcosms mimicking reservoir conditions (55 °C, 5 MPa) using high-temperature oil reservoir samples. Methanogenesis occurs under both high and low CO2 conditions in the microcos...

  19. Mechanism and Reaction Pathways for Microcystin-LR Degradation through UV/H2O2 Treatment

    Science.gov (United States)

    Liu, Yafeng; Ren, Jing; Wang, Xiangrong; Fan, Zhengqiu

    2016-01-01

    Microcystin-LR (MCLR) is the most common cyanotoxin in contaminated aquatic systems. MCLR inhibits protein phosphatases 1 and 2A, leading to liver damage and tumor formation. MCLR is relatively stable owing to its cyclic structures. The combined UV/H2O2 technology can degrade MCLR efficiently. The second-order rate constant of the reaction between MCLR and hydroxyl radical (·OH) is 2.79(±0.23)×1010 M−1 s−1 based on the competition kinetics model using nitrobenzene as reference compound. The probable degradation pathway was analyzed through liquid chromatography mass spectrometry. Results suggested that the major destruction pathways of MCLR were initiated by ·OH attack on the benzene ring and diene of the Adda side chain. The corresponding aldehyde or ketone peptide residues were formed through further oxidation. Another minor destruction pathway involved ·OH attack on the methoxy group of the Adda side chain, followed by complete removal of the methoxy group. The combined UV/H2O2 system is a promising technology for MCLR removal in contaminated aquatic systems. PMID:27281173

  20. A novel role for ATM in regulating proteasome-mediated protein degradation through suppression of the ISG15 conjugation pathway.

    Directory of Open Access Journals (Sweden)

    Laurence M Wood

    Full Text Available Ataxia Telangiectasia (A-T is an inherited immunodeficiency disorder wherein mutation of the ATM kinase is responsible for the A-T pathogenesis. Although the precise role of ATM in A-T pathogenesis is still unclear, its function in responding to DNA damage has been well established. Here we demonstrate that in addition to its role in DNA repair, ATM also regulates proteasome-mediated protein turnover through suppression of the ISG15 pathway. This conclusion is based on three major pieces of evidence: First, we demonstrate that proteasome-mediated protein degradation is impaired in A-T cells. Second, we show that the reduced protein turnover is causally linked to the elevated expression of the ubiquitin-like protein ISG15 in A-T cells. Third, we show that expression of the ISG15 is elevated in A-T cells derived from various A-T patients, as well as in brain tissues derived from the ATM knockout mice and A-T patients, suggesting that ATM negatively regulates the ISG15 pathway. Our current findings suggest for the first time that proteasome-mediated protein degradation is impaired in A-T cells due to elevated expression of the ISG15 conjugation pathway, which could contribute to progressive neurodegeneration in A-T patients.

  1. Modeling Aerobic Carbon Source Degradation Processes using Titrimetric Data and Combined Respirometric-Titrimetric Data: Experimental Data and Model Structure

    DEFF Research Database (Denmark)

    Gernaey, Krist; Petersen, B.; Nopens, I.;

    2002-01-01

    Experimental data are presented that resulted from aerobic batch degradation experiments in activated sludge with simple carbon sources (acetate and dextrose) as substrates. Data collection was done using combined respirometric-titrimetric measurements. The respirometer consists of an open aerate...

  2. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    Directory of Open Access Journals (Sweden)

    G. Cailleau

    2011-07-01

    Full Text Available An African oxalogenic tree, the iroko tree (Milicia excelsa, has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi. Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate

  3. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    Directory of Open Access Journals (Sweden)

    G. Cailleau

    2011-02-01

    Full Text Available An African oxalogenic tree, the iroko tree (Milicia excelsa, has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the theoretical acidic conditions of these soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. Regarding the carbonate flux, another direct consequence of wood feeding is a concomitant flux of carbonate formed in wood tissues, which is not consumed by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter. Therefore, an oxalate pool is formed on the forest ground. Then, wood rotting gents (mainly termites, fungi, and bacteria release significant amounts of oxalate crystals from decaying plant tissues. In addition some of these gents are themselves producers of oxalate (fungi. Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is pumped

  4. Turning sunlight into stone: the oxalate-carbonate pathway in a tropical tree ecosystem

    Science.gov (United States)

    Cailleau, G.; Braissant, O.; Verrecchia, E. P.

    2011-07-01

    An African oxalogenic tree, the iroko tree (Milicia excelsa), has the property to enhance carbonate precipitation in tropical oxisols, where such accumulations are not expected due to the acidic conditions in these types of soils. This uncommon process is linked to the oxalate-carbonate pathway, which increases soil pH through oxalate oxidation. In order to investigate the oxalate-carbonate pathway in the iroko system, fluxes of matter have been identified, described, and evaluated from field to microscopic scales. In the first centimeters of the soil profile, decaying of the organic matter allows the release of whewellite crystals, mainly due to the action of termites and saprophytic fungi. In addition, a concomitant flux of carbonate formed in wood tissues contributes to the carbonate flux and is identified as a direct consequence of wood feeding by termites. Nevertheless, calcite biomineralization of the tree is not a consequence of in situ oxalate consumption, but rather related to the oxalate oxidation inside the upper part of the soil. The consequence of this oxidation is the presence of carbonate ions in the soil solution pumped through the roots, leading to preferential mineralization of the roots and the trunk base. An ideal scenario for the iroko biomineralization and soil carbonate accumulation starts with oxalatization: as the iroko tree grows, the organic matter flux to the soil constitutes the litter, and an oxalate pool is formed on the forest ground. Then, wood rotting agents (mainly termites, saprophytic fungi, and bacteria) release significant amounts of oxalate crystals from decaying plant tissues. In addition, some of these agents are themselves producers of oxalate (e.g. fungi). Both processes contribute to a soil pool of "available" oxalate crystals. Oxalate consumption by oxalotrophic bacteria can then start. Carbonate and calcium ions present in the soil solution represent the end products of the oxalate-carbonate pathway. The solution is

  5. Photocatalytic activity of porous multiwalled carbon nanotube-TiO2 composite layers for pollutant degradation.

    Science.gov (United States)

    Zouzelka, Radek; Kusumawati, Yuly; Remzova, Monika; Rathousky, Jiri; Pauporté, Thierry

    2016-11-01

    TiO2 nanoparticles are suitable building blocks nanostructures for the synthesis of porous functional thin films. Here we report the preparation of films using brookite, P25 titania and anatase pristine nanoparticles and of nanocomposite layers combining anatase nanoparticles and multi-walled carbon nanotube (MWCNT) at various concentrations. The structure and phase composition of the layers were characterized by X-ray diffraction and Raman spectroscopy. Their morphology and texture properties were determined by scanning electron microscopy and krypton adsorption experiments, respectively. Additionally to a strong absorption in the UV range, the composites exhibited light absorption in the visible range as well. The photocatalytic performance of the layers was tested in the degradation of aqueous solutions of 4-chlorophenol serving as a model of an eco-persistent pollutant. Besides the determination of the decrease in the concentration of 4-chlorophenol, also the formation of intermediate degradation products, namely hydroquinone and benzoquinone, was followed. The presence of MWCNTs had a beneficial effect on the photocatalytic performance, a marked increase in the photocatalytic degradation rate constant being observed even at very low concentrations of MWCNTs. Compared to a P25 reference layer, the first order rate reaction constant increased by about 100% for the composite films containing MWCNTs at concentrations above 0.6 wt%. The key parameters for the enhancement of the photocatalytic performance are discussed. The presence of carbon nanotubes influences beneficially the degradation of 4-chlorophenol by an attack of the primarily photoproduced hydroxyl radicals onto the 4-chlorophenol molecules. The degradation due to the direct charge transfer is practically not influenced at all. PMID:27262272

  6. Organic carbon degradation in arctic marine sediments, Svalbard: A comparison of initial and terminal steps

    DEFF Research Database (Denmark)

    Arnosti, C.; Jørgensen, BB

    2006-01-01

    carbohydrate concentrations were comparable to those measured in more temperate sediments, and likely comprise a considerable fraction of porewater dissolved organic carbon. A comparison of dissolved carbohydrate inventories with hydrolysis and sulfate reduction rates suggests that the turnover of carbon......Degradation of marine organic matter under anoxic conditions involves microbial communities working in concert to remineralize complex substrates to CO2. In order to investigate the coupling between the initial and terminal steps of this sequence in permanently cold sediments, rates of...... extracellular enzymatic hydrolysis and sulfate reduction were measured in parallel cores collected from 5 fjords on the west and northwest coast of Svalbard, in the high Arctic. Inventories of total dissolved carbohydrates were also measured in order to evaluate their potential role in carbon turnover...

  7. Estimating global "blue carbon" emissions from conversion and degradation of vegetated coastal ecosystems.

    Directory of Open Access Journals (Sweden)

    Linwood Pendleton

    Full Text Available Recent attention has focused on the high rates of annual carbon sequestration in vegetated coastal ecosystems--marshes, mangroves, and seagrasses--that may be lost with habitat destruction ('conversion'. Relatively unappreciated, however, is that conversion of these coastal ecosystems also impacts very large pools of previously-sequestered carbon. Residing mostly in sediments, this 'blue carbon' can be released to the atmosphere when these ecosystems are converted or degraded. Here we provide the first global estimates of this impact and evaluate its economic implications. Combining the best available data on global area, land-use conversion rates, and near-surface carbon stocks in each of the three ecosystems, using an uncertainty-propagation approach, we estimate that 0.15-1.02 Pg (billion tons of carbon dioxide are being released annually, several times higher than previous estimates that account only for lost sequestration. These emissions are equivalent to 3-19% of those from deforestation globally, and result in economic damages of $US 6-42 billion annually. The largest sources of uncertainty in these estimates stems from limited certitude in global area and rates of land-use conversion, but research is also needed on the fates of ecosystem carbon upon conversion. Currently, carbon emissions from the conversion of vegetated coastal ecosystems are not included in emissions accounting or carbon market protocols, but this analysis suggests they may be disproportionally important to both. Although the relevant science supporting these initial estimates will need to be refined in coming years, it is clear that policies encouraging the sustainable management of coastal ecosystems could significantly reduce carbon emissions from the land-use sector, in addition to sustaining the well-recognized ecosystem services of coastal habitats.

  8. Gamma radiolytic eradication of methoxychlor in aqueous media. The degradation pathways using HPLC and SPME-GC-MS

    Energy Technology Data Exchange (ETDEWEB)

    Butt, S.B.; Zafar, A. [PINSTECH, Nilore, Islamabad (Pakistan). Central Analytical Facility Div.; Riaz, M. [PINSTECH, Nilore, Islamabad (Pakistan). Chemistry Div.

    2013-08-01

    The gamma radiation-induced degradation of environmental pollutant methoxychlor in water was investigated. A {sup 60}Co gamma radiation source with a dose rate of 372 Gy h{sup -1} was used for gamma irradiation of 1 mg L{sup -1} and 10 mg L{sup -1} methoxychlor in water with a varied absorbed dose of 1-5 kGy. A single step clean up and pre-concentration procedure based on solid phase micro-extraction was optimized. The extent of radiolytic degradation was monitored by reversed phase HPLC-UV and GC-ECD. The trace and ultra trace level degradation products were identified using GC-MS-SPME by comparing their mass spectra with the NIST 98 m mass spectral library. Most of the generated products for 4 kGy dose are substituted chlorophenols. The reaction pathways of these substituted chlorophenols and benzophenone formation are also proposed. However, generated chlorophenols disappeared along with methoxychlor for an absorbed dose of 5 kGy. The attained degradation of methoxychlor is {proportional_to} 95% that reflects the potential use of ionization radiation for wastewater treatment. (orig.)

  9. Gamma radiolytic eradication of methoxychlor in aqueous media. The degradation pathways using HPLC and SPME-GC-MS

    International Nuclear Information System (INIS)

    The gamma radiation-induced degradation of environmental pollutant methoxychlor in water was investigated. A 60Co gamma radiation source with a dose rate of 372 Gy h-1 was used for gamma irradiation of 1 mg L-1 and 10 mg L-1 methoxychlor in water with a varied absorbed dose of 1-5 kGy. A single step clean up and pre-concentration procedure based on solid phase micro-extraction was optimized. The extent of radiolytic degradation was monitored by reversed phase HPLC-UV and GC-ECD. The trace and ultra trace level degradation products were identified using GC-MS-SPME by comparing their mass spectra with the NIST 98 m mass spectral library. Most of the generated products for 4 kGy dose are substituted chlorophenols. The reaction pathways of these substituted chlorophenols and benzophenone formation are also proposed. However, generated chlorophenols disappeared along with methoxychlor for an absorbed dose of 5 kGy. The attained degradation of methoxychlor is ∝ 95% that reflects the potential use of ionization radiation for wastewater treatment. (orig.)

  10. SIAH-1 interacts with alpha-tubulin and degrades the kinesin Kid by the proteasome pathway during mitosis.

    Science.gov (United States)

    Germani, A; Bruzzoni-Giovanelli, H; Fellous, A; Gisselbrecht, S; Varin-Blank, N; Calvo, F

    2000-12-01

    SIAH-1, a human homologue of the Drosophila seven in absentia (Sina), has been implicated in ubiquitin-mediated proteolysis of different target proteins through its N-terminal RING finger domain. SIAH-1 is also induced during p53-mediated apoptosis. Furthermore, SIAH-1-transfected breast cancer cell line MCF-7 exhibits an altered mitotic process resulting in multinucleated giant cells. Now, using the two-hybrid system, we identified two new SIAH interacting proteins: Kid (kinesin like DNA binding protein) and alpha-tubulin. We demonstrate that SIAH is involved in the degradation of Kid via the ubiquitin-proteasome pathway. Our results suggest that SIAH-1 but not its N-terminal deletion mutant, affects the mitosis by an enhanced reduction of kinesin levels. Our results imply, for the first time, SIAH-1 in regulating the degradation of proteins directly implicated in the mitotic process. PMID:11146551

  11. Abiotic degradation of methyl parathion by manganese dioxide: Kinetics and transformation pathway.

    Science.gov (United States)

    Liao, Xiaoping; Zhang, Caixiang; Liu, Yuan; Luo, Yinwen; Wu, Sisi; Yuan, Songhu; Zhu, Zhenli

    2016-05-01

    Methyl parathion, a widely used insecticide around the world, has aroused gradually extensive concern of researchers due to its degradation product such as methyl paraoxon, with higher toxicity for mammals and more recalcitrant. Given the ubiquity of manganese dioxide (MnO2) in soils and aquatic sediments, the abiotic degradation of methyl parathion by α-MnO2 was investigated in batch experiments. It was found that methyl parathion was decomposed up to 90% by α-MnO2 in 30 h and the removal efficiency of methyl parathion depended strongly on the loading of α-MnO2 and pH value in the solution where the reactions followed pseudo-first-order model well. The coexisting metal ions (such as Ca(2+), Mg(2+) and Mn(2+)) weakened markedly the degradation of methyl parathion by α-MnO2. However, the effect of dissolved organic matter (HA-Na) on reaction rates presented two sides: to improve hydrolysis rate but deteriorate oxidation rate of methyl parathion. Based on the degradation products identified by gas chromatography-mass spectrometer (GC/MS) and liquid chromatography high-resolution mass spectrometer (LC/HRMS), both hydrolysis and oxidation processes were proposed to be two predominant reaction mechanisms contributing to methyl parathion degradation by α-MnO2. This study provided meaningful information to elucidate the abiotic dissipation of methyl parathion by manganese oxide minerals in the environment. PMID:26891361

  12. Elucidating the Pseudomonas aeruginosa Fatty Acid Degradation Pathway: Identification of Additional Fatty Acyl-CoA Synthetase Homologues

    OpenAIRE

    Zarzycki-Siek, Jan; Norris, Michael H.; Kang, Yun (Kenneth); Sun, Zhenxin; Bluhm, Andrew P.; McMillan, Ian A.; Hoang, Tung T.

    2013-01-01

    The fatty acid (FA) degradation pathway of Pseudomonas aeruginosa, an opportunistic pathogen, was recently shown to be involved in nutrient acquisition during BALB/c mouse lung infection model. The source of FA in the lung is believed to be phosphatidylcholine, the major component of lung surfactant. Previous research indicated that P. aeruginosa has more than two fatty acyl-CoA synthetase genes (fadD; PA3299 and PA3300), which are responsible for activation of FAs using ATP and coenzyme A. T...

  13. Self-floating graphitic carbon nitride/zinc phthalocyanine nanofibers for photocatalytic degradation of contaminants.

    Science.gov (United States)

    Xu, Tiefeng; Ni, Dongjing; Chen, Xia; Wu, Fei; Ge, Pengfei; Lu, Wangyang; Hu, Hongguang; Zhu, ZheXin; Chen, Wenxing

    2016-11-01

    The effective elimination of micropollutants by an environmentally friendly method has received extensive attention recently. In this study, a photocatalyst based on polyacrylonitrile (PAN)-supported graphitic carbon nitride coupled with zinc phthalocyanine nanofibers (g-C3N4/ZnTcPc/PAN nanofibers) was successfully prepared, where g-C3N4/ZnTcPc was introduced as the catalytic entity and the PAN nanofibers were employed as support to overcome the defects of easy aggregation and difficult recycling. Herein, rhodamine B (RhB), 4-chlorophenol and carbamazepine (CBZ) were selected as the model pollutants. Compared with the typical hydroxyl radical-dominated catalytic system, g-C3N4/ZnTcPc/PAN nanofibers displayed the targeted adsorption and degradation of contaminants under visible light or solar irradiation in the presence of high additive concentrations. According to the results of the radical scavenging techniques and the electron paramagnetic resonance technology, the degradation of target substrates was achieved by the attack of active species, including photogenerated hole, singlet oxygen, superoxide radicals and hydroxyl radicals. Based on the results of ultra-performance liquid chromatography and mass spectrometry, the role of free radicals on the photocatalytic degradation intermediates was identified and the final photocatalytic degradation products of both RhB and CBZ were some biodegradable small molecules. PMID:27239724

  14. Intensive soil organic carbon losses by degradation of alpine Kobresia pasture on the Tibetan Plateau

    Science.gov (United States)

    Schleuss, Per-Marten; Heitkamp, Felix; Seeber, Elke; Spielvogel, Sandra; Miehe, Georg; Guggenberger, Georg; Kuzyakov, Yakov

    2015-04-01

    Kobresia grasslands of the Tibetan Plateau cover an area of ca. 450,000 km2. They are of high global and regional importance as they store large amounts of carbon (C) and nitrogen (N) and provide food for grazing animals. However, intensive grassland degradation in recent decades destroyed mainly the upper root-mat/soil horizon. This has dramatic consequences for SOC storage against the background of climate change and further grazing pressure. We investigated the impact of pasture degradation on SOC storage and hypothesized that SOC stocks strongly decreased due to a reduction of C-input by roots as consequence of vegetation cover loss by overgrazing, SOM decomposition and soil erosion. We selected a sequence of six degradation stages (DS1-6). As initial trigger of grassland degradation, the high grazing pressure reduces the ability of Kobresia pastures to recover from disturbances (e.g. by freezing and drying events, herbivory, trampling). Once the root mats are destroyed, the occurring root-mat cracks increase due to soil erosion, SOC decomposition and trampling activities of livestock. The SOC stocks and contents decreased along the degradation sequence from intact to highly disturbed stages. Carbon stocks declined from intact Kobresia root mats (DS1) to bare soil patches (DS6) by about 70%. The thickness of the upper soil horizons strongly declined from DS1 to DS6. Considering the bare soil patches (DS6) on average 10 cm of the most fertile topsoil were removed. This clearly suggests that soil erosion strongly contributed to SOC losses, especially from topsoil with highest SOC contents. A strong decrease of the vegetation cover (mainly K. pygmaea) demonstrated that soil degradation also resulted in die-back of K. pygmaea. Consequently, root biomass decreased along the degradation sequence (DS1-2 > DS3-4 > DS5-6), indicating lower belowground C input from roots. We found decreasing δ13C values with increasing degradation stages within the upper 20 cm of soil

  15. Pioneering in Marginal Fields: Jatropha for Carbon Credits and Restoring Degraded Land in Eastern Indonesia

    Directory of Open Access Journals (Sweden)

    Loes Willemijn van Rooijen

    2014-04-01

    Full Text Available This paper highlights the role of a national Non-Governmental Organization (NGO in Indonesia as “pioneer” actor in the jatropha global production network, linking solutions for local problems with narratives concerning global concerns. Analysis of previous activities of the NGO positions their jatropha project as one period in a sequence of donor-funded appropriate technology programs. On the island of Flores in Eastern Indonesia the NGO aimed to establish community based jatropha cultivation exclusively on “degraded land”, avoiding threats to food cultivation, and responding to local problems of land degradation and water resources depletion. In contrast with investors interested in jatropha based biofuel production for export, the NGO aimed at developing biofuel for local needs, including jatropha based electricity generation in the regional state-owned power plant. Anticipating progress in international and national regulations concerning the Clean Development Mechanism (CDM the 2008 project’s design included carbon credit income as a main source of future project financing. Using methods of socio-legal studies and political ecology, this study indicates that when the economic feasibility of a project is based on the future financial value of a legally constructed commodity like carbon credits, the sustainability of the project outcome can be questionable. The author recommends precaution when it comes to including anticipated income from carbon credits in calculating the economic viability of a project, as price developments can fluctuate when political support and regulations change.

  16. Funding pathways to a low-carbon transition

    Science.gov (United States)

    Foulds, Chris; Christensen, Toke Haunstrup

    2016-07-01

    The framing of funding programmes can sustain existing ways of conceptualizing particular problems, as well as create new ones. Yet, without more prominent roles for social sciences and humanities, the techno-economic conceptualization of energy consumers could hinder long-term low-carbon aspirations.

  17. Removal of TBP degradation products from carbonate scrub solution using 2-ethyl-1-hexanol

    International Nuclear Information System (INIS)

    The reprocessing of spent nuclear fuel of FBTR having burn up (up to 155 GWd/t) was carried out in CORAL (Compact Reprocessing of Advanced fuel in Lead shielded cells) by following modified PUREX process. In this process, TBP diluted with n-dodecane is used as an extractant. TBP degrades significantly due to radiolysis and extracted metal ion as well as HNO3 hydrolysis leading to the formation of HDBP, H2MBP, H3PO4 etc which interfere with the liquid-liquid extraction process. Hence the spent solvent is periodically cleaned up with an alkaline solution of Na2CO3, (NH4)2CO3 or N2H4.H2CO3 . These carbonate solutions form water soluble salts with the acidic degradation products of TBP and complexes of the actinides like Pu, U and fission products like Zr and Ru

  18. An ancient pathway combining carbon dioxide fixation with the generation and utilization of a sodium ion gradient for ATP synthesis

    OpenAIRE

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potenti...

  19. A review of degradation modes of low carbon steel in brine environments

    International Nuclear Information System (INIS)

    A literature search was conducted to review information on degradation modes of low carbon steel in brine solutions. A computer search was used to obtain articles from 1970 to present while a manual search was conducted for articles published prior to 1970. The published articles and reports indicated that uniform corrosion occurred in sea water, geothermal brines and simulated repository brines. The uniform corrosion rate increased with decreasing pH, increasing oxygen contest of brine and increasing temperature. Pitting of low carbon steel in brine solutions was related to scale formation due to presences of sulfur and heavy metal ions or mill scale present prior to exposure. Low carbon steel did not appear to be susceptible to stress corrosion cracking, but data was limited. The presence of anaerobic bacteria greatly increased the rate of corrosion of low carbon steel as compared to sterile conditions. If sufficient hydrogen is present, low carbon steel could fail due to hydrogen embrittlement in brine solutions. However, this is an area where experimental work needs to be done under more specific conditions related to salt repositories. Corrosion fatigue and stray current corrosion require specific conditions to occur which can be avoided during waste storage and were there fore not addressed. Also, galvanic effects were not addressed as it will be possible to minimize galvanic effects by design. 226 refs., 4 tabs

  20. Microbial degradation pathways of the herbicide dichlobenil in soils with different history of dichlobenil-exposure

    International Nuclear Information System (INIS)

    This is the first detailed study of metabolite production during degradation of the herbicide 2,6-dichlorobenzonitrile (dichlobenil). Degradation of dichlobenil and three potential metabolites: 2,6-dichlorobenzamide (BAM), 2,6-dichlorobenzoic acid (2,6-DCBA) and ortho-chlorobenzamide (OBAM) was studied in soils either previously exposed or not exposed to dichlobenil using a newly developed HPLC method. Dichlobenil was degraded in all four soils; BAM and 2,6-DCBA were only degraded in soils previously exposed to dichlobenil (100% within 35-56 days and 85-100% in 56 days, respectively), and OBAM in all four soils (25-33% removal in 48 days). BAM produced from dichlobenil was either hydrolyzed to 2,6-DCBA or dechlorinated to OBAM, which was further hydrolyzed to ortho-chlorobenzoic acid. BAM was rapidly mineralized in previously exposed soils only. All potential metabolites and the finding that BAM was a dead-end metabolite of dichlobenil in soils not previously exposed to dichlobenil needs to be included in risk assessments of the use of dichlobenil. - BAM produced from dichlobenil was either hydrolyzed to 2,6-DCBA or dechlorinated to OBAM, which was further hydrolyzed to ortho-chlorobenzoic acid

  1. Immobilization of Bacillus sp. in mesoporous activated carbon for degradation of sulphonated phenolic compound in wastewater

    International Nuclear Information System (INIS)

    Xenobiotic compounds are used in considerable quantities in leather industries besides natural organic and inorganic compounds. These compounds resist biological degradation and thus they remain in the treated wastewater in the unaltered molecular configurations. Immobilization of organisms in carrier matrices protects them from shock load application and from the toxicity of chemicals in bulk liquid phase. Mesoporous activated carbon (MAC) has been considered in the present study as the carrier matrix for the immobilization of Bacillus sp. isolated from Effluent Treatment Plant (ETP) employed for the treatment of wastewater containing sulphonated phenolic (SP) compounds. Temperature, pH, concentration, particle size and mass of MAC were observed to influence the immobilization behavior of Bacillus sp. The percentage immobilization of Bacillus sp. was the maximum at pH 7.0, temperature 20 °C and at particle size 300 μm. Enthalpy, free energy and entropy of immobilization were − 46.9 kJ mol−1, − 1.19 kJ mol−1 and − 161.36 J K−1 mol−1 respectively at pH 7.0, temperature 20 °C and particle size 300 μm. Higher values of ΔH0 indicate the firm bonding of the Bacillus sp. in MAC. Degradation of aqueous sulphonated phenolic compound by Bacillus sp. immobilized in MAC followed pseudo first order rate kinetics with rate constant 1.12 × 10−2 min−1. Highlights: ► Degradation on phenolic syntan using immobilized activated carbon as catalyst. ► Bacillus sp. immobilized cell reactor removed all refractory organic loads. ► The removal mechanism is due to co-metabolism between carbon and organisms. ► The organics are completely metabolized rather than adsorption.

  2. Immobilization of Bacillus sp. in mesoporous activated carbon for degradation of sulphonated phenolic compound in wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Sekaran, G., E-mail: ganesansekaran@gmail.com [Environmental Technology Division, Council of Scientific and Industrial Research (CSIR), Central Leather Research Institute (CLRI), Adyar, Chennai-600 020 (India); Karthikeyan, S. [Environmental Technology Division, Council of Scientific and Industrial Research (CSIR), Central Leather Research Institute (CLRI), Adyar, Chennai-600 020 (India); Gupta, V.K. [Department of Chemistry, Indian Institute of Technology Roorkee, Roorkee-247 667 (India); Department of Chemistry, King Fahd University of Petroleum and Minerals, Dhahran 31261 (Saudi Arabia); Boopathy, R.; Maharaja, P. [Environmental Technology Division, Council of Scientific and Industrial Research (CSIR), Central Leather Research Institute (CLRI), Adyar, Chennai-600 020 (India)

    2013-03-01

    Xenobiotic compounds are used in considerable quantities in leather industries besides natural organic and inorganic compounds. These compounds resist biological degradation and thus they remain in the treated wastewater in the unaltered molecular configurations. Immobilization of organisms in carrier matrices protects them from shock load application and from the toxicity of chemicals in bulk liquid phase. Mesoporous activated carbon (MAC) has been considered in the present study as the carrier matrix for the immobilization of Bacillus sp. isolated from Effluent Treatment Plant (ETP) employed for the treatment of wastewater containing sulphonated phenolic (SP) compounds. Temperature, pH, concentration, particle size and mass of MAC were observed to influence the immobilization behavior of Bacillus sp. The percentage immobilization of Bacillus sp. was the maximum at pH 7.0, temperature 20 Degree-Sign C and at particle size 300 {mu}m. Enthalpy, free energy and entropy of immobilization were - 46.9 kJ mol{sup -1}, - 1.19 kJ mol{sup -1} and - 161.36 J K{sup -1} mol{sup -1} respectively at pH 7.0, temperature 20 Degree-Sign C and particle size 300 {mu}m. Higher values of {Delta}H{sup 0} indicate the firm bonding of the Bacillus sp. in MAC. Degradation of aqueous sulphonated phenolic compound by Bacillus sp. immobilized in MAC followed pseudo first order rate kinetics with rate constant 1.12 Multiplication-Sign 10{sup -2} min{sup -1}. Highlights: Black-Right-Pointing-Pointer Degradation on phenolic syntan using immobilized activated carbon as catalyst. Black-Right-Pointing-Pointer Bacillus sp. immobilized cell reactor removed all refractory organic loads. Black-Right-Pointing-Pointer The removal mechanism is due to co-metabolism between carbon and organisms. Black-Right-Pointing-Pointer The organics are completely metabolized rather than adsorption.

  3. Advances in mechanisms and signaling pathways of carbon nanotube toxicity

    OpenAIRE

    Dong, Jie; Ma, Qiang

    2015-01-01

    Carbon nanotubes (CNT) have been developed into new materials with a variety of industrial and commercial applications. In contrast, the physicochemical properties of CNT at the nanoscale render them the potency to generate toxic effects. Indeed, the potential health impacts of CNT have drawn a great deal of attention in recent years, owing to their identified toxicological and pathological consequences including cytotoxicity, inflammation, fibrosis, genotoxicity, tumorigenesis, and immunotox...

  4. Pathways of nitrobenzene degradation in horizontal subsurface flow constructed wetlands: Effect of intermittent aeration and glucose addition.

    Science.gov (United States)

    Kirui, Wesley K; Wu, Shubiao; Kizito, Simon; Carvalho, Pedro N; Dong, Renjie

    2016-01-15

    Intermittent aeration and addition of glucose were applied to horizontal subsurface flow constructed wetlands in order to investigate the effect on pathways of nitrobenzene (NB) degradation and interactions with microbial nitrogen and sulphur transformations. The experiment was carried out in three phases A, B and C consisting of different NB loading and glucose dosing. For each phase, the effect of aeration was assessed by intermittently aerating one wetland and leaving one unaerated. Regardless of whether or not the wetland was aerated, at an influent NB concentration of 140 mg/L, both wetlands significantly reduced NB to less than 2 mg/L, a reduction efficiency of 98%. However, once the influent NB concentration was increased to 280 mg/L, the aerated wetland had a higher removal performance 82% compared to that of the unaerated wetland 71%. Addition of glucose further intensified the NB removal to 95% in the aerated wetlands and 92% in the unaerated. Aeration of wetlands enhanced NB degradation, but also resulted in higher NB volatilization of 6 mg m(-2) d(-1). The detected high concentration of sulphide 20-60 mg/L in the unaerated wetland gave a strong indication that NB may act as an electron donor to sulphate-reducing bacteria, but this should be further investigated. Aeration positively improved NB removal in constructed wetlands, but resulted in higher NB volatilization. Glucose addition induced co-metabolism to enhance NB degradation. PMID:26468606

  5. Microbial Degradation and Carbon Biosequestration Potential of Biochar in Contrasting Soils

    Science.gov (United States)

    Tas, N.; Castanha, C.; Reichl, K.; Fischer, M. L.; Brodie, E. L.; Torn, M. S.; Jansson, J. K.

    2012-12-01

    Biochar is a carbon-rich product that is produced by high-temperature and low-oxygen pyrolysis of biomass, whose addition to soil has been proposed as a promising method for carbon sequestration. Biochar carbon has been assumed to be stable in soil, but recent research shows that it is at least partly degradable by soil microbes. However, the influence of environmental conditions on microbial transformation of biochar is poorly understood. Our overall goal is to determine the factors that regulate microbial decomposition of biochar in soils. We performed laboratory incubation experiments to compare the potential for biochar decomposition in soils from contrasting ecosystems (tropical forest from Puerto Rico and Mediterranean grassland from California), varied temperatures (ambient and +6°C) and depths (A and B horizons). Soil incubations with pyrolyzed 13C-enriched wood were continuously monitored for heterotrophic respiration using an online Cavity Ringdown Spectrometer. Samples collected after 10 and 150 days of incubation were analyzed for the activity of extracellular enzymes while changes in microbial community composition were assessed via pyrotag sequencing of both 16S rRNA and 16S rRNA genes. 13C-CO2 measurements confirmed that a fraction of added biochar was degraded in both soils during the one-year incubation period. Biochar addition was associated with a decline in cellulose and hemicellulose degrading enzyme activity in grassland soils, although not in tropical soils. In both soils, native soil organic carbon decomposition was not significantly impacted by biochar addition. Principle coordinates analysis of microbial composition showed that both soils harbored different microbial communities and those communities at different depths were distinct. The main bacterial groups enriched by biochar addition were Actinobacteria in the grassland soil, and α-Proteobacteria, Actinobacteria and Acidobacteria in the tropical soil. Analysis of 16S r

  6. Electrochemical degradation of sulfonamides at BDD electrode: Kinetics, reaction pathway and eco-toxicity evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Fabiańska, Aleksandra; Białk-Bielińska, Anna; Stepnowski, Piotr [Faculty of Chemistry, University of Gdansk, ul. Wita Stwosza 63, 80-952 Gdansk (Poland); Stolte, Stefan [Faculty of Chemistry, University of Gdansk, ul. Wita Stwosza 63, 80-952 Gdansk (Poland); UFT-Centre of Environmental Research and Sustainable Technology, University of Bremen, Leobener Straße UFT, D-28359 Bremen (Germany); Siedlecka, Ewa Maria, E-mail: ewa.siedlecka@ug.edu.pl [Faculty of Chemistry, University of Gdansk, ul. Wita Stwosza 63, 80-952 Gdansk (Poland)

    2014-09-15

    Highlights: • SNs were electrochemically oxidized at BDD in one compartment reactor. • The efficiency of SN degradation was the highest in effluents from municipal WWTP. • The electro-degradation SNs based on oxidation but reduction was also possible. • Electrochemical oxidation of SNs led in some cases to mixtures toxic to L. minor. - Abstract: The investigation dealt with electrochemical oxidation of five sulfonamides (SNs): sulfadiazine (SDZ), sulfathiazole (STZ), sulfamerazine (SMR), sulfamethazine (SMN) and sulfadimethoxine (SDM) in aqueous solution at boron-doped diamond (BDD) electrode. All studied sulfonamides were degraded according to a pseudo first order kinetics. The structure of SNs had no significant effect on the values of pseudo first order rate constants. Increased degradation efficiency was observed in higher temperature and in acidic pH. Due to the presence of chlorine and nitrate SNs were more effectively oxidized from municipal wastewater treatment plant (WWTP) effluents than from pure supporting electrolyte Na{sub 2}SO{sub 4}. The intermediates identified by LC–MS and GC–MS analysis suggested that the hydroxyl radicals attack mainly the S-N bond, but also the aromatic ring systems (aniline, pyrimidine or triazole) of SNs. Finally, the toxicity of the SNs solutions and effluents after electrochemical treatment was assessed through the measurement of growth inhibition of green algae (Scenedesmus vacualatus) and duckweed (Lemna minor). Toxicity of SMR, STZ, SMN solutions before and after electrochemical oxidation and SDM solution after the process in L. minor test was observed. No significant toxicity of studied SNs was observed in algae test.

  7. Electrochemical treatment of trypan blue synthetic wastewater and its degradation pathway

    OpenAIRE

    ANANTHA N. SUBBA RAO; ENKATESHA T. VENKATARANGAIAH

    2013-01-01

    The trypan blue (TB) dye synthetic wastewater was treated in presence of chloride ions by electrochemical method. The effect of current density, pH, initial concentration of dye and supporting electrolyte on color and COD removal were investigated. The UV-Vis ab­sorption intensity, chemical oxygen demand (COD), cyclic voltammetry (CV), Fourier transform- infrared spectroscopy (FT-IR), gas chromatography – mass spectrometry (GC-MS) analysis were conducted to investigate the kinetics and degrad...

  8. Electrochemical degradation of sulfonamides at BDD electrode: Kinetics, reaction pathway and eco-toxicity evaluation

    International Nuclear Information System (INIS)

    Highlights: • SNs were electrochemically oxidized at BDD in one compartment reactor. • The efficiency of SN degradation was the highest in effluents from municipal WWTP. • The electro-degradation SNs based on oxidation but reduction was also possible. • Electrochemical oxidation of SNs led in some cases to mixtures toxic to L. minor. - Abstract: The investigation dealt with electrochemical oxidation of five sulfonamides (SNs): sulfadiazine (SDZ), sulfathiazole (STZ), sulfamerazine (SMR), sulfamethazine (SMN) and sulfadimethoxine (SDM) in aqueous solution at boron-doped diamond (BDD) electrode. All studied sulfonamides were degraded according to a pseudo first order kinetics. The structure of SNs had no significant effect on the values of pseudo first order rate constants. Increased degradation efficiency was observed in higher temperature and in acidic pH. Due to the presence of chlorine and nitrate SNs were more effectively oxidized from municipal wastewater treatment plant (WWTP) effluents than from pure supporting electrolyte Na2SO4. The intermediates identified by LC–MS and GC–MS analysis suggested that the hydroxyl radicals attack mainly the S-N bond, but also the aromatic ring systems (aniline, pyrimidine or triazole) of SNs. Finally, the toxicity of the SNs solutions and effluents after electrochemical treatment was assessed through the measurement of growth inhibition of green algae (Scenedesmus vacualatus) and duckweed (Lemna minor). Toxicity of SMR, STZ, SMN solutions before and after electrochemical oxidation and SDM solution after the process in L. minor test was observed. No significant toxicity of studied SNs was observed in algae test

  9. Uracil and beta-alanine degradation in Saccharomyces Kluyveri - discovery of a novel catabolic pathway

    DEFF Research Database (Denmark)

    Andersen, Gorm

    2006-01-01

    Det første skridt i nedbrydningen af pyrimidiner er enten en reduktiv eller en oxidativ reaktion! Er der virkelig ingen alternativer? Nedbrydningen af pyrimidiner har stor betydning i mennesket. Genetiske defekter i den tilhørende pathway medfører alvorlige symptomer og specielt i for kræftpatien...

  10. Degradation of modified carbon black/epoxy nanocomposite coatings under ultraviolet exposure

    Science.gov (United States)

    Ghasemi-Kahrizsangi, Ahmad; Shariatpanahi, Homeira; Neshati, Jaber; Akbarinezhad, Esmaeil

    2015-10-01

    Degradation of epoxy coatings with and without Carbon Black (CB) nanoparticles under ultraviolet (UV) radiation were investigated using electrochemical impedance spectroscopy (EIS). Sodium dodecyl sulfate (SDS) was used to obtain a good dispersion of CB nanoparticles in a polymer matrix. TEM analysis proved a uniform dispersion of modified CB nanoparticles in epoxy coating. The coatings were subjected to UV radiation to study the degradation behavior and then immersed in 3.5 wt% NaCl. The results showed that the electrochemical behavior of neat epoxy coating was related to the formation and development of microcracks on the surface. The occurrence of microcracks on the surface of the coatings and consequently the penetration of ionic species reduced by adding CB nanoparticles into the formulation of the coatings. CB nanoparticles decreased degradation of CB coatings by absorbing UV irradiation. The ATR-FTIR results showed that decrease in the intensity of methyl group as main peak in presence of 2.5 wt% CB was lower than neat epoxy. In addition, the reduction in impedance of neat epoxy coating under corrosive environment was larger than CB coatings. The CB coating with 2.5 wt% nanoparticles had the highest impedance to corrosive media after 2000 h UV irradiation and 24 h immersion in 3.5 wt% NaCl.

  11. Insulin-degrading enzyme secretion from astrocytes is mediated by an autophagy-based unconventional secretory pathway in Alzheimer disease.

    Science.gov (United States)

    Son, Sung Min; Cha, Moon-Yong; Choi, Heesun; Kang, Seokjo; Choi, Hyunjung; Lee, Myung-Shik; Park, Sun Ah; Mook-Jung, Inhee

    2016-05-01

    The secretion of proteins that lack a signal sequence to the extracellular milieu is regulated by their transition through the unconventional secretory pathway. IDE (insulin-degrading enzyme) is one of the major proteases of amyloid beta peptide (Aβ), a presumed causative molecule in Alzheimer disease (AD) pathogenesis. IDE acts in the extracellular space despite having no signal sequence, but the underlying mechanism of IDE secretion extracellularly is still unknown. In this study, we found that IDE levels were reduced in the cerebrospinal fluid (CSF) of patients with AD and in pathology-bearing AD-model mice. Since astrocytes are the main cell types for IDE secretion, astrocytes were treated with Aβ. Aβ increased the IDE levels in a time- and concentration-dependent manner. Moreover, IDE secretion was associated with an autophagy-based unconventional secretory pathway, and depended on the activity of RAB8A and GORASP (Golgi reassembly stacking protein). Finally, mice with global haploinsufficiency of an essential autophagy gene, showed decreased IDE levels in the CSF in response to an intracerebroventricular (i.c.v.) injection of Aβ. These results indicate that IDE is secreted from astrocytes through an autophagy-based unconventional secretory pathway in AD conditions, and that the regulation of autophagy is a potential therapeutic target in addressing Aβ pathology. PMID:26963025

  12. Degradation of carbon-based materials under ablative conditions produced by a high enthalpy plasma jet

    Directory of Open Access Journals (Sweden)

    Gilberto Petraconi

    2010-04-01

    Full Text Available A stationary experiment was performed to study the degradation of carbon-based materials by immersion in a plasma jet. In the experiment, graphite and C/C composite were chosen as the target materials, and the reactive plasma jet was generated by an air plasma torch. For macroscopic study of the material degradation, the sample’s mass losses were measured as function of the exposure time under various temperatures on the sample surface. A microscopic analysis was then carried out for the study of microscopic aspects of the erosion of material surface. These experiments showed that the mass loss per unit area is approximately proportional to the exposure time and strongly depends on the temperature of the material surface. The mass erosion rate of graphite was appreciably higher than the C/C composite. The ablation rate in the carbon matrix region in C/C composite was also noticeably higher than that in the fiber region. In addition, the latter varied according to the orientation of fibers relatively to the flow direction. These tests indicated an excellent ablation resistance of the C/C composite, thus being a reliable material for rocket nozzles and heat shielding elements of the protection systems of hypersonic apparatuses from aerodynamic heating.

  13. Transcriptional profiling of biomass degradation-related genes during Trichoderma reesei growth on different carbon sources.

    Science.gov (United States)

    Chen, Xiuzhen; Luo, Yingfeng; Yu, Hongtao; Sun, Yuhui; Wu, Hong; Song, Shuhui; Hu, Songnian; Dong, Zhiyang

    2014-03-10

    To identify all the gene products involved in cellulosic biomass degradation, we employed RNA sequencing technology to perform a genome-wide comparison of gene expression during growth of Trichoderma reesei QM9414 on cellulose or glucose. Due to their important role in lignocellulose decomposition, we focused on CAZymes and other secreted proteins. In total, 122 CAZymes showed at least a two-fold change in mRNA abundance, and 97 of those were highly induced by cellulose. Compared to the well-characterized cellulases and hemicellulases, a majority of the other upregulated CAZymes showed lower transcriptional levels. In addition, 64 secreted proteins, including oxidoreductases, exhibited at least two-fold upregulation on cellulose medium. To better understand the potential roles of low-abundance CAZymes in cellulose breakdown, we compared the expression patterns of 25 glycoside hydrolase genes under different conditions via real-time PCR. Substantial differences for the 25 genes were observed for individual strains grown on different carbon sources, and between QM9414 and RUTC30 when grown on the same carbon source. Moreover, we identified 3 genes that are coregulated with known cellulases. Collectively, this study highlights a comprehensive transcriptional profile for biomass degradation-related proteins and provides a first step toward the identification of candidates to construct optimized enzyme cocktails. PMID:24445169

  14. The thermal properties of a carbon nanotube-enriched epoxy: Thermal conductivity, curing, and degradation kinetics

    KAUST Repository

    Ventura, Isaac Aguilar

    2013-05-31

    Multiwalled carbon nanotube-enriched epoxy polymers were prepared by solvent evaporation based on a commercially available epoxy system and functionalized multiwalled carbon nanotubes (COOH-MWCNTs). Three weight ratio configurations (0.05, 0.5, and 1.0 wt %) of COOH-MWCNTs were considered and compared with neat epoxy and ethanol-treated epoxy to investigate the effects of nano enrichment and processing. Here, the thermal properties of the epoxy polymers, including curing kinetics, thermal conductivity, and degradation kinetics were studied. Introducing the MWCNTs increased the curing activation energy as revealed by differential scanning calorimetry. The final thermal conductivity of the 0.5 and 1.0 wt % MWCNT-enriched epoxy samples measured by laser flash technique increased by up to 15% compared with the neat material. The activation energy of the degradation process, investigated by thermogravimetric analysis, was found to increase with increasing CNT content, suggesting that the addition of MWCNTs improved the thermal stability of the epoxy polymers. © 2013 Wiley Periodicals, Inc.

  15. Longevity of terrestrial Carbon sinks: effects of soil degradation on greenhouse gas emissions

    Science.gov (United States)

    Kuhn, Nikolaus J.; Berger, Samuel; Kuonen, Samuel

    2013-04-01

    Soil erosion by water is a key process of soil and land degradation. In addition, significant amounts of nutrients and organic Carbon are moved from eroding source areas to landscape sinks. As a consequence, areas affected by erosion suffer a loss of fertility, while sinks experience the development of a stockpile of the deposited sediment, including soil organic matter and nutrients. The deposited nutrients are largely unavailable for the plants growing in these landscape sediment sinks once the thickness of the deposited layer is greater than the rooting depth of the plants. In addition, the deposited organic matter is decomposed slowly through the pack of sediment. At sites of erosion, nutrients have to be replaced and organic matter content of the soil declines due to a destruction of the A horizon. Over time, the risk of a significant reduction in productivity, for example caused by a loss of top soil with a sufficient water storage capacity for maximum plant growth, leads to a decline in CO2 uptake by photosynthesis. Soil organic matter at eroding sites therefore declines and consequently the sediment that is moved to landscape sinks also has a smaller organic matter content than sediment generated from the non-degraded soil. The sediment sinks, on the other hand, emit an increasing amount of greenhouse gases as a consequence of the increasing amount of organic matter deposited while the upslope area is eroded. Over time, the perceived sink effect of soil erosion for greenhouse gases is therefore replaced with a neutral or positive emission balance of erosion in agricultural landscapes. Such a switch from none or a negative emission balance of agricultural landscapes to a positive balance carries the risk of accelerating climate change. In this study, we tried to estimate the risk associated with ongoing soil degradation and closing landscape soil organic matter sinks. Currently observed global erosion rates were linked to known limitations of soil

  16. Iron-mediated stabilization of soil carbon amplifies the benefits of ecological restoration in degraded lands.

    Science.gov (United States)

    Silva, Lucas C R; Doane, Timothy A; Corrêa, Rodrigo S; Valverde, Vinicius; Pereira, Engil I P; Horwath, William R

    2015-07-01

    unsuccessful attempts to restore mined areas through nutrient application alone, iron-mediated stabilization of vegetation inputs favored the regeneration of a barren stable state that had persisted for over five decades since disturbance. The effectiveness of coupled organic matter and iron "fertilization," combined with management of invasive species, has the possibility to enhance terrestrial carbon sequestration and accelerate the restoration of degraded lands, while addressing important challenges associated with urban waste disposal. PMID:26485951

  17. Thermal degradation kinetics of polyketone based on styrene and carbon monoxide

    International Nuclear Information System (INIS)

    Highlights: • The PK were synthesized from carbon monoxide and styrene in the presence of PANI-PdCl2 catalyst and PdCl2 catalyst. • The structures and thermal behaviors of PK prepared by homogenous and the supported catalyst were investigated. • The microstructures of PK were changed in the supported catalyst system. • The alternating PK copolymer (PANI-PdCl2 catalyst) was more thermally stable than PK (PdCl2 catalyst). • The degradation activation energy values were estimated by Flynn–Wall–Ozawa method and Kissinger method. - Abstract: Copolymerization of styrene with carbon monoxide to give polyketones (PK) was carried out under homogeneous palladium catalyst and polyaniline (PANI) supported palladium(II) catalyst, respectively. The copolymers were characterized by 1H NMR, 13C NMR and GPC. The results indicated that the PK catalyzed by the supported catalyst has narrow molecular weight distribution (PDI = 1.18). For comparison purpose of thermal behaviors of PK prepared by the homogeneous and the supported catalyst, thermogravimetric (TG) analysis and derivative thermogravimetric (DTG) were conducted at different heating rates. The peak temperatures (396–402 °C) for PK prepared by the supported catalyst are higher than those (387–395 °C) of PK prepared by the homogeneous catalyst. The degradation activation energy (Ek) values were estimated by Flynn–Wall–Ozawa method and Kissinger method, respectively. The Ek values, as determined by two methods, were found to be in the range 270.72 ± 0.03–297.55 ± 0.10 kJ mol−1. Structures analysis and thermal degradation analysis revealed that the supported catalyst changed the microstructures of PK, resulting in improving thermal stability of PK

  18. Elimination of paternal mitochondria through the lysosomal degradation pathway in C. elegans

    OpenAIRE

    Zhou, Qinghua; Li, Haimin; Xue, Ding

    2011-01-01

    In mammals, the inheritance of mitochondrion and its DNA (mtDNA) is strictly maternal, despite the fact that a sperm can inject up to 100 functional mitochondria into the oocyte during fertilization. The mechanisms responsible for the elimination of the paternal mitochondria remain largely unknown. We report here that this paternal mitochondrial elimination process is conserved in Caenorhabditis elegans, and that the lysosomal pathway actively participates in this process. Molecular and cell ...

  19. CARBON MONOXIDE: ITS ROLE IN MITOCHONDRIAL PATHWAY OF APOPTOSIS INDUCTION IN JURKAT CANCER CELLS

    Directory of Open Access Journals (Sweden)

    E. G. Starikova

    2014-07-01

    Full Text Available  Abstract. This study demonstrates ability of carbon monoxide to trigger mitochondrial pathway of apoptosis induction of Jurcat cells. We have shown that proapoptotic action of carbon monoxide is coupled to permeabilization of cellular mitochondrial membranes. Imbalance in Bcl-2 family of regulatory proteins may be considered among possible reasons of the membrane pore formation. We have shown downregulated cl-2 and Bcl-xl mRNA expression and decreased levels of antiapoptotic proteins, along wih decreased mRNA expression and increase of Bad proapototic protein level in Jurkat cells following incubation with 50 μm of CORM-2, a carbon monoxide donor.

  20. Population sinks resulting from degraded habitats of an obligate life-history pathway.

    Science.gov (United States)

    Hickford, Michael J H; Schiel, David R

    2011-05-01

    Many species traverse multiple habitats across ecosystems to complete their life histories. Degradation of critical, life stage-specific habitats can therefore lead to population bottlenecks and demographic deficits in sub-populations. The riparian zone of waterways is one of the most impacted areas of the coastal zone because of urbanisation, deforestation, farming and livestock grazing. We hypothesised that sink populations can result from alterations of habitats critical to the early life stages of diadromous fish that use this zone, and tested this with field-based sampling and experiments. We found that for Galaxias maculatus, one of the most widely distributed fishes of the southern hemisphere, obligate riparian spawning habitat was very limited and highly vulnerable to disturbance across 14 rivers in New Zealand. Eggs were laid only during spring tides, in the highest tidally influenced vegetation of waterways. Egg survival increased to >90% when laid in three riparian plant species and where stem densities were great enough to prevent desiccation, compared to no survival where vegetation was comprised of other species or was less dense. Experimental exclusion of livestock, one of the major sources of riparian degradation in rural waterways, resulted in quick regeneration, a tenfold increase in egg laying by fish and a threefold increase in survival, compared to adjacent controls. Overall, there was an inverse relationship between river size and egg production. Some of the largest rivers had little or no spawning habitat and very little egg production, effectively becoming sink populations despite supporting large adult populations, whereas some of the smallest pristine streams produced millions of eggs. We demonstrate that even a wide-ranging species with many robust adult populations can be compromised if a stage-specific habitat required to complete a life history is degraded by localised or more diffuse impacts. PMID:21076966

  1. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    Institute of Scientific and Technical Information of China (English)

    Agus Suryawan; Teresa ADavis

    2014-01-01

    Background:The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the current study, we identified mechanisms involved in protein degradation regulation. In experiment 1, 6-and 26-d-old pigs were studied during 1) euinsulinemic-euglycemic-euaminoacidemic, 2) euinsulinemic-euglycemic-hyperaminoacidemic, and 3) hyperinsulinemic-euglycemic-euaminoacidemic clamps for 2 h. In experiment 2, 5-d-old pigs were studied during 1) euinsulinemic-euglycemic-euaminoacidemic-euleucinemic, 2) euinsulinemic-euglycemic-hypoaminoacidemic-hyperleucinemic, and 3) euinsulinemic-euglycemic-euaminoacidemic-hyperleucinemic clamps for 24 h. We determined in muscle indices of ubiquitin-proteasome, i.e., atrogin-1 (MAFbx) and muscle RING-finger protein-1 (MuRF1) and autophagy-lysosome systems, i.e., unc51-like kinase 1 (UKL1), microtubule-associated protein light chain 3 (LC3), and lysosomal-associated membrane protein 2 (Lamp-2). For comparison, we measured ribosomal protein S6 (rpS6) and eukaryotic initiation factor 4E (eIF4E) activation, components of translation initiation. Results:Abundance of atrogin-1, but not MuRF1, was greater in 26-than 6-d-old pigs and was not affected by insulin, amino acids, or leucine. Abundance of ULK1 and LC3 was higher in younger pigs and not affected by treatment. The LC3-II/LC3-I ratio was reduced and ULK1 phosphorylation increased by insulin, amino acids, and leucine. These responses were more profound in younger pigs. Abundance of Lamp-2 was not affected by treatment or development. Abundance of eIF4E, but not rpS6, was higher in 6-than 26-d-old-pigs but unaffected by treatment. Phosphorylation of eIF4E was not affected by treatment, however, insulin, amino acids, and leucine stimulated rpS6 phosphorylation, and the

  2. Finely Tuned Regulation of the Aromatic Amine Degradation Pathway in Escherichia coli

    OpenAIRE

    Zeng, Ji; Spiro, Stephen

    2013-01-01

    FeaR is an AraC family regulator that activates transcription of the tynA and feaB genes in Escherichia coli. TynA is a periplasmic topaquinone- and copper-containing amine oxidase, and FeaB is a cytosolic NAD-linked aldehyde dehydrogenase. Phenylethylamine, tyramine, and dopamine are oxidized by TynA to the corresponding aldehydes, releasing one equivalent of H2O2 and NH3. The aldehydes can be oxidized to carboxylic acids by FeaB, and (in the case of phenylacetate) can be further degraded to...

  3. Carbon Fluxes in a sub-arctic tundra undergoing permafrost degradation

    Science.gov (United States)

    Bracho, R. G.; Webb, E.; Mauritz, M.; Schuur, E. A. G.

    2014-12-01

    As an effect of climate change, temperatures in high latitude regions are increasing faster than in the rest of the world and future projections indicate it will increase between 7°C and 8°C by the end of the 21st century. Permafrost soils store around 1700 Pg of Carbon (C), which is approximately the amount of C stored in terrestrial vegetation and in the atmosphere combined. Sustained warming induces permafrost thaw, leads to a thicker seasonal active layer, and creates subsided patches in the landscape. Carbon that was previously inaccessible to decomposition is thus exposed, increasing the likelihood of positive feedback of CO2 to the atmosphere. We measured C fluxes (Net ecosystem carbon flux, NEE, and Ecosystem respiration, Re) using the eddy covariance approach in a tundra landscape (Eight Mile Lake Watershed, Alaska) undergoing permafrost degradation from the beginning of the growing season in 2008 and throughout most winters until May 2014. This interval encompassed a range of climatic variability that included a deviation of ± 50% from the long term average in growing season precipitation. Active layer depth (thaw depth at the end of the growing season) and subsidence in the footprint were used as indicators of permafrost degradation. Results indicate that annual NEE ranged from a sink of 0.76 MgC ha-1 yr-1 to a source of 0.55 MgC ha-1 yr-1. NEE during the growing seasons fluctuated from 1.1 to 1.8 MgC ha-1 season-1 in net C uptake. Annual NEE was strongly affected by winter Re, which represented between 33% and 45% of the annual value regardless of of the large drop in both air and soil temperature. Parameters from the light response curve (optimum NEE, NEEopt and quantum yield, α) showed a seasonal and interannual variability and were different between the most and least degraded sites in the footprint, which affected the magnitude of the carbon cycle and may have implications for landscape C balance in sub-arctic tundra.

  4. Metabolism of 2-Chloro-4-Nitroaniline via Novel Aerobic Degradation Pathway by Rhodococcus sp. Strain MB-P1

    OpenAIRE

    Fazlurrahman Khan; Deepika Pal; Surendra Vikram; Swaranjit Singh Cameotra

    2013-01-01

    2-chloro-4-nitroaniline (2-C-4-NA) is used as an intermediate in the manufacture of dyes, pharmaceuticals, corrosion inhibitor and also used in the synthesis of niclosamide, a molluscicide. It is marked as a black-listed substance due to its poor biodegradability. We report biodegradation of 2-C-4-NA and its pathway characterization by Rhodococcus sp. strain MB-P1 under aerobic conditions. The strain MB-P1 utilizes 2-C-4-NA as the sole carbon, nitrogen, and energy source. In the growth medium...

  5. Electrochemical degradation of sulfonamides at BDD electrode: kinetics, reaction pathway and eco-toxicity evaluation.

    Science.gov (United States)

    Fabiańska, Aleksandra; Białk-Bielińska, Anna; Stepnowski, Piotr; Stolte, Stefan; Siedlecka, Ewa Maria

    2014-09-15

    The investigation dealt with electrochemical oxidation of five sulfonamides (SNs): sulfadiazine (SDZ), sulfathiazole (STZ), sulfamerazine (SMR), sulfamethazine (SMN) and sulfadimethoxine (SDM) in aqueous solution at boron-doped diamond (BDD) electrode. All studied sulfonamides were degraded according to a pseudo first order kinetics. The structure of SNs had no significant effect on the values of pseudo first order rate constants. Increased degradation efficiency was observed in higher temperature and in acidic pH. Due to the presence of chlorine and nitrate SNs were more effectively oxidized from municipal wastewater treatment plant (WWTP) effluents than from pure supporting electrolyte Na2SO4. The intermediates identified by LC-MS and GC-MS analysis suggested that the hydroxyl radicals attack mainly the SN bond, but also the aromatic ring systems (aniline, pyrimidine or triazole) of SNs. Finally, the toxicity of the SNs solutions and effluents after electrochemical treatment was assessed through the measurement of growth inhibition of green algae (Scenedesmus vacualatus) and duckweed (Lemna minor). Toxicity of SMR, STZ, SMN solutions before and after electrochemical oxidation and SDM solution after the process in L. minor test was observed. No significant toxicity of studied SNs was observed in algae test. PMID:25215656

  6. Bioremediation of soil polluted with crude oil and its derivatives: Microorganisms, degradation pathways, technologies

    Directory of Open Access Journals (Sweden)

    Beškoski Vladimir P.

    2012-01-01

    Full Text Available The contamination of soil and water with petroleum and its products occurs due to accidental spills during exploitation, transport, processing, storing and use. In order to control the environmental risks caused by petroleum products a variety of techniques based on physical, chemical and biological methods have been used. Biological methods are considered to have a comparative advantage as cost effective and environmentally friendly technologies. Bioremediation, defined as the use of biological systems to destroy and reduce the concentrations of hazardous waste from contaminated sites, is an evolving technology for the removal and degradation of petroleum hydrocarbons as well as industrial solvents, phenols and pesticides. Microorganisms are the main bioremediation agents due to their diverse metabolic capacities. In order to enhance the rate of pollutant degradation the technology optimizes the conditions for the growth of microorganisms present in soil by aeration, nutrient addition and, if necessary, by adding separately prepared microorganisms cultures. The other factors that influence the efficiency of process are temperature, humidity, presence of surfactants, soil pH, mineral composition, content of organic substance of soil as well as type and concentration of contaminant. This paper presents a review of our ex situ bioremediation procedures successfully implemented on the industrial level. This technology was used for treatment of soils contaminated by crude oil and its derivatives originated from refinery as well as soils polluted with oil fuel and transformer oil.

  7. Metabolome analysis and pathway abundance profiling of Yarrowia lipolytica cultivated on different carbon sources.

    Science.gov (United States)

    Zhao, Chen; Gu, Deqing; Nambou, Komi; Wei, Liujing; Chen, Jun; Imanaka, Tadayuki; Hua, Qiang

    2015-07-20

    Yarrowia lipolytica, a model microorganism of oleaginous yeasts with developed sophisticated genetic tools, is able to metabolize a wide range of substrates and accumulate large amounts of lipids. However, there is a lack of literature reporting the metabolic characteristics of Y. lipolytica metabolizing these substrates in a systematic view. In this study, Y. lipolytica was cultivated on a variety of carbon sources, among which cell growth and production characteristics on two representative substrates (glucose and oleic acid) were investigated in detail at metabolomic level. Metabolic pathway abundance was computed to interpret the metabolome data in a straightforward way. The results showed that most pathway abundances decreased in the shift from growth to production phase. Specifically, when cultivated on glucose, abundances of twelve pathways decreased markedly between the growth and lipid production phases, while thirteen pathways reduced and only three pathways increased significantly in abundances on oleic acid. In comparison, for the same cultivation phase only a few pathways exhibited significant changes between glucose-grown and oleic acid-grown cells. This study revealed that the pathway abundance could be used to effectively show the activity changes of pathways, providing a new perspective to employ metabolomics data for understanding cell metabolism and enhancing the production of target metabolites. PMID:25912211

  8. Biochemical and structural characterization of Klebsiella pneumoniae oxamate amidohydrolase in the uric acid degradation pathway

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, Katherine A.; Ealick, Steven E.

    2016-05-25

    HpxW from the ubiquitous pathogenKlebsiella pneumoniaeis involved in a novel uric acid degradation pathway downstream from the formation of oxalurate. Specifically, HpxW is an oxamate amidohydrolase which catalyzes the conversion of oxamate to oxalate and is a member of the Ntn-hydrolase superfamily. HpxW is autoprocessed from an inactive precursor to form a heterodimer, resulting in a 35.5 kDa α subunit and a 20 kDa β subunit. Here, the structure of HpxW is presented and the substrate complex is modeled. In addition, the steady-state kinetics of this enzyme and two active-site variants were characterized. These structural and biochemical studies provide further insight into this class of enzymes and allow a mechanism for catalysis consistent with other members of the Ntn-hydrolase superfamily to be proposed.

  9. Lipid rafts participate in aberrant degradative autophagic-lysosomal pathway of amyloid-beta peptide in Alzheimer’s disease

    Institute of Scientific and Technical Information of China (English)

    Xin Zhou; Chun Yang; Yufeng Liu; Peng Li; Huiying Yang; Jingxing Dai; Rongmei Qu; Lin Yuan

    2014-01-01

    Amyloid-beta peptide is the main component of amyloid plaques, which are found in Alzhei-mer’s disease. The generation and deposition of amyloid-beta is one of the crucial factors for the onset and progression of Alzheimer’s disease. Lipid rafts are glycolipid-rich liquid domains of the plasma membrane, where certain types of protein tend to aggregate and intercalate. Lipid rafts are involved in the generation of amyloid-beta oligomers and the formation of amyloid-beta peptides. In this paper, we review the mechanism by which lipid rafts disturb the aberrant deg-radative autophagic-lysosomal pathway of amyloid-beta, which plays an important role in the pathological process of Alzheimer’s disease. Moreover, we describe this mechanism from the view of the Two-system Theory of fasciology and thus, suggest that lipid rafts may be a new target of Alzheimer’s disease treatment.

  10. M2-like macrophages are responsible for collagen degradation through a mannose receptor-mediated pathway

    DEFF Research Database (Denmark)

    Madsen, Daniel H; Leonard, Daniel; Masedunskas, Andrius;

    2013-01-01

    Tissue remodeling processes critically depend on the timely removal and remodeling of preexisting collagen scaffolds. Nevertheless, many aspects related to the turnover of this abundant extracellular matrix component in vivo are still incompletely understood. We therefore took advantage of recent...... advances in optical imaging to develop an assay to visualize collagen turnover in situ and identify cell types and molecules involved in this process. Collagen introduced into the dermis of mice underwent cellular endocytosis in a partially matrix metalloproteinase-dependent manner and was subsequently...... routed to lysosomes for complete degradation. Collagen uptake was predominantly executed by a quantitatively minor population of M2-like macrophages, whereas more abundant Col1a1-expressing fibroblasts and Cx3cr1-expressing macrophages internalized collagen at lower levels. Genetic ablation of the...

  11. Significant role of UV and carbonate radical on the degradation of oxytetracycline in UV-AOPs: Kinetics and mechanism.

    Science.gov (United States)

    Liu, Yiqing; He, Xuexiang; Duan, Xiaodi; Fu, Yongsheng; Fatta-Kassinos, Despo; Dionysiou, Dionysios D

    2016-05-15

    Carbonate radical (CO3(•-)), a selective oxidant, reacts readily with electron-rich compounds through electron transfer and/or hydrogen abstraction. In this study, the role of CO3(•-) in degrading oxytetracycline (OTC) by UV only, UV/H2O2 and UV/persulfate (UV/PS) advanced oxidation processes (AOPs) in the presence of HCO3(-) or CO3(2-) was investigated. For UV only process, the presence of photosensitizers, i.e., nitrate (NO3(-)) and natural organic matter (NOM), had different impacts on OTC degradation, i.e., an enhancing effect by NO3(-) due to the generation of HO(•) and a slight inhibiting effect by NOM possibly due to a light scattering effect. Differently for UV/H2O2 and UV/PS processes, the presence of NO3(-) hardly influenced the destruction of OTC. Generation of CO3(•-) presented a positive role on OTC degradation by UV/NO3(-)/HCO3(-). Such influence was also observed in the two studied AOPs in the presence of both bicarbonate and other natural water constituents. When various natural water samples from different sources were used as reaction matrices, UV only and UV/H2O2 showed an inhibiting effect while UV/PS demonstrated a comparable or even promoting effect in OTC decomposition. After elucidating the potential contribution of UV direct photolysis via excited state OTC* at an elevated reaction pH condition, putative OTC transformation byproducts via CO3(•-) reaction were identified by ultra-high definition accurate-mass quadrupole time-of-flight tandem mass spectrometry (QTOF/MS). Five different reaction pathways were subsequently proposed, including hydroxylation (+16 Da), quinonization (+14 Da), demethylation (-14 Da), decarbonylation (-28 Da) and dehydration (-18 Da). The significant role of UV at high pH and CO3(•-) on OTC removal from contaminated water was therefore demonstrated both kinetically and mechanistically. PMID:27131094

  12. Biochemical, transcriptional and translational evidences of the phenol-meta-degradation pathway by the hyperthermophilic Sulfolobus solfataricus 98/2.

    Directory of Open Access Journals (Sweden)

    Alexia Comte

    Full Text Available Phenol is a widespread pollutant and a model molecule to study the biodegradation of monoaromatic compounds. After a first oxidation step leading to catechol in mesophilic and thermophilic microorganisms, two main routes have been identified depending on the cleavage of the aromatic ring: ortho involving a catechol 1,2 dioxygenase (C12D and meta involving a catechol 2,3 dioxygenase (C23D. Our work aimed at elucidating the phenol-degradation pathway in the hyperthermophilic archaea Sulfolobus solfataricus 98/2. For this purpose, the strain was cultivated in a fermentor under different substrate and oxygenation conditions. Indeed, reducing dissolved-oxygen concentration allowed slowing down phenol catabolism (specific growth and phenol-consumption rates dropped 55% and 39%, respectively and thus, evidencing intermediate accumulations in the broth. HPLC/Diode Array Detector and LC-MS analyses on culture samples at low dissolved-oxygen concentration (DOC  =  0.06 mg x L(-1 suggested, apart for catechol, the presence of 2-hydroxymuconic acid, 4-oxalocrotonate and 4-hydroxy-2-oxovalerate, three intermediates of the meta route. RT-PCR analysis on oxygenase-coding genes of S. solfataricus 98/2 showed that the gene coding for the C23D was expressed only on phenol. In 2D-DIGE/MALDI-TOF analysis, the C23D was found and identified only on phenol. This set of results allowed us concluding that S. solfataricus 98/2 degrade phenol through the meta route.

  13. Evidence for isofunctional enzymes in the degradation of phenol, m- and p-toluate, and p-cresol via catechol meta-cleavage pathways in Alcaligenes eutrophus.

    OpenAIRE

    Hughes, E J; Bayly, R C; Skurray, R A

    1984-01-01

    A study of the degradation of phenol, p-cresol, and m- and p-toluate by Alcaligenes eutrophus 345 has provided evidence that these compounds are metabolized via separate catechol meta-cleavage pathways. Analysis of the enzymes synthesized by wild-type and mutant strains and by strains cured of the plasmid pRA1000, which encodes m- and p-toluate degradation, indicated that two or more isofunctional enzymes mediated several steps in the pathway. The formation of three catechol 2,3-oxygenases an...

  14. Stable carbon isotope analysis to distinguish biotic and abiotic degradation of 1,1,1-trichloroethane in groundwater sediments

    DEFF Research Database (Denmark)

    Broholm, Mette Martina; Hunkeler, Daniel; Tuxen, Nina;

    2014-01-01

    The fate and treatability of 1,1,1-TCA by natural and enhanced reductive dechlorination was studied in laboratory microcosms. The study shows that compound-specific isotope analysis (CSIA) identified an alternative 1,1,1-TCA degradation pathway that cannot be explained by assuming biotic reductive...

  15. Sources and Input Pathways of Glyphosate and its Degradation Product AMPA

    Science.gov (United States)

    Bischofberger, S.; Hanke, I.; Wittmer, I.; Singer, H.; Stamm, C.

    2009-04-01

    Despite being the pesticide used in the largest quantities worldwide, the environmental relevance of glyphosate has been considered low for many years. Reasons for this assessment were the observations that glyphosate degrades quickly into its degradation product AMPA and that it sorbs strongly to soil particles. Hence, little losses to water bodies had been expected. Research during the last few years however contradicts this expectation. Although glyphosate is a dominant pesticide used in agriculture, recent studies on other pesticides revealed that urban sources may play a significant role for water quality. Therefore this study compares glyphosate input into streams from agricultural and urban sources. For that purpose, a catchment of an area of 25 km2 was selected. It has by about 12'000 inhabitants and about 15 % of the area is used as arable land. Four sampling sites were selected in the river system in order to reflect different urban and agricultural sources. Additionally, we sampled a combined sewer overflow, a rain sewer and the outflow of a waste water treatment plant. At each site discharge was measured continuously from March to November 2007. During 16 rain events samples were taken by automatic devices at a high temporal resolution. To analyze the concentration of glyphosate and its degradation product AMPA, the samples were derivatized with FMOC-Cl at low pH conditions and then filtrated. The solid phase extraction was conducted with Strata-X sorbent cartridge. Glyphosate and AMPA were detected with API 4000 after the chromatography with X bridge column C18. To assure the data quality, interne standards of Glyphosate and AMPA were added to every sample. The limit of detection and quantification for glyphosate and AMPA are bellow 1ng/l. We analyzed two rain events at a high resolution for all stations and several events at the outlet of the catchment. We measured high glyphosate concentration in urban and agriculture dominated catchments with up to

  16. Reversal of Cytosolic One-Carbon Flux Compensates for Loss of the Mitochondrial Folate Pathway.

    Science.gov (United States)

    Ducker, Gregory S; Chen, Li; Morscher, Raphael J; Ghergurovich, Jonathan M; Esposito, Mark; Teng, Xin; Kang, Yibin; Rabinowitz, Joshua D

    2016-06-14

    One-carbon (1C) units for purine and thymidine synthesis can be generated from serine by cytosolic or mitochondrial folate metabolism. The mitochondrial 1C pathway is consistently overexpressed in cancer. Here, we show that most but not all proliferating mammalian cell lines use the mitochondrial pathway as the default for making 1C units. Clustered regularly interspaced short palindromic repeats (CRISPR)-mediated mitochondrial pathway knockout activates cytosolic 1C-unit production. This reversal in cytosolic flux is triggered by depletion of a single metabolite, 10-formyl-tetrahydrofolate (10-formyl-THF), and enables rapid cell growth in nutrient-replete conditions. Loss of the mitochondrial pathway, however, renders cells dependent on extracellular serine to make 1C units and on extracellular glycine to make glutathione. HCT-116 colon cancer xenografts lacking mitochondrial 1C pathway activity generate the 1C units required for growth by cytosolic serine catabolism. Loss of both pathways precludes xenograft formation. Thus, either mitochondrial or cytosolic 1C metabolism can support tumorigenesis, with the mitochondrial pathway required in nutrient-poor conditions. PMID:27211901

  17. Carbon capture and sequestration: an exploratory inhalation toxicity assessment of amine-trapping solvents and their degradation products.

    Science.gov (United States)

    McDonald, Jacob D; Kracko, Dean; Doyle-Eisele, Melanie; Garner, C Edwin; Wegerski, Chris; Senft, Al; Knipping, Eladio; Shaw, Stephanie; Rohr, Annette

    2014-09-16

    Carbon dioxide (CO2) absorption with aqueous amine solvents is a method of carbon capture and sequestration (CCS) from flue gases. One concern is the possible release of amine solvents and degradation products into the atmosphere, warranting evaluation of potential pulmonary effects from inhalation. The CCS amines monoethanolamine (MEA), methyldiethanolamine (MDEA), and piperazine (PIP) underwent oxidative and CO2-mediated degradation for 75 days. C57bl/6N mice were exposed for 7 days by inhalation of 25 ppm neat amine or equivalant concentration in the degraded mixture. The aqueous solutions were nebulized to create the inhalation atmospheres. Pulmonary response was measured by changes in inflammatory cells in bronchoalveolar lavage fluid and cytokine expression in lung tissue. Ames mutagenicity and CHO-K1 micronucleus assays were applied to assess genotoxicity. Chemical analysis of the test atmosphere and liquid revealed complex mixtures, including acids, aldehydes, and other compounds. Exposure to oxidatively degraded MEA increased (p oxidative stress. CO2 degradation resulted in a different composition, less degradation, and lower observed toxicity (less magnitude and number of effects) with no genotoxicity. Overall, oxidative degradation of the amines studied resulted in enhanced toxicity (increased magnitude and number of effects) compared to the neat chemicals. PMID:25167095

  18. Soil organic carbon stocks in rangelands of SW Iberian Peninsula as influenced by land degradation

    Science.gov (United States)

    Pulido-Fernández, Manuel; Schnabel, Susanne; Francisco Lavado-Contador, Joaquín

    2014-05-01

    Rangelands in SW Iberian Peninsula occupy approximately 95,000 km2 of land grazed by millions of domestic animals. They are characterised by grasslands with varying tree density, interspersed in some areas with shrubs. The herbaceous layer is dominated by annual species and the tree layer is mainly formed of evergreen oak. Most rangelands are exploited in large farms (>100 ha), held mainly on private ownership and dedicated to extensive livestock breeding. Soil organic carbon (SOC) is an essential component of the fertility and productivity in both, natural and human-induced ecosystems. Previous research evidenced SOC is concentrated mainly in the top 5 cm soil layer, displaying large spatial variability, with higher values beneath tree canopies as compared to the open spaces. Traditional practices such as cereal cultivation, as well as an increasing number of domestic animals in the last decades, have been remarked as some of the main causes of SOC depletion in rangelands. However, a better understanding of how livestock grazing affects soil organic carbon stock is still needed. The main objective of this study is to investigate the possible relationships between land degradation and SOC stock in rangelands of SW Iberian Peninsula. Previous studies have shown that sheet erosion is one of the main soil degradation processes. In this study, we have compared SOC stock values from reference soils belonging to a farm where no livestock exists for more than 100 years, with those from 10 farms grazed by domestic animals in the Spanish region of Extremadura. The reference farm is an example of an undisturbed natural area composed of Mediterranean forest and dense scrub. In each farm at least 2 areas were selected, constituting in the case of the grazed farms fenced areas, where the stocking rates could be determined. These units are representative of different rangeland types: wooded rangelands (dehesas), treeless grasslands and scrublands of Retama sphaerocarpa with

  19. Abatement and degradation pathways of toluene in indoor air by positive corona discharge.

    Science.gov (United States)

    Van Durme, J; Dewulf, J; Sysmans, W; Leys, C; Van Langenhove, H

    2007-08-01

    Indoor air concentrations of volatile organic compounds often exceed outdoor levels by a factor of 5. There is much interest in developing new technologies in order to improve indoor air quality. In this work non-thermal plasma (DC positive corona discharge) is explored as an innovative technology for indoor air purification. An inlet gas stream of 10 l min(-1) containing 0.50+/-0.02 ppm toluene was treated by the plasma reactor in atmospheric conditions. Toluene removal proved to be achievable with a characteristic energy density epsilon(0) of 50 J l(-1). Removal efficiencies were higher for 26% relative humidity (epsilon(0)=35 J l(-1)), compared with those at increased humidities (50% relative humidity, epsilon(0)=49 J l(-1)). Reaction products such as formic acid, benzaldehyde, benzyl alcohol, 3-methyl-4-nitrophenol, 4-methyl-2-nitrophenol, 4-methyl-2-propyl furan, 5-methyl-2-nitrophenol, 4-nitrophenol, 2-methyl-4,6-dinitrophenol are identified by means of mass spectrometry. Based on these by-products a toluene degradation mechanism is proposed. PMID:17490711

  20. In vitro degradation and cell response of calcium carbonate composite ceramic in comparison with other synthetic bone substitute materials

    International Nuclear Information System (INIS)

    The robust calcium carbonate composite ceramics (CC/PG) can be acquired by fast sintering calcium carbonate at a low temperature (650 °C) using a biocompatible, degradable phosphate-based glass (PG) as sintering agent. In the present study, the in vitro degradation and cell response of CC/PG were assessed and compared with 4 synthetic bone substitute materials, calcium carbonate ceramic (CC), PG, hydroxyapatite (HA) and β-tricalcium phosphate (β-TCP) ceramics. The degradation rates in decreasing order were as follows: PG, CC, CC/PG, β-TCP, and HA. The proliferation of rat bone mesenchymal stem cells (rMSCs) cultured on the CC/PG was comparable with that on CC and PG, but inferior to HA and β-TCP. The alkaline phosphatase (ALP) activity of rMSCs on CC/PG was lower than PG, comparable with β-TCP, but higher than HA. The rMSCs on CC/PG and PG had enhanced gene expression in specific osteogenic markers, respectively. Compared to HA and β-TCP, the rMSCs on the CC/PG expressed relatively lower level of collagen I and runt-related transcription factor 2, but showed more considerable expression of osteopontin. Although CC, PG, HA, and β-TCP possessed impressive performances in some specific aspects, they faced extant intrinsic drawbacks in either degradation rate or mechanical strength. Based on considerable compressive strength, moderate degradation rate, good cell response, and being free of obvious shortcoming, the CC/PG is promising as another choice for bone substitute materials. - Highlights: • A calcium carbonate composite ceramic (CC/PG) was acquired. • The in vitro degradation and cell response of CC/PG were compared to 4 materials. • The CC/PG showed moderate degradation rate. • The CC/PG exhibited good cell response. • The CC/PG was free of obvious drawback compared to other materials

  1. In vitro degradation and cell response of calcium carbonate composite ceramic in comparison with other synthetic bone substitute materials

    Energy Technology Data Exchange (ETDEWEB)

    He, Fupo [Department of Biomedical Engineering, School of Basic Sciences, Guangzhou Medical University, Guangzhou 510182 (China); Zhang, Jing [School of Materials Science and Engineering, South China University of Technology, Guangzhou 510641 (China); Yang, Fanwen; Zhu, Jixiang; Tian, Xiumei [Department of Biomedical Engineering, School of Basic Sciences, Guangzhou Medical University, Guangzhou 510182 (China); Chen, Xiaoming, E-mail: xmchenw@126.com [Department of Biomedical Engineering, School of Basic Sciences, Guangzhou Medical University, Guangzhou 510182 (China)

    2015-05-01

    The robust calcium carbonate composite ceramics (CC/PG) can be acquired by fast sintering calcium carbonate at a low temperature (650 °C) using a biocompatible, degradable phosphate-based glass (PG) as sintering agent. In the present study, the in vitro degradation and cell response of CC/PG were assessed and compared with 4 synthetic bone substitute materials, calcium carbonate ceramic (CC), PG, hydroxyapatite (HA) and β-tricalcium phosphate (β-TCP) ceramics. The degradation rates in decreasing order were as follows: PG, CC, CC/PG, β-TCP, and HA. The proliferation of rat bone mesenchymal stem cells (rMSCs) cultured on the CC/PG was comparable with that on CC and PG, but inferior to HA and β-TCP. The alkaline phosphatase (ALP) activity of rMSCs on CC/PG was lower than PG, comparable with β-TCP, but higher than HA. The rMSCs on CC/PG and PG had enhanced gene expression in specific osteogenic markers, respectively. Compared to HA and β-TCP, the rMSCs on the CC/PG expressed relatively lower level of collagen I and runt-related transcription factor 2, but showed more considerable expression of osteopontin. Although CC, PG, HA, and β-TCP possessed impressive performances in some specific aspects, they faced extant intrinsic drawbacks in either degradation rate or mechanical strength. Based on considerable compressive strength, moderate degradation rate, good cell response, and being free of obvious shortcoming, the CC/PG is promising as another choice for bone substitute materials. - Highlights: • A calcium carbonate composite ceramic (CC/PG) was acquired. • The in vitro degradation and cell response of CC/PG were compared to 4 materials. • The CC/PG showed moderate degradation rate. • The CC/PG exhibited good cell response. • The CC/PG was free of obvious drawback compared to other materials.

  2. Cx31 is assembled and trafficked to cell surface by ER-Golgi pathway and degraded by proteasomal or lysosomal pathways

    Institute of Scientific and Technical Information of China (English)

    Li Qiang HE; Zhi Gao LONG; He Ping DAI; Kun XIA; Jia Hui XIA; Zhuo Hua ZHANG; Fang CAI; Yu LIU; Mu Jun LIU; Zhi Ping TAN; Qian PAN; Fai Yan FANG; De Sheng LIANG; Ling Qian WU

    2005-01-01

    Gap junctions, consisting of connexins, allow the exchange of small molecules (<1 kD) between adjacent cells, thus providing a mechanism for synchronizing the responses of groups of cells to environmental stimuli. Connexin 31 is a member of the connexin family. Mutations on connexin 31 are associated with erythrokeratodermia variabilis, hearing impairment and peripheral neuropathy. However, the pathological mechanism for connexin 31 mutants in these diseases are still unknown. In this study, we analyzed the assembly, trafficking and metabolism of connexin 31 in HeLa cells stably expressing connexin 31. Calcein transfer assay showed that calcein transfer was inhibited when cells were treated with Brefeldin A or cytochalasin D, but not when treated with nocodazole or α-glycyrrhetinic acid, suggesting that Golgi apparatus and actin filaments, but not microtubules, are crucial to the trafficking and assembly of connexin 31, as well as the formation of gap junction intercellular communication by connexin 31. Additionally, α-glycyrrhetinic acid did not effectively inhibit gap junctional intercellular communication formed by connexin 31. Pulse-chase assay revealed that connexin 31 had a half-life of about 6 h. Moreover, Western blotting and fluorescent staining demonstrated that in HeLa cells stably expressing connexin 31, the amount of connexin 31 was significantly increased after these cells were treated with proteasomal or lysosomal inhibitors. These findings indicate that connexin 31 was rapidly renewed,and possibly degraded by both proteasomal and lysosomal pathways.

  3. Microbial degradation of fluorinated drugs: biochemical pathways, impacts on the environment and potential applications.

    Science.gov (United States)

    Murphy, Cormac D

    2016-03-01

    Since the discovery over 60 years ago of fluorocortisone's biological properties (9-α-Fluoro derivatives of cortisone and hydrocortisone; Fried J and Sabo EF, J Am Chem Soc 76: 1455-1456, 1954), the number of fluorinated drugs has steadily increased. With the improvement in synthetic methodologies, this trend is likely to continue and will lead to the introduction of new fluorinated substituents into pharmaceutical compounds. Although the biotransformation of organofluorine compounds by microorganisms has been well studied, specific investigations on fluorinated drugs are relatively few, despite the increase in the number and variety of fluorinated drugs that are available. The strength of the carbon-fluorine bond conveys stability to fluorinated drugs; thus, they are likely to be recalcitrant in the environment or may be partially metabolized to a more toxic metabolite. This review examines the research done on microbial biotransformation and biodegradation of fluorinated drugs and highlights the importance of understanding how microorganisms interact with this class of compound from environmental, clinical and biotechnological perspectives. PMID:26830103

  4. Photocatalytic degradation of phenol using TiO2 nanocrystals supported on activated carbon

    International Nuclear Information System (INIS)

    It has been deposited titanium oxide on activated carbon (AC) in two forms as powder and as a pellet. This oxide was obtained using sol-gel process based on titanium isopropoxide and isopropyl alcohol. Nanocrystalline TiO2 anatase phase on activated carbon was obtained using an adequated thermal treatment of 325 oC by 5 h considering the thermal instability of the AC. The resulting material was characterized by spectroscopic X-ray fluorescence, scanning electron microscopy with energy dispersive X-ray microanalyses (EDX), and Brunauer-Emmett-Teller (BET) surface area measurements. Activity measurements performed under UV lamp and solar irradiation have shown good results for the photo degradation of phenol in aqueous solution. For solar applications, a polyethylene terephtalate bottle containing the photocatalyts was filled up with the contaminated water and place few hours under the solar radiation of a couple of sunny days. The results indicate that 20 ppm of phenol can be removed by using this method. (author)

  5. The in Vitro and in Vivo Degradation of Cross-Linked Poly(trimethylene carbonate-Based Networks

    Directory of Open Access Journals (Sweden)

    Liqun Yang

    2016-04-01

    Full Text Available The degradation of the poly(trimethylene carbonate (PTMC and poly(trimethylene carbonate-co-ε-caprolactone (P(TMC-co-CL networks cross-linked by 0.01 and 0.02 mol % 2,2′-bis(trimethylene carbonate-5-yl-butylether (BTB was carried out in the conditions of hydrolysis and enzymes in vitro and subcutaneous implantation in vivo. The results showed that the cross-linked PTMC networks exhibited much faster degradation in enzymatic conditions in vitro and in vivo versus in a hydrolysis case due to the catalyst effect of enzymes; the weight loss and physical properties of the degraded networks were dependent on the BTB amount. The morphology observation in lipase and in vivo illustrated that enzymes played an important role in the surface erosion of cross-linked PTMC. The hydrolytic degradation rate of the cross-linked P(TMC-co-CL networks increased with increasing ε-caprolactone (CL content in composition due to the preferential cleavage of ester bonds. Cross-linking is an effective strategy to lower the degradation rate and enhance the form-stability of PTMC-based materials.

  6. Interaction between Carbon Nanotubes and Aromatic Hydrocarbon-degrading Microbes and its Effect on Carbon Nanotubes Transformation

    Science.gov (United States)

    You, Y.; Wang, L.; Poulson, S.; Wang, X.; Xing, B.; Yang, Y.

    2015-12-01

    Due to their unique electrical, optical and mechanical properties, carbon nanotubes (CNTs) have been substantially produced and widely applied during the past decades, leading to their increased probability of entering the environment. Some estimation suggests that CNTs are accumulated in agricultural systems with their soil concentration increasing by 0.4-157 ng/kg/year. This has raised concerns about environmental impacts of these emerging contaminants including their ecotoxicity. Meanwhile, transformation of CNTs in the environment can significantly affect their transport, bioavailability and thereby ecotoxicity. So far, environmental biodegradation of CNTs remains obscure. Given the high diversity of soil microorganisms and their metabolic potentials, it is important to investigate microbial biodegradation of CNTs under various environmental conditions. This study focuses on an aromatic hydrocarbon-degrading bacterium, Mycobacterium vanbaalenii PYR-1, as a model microorganism capable of ring cleavage. We hypothesize that bacterial activities could transform CNTs to more hydrophilic forms, increasing their aqueous stability and environmental reactivity. We incubated M. vanbaalenii PYR-1 with 13C-labeded multiwall carbon nanotubes (MWCNTs) for 30 days, monitored δ13C in the system, characterized MWCNTs before and after the reaction, and compared the results with culture-negative controls. To investigate effects of various environmental conditions, including the presence of extracellular oxidative enzymes from white-rot fungi, additional experiments will be conducted and results compared will be compared among different setups. Moreover, we will measure adverse impacts of CNTs on the metabolic activities of M. vanbaalenii PYR-1, particularly its biodegradation of polycyclic aromatic hydrocarbons.

  7. Carbon black and titanium dioxide nanoparticles elicit distinct apoptotic pathways in bronchial epithelial cells

    OpenAIRE

    Baeza-Squiban Armelle; Fleury Jocelyne; Martens Johan A; Andreau Karine; Borot Marie-Caroline; Ferecatu Ioana; Thomassen Leen CJ; Hussain Salik; Marano Francelyne; Boland Sonja

    2010-01-01

    Abstract Background Increasing environmental and occupational exposures to nanoparticles (NPs) warrant deeper insight into the toxicological mechanisms induced by these materials. The present study was designed to characterize the cell death induced by carbon black (CB) and titanium dioxide (TiO2) NPs in bronchial epithelial cells (16HBE14o- cell line and primary cells) and to investigate the implicated molecular pathways. Results Detailed time course studies revealed that both CB (13 nm) and...

  8. Modeling Aerobic Carbon Source Degradation Processes using Titrimetric Data and Combined Respirometric-Titrimetric Data: Structural and Practical Identifiability

    DEFF Research Database (Denmark)

    Gernaey, Krist; Petersen, B.; Dochain, D.;

    2002-01-01

    The structural and practical identifiability of a model for description of respirometric-titrimetric data derived from aerobic batch substrate degradation experiments of a CxHyOz carbon source with activated sludge was evaluated. The model processes needed to describe titrimetric data included su...

  9. Degradation of γ-HCH spiked soil using stabilized Pd/Fe0 bimetallic nanoparticles: Pathways, kinetics and effect of reaction conditions

    International Nuclear Information System (INIS)

    Highlights: ► This study explores the potential of CMC-Pd/nFe0 to degrade γ-HCH in spiked soil. ► Sorption–desorption characteristics and partitioning of γ-HCH is investigated. ► Three degradation pathways has been proposed and discussed. ► γ-HCH degradation mechanism and kinetics is elucidated. ► Activation energy reveals that γ-HCH degradation is a surface mediated reaction. - Abstract: This study investigates the degradation pathway of gamma-hexachlorocyclohexane (γ-HCH) in spiked soil using carboxymethyl cellulose stabilized Pd/Fe0 bimetallic nanoparticles (CMC-Pd/nFe0). GC–MS analysis of γ-HCH degradation products showed the formation of pentachlorocyclohexene, tri- and di-chlorobenzene as intermediate products while benzene was formed as the most stable end product. On the basis of identified intermediates and final products, degradation pathway of γ-HCH has been proposed. Batch studies showed complete γ-HCH degradation at a loading of 0.20 g/L CMC-Pd/nFe0 within 6 h of incubation. The surface area normalized rate constant (kSA) was found to be 7.6 × 10−2 L min−1 m−2. CMC-Pd/nFe0 displayed ∼7-fold greater efficiency for γ-HCH degradation in comparison to Fe0 nanoparticles (nFe0), synthesized without CMC and Pd. Further studies showed that increase in CMC-Pd/nFe0 loading and reaction temperature facilitates γ-HCH degradation, whereas a declining trend in degradation was noticed with the increase in pH, initial γ-HCH concentration and in the presence of cations. The data on activation energy (33.7 kJ/mol) suggests that γ-HCH degradation is a surface mediated reaction. The significance of the study with respect to remediation of γ-HCH contaminated soil using CMC-Pd/nFe0 has been discussed.

  10. Degradation of {gamma}-HCH spiked soil using stabilized Pd/Fe{sup 0} bimetallic nanoparticles: Pathways, kinetics and effect of reaction conditions

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Ritu [Ecotoxicology Division, CSIR-Indian Institute of Toxicology Research, Post Box 80, Mahatma Gandhi Marg, Lucknow 226 001, UP (India); Department of Environmental Science, Babasaheb Bhimrao Ambedkar University, Raebareli Road, Lucknow 226 025, UP (India); Misra, Virendra, E-mail: virendra_misra2001@yahoo.co.in [Ecotoxicology Division, CSIR-Indian Institute of Toxicology Research, Post Box 80, Mahatma Gandhi Marg, Lucknow 226 001, UP (India); Mudiam, Mohana Krishna Reddy [Analytical Chemistry Division, CSIR-Indian Institute of Toxicology Research, Post Box 80, Mahatma Gandhi Marg, Lucknow 226 001, UP (India); Chauhan, Lalit Kumar Singh [Petroleum Toxicology Division, CSIR-Indian Institute of Toxicology Research, Post Box 80, Mahatma Gandhi Marg, Lucknow 226 001, UP (India); Singh, Rana Pratap [Department of Environmental Science, Babasaheb Bhimrao Ambedkar University, Raebareli Road, Lucknow 226 025, UP (India)

    2012-10-30

    Highlights: Black-Right-Pointing-Pointer This study explores the potential of CMC-Pd/nFe{sup 0} to degrade {gamma}-HCH in spiked soil. Black-Right-Pointing-Pointer Sorption-desorption characteristics and partitioning of {gamma}-HCH is investigated. Black-Right-Pointing-Pointer Three degradation pathways has been proposed and discussed. Black-Right-Pointing-Pointer {gamma}-HCH degradation mechanism and kinetics is elucidated. Black-Right-Pointing-Pointer Activation energy reveals that {gamma}-HCH degradation is a surface mediated reaction. - Abstract: This study investigates the degradation pathway of gamma-hexachlorocyclohexane ({gamma}-HCH) in spiked soil using carboxymethyl cellulose stabilized Pd/Fe{sup 0} bimetallic nanoparticles (CMC-Pd/nFe{sup 0}). GC-MS analysis of {gamma}-HCH degradation products showed the formation of pentachlorocyclohexene, tri- and di-chlorobenzene as intermediate products while benzene was formed as the most stable end product. On the basis of identified intermediates and final products, degradation pathway of {gamma}-HCH has been proposed. Batch studies showed complete {gamma}-HCH degradation at a loading of 0.20 g/L CMC-Pd/nFe{sup 0} within 6 h of incubation. The surface area normalized rate constant (k{sub SA}) was found to be 7.6 Multiplication-Sign 10{sup -2} L min{sup -1} m{sup -2}. CMC-Pd/nFe{sup 0} displayed {approx}7-fold greater efficiency for {gamma}-HCH degradation in comparison to Fe{sup 0} nanoparticles (nFe{sup 0}), synthesized without CMC and Pd. Further studies showed that increase in CMC-Pd/nFe{sup 0} loading and reaction temperature facilitates {gamma}-HCH degradation, whereas a declining trend in degradation was noticed with the increase in pH, initial {gamma}-HCH concentration and in the presence of cations. The data on activation energy (33.7 kJ/mol) suggests that {gamma}-HCH degradation is a surface mediated reaction. The significance of the study with respect to remediation of {gamma}-HCH contaminated soil using

  11. Novel small molecule binders of human N-glycanase 1, a key player in the endoplasmic reticulum associated degradation pathway.

    Science.gov (United States)

    Srinivasan, Bharath; Zhou, Hongyi; Mitra, Sreyoshi; Skolnick, Jeffrey

    2016-10-01

    Peptide:N-glycanase (NGLY1) is an enzyme responsible for cleaving oligosaccharide moieties from misfolded glycoproteins to enable their proper degradation. Deletion and truncation mutations in this gene are responsible for an inherited disorder of the endoplasmic reticulum-associated degradation pathway. However, the literature is unclear whether the disorder is a result of mutations leading to loss-of-function, loss of substrate specificity, loss of protein stability or a combination of these factors. In this communication, without burdening ourselves with the mechanistic underpinning of disease causation because of mutations on the NGLY1 protein, we demonstrate the successful application of virtual ligand screening (VLS) combined with experimental high-throughput validation to the discovery of novel small-molecules that show binding to the transglutaminase domain of NGLY1. Attempts at recombinant expression and purification of six different constructs led to successful expression of five, with three constructs purified to homogeneity. Most mutant variants failed to purify possibly because of misfolding and the resultant exposure of surface hydrophobicity that led to protein aggregation. For the purified constructs, our threading/structure-based VLS algorithm, FINDSITE(comb), was employed to predict ligands that may bind to the protein. Then, the predictions were assessed by high-throughput differential scanning fluorimetry. This led to the identification of nine different ligands that bind to the protein of interest and provide clues to the nature of pharmacophore that facilitates binding. This is the first study that has identified novel ligands that bind to the NGLY1 protein as a possible starting point in the discovery of ligands with potential therapeutic applications in the treatment of the disorder caused by NGLY1 mutants. PMID:27567076

  12. The type II collagen fragments Helix-II and CTX-II reveal different enzymatic pathways of human cartilage collagen degradation

    DEFF Research Database (Denmark)

    Charni-Ben Tabassi, N; Desmarais, S; Jensen, Anne-Christine Bay;

    2008-01-01

    OBJECTIVE: Cartilage degradation in osteoarthritis (OA) generates the type II collagen fragments, Helix-II and CTX-II that can be used as clinical biological markers. Helix-II and C-telopeptide of type II collagen (CTX-II) levels are associated independently with progression of OA suggesting that...... they may be generated through different collagenolytic pathways. In this study we analyzed the release of Helix-II and CTX-II from human cartilage collagen by the proteinases reported to play a role in cartilage degradation. METHODS: In vitro, human articular cartilage extract was incubated with...... enzymatic pathways. Helix-II and CTX-II alone reflect only partially overall cartilage collagen degradation. These findings may explain why these two biological markers could provide complementary information on disease progression in OA....

  13. Carbon pools and flows during lab-scale degradation of old landfilled waste under different oxygen and water regimes

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted - Highlights: • 40 year old waste from an old MSW landfill was incubated in LSR experiments. • Carbon balances for anaerobic and aerobic waste degradation were established. • The transformation of carbon pools during waste degradation was investigated. • Waste aeration resulted in the formation of a new, stable organic carbon pool. • Water addition did not have a significant effect on aerobic waste degradation. - Abstract: Landfill aeration has been proven to accelerate the degradation of organic matter in landfills in comparison to anaerobic decomposition. The present study aims to evaluate pools of organic matter decomposing under aerobic and anaerobic conditions using landfill simulation reactors (LSR) filled with 40 year old waste from a former MSW landfill. The LSR were operated for 27 months, whereby the waste in one pair was kept under anaerobic conditions and the four other LSRs were aerated. Two of the aerated LSR were run with leachate recirculation and water addition and two without. The organic carbon in the solid waste was characterized at the beginning and at the end of the experiments and major carbon flows (e.g. TOC in leachate, gaseous CO2 and CH4) were monitored during operation. After the termination of the experiments, the waste from the anaerobic LSRs exhibited a long-term gas production potential of more than 20 NL kg−1 dry waste, which corresponded to the mineralization of around 12% of the initial TOC (67 g kg−1 dry waste). Compared to that, aeration led to threefold decrease in TOC (32–36% of the initial TOC were mineralized), without apparent differences in carbon discharge between the aerobic set ups with and without water addition. Based on the investigation of the carbon pools it could be demonstrated that a bit more than 10% of the initially present organic carbon was transformed into more recalcitrant forms, presumably due to the formation of humic substances. The source of anaerobic

  14. Carbon pools and flows during lab-scale degradation of old landfilled waste under different oxygen and water regimes

    Energy Technology Data Exchange (ETDEWEB)

    Brandstätter, Christian, E-mail: bran.chri@gmail.com; Laner, David, E-mail: david.laner@tuwien.ac.at; Fellner, Johann, E-mail: johann.fellner@tuwien.ac.at

    2015-06-15

    Graphical abstract: Display Omitted - Highlights: • 40 year old waste from an old MSW landfill was incubated in LSR experiments. • Carbon balances for anaerobic and aerobic waste degradation were established. • The transformation of carbon pools during waste degradation was investigated. • Waste aeration resulted in the formation of a new, stable organic carbon pool. • Water addition did not have a significant effect on aerobic waste degradation. - Abstract: Landfill aeration has been proven to accelerate the degradation of organic matter in landfills in comparison to anaerobic decomposition. The present study aims to evaluate pools of organic matter decomposing under aerobic and anaerobic conditions using landfill simulation reactors (LSR) filled with 40 year old waste from a former MSW landfill. The LSR were operated for 27 months, whereby the waste in one pair was kept under anaerobic conditions and the four other LSRs were aerated. Two of the aerated LSR were run with leachate recirculation and water addition and two without. The organic carbon in the solid waste was characterized at the beginning and at the end of the experiments and major carbon flows (e.g. TOC in leachate, gaseous CO{sub 2} and CH{sub 4}) were monitored during operation. After the termination of the experiments, the waste from the anaerobic LSRs exhibited a long-term gas production potential of more than 20 NL kg{sup −1} dry waste, which corresponded to the mineralization of around 12% of the initial TOC (67 g kg{sup −1} dry waste). Compared to that, aeration led to threefold decrease in TOC (32–36% of the initial TOC were mineralized), without apparent differences in carbon discharge between the aerobic set ups with and without water addition. Based on the investigation of the carbon pools it could be demonstrated that a bit more than 10% of the initially present organic carbon was transformed into more recalcitrant forms, presumably due to the formation of humic substances

  15. Dysregulation of protein degradation pathways may mediate the liver injury and phospholipidosis associated with a cationic amphiphilic antibiotic drug

    Energy Technology Data Exchange (ETDEWEB)

    Mosedale, Merrie [Hamner-University of North Carolina Institute for Drug Safety Sciences, The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States); Wu, Hong [Drug Safety Research and Development, Pfizer Global Research and Development, Groton, CT06340 (United States); Kurtz, C. Lisa [Hamner-University of North Carolina Institute for Drug Safety Sciences, The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States); Schmidt, Stephen P. [Drug Safety Research and Development, Pfizer Global Research and Development, Groton, CT06340 (United States); Adkins, Karissa, E-mail: Karissa.Adkins@pfizer.com [Drug Safety Research and Development, Pfizer Global Research and Development, Groton, CT06340 (United States); Harrill, Alison H. [Hamner-University of North Carolina Institute for Drug Safety Sciences, The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States); University of Arkansas for Medical Sciences, Little Rock, AR72205 (United States)

    2014-10-01

    A large number of antibiotics are known to cause drug-induced liver injury in the clinic; however, interpreting clinical risk is not straightforward owing to a lack of predictivity of the toxicity by standard preclinical species and a poor understanding of the mechanisms of toxicity. An example is PF-04287881, a novel ketolide antibiotic that caused elevations in liver function tests in Phase I clinical studies. In this study, a mouse diversity panel (MDP), comprised of 34 genetically diverse, inbred mouse strains, was utilized to model the toxicity observed with PF-04287881 treatment and investigate potential mechanisms that may mediate the liver response. Significant elevations in serum alanine aminotransferase (ALT) levels in PF-04287881-treated animals relative to vehicle-treated controls were observed in the majority (88%) of strains tested following a seven day exposure. The average fold elevation in ALT varied by genetic background and correlated with microscopic findings of hepatocellular hypertrophy, hepatocellular single cell necrosis, and Kupffer cell vacuolation (confirmed as phospholipidosis) in the liver. Global liver mRNA expression was evaluated in a subset of four strains to identify transcript and pathway differences that distinguish susceptible mice from resistant mice in the context of PF-04287881 treatment. The protein ubiquitination pathway was highly enriched among genes associated with PF-04287881-induced hepatocellular necrosis. Expression changes associated with PF-04287881-induced phospholipidosis included genes involved in drug transport, phospholipid metabolism, and lysosomal function. The findings suggest that perturbations in genes involved in protein degradation leading to accumulation of oxidized proteins may mediate the liver injury induced by this drug. - Highlights: • Identified susceptible and resistant mouse strains to liver injury induced by a CAD • Liver injury characterized by single cell necrosis, and phospholipidosis

  16. Dysregulation of protein degradation pathways may mediate the liver injury and phospholipidosis associated with a cationic amphiphilic antibiotic drug

    International Nuclear Information System (INIS)

    A large number of antibiotics are known to cause drug-induced liver injury in the clinic; however, interpreting clinical risk is not straightforward owing to a lack of predictivity of the toxicity by standard preclinical species and a poor understanding of the mechanisms of toxicity. An example is PF-04287881, a novel ketolide antibiotic that caused elevations in liver function tests in Phase I clinical studies. In this study, a mouse diversity panel (MDP), comprised of 34 genetically diverse, inbred mouse strains, was utilized to model the toxicity observed with PF-04287881 treatment and investigate potential mechanisms that may mediate the liver response. Significant elevations in serum alanine aminotransferase (ALT) levels in PF-04287881-treated animals relative to vehicle-treated controls were observed in the majority (88%) of strains tested following a seven day exposure. The average fold elevation in ALT varied by genetic background and correlated with microscopic findings of hepatocellular hypertrophy, hepatocellular single cell necrosis, and Kupffer cell vacuolation (confirmed as phospholipidosis) in the liver. Global liver mRNA expression was evaluated in a subset of four strains to identify transcript and pathway differences that distinguish susceptible mice from resistant mice in the context of PF-04287881 treatment. The protein ubiquitination pathway was highly enriched among genes associated with PF-04287881-induced hepatocellular necrosis. Expression changes associated with PF-04287881-induced phospholipidosis included genes involved in drug transport, phospholipid metabolism, and lysosomal function. The findings suggest that perturbations in genes involved in protein degradation leading to accumulation of oxidized proteins may mediate the liver injury induced by this drug. - Highlights: • Identified susceptible and resistant mouse strains to liver injury induced by a CAD • Liver injury characterized by single cell necrosis, and phospholipidosis

  17. Potential role of multiple carbon fixation pathways during lipid accumulation in Phaeodactylum tricornutum

    Directory of Open Access Journals (Sweden)

    Valenzuela Jacob

    2012-06-01

    Full Text Available Abstract Background Phaeodactylum tricornutum is a unicellular diatom in the class Bacillariophyceae. The full genome has been sequenced (P. tricornutum gene expression profiles during nutrient-deprivation and lipid-accumulation, cell cultures were grown with a nitrate to phosphate ratio of 20:1 (N:P and whole-genome transcripts were monitored over time via RNA-sequence determination. Results The specific Nile Red (NR fluorescence (NR fluorescence per cell increased over time; however, the increase in NR fluorescence was initiated before external nitrate was completely exhausted. Exogenous phosphate was depleted before nitrate, and these results indicated that the depletion of exogenous phosphate might be an early trigger for lipid accumulation that is magnified upon nitrate depletion. As expected, many of the genes associated with nitrate and phosphate utilization were up-expressed. The diatom-specific cyclins cyc7 and cyc10 were down-expressed during the nutrient-deplete state, and cyclin B1 was up-expressed during lipid-accumulation after growth cessation. While many of the genes associated with the C3 pathway for photosynthetic carbon reduction were not significantly altered, genes involved in a putative C4 pathway for photosynthetic carbon assimilation were up-expressed as the cells depleted nitrate, phosphate, and exogenous dissolved inorganic carbon (DIC levels. P. tricornutum has multiple, putative carbonic anhydrases, but only two were significantly up-expressed (2-fold and 4-fold at the last time point when exogenous DIC levels had increased after the cessation of growth. Alternative pathways that could utilize HCO3- were also suggested by the gene expression profiles (e.g., putative propionyl-CoA and methylmalonyl-CoA decarboxylases. Conclusions The results indicate that P. tricornutum continued carbon dioxide reduction when population growth was arrested and different carbon-concentrating mechanisms were used dependent upon exogenous

  18. Carbon and hydrogen isotopic composition and generation pathway of biogenic gas in China

    Institute of Scientific and Technical Information of China (English)

    SHEN Ping; WANG Xiaofeng; XU Yin; SHI Baoguang; XU Yongchang

    2009-01-01

    The carbon and hydrogen isotopic composition of biogenic gas is of great importance for the study of its generation pathway and reservoiring characteristics. In this paper, the formation pathways and reservoiring characteristics of biogenic gas reservoirs in China are described in terms of the carbon and hydrogen isotopic compositions of 31 gas samples from 10 biogenic gas reservoirs. The study shows that the hydrogen isotopic compositions of these biogenic gas reservoirs can be divided into three intervals:δDCH4>-200‰,-250‰<δDCH4<-200‰ and δDCH4<-250‰. The forerunners believed that the main generation pathway of biogenic gas under the condition of continental fresh water is acetic fermentation. Our research results showed that the generation pathway of biogenic gas under the condition of marine facies is typical CO2- reduction, the biogenic gas has heavy hydrogen isotopic composition: its δDCH4 values are higher than -200‰; that the biogenic gas under the condition of continental facies also was generated by the same way, but its hydrogen isotopic composition is lighter than that of biogenetic gas generated under typical marine facies condition: -250‰<δDCH4<-200‰, the δDCH4 values may be related to the salinity of the water medium in ancient lakes. From the relevant data of the Qaidam Basin, it can be seen that the hydrogen isotopic composition of biogenic methane has the same variation trend with increasing salinity of water medium. There are biogenic gas reservoirs formed in transitional regions under the condition of continental facies. These gas reservoirs resulted from both CO2- reduction and acetic fermentation, the formation of which may be related to the non-variant salinity of ancient water medium and the relatively high geothermal gradient, as is the case encountered in the Baoshan Basin. The biogenic gas generating in these regions has light hydrogen isotopic composition: δDCH4<-250‰, and relatively heavy carbon isotopic

  19. Carbon metabolic pathways in phototrophic bacteria and their broader evolutionary implications

    Directory of Open Access Journals (Sweden)

    Kuo-HsiangTang

    2011-08-01

    Full Text Available Photosynthesis is the biological process that converts solar energy to biomass, bio-products and biofuel. It is the only major natural solar energy storage mechanism on Earth. To satisfy the increased demand for sustainable energy sources and identify the mechanism of photosynthetic carbon assimilation, which is one of the bottlenecks in photosynthesis, it is essential to understand the process of solar energy storage and associated carbon metabolism in photosynthetic organisms. Researchers have employed physiological studies, microbiological chemistry, enzyme assays, genome sequencing, transcriptomics, and 13C-based metabolomics/fluxomics to investigate central carbon metabolism and enzymes that operate in phototrophs. In this report, we review diverse CO2 assimilation pathways, acetate assimilation, carbohydrate catabolism, the TCA cycle and some key and/or unconventional enzymes in central carbon metabolism of phototrophic microorganisms. We also discuss the reducing equivalent flow during photoautotrophic and photoheterotrophic growth, evolutionary links in the central carbon metabolic network, and correlations between photosynthetic and non-photosynthetic organisms. Considering the metabolic versatility in these fascinating and diverse photosynthetic bacteria, many essential questions in their central carbon metabolism still remain to be addressed.

  20. Simplifying the complexity of a coupled carbon turnover and pesticide degradation model

    Science.gov (United States)

    Marschmann, Gianna; Erhardt, André H.; Pagel, Holger; Kügler, Philipp; Streck, Thilo

    2016-04-01

    The mechanistic one-dimensional model PECCAD (PEsticide degradation Coupled to CArbon turnover in the Detritusphere; Pagel et al. 2014, Biogeochemistry 117, 185-204) has been developed as a tool to elucidate regulation mechanisms of pesticide degradation in soil. A feature of this model is that it integrates functional traits of microorganisms, identifiable by molecular tools, and physicochemical processes such as transport and sorption that control substrate availability. Predicting the behavior of microbially active interfaces demands a fundamental understanding of factors controlling their dynamics. Concepts from dynamical systems theory allow us to study general properties of the model such as its qualitative behavior, intrinsic timescales and dynamic stability: Using a Latin hypercube method we sampled the parameter space for physically realistic steady states of the PECCAD ODE system and set up a numerical continuation and bifurcation problem with the open-source toolbox MatCont in order to obtain a complete classification of the dynamical system's behaviour. Bifurcation analysis reveals an equilibrium state of the system entirely controlled by fungal kinetic parameters. The equilibrium is generally unstable in response to small perturbations except for a small band in parameter space where the pesticide pool is stable. Time scale separation is a phenomenon that occurs in almost every complex open physical system. Motivated by the notion of "initial-stage" and "late-stage" decomposers and the concept of r-, K- or L-selected microbial life strategies, we test the applicability of geometric singular perturbation theory to identify fast and slow time scales of PECCAD. Revealing a generic fast-slow structure would greatly simplify the analysis of complex models of organic matter turnover by reducing the number of unknowns and parameters and providing a systematic mathematical framework for studying their properties.

  1. Application of vibrational spectroscopy in the in vitro studies of carbon fiber-polylactic acid composite degradation.

    Science.gov (United States)

    Blazewicz, Marta; Gajewska, Maria Chomyszyn; Paluszkiewicz, Czeslawa

    1999-05-01

    Vibrational spectroscopy was used for assessment of new material for stomatology, for guided tissue regeneration (GTR) techniqe.Implants applied in the healing of periodontal defects using GTR technique have to meet stringent requirements concerning their chemical as well physical properties.At present the implants prepared from two layers membranes differing in porosity in their outer and inner layers are studied clinically. Composite plates prepared by us consist of three layers: polylactic acid film, carbon fibres coated with polylactic acid and carbon fabric.Vibrational spectroscopic studies of the material; polylactic acid- carbon fiber have made it possible to analyse chemical reactions occurring between the polymer and carbon surface. Analysis of the IR spectra of samples treated in Ringer solution allowed to describe the phenomena resulting from the composite degradation. It was shown that material biostability is related to the presence of carbon fibers.

  2. Analysis of preference for carbon source utilization among three strains of aromatic compounds degrading Pseudomonas.

    Science.gov (United States)

    Karishma, M; Trivedi, Vikas D; Choudhary, Alpa; Mhatre, Akanksha; Kambli, Pranita; Desai, Jinal; Phale, Prashant S

    2015-10-01

    Soil isolates Pseudomonas putida CSV86, Pseudomonas aeruginosa PP4 and Pseudomonas sp. C5pp degrade naphthalene, phthalate isomers and carbaryl, respectively. Strain CSV86 displayed a diauxic growth pattern on phenylpropanoid compounds (veratraldehyde, ferulic acid, vanillin or vanillic acid) plus glucose with a distinct second lag-phase. The glucose concentration in the medium remained constant with higher cell respiration rates on aromatics and maximum protocatechuate 3,4-dioxygenase activity in the first log-phase, which gradually decreased in the second log-phase with concomitant depletion of the glucose. In strains PP4 and C5pp, growth profile and metabolic studies suggest that glucose is utilized in the first log-phase with the repression of utilization of aromatics (phthalate or carbaryl). All three strains utilize benzoate via the catechol 'ortho' ring-cleavage pathway. On benzoate plus glucose, strain CSV86 showed preference for benzoate over glucose in contrast to strains PP4 and C5pp. Additionally, organic acids like succinate were preferred over aromatics in strains PP4 and C5pp, whereas strain CSV86 co-metabolizes them. Preferential utilization of aromatics over glucose and co-metabolism of organic acids and aromatics are found to be unique properties of P. putida CSV86 as compared with strains PP4 and C5pp and this property of strain CSV86 can be exploited for effective bioremediation. PMID:26316546

  3. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.

    Directory of Open Access Journals (Sweden)

    Hiroaki Kajiho

    Full Text Available The Rab family of small guanosine triphosphatases (GTPases plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs. Ras and Rab interactor (or Ras interaction/interference-like (RINL, which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM domain-containing (Anks protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  4. Reorganization of vegetation, hydrology and soil carbon after permafrost degradation across heterogeneous boreal landscapes

    Science.gov (United States)

    Jorgenson, M. Torre; Harden, Jennifer; Kanevskiy, Mikhail; O'Donnell, Jonathan; Wickland, Kim; Ewing, Stephanie; Manies, Kristen; Zhuang, Qianlai; Shur, Yuri; Striegl, Robert; Koch, Josh

    2013-01-01

    The diversity of ecosystems across boreal landscapes, successional changes after disturbance and complicated permafrost histories, present enormous challenges for assessing how vegetation, water and soil carbon may respond to climate change in boreal regions. To address this complexity, we used a chronosequence approach to assess changes in vegetation composition, water storage and soil organic carbon (SOC) stocks along successional gradients within four landscapes: (1) rocky uplands on ice-poor hillside colluvium, (2) silty uplands on extremely ice-rich loess, (3) gravelly–sandy lowlands on ice-poor eolian sand and (4) peaty–silty lowlands on thick ice-rich peat deposits over reworked lowland loess. In rocky uplands, after fire permafrost thawed rapidly due to low ice contents, soils became well drained and SOC stocks decreased slightly. In silty uplands, after fire permafrost persisted, soils remained saturated and SOC decreased slightly. In gravelly–sandy lowlands where permafrost persisted in drier forest soils, loss of deeper permafrost around lakes has allowed recent widespread drainage of lakes that has exposed limnic material with high SOC to aerobic decomposition. In peaty–silty lowlands, 2–4 m of thaw settlement led to fragmented drainage patterns in isolated thermokarst bogs and flooding of soils, and surface soils accumulated new bog peat. We were not able to detect SOC changes in deeper soils, however, due to high variability. Complicated soil stratigraphy revealed that permafrost has repeatedly aggraded and degraded in all landscapes during the Holocene, although in silty uplands only the upper permafrost was affected. Overall, permafrost thaw has led to the reorganization of vegetation, water storage and flow paths, and patterns of SOC accumulation. However, changes have occurred over different timescales among landscapes: over decades in rocky uplands and gravelly–sandy lowlands in response to fire and lake drainage, over decades to

  5. Tailoring the degradation kinetics of poly(ester carbonate urethane)urea thermoplastic elastomers for tissue engineering scaffolds.

    Science.gov (United States)

    Hong, Yi; Guan, Jianjun; Fujimoto, Kazuro L; Hashizume, Ryotaro; Pelinescu, Anca L; Wagner, William R

    2010-05-01

    Biodegradable elastomeric scaffolds are of increasing interest for applications in soft tissue repair and regeneration, particularly in mechanically active settings. The rate at which such a scaffold should degrade for optimal outcomes, however, is not generally known and the ability to select from similar scaffolds that vary in degradation behavior to allow such optimization is limited. Our objective was to synthesize a family of biodegradable polyurethane elastomers where partial substitution of polyester segments with polycarbonate segments in the polymer backbone would lead to slower degradation behavior. Specifically, we synthesized poly(ester carbonate)urethane ureas (PECUUs) using a blended soft segment of poly(caprolactone) (PCL) and poly(1,6-hexamethylene carbonate) (PHC), a 1,4-diisocyanatobutane hard segment and chain extension with putrescine. Soft segment PCL/PHC molar ratios of 100/0, 75/25, 50/50, 25/75, and 0/100 were investigated. Polymer tensile strengths varied from 14 to 34 MPa with breaking strains of 660-875%, initial moduli of 8-24 MPa and 100% recovery after 10% strain. Increased PHC content was associated with softer, more distensible films. Scaffolds produced by salt leaching supported smooth muscle cell adhesion and growth in vitro. PECUU in aqueous buffer in vitro and subcutaneous implants in rats of PECUU scaffolds showed degradation slower than comparable poly(ester urethane)urea and faster than poly(carbonate urethane)urea. These slower degrading thermoplastic polyurethanes provide opportunities to investigate the role of relative degradation rates for mechanically supportive scaffolds in a variety of soft tissue repair and reconstructive procedures. PMID:20188411

  6. An endogenous calcium-dependent, caspase-independent intranuclear degradation pathway in thymocyte nuclei: Antagonism by physiological concentrations of K+ ions

    International Nuclear Information System (INIS)

    Calcium ions have been implicated in apoptosis for many years, however the precise role of this ion in the cell death process remains incomplete. We have extensively examined the role of Ca2+ on nuclear degradation in vitro using highly purified nuclei isolated from non-apoptotic rat thymocytes. We show that these nuclei are devoid of CAD (caspase-activated DNase), and DNA degradation occurs independent of caspase activity. Serine proteases rather than caspase-3 appear necessary for this Ca2+-dependent DNA degradation in nuclei. We analyzed nuclei treated with various concentrations of Ca2+ in the presence of both a physiological (140 mM) and apoptotic (40 mM) concentration of KCl. Our results show that a 5-fold increase in Ca2+ is required to induce DNA degradation at the physiological KCl concentration compared to the lower, apoptotic concentration of the cation. Ca2+-induced internucleosomal DNA degradation was also accompanied by the release of histones, however the apoptotic-specific phosphorylation of histone H2B does not occur in these isolated nuclei. Interestingly, physiological concentrations of K+ inhibit both Ca2+-dependent DNA degradation and histone release suggesting that a reduction of intracellular K+ is necessary for this apoptosis-associated nuclear degradation in cells. Together, these data define an inherent caspase-independent catabolic pathway in thymocyte nuclei that is sensitive to physiological concentrations of intracellular cations

  7. Docetaxel induced-JNK2/PHD1 signaling pathway increases degradation of HIF-1α and causes cancer cell death under hypoxia

    Science.gov (United States)

    Oh, Eun-Taex; Kim, Chan Woo; Kim, Soo Jung; Lee, Jae-Seon; Hong, Soon-Sun; Park, Heon Joo

    2016-01-01

    HIF-1 (hypoxia-inducible factor-1) regulates the expression of more than 70 genes involved in angiogenesis, tumor growth, metastasis, chemoresistance, and radioresistance. Thus, there is growing interest in using HIF-1 inhibitors as anticancer drugs. Docetaxel, a Food and Drug Administration-approved anticancer drug, is reported to enhance HIF-1α degradation. Here, we investigated the molecular mechanism underlying docetaxel-induced HIF-1α degradation and cancer cell death under hypoxic conditions. Docetaxel pretreatment enhanced the polyubiquitination and proteasome-mediated degradation of HIF-1α, and increased cancer cell death under hypoxic conditions. Docetaxel also activated the prolyl hydroxylase, PHD1, in hypoxia, and pharmacological inhibition or siRNA-mediated knockdown of PHD1 prevented docetaxel-induced HIF-1α degradation and cancer cell death. Additionally, siRNA-mediated JNK2 knockdown blocked docetaxel-induced HIF-1α degradation and cancer cell death by inhibiting PHD1 activation. A luciferase reporter assay revealed that inhibition of the JNK2/PHD1 signaling pathway significantly increased the transcriptional activity of HIF-1 in docetaxel-treated cancer cells under hypoxia. Consistent with these results, docetaxel-treated JNK2-knockdown tumors grew much faster than control tumors through inhibition of docetaxel-induced PHD1 activation and degradation of HIF-1α. Our results collectively show that, under hypoxic conditions, docetaxel induces apoptotic cell death through JNK2/PHD1 signaling-mediated HIF-1α degradation. PMID:27263528

  8. Abiotic Degradation Rates for Carbon Tetrachloride and Chloroform: Progress in FY 2010

    Energy Technology Data Exchange (ETDEWEB)

    Amonette, James E.; Jeffers, Peter M.; Qafoku, Odeta; Russell, Colleen K.; Humphrys, Daniel R.; Wietsma, Thomas W.; Truex, Michael J.

    2010-12-08

    This report documents the progress made through FY 2010 on a project initiated in FY 2006 to help address uncertainties related to the rates of hydrolysis in groundwater at the Hanford Site for carbon tetrachloride (CT) and chloroform (CF). The study also explores the possible effects of contact with minerals and sediment (i.e., heterogeneous hydrolysis) on these rates. The research was initiated to decrease the uncertainties in abiotic degradation rates of CT and chloroform CF associated with temperature and possible heterogeneous effects. After 2 years of data collection, the first evidence for heterogeneous effects was identified for hydrolysis of CT, and preliminary evidence for the effects of different mineral types on CF hydrolysis rates also was reported. The CT data showed no difference among mineral types, whereas significant differences were seen in the CF results, perhaps due to the fact that CF hydrolyzes by both neutral and base-catalyzed mechanisms whereas CT follows only the neutral hydrolysis path. In this report, we review the project objectives, organization, and technical approaches taken, update the status and results of the hydrolysis-rate experiments after 4 years of experimentation (i.e., through FY 2010), and provide a brief discussion of how these results add to scientific understanding of the behavior of the CT/CF plume at the Hanford Site.

  9. Effective Degradation of Aqueous Tetracycline Using a Nano-TiO2/Carbon Electrocatalytic Membrane

    Directory of Open Access Journals (Sweden)

    Zhimeng Liu

    2016-05-01

    Full Text Available In this work, an electrocatalytic membrane was prepared to degrade aqueous tetracycline (TC using a carbon membrane coated with nano-TiO2 via a sol-gel process. SEM, XRD, EDS, and XPS were used to characterize the composition and structure of the electrocatalytic membrane. The effect of operating conditions on the removal rate of tetracycline was investigated systematically. The results show that the chemical oxygen demand (COD removal rate increased with increasing residence time while it decreased with increasing the initial concentration of tetracycline. Moreover, pH had little effect on the removal of tetracycline, and the electrocatalytic membrane could effectively remove tetracycline with initial concentration of 50 mg·L−1 (pH, 3.8–9.6. The 100% tetracycline and 87.8% COD removal rate could be achieved under the following operating conditions: tetracycline concentration of 50 mg·L−1, current density of 1 mA·cm−2, temperature of 25 °C, and residence time of 4.4 min. This study provides a new and feasible method for removing antibiotics in water with the synergistic effect of electrocatalytic oxidation and membrane separation. It is evident that there will be a broad market for the application of electrocatalytic membrane in the field of antibiotic wastewater treatment.

  10. Multivariate Analysis of Rangeland Vegetation and Soil Organic Carbon Describes Degradation, Informs Restoration and Conservation

    OpenAIRE

    Devan Allen McGranahan; Engle, David M.; Fuhlendorf, Samuel D; Miller, James R.; Diane M. Debinski

    2013-01-01

    Agricultural expansion has eliminated a high proportion of native land cover and severely degraded remaining native vegetation. Managers must determine where degradation is severe enough to merit restoration action, and what action, if any, is necessary. We report on grassland degraded by multiple factors, including grazing, soil disturbance, and exotic plant species introduced in response to agriculture management. We use a multivariate method to categorize plant communities by degradation s...

  11. Scenario analysis of China's emissions pathways in the 21st century for low carbon transition

    International Nuclear Information System (INIS)

    China's growing demand for energy - and its dependence on coal - has seen its carbon emissions increase more than 50% since 2000. Within the debate about mitigating global climate change, there is mounting pressure for emerging economies like China to take more responsibility for reducing their carbon emissions within a post-2012 international climate change policy framework. For China, this leads to fundamental questions about how feasible it is for the country to shift away from its recent carbon intensive pattern of growth. This paper presents some general results of scenarios that have been developed to investigate how China might continue to develop within a cumulative carbon emissions budget. The results show how changes in the key sectors of the Chinese economy could enable China to follow four different low carbon development pathways, each of which complies with a cumulative emissions constraint. Each scenario reflects different priorities for governmental decision making, infrastructure investments and social preferences. Having compared the key features of each scenario, the paper concludes with some implications for Chinese government policy.

  12. Scenario analysis of China's emissions pathways in the 21st century for low carbon transition

    International Nuclear Information System (INIS)

    China's growing demand for energy - and its dependence on coal - has seen its carbon emissions increase more than 50% since 2000. Within the debate about mitigating global climate change, there is mounting pressure for emerging economies like China to take more responsibility for reducing their carbon emissions within a post-2012 international climate change policy framework. For China, this leads to fundamental questions about how feasible it is for the country to shift away from its recent carbon intensive pattern of growth. This paper presents some general results of scenarios that have been developed to investigate how China might continue to develop within a cumulative carbon emissions budget. The results show how changes in the key sectors of the Chinese economy could enable China to follow four different low carbon development pathways, each of which complies with a cumulative emissions constraint. Each scenario reflects different priorities for governmental decision making, infrastructure investments and social preferences. Having compared the key features of each scenario, the paper concludes with some implications for Chinese government policy. (author)

  13. Biodegradability of HCH in agricultural soils from Guadeloupe (French West Indies): identification of the lin genes involved in the HCH degradation pathway.

    Science.gov (United States)

    Laquitaine, L; Durimel, A; de Alencastro, L F; Jean-Marius, C; Gros, O; Gaspard, S

    2016-01-01

    Banana has been a main agricultural product in the French West Indies (Guadeloupe and Martinique) since the 1960s. This crop requires the intensive use of pesticides to prevent attacks by insect pests. Chlorinated pesticides, such as hexachlorocyclohexane (HCH), chlordecone and dieldrin, were used until the beginning of the 1990s, resulting in a generalized diffuse contamination of the soil and water in the areas of banana production, hence the need to develop solutions for cleanup of the polluted sites. The aims of this work were (i) to assess lindane degradation in soil slurry microcosms treated with lindane at 10 mg/L and (ii) to detect the catabolic genes involved in the HCH degradation pathway. The soil slurry microcosm system showed a 40% lindane degradation efficiency at the end of a 30-day experiment. Lower lindane removal was also detected in the abiotic controls, probably caused by pesticide adsorption to soil particles. Indeed, the lindane concentration decreased from 6000 to 1330 ng/mL and from 800 to 340 ng/mL for the biotic and abiotic soils, respectively. Nevertheless, some of the genes involved in the HCH degradation pathway were amplified by polymerase chain reaction (PCR) from crude deoxyribonucleic acid (DNA) extracted from the Guadeloupe agricultural soil, suggesting that HCH degradation is probably mediated by bacteria closely related to the family Sphingomonadaceae. PMID:26686518

  14. Secondary brown carbon formation via the dicarbonyl imine pathway: nitrogen heterocycle formation and synergistic effects.

    Science.gov (United States)

    Kampf, C J; Filippi, A; Zuth, C; Hoffmann, T; Opatz, T

    2016-07-21

    Dicarbonyls are known to be important precursors of so-called atmospheric brown carbon, significantly affecting aerosol optical properties and radiative forcing. In this systematic study we report the formation of light-absorbing nitrogen containing compounds from simple 1,2-, 1,3-, 1,4-, and 1,5-dicarbonyl + amine reactions. A combination of spectrophotometric and mass spectrometric techniques was used to characterize reaction products in solutions mimicking atmospheric particulates. Experiments with individual dicarbonyls and dicarbonyl mixtures in ammonium sulfate and glycine solutions demonstrate that nitrogen heterocycles are common structural motifs of brown carbon chromophores formed in such reaction systems. 1,4- and 1,5-dicarbonyl reaction systems, which were used as surrogates for terpene ozonolysis products, showed rapid formation of light-absorbing material and products with absorbance maxima at ∼450 nm. Synergistic effects on absorbance properties were observed in mixed (di-)carbonyl experiments, as indicated by the formation of a strong absorber in ammonium sulfate solutions containing acetaldehyde and acetylacetone. This cross-reaction oligomer shows an absorbance maximum at 385 nm, relevant for the actinic flux region of the atmosphere. This study demonstrates the complexity of secondary brown carbon formation via the imine pathway and highlights that cross-reactions with synergistic effects have to be considered an important pathway for atmospheric BrC formation. PMID:27334793

  15. Genetic associations of type 2 diabetes with islet amyloid polypeptide processing and degrading pathways in asian populations.

    Directory of Open Access Journals (Sweden)

    Vincent Kwok Lim Lam

    Full Text Available Type 2 diabetes (T2D is a complex disease characterized by beta cell dysfunctions. Islet amyloid polypeptide (IAPP is highly conserved and co-secreted with insulin with over 40% of autopsy cases of T2D showing islet amyloid formation due to IAPP aggregation. Dysregulation in IAPP processing, stabilization and degradation can cause excessive oligomerization with beta cell toxicity. Previous studies examining genetic associations of pathways implicated in IAPP metabolism have yielded conflicting results due to small sample size, insufficient interrogation of gene structure and gene-gene interactions. In this multi-staged study, we screened 89 tag single nucleotide polymorphisms (SNPs in 6 candidate genes implicated in IAPP metabolism and tested for independent and joint associations with T2D and beta cell dysfunctions. Positive signals in the stage-1 were confirmed by de novo and in silico analysis in a multi-centre unrelated case-control cohort. We examined the association of significant SNPs with quantitative traits in a subset of controls and performed bioinformatics and relevant functional analyses. Amongst the tag SNPs, rs1583645 in carboxypeptidase E (CPE and rs6583813 in insulin degrading enzyme (IDE were associated with 1.09 to 1.28 fold increased risk of T2D (P Meta = 9.4×10(-3 and 0.02 respectively in a meta-analysis of East Asians. Using genetic risk scores (GRS with each risk variant scoring 1, subjects with GRS≥3 (8.2% of the cohort had 56% higher risk of T2D than those with GRS = 0 (P = 0.01. In a subcohort of control subjects, plasma IAPP increased and beta cell function index declined with GRS (P = 0.008 and 0.03 respectively. Bioinformatics and functional analyses of CPE rs1583645 predicted regulatory elements for chromatin modification and transcription factors, suggesting differential DNA-protein interactions and gene expression. Taken together, these results support the importance of dysregulation of IAPP

  16. Small heat shock proteins target mutant cystic fibrosis transmembrane conductance regulator for degradation via a small ubiquitin-like modifier-dependent pathway.

    Science.gov (United States)

    Ahner, Annette; Gong, Xiaoyan; Schmidt, Bela Z; Peters, Kathryn W; Rabeh, Wael M; Thibodeau, Patrick H; Lukacs, Gergely L; Frizzell, Raymond A

    2013-01-01

    Small heat shock proteins (sHsps) bind destabilized proteins during cell stress and disease, but their physiological functions are less clear. We evaluated the impact of Hsp27, an sHsp expressed in airway epithelial cells, on the common protein misfolding mutant that is responsible for most cystic fibrosis. F508del cystic fibrosis transmembrane conductance regulator (CFTR), a well-studied protein that is subject to cytosolic quality control, selectively associated with Hsp27, whose overexpression preferentially targeted mutant CFTR to proteasomal degradation. Hsp27 interacted physically with Ubc9, the small ubiquitin-like modifier (SUMO) E2 conjugating enzyme, implying that F508del SUMOylation leads to its sHsp-mediated degradation. Enhancing or disabling the SUMO pathway increased or blocked Hsp27's ability to degrade mutant CFTR. Hsp27 promoted selective SUMOylation of F508del NBD1 in vitro and of full-length F508del CFTR in vivo, which preferred endogenous SUMO-2/3 paralogues that form poly-chains. The SUMO-targeted ubiquitin ligase (STUbL) RNF4 recognizes poly-SUMO chains to facilitate nuclear protein degradation. RNF4 overexpression elicited F508del degradation, whereas Hsp27 knockdown blocked RNF4's impact on mutant CFTR. Similarly, the ability of Hsp27 to degrade F508del CFTR was lost during overexpression of dominant-negative RNF4. These findings link sHsp-mediated F508del CFTR degradation to its SUMOylation and to STUbL-mediated targeting to the ubiquitin-proteasome system and thereby implicate this pathway in the disposal of an integral membrane protein. PMID:23155000

  17. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    Science.gov (United States)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

  18. Avoiding, transforming, transitioning: pathways to sustainable low carbon passenger transport in developing countries

    DEFF Research Database (Denmark)

    Meza, Maria Josefina Figueroa; Fulton, Lewis; Tiwari, Geetam;

    2013-01-01

    emerges where non-OECD passenger travel increases of up to 200% can be accommodated via strong investments in transit and non-motorized modes and a recasting of informal transport services into self-organized systems, with lower levels of car ownership and avoidance of carbon emissions. Reductions in......This review examines conditions affecting road passenger transport in developing countries that can be instrumental to building a pathway for reducing carbon emissions while concurrently meeting sustainable development goals. By contrasting present and future status of these conditions a vision...... motorized travel are also necessary from OECD countries; the focus there is given to what level of pricing and regulatory interventions could change behavior. The articulation of detailed visions can help clarify and prioritize areas where policy efforts can have great impact. Strong actions are necessary...

  19. An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

    Science.gov (United States)

    Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

    2012-01-01

    Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

  20. Reorganization of vegetation, hydrology and soil carbon after permafrost degradation across heterogeneous boreal landscapes

    International Nuclear Information System (INIS)

    The diversity of ecosystems across boreal landscapes, successional changes after disturbance and complicated permafrost histories, present enormous challenges for assessing how vegetation, water and soil carbon may respond to climate change in boreal regions. To address this complexity, we used a chronosequence approach to assess changes in vegetation composition, water storage and soil organic carbon (SOC) stocks along successional gradients within four landscapes: (1) rocky uplands on ice-poor hillside colluvium, (2) silty uplands on extremely ice-rich loess, (3) gravelly–sandy lowlands on ice-poor eolian sand and (4) peaty–silty lowlands on thick ice-rich peat deposits over reworked lowland loess. In rocky uplands, after fire permafrost thawed rapidly due to low ice contents, soils became well drained and SOC stocks decreased slightly. In silty uplands, after fire permafrost persisted, soils remained saturated and SOC decreased slightly. In gravelly–sandy lowlands where permafrost persisted in drier forest soils, loss of deeper permafrost around lakes has allowed recent widespread drainage of lakes that has exposed limnic material with high SOC to aerobic decomposition. In peaty–silty lowlands, 2–4 m of thaw settlement led to fragmented drainage patterns in isolated thermokarst bogs and flooding of soils, and surface soils accumulated new bog peat. We were not able to detect SOC changes in deeper soils, however, due to high variability. Complicated soil stratigraphy revealed that permafrost has repeatedly aggraded and degraded in all landscapes during the Holocene, although in silty uplands only the upper permafrost was affected. Overall, permafrost thaw has led to the reorganization of vegetation, water storage and flow paths, and patterns of SOC accumulation. However, changes have occurred over different timescales among landscapes: over decades in rocky uplands and gravelly–sandy lowlands in response to fire and lake drainage, over decades to

  1. Electrochemical detection and degradation of ibuprofen from water on multi-walled carbon nanotubes-epoxy composite electrode

    Institute of Scientific and Technical Information of China (English)

    Sorina Motoc; Adriana Remes; Aniela Pop; Florica Manea; Joop Schoonman

    2013-01-01

    This work describes the electrochemical behaviour of ibuprofen on two types of multi-walled carbon nanotubes based composite electrodes,i.e.,multi-walled carbon nanotubes-epoxy (MWCNT) and silver-modified zeolite-multi-walled carbon nanotubes-epoxy (AgZMWCNT) composites electrodes.The composite electrodes were obtained using two-roll mill procedure.SEM images of surfaces of the composites revealed a homogeneous distribution of the composite components within the epoxy matrix.AgZMWCNT composite electrode exhibited the better electrical conductivity and larger electroactive surface area.The electrochemical determination of ibuprofen (IBP) was achieved using AgZMWCNT by cyclic voltammetry,differential-pulsed voltammetry,square-wave voltammetry and chronoamperometry.The IBP degradation occurred on both composite electrodes under controlled electrolysis at 1.2 and 1.75 V vs.Ag/AgCl,and IBP concentration was determined comparatively by differential-pulsed voltammetry,under optimized conditions using AgZMWCNT electrode and UV-Vis spectrophotometry methods to determine the IBP degradation performance for each electrode.AgZMWCNT electrode exhibited a dual character allowing a double application in IBP degradation process and its control.

  2. Kinetic analysis of acid orange 7 degradation by pulsed discharge plasma combined with activated carbon and the synergistic mechanism exploration.

    Science.gov (United States)

    Guo, He; Wang, Huijuan; Wu, Qiangshun; Zhou, Guangshun; Yi, Chengwu

    2016-09-01

    The synergistic technique of pulsed discharge plasma (PDP) and activated carbon (AC) was built to investigate the kinetics of acid orange 7 (AO7) degradation under different conditions of AC addition, electrode gap, initial pH value of solution, gas variety and gas flow rate. Emission spectra of OH and O, UV-vis absorption spectra of the AO7 solution and TOC removal were measured to illustrate the synergistic mechanism of the PDP and the AC. The obtained results indicated that the kinetic constant of AO7 degradation increased from 0.00947 min(-1) to 0.01419 min(-1) when 4 g AC was added into the PDP system; AO7 degradation was higher in the case of alkaline solution when oxygen was used as the flow gas in the PDP/AC system, 2 L/min oxygen flow was more favorable for the degradation. Results of the relative emission intensities of OH and O indicated the catalytic effect of the AC on the active species formation as well as the important role of the two radicals for the AO7 degradation. There was no new peaks appeared by the UV-vis analysis of the AO7 solution after 60 min treatment. The highest TOC removal in the PDP/AC system was 30.3%, which was achieved under the condition of 4 L/min air flow rate and 3 initial pH value. PMID:27295438

  3. Kenya's Climate Change Action Plan. Low Carbon Climate Resilient Development Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, D.; Sawyer, D.; Stiebert, S.; McFatridge, S. [International Institute for Sustainable Development IISD, Winnipeg, Manitoba (Canada); Wuertenberger, L.; Van Tilburg, X.; Hekkenberg, M. [Energy research Centre of the Netherlands ECN, Policy Studies, Amsterdam (Netherlands); Owino, T.; Battye, W. [ClimateCare, Nairobi (Kenya); Mutia, T. [Regional Institute for Social Enterprise Kenya RISE, Nairobi (Kenya); Olum, P. [Climate Change Consultant (Kenya)

    2012-12-15

    Kenya Vision 2030 - the long-term development blueprint for the country - aims to transform Kenya into 'a newly industrialising, middle-income country providing a high quality of life to all its citizens in a clean and secure environment'. A low carbon climate resilient development pathway, as set out in this Climate Change Action Plan, can help meet Vision 2030 goals through actions that address both sustainable development and climate change. This pathway can also help the Government achieve the Millennium Development Goals and other internationally agreed development goals without compromising the environment and its natural resources. As Kenya realizes its development aspirations, there will be gains and risks. A growing population and economy with migration to cities will mean increases in greenhouse gas (GHG) emissions. Resulting environmental and social conditions, including increased competition over resources, could intensify vulnerability to climate risks. Transitioning to a low carbon climate resilient development pathway can address future risks thereby improving Kenya's ability to prosper under a changing climate while reducing the emissions intensity of a growing economy. Moving forward on the 2010 National Climate Change Response Strategy will help Kenya transition to a low carbon climate resilient development pathway that puts people and livelihoods at the forefront. The strategy recognized the importance of climate change and development, and this Climate Change Action Plan is the logical next step. A yearlong multistakeholder participatory process involving the public sector, private sector and civil society resulted in this Action Plan that identifies priority climate change actions for Kenya for the short, medium and long term. The Government of Kenya takes climate change and its impact on development seriously. Climate change is considered a crosscutting issue that will be mainstreamed in the planning process both at the national

  4. Cloning and expression of meta-cleavage enzyme (CarB of carbazole degradation pathway from Pseudomonas stutzeri

    Directory of Open Access Journals (Sweden)

    Ariane Leites Larentis

    2005-06-01

    Full Text Available In this work, the 1082bp PCR product corresponding to carBaBb genes that encode the heterotetrameric enzyme 2'-aminobiphenyl-2,3-diol 1,2-dioxygenase (CarB, involved in the Pseudomonas stutzeri ATCC 31258 carbazole degradation pathway, was cloned using the site-specific recombination system. Recombinant clones were confirmed by PCR, restriction enzyme digestion and sequencing. CarB dioxygenase was expressed in high levels and in active form in Escherichia coli BL21-SI using the His-tagged expression vector pDEST TM17 and salt induction for 4h.Carbazol e seus derivados são compostos nitrogenados aromáticos, presentes comumente em petróleo e potencialmente poluentes. A rota de biodegradação de carbazol a ácido antranílico em Pseudomonas sp. é composta por três enzimas responsáveis, respectivamente, pelas reações de dioxigenação angular, meta-clivagem e hidrólise. A segunda enzima da rota, 2'-aminobifenil-2,3-diol 1,2-dioxigenase (CarB, codificada por dois genes (carBa e carBb, é um heterotetrâmero com atividade catalítica na quebra do anel catecol do susbtrato na posição meta. Neste trabalho, foi clonado o produto de PCR de 1082pb correspondente aos genes carBaBb da bactéria degradadora de carbazol Pseudomonas stutzeri ATCC 31258. A estratégia de clonagem empregada foi a de recombinação sítio-específica e a construção dos plasmídeos foi confirmada por PCR, digestão com enzima de restrição e seqüenciamento. A enzima ativa foi expressa em altas concentrações em vetor pDEST TM17 com cauda de histidina e promotor T7 em Escherichia coli BL21-SI com indução por NaCl durante 4h.

  5. New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces

    Energy Technology Data Exchange (ETDEWEB)

    Pfeifer, Peter [University of Missouri; Wexler, Carlos [University of Missouri; Hawthorne, M. Frederick [University of Missouri; Lee, Mark W. [University of Missouri; Jalistegi, Satish S. [University of Missouri

    2014-08-14

    This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have

  6. Towards early detection of the hydrolytic degradation of poly(bisphenol A)carbonate by hyphenated liquid chromatography and comprehensive two-dimensional liquid chromatography

    NARCIS (Netherlands)

    Coulier, L.; Kaal, E.R.; Hankemeier, Th.

    2006-01-01

    The hydrolytic degradation of poly(bisphenol A)carbonate (PC) has been characterized by various liquid chromatography techniques. Size exclusion chromatography (SEC) showed a significant decrease in molecular mass as a result of hydrolytic degradation, while 'liquid chromatography at critical condit

  7. The Homogentisate Pathway: a Central Catabolic Pathway Involved in the Degradation of l-Phenylalanine, l-Tyrosine, and 3-Hydroxyphenylacetate in Pseudomonas putida

    OpenAIRE

    Arias-Barrau, Elsa; Olivera, Elías R.; Luengo, José M.; Fernández, Cristina; Galán, Beatriz; García, José L.; Díaz, Eduardo; Miñambres, Baltasar

    2004-01-01

    Pseudomonas putida metabolizes Phe and Tyr through a peripheral pathway involving hydroxylation of Phe to Tyr (PhhAB), conversion of Tyr into 4-hydroxyphenylpyruvate (TyrB), and formation of homogentisate (Hpd) as the central intermediate. Homogentisate is then catabolized by a central catabolic pathway that involves three enzymes, homogentisate dioxygenase (HmgA), fumarylacetoacetate hydrolase (HmgB), and maleylacetoacetate isomerase (HmgC), finally yielding fumarate and acetoacetate. Wherea...

  8. 13C-metabolic flux ratio and novel carbon path analyses confirmed that Trichoderma reesei uses primarily the respirative pathway also on the preferred carbon source glucose

    Directory of Open Access Journals (Sweden)

    Saloheimo Markku

    2009-10-01

    Full Text Available Abstract Background The filamentous fungus Trichoderma reesei is an important host organism for industrial enzyme production. It is adapted to nutrient poor environments where it is capable of producing large amounts of hydrolytic enzymes. In its natural environment T. reesei is expected to benefit from high energy yield from utilization of respirative metabolic pathway. However, T. reesei lacks metabolic pathway reconstructions and the utilization of the respirative pathway has not been investigated on the level of in vivo fluxes. Results The biosynthetic pathways of amino acids in T. reesei supported by genome-level evidence were reconstructed with computational carbon path analysis. The pathway reconstructions were a prerequisite for analysis of in vivo fluxes. The distribution of in vivo fluxes in both wild type strain and cre1, a key regulator of carbon catabolite repression, deletion strain were quantitatively studied by performing 13C-labeling on both repressive carbon source glucose and non-repressive carbon source sorbitol. In addition, the 13C-labeling on sorbitol was performed both in the presence and absence of sophorose that induces the expression of cellulase genes. Carbon path analyses and the 13C-labeling patterns of proteinogenic amino acids indicated high similarity between biosynthetic pathways of amino acids in T. reesei and yeast Saccharomyces cerevisiae. In contrast to S. cerevisiae, however, mitochondrial rather than cytosolic biosynthesis of Asp was observed under all studied conditions. The relative anaplerotic flux to the TCA cycle was low and thus characteristic to respiratory metabolism in both strains and independent of the carbon source. Only minor differences were observed in the flux distributions of the wild type and cre1 deletion strain. Furthermore, the induction of the hydrolytic gene expression did not show altered flux distributions and did not affect the relative amino acid requirements or relative anabolic

  9. Preparation of ultrafine magnetic biochar and activated carbon for pharmaceutical adsorption and subsequent degradation by ball milling.

    Science.gov (United States)

    Shan, Danna; Deng, Shubo; Zhao, Tianning; Wang, Bin; Wang, Yujue; Huang, Jun; Yu, Gang; Winglee, Judy; Wiesner, Mark R

    2016-03-15

    Ball milling was used to prepare two ultrafine magnetic biochar/Fe3O4 and activated carbon (AC)/Fe3O4 hybrid materials targeted for use in pharmaceutical removal by adsorption and mechanochemical degradation of pharmaceutical compounds. Both hybrid adsorbents prepared after 2h milling exhibited high removal of carbamazepine (CBZ), and were easily separated magnetically. These adsorbents exhibited fast adsorption of CBZ and tetracycline (TC) in the initial 1h. The biochar/Fe3O4 had a maximum adsorption capacity of 62.7mg/g for CBZ and 94.2mg/g for TC, while values obtained for AC/Fe3O4 were 135.1mg/g for CBZ and 45.3mg/g for TC respectively when data were fitted using the Langmuir expression. Solution pH values slightly affected the sorption of TC on the adsorbents, while CBZ sorption was almost pH-independent. The spent adsorbents with adsorbed CBZ and TC were milled to degrade the adsorbed pollutants. The adsorbed TC itself was over 97% degraded after 3h of milling, while about half of adsorbed CBZ were remained. The addition of quartz sand was found to improve the mechanochemical degradation of CBZ on biochar/Fe3O4, and its degradation percent was up to 98.4% at the dose of 0.3g quarts sand/g adsorbent. This research provided an easy method to prepare ultrafine magnetic adsorbents for the effective removal of typical pharmaceuticals from water or wastewater and degrade them using ball milling. PMID:26685062

  10. Simvastatin and atorvastatin facilitates amyloid β-protein degradation in extracellular spaces by increasing neprilysin secretion from astrocytes through activation of MAPK/Erk1/2 pathways.

    Science.gov (United States)

    Yamamoto, Naoki; Fujii, Yoko; Kasahara, Rika; Tanida, Mamoru; Ohora, Kentaro; Ono, Yoko; Suzuki, Kenji; Sobue, Kazuya

    2016-06-01

    One of the major neuropathological hallmarks of Alzheimer's disease (AD) is the deposition of amyloid β-protein (Aβ) in the brain. Aβ accumulation seems to arise from an imbalance between Aβ production and clearance. Neprilysin (NEP) and insulin-degrading enzyme (IDE) are the important Aβ-degrading enzymes in the brain, and deficits in their expression may promote Aβ deposition in patients with sporadic late-onset AD. Statins, which are used clinically for reducing cholesterol levels, can exert beneficial effects on AD. Therefore, we examined whether various statins are associated with Aβ degradation by inducing NEP and IDE expression, and then evaluating the relation between activation of intracellular signaling transduction, inhibition of cholesterol production, and morphological changes to astrocytes. Treating cultured rat astrocytes with simvastatin and atorvastatin significantly decreased the expression of NEP but not IDE in a concentration- and time-dependent manner. The decrease in NEP expression was a result of activation of extracellular signal-regulated kinase (ERK) but not the reduction of cholesterol synthesis pathway. This NEP reduction was achieved by the release to the extracellular space of cultured astrocytes. Furthermore, the cultured medium prepared from simvastatin- and atorvastatin-treated astrocytes significantly induced the degradation of exogenous Aβ. These results suggest that simvastatin and atorvastatin induce the increase of Aβ degradation of NEP on the extracellular of astrocytes by inducing ERK-mediated pathway activity and that these reagents regulate the differential mechanisms between the secretion of NEP, the induction of cholesterol reduction, and the morphological changes in the cultured astrocytes. GLIA 2016;64:952-962. PMID:26875818

  11. Evaluation of water matrix effects, experimental parameters, and the degradation pathway during the TiO2 photocatalytical treatment of the antibiotic dicloxacillin.

    Science.gov (United States)

    Villegas-Guzman, Paola; Silva-Agredo, Javier; González-Gómez, Duván; Giraldo-Aguirre, Ana L; Flórez-Acosta, Oscar; Torres-Palma, Ricardo A

    2015-01-01

    The photocalytic degradation of dicloxacillin (DXC) using TiO2 was studied in synthetic and natural waters. The degradation route and the effect of different experimental variables such as pH, applied power, and the initial concentrations of DXC and the catalyst were investigated. The best performances were achieved at a natural pH 5.8 and using 2.0 g L(-1) of TiO2 with 150 W of applied power. The photodegradation process followed Langmuir-Hinshelwood kinetics. The water matrix effect was evaluated in terms of degradation efficiency in the presence of organic compounds (oxalic acid, glucose), Fe(2+) ion and natural water. An increase in degradation was observed when ferrous ion was part of the solution, but the process was inhibited with all evaluated organic compounds. Similarly, inhibition was observed when natural water was used instead of distilled water. The extent of degradation of the process was evaluated following the evolution of chemical oxygen demand (COD), antimicrobial activity (AA), total organic carbon (TOC) and biochemical oxygen demand (BOD5). Total removal of DXC was achieved after 120 min of treatment and 95% mineralization was observed after 480 min of treatment. Additionally, the total removal of antimicrobial activity and a high level of biodegradability were observed after the photocalytical system had been operating for 240 min. PMID:25438130

  12. Influence of soil frost on the character and degradability of dissolved organic carbon in boreal forest soils

    Science.gov (United States)

    Panneer Selvam, B.; Laudon, H.; Guillemette, F.; Berggren, M.

    2016-03-01

    Recent studies suggest that increases in extent and duration of winter soil frost increases dissolved organic carbon (DOC) concentrations in boreal riparian soils and connected aquatic systems during the subsequent spring and summer. However, little is known about the impact of frost on DOC character and its degradability. We applied three experimental treatments to riparian soils in northern Sweden—shallow soil frost (insulated), deep soil frost (snow removed) and control plots—to test the effect of different soil frost regimes on the chemical characteristics and degradability of soil DOC. Soil pore water samples were analyzed using excitation-emission fluorescence (parallel factor analysis) combined with biological and photochemical degradation experiments. We found that the absolute bacterial metabolic rates were significantly lower in samples from the shallow soil frost treatments, compared with the other treatments. Explorative multivariate analyses indicate that increasing soil frost is contributing to increased protein-like fluorescence and to increased biological degradability of the DOC. Our study shows that decreases in riparian soil frost due to climate warming may not only contribute to decreased riparian DOC concentrations but also lead to shifts in the DOC composition, resulting in decreased biodegradability (yet similar photodegradability) of the DOC that is exported from riparian soils to streams.

  13. Modeling microbially induced carbon degradation in redox-stratified subsurface environments: concepts and open questions

    OpenAIRE

    Thullner, M.; Regnier, P.

    2007-01-01

    The degradation of organic matter, including organic contaminants, in subsurface environments is controlled by the abundances and functional capabilities of the resident microorganisms. As a consequence, modeling approaches simulating the fate of organics and related changes in redox conditions have to account for the effects of microbial activity on the degradation kinetics, as well as for the spatial and temporal distributions of the chemical species (e.g., terminal electron acceptors, nutr...

  14. Photosynthetic carbon fixation pathways in Zostera marina and three Florida seagrasses

    Energy Technology Data Exchange (ETDEWEB)

    Beer, S.; Wetzel, R.G.

    1982-06-01

    The photosynthetic carbon fixation pathways of four seagrass species, Zostera marina L. from Alaska and Thalassia testudinum Banks ex Konig, Syringodium filiforme Kutz. and Halodule wrightii Aschers. from the Gulf of Mexico, were investigated with a /sup 14/C pulse-chase technique. All species were found to be principally of the C/sub 3/ type. However, Thalassia and Halodule had higher initial incorporation rates into organic acids than is typical for terrestrial C/sub 3/ plants. Of 11 seagrass species investigated thus far for C/sub 3/ or C/sub 4/ metabolism using this technique, 10 were found to be principally of the C/sub 3/ type while only one exhibited C/sub 4/ metabolism.

  15. Heterogeneous photo-Fenton degradation of acid red B over Fe2O3 supported on activated carbon fiber

    International Nuclear Information System (INIS)

    Highlights: • Fe2O3 with small particle size was highly dispersed on activated carbon fiber. • Fe2O3/ACF exhibited higher photo-Fenton activity toward ARB degradation. • Fe2O3/ACF has an excellent long-term stability without obvious deactivation. - Abstract: Fe2O3 supported on activated carbon fiber (Fe2O3/ACF) was prepared via an impregnation method and characterized by X-ray diffraction, scanning electron microscopy and BET analysis. The results indicated that Fe2O3 with small particle size was highly dispersed on the surface of the ACF and the introduction of Fe2O3 did not change the ACF pore structure. Fe2O3/ACF exhibited a higher Fenton efficiency for the degradation of acid red B (ARB), especially under simulated solar irradiation. Complete decoloration of the ARB solution and 43% removal of TOC could be achieved within 200 min under optimal conditions. It was verified that more ·OH radicals were generated in the photo-assisted Fenton process and involved as active species in ARB degradation. FTIR analysis indicated that the degradation of ARB was initiated through the cleavage of −N=N−, followed by hydroxylation and opening of phenyl rings to form aliphatic acids, and further oxidation of aliphatic acids would produce CO2 and H2O. Moreover, Fe2O3/ACF maintained its activity after being reused 4 times and the release of iron from the catalyst was found to be insignificant during the Fenton and photo-Fenton processes, indicating that Fe2O3/ACF had good long-term stability

  16. Detection of potential leakage pathways from geological carbon storage by fluid pressure data assimilation

    Science.gov (United States)

    González-Nicolás, Ana; Baù, Domenico; Alzraiee, Ayman

    2015-12-01

    One of the main concerns of geological carbon storage (GCS) systems is the risk of leakage through "weak" permeable areas of the sealing formation or caprock. Since the fluid pressure pulse travels faster than the carbon dioxide (CO2) plume across the storage reservoir, the fluid overpressure transmitted into overlying permeable formations through caprock discontinuities is potentially detectable sooner than actual CO2 leakage occurs. In this work, an inverse modeling method based on fluid pressure measurements collected in strata above the target CO2 storage formation is proposed, which aims at identifying the presence, the location, and the extent of possible leakage pathways through the caprock. We combine a three-dimensional subsurface multiphase flow model with ensemble-based data assimilation algorithms to recognize potential caprock discontinuities that could undermine the long-term safety of GCS. The goal of this work is to examine and compare the capabilities of data assimilation algorithms such as the ensemble smoother (ES) and the restart ensemble Kalman filter (REnKF) to detect the presence of brine and/or CO2 leakage pathways, potentially in real-time during GCS operations. For the purpose of this study, changes in fluid pressure in the brine aquifer overlying to CO2 storage formation aquifer are hypothetically observed in monitoring boreholes, or provided by time-lapse seismic surveys. Caprock discontinuities are typically characterized locally by higher values of permeability, so that the permeability distribution tends to fit to a non-Gaussian bimodal process, which hardly complies with the requirements of the ES and REnKF algorithms. Here, issues related to the non-Gaussianity of the caprock permeability field are investigated by developing and applying a normal score transform procedure. Results suggest that the REnKF is more effective than the ES in characterizing caprock discontinuities.

  17. Degradation of triclocarban by a triclosan-degrading Sphingomonas sp. strain YL-JM2C.

    Science.gov (United States)

    Mulla, Sikandar I; Hu, Anyi; Wang, Yuwen; Sun, Qian; Huang, Shir-Ly; Wang, Han; Yu, Chang-Ping

    2016-02-01

    Bacterial degradation plays a vital role in determining the environmental fate of micropollutants like triclocarban. The mechanism of triclocarban degradation by pure bacterium is not yet explored. The purpose of this study was to identify metabolic pathway that might be involved in bacterial degradation of triclocarban. Triclosan-degrading Sphingomonas sp. strain YL-JM2C was first found to degrade up to 35% of triclocarban (4 mg L(-1)) within 5 d. Gas chromatography-mass spectrometry detected 3,4-dichloroaniline, 4-chloroaniline and 4-chlorocatechol as the major metabolites of the triclocarban degradation. Furthermore, total organic carbon results confirmed that the intermediates, 3,4-dichloroaniline (4 mg L(-1)) and 4-chloroaniline (4 mg L(-1)) could be degraded up to 77% and 80% by strain YL-JM2C within 5 d. PMID:26364219

  18. Isolation and characterization of two novel thermophilic anaerobic bacteria from syngas - and carbon monoxide - degrading cultures

    OpenAIRE

    Alves, J.I.; Alves, M.M.; Stams, A. J. M.; Plugge, C.M.; Sousa, D. Z.

    2012-01-01

    Syn(thesis)gas is a mixture containing hydrogen, carbon monoxide and carbon dioxide, in variable ratios. Syngas is commonly produced from fossil fuels, but it can be generated from a vast array of feedstocks such as lignocellulosic biomass and carbon-based wastes, including recalcitrant wastes. Production of biofuels and bulk chemicals from syngas, both by thermochemical or microbial processes, is a field of promising technological developments. In this work, thermophilic (55ºC...

  19. PEGylated single-walled carbon nanotubes activate neutrophils to increase production of hypochlorous acid, the oxidant capable of degrading nanotubes

    International Nuclear Information System (INIS)

    Perspectives for the use of carbon nanotubes in biomedical applications depend largely on their ability to degrade in the body into products that can be easily cleared out. Carboxylated single-walled carbon nanotubes (c-SWCNTs) were shown to be degraded by oxidants generated by peroxidases in the presence of hydrogen peroxide. In the present study we demonstrated that conjugation of poly(ethylene glycol) (PEG) to c-SWCNTs does not interfere with their degradation by peroxidase/H2O2 system or by hypochlorite. Comparison of different heme-containing proteins for their ability to degrade PEG-SWCNTs has led us to conclude that the myeloperoxidase (MPO) product hypochlorous acid (HOCl) is the major oxidant that may be responsible for biodegradation of PEG-SWCNTs in vivo. MPO is secreted mainly by neutrophils upon activation. We hypothesize that SWCNTs may enhance neutrophil activation and therefore stimulate their own biodegradation due to MPO-generated HOCl. PEG-SWCNTs at concentrations similar to those commonly used in in vivo studies were found to activate isolated human neutrophils to produce HOCl. Both PEG-SWCNTs and c-SWCNTs enhanced HOCl generation from isolated neutrophils upon serum-opsonized zymosan stimulation. Both types of nanotubes were also found to activate neutrophils in whole blood samples. Intraperitoneal injection of a low dose of PEG-SWCNTs into mice induced an increase in percentage of circulating neutrophils and activation of neutrophils and macrophages in the peritoneal cavity, suggesting the evolution of an inflammatory response. Activated neutrophils can produce high local concentrations of HOCl, thereby creating the conditions favorable for degradation of the nanotubes. -- Highlights: ► Myeloperoxidase (MPO) product hypochlorous acid is able to degrade CNTs. ► PEGylated SWCNTs stimulate isolated neutrophils to produce hypochlorous acid. ► SWCNTs are capable of activating neutrophils in blood samples. ► Activation of neutrophils in

  20. The Effect of Mesoporous Carbon Nitride Modification by Titanium Oxide Nanoparticles on Photocatalytic Degradation of 1,3-Dinitrobenzene

    Directory of Open Access Journals (Sweden)

    Seyyed Ershad Moradi

    2015-11-01

    Full Text Available In the present work, well ordered, mesoporous carbon nitride (MCN sorbent with uniform mesoporous wall, high surface area and pore volume has been fabricated using the simple polymerization reaction between ethylene diamine and carbon tetrachloride in mesoporous silica media, and then modified by TiO2 nanoparticles (Ti-MCN. The structural order and textural properties of the nanoporous materials were studied by XRD, elemental analysis, and nitrogen adsorption–desorption experiments. Photodegradation experiments for 1,3-dinitrobenzene were conducted in batch mode, the Ti-MCN catalysts were found to be more active compared to the free TiO2 nanoparticles for 1,3-dinitrobenzene degradation.

  1. Demonstration of Carbon Catabolite Repression in Naphthalene Degrading Soil Bacteria via Raman Spectroscopy Based Stable Isotope Probing.

    Science.gov (United States)

    Kumar B N, Vinay; Guo, Shuxia; Bocklitz, Thomas; Rösch, Petra; Popp, Jürgen

    2016-08-01

    Carbon catabolite repression (CCR) is a regulatory phenomenon occurring in both lower organisms like bacteria and higher organisms like yeast, which allows them to preferentially utilize a specific carbon source to achieve highest metabolic activity and cell growth. CCR has been intensely studied in the model organisms Escherichia coli and Bacillus subtilis by following diauxic growth curves, assays to estimate the utilization or depletion of carbon sources, enzyme assays, Western blotting and mass spectrometric analysis to monitor and quantify the involvement of specific enzymes and proteins involved in CCR. In this study, we have visualized this process in three species of naphthalene degrading soil bacteria at a single cell level via Raman spectroscopy based stable isotope probing (Raman-SIP) using a single and double labeling approach. This is achieved using a combination of (2)H and (13)C isotope labeled carbon sources like glucose, galactose, fructose, and naphthalene. Time dependent metabolic flux of (13)C and (2)H isotopes has been followed via semi quantification and 2D Raman correlation analysis. For this, the relative intensities of Raman marker bands corresponding to (2)H and (13)C incorporation in newly synthesized macromolecules like proteins and lipids have been utilized. The 2D correlation analysis of time dependent Raman spectra readily identified small sequential changes resulting from isotope incorporation. Overall, we show that Raman-SIP has the potential to be used to obtain information about regulatory processes like CCR in bacteria at a single cell level within a time span of 3 h in fast growing bacteria. We also demonstrate the potential of this approach in identifying the most efficient naphthalene degraders asserting its importance for use in bioremediation. PMID:27305464

  2. Arctigenin promotes degradation of inducible nitric oxide synthase through CHIP-associated proteasome pathway and suppresses its enzyme activity.

    Science.gov (United States)

    Yao, Xiangyang; Li, Guilan; Lü, Chaotian; Xu, Hui; Yin, Zhimin

    2012-10-01

    Arctigenin, a natural dibenzylbutyrolactone lignan compound, has been reported to possess anti-inflammatory properties. Previous works showed that arctigenin decreased lipopolysaccharide (LPS)-induced iNOS at transcription level. However, whether arctigenin could regulate iNOS at the post-translational level is still unclear. In the present study, we demonstrated that arctigenin promoted the degradation of iNOS which is expressed under LPS stimulation in murine macrophage-like RAW 264.7 cells. Such degradation of iNOS protein is due to CHIP-associated ubiquitination and proteasome-dependency. Furthermore, arctigenin decreased iNOS phosphorylation through inhibiting ERK and Src activation, subsequently suppressed iNOS enzyme activity. In conclusion, our research displays a new finding that arctigenin can promote the ubiqitination and degradation of iNOS after LPS stimulation. iNOS activity regulated by arctigenin is likely to involve a multitude of crosstalking mechanisms. PMID:22770942

  3. Blocking phosphatidylcholine utilization in Pseudomonas aeruginosa, via mutagenesis of fatty acid, glycerol and choline degradation pathways, confirms the importance of this nutrient source in vivo.

    Directory of Open Access Journals (Sweden)

    Zhenxin Sun

    Full Text Available Pseudomonas aeruginosa can grow to very high-cell-density (HCD during infection of the cystic fibrosis (CF lung. Phosphatidylcholine (PC, the major component of lung surfactant, has been hypothesized to support HCD growth of P. aeruginosa in vivo. The phosphorylcholine headgroup, a glycerol molecule, and two long-chain fatty acids (FAs are released by enzymatic cleavage of PC by bacterial phospholipase C and lipases. Three different bacterial pathways, the choline, glycerol, and fatty acid degradation pathways, are then involved in the degradation of these PC components. Here, we identified five potential FA degradation (Fad related fadBA-operons (fadBA1-5, each encoding 3-hydroxyacyl-CoA dehydrogenase and acyl-CoA thiolase. Through mutagenesis and growth analyses, we showed that three (fadBA145 of the five fadBA-operons are dominant in medium-chain and long-chain Fad. The triple fadBA145 mutant also showed reduced ability to degrade PC in vitro. We have previously shown that by partially blocking Fad, via mutagenesis of fadBA5 and fadDs, we could significantly reduce the ability of P. aeruginosa to replicate on FA and PC in vitro, as well as in the mouse lung. However, no studies have assessed the ability of mutants, defective in choline and/or glycerol degradation in conjunction with Fad, to grow on PC or in vivo. Hence, we constructed additional mutants (ΔfadBA145ΔglpD, ΔfadBA145ΔbetAB, and ΔfadBA145ΔbetABΔglpD significantly defective in the ability to degrade FA, choline, and glycerol and, therefore, PC. The analysis of these mutants in the BALB/c mouse lung infection model showed significant inability to utilize PC in vitro, resulted in decreased replication fitness and competitiveness in vivo compared to the complement strain, although there was little to no variation in typical virulence factor production (e.g., hemolysin, lipase, and protease levels. This further supports the hypothesis that lung surfactant PC serves as an

  4. Metabolic analysis of the soil microbe Dechloromonas aromatica str. RCB: indications of a surprisingly complex life-style and cryptic anaerobic pathways for aromatic degradation

    Directory of Open Access Journals (Sweden)

    Feil Helene

    2009-08-01

    Full Text Available Abstract Background Initial interest in Dechloromonas aromatica strain RCB arose from its ability to anaerobically degrade benzene. It is also able to reduce perchlorate and oxidize chlorobenzoate, toluene, and xylene, creating interest in using this organism for bioremediation. Little physiological data has been published for this microbe. It is considered to be a free-living organism. Results The a priori prediction that the D. aromatica genome would contain previously characterized "central" enzymes to support anaerobic aromatic degradation of benzene proved to be false, suggesting the presence of novel anaerobic aromatic degradation pathways in this species. These missing pathways include the benzylsuccinate synthase (bssABC genes (responsible for fumarate addition to toluene and the central benzoyl-CoA pathway for monoaromatics. In depth analyses using existing TIGRfam, COG, and InterPro models, and the creation of de novo HMM models, indicate a highly complex lifestyle with a large number of environmental sensors and signaling pathways, including a relatively large number of GGDEF domain signal receptors and multiple quorum sensors. A number of proteins indicate interactions with an as yet unknown host, as indicated by the presence of predicted cell host remodeling enzymes, effector enzymes, hemolysin-like proteins, adhesins, NO reductase, and both type III and type VI secretory complexes. Evidence of biofilm formation including a proposed exopolysaccharide complex and exosortase (epsH are also present. Annotation described in this paper also reveals evidence for several metabolic pathways that have yet to be observed experimentally, including a sulphur oxidation (soxFCDYZAXB gene cluster, Calvin cycle enzymes, and proteins involved in nitrogen fixation in other species (including RubisCo, ribulose-phosphate 3-epimerase, and nif gene families, respectively. Conclusion Analysis of the D. aromatica genome indicates there is much to be

  5. Metabolic analysis of the soil microbe Dechloromonas aromatica str. RCB: indications of a surprisingly complex life-style and cryptic anaerobic pathways for aromatic degradation

    Energy Technology Data Exchange (ETDEWEB)

    Salinero, Kennan Kellaris; Keller, Keith; Feil, William S.; Feil, Helene; Trong, Stephan; Di Bartolo, Genevieve; Lapidus, Alla

    2008-11-17

    Initial interest in Dechloromonas aromatica strain RCB arose from its ability to anaerobically degrade benzene. It is also able to reduce perchlorate and oxidize chlorobenzoate, toluene, and xylene, creating interest in using this organism for bioremediation. Little physiological data has been published for this microbe. It is considered to be a free-living organism. The a priori prediction that the D. aromatica genome would contain previously characterized 'central' enzymes involved in anaerobic aromatic degradation proved to be false, suggesting the presence of novel anaerobic aromatic degradation pathways in this species. These missing pathways include the benzyl succinyl synthase (bssABC) genes (responsible for formate addition to toluene) and the central benzoylCoA pathway for monoaromatics. In depth analyses using existing TIGRfam, COG, and InterPro models, and the creation of de novo HMM models, indicate a highly complex lifestyle with a large number of environmental sensors and signaling pathways, including a relatively large number of GGDEF domain signal receptors and multiple quorum sensors. A number of proteins indicate interactions with an as yet unknown host, as indicated by the presence of predicted cell host remodeling enzymes, effector enzymes, hemolysin-like proteins, adhesins, NO reductase, and both type III and type VI secretory complexes. Evidence of biofilm formation including a proposed exopolysaccharide complex with the somewhat rare exosortase (epsH), is also present. Annotation described in this paper also reveals evidence for several metabolic pathways that have yet to be observed experimentally, including a sulphur oxidation (soxFCDYZAXB) gene cluster, Calvin cycle enzymes, and nitrogen fixation (including RubisCo, ribulose-phosphate 3-epimerase, and nif gene families, respectively). Analysis of the D. aromatica genome indicates there is much to be learned regarding the metabolic capabilities, and life-style, for this microbial

  6. Effect of Iron and Carbon Monoxide on Fibrinogenase-like Degradation of Plasmatic Coagulation by Venoms of Six Agkistrodon Species.

    Science.gov (United States)

    Nielsen, Vance G; Redford, Daniel T; Boyle, Patrick K

    2016-05-01

    Annually, thousands suffer poisonous snakebite, often from defibrinogenating species. It has been demonstrated that iron and carbon monoxide change the ultrastructure of plasma thrombi and improve coagulation kinetics. Thus, this investigation sought to determine whether pre-treatment of plasma with iron and carbon monoxide could attenuate venom-mediated catalysis of fibrinogen obtained from Agkistrodon species with fibrinogenase activity. Human plasma was pre-treated with ferric chloride (0-10 μM) and carbon monoxide-releasing molecule-2 (CORM-2, 0-100 μM) prior to exposure to 0.5-11 μg/ml of six different Agkistrodon species' venom. The amount of venom used for experimentation needed to decrease coagulation function of one or more kinetic parameters by at least 50% of normal values for (e.g. half the normal speed of clot formation). Coagulation kinetics were determined with thrombelastography. All six snake venoms degraded plasmatic coagulation kinetics to a significant extent, especially prolonging the onset to clot formation and diminishing the speed of clot growth. Pre-treatment of plasma with iron and carbon monoxide attenuated these venom-mediated coagulation kinetic changes in a species-specific manner, with some venom effects markedly abrogated while others were only mildly decreased. Further in vitro investigation of other pit viper venoms that possess fibrinogenolytic activity is indicated to identify species amenable to or resistant to iron and carbon monoxide-mediated attenuation of venom-mediated catalysis of fibrinogen. Lastly, future pre-clinical investigation with animal models (e.g. rabbit ear-bleed model) is planned to determine whether iron and carbon monoxide can be used therapeutically after envenomation. PMID:26467642

  7. Induction and carbon catabolite repression of phenol degradation genes in Rhodococcus erythropolis nad Rhodococcus jostii

    Czech Academy of Sciences Publication Activity Database

    Szököl, Juraj; Rucká, Lenka; Šimčíková, M.; Halada, Petr; Nešvera, Jan; Pátek, Miroslav

    2014-01-01

    Roč. 98, č. 19 (2014), s. 8267-8279. ISSN 0175-7598 R&D Projects: GA MŠk 2B08062; GA ČR(CZ) GAP504/11/0394 Institutional support: RVO:61388971 Keywords : Phenol degradation * Phenol hydroxylase * Rhodococcus erythropolis Subject RIV: EE - Microbiology, Virology Impact factor: 3.337, year: 2014

  8. The impact of Indonesian peatland degradation on downstream marine ecosystems and the global carbon cycle.

    Science.gov (United States)

    Abrams, Jesse F; Hohn, Sönke; Rixen, Tim; Baum, Antje; Merico, Agostino

    2016-01-01

    Tropical peatlands are among the most space-efficient stores of carbon on Earth containing approximately 89 Gt C. Of this, 57 Gt (65%) are stored in Indonesian peatlands. Large-scale exploitation of land, including deforestation and drainage for the establishment of oil palm plantations, is changing the carbon balance of Indonesian peatlands, turning them from a natural sink to a source via outgassing of CO2 to the atmosphere and leakage of dissolved organic carbon (DOC) into the coastal ocean. The impacts of this perturbation to the coastal environment and at the global scale are largely unknown. Here, we evaluate the downstream effects of released Indonesian peat carbon on coastal ecosystems and on the global carbon cycle. We use a biogeochemical box model in combination with novel and literature observations to investigate the impact of different carbon emission scenarios on the combined ocean-atmosphere system. The release of all carbon stored in the Indonesian peat pool, considered as a worst-case scenario, will increase atmospheric pCO2 by 8 ppm to 15 ppm within the next 200 years. The expected impact on the Java Sea ecosystems is most significant on the short term (over a few hundred years) and is characterized by an increase of 3.3% in phytoplankton, 32% in seagrass biomass, and 5% decrease in coral biomass. On the long term, however, the coastal ecosystems will recover to reach near pre-excursion conditions. Our results suggest that the ultimate fate of the peat carbon is in the deep ocean with 69% of it landing in the deep DIC pool after 1000 years, but the effects on the global ocean carbonate chemistry will be marginal. PMID:26416553

  9. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source.

    Science.gov (United States)

    Vital-Jacome, Miguel; Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor; Thalasso, Frederic

    2016-08-01

    In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9kg CODm(-3)d(-1), and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems. PMID:27054670

  10. Degradation of a model azo dye in submerged anaerobic membrane bioreactor (SAMBR) operated with powdered activated carbon (PAC).

    Science.gov (United States)

    Baêta, B E L; Luna, H J; Sanson, A L; Silva, S Q; Aquino, S F

    2013-10-15

    This work investigated the anaerobic degradation of the model azo dye Remazol Yellow Gold RNL in an upflow anaerobic sludge blanket reactor (UASB) and two submerged anaerobic membrane (SAMBR) bioreactors, one of which (SAMBR-1) was operated with powdered activated carbon (PAC) in its interior. The reactors were operated at 35 °C with a hydraulic retention time of 24 h in three operational phases, aimed to assess the effect of external sources of carbon (glucose) or redox mediator (yeast extract) on the removal or color and organic matter. The results showed that removal efficiencies of COD (73-94%) and color (90-94%) were higher for SAMBR-1 when compared to SAMBR-2 (operated without PAC) and UASB reactors. In addition, the presence of PAC in SAMBR-1 increased reactor stability, thereby leading to a lower accumulation of volatile fatty acids (VFA). The microfiltration membrane was responsible for an additional removal of ~50% of soluble residual COD in the form of VFA, thus improving permeate quality. On its turn, PAC exhibited the ability to adsorb byproducts (aromatic amines) of azo dye degradation as well as to act as source of immobilized redox mediator (quinone groups on its surface), thereby enhancing color removal. PMID:23810998

  11. Effects of rodent-induced land degradation on ecosytem carbon fluxes in alpine meadow in the Qinghai–Tibet Plateau, China

    Directory of Open Access Journals (Sweden)

    F. Peng

    2014-10-01

    Full Text Available Land degradation induced by rodent activities is extensively occurred in alpine meadow ecosystem in the Qinghai–Tibet Plateau that would affect the ecosystem carbon (C balance. We conducted a field experiment with six levels of land degradation (D1–D6, degradation aggravates from D1 to D6 to investigate the effects of land degradation on ecosystem C fluxes. Soil respiration (Rs, net ecosystem exchange (NEE, ecosystem respiration (ER and gross ecosystem production (GEP were measured from June to September 2012. Soil respiration, ER, GEP and above-ground biomass (AGB was significantly higher in slightly degraded (D3 and D6 than in severely degraded land (D1, D2, D4 and D5. Positive averages of NEE in the growing season indicate that alpine meadow ecosystem is a weak C sink during the growing season. Net ecosystem exchange had no significant difference among different degraded levels, but the average NEE in slightly degraded group was 33.6% higher than in severely degraded group. Soil respiration, ER and NEE were positively correlated with AGB whereas soil organic C, labile soil C, total nitrogen (N and inorganic nitrogen were associated with root biomass (RB. Our results highlight the decline of vegetation C storage of alpine meadow ecosystem with increasing number of rodent holes and suggest the control of AGB on ecosystem C fluxes, and the control of RB on soil C and N with development of land degradation.

  12. Degradation of 2,4-dihydroxibenzoic acid by vacuum UV process in aqueous solution: Kinetic, identification of intermediates and reaction pathway

    Energy Technology Data Exchange (ETDEWEB)

    Azrague, Kamal [Laboratoire IMRCP, CNRS UMR 5623, University of Toulouse, 118 route de Narbonne, 31062 Toulouse (France); Department for Water and Environment, SINTEF, Klaebuveien 153, Trondheim 7465 (Norway); Pradines, Vincent; Bonnefille, Eric [Laboratoire IMRCP, CNRS UMR 5623, University of Toulouse, 118 route de Narbonne, 31062 Toulouse (France); Laboratoire LCC, CNRS, 205 route de Narbonne, F31077 Toulouse Cedex 4 (France); Claparols, Catherine [Laboratoire LCC, CNRS, 205 route de Narbonne, F31077 Toulouse Cedex 4 (France); Universite de Toulouse, UPS, Service Commun de Spectrometrie de Masse, 118 route de Narbonne, F31062 Toulouse Cedex 9 (France); Maurette, Marie-Therese [Laboratoire IMRCP, CNRS UMR 5623, University of Toulouse, 118 route de Narbonne, 31062 Toulouse (France); Benoit-Marquie, Florence, E-mail: florence@chimie.ups-tlse.fr [Laboratoire IMRCP, CNRS UMR 5623, University of Toulouse, 118 route de Narbonne, 31062 Toulouse (France)

    2012-10-30

    Highlights: Black-Right-Pointing-Pointer Degradation of 2,4-dihydroxybenzoic acid (DHBA) by vacuum UV photolysis of water. Black-Right-Pointing-Pointer V-UV Xe-excimer lamps produced essentially hydroxyl radicals (HO Degree-Sign ). Black-Right-Pointing-Pointer Identification of all intermediates formed allowed us to propose a reaction pathway. Black-Right-Pointing-Pointer This reaction pathway showed that DHBA reacts differently with HO Degree-Sign and h+. Black-Right-Pointing-Pointer DHBA would be used as a probe to determine which of these entities were involved. - Abstract: 2,4-Dihydroxybenzoic acid (2,4-DHBA) is found frequently as a pollutant in natural waters and represents a threat to water quality because it is a precursor to the formation of quinones which are highly toxic. The degradation of 2,4-DHBA using the vacuum UV photolysis of water has been investigated. Irradiation was carried out in an annular photoreactor equipped with a Xe-excimer lamp situated in the centre and emitting at 172 nm. The degradation kinetic followed a pseudo first order and the reaction has been found to be very heterogeneous, especially at low concentration. Impacts of oxygen or temperature have also been investigated but no effect has been shown. LC-MS and HPLC-UV combined with other analytical techniques allowed the identification of the formation of trihydroxybenzoiec acids and trihydroxybenzenes which underwent a ring opening, conducting to the formation of aliphatic products named {alpha}, {beta}, {delta} and {gamma}. These products were in turn degraded successively into maleiec acid, malic and succinic acid, malonic acid, glyoxalic acid and oxalic acid before reaching the complete mineralization in about 180 min. The proposed reaction pathway has shown to be very different from the one observed for the TiO{sub 2} photocatalysis which involves only holes (h{sup +}) without any formation of aromatic intermediates. The different behaviours of 2,4-DHBA towards the h

  13. North and south: Regional footprints on the transition pathway towards a low carbon, global economy

    International Nuclear Information System (INIS)

    Environmental or 'ecological' footprints are indicators of resource consumption and waste absorption transformed on the basis of biologically productive land area required per capita with prevailing technology. They represent a partial measure of the extent to which the planet, its regions, or nations are moving along a sustainable development pathway. Such footprints vary between countries at different stages of economic development and varying geographic characteristics. A correlation equation for national environmental footprints is used, alongside international projections of population growth and gross regional income, to estimate the relative contributions of the peoples of the industrialised North and populous South that would be needed in order to secure climate-stabilising carbon reductions out to about 2100. The four so-called 'marker scenarios' produced by the Intergovernmental Panel on Climate Change are used to estimate the degree of energy efficiency improvement and carbon mitigation that is feasible. The present footprint projections suggest that a reduction in the consumption of biophysical assets across both the developing and industrialised world is indeed possible. However, the developing world's footprint is shown to overshoot that of the industrialised countries by around 2010-2015. It then levels out and starts to fall, on the most optimistic scenario, by about 2050. In order to achieve global sustainability in the 21st Century a serious commitment to environmental protection is required in both the industrialised North and the 'majority South'. That implies balancing population growth, economic well-being, and environmental impacts in the interests of all the people and wildlife on 'Spaceship Earth'.

  14. Catalytic degradation of recalcitrant pollutants by Fenton-like process using polyacrylonitrile-supported iron (II) phthalocyanine nanofibers: Intermediates and pathway.

    Science.gov (United States)

    Zhu, Zhexin; Chen, Yi; Gu, Yan; Wu, Fei; Lu, Wangyang; Xu, Tiefeng; Chen, Wenxing

    2016-04-15

    Iron (II) phthalocyanine (FePc) molecules were isolated in polyacrylonitrile (PAN) nanofibers by electrospinning to prevent the formation of dimers and oligomers. Carbamazepine (CBZ) and Rhodamine B (RhB) degradation was investigated during a Fenton-like process with FePc/PAN nanofibers. Classical quenching tests with isopropanol and electron paramagnetic resonance tests with 5,5-dimethyl-pyrroline-oxide as spin-trapping agent were performed to determine the formation of active species during hydrogen peroxide (H2O2) decomposition by FePc/PAN nanofibers. After eight recycles for CBZ degradation over the FePc/PAN nanofibers/H2O2 system, the removal ratios of CBZ remained at 99%. Seven by-products of RhB and twelve intermediates of CBZ were identified using ultra-performance liquid chromatography and high-resolution mass spectrometry. Pathways of CBZ and RhB degradation were proposed based on the identified intermediates. As the reaction proceeded, all CBZ and RhB aromatic nucleus intermediates decreased and were transformed to small acids, but also to potentially toxic epoxide-containing intermediates and acridine, because of the powerful oxidation ability of •OH in the catalytic system. PMID:26949842

  15. Global zero-carbon energy pathways using viable mixes of nuclear and renewables

    International Nuclear Information System (INIS)

    Highlights: • A proper mix of nuclear power and renewables achieves sustainable energy future. • A high nuclear share provides cost and land effectiveness compared to nuclear-free. • Only-renewable mix will increase negative economic and environmental impacts. • A deployment of advanced reactor technologies is essential to overcome limitations. - Abstract: What are the most viable global pathways for a major expansion of zero-carbon emissions electricity sources given the diversity of regional technical, socio-political and economic constraints? We modelled a range of zero-emissions energy scenarios across nations that were designed to meet projected final energy demand in 2060, and optimised to derive the best globally aggregated results in terms of minimising costs and land use (a surrogate for environmental impacts). We found that a delayed energy transition to a zero-emissions pathway will decrease investment costs (−$3,431 billion), but increase cumulative CO2 emissions (additional 696 Gt). A renewable-only scenario would convert >7.4% of the global land area to energy production, whereas a maximum nuclear scenario would affect <0.4% of land area, including mining, spent-fuel storage, and buffer zones. Moreover, a nuclear-free pathway would involve up to a 50% greater cumulative capital investment compared to a high nuclear penetration scenario ($73.7 trillion). However, for some nations with a high current share of renewables and a low projected future energy demand (e.g., Norway), pursuit of a higher nuclear share is suboptimal. In terms of the time frame for replacement of fossil fuels, achieving a global nuclear share of about 50% by 2060 would be a technically and economically plausible target if progressing at a pace of the average historical growth of nuclear power penetration in France from 1970 to 1986 (0.28 MWh person−1 year-1). For effective climate-change mitigation, a high penetration of nuclear in association with a nationally

  16. Comparative genomic analysis and benzene, toluene, ethylbenzene, and o-, m-, and p-xylene (BTEX) degradation pathways of Pseudoxanthomonas spadix BD-a59.

    Science.gov (United States)

    Choi, Eun Jin; Jin, Hyun Mi; Lee, Seung Hyeon; Math, Renukaradhya K; Madsen, Eugene L; Jeon, Che Ok

    2013-01-01

    Pseudoxanthomonas spadix BD-a59, isolated from gasoline-contaminated soil, has the ability to degrade all six BTEX (benzene, toluene, ethylbenzene, and o-, m-, and p-xylene) compounds. The genomic features of strain BD-a59 were analyzed bioinformatically and compared with those of another fully sequenced Pseudoxanthomonas strain, P. suwonensis 11-1, which was isolated from cotton waste compost. The genome of strain BD-a59 differed from that of strain 11-1 in many characteristics, including the number of rRNA operons, dioxygenases, monooxygenases, genomic islands (GIs), and heavy metal resistance genes. A high abundance of phage integrases and GIs and the patterns in several other genetic measures (e.g., GC content, GC skew, Karlin signature, and clustered regularly interspaced short palindromic repeat [CRISPR] gene homology) indicated that strain BD-a59's genomic architecture may have been altered through horizontal gene transfers (HGT), phage attack, and genetic reshuffling during its evolutionary history. The genes for benzene/toluene, ethylbenzene, and xylene degradations were encoded on GI-9, -13, and -21, respectively, which suggests that they may have been acquired by HGT. We used bioinformatics to predict the biodegradation pathways of the six BTEX compounds, and these pathways were proved experimentally through the analysis of the intermediates of each BTEX compound using a gas chromatograph and mass spectrometry (GC-MS). The elevated abundances of dioxygenases, monooxygenases, and rRNA operons in strain BD-a59 (relative to strain 11-1), as well as other genomic characteristics, likely confer traits that enhance ecological fitness by enabling strain BD-a59 to degrade hydrocarbons in the soil environment. PMID:23160122

  17. HUWE1 interacts with BRCA1 and promotes its degradation in the ubiquitin–proteasome pathway (Biochemical and Biophysical Research Communications, v. 444 issue 3)

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xiaozhen [Department of Cell Biology, Peking University Health Science Center, Beijing 100191 (China); Institute of Systems Biology, Peking University, Beijing 100191 (China); Lu, Guang; Li, Li; Yi, Juan; Yan, Kaowen; Wang, Yaqing; Zhu, Baili; Kuang, Jingyu; Lin, Ming; Zhang, Sha [Department of Cell Biology, Peking University Health Science Center, Beijing 100191 (China); Shao, Genze, E-mail: gzshao@bjmu.edu.cn [Department of Cell Biology, Peking University Health Science Center, Beijing 100191 (China); Institute of Systems Biology, Peking University, Beijing 100191 (China)

    2014-02-14

    Highlights: • The 2000–2634 aa region of HUWE1 mediates the interaction with BRCA1 degron. • HUWE1 promotes the degradation of BRCA1 through the ubiquitin–proteasome pathway. • HUWE1 expression is inversely correlated with BRCA1 in breast cancer cells. • RNAi inhibition of HUWE1 confers increased resistance of MCF-10F cells to IR and MMC. - Abstract: The cellular BRCA1 protein level is essential for its tumor suppression activity and is tightly regulated through multiple mechanisms including ubiquitn–proteasome system. E3 ligases are involved to promote BRCA1 for ubiquitination and degradation. Here, we identified HUWE1/Mule/ARF-BP1 as a novel BRCA1-interacting protein involved in the control of BRCA1 protein level. HUWE1binds BRCA1 through its N-terminus degron domain. Depletion of HUWE1 by siRNA-mediated interference significantly increases BRCA1 protein levels and prolongs the half-life of BRCA1. Moreover, exogenous expression of HUWE1 promotes BRCA1 degradation through the ubiquitin–proteasome pathway, which could explain an inverse correlation between HUWE1 and BRCA1 levels in MCF10F, MCF7 and MDA-MB-231 breast cancer cells. Consistent with a functional role for HUWE1 in regulating BRCA1-mediated cellular response to DNA damage, depletion of HUWE1 by siRNA confers increased resistance to ionizing radiation and mitomycin. These data indicate that HUWE1 is a critical negative regulator of BRCA1 and suggest a new molecular mechanism for breast cancer pathogenesis.

  18. HUWE1 interacts with BRCA1 and promotes its degradation in the ubiquitin–proteasome pathway (Biochemical and Biophysical Research Communications, v. 444, isse 4)

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xiaozhen [Department of Cell Biology, Peking University Health Science Center, Beijing 100191 (China); Institute of Systems Biology, Peking University, Beijing 100191 (China); Lu, Guang; Li, Li; Yi, Juan; Yan, Kaowen; Wang, Yaqing; Zhu, Baili; Kuang, Jingyu; Lin, Ming; Zhang, Sha [Department of Cell Biology, Peking University Health Science Center, Beijing 100191 (China); Shao, Genze, E-mail: gzshao@bjmu.edu.cn [Department of Cell Biology, Peking University Health Science Center, Beijing 100191 (China); Institute of Systems Biology, Peking University, Beijing 100191 (China)

    2014-02-21

    Highlights: • The 2000–2634aa region of HUWE1 mediates the interaction with BRCA1 degron. • HUWE1 promotes the degradation of BRCA1 through the ubiquitin–proteasome pathway. • HUWE1 expression is inversely correlated with BRCA1 in breast cancer cells. • RNAi inhibition of HUWE1 confers increased resistance of MCF-10F cells to IR and MMC. - Abstract: The cellular BRCA1 protein level is essential for its tumor suppression activity and is tightly regulated through multiple mechanisms including ubiquitn–proteasome system. E3 ligases are involved to promote BRCA1 for ubiquitination and degradation. Here, we identified HUWE1/Mule/ARF-BP1 as a novel BRCA1-interacting protein involved in the control of BRCA1 protein level. HUWE1 binds BRCA1 through its N-terminus degron domain. Depletion of HUWE1 by siRNA-mediated interference significantly increases BRCA1 protein levels and prolongs the half-life of BRCA1. Moreover, exogenous expression of HUWE1 promotes BRCA1 degradation through the ubiquitin–proteasome pathway, which could explain an inverse correlation between HUWE1 and BRCA1 levels in MCF10F, MCF7 and MDA-MB-231 breast cancer cells. Consistent with a functional role for HUWE1 in regulating BRCA1-mediated cellular response to DNA damage, depletion of HUWE1 by siRNA confers increased resistance to ionizing radiation and mitomycin. These data indicate that HUWE1 is a critical negative regulator of BRCA1 and suggest a new molecular mechanism for breast cancer pathogenesis.

  19. Jak-STAT3 pathway triggers DICER1 for proteasomal degradation by ubiquitin ligase complex of CUL4A(DCAF1) to promote colon cancer development.

    Science.gov (United States)

    Ren, Weiguo; Shen, Shourong; Sun, Zhenqiang; Shu, Peng; Shen, Xiaohua; Bu, Chibin; Ai, Feiyan; Zhang, Xuemei; Tang, Anliu; Tian, Li; Li, Guiyuan; Li, Xiayu; Ma, Jian

    2016-06-01

    Chronic intestinal inflammation is closely associated with colon cancer development and STAT3 seems to take center stage in bridging chronic inflammation to colon cancer progress. Here, we discovered that DICER1 was significantly downregulated in response to IL-6 or LPS stimulation and identified a novel mechanism for DICER1 downregulation via proteasomal degradation by ubiquitin ligase complex of CUL4A(DCAF1) in colon cancer cells. Meanwhile, PI3K-AKT signaling pathway phosphorylated DICER1 and contributed to its proteasomal degradation. The regulation of DICER1 by CUL4A(DCAF1) affected cell growth and apoptosis which is controlled by IL-6 activated Jak-STAT3 pathway. Intervention of CUL4A(DCAF1) ubiquitin ligase complex led to fluctuation in expression levels of DICER1 and microRNAs, and thus affected tumor growth in a mouse xenograft model. A panel of microRNAs that were downregulated by IL-6 stimulation was rescued by siRNA-CUL4A, and their predicated functions are involved in regulation of cell proliferation, apoptosis and motility. Furthermore, clinical specimen analysis revealed that decreased DICER1 expression was negatively correlated with STAT3 activation and cancer progression in human colon cancers. DICER1 and p-STAT3 expression levels correlated with 5-year overall survival of colon cancer patients. Consequently, this study proposes that inflammation-induced Jak-STAT3 signaling leads to colon cancer development through proteasomal degradation of DICER1 by ubiquitin ligase complex of CUL4A(DCAF1), which suggests a novel therapeutic opportunity for colon cancer. PMID:26965998

  20. HUWE1 interacts with BRCA1 and promotes its degradation in the ubiquitin–proteasome pathway (Biochemical and Biophysical Research Communications, v. 444, isse 4)

    International Nuclear Information System (INIS)

    Highlights: • The 2000–2634aa region of HUWE1 mediates the interaction with BRCA1 degron. • HUWE1 promotes the degradation of BRCA1 through the ubiquitin–proteasome pathway. • HUWE1 expression is inversely correlated with BRCA1 in breast cancer cells. • RNAi inhibition of HUWE1 confers increased resistance of MCF-10F cells to IR and MMC. - Abstract: The cellular BRCA1 protein level is essential for its tumor suppression activity and is tightly regulated through multiple mechanisms including ubiquitn–proteasome system. E3 ligases are involved to promote BRCA1 for ubiquitination and degradation. Here, we identified HUWE1/Mule/ARF-BP1 as a novel BRCA1-interacting protein involved in the control of BRCA1 protein level. HUWE1 binds BRCA1 through its N-terminus degron domain. Depletion of HUWE1 by siRNA-mediated interference significantly increases BRCA1 protein levels and prolongs the half-life of BRCA1. Moreover, exogenous expression of HUWE1 promotes BRCA1 degradation through the ubiquitin–proteasome pathway, which could explain an inverse correlation between HUWE1 and BRCA1 levels in MCF10F, MCF7 and MDA-MB-231 breast cancer cells. Consistent with a functional role for HUWE1 in regulating BRCA1-mediated cellular response to DNA damage, depletion of HUWE1 by siRNA confers increased resistance to ionizing radiation and mitomycin. These data indicate that HUWE1 is a critical negative regulator of BRCA1 and suggest a new molecular mechanism for breast cancer pathogenesis

  1. HUWE1 interacts with BRCA1 and promotes its degradation in the ubiquitin–proteasome pathway (Biochemical and Biophysical Research Communications, v. 444 issue 3)

    International Nuclear Information System (INIS)

    Highlights: • The 2000–2634 aa region of HUWE1 mediates the interaction with BRCA1 degron. • HUWE1 promotes the degradation of BRCA1 through the ubiquitin–proteasome pathway. • HUWE1 expression is inversely correlated with BRCA1 in breast cancer cells. • RNAi inhibition of HUWE1 confers increased resistance of MCF-10F cells to IR and MMC. - Abstract: The cellular BRCA1 protein level is essential for its tumor suppression activity and is tightly regulated through multiple mechanisms including ubiquitn–proteasome system. E3 ligases are involved to promote BRCA1 for ubiquitination and degradation. Here, we identified HUWE1/Mule/ARF-BP1 as a novel BRCA1-interacting protein involved in the control of BRCA1 protein level. HUWE1binds BRCA1 through its N-terminus degron domain. Depletion of HUWE1 by siRNA-mediated interference significantly increases BRCA1 protein levels and prolongs the half-life of BRCA1. Moreover, exogenous expression of HUWE1 promotes BRCA1 degradation through the ubiquitin–proteasome pathway, which could explain an inverse correlation between HUWE1 and BRCA1 levels in MCF10F, MCF7 and MDA-MB-231 breast cancer cells. Consistent with a functional role for HUWE1 in regulating BRCA1-mediated cellular response to DNA damage, depletion of HUWE1 by siRNA confers increased resistance to ionizing radiation and mitomycin. These data indicate that HUWE1 is a critical negative regulator of BRCA1 and suggest a new molecular mechanism for breast cancer pathogenesis

  2. Oxidation state, bioavailability & biochemical pathway define the fate of carbon in soil

    Science.gov (United States)

    Kuzyakov, Yakov; Apostel, Carolin; Gunina, Anna; Herrmann, Anke M.; Dippold, Michaela

    2015-04-01

    Numerous experiments under laboratory and field conditions analyzed microbial utilization and mean residence time (MRT) of carbon (C) from plant and microbial residues as well as root exudates in soil. Most of these studies tested the effects of various environmental factors, such as temperature, soil moisture, texture etc. on these parameters. However, only a few studies compared the properties of the substances themselves and there is no conceptual framework based on biochemical pathways. We hypothesize that the fate of C from organic substances in soil strongly depends on the first step of their microbial utilization, specifically, on biochemical pathway and initial C oxidation state, as well as its bioavailability in soils, defined by its hydrophobicity and molecular weight. Here we introduce and evaluate a new conceptual framework based on the following parameters: 1) C oxidation state, 2) molecular weight and hydrophobicity, 3) initial biochemical pathway of a substance class in microbial cells. To assess these parameters, two databases were prepared based on the literature and own studies. The first database included only the studies with 14C or 13C position specific labeled sugars, amino acids, carboxylic acids, phenols and lipids in soil. This database allowed us to analyze microbial utilization and mineralization of organics to CO2 depending on their C oxidation state (OS) and on functional groups. Additionally, we calculated data on the bond electronegativity of all compounds investigated in these studies. The second data base included the results of 14C and 13C studies with uniformly labeled substances of various classes. This database considered the free enthalpie (Delta H) per C unit from a variety of substrates differing in their aromaticity, hydrophobicity/electronegativity and location of the substance on the van Krevelen diagram. In addition, we calculated the hydrophobicity from the electronegativity of the individual bonds and recorded their

  3. The dominant acetate degradation pathway/methanogenic composition in full-scale anaerobic digesters operating under different ammonia levels

    DEFF Research Database (Denmark)

    Fotidis, Ioannis; Karakashev, Dimitar Borisov; Angelidaki, Irini

    2014-01-01

    Ammonia is a major environmental factor influencing biomethanation in full-scale anaerobic digesters. In this study, the effect of different ammonia levels on methanogenic pathways and methanogenic community composition of full-scale biogas plants was investigated. Eight full-scale digesters...

  4. AB044. AGE/RAGE/Akt pathway contributes to prostate cancer cell proliferation by promoting Rb phosphorylation and degradation

    Science.gov (United States)

    Bao, Jiming; Bao, Yawei; Zhao, Shanchao; He, Minyi; Luo, Haihua; Ren, Zhonglu; Lv, Yongjie; Hong, Yingqia

    2016-01-01

    Objective Metabolomic research has revealed that metabolites play an important role in prostate cancer development and progression. Previous studies have suggested that prostate cancer cell proliferation is induced by advanced glycation end products (AGEs) exposure, but the mechanism of this induction remains unknown. This study aim to investigate the molecular mechanisms underlying the proliferative response of prostate cancer cell to the interaction of AGEs and the receptor for advanced glycation end products (RAGE). Methods To investigate this mechanism, we used Western blotting to evaluate the responses of the retinoblastoma (Rb), p-Rb and PI3K/Akt pathway to AGEs stimulation. We also examined the effect of knocking down Rb and blocking the PI3K/Akt pathway on AGEs induced PC-3 cell proliferation. Results Our results indicated that AGE-RAGE interaction enhanced Rb phosphorylation and subsequently decreased total Rb levels. Bioinformatics analysis further indicated a negative correlation between RAGE and RB1 expression in prostate cancer tissue. Furthermore, we observed that AGEs stimulation activated the PI3K/Akt signaling pathway and that blocking PI3K/Akt signaling abrogated AGEs-induced cell proliferation. Conclusions We report, for the first time, that AGE-RAGE interaction enhances prostate cancer cell proliferation by phosphorylation of Rb via the PI3K/Akt signaling pathway.

  5. Sonochemical degradation of ethyl paraben in environmental samples: Statistically important parameters determining kinetics, by-products and pathways.

    Science.gov (United States)

    Papadopoulos, Costas; Frontistis, Zacharias; Antonopoulou, Maria; Venieri, Danae; Konstantinou, Ioannis; Mantzavinos, Dionissios

    2016-07-01

    The sonochemical degradation of ethyl paraben (EP), a representative of the parabens family, was investigated. Experiments were conducted at constant ultrasound frequency of 20kHz and liquid bulk temperature of 30°C in the following range of experimental conditions: EP concentration 250-1250μg/L, ultrasound (US) density 20-60W/L, reaction time up to 120min, initial pH 3-8 and sodium persulfate 0-100mg/L, either in ultrapure water or secondary treated wastewater. A factorial design methodology was adopted to elucidate the statistically important effects and their interactions and a full empirical model comprising seventeen terms was originally developed. Omitting several terms of lower significance, a reduced model that can reliably simulate the process was finally proposed; this includes EP concentration, reaction time, power density and initial pH, as well as the interactions (EP concentration)×(US density), (EP concentration)×(pHo) and (EP concentration)×(time). Experiments at an increased EP concentration of 3.5mg/L were also performed to identify degradation by-products. LC-TOF-MS analysis revealed that EP sonochemical degradation occurs through dealkylation of the ethyl chain to form methyl paraben, while successive hydroxylation of the aromatic ring yields 4-hydroxybenzoic, 2,4-dihydroxybenzoic and 3,4-dihydroxybenzoic acids. By-products are less toxic to bacterium V. fischeri than the parent compound. PMID:26964924

  6. Involvement of Bcl-xL degradation and mitochondrial-mediated apoptotic pathway in pyrrolizidine alkaloids-induced apoptosis in hepatocytes

    International Nuclear Information System (INIS)

    Pyrrolizidine alkaloids (PAs) are natural hepatotoxins with worldwide distribution in more than 6000 high plants including medicinal herbs or teas. The aim of this study is to investigate the signal pathway involved in PAs-induced hepatotoxicity. Our results showed that clivorine, isolated from Ligularia hodgsonii Hook, decreased cell viability and induced apoptosis in L-02 cells and mouse hepatocytes. Western-blot results showed that clivorine induced caspase-3/-9 activation, mitochondrial release of cytochrome c and decreased anti-apoptotic Bcl-xL in a time (8-48 h)- and concentration (1-100 μM)-dependent manner. Furthermore, inhibitors of pan-caspase, caspase-3 and caspase-9 significantly inhibited clivorine-induced apoptosis and rescued clivorine-decreased cell viability. Polyubiquitination of Bcl-xL was detected after incubation with 100 μM clivorine for 40 h in the presence of proteasome specific inhibitor MG132, indicating possible degradation of Bcl-xL protein. Furthermore, pretreatment with MG132 or calpain inhibitor I for 2 h significantly enhanced clivorine-decreased Bcl-xL level and cell viability. All the other tested PAs such as senecionine, isoline and monocrotaline decreased mouse hepatocytes viability in a concentration-dependent manner. Clivorine (10 μM) induced caspase-3 activation and decreased Bcl-xL was also confirmed in mouse hepatocytes. Meanwhile, another PA senecionine isolated from Senecio vulgaris L also induced apoptosis, caspase-3 activation and decreased Bcl-xL in mouse hepatocytes. In conclusion, our results suggest that PAs may share the same hepatotoxic signal pathway, which involves degradation of Bcl-xL protein and thus leading to the activation of mitochondrial-mediated apoptotic pathway

  7. Photocatalytic degradation of organic contaminants under solar light using carbon dot/titanium dioxide nanohybrid, obtained through a facile approach

    Science.gov (United States)

    Hazarika, Deepshikha; Karak, Niranjan

    2016-07-01

    In the present study, a novel, simple and green method was developed to synthesize highly luminescent nitrogen containing carbon dot (CD) using carbon resources like bio-based citric acid and glycerol in the presence of cost free cow urine. The as-synthesized CD showed exciting wavelength dependent down- and up-conversion flourescence properties. To utilize the advantage of up-conversion flourescence, a nanohybrid (CD@TiO2) was synthesized from the above carbon resources and titanium butoxide through a facile one pot single step hydrothermal protocol. Nanomaterials like bare TiO2 and nanohybrid of TiO2 in presence of CD (CD/TiO2) were also synthesized for comparison purpose. The optical properties and structural characteristics of the prepared CD, bare TiO2, CD@TiO2 and CD/TiO2 were examined by Fourier transform infrared (FTIR), UV-vis and fluorescence spectroscopic, scanning electron microscopic (SEM), transmission electron microscopic (TEM) and X-ray diffraction (XRD) studies. The elemental compositions of bare CD and CD@TiO2 nanohybrid were obtained from EDX analyses. The poor crystalline nature and narrow distribution of spherical CD and anatase form of TiO2 were confirmed from XRD and TEM studies. Amongst the studied nanomaterials, CD@TiO2 exhibited the most promising photocatalytic degradation of organic pollutants like benzene and phenol as well as an anthrogenic pesticide under sunlight.

  8. Carbon-Ion Irradiation Suppresses Migration and Invasiveness of Human Pancreatic Carcinoma Cells MIAPaCa-2 via Rac1 and RhoA Degradation

    International Nuclear Information System (INIS)

    Purpose: To investigate the mechanisms underlying the inhibition of cancer cell migration and invasion by carbon (C)-ion irradiation. Methods and Materials: Human pancreatic cancer cells MIAPaCa-2, AsPC-1, and BxPC-3 were treated by x-ray (4 Gy) or C-ion (0.5, 1, 2, or 4 Gy) irradiation, and their migration and invasion were assessed 2 days later. The levels of guanosine triphosphate (GTP)-bound Rac1 and RhoA were determined by the active GTPase pull-down assay with or without a proteasome inhibitor, and the binding of E3 ubiquitin ligase to GTP-bound Rac1 was examined by immunoprecipitation. Results: Carbon-ion irradiation reduced the levels of GTP-bound Rac1 and RhoA, 2 major regulators of cell motility, in MIAPaCa-2 cells and GTP-bound Rac1 in AsPC-1 and BxPC-3 cells. Proteasome inhibition reversed the effect, indicating that C-ion irradiation induced Rac1 and RhoA degradation via the ubiquitin (Ub)-proteasome pathway. E3 Ub ligase X-linked inhibitor of apoptosis protein (XIAP), which directly targets Rac1, was selectively induced in C-ion–irradiated MIAPaCa-2 cells and coprecipitated with GTP-bound Rac1 in C-ion–irradiated cells, which was associated with Rac1 ubiquitination. Cell migration and invasion reduced by C-ion radiation were restored by short interfering RNA–mediated XIAP knockdown, indicating that XIAP is involved in C-ion–induced inhibition of cell motility. Conclusion: In contrast to x-ray irradiation, C-ion treatment inhibited the activity of Rac1 and RhoA in MIAPaCa-2 cells and Rac1 in AsPC-1 and BxPC-3 cells via Ub-mediated proteasomal degradation, thereby blocking the motility of these pancreatic cancer cells

  9. Carbon-Ion Irradiation Suppresses Migration and Invasiveness of Human Pancreatic Carcinoma Cells MIAPaCa-2 via Rac1 and RhoA Degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, Mayumi; Imadome, Kaori; Shoji, Yoshimi [Advanced Radiation Biology Research Program, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba (Japan); Isozaki, Tetsurou; Endo, Satoshi; Yamada, Shigeru [Research Center Hospital for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba (Japan); Imai, Takashi, E-mail: imait@nirs.go.jp [Advanced Radiation Biology Research Program, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba (Japan)

    2015-09-01

    Purpose: To investigate the mechanisms underlying the inhibition of cancer cell migration and invasion by carbon (C)-ion irradiation. Methods and Materials: Human pancreatic cancer cells MIAPaCa-2, AsPC-1, and BxPC-3 were treated by x-ray (4 Gy) or C-ion (0.5, 1, 2, or 4 Gy) irradiation, and their migration and invasion were assessed 2 days later. The levels of guanosine triphosphate (GTP)-bound Rac1 and RhoA were determined by the active GTPase pull-down assay with or without a proteasome inhibitor, and the binding of E3 ubiquitin ligase to GTP-bound Rac1 was examined by immunoprecipitation. Results: Carbon-ion irradiation reduced the levels of GTP-bound Rac1 and RhoA, 2 major regulators of cell motility, in MIAPaCa-2 cells and GTP-bound Rac1 in AsPC-1 and BxPC-3 cells. Proteasome inhibition reversed the effect, indicating that C-ion irradiation induced Rac1 and RhoA degradation via the ubiquitin (Ub)-proteasome pathway. E3 Ub ligase X-linked inhibitor of apoptosis protein (XIAP), which directly targets Rac1, was selectively induced in C-ion–irradiated MIAPaCa-2 cells and coprecipitated with GTP-bound Rac1 in C-ion–irradiated cells, which was associated with Rac1 ubiquitination. Cell migration and invasion reduced by C-ion radiation were restored by short interfering RNA–mediated XIAP knockdown, indicating that XIAP is involved in C-ion–induced inhibition of cell motility. Conclusion: In contrast to x-ray irradiation, C-ion treatment inhibited the activity of Rac1 and RhoA in MIAPaCa-2 cells and Rac1 in AsPC-1 and BxPC-3 cells via Ub-mediated proteasomal degradation, thereby blocking the motility of these pancreatic cancer cells.

  10. Foot-and-mouth disease virus structural protein VP3 degrades Janus kinase 1 to inhibit IFN-γ signal transduction pathways.

    Science.gov (United States)

    Li, Dan; Wei, Jin; Yang, Fan; Liu, Hua-Nan; Zhu, Zi-Xiang; Cao, Wei-Jun; Li, Shu; Liu, Xiang-Tao; Zheng, Hai-Xue; Shu, Hong-Bing

    2016-01-01

    Foot-and-mouth disease is a highly contagious viral disease of cloven-hoofed animals that is caused by foot-and-mouth disease virus (FMDV). To replicate efficiently in vivo, FMDV has evolved methods to circumvent host antiviral defense mechanisms, including those induced by interferons (IFNs). Previous research has focused on the effect of FMDV L(pro) and 3C(pro) on type I IFNs. In this study, FMDV VP3 was found to inhibit type II IFN signaling pathways. The overexpression of FMDV VP3 inhibited the IFN-γ-triggered phosphorylation of STAT1 at Tyr701 and the subsequent expression of downstream genes. Mechanistically, FMDV VP3 interacted with JAK1/2 and inhibited the tyrosine phosphorylation, dimerization and nuclear accumulation of STAT1. FMDV VP3 also disrupted the assembly of the JAK1 complex and degraded JAK1 but not JAK2 via a lysosomal pathway. Taken together, the results reveal a novel mechanism used by which FMDV VP3 counteracts the type II IFN signaling pathways. PMID:26901336

  11. Pathways of Organic-Carbon Oxidation in 3 Continental-Margin Sediments Rid A-8010-2010

    DEFF Research Database (Denmark)

    CANFIELD, DE; JØRGENSEN, BB; FOSSING, H.;

    1993-01-01

    We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and SIGMACO2 liberation in sediment incubations were used with O2 penetration depths to conclude...... that O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated...... organic carbon mineralization, but their relative significance varied depending on the sediment. Where high concentrations of Mn-oxide were found (3-4 wt% Mn), only Mn reduction occurred. With lower Mn oxide concentrations more typical of coastal sediments, Fe reduction and sulfate reduction were most...

  12. Trimethylene Carbonate and epsilon-Caprolactone Based (co)Polymer Networks : Mechanical Properties and Enzymatic Degradation

    NARCIS (Netherlands)

    Bat, Erhan; Plantinga, Josee A.; Harmsen, Martin C.; van Luyn, Marja J. A.; Zhang, Zheng; Grijpma, Dirk W.; Feijen, Jan

    2008-01-01

    High molecular weight trimethylene carbonate (TMC) and epsilon-caprolactone (CL) (co)polymers were synthesized. Melt pressed (co)polymer films were cross-linked by gamma irradiation (25 kGy or 50 kGy) in vacuum, yielding gel fractions of up to 70%. The effects of copolymer composition and irradiatio

  13. Trimethylene Carbonate and -Caprolactone Based (co)Polymer Networks: Mechanical Properties and Enzymatic Degradation

    NARCIS (Netherlands)

    Bat, Erhan; Plantinga, Josée A.; Harmsen, Martin C.; Luyn, van Marja J.A.; Zhang, Zheng; Grijpma, Dirk W.; Feijen, Jan

    2008-01-01

    High molecular weight trimethylene carbonate (TMC) and -caprolactone (CL) (co)polymers were synthesized. Melt pressed (co)polymer films were cross-linked by gamma irradiation (25 kGy or 50 kGy) in vacuum, yielding gel fractions of up to 70%. The effects of copolymer composition and irradiation dose

  14. Adsorption and Photocatalytic Decomposition of the -Blocker Metoprolol in Aqueous Titanium Dioxide Suspensions: Kinetics, Intermediates, and Degradation Pathways

    OpenAIRE

    Violette Romero; Pilar Marco; Jaime Giménez; Santiago Esplugas

    2013-01-01

    This study reports the photocatalytic degradation of the β-blocker metoprolol (MET) using TiO2 suspended as catalyst. A series of photoexperiments were carried out by a UV lamp, emitting in the 250–400 nm range, providing information about the absorption of radiation in the photoreactor wall. The influence of the radiation wavelength on the MET photooxidation rate was investigated using a filter cutting out wavelengths shorter than 280 nm. Effects of photolysis and adsorption at different ini...

  15. Soil Carbon Dynamics Along the Pathway From Diverse Microbial Carbon to Humus in a Temperate and Tropical Forest

    Science.gov (United States)

    Throckmorton, H. M.; Bird, J. A.; Firestone, M. K.; Horwath, W. R.

    2008-12-01

    This research investigates the importance of microbial biochemistry to humification pathways in two climatically different forest ecosystems; Blodgett forest (BF), a temperate forest in the Sierra Nevada and Luquillo forest (LF), a tropical forest in Puerto Rico. Non-living 13C enriched temperate and tropical microorganisms from four biochemically contrasting microbial groups (fungi, actinomycetes, bacteria gram (+), and bacteria gram (-)) were separately added to soil at both sites in a reciprocal transplant experiment. Decomposition rates were substantially greater at LF than BF for all microbial inputs. Although there were initial differences in microbial C turnover and recovery within the soil microbial biomass and dissolved organic carbon pools for unique microbial C inputs at both sites, over time treatment differences converge within each site and the quality of input microbial C becomes less important to C remaining and maintained within these soil C pools. Physical soil fractionation revealed important trends which illustrate the role of the soil mineral matrix to protect and stabilize C in soil. Results indicate different C turnover rates associated with the light, aggregate- occluded, and mineral-associated soil fractions at both sites. At BF input C recovered within the light and mineral-associated fractions decreased substantially over time (1 to 13 months), while C occluded within aggregates only slightly decreased. Similarly, LF soils exhibit only a slight decrease in aggregate-occluded C over time (0.5 to 3.5 months), while C recovered within the light fraction decreased substantially; however, unlike BF, LF soils exhibited only a slight decrease in C recovered within the mineral fraction. The distribution of total C among these physical soil pools differs substantially for either site, suggesting differences in the relative importance of the mineral matrix to protect and stabilize C. Preliminary compound-specific isotope analyses employing

  16. Investigating Pathways of Nutrient and Energy Flows Through Aquatic Food Webs Using Stable Isotopes of Carbon and Nitrogen

    International Nuclear Information System (INIS)

    Carbon and nitrogen stable isotopes can provide valuable insights into pathways of nutrient and energy flows in aquatic ecosystems. Carbon stable isotopes are principally used to trace pathways of organic matter transfer through aquatic food webs, particularly with regard to identifying the dominant sources of nutrition for aquatic biota. Stable isotopes of carbon have been widely used to answer one of the most pressing questions in aquatic food web ecology - to what degree do in-stream (autochthonous) and riparian (allochthonous) sources of energy fuel riverine food webs? In conjunction with carbon stable isotopes, nitrogen stable isotopes have been used to determine the trophic position of consumers and to identify the number of trophic levels in aquatic food webs. More recently, stable nitrogen isotopes have been recommended as indicators of anthropogenic disturbances. Specifically, agricultural land uses and/or sewage effluent discharge have been shown to significantly increase δ15N signatures in primary producers and higher order consumers in freshwater, estuarine and marine environments. Together, carbon and nitrogen stable isotopes can be used to examine natural food web functions as well as the degree to which human modifications to catchments and aquatic environments can influence aquatic ecosystem function. (author)

  17. Degradation of paracetamol by catalytic wet air oxidation and sequential adsorption – Catalytic wet air oxidation on activated carbons

    International Nuclear Information System (INIS)

    Highlights: ► Three activated carbons (AC) compared as adsorbents and oxidation catalysts. ► Similar evolution for catalytic and adsorptive properties of AC over reuses. ► Acidic and mesoporous AC to be preferred, despite lower initial efficiency. ► Oxidative degradation of paracetamol improves biodegradability. ► Convenient hybrid adsorption–regenerative oxidation process for continuous treatment. - Abstract: The concern about the fate of pharmaceutical products has raised owing to the increasing contamination of rivers, lakes and groundwater. The aim of this paper is to evaluate two different processes for paracetamol removal. The catalytic wet air oxidation (CWAO) of paracetamol on activated carbon was investigated both as a water treatment technique using an autoclave reactor and as a regenerative treatment of the carbon after adsorption in a sequential fixed bed process. Three activated carbons (ACs) from different source materials were used as catalysts: two microporous basic ACs (S23 and C1) and a meso- and micro-porous acidic one (L27). During the first CWAO experiment the adsorption capacity and catalytic performance of fresh S23 and C1 were higher than those of fresh L27 despite its higher surface area. This situation changed after AC reuse, as finally L27 gave the best results after five CWAO cycles. Respirometry tests with activated sludge revealed that in the studied conditions the use of CWAO enhanced the aerobic biodegradability of the effluent. In the ADOX process L27 also showed better oxidation performances and regeneration efficiency. This different ageing was examined through AC physico-chemical properties.

  18. Degradation of paracetamol by catalytic wet air oxidation and sequential adsorption - Catalytic wet air oxidation on activated carbons

    Energy Technology Data Exchange (ETDEWEB)

    Quesada-Penate, I. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, 4, Allee Emile Monso, F-31432 Toulouse (France); CNRS, Laboratoire de Genie Chimique, F-31432 Toulouse (France); Julcour-Lebigue, C., E-mail: carine.julcour@ensiacet.fr [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, 4, Allee Emile Monso, F-31432 Toulouse (France); CNRS, Laboratoire de Genie Chimique, F-31432 Toulouse (France); Jauregui-Haza, U.J. [Instituto Superior de Tecnologias y Ciencias Aplicadas, Ave. Salvador Allende y Luaces, Habana (Cuba); Wilhelm, A.M.; Delmas, H. [Universite de Toulouse, INPT, UPS, Laboratoire de Genie Chimique, 4, Allee Emile Monso, F-31432 Toulouse (France); CNRS, Laboratoire de Genie Chimique, F-31432 Toulouse (France)

    2012-06-30

    Highlights: Black-Right-Pointing-Pointer Three activated carbons (AC) compared as adsorbents and oxidation catalysts. Black-Right-Pointing-Pointer Similar evolution for catalytic and adsorptive properties of AC over reuses. Black-Right-Pointing-Pointer Acidic and mesoporous AC to be preferred, despite lower initial efficiency. Black-Right-Pointing-Pointer Oxidative degradation of paracetamol improves biodegradability. Black-Right-Pointing-Pointer Convenient hybrid adsorption-regenerative oxidation process for continuous treatment. - Abstract: The concern about the fate of pharmaceutical products has raised owing to the increasing contamination of rivers, lakes and groundwater. The aim of this paper is to evaluate two different processes for paracetamol removal. The catalytic wet air oxidation (CWAO) of paracetamol on activated carbon was investigated both as a water treatment technique using an autoclave reactor and as a regenerative treatment of the carbon after adsorption in a sequential fixed bed process. Three activated carbons (ACs) from different source materials were used as catalysts: two microporous basic ACs (S23 and C1) and a meso- and micro-porous acidic one (L27). During the first CWAO experiment the adsorption capacity and catalytic performance of fresh S23 and C1 were higher than those of fresh L27 despite its higher surface area. This situation changed after AC reuse, as finally L27 gave the best results after five CWAO cycles. Respirometry tests with activated sludge revealed that in the studied conditions the use of CWAO enhanced the aerobic biodegradability of the effluent. In the ADOX process L27 also showed better oxidation performances and regeneration efficiency. This different ageing was examined through AC physico-chemical properties.

  19. Soil Carbon Recovery of Degraded Steppe Ecosystems of the Mongolian Plateau

    Science.gov (United States)

    Ojima, D. S.; Togtohyn, C.; Qi, J.

    2013-12-01

    Mongolian steppe grassland systems are critical source of ecosystem services to societal groups in temperate East Asia. These systems are characterized by their arid and semiarid environments where rainfall tends to be too variable or evaporative losses reduce water availability to reliably support cropping systems or substantial forest cover. These steppe ecosystems have supported land use practices to accommodate the variable rainfall patterns, and seasonal and spatial patterns of forage production displayed by the nomadic pastoral systems practiced across Asia. These pastoral systems are dependent on grassland ecosystem services, including forage production, wool, skins, meat and dairy products, and in many systems provide critical biodiversity and land and water protection services which serve to maintain pastoral livelihoods. Precipitation variability and associated drought conditions experienced frequently in these grassland systems are key drivers of these systems. However, during the past several decades climate change and grazing and land use conversion have resulted in degradation of ecosystem services and loss of soil organic matter. Recent efforts in China and Mongolia are investigating different grazing management practices to restore soil organic matter in these degraded systems. Simulation modeling is being applied to evaluate the long-term benefits of different grazing management regimes under various climate scenarios.

  20. Use of Activated Carbon in Packaging to Attenuate Formaldehyde-Induced and Formic Acid-Induced Degradation and Reduce Gelatin Cross-Linking in Solid Dosage Forms.

    Science.gov (United States)

    Colgan, Stephen T; Zelesky, Todd C; Chen, Raymond; Likar, Michael D; MacDonald, Bruce C; Hawkins, Joel M; Carroll, Sophia C; Johnson, Gail M; Space, J Sean; Jensen, James F; DeMatteo, Vincent A

    2016-07-01

    Formaldehyde and formic acid are reactive impurities found in commonly used excipients and can be responsible for limiting drug product shelf-life. Described here is the use of activated carbon in drug product packaging to attenuate formaldehyde-induced and formic acid-induced drug degradation in tablets and cross-linking in hard gelatin capsules. Several pharmaceutical products with known or potential vulnerabilities to formaldehyde-induced or formic acid-induced degradation or gelatin cross-linking were subjected to accelerated stability challenges in the presence and absence of activated carbon. The effects of time and storage conditions were determined. For all of the products studied, activated carbon attenuated drug degradation or gelatin cross-linking. This novel use of activated carbon in pharmaceutical packaging may be useful for enhancing the chemical stability of drug products or the dissolution stability of gelatin-containing dosage forms and may allow for the 1) extension of a drug product's shelf-life when the limiting attribute is a degradation product induced by a reactive impurity, 2) marketing of a drug product in hotter and more humid climatic zones than currently supported without the use of activated carbon, and 3) enhanced dissolution stability of products that are vulnerable to gelatin cross-linking. PMID:27262203

  1. Variability in carbon isotope fractionation of trichloroethene during degradation by persulfate activated with zero-valent iron: Effects of inorganic anions.

    Science.gov (United States)

    Liu, Yunde; Zhou, Aiguo; Gan, Yiqun; Li, Xiaoqian

    2016-04-01

    Stable carbon isotope analysis has the potential to be used for assessing the performance of in situ remediation of organic contaminants. Successful application of this isotope technique requires understanding the magnitude and variability in carbon isotope fractionation associated with the reactions under consideration. This study investigated the influence of inorganic anions (sulfate, bicarbonate, and chloride) on carbon isotope fractionation of trichloroethene (TCE) during its degradation by persulfate activated with zero-valent iron. The results demonstrated that the significant carbon isotope fractionation (enrichment factors ε ranging from -3.4±0.3 to -4.3±0.3‰) was independent on the zero-iron dosage, sulfate concentration, and bicarbonate concentration. However, the ε values (ranging from -7.0±0.4 to -13.6±1.2‰) were dependent on the chloride concentration, indicating that chloride could significantly affect carbon isotope fractionation during TCE degradation by persulfate activated with zero-valent iron. The dependence of ε values on chloride concentration, indicated that TCE degradation mechanisms may be different from the degradation mechanism caused by sulfate radical (SO4(-)). Ignoring the effect of chloride on ε value may cause numerous uncertainties in quantitative assessment of the performance of the in situ chemical oxidation (ISCO). PMID:26784392

  2. Murrayafoline A attenuates the Wnt/{beta}-catenin pathway by promoting the degradation of intracellular {beta}-catenin proteins

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hyuk; Gwak, Jungsug; Cho, Munju; Ryu, Min-Jung [PharmacoGenomics Research Center, Inje University, Busan 614-735 (Korea, Republic of); Lee, Jee-Hyun; Kim, Sang Kyum; Kim, Young Ho [College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Gye Won [Department of Pharmaceutical Engineering, Konyang University, Nonsan 320-711 (Korea, Republic of); Yun, Mi-Young [Department of Beauty Health Care, Daejeon University, Daejeon 305-764 (Korea, Republic of); Cuong, Nguyen Manh [Institute of Natural Products Chemistry, Vietnam Academy of Science and Technology, Hanoi (Viet Nam); Shin, Jae-Gook [PharmacoGenomics Research Center, Inje University, Busan 614-735 (Korea, Republic of); Song, Gyu-Yong, E-mail: gysong@cnu.ac.kr [College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Oh, Sangtaek, E-mail: ohsa@inje.ac.kr [PharmacoGenomics Research Center, Inje University, Busan 614-735 (Korea, Republic of)

    2010-01-01

    Molecular lesions in Wnt/{beta}-catenin signaling and subsequent up-regulation of {beta}-catenin response transcription (CRT) occur frequently during the development of colon cancer. To identify small molecules that suppress CRT, we screened natural compounds in a cell-based assay for detection of TOPFalsh reporter activity. Murrayafoline A, a carbazole alkaloid isolated from Glycosmis stenocarpa, antagonized CRT that was stimulated by Wnt3a-conditioned medium (Wnt3a-CM) or LiCl, an inhibitor of glycogen synthase kinase-3{beta} (GSK-3{beta}), and promoted the degradation of intracellular {beta}-catenin without altering its N-terminal phosphorylation at the Ser33/37 residues, marking it for proteasomal degradation, or the expression of Siah-1, an E3 ubiquitin ligase. Murrayafoline A repressed the expression of cyclin D1 and c-myc, which is known {beta}-catenin/T cell factor (TCF)-dependent genes and thus inhibited the proliferation of various colon cancer cells. These findings indicate that murrayafoline A may be a potential chemotherapeutic agent for use in the treatment of colon cancer.

  3. Murrayafoline A attenuates the Wnt/β-catenin pathway by promoting the degradation of intracellular β-catenin proteins

    International Nuclear Information System (INIS)

    Molecular lesions in Wnt/β-catenin signaling and subsequent up-regulation of β-catenin response transcription (CRT) occur frequently during the development of colon cancer. To identify small molecules that suppress CRT, we screened natural compounds in a cell-based assay for detection of TOPFalsh reporter activity. Murrayafoline A, a carbazole alkaloid isolated from Glycosmis stenocarpa, antagonized CRT that was stimulated by Wnt3a-conditioned medium (Wnt3a-CM) or LiCl, an inhibitor of glycogen synthase kinase-3β (GSK-3β), and promoted the degradation of intracellular β-catenin without altering its N-terminal phosphorylation at the Ser33/37 residues, marking it for proteasomal degradation, or the expression of Siah-1, an E3 ubiquitin ligase. Murrayafoline A repressed the expression of cyclin D1 and c-myc, which is known β-catenin/T cell factor (TCF)-dependent genes and thus inhibited the proliferation of various colon cancer cells. These findings indicate that murrayafoline A may be a potential chemotherapeutic agent for use in the treatment of colon cancer.

  4. Sonocatalytical degradation enhancement for ibuprofen and sulfamethoxazole in the presence of glass beads and single-walled carbon nanotubes.

    Science.gov (United States)

    Al-Hamadani, Yasir A J; Chu, Kyoung Hoon; Flora, Joseph R V; Kim, Do-Hyung; Jang, Min; Sohn, Jinsik; Joo, Wanho; Yoon, Yeomin

    2016-09-01

    Sonocatalytic degradation experiments were carried out to determine the effects of glass beads (GBs) and single-walled carbon nanotubes (SWNTs) on ibuprofen (IBP) and sulfamethoxazole (SMX) removal using low and high ultrasonic frequencies (28 and 1000kHz). In the absence of catalysts, the sonochemical degradation at pH 7, optimum power of 0.18WmL(-1), and a temperature of 15°C was higher (79% and 72%) at 1000kHz than at 28kHz (45% and 33%) for IBP and SMX, respectively. At the low frequency (28kHz) H2O2 production increased significantly, from 10μM (no GBs) to 86μM in the presence of GBs (0.1mm, 10gL(-1)); however, no enhancement was achieved at 1000kHz. In contrast, the H2O2 production increased from 10μM (no SWNTs) to 31μM at 28kHz and from 82μM (no SWNTs) to 111μM at 1000kHz in the presence of SWNTs (45mgL(-1)). Thus, maximum removals of IBP and SMX were obtained in the presence of a combination of GBs and SWNTs at the low frequency (94% and 88%) for 60min contact time; however, >99% and 97% removals were achieved for 40 and 60min contact times at the high frequency for IBP and SMX, respectively. The results indicate that both IBP and SMX degradation followed pseudo-first-order kinetics. Additionally, the enhanced removal of IBP and SMX in the presence of catalysts was because GBs and SWNTs increased the number of free OH radicals due to ultrasonic irradiation and the adsorption capacity increase with SWNT dispersion. PMID:27150790

  5. Dissolved inorganic carbon (DIC) and its δ13C in the Ganga (Hooghly) River estuary, India: Evidence of DIC generation via organic carbon degradation and carbonate dissolution

    Digital Repository Service at National Institute of Oceanography (India)

    Samanta, S.; Dalai, T.K.; Pattanaik, J.K.; Rai, S.K.; Mazumdar, A.

    In this study, we present comprehensive data on dissolved Ca, dissolved inorganic carbon (DIC) and its carbon isotope composition (δ13CDIC) of (i) the Ganga (Hooghly) River estuary water sampled during six seasons...

  6. In-situ evaluation of the degradable carbon influence for industrial waste water treatment

    Science.gov (United States)

    Fayomi, O. S. I.; Olukanni, D. O.; Fayomi, G. U.; Joseph, O. O.; Popoola, A. P. I.

    2016-07-01

    A photochemical investigation and synergetic blend for wastewater purification was carried out. Blends of different peels: Potato-, Apple and Pineapples-peals (PAP-peals) were impregnated with aqueous solutions of ZnCl2 following the variant of the incipient wetness method for activation of activated carbon (AC). Different concentrations were used to produce impregnation ratios. Activation was carried out in a tube furnace by heating to 700°C with 1 hour soaking time. Scanning Electron Microscopic with attached energy dispersive spectrometer (SEM/EDS), Atomic Adsorption Spectrometry (AAS) and Fourier Transform Infrared spectrometer (FTIS) equipments were used for the characterization of the AC produced. The result shows that PAP-peals derived activated carbons had micro porous characteristics. The study revealed that these new combined adsorbents materials are inexpensive, easily available and they have applications for the removal of Cu, Pb and Cr contained in industrial effluents.

  7. Application of Silver and Silver Oxide Nanoparticles Impregnated on Activated Carbon to the Degradation of Bromate.

    Science.gov (United States)

    Choi, J S; Lee, H; Park, Y K; Kim, S J; Kim, B J; An, K H; Kim, B H; Jung, S C

    2016-05-01

    Silver and silver oxide nanoparticles were impregnated on the surface of powdered activated carbon (PAC) using a single-step liquid phase plasma (LPP) method. Spherical silver and silver oxide nanoparticles of 20 to 100 nm size were dipersed evenly on the surface of PAC. The impregnated PAC exhibited a higher activity for the decomposition of bromate than bare PAC. The XPS, Raman and EDX analyses showed that the Ag/PAC composites synthesized by the LPP process. PMID:27483780

  8. Use of organic substrates for increasing soil organic matter quality and carbon sequestration of tropical degraded soil : a 3-year mesocosms experiment

    OpenAIRE

    Ngo, P.T; Rumpel, C.; Thu, T. D.; Henry des Tureaux, Thierry; Dang, D.K.; Jouquet, Pascal

    2014-01-01

    Background: Exogenous organic matter may be valuable amendments for degraded tropical soil in Northern Vietnam. Their effect on carbon storage and composition need to be evaluated. Method: The study investigates soil from mesocosms cultivated with maize and amended with four different kinds of amendments: only mineral fertilizers (control), buffalo manure, compost or vermiconnpost as well as biochar. Results: All organic amendments showed a positive effect on soil carbon storage and significa...

  9. Quantification of forest carbon degradation in Nicaragua using RapidEye remote sensing data: El Cuá and Wiwili case studies

    Science.gov (United States)

    Argoty, F. N.; Cifuentes, M.; Imbach, P. A.; Vilchez, S.; Casanoves, F.; Ibrahim, M.; Vierling, L. A.

    2012-12-01

    Forest degradation and deforestation affect ecosystem function and climate regulation services such as carbon storage. Historically, Central America has been a deforestation and forest degradation hotspot. Wiwili and El Cuá municipalities in northern Nicaragua are no exception, where subsistence agriculture and cattle ranch expansion have driven deforestation and other wood extraction activities, leading to various levels of forest degradation. Reduction of Emissions from forest Degradation and Deforestation (REDD) projects are proposed as a tool to slow the degradation and loss of carbon stocks by restoring carbon to its natural levels in order to mitigate carbon dioxide emissions that cause global warming. REDD projects require baseline estimations of current carbon stocks and forest degradation status. We estimated carbon stocks across a forest degradation gradient based on common biophysical variables and commercially available (RapidEye) remote sensing data. We measured 80 temporary forest plots (50x20m) for aboveground biomass to sample a gradient of forest degradation at two municipalities (El Cuá and Wiwili) in northern Nicaragua. We measured biomass in trees (≥10 cm DBH), saplings (5-9.9 cm DBH), other growth forms (ferns, palms and woody vines), and large detritus (snags and downed wood). Biomass was estimated by a range of allometric models and a constant conversion factor (0.47) was applied to calculate aboveground carbon stocks. Remote sensing data from a RapidEye scene for 02/2010 provided data for 5 spectral bands and 19 vegetation indexes at 6 m spatial resolution. Precipitation, temperature, altitude, slope, canopy cover, and aspect were also used as input variables for carbon modeling. We tested linear mixed models, generalized additive mixed models and regression tree approaches to explain carbon stocks based on vegetation indexes and biophysical variables. Additionally, we grouped plots into low (17-168 Mg C ha-1), medium (168-302 Mg C ha-1

  10. Monomethylhydrazine degradation and its effect on carbon dioxide evolution and microbial populations in soil

    International Nuclear Information System (INIS)

    Monomethylhydrazine (MMH), along with hydrazine and 1,1-dimethylhydrazine are the main components of hydrazine fuels. Information on the fate of MMH in soil and its overall effect on soil microbial activity is not known, though MMH is known to be toxic to a number of soil bacteria. Despite the fact that axenic bacterial cultures are inhibited by the three hydrazines, Ou and Street reported that soil respiration, and total bacterial and fungal populations in soil, were not inhibited by hydrazine at concentrations of 100 μg/g and lower. Even at 500 μg/g, only total bacterial populations in soil were inhibited by the presence of hydrazine. They also reported that hydrazine rapidly disappeared in soil. The authors initiated this study to investigate the effect of MMH on soil microbial activity and on degradation of the chemical in soil

  11. Thermal oxidation induced degradation of carbon fiber reinforced composites and carbon nanotube sheet enhanced fiber/matrix interface for high temperature aerospace structural applications

    Science.gov (United States)

    Haque, Mohammad Hamidul

    Recent increase in the use of carbon fiber reinforced polymer matrix composite, especially for high temperature applications in aerospace primary and secondary structures along with wind energy and automotive industries, have generated new challenges to predict its failure mechanisms and service life. This dissertation reports the experimental study of a unidirectional carbon fiber reinforced bismaleimide (BMI) composites (CFRC), an excellent candidate for high temperature aerospace components, undergoing thermal oxidation at 260 °C in air for over 3000 hours. The key focus of the work is to investigate the mechanical properties of the carbon fiber BMI composite subjected to thermal aging in three key aspects - first, studying its bulk flexural properties (in macro scale), second, characterizing the crack propagation along the fiber direction, representing the interfacial bonding strength between fiber and matrix (in micro scale), and third, introducing nano-structured materials to modify the interface (in nano scale) between the carbon fiber and BMI resin and mechanical characterization to study its influence on mitigating the aging effect. Under the first category, weight loss and flexural properties have been monitored as the oxidation propagates through the fiber/matrix interface. Dynamic mechanical analysis and micro-computed tomography analysis have been performed to analyze the aging effects. In the second category, the long-term effects of thermal oxidation on the delamination (between the composite plies) and debonding (between fiber and matrix) type fracture toughness have been characterized by preparing two distinct types of double cantilever beam specimens. Digital image correlation has been used to determine the deformation field and strain distribution around the crack propagation path. Finally the resin system and the fiber/matrix interface have been modified using nanomaterials to mitigate the degradations caused by oxidation. Nanoclay modified

  12. Metaproteomics of a gutless marine worm and its symbiotic microbial community reveal unusual pathways for carbon and energy use

    Energy Technology Data Exchange (ETDEWEB)

    Kleiner, Manuel [Max Planck Institute for Marine Microbiology; Wentrop, C. [Max Planck Institute for Marine Microbiology; Lott, C. [Max Planck Institute for Marine Microbiology; Teeling, Hanno [Max Planck Institute for Marine Microbiology; Wetzel, Silke [Max Planck Institute for Marine Microbiology; Young, Jacque C [ORNL; Chang, Y. [Oak Ridge National Laboratory (ORNL); Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Zarzycki, Jan [University of Freiburg, Germany; Fuchs, Georg [University of Freiburg, Germany; Markert, Stephanie [Institute of Marine Biotechnology, Germany; Hempel, Kristina [Institute for Microbiology, Germany

    2012-01-01

    Low nutrient and energy availability has led to the evolution of numerous strategies for overcoming these limitations, of which symbiotic associations represent a key mechanism. Particularly striking are the associations between chemosynthetic bacteria and marine animals that thrive in nutrient-poor environments such as the deep-sea because the symbionts allow their hosts to grow on inorganic energy and carbon sources such as sulfide and CO2. Remarkably little is known about the physiological strategies that enable chemosynthetic symbioses to colonize oligotrophic environments. In this study, we used metaproteomics and metabolomics to investigate the intricate network of metabolic interactions in the chemosynthetic association between Olavius algarvensis, a gutless marine worm, and its bacterial symbionts. We propose novel pathways for coping with energy and nutrient limitation, some of which may be widespread in both free-living and symbiotic bacteria. These include (i) a pathway for symbiont assimilation of the host waste products acetate, propionate, succinate and malate, (ii) the potential use of carbon monoxide as an energy source, a substrate previously not known to play a role in marine invertebrate symbioses, (iii) the potential use of hydrogen as an energy source, (iv) the strong expression of high affinity uptake transporters, and (v) novel energy efficient steps in CO2 fixation and sulfate reduction. The high expression of proteins involved in pathways for energy and carbon uptake and conservation in the O. algarvensis symbiosis indicates that the oligotrophic nature of its environment exerted a strong selective pressure in shaping these associations.

  13. Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways

    Directory of Open Access Journals (Sweden)

    K. Hara

    2008-05-01

    Full Text Available Measurement of black carbon (BC was carried out at Syowa station Antarctica (69° S, 39° E from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m−3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and Indian Oceans to Syowa (Antarctic coast. During the summer (November–February, the BC concentration showed a diurnal variation together with surface wind speed and increased in the katabatic wind from the Antarctic continent. Considering the low BC source strength in the Antarctic continent, the higher BC concentration in the continental air (katabatic wind might be caused by long range transport of BC via the free troposphere from mid- and low- latitudes. The seasonal variation of BC at Syowa had a maximum in August, while at the other coastal stations (Halley, Neumayer, and Ferraz and the continental station (Amundsen-Scott, the maximum occurred in October. This difference may result from different transport pathways and scavenging of BC by precipitation during the transport from the source regions. During the austral summer, long-range transport of BC via the free troposphere is likely to make an important contribution to the ambient BC concentration. The BC transport flux indicated that BC injection into the Antarctic region strongly depended on the frequency of storm (blizzard conditions. The seasonal variation of BC transport flux increased by 290 mg m−2 month−1 in winter–spring when blizzards frequently occurred, whereas the flux decreased to lower than 50 mg m−2 month−1 in the summer with infrequent blizzards.

  14. Pathways to a low-carbon economy for the UK with the macro-econometric E3MG model

    International Nuclear Information System (INIS)

    This paper examines different carbon pathways for achieving deep CO2 reduction targets for the UK using a macro-econometric hybrid model E3MG, which stands for Energy-Economy-Environment Model at the Global level. The E3MG, with the UK as one of its regions, combines a top-down approach for modeling the global economy and for estimating the aggregate and disaggregate energy demand and a bottom-up approach (Energy Technology subModel, ETM) for simulating the power sector, which then provides feedback to the energy demand equations and the whole economy. The ETM submodel uses a probabilistic approach and historical data for estimating the penetration levels of the different technologies, considering their economic, technical and environmental characteristics. Three pathway scenarios (CFH, CLC and CAM) simulate the CO2 reduction by 40%, 60% and 80% by 2050 compared to 1990 levels respectively and are compared with a reference scenario (REF), with no reduction target. The targets are modeled as the UK contribution to an international mitigation effort, such as achieving the G8 reduction targets, which is a more realistic political framework for the UK to move towards deep reductions rather than moving alone. This paper aims to provide modeling evidence that deep reduction targets can be met through different carbon pathways while also assessing the macroeconomic effects of the pathways on GDP and investment.

  15. Heterogeneous photo-Fenton decolorization of Orange II over Al-pillared Fe-smectite: Response surface approach, degradation pathway, and toxicity evaluation

    International Nuclear Information System (INIS)

    Highlights: • Al-pillared Fe-smectite was synthesized and used as the photo-Fenton catalyst. • Response surface methodology was used to study the effects of reaction parameters. • The main intermediate products were identified by GC–MS technique. • A possible degradation pathway of Orange II was proposed. • All the generated products of Orange II were less toxic than the original dye. - Abstract: A ferric smectite clay material was synthesized and further intercalated with Al2O3 pillars for the first time with the aim of evaluating its ability to be used as heterogeneous catalyst for the photo-Fenton decolorization of azo dye Orange II. UV irradiation was found to enhance the activity of the catalyst in the heterogeneous photo-Fenton process. Catalyst loading of 0.5 g/L and hydrogen peroxide concentration of 13.5 mM yielded a remarkable color removal, accompanied by excellent catalyst stability. The decolorization of Orange II followed the pseudo-first-order kinetics for initial dye concentrations from 20 to 160 mg/L. The central composite design (CCD) based on the response surface methodology (RSM) was applied to evaluate the effects of several operating parameters, namely initial pH, catalyst loading and hydrogen peroxide concentration, on the decolorization efficiency. The RSM model was derived and the response surface plots were developed based on the results. Moreover, the main intermediate products were separated and identified using gas chromatography–mass spectrometry (GC–MS) and a possible degradation pathway was proposed accordingly. The acute toxicity experiments illustrated that the Daphniamagna immobilization rate continuously decreased during 150 min reaction, indicating that the effluent was suitable for sequential biological treatment

  16. Heterogeneous photo-Fenton decolorization of Orange II over Al-pillared Fe-smectite: Response surface approach, degradation pathway, and toxicity evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Huiyuan; Li, Yanli [Department of Environmental Engineering, Wuhan University, Wuhan 430079 (China); Xiang, Luojing [Department of Environmental Engineering, Wuhan University, Wuhan 430079 (China); Université de Poitiers, UMR CNRS 7285, IC2MP, ENSIP, B1, 1 rue Marcel Doré, TSA 41105, Poitiers 86073 Cedex 9 (France); Huang, Qianqian; Qiu, Juanjuan [Department of Environmental Engineering, Wuhan University, Wuhan 430079 (China); Zhang, Hui, E-mail: eeng@whu.edu.cn [Department of Environmental Engineering, Wuhan University, Wuhan 430079 (China); Sivaiah, Matte Venkata; Baron, Fabien; Barrault, Joel; Petit, Sabine [Université de Poitiers, UMR CNRS 7285, IC2MP, ENSIP, B1, 1 rue Marcel Doré, TSA 41105, Poitiers 86073 Cedex 9 (France); Valange, Sabine, E-mail: sabine.valange@univ-poitiers.fr [Université de Poitiers, UMR CNRS 7285, IC2MP, ENSIP, B1, 1 rue Marcel Doré, TSA 41105, Poitiers 86073 Cedex 9 (France)

    2015-04-28

    Highlights: • Al-pillared Fe-smectite was synthesized and used as the photo-Fenton catalyst. • Response surface methodology was used to study the effects of reaction parameters. • The main intermediate products were identified by GC–MS technique. • A possible degradation pathway of Orange II was proposed. • All the generated products of Orange II were less toxic than the original dye. - Abstract: A ferric smectite clay material was synthesized and further intercalated with Al{sub 2}O{sub 3} pillars for the first time with the aim of evaluating its ability to be used as heterogeneous catalyst for the photo-Fenton decolorization of azo dye Orange II. UV irradiation was found to enhance the activity of the catalyst in the heterogeneous photo-Fenton process. Catalyst loading of 0.5 g/L and hydrogen peroxide concentration of 13.5 mM yielded a remarkable color removal, accompanied by excellent catalyst stability. The decolorization of Orange II followed the pseudo-first-order kinetics for initial dye concentrations from 20 to 160 mg/L. The central composite design (CCD) based on the response surface methodology (RSM) was applied to evaluate the effects of several operating parameters, namely initial pH, catalyst loading and hydrogen peroxide concentration, on the decolorization efficiency. The RSM model was derived and the response surface plots were developed based on the results. Moreover, the main intermediate products were separated and identified using gas chromatography–mass spectrometry (GC–MS) and a possible degradation pathway was proposed accordingly. The acute toxicity experiments illustrated that the Daphniamagna immobilization rate continuously decreased during 150 min reaction, indicating that the effluent was suitable for sequential biological treatment.

  17. Thermal Degradation Behavior of Siloxane Elastomer Impregnated Carbon Nanotube Areogel Networks

    Energy Technology Data Exchange (ETDEWEB)

    Lewicki, J P; Worsley, M A

    2010-12-13

    A novel class of nanoporous graphitic carbon foams has been synthesized. Unprecedented properties - electrically conductive, thermally stable (> 1000 C), and mechanically robust. Improved transport properties (DWNT-CA, SWNT-CA) - greater than 100% enhancement in thermal conductivity, 100-400% improvement in electrical conductivity. Rich mechanical deformation behavior (SWNT-CA) - stiff ({approx}100% improvement of elastic modulus), energy dissipation, fracture toughness, and fatigue behavior. Implications for energy-related technologies - hydrogen storage, fusion and fission energy, catalysis, electrochemical energy storage, and composites with foam scaffolds.

  18. Soil Degradation and Global Change: Role of Soil Erosion and Deposition in Carbon Sequestration

    OpenAIRE

    Berhe, Asmeret Asefaw; Harden, Jennifer W.; Harte, John; Torn, Margaret S.

    2005-01-01

    Soil erosion and terrestrial sedimentation are important variables in global change science. Erosion is estimated to transport more than 100 Gt soil yr-1; 70 to 90-percent of which is deposited in depositional basins within the same or adjacent toposequence. Terrestrial sedimentation may constitute a sink of up to 1 Gt C yr-1 (missing Carbon (C)-sink = 1.8 (+/- 1.2) Gt C yr-1), which would offset up to 15-percent of global fossil fuel emissions. Our study characterized the rates of input, st...

  19. Specific Hsp100 Chaperones Determine the Fate of the First Enzyme of the Plastidial Isoprenoid Pathway for Either Refolding or Degradation by the Stromal Clp Protease in Arabidopsis.

    Science.gov (United States)

    Pulido, Pablo; Llamas, Ernesto; Llorente, Briardo; Ventura, Salvador; Wright, Louwrance P; Rodríguez-Concepción, Manuel

    2016-01-01

    The lifespan and activity of proteins depend on protein quality control systems formed by chaperones and proteases that ensure correct protein folding and prevent the formation of toxic aggregates. We previously found that the Arabidopsis thaliana J-protein J20 delivers inactive (misfolded) forms of the plastidial enzyme deoxyxylulose 5-phosphate synthase (DXS) to the Hsp70 chaperone for either proper folding or degradation. Here we show that the fate of Hsp70-bound DXS depends on pathways involving specific Hsp100 chaperones. Analysis of individual mutants for the four Hsp100 chaperones present in Arabidopsis chloroplasts showed increased levels of DXS proteins (but not transcripts) only in those defective in ClpC1 or ClpB3. However, the accumulated enzyme was active in the clpc1 mutant but inactive in clpb3 plants. Genetic evidence indicated that ClpC chaperones might be required for the unfolding of J20-delivered DXS protein coupled to degradation by the Clp protease. By contrast, biochemical and genetic approaches confirmed that Hsp70 and ClpB3 chaperones interact to collaborate in the refolding and activation of DXS. We conclude that specific J-proteins and Hsp100 chaperones act together with Hsp70 to recognize and deliver DXS to either reactivation (via ClpB3) or removal (via ClpC1) depending on the physiological status of the plastid. PMID:26815787

  20. Degradation pathway, toxicity and kinetics of 2,4,6-trichlorophenol with different co-substrate by aerobic granules in SBR.

    Science.gov (United States)

    Khan, Mohammad Zain; Mondal, Pijush Kanti; Sabir, Suhail; Tare, Vinod

    2011-07-01

    The present study deals with cultivation of 2,4,6-trichlorophenol (TCP) degrading aerobic granules in two SBR systems based on glucose and acetate as co-substrate. Biodegradation of TCP containing wastewater starting from 10 to 360 mg L(-1) with more than 90% efficiency was achieved. Sludge volume index decreases as the operation proceeds to stabilize at 35 and 30 mL g(-1) while MLVSS increases from 4 to 6.5 and 6.2 g L(-1) for R1 (with glucose as co-substrate) and R2 (with sodium acetate as co-substrate), respectively. FTIR, GC and GC/MS spectral studies shows that the biodegradation occurred via chlorocatechol pathway and the cleavage may be at ortho-position. Haldane model for inhibitory substrate was applied to the system and it was observed that glucose fed granules have a high specific degradation rate and efficiency than acetate fed granules. Genotoxicity studies shows that effluent coming from SBRs was non-toxic. PMID:21565491

  1. ESCRT-0 dysfunction compromises autophagic degradation of protein aggregates and facilitates ER stress-mediated neurodegeneration via apoptotic and necroptotic pathways

    Science.gov (United States)

    Oshima, Ryuji; Hasegawa, Takafumi; Tamai, Keiichi; Sugeno, Naoto; Yoshida, Shun; Kobayashi, Junpei; Kikuchi, Akio; Baba, Toru; Futatsugi, Akira; Sato, Ikuro; Satoh, Kennichi; Takeda, Atsushi; Aoki, Masashi; Tanaka, Nobuyuki

    2016-01-01

    Endosomal sorting required for transport (ESCRT) complexes orchestrate endo-lysosomal sorting of ubiquitinated proteins, multivesicular body formation and autophagic degradation. Defects in the ESCRT pathway have been implicated in many neurodegenerative diseases, but the underlying molecular mechanisms that link them to neurodegeneration remain unknown. In this study, we showed that forebrain-specific ablation of ESCRT-0/Hrs induced marked hippocampal neuronal cell loss accompanied by the accumulation of ubiquitinated proteins, including α-synuclein, TDP-43 and huntingtin as well as the autophagic substrate SQSTM1/p62. Consistent with this, silencing of Hrs in cultured cells not only led to α-synuclein and TDP-43 accumulation in addition to impaired autophagic flux but also suppressed cell viability through the induction of ER stress followed by the activation of JNK and RIPK1, a key regulator of necroptosis. Moreover, necrostatin-1, a specific inhibitor of RIPK1, and pan-caspase inhibitors partially reduced the neurotoxicity in the Hrs-silenced cells. Altogether, these findings suggest that the disruption of ESCRT-0/Hrs in the nervous system compromises autophagic/lysosomal degradation of neurodegenerative disease-related proteins, which thereby triggers ER stress-mediated apoptotic and necroptotic cell death. PMID:27112194

  2. Specific Hsp100 Chaperones Determine the Fate of the First Enzyme of the Plastidial Isoprenoid Pathway for Either Refolding or Degradation by the Stromal Clp Protease in Arabidopsis

    Science.gov (United States)

    Pulido, Pablo; Llamas, Ernesto; Llorente, Briardo; Ventura, Salvador; Wright, Louwrance P.; Rodríguez-Concepción, Manuel

    2016-01-01

    The lifespan and activity of proteins depend on protein quality control systems formed by chaperones and proteases that ensure correct protein folding and prevent the formation of toxic aggregates. We previously found that the Arabidopsis thaliana J-protein J20 delivers inactive (misfolded) forms of the plastidial enzyme deoxyxylulose 5-phosphate synthase (DXS) to the Hsp70 chaperone for either proper folding or degradation. Here we show that the fate of Hsp70-bound DXS depends on pathways involving specific Hsp100 chaperones. Analysis of individual mutants for the four Hsp100 chaperones present in Arabidopsis chloroplasts showed increased levels of DXS proteins (but not transcripts) only in those defective in ClpC1 or ClpB3. However, the accumulated enzyme was active in the clpc1 mutant but inactive in clpb3 plants. Genetic evidence indicated that ClpC chaperones might be required for the unfolding of J20-delivered DXS protein coupled to degradation by the Clp protease. By contrast, biochemical and genetic approaches confirmed that Hsp70 and ClpB3 chaperones interact to collaborate in the refolding and activation of DXS. We conclude that specific J-proteins and Hsp100 chaperones act together with Hsp70 to recognize and deliver DXS to either reactivation (via ClpB3) or removal (via ClpC1) depending on the physiological status of the plastid. PMID:26815787

  3. Electroacupuncture inhibits apoptosis in annulus fibrosis cells through suppression of the mitochondria-dependent pathway in a rat model of cervical intervertebral disc degradation

    Directory of Open Access Journals (Sweden)

    Jun Liao

    2012-01-01

    Full Text Available The purpose of this study was to investigate whether treatment with electroacupuncture (EA inhibited mitochondria-dependent apoptosis in annulus fibrosis (AF cells in a rat model of cervical intervertebral disc degradation induced by unbalanced dynamic and static forces. Forty Sprague-Dawley rats were used in this study, of which 30 underwent surgery to induce cervical intervertebral disc degradation, 10 rats received EA at acupoints Dazhui (DU 14 and Shousanli (LI 10. TUNEL staining was measured to assess apoptosis in AF cells, immunohistochemistry was used to examine Bcl-2 and Bax expression, colorimetric assays were used to determine caspase 9 and caspase 3 activities and RT-PCR and western blotting were used to assess the mRNA and protein expression of Crk and ERK2. Treatment with EA reduced the number of AF-positive cells in TUNEL staining, increased Bcl-2-positive cells and decreased Bax-positive cells in immunohistochemical staining, significantly inhibited the activation of caspases-9 and -3, and enhanced the mRNA and protein expression of Crk and ERK2. Our data show that EA inhibits AF cell apoptosis via the mitochondria-dependent pathway and up-regulates Crk and ERK2 expression. These results suggest that treatment with may be a good alternative therapy for preventing cervical spondylosis.

  4. Elementary Flux Mode Analysis Revealed Cyclization Pathway as a Powerful Way for NADPH Regeneration of Central Carbon Metabolism.

    Directory of Open Access Journals (Sweden)

    Bin Rui

    Full Text Available NADPH regeneration capacity is attracting growing research attention due to its important role in resisting oxidative stress. Besides, NADPH availability has been regarded as a limiting factor in production of industrially valuable compounds. The central carbon metabolism carries the carbon skeleton flux supporting the operation of NADPH-regenerating enzyme and offers flexibility in coping with NADPH demand for varied intracellular environment. To acquire an insightful understanding of its NADPH regeneration capacity, the elementary mode method was employed to compute all elementary flux modes (EFMs of a network representative of central carbon metabolism. Based on the metabolic flux distributions of these modes, a cluster analysis of EFMs with high NADPH regeneration rate was conducted using the self-organizing map clustering algorithm. The clustering results were used to study the relationship between the flux of total NADPH regeneration and the flux in each NADPH producing enzyme. The results identified several reaction combinations supporting high NADPH regeneration, which are proven to be feasible in cells via thermodynamic analysis and coincident with a great deal of previous experimental report. Meanwhile, the reaction combinations showed some common characteristics: there were one or two decarboxylation oxidation reactions in the combinations that produced NADPH and the combination constitution included certain gluconeogenesis pathways. These findings suggested cyclization pathways as a powerful way for NADPH regeneration capacity of bacterial central carbon metabolism.

  5. Improved constraints on in situ rates and on quantification of complete chloroethene degradation from stable carbon isotope mass balances in groundwater plumes

    Science.gov (United States)

    Höhener, Patrick; Elsner, Martin; Eisenmann, Heinrich; Atteia, Olivier

    2015-11-01

    Spills of chloroethenes (CEs) at industrial and urban sites can create groundwater plumes in which tetrachloro- and trichloroethene sequentially degrade to dichloroethenes, vinyl chloride (VC) and ethene, or ethane under reducing conditions. For detoxification, degradation must go beyond VC. Assessments based on ethene and ethane, however, are difficult because these products are volatile, may stem from alternative sources, can be further transformed and are not always monitored. To alternatively quantify degradation beyond VC, stable carbon isotope mass balances have been proposed where concentration-weighted CE isotope ratios are summed up and compared to the original source isotope ratio. Reported assessments, however, have provided not satisfactorily quantified results entailing greatly differing upper and lower estimates. This work proposes an integrative approach to better constrain the extent of total chloroethene degradation in groundwater samples. It is based on fitting of measured concentration and compound-specific stable carbon isotope data to an analytical reactive transport equation simulating steady-state plumes in two dimensions using an EXCEL spreadsheet. The fitting also yields estimates of degradation rates, of source width and of dispersivities. The approach is validated using two synthetic benchmark cases where the true extent of degradation is well known, and using data from two real field cases from literature.

  6. Hyphenation of infrared spectroscopy to liquid chromatography for qualitative and quantitative polymer analysis: Degradation of poly(bisphenol A)carbonate

    NARCIS (Netherlands)

    Coulier, L.; Kaal, E.; Hankemeier, T.

    2006-01-01

    Hyphenation of infrared spectroscopy (IR) to liquid chromatography (LC) has been applied to study chemical changes in poly(bisphenol A)carbonate (PC) as a result of degradation. Especially coupling of LC to FTIR through solvent elimination is a sensitive approach to identify changes in functionality

  7. Stimulatory effects of the degradation products from Mg-Ca-Sr alloy on the osteogenesis through regulating ERK signaling pathway

    Science.gov (United States)

    Li, Mei; He, Peng; Wu, Yuanhao; Zhang, Yu; Xia, Hong; Zheng, Yufeng; Han, Yong

    2016-01-01

    The influence of Mg-1Ca-xwt.% Sr (x = 0.2, 0.5, 1.0, 2.0) alloys on the osteogenic differentiation and mineralization of pre-osteoblast MC3T3-E1 were studied through typical differentiation markers, such as intracellular alkaline phosphatase (ALP) activity, extracellular collagen secretion and calcium nodule formation. It was shown that Mg-1Ca alloys with different content of Sr promoted cell viability and enhanced the differentiation and mineralization levels of osteoblasts, and Mg-1Ca-2.0Sr alloy had the most remarkable and significant effect among all. To further investigate the underlying mechanisms, RT-PCR and Western Blotting assays were taken to analyze the mRNA expression level of osteogenesis-related genes and intracellular signaling pathways involved in osteogenesis, respectively. RT-PCR results showed that Mg-1Ca-2.0Sr alloy significantly up-regulated the expressions of the transcription factors of Runt-related transcription factor 2 (RUNX2) and Osterix (OSX), Integrin subunits, as well as alkaline phosphatase (ALP), Bone sialoprotein (BSP), Collagen I (COL I), Osteocalcin (OCN) and Osteopontin (OPN). Western Blotting results suggested that Mg-1Ca-2.0Sr alloy rapidly induced extracellular signal-regulated kinase (ERK) activation but showed no obvious effects on c-Jun N terminal kinase (JNK) and p38 kinase of MAPK. Taken together, our results demonstrated that Mg-1Ca-2.0Sr alloy had excellent biocompatibility and osteogenesis via the ERK pathway and is expected to be promising as orthopedic implants and bone repair materials. PMID:27580744

  8. Species-specific diversity of novel bacterial lineages and differential abundance of predicted pathways for toxic compound degradation in scorpion gut microbiota.

    Science.gov (United States)

    Bolaños, Luis M; Rosenblueth, Mónica; Castillo-Ramírez, Santiago; Figuier-Huttin, Gilles; Martínez-Romero, Esperanza

    2016-05-01

    Scorpions are considered 'living fossils' that have conserved ancestral anatomical features and have adapted to numerous habitats. However, their gut microbiota diversity has not been studied. Here, we characterized the gut microbiota of two scorpion species, Vaejovis smithi and Centruroides limpidus. Our results indicate that scorpion gut microbiota is species-specific and that food deprivation reduces bacterial diversity. 16S rRNA gene phylogenetic analysis revealed novel bacterial lineages showing a low level of sequence identity to any known bacteria. Furthermore, these novel bacterial lineages were each restricted to a different scorpion species. Additionally, our results of the predicted metagenomic profiles revealed a core set of pathways that were highly abundant in both species, and mostly related to amino acid, carbohydrate, vitamin and cofactor metabolism. Notably, the food-deprived V. smithi shotgun metagenome matched almost completely the metabolic features of the prediction. Finally, comparisons among predicted metagenomic profiles showed that toxic compound degradation pathways were more abundant in recently captured C. limpidus scorpions. This study gives a first insight into the scorpion gut microbiota and provides a reference for future studies on the gut microbiota from other arachnid species. PMID:26058415

  9. A Numerical Study of the Effect of Periodic Nutrient Supply on Pathways of Carbon in a Coastal Upwelling Regime

    Science.gov (United States)

    Carr, Mary-Elena

    1998-01-01

    A size-based ecosystem model was modified to include periodic upwelling events and used to evaluate the effect of episodic nutrient supply on the standing stock, carbon uptake, and carbon flow into mesozooplankton grazing and sinking flux in a coastal upwelling regime. Two ecosystem configurations were compared: a single food chain made up of net phytoplankton and mesozooplankton (one autotroph and one heterotroph, A1H1), and three interconnected food chains plus bacteria (three autotrophs and four heterotrophs, A3H4). The carbon pathways in the A1H1 simulations were under stronger physical control than those of the A3H4 runs, where the small size classes are not affected by frequent upwelling events. In the more complex food web simulations, the microbial pathway determines the total carbon uptake and grazing rates, and regenerated nitrogen accounts for more than half of the total primary production for periods of 20 days or longer between events. By contrast, new production, export of carbon through sinking and mesozooplankton grazing are more important in the A1H1 simulations. In the A3H4 simulations, the turnover time scale of the autotroph biomass increases as the period between upwelling events increases, because of the larger contribution of slow-growing net phytoplankton. The upwelling period was characterized for three upwelling sites from the alongshore wind speed measured by the NASA Scatterometer (NSCAT) and the corresponding model output compared with literature data. This validation exercise for three upwelling sites and a downstream embayment suggests that standing stock, carbon uptake and size fractionation were best supported by the A3H4 simulations, while the simulated sinking fluxes are not distinguishable in the two configurations.

  10. Sonolytic degradation of 2-chlorobiphenyl

    Institute of Scientific and Technical Information of China (English)

    张光明; 华天星; 常爱敏

    2004-01-01

    The sonolytic degradation of 2-chlorobiphenyl was investigated. Mass spectroscopy was used to detect the products of sonolytic degradation of 2-chlorobiphenyl. The results show that the products of sonolytic degradation, such as biphenyl, ethyl benzene, diethylbiphenyl, dibutylbiphenyl, phenol, propylphenol and di-tert-butyl phenol are produced by thermolysis and hydroxyl free radical reactions, in which biphenyl counts for almost 40%(mole fraction) of the mother compound and others are at trace level. Rapid accumulation of chloride ion shows quick dechlorination, and 78% organic chlorine is converted into chloride ion. Free radical scavengers, bicarbonate and carbonate, decrease the reaction rate of sonolytic degradation of 2-chlorobiphenyl significantly, and the pseudo 1st order rate constant of sonolytic degradation of 2-chlorobiphenyl decreases linearly with the natural logarithm of the concentration of the added free radical scavenger, showing that the pyrolysis and hydroxyl free radical reaction are the two major pathways for the sonolytic degradation of 2-chlorobiphenyl, in which the hydroxyl radical concentration is estimated to be 1 × 10 10mol/L.

  11. Abiotic Degradation Rates for Carbon Tetrachloride and Chloroform: Progress in FY2009

    Energy Technology Data Exchange (ETDEWEB)

    Amonette, James E.; Jeffers, Peter M.; Qafoku, Odeta; Russell, Colleen K.; Wietsma, Thomas W.; Truex, Michael J.

    2010-03-31

    This report documents the progress made through FY 2009 on a project initiated in FY 2006 to help address uncertainties related to the rates of hydrolysis in groundwater for carbon tetrachloride (CT) and chloroform (CF). The study seeks also to explore the possible effects of contact with minerals and sediment (i.e., heterogeneous hydrolysis) on these rates. In previous years the work was funded as two separate projects by various sponsors, all of whom received their funding from the U.S. Department of Energy (DOE). In FY2009, the projects were combined and funded by CH2MHill Plateau Remediation Corporation (CHPRC). Work in FY2009 was performed by staff at the Pacific Northwest National Laboratory (PNNL). Staff from the State University of New York at Cortland (SUNY–Cortland) contributed in previous years.

  12. Promoted degradation of perfluorooctanic acid by persulfate when adding activated carbon

    International Nuclear Information System (INIS)

    Highlights: • PFOA removal and defluorination with AC/PS are 12 and 19 times higher than PS only • AC can activate PS to accelerate the decomposition and mineralization of PFOA. • With AC/PS, a lower reaction temperature and a shorter reaction time would suffice • A 2-cycle schematic reaction mechanism was proposed to describe PS oxidation of PFOA. -- Abstract: Treatment of persistent perfluorooctanoic acid (PFOA) in water using persulfate (PS) oxidation typically requires an elevated temperature or UV irradiation, which is energy-consuming. Under relatively low temperatures of 25–45 °C, activated carbon (AC) activated PS oxidation of PFOA was evaluated for its potential of practical applications. With presence of AC in PS oxidation, PFOA removal efficiency at 25 °C reached 682% with a high defluorination efficiency of 549% after 12 h and few intermediates of short-chain perfluorinated carboxylic acids (PFCAs) were found. The removal and defluorination rates with the combined AC/PS system were approximately 12 and 19 times higher than those of the PS-only system, respectively. Activated carbon not only removes PFOA through adsorption, but also activates PS to form sulfate radicals that accelerate the decomposition and mineralization of PFOA. The activation energy for PS oxidation of PFOA was reduced from 668 to 261 kJ/mol by the catalytic effect of AC, which implies a lower reaction temperature and a shorter reaction time would suffice. A 2-cycle schematic reaction mechanism was used to describe PS oxidation of PFOA with the generation of various intermediates and end-products

  13. Promoted degradation of perfluorooctanic acid by persulfate when adding activated carbon

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yu-Chi [Research Center for Environmental Pollution Prevention and Control Technology, Graduate Institute of Environmental Engineering, National Taiwan University, 71, Chou-Shan Rd., Taipei 106, Taiwan, ROC (China); Lo, Shang-Lien, E-mail: sllo@ntuedu.tw [Research Center for Environmental Pollution Prevention and Control Technology, Graduate Institute of Environmental Engineering, National Taiwan University, 71, Chou-Shan Rd., Taipei 106, Taiwan, ROC (China); Kuo, Jeff [Department of Civil and Environmental Engineering, California State University, 800 North, State College Blvd., Fullerton (United States); Huang, Chin-Pao [Department of Civil and Environmental Engineering, University of Delaware, Newark, DE 19716 (United States)

    2013-10-15

    Highlights: • PFOA removal and defluorination with AC/PS are 12 and 19 times higher than PS only • AC can activate PS to accelerate the decomposition and mineralization of PFOA. • With AC/PS, a lower reaction temperature and a shorter reaction time would suffice • A 2-cycle schematic reaction mechanism was proposed to describe PS oxidation of PFOA. -- Abstract: Treatment of persistent perfluorooctanoic acid (PFOA) in water using persulfate (PS) oxidation typically requires an elevated temperature or UV irradiation, which is energy-consuming. Under relatively low temperatures of 25–45 °C, activated carbon (AC) activated PS oxidation of PFOA was evaluated for its potential of practical applications. With presence of AC in PS oxidation, PFOA removal efficiency at 25 °C reached 682% with a high defluorination efficiency of 549% after 12 h and few intermediates of short-chain perfluorinated carboxylic acids (PFCAs) were found. The removal and defluorination rates with the combined AC/PS system were approximately 12 and 19 times higher than those of the PS-only system, respectively. Activated carbon not only removes PFOA through adsorption, but also activates PS to form sulfate radicals that accelerate the decomposition and mineralization of PFOA. The activation energy for PS oxidation of PFOA was reduced from 668 to 261 kJ/mol by the catalytic effect of AC, which implies a lower reaction temperature and a shorter reaction time would suffice. A 2-cycle schematic reaction mechanism was used to describe PS oxidation of PFOA with the generation of various intermediates and end-products.

  14. Methane and carbon dioxide production from simulated anaerobic degradation of cattle carcasses

    International Nuclear Information System (INIS)

    Highlights: ► This study evaluates methane and carbon dioxide production after land burial of cattle carcasses. ► Disposal of animal mortalities is often overlooked in evaluating the environmental impacts of animal production. ► we quantify annual emissions from cattle carcass disposal in the United States as 1.6 Tg CO2 equivalents. - Abstract: Approximately 2.2 million cattle carcasses require disposal annually in the United States. Land burial is a convenient disposal method that has been widely used in animal production for disposal of both daily mortalities as well as during catastrophic mortality events. To date, greenhouse gas production after mortality burial has not been quantified, and this study represents the first attempt to quantify greenhouse gas emissions from land burial of animal carcasses. In this study, anaerobic decomposition of both homogenized and unhomogenized cattle carcass material was investigated using bench-scale reactors. Maximum yields of methane and carbon dioxide were 0.33 and 0.09 m3/kg dry material, respectively, a higher methane yield than that previously reported for municipal solid waste. Variability in methane production rates were observed over time and between reactors. Based on our laboratory data, annual methane emissions from burial of cattle mortalities in the United States could total 1.6 Tg CO2 equivalents. Although this represents less than 1% of total emissions produced by the agricultural sector in 2009, greenhouse gas emissions from animal carcass burial may be significant if disposal of swine and poultry carcasses is also considered.

  15. Degradation State and Sequestration Potential of Carbon in Coastal Wetlands of Texas: Mangrove Vs. Saltmarsh Ecosystems

    Science.gov (United States)

    Sterne, A. M. E.; Kaiser, K.; Louchouarn, P.; Norwood, M. J.

    2015-12-01

    The estimated magnitude of the organic carbon (OC) stocks contained in the first meter of US coastal wetland soils represents ~10% of the entire OC stock in US soils (4 vs. 52 Pg, respectively). Because this stock extends to several meters below the surface for many coastal wetlands, it becomes paramount to understand the fate of OC under ecosystem shifts, varying natural environmental constraints, and changing land use. In this project we analyze the major classes of biochemicals including total hydrolysable neutral carbohydrates, enantiomeric amino acids, phenols, and cutins/suberins at two study sites located on the Texas coastline to investigate chemical composition and its controls on organic carbon preservation in mangrove (Avicennia germinans) and saltmarsh grass (Spartina alterniflora) dominated wetlands. Results show neutral carbohydrates and lignin contribute 30-70% and 10-40% of total OC, respectively, in plant litter and surface sediments at both sites. Sharp declines of carbohydrate yields with depth occur parallel to increasing Ac/AlS,V ratios indicating substantial decomposition of both the polysaccharide and lignin components of litter detritus. Contrasts in the compositions and relative abundances of all previously mentioned compound classes are further discussed to examine the role of litter biochemistry in OC preservation. For example, the selective preservation of cellulose over hemicellulose in sediments indicates macromolecular structure plays a key role in preservation between plant types. It is concluded that the chemical composition of litter material controls the composition and magnitude of OC stored in sediments. Ultimately, as these ecosystems transition from one dominant plant type to another, as is currently observed along the Texas coastline, there is the potential for OC sequestration efficiency to shift due to the changing composition of OC input to sediments.

  16. Installing artificial macropores in degraded soils to enhance vertical infiltration and increase soil carbon content

    Science.gov (United States)

    Mori, Yasushi; Fujihara, Atsushi; Yamagishi, Kazuto

    2014-12-01

    Of all terrestrial media (including vegetation and the atmosphere), soil is the largest store of carbon. Soils also have important functions such as water storage and plant support roles. However, at present, these characteristics do not fully function, because of, for example, climate-change-induced heavy rainfall would wash away the organic-rich surface soils. In this study, artificial macropores were introduced into exposed soil plots for the purpose of enhancing infiltration, and fibrous material was inserted to reinforce the macropore structure. As expected, the capillary force caused by the fibers drew surface water deeper into the soil profile before saturation. Additionally, the same capillary force promoted vertical transport, while micropores (matrix) enhanced horizontal flow. Our results show that infiltration was more effective in the fiber-containing macropores than in empty macropores. Additionally, our column experiments showed that artificial macropores reduced surface runoff when the rainfall intensities were 2, 4, and 20 mm · h-1 but not for 80 mm · h-1. In field experiments, soil moisture sensors installed at depths of 10, 30, and 50 cm responded well to rainfall, showing that artificial macropores were able to successfully introduce surface water into the soil profile. One year after the artificial macropores were installed, a field survey carried out to assess soil organic matter and plant growth showed that plant biomass had doubled and that there was a significant increase in soil carbon. This novel technique has many advantages as it mimics natural processes, is low cost, and has a simple structure.

  17. Copper-promoted circumneutral activation of H2O2 by magnetic CuFe2O4 spinel nanoparticles: Mechanism, stoichiometric efficiency, and pathway of degrading sulfanilamide.

    Science.gov (United States)

    Feng, Yong; Liao, Changzhong; Shih, Kaimin

    2016-07-01

    To evaluate the heterogeneous degradation of sulfanilamide by external energy-free Fenton-like reactions, magnetic CuFe2O4 spinel nanoparticles (NPs) were synthesized and used as catalysts for activation of hydrogen peroxide (H2O2). The physicochemical properties of the CuFe2O4 NPs were characterized with several techniques, including X-ray diffraction, X-ray photoelectron spectroscopy, transmission electron microscopy, and magnetometry. In the catalytic experiments, CuFe2O4 NPs/H2O2 oxidation showed the best degradation performance in the circumneutral conditions that resulted from the presence of Cu(II) on the surface of the CuFe2O4 NPs. The surface area-normalized pseudo-first-order rate constants were calculated as 2.60 × 10(-2) L m(-1) min(-1), 2.58 × 10(-3) L m(-1) min(-1), 1.92 × 10(-3) L m(-1) min(-1), and 7.30 × 10(-4) L m(-1) min(-1) for CuO, CuFe2O4 NPs, Fe3O4, and α-Fe2O3 catalysts, respectively. Thus, solid state Cu(II) was more reactive and efficient than Fe(III) in the circumneutral activation of H2O2; this finding was further supported by the results regarding the stoichiometric efficiency of H2O2. The effects of experimental parameters such as the oxidant dosage and catalyst loading were investigated. The mechanism for H2O2 activation on the spinel surface was explored and could be explained by the solid redox cycles of Fe(II)/Fe(III) and Cu(II)/Cu(I). Based on the products detected, a degradation pathway via the CS bond cleavage is proposed for the degradation of sulfanilamide. The findings of this study suggest that copper can be used as a doping metal to improve the reactivity and expand the effective pH range of iron oxides. PMID:27085318

  18. Chlorophyll catabolism in senescing plant tissues: In vivo breakdown intermediates suggest different degradative pathways for Citrus fruit and parsley leaves.

    Science.gov (United States)

    Amir-Shapira, D; Goldschmidt, E E; Altman, A

    1987-04-01

    High-pressure liquid chromatography was used to separate chlorophyll derivatives in acetone extracts from senescing Citrus fruit peel, autumnal Melia azedarach L. leaves, and dark-held detached parsley (Petroselinum sativum L.) leaves. Chlorophyllide a and another polar, dephytylated derivative accumulated in large amounts in senescing Citrus peel, particularly in fruit treated with ethylene. Ethylene also induced a 4-fold increase in the specific activity of Citrus chlorophyllase (chlorophyll chlorophyllidohydrolase, EC 3.1.1.14). Detailed kinetics based on a hexane/acetone solvent partition system showed that the in vivo increase in dephytylated derivatives coincided with the decrease in total chlorophyll. Polar, dephytylated derivatives accumulated also in senescing Melia leaves. Senescing parsley leaves revealed a very different picture. The gradual disappearance of chlorophyll a was accompanied by an increase in pheophytin a and by the transient appearance of several phytylated derivatives. Only pheophytin a and an adjacent peak were left when all the chlorophyll a had disappeared. The pathways for breakdown of chlorophyll in the Citrus and parsley senescence systems are discussed. PMID:16593821

  19. Biosurfactant production from marine hydrocarbon-degrading consortia and pure bacterial strains using crude oil as carbon source

    Science.gov (United States)

    Antoniou, Eleftheria; Fodelianakis, Stilianos; Korkakaki, Emmanouela; Kalogerakis, Nicolas

    2015-01-01

    Biosurfactants (BSs) are “green” amphiphilic molecules produced by microorganisms during biodegradation, increasing the bioavailability of organic pollutants. In this work, the BS production yield of marine hydrocarbon degraders isolated from Elefsina bay in Eastern Mediterranean Sea has been investigated. The drop collapse test was used as a preliminary screening test to confirm BS producing strains or mixed consortia. The community structure of the best consortia based on the drop collapse test was determined by 16S-rDNA pyrotag screening. Subsequently, the effect of incubation time, temperature, substrate and supplementation with inorganic nutrients, on BS production, was examined. Two types of BS – lipid mixtures were extracted from the culture broth; the low molecular weight BS Rhamnolipids and Sophorolipids. Crude extracts were purified by silica gel column chromatography and then identified by thin layer chromatography and Fourier transform infrared spectroscopy. Results indicate that BS production yield remains constant and low while it is independent of the total culture biomass, carbon source, and temperature. A constant BS concentration in a culture broth with continuous degradation of crude oil (CO) implies that the BS producing microbes generate no more than the required amount of BSs that enables biodegradation of the CO. Isolated pure strains were found to have higher specific production yields than the complex microbial marine community-consortia. The heavy oil fraction of CO has emerged as a promising substrate for BS production (by marine BS producers) with fewer impurities in the final product. Furthermore, a particular strain isolated from sediments, Paracoccus marcusii, may be an optimal choice for bioremediation purposes as its biomass remains trapped in the hydrocarbon phase, not suffering from potential dilution effects by sea currents. PMID:25904907

  20. Biological phosphate removal using a degradable carbon source produced by hydrothermal treatment of excess sludge

    Directory of Open Access Journals (Sweden)

    L. H. Haraguchi

    2006-03-01

    Full Text Available The possibility of reusing excess sludge treated by hydrothermal reaction for the purpose of improving the efficiency of the enhanced biological phosphate removal (EBPR process was investigated. Excess sludge from a fish-processing industry located in Japan was treated in high-temperature and high-pressure water, at a reaction temperature ranging from 200 to 400ºC, a pressure of 1.8 to 30MPa and a constant reaction time of 7 min. For the conditions tested, the results showed that when the reaction temperature was increased the content of readily biodegradable substrate in the total COD Cr increased. In addition, the amount of some volatile fatty acids (VFAs produced by the hydrothermal reaction increased as reaction temperature increased. From the phosphate release tests under anaerobic conditions, it was possible to demonstrate that not only the VFAs, but also the readily and slowly biodegradable substrates are used as potential carbon source by the phosphate-accumulating organisms (PAOs.

  1. Impacts of rewetting on hydrological functioning and dissolved organic carbon flux in a degraded peatland (La Guette, France)

    Science.gov (United States)

    Bernard-Jannin, Léonard; Binet, Stéphane; Gogo, Sébastien; Lemoing, Franck; Zocatelli, Renata; Jozja, Nevila; Défarge, Christian; Laggoun-Défarge, Fatima

    2016-04-01

    In Sphagnum-dominated peatlands, dissolved organic carbon (DOC) fluxes are mainly controlled by peat water saturation state corresponding to the equilibrium between recharge/drainage fluxes and to the peat storage capacity. Rewetting is a wide spread method that has been used for restoring the global hydrological behavior of degraded peatland ecosystems. Therefore, there is a need to assess the impact of rewetting on peatland hydrology but also on the modification of dynamics and DOC fluxes that significantly impact on carbon sink function of these ecosystems. To investigate this question, meteorology, hydrological data, DOC concentrations and dissolved organic matter (DOM) quality (aromaticity and fluorescence) were monthly monitored at the watershed scales and in two piezometer transects since 2010 in a hydrologically disturbed peatland, La Guette, which experienced a rewetting action on February 2014. One piezometer transect (called downstream plots) was supposedly influenced by the hydrological restoration while the other (called upstream plots) was considered as a control. Collected data allowed studying the impact of the restoration on hydrology and dynamics and DOC fluxes in the peatland. Preliminary results indicate that water table level became more stable after the rewetting in the area affected by the restoration. This seems to have an impact on DOC quantity and quality since concentrations became higher in the same area with also a higher aromaticity degree and a larger proportion of low-weight molecules compared to upstream area. This could indicate that in the downstream area, more anaerobic conditions inhibit microorganism activity responsible for the mineralization of peat organic matter.

  2. IL-1-induced ERK1/2 activation up-regulates p21Waf1/Cip1 protein by inhibition of degradation via ubiquitin-independent pathway in human melanoma cells A375

    International Nuclear Information System (INIS)

    IL-1 inhibits the proliferation of human melanoma cells A375 by arresting the cell cycle at G0/G1 phase, which accompanies the increase of p21Waf1/Cip1 (p21) protein. Here, we demonstrate that IL-1 induces the stabilization of p21 protein via ERK1/2 pathway. The degradation of p21 was inhibited by IL-1, however the ubiquitination level of p21 was not affected. In addition, the degradation of non-ubiquitinated form of lysine less mutant p21-K6R was also inhibited by IL-1, suggesting that IL-1 stabilized p21 protein via ubiquitin-independent pathway. Furthermore, the inhibition of p21 protein degradation was prevented by a selective inhibitor of ERK1/2 pathway, PD98059. These results suggest that IL-1-induced ERK1/2 activation leads to the up-regulation of p21 by inhibiting degradation via ubiquitin-independent pathway in human melanoma cells A375.

  3. Diphenylarsinic acid contaminated soil remediation by titanium dioxide (P25) photocatalysis: Degradation pathway, optimization of operating parameters and effects of soil properties.

    Science.gov (United States)

    Wang, A-nan; Teng, Ying; Hu, Xue-feng; Wu, Long-hua; Huang, Yu-juan; Luo, Yong-ming; Christie, Peter

    2016-01-15

    Diphenylarsinic acid (DPAA) is formed during the leakage of arsenic chemical weapons in sites and poses a high risk to biota. However, remediation methods for DPAA contaminated soils are rare. Here, the photocatalytic oxidation (PCO) process by nano-sized titanium dioxide (TiO2) was applied to degrade DPAA in soil. The degradation pathway was firstly studied, and arsenate was identified as the final product. Then, an orthogonal array experimental design of L9(3)(4), only 9 experiments were needed, instead of 81 experiments in a conventional one-factor-at-a-time, was used to optimize the operational parameters soil:water ratio, TiO2 dosage, irradiation time and light intensity to increase DPAA removal efficiency. Soil:water ratio was found to have a more significant effect on DPAA removal efficiency than other properties. The optimum conditions to treat 4 g soil with a DPAA concentration of 20 mg kg(-1) were found to be a 1:10 soil: water ratio, 40 mW cm(-2) light intensity, 5% TiO2 in soil, and a 3-hour irradiation time, with a removal efficiency of up to 82.7%. Furthermore, this method (except for a change in irradiation time from 3 to 1.5h) was validated in nine different soils and the removal efficiencies ranged from 57.0 to 78.6%. Removal efficiencies were found to be negatively correlated with soil electrical conductivity, organic matter content, pH and total phosphorus content. Finally, coupled with electron spin resonance (ESR) measurement, these soil properties affected the generation of OH• by TiO2 in soil slurry. This study suggests that TiO2 photocatalytic oxidation is a promising treatment for removing DPAA from soil. PMID:26410709

  4. The putrescine biosynthesis pathway in Lactococcus lactis is transcriptionally regulated by carbon catabolic repression, mediated by CcpA.

    Science.gov (United States)

    Linares, Daniel M; del Río, Beatriz; Ladero, Victor; Redruello, Begoña; Martín, María Cruz; Fernández, María; Alvarez, Miguel A

    2013-07-01

    Lactococcus lactis is the lactic acid bacterium most widely used by the dairy industry as a starter for the manufacture of fermented products such as cheese and buttermilk. However, some strains produce putrescine from agmatine via the agmatine deiminase (AGDI) pathway. The proteins involved in this pathway, including those necessary for agmatine uptake and conversion into putrescine, are encoded by the aguB, aguD, aguA and aguC genes, which together form an operon. This paper reports the mechanism of regulation of putrescine biosynthesis in L. lactis. It is shown that the aguBDAC operon, which contains a cre site at the promoter of aguB (the first gene of the operon), is transcriptionally regulated by carbon catabolic repression (CCR) mediated by the catabolite control protein CcpA. PMID:23688550

  5. Electrochemical Degradation Characteristics of Refractory Organic Pollutants in Coking Wastewater on Multiwall Carbon Nanotube-Modified Electrode

    Directory of Open Access Journals (Sweden)

    Yan Wang

    2012-01-01

    Full Text Available The multiwall carbon nanotube-mollified electrode (MWCNT-ME was fabricated and its electrocatalytic activity of refractory organic pollutants of coking wastewater was investigated. The surface morphology, absorption properties, and the electrochemical behavior of phenol and aniline at the MWCNT-ME were analyzed. Using ultraviolet-visible adsorption spectroscopy (UV-vis, Gas chromatography mass spectrometry (GC/MS, and chemical oxygen demand (COD test, the electrochemical oxidation properties of refractory organic pollutants of coking wastewater using the MWCNT-ME and the IrSnSb/Ti electrode were analyzed. Compared with the powder adsorption media, the MWCNT-ME was proved to have weaker adsorption activity, which means electrochemical degradation is the decisive factor of the removal of organic pollutants. The MWCNT-ME shows high electrochemical reactivity with oxidation peaks of 0.18 A and 0.12 A for phenol and aniline, respectively. Under the same working conditions, the MWCNT-ME COD removal rate 51% is higher than IrSnSb/Ti electrode’s rate 35%. The MWCNT-ME has application potential of electrochemical oxidation of refractory organic pollutants of coking wastewater.

  6. Stable carbon isotope fractionation of trans-1,2-dichloroethylene during co-metabolic degradation by methanotrophic bacteria

    Science.gov (United States)

    Brungard, K.L.; Munakata-Marr, J.; Johnson, C.A.; Mandernack, K.W.

    2003-01-01

    Changes in the carbon isotope ratio (??13C) of trans-1,2-dichloroethylene (t-DCE) were measured during its co-metabolic degradation by Methylomonas methanica, a type I methanotroph, and Methylosinus trichosporium OB3b, a type II methanotroph. In closed-vessel incubation experiments with each bacterium, the residual t-DCE became progressively enriched in 13C, indicating isotopic fractionation. From these experiments, the biological fractionation during t-DCE co-metabolism, expressed as ??, was measured to be -3.5??? for the type I culture and -6.7??? for the type II culture. This fractionation effect and subsequent enrichment in the ??13C of the residual t-DCE can thus be applied to determine the extent of biodegradation of DCE by these organisms. Based on these results, isotopic fractionation clearly warrants further study, as measured changes in the ??13C values of chlorinated solvents could ultimately be used to monitor the extent of biodegradation in laboratory or field settings where co-metabolism by methanotrophs occurs. ?? 2002 Elsevier Science B.V. All rights reserved.

  7. The effects of mediator and granular activated carbon addition on degradation of trace organic contaminants by an enzymatic membrane reactor.

    Science.gov (United States)

    Nguyen, Luong N; Hai, Faisal I; Price, William E; Leusch, Frederic D L; Roddick, Felicity; Ngo, Hao H; Guo, Wenshan; Magram, Saleh F; Nghiem, Long D

    2014-09-01

    The removal of four recalcitrant trace organic contaminants (TrOCs), namely carbamazepine, diclofenac, sulfamethoxazole and atrazine by laccase in an enzymatic membrane reactor (EMR) was studied. Laccases are not effective for degrading non-phenolic compounds; nevertheless, 22-55% removal of these four TrOCs was achieved by the laccase EMR. Addition of the redox-mediator syringaldehyde (SA) to the EMR resulted in a notable dose-dependent improvement (15-45%) of TrOC removal affected by inherent TrOC properties and loading rates. However, SA addition resulted in a concomitant increase in the toxicity of the treated effluent. A further 14-25% improvement in aqueous phase removal of the TrOCs was consistently observed following a one-off dosing of 3g/L granular activated carbon (GAC). Mass balance analysis reveals that this improvement was not due solely to adsorption but also enhanced biodegradation. GAC addition also reduced membrane fouling and the SA-induced toxicity of the effluent. PMID:24980029

  8. Novel carbon-rich additives preparation by degradative solvent extraction of biomass wastes for coke-making.

    Science.gov (United States)

    Zhu, Xianqing; Li, Xian; Xiao, Li; Zhang, Xiaoyong; Tong, Shan; Wu, Chao; Ashida, Ryuichi; Liu, Wenqiang; Miura, Kouichi; Yao, Hong

    2016-05-01

    In this work, two extracts (Soluble and Deposit) were produced by degradative solvent extraction of biomass wastes from 250 to 350°C. The feasibilities of using Soluble and Deposit as additives for coke-making were investigated for the first time. The Soluble and Deposit, having significantly higher carbon content, lower oxygen content and extremely lower ash content than raw biomasses. All Solubles and most of Deposits can melt completely at the temperature ranged from 80 to 120°C and 140 to 180°C, respectively. The additions of Soluble or Deposit into the coke-making coal significantly improved their thermoplastic properties with as high as 9°C increase of the plastic range. Furthermore, the addition of Deposit or Soluble also markedly enhanced the coke quality through increasing coke strength after reaction (CSR) and reducing coke reactivity index (CRI). Therefore, the Soluble and Deposit were proved to be good additives for coke-making. PMID:26871958

  9. Effect of Carbon Sources on the Biomass Build-Up and Degradation of Rubber Processing Industry Effluent

    Directory of Open Access Journals (Sweden)

    K. Girish

    2014-12-01

    Full Text Available Rubber processing industry effluent represents a serious environmental pollution problem especially for underground and surface water. Wastewater collected from rubber processing industry was characterized for their pollution characteristics. Analysis showed that the biological oxygen demand (BOD, chemical oxygen demand (COD, total dissolved solids (TDS, total suspended solids (TSS, total solids (TS, ammonia and phosphate were high when compared to effluent discharge standard for industrial wastewater. Four bacterial species were isolated from the wastes and were identified as Arthrobacter sp., Bacillus sp., Lactobacillus sp., and Pseudomonas sp. A bacterial consortium was constituted by mixing proportionately these four bacteria and used in effluent aerobic biotreatment. Complex carbon sources such as bagasse, corn-cob, rice straw, wheat bran, molasses, corn steep liquor, were screened for their effect on growth of the consortium constituted. Highest biomass production was in molasses followed by rice straw hydrolysate, wheat bran hydrolysate and bagasse hydrolysate. However, the inoculum grown on rice straw and wheat bran hydrolysate caused maximum degradation in terms of reduction in various parameters such as BOD, COD, TDS, TSS, NH4+ and PO43, about 70 to 80% reduction was observed. From the results of the present study it could be inferred that the constituted consortium could effectively be used for the treatment of effluents from rubber processing industry and rice straw and wheat bran hydrolysate could be used for mass production of effective consortium.

  10. Bacterial degradation of monocyclic aromatic amines

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Arora

    2015-08-01

    Full Text Available Aromatic amines are an important group of industrial chemicals, which are widely used for manufacturing of dyes, pesticides, drugs, pigments, and other industrial products. These compounds have been considered highly toxic to human beings due to their carcinogenic nature. Three groups of aromatic amines have been recognized: monocyclic, polycyclic and heterocyclic aromatic amines. Bacterial degradation of several monocyclic aromatic compounds has been studied in a variety of bacteria, which utilizes monocyclic aromatic amines as their sole source of carbon and energy. Several degradation pathways have been proposed and the related enzymes and genes have also been characterized. Many reviews have been reviewed toxicity of monocyclic aromatic amines; however, there is lack of review on biodegradation of monocyclic aromatic amines. The aim of this review is to summarize bacterial degradation of monocyclic aromatic amines. This review will increase our current understanding of biochemical and molecular basis of bacterial degradation of monocyclic aromatic amines.

  11. Modified iron-carbon as heterogeneous electro-Fenton catalyst for organic pollutant degradation in near neutral pH condition: Characterization, degradation activity and stability

    International Nuclear Information System (INIS)

    Polytetrafluoroethylene (PTFE) was firstly used to modify the surface characteristics of Fe-C particles and acted as catalyst to degrade 2,4-dichlorophenol (2,4-DCP) by heterogeneous electro-Fenton (EF) in near neutral pH condition. Fe-C particles before and after PTFE modification, and after 15 times consecutive degradations were characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD), and energy dispersive X-ray (EDX) spectrometry. The modified Fe-C exhibited a good activity for degradation of 120 mg/L 2,4-DCP in near neutral pH condition, achieving over 95% removal efficiency within 120 min under the conditions of Fe-C 6 g/L, current intensity 100 mA and initial pH 6.7. In this heterogeneous EF system, a significant synergetic effect between anodic oxidation and single Fe-C micro-electrolysis was obtained, which attributed to the effective EF oxidation at favorable acidic pH condition that triggered by anodic oxidation. 15 times consecutive runs demonstrated the 2,4-DCP degradation efficiency was stable while the iron leaching ratio was relatively low. Account for the catalytic activity, life span and inexpensive cost, the PTFE modified Fe-C was potential for industrial application as a good electro-Fenton catalyst to abate biorefractory pollutants in neutral pH condition

  12. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources

    OpenAIRE

    Jun Ni; Fei Tao; Huaiqing Du; Ping Xu

    2015-01-01

    Plant secondary metabolites have been attracting people’s attention for centuries, due to their potentials; however, their production is still difficult and costly. The rich diversity of microbes and microbial genome sequence data provide unprecedented gene resources that enable to develop efficient artificial pathways in microorganisms. Here, by mimicking a natural pathway of plants using microbial genes, a new metabolic route was developed in E. coli for the synthesis of vanillin, the most ...

  13. Activation of locus coeruleus heme oxygenase-carbon monoxide pathway promoted an anxiolytic-like effect in rats

    Science.gov (United States)

    Carvalho-Costa, P.G.; Branco, L.G.S.; Leite-Panissi, C.R.A.

    2016-01-01

    The heme oxygenase-carbon monoxide pathway has been shown to play an important role in many physiological processes and is capable of altering nociception modulation in the nervous system by stimulating soluble guanylate cyclase (sGC). In the central nervous system, the locus coeruleus (LC) is known to be a region that expresses the heme oxygenase enzyme (HO), which catalyzes the metabolism of heme to carbon monoxide (CO). Additionally, several lines of evidence have suggested that the LC can be involved in the modulation of emotional states such as fear and anxiety. The purpose of this investigation was to evaluate the activation of the heme oxygenase-carbon monoxide pathway in the LC in the modulation of anxiety by using the elevated plus maze test (EPM) and light-dark box test (LDB) in rats. Experiments were performed on adult male Wistar rats weighing 250-300 g (n=182). The results showed that the intra-LC microinjection of heme-lysinate (600 nmol), a substrate for the enzyme HO, increased the number of entries into the open arms and the percentage of time spent in open arms in the elevated plus maze test, indicating a decrease in anxiety. Additionally, in the LDB test, intra-LC administration of heme-lysinate promoted an increase on time spent in the light compartment of the box. The intracerebroventricular microinjection of guanylate cyclase, an sGC inhibitor followed by the intra-LC microinjection of the heme-lysinate blocked the anxiolytic-like reaction on the EPM test and LDB test. It can therefore be concluded that CO in the LC produced by the HO pathway and acting via cGMP plays an anxiolytic-like role in the LC of rats. PMID:27074170

  14. Activation of locus coeruleus heme oxygenase-carbon monoxide pathway promoted an anxiolytic-like effect in rats

    Directory of Open Access Journals (Sweden)

    P.G. Carvalho-Costa

    2016-01-01

    Full Text Available The heme oxygenase-carbon monoxide pathway has been shown to play an important role in many physiological processes and is capable of altering nociception modulation in the nervous system by stimulating soluble guanylate cyclase (sGC. In the central nervous system, the locus coeruleus (LC is known to be a region that expresses the heme oxygenase enzyme (HO, which catalyzes the metabolism of heme to carbon monoxide (CO. Additionally, several lines of evidence have suggested that the LC can be involved in the modulation of emotional states such as fear and anxiety. The purpose of this investigation was to evaluate the activation of the heme oxygenase-carbon monoxide pathway in the LC in the modulation of anxiety by using the elevated plus maze test (EPM and light-dark box test (LDB in rats. Experiments were performed on adult male Wistar rats weighing 250-300 g (n=182. The results showed that the intra-LC microinjection of heme-lysinate (600 nmol, a substrate for the enzyme HO, increased the number of entries into the open arms and the percentage of time spent in open arms in the elevated plus maze test, indicating a decrease in anxiety. Additionally, in the LDB test, intra-LC administration of heme-lysinate promoted an increase on time spent in the light compartment of the box. The intracerebroventricular microinjection of guanylate cyclase, an sGC inhibitor followed by the intra-LC microinjection of the heme-lysinate blocked the anxiolytic-like reaction on the EPM test and LDB test. It can therefore be concluded that CO in the LC produced by the HO pathway and acting via cGMP plays an anxiolytic-like role in the LC of rats.

  15. Abiotic Degradation Rates for Carbon Tetrachloride: and Chloroform: Progress in FY 2008

    Energy Technology Data Exchange (ETDEWEB)

    Amonette, James E.; Jeffers, Peter M.; Qafoku, Odeta; Russell, Colleen K.; Wietsma, Thomas W.; Truex, Michael J.

    2008-10-31

    This is a letter report summarizing work performed in FY2008 to determine the rates of carbon tetrachloride hydrolysis at temperatures close to actual groundwater temperatures. The report describes the project, the methodology, and the results obtained since the project's inception in FY2006. Measurements of hydrolysis rates in homogeneous solution have been completed for temperaturs of 70 C through 40 C, with additional data available at 30 C and 20 C. These results show no difference between the rates in deionized H2O and in filter-sterilized Hanford-Site groundwater. Moreover, the rates measured are 2-3 times slower than predicted from the open literature. Measurements of rates involving sterile suspensions of Hanford-Site sediment in Hanford-Site groundwater, however, show faster hydrolysis at temperatures below 40 C. Extrapolation of the current data available suggests a six-fold increase in rate would be expected at groundwater temperature of 16 C due to the presence of the sediment. This result translates into a 78-year half-life, rather than the 470-680 year half-life that would be predicted from rate determinations in homogeneous solution. The hydrolysis rate data at 20 C, in contrast to those at higher temperatures, are preliminary and have low statistical power. While significant (p < 0.05) differences between the heterogeneous and homogeneous systems are seen at 30 C, the results at 20 C are not statistically significant at this level due to limited data and the very slow nature of the reaction. More time is needed to collect data at these low temperatures to improve the statistical power of our observation. Given the critical need for hydrolysis rate data at temperatures relevant to groundwater systems, we have three recommendations for future work. First, we recommend a continuation of the sampling and analysis of the remaining long-term sealed-ampule experiments described in this report. These are primarily 20 C and 30 C experiments. The data at

  16. Photoassisted electrochemical recirculation system with boron-doped diamond anode and carbon nanotubes containing cathode for degradation of a model azo dye

    International Nuclear Information System (INIS)

    In this research work, a photoassisted electrochemical system under recirculation mode and with UV irradiation was designed for treatment of C.I. Acid Blue 92 (AB92) as a model anionic azo dye in aqueous solution. Degradation experiments were carried out with boron-doped diamond (BDD) anode and carbon nanotubes-polytetrafluoroethylene (CNTs-PTFE) cathode in the presence of sulfate as an electrolyte. A comparative study of AB92 degradation by photolysis, electrochemical oxidation and photoassisted electrochemical processes after 45 min of treatment demonstrated that degradation efficiency was 27.89, 37.65 and 95.86%, respectively. Experimental data revealed that the degradation rate of AB92 in all of the processes obeyed pseudo-first-order kinetics and application of photoassisted electrochemical system reduced electrical energy per order (EEO), considerably. Degradation efficiency of photoassisted electrochemical process enhanced by increasing applied current and flow rate values, but vice versa trend was observed for initial dye concentration and an optimum amount of 6 was obtained for initial pH. The TOC measurement results demonstrated that 93.24% of organic substrates were mineralized after 120 min of photoassisted electrochemical process and GC–Mass analysis was performed for identification of degradation intermediates

  17. Multifactor dimensionality reduction analysis to elucidate the cross-talk between one-carbon and xenobiotic metabolic pathways in multi-disease models.

    Science.gov (United States)

    Naushad, Shaik Mohammad; Vijayalakshmi, Sana Venkata; Rupasree, Yedluri; Kumudini, Nadella; Sowganthika, Sampathkumar; Naidu, Janardhanan Venketlakshmi; Ramaiah, M Janaki; Rao, Dunna Nageswara; Kutala, Vijay Kumar

    2015-07-01

    Putatively functional polymorphisms of one-carbon and xenobiotic metabolic pathways influence susceptibility for wide spectrum of diseases. The current study was aimed to explore gene-gene interactions among these two metabolic pathways in four diseases i.e. breast cancer, systemic lupus erythematosus (SLE), coronary artery disease (CAD) and Parkinson's disease (PD). Multifactor dimensionality reduction analysis was carried out on four case-control datasets. Cross-talk was observed between one-carbon and xenobiotic pathways in breast cancer (RFC 80 G>A, COMT H108L and TYMS 5'-UTR 28 bp tandem repeat) and SLE (CYP1A1 m1, MTRR 66 A>G and GSTT1). Gene-gene interactions within one-carbon metabolic pathway were observed in CAD (GCPII 1561 C>T, SHMT 1420 C>T and MTHFR 677 C>T) and PD (cSHMT 1420 C>T, MTRR 66 A>G and RFC1 80 G>A). These interaction models showed good predictability of risk for PD (The area under the receiver operating characteristic curve (C) = 0.83) and SLE (C = 0.73); and moderate predictability of risk for breast cancer (C = 0.64) and CAD (C = 0.63). Cross-talk between one-carbon and xenobiotic pathways was observed in diseases with female preponderance. Gene-gene interactions within one-carbon metabolic pathway were observed in diseases with male preponderance. PMID:25648260

  18. Thermal battery degradation mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Missert, Nancy A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Brunke, Lyle Brent [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-09-01

    Diffuse reflectance IR spectroscopy (DRIFTS) was used to investigate the effect of accelerated aging on LiSi based anodes in simulated MC3816 batteries. DRIFTS spectra showed that the oxygen, carbonate, hydroxide and sulfur content of the anodes changes with aging times and temperatures, but not in a monotonic fashion that could be correlated to phase evolution. Bands associated with sulfur species were only observed in anodes taken from batteries aged in wet environments, providing further evidence for a reaction pathway facilitated by H2S transport from the cathode, through the separator, to the anode. Loss of battery capacity with accelerated aging in wet environments was correlated to loss of FeS2 in the catholyte pellets, suggesting that the major contribution to battery performance degradation results from loss of active cathode material.

  19. UV/H2O2degradation of the antidepressants venlafaxine and O-desmethylvenlafaxine: Elucidation of their transformation pathway and environmental fate.

    Science.gov (United States)

    García-Galán, Ma Jesús; Anfruns, Alba; Gonzalez-Olmos, Rafael; Rodríguez-Mozaz, Sara; Comas, Joaquim

    2016-07-01

    The aim of the present work is to investigate the removal and transformation of the antidepressants venlafaxine (VFX) and its main metabolite O-desmethylvenlafaxine (DVFX) upon advanced oxidation with UV/H2O2 under lab conditions. High-resolution mass spectrometry (HRMS) analyses were carried out by means of ultra-high pressure liquid chromatography (UHPLC)-linear ion trap high resolution Orbitrap instrument (LTQ-Orbitrap-MS) in order to elucidate the different transformation products (TPs) generated. The depletion of both VFX and DVFX was very significant, with the 99.9% of both compounds eliminated after 5 and 30 min of reaction, respectively. Eleven TPs for VFX and six for DVFX were detected and their molecular structures elucidated by means of MS(2) and MS(3) scans, and the corresponding degradation pathways were proposed. The combined ecotoxicity at different treatment times was evaluated by means of bioluminescence inhibition assays with the marine bacteria Vibrio fischeri. Results showed an increase in the ecotoxicity during the UV/H2O2 experiment, especially at those reaction times where the total abundance of TPs was higher. PMID:26954478

  20. Degradation products of different water content sevoflurane in carbon dioxide absorbents by gas chromatogpy-mass spectromerty analysis

    Institute of Scientific and Technical Information of China (English)

    LI Yue; LI Yi-cong; ZHANG Yi-nan; LIU Shu-jie; ZHOU Yan-mei; WANG Chang-song; GONG Yu-lei; LI En-you

    2011-01-01

    Background Sevoflurane is currently used as a volatile inhalation anesthetic with many clinical advantages. A representative degradation product,compound A,was quantitatively measured to investigate whether there are different reactions between two kinds of water content sevoflurane formulations with different carbon dioxide (CO2) absorbents.Methods A closed-circle breathe bag with the Dr(a)ger Fabius GS anesthesia apparatus was used as an artificial rubber lung. The experiments were grouped according to different sevoflurane formulations:group A:higher-water sevoflurane (Ultane);group B:lower-water sevoflurane (Sevoness). During the experiment,CO2 (200 ml/min) was continually perfused to keep the end-tidal pressure of CO2 (PETCO2)at 35-45 mmHg. The artificial ventilation was set to 6 L/min,and the breathing rate at 12 breaths/min. The circuit was operated with constant fresh gas flow rate (1 L/min) and the sevoflurane concentration was kept at 1.0 minimum alveolar concentration (MAC) for 240 minutes. At 0,10,20,30,60,90,120,180 and 240 minutes,gas was collected from the Y-piece. Gas chromatography/mass spectrometry (GC/MS)was used to quantify the major degradation product,compound A,with different water content sevoflurane. PETCO2 and sevoflurane concentration,and the temperature of the canister were continuously monitored during the experiment.Results There were no significant differences in PETCO2 and sevoflurane concentrations between the two groups.Dr(a)gersorb 800 plus produced the highest concentrations of compound A compared with other sodalimes,and Sevoness in Dr(a)gersorb 800 plus generated more compound A than Ultane (P <0.05). There were significant differences in the peak and average compound A concentrations between Ultane and Sevoness with Dr(a)gersorb 800 plus (P <0.05),while the compound A concentration produced by Sodasorb grase and sofonolime in the two groups showed no significant difference (P >0.05). In the same group,the peak and

  1. The solar photovoltaics wedge: pathways for growth and potential carbon mitigation in the US

    International Nuclear Information System (INIS)

    The challenge of stabilizing global carbon emissions over the next 50 years has been framed in the context of finding seven 1.0 Gton C/year carbon reduction wedges. Solar photovoltaics (PV) could provide at least one carbon wedge, but will require significant growth in PV manufacturing capacity. The actual amount of installed PV capacity required to reach wedge-level carbon reductions will vary greatly depending on the mix of avoided fuels and the additional emissions from manufacturing PV capacity. In this work, we find that the US could reduce its carbon emissions by 0.25 Gton C/year, equal to the fraction of a global carbon wedge proportional to its current domestic electricity use, by installing 792-811 GW of PV capacity. We evaluate a series of PV growth scenarios and find that wedge-level reductions could be met by increasing PV manufacturing capacity and annual installations by 0.95 GW/year/year each year from 2009 to 2050 or by increasing up to 4 GW/year/year for a period of 4-17 years for early and late growth scenarios. This challenge of increasing PV manufacturing capacity and market demand is significant but not out of line with the recent rapid growth in both the global and US PV industry. We find that the rapid growth in PV manufacturing capacity leads to a short term increase in carbon emissions from the US electric sector. However, this increase is small, contributing less than an additional 0.3% to electric sector emissions for less than 4.5 years, alleviating recent concern regarding carbon emissions from rapid PV growth scenarios.

  2. Carbon dioxide metabolism by Actinomyces viscosus: pathways for succinate and aspartate production.

    OpenAIRE

    Brown, A T; Breeding, L C

    1980-01-01

    14C-labeled bicarbonate was incorporated into trichloroacetic acid-insoluble material by cell suspensions of A. viscosus strain M100 and also into the four-carbon fermentation product, succinate, but not into the three-carbon fermentation product, lactate. The initial step in the conversion of 14C-labeled bicarbonate into both trichloroacetic acid-insoluble material and succinate was catalyzed by the enzyme phosphoenolypyruvate carboxylase, which served to convert the glycolytic intermediate,...

  3. Adsorption and photocatalytic degradation of pharmaceuticals and pesticides by carbon doped-TiO2 coated on zeolites under solar light irradiation.

    Science.gov (United States)

    An, Ye; de Ridder, David Johannes; Zhao, Chun; Schoutteten, Klaas; Bussche, Julie Vanden; Zheng, Huaili; Chen, Gang; Vanhaecke, Lynn

    2016-01-01

    To evaluate the performance of zeolite-supported carbon-doped TiO(2) composite catalysts toward target pollutants under solar light irradiation, the adsorption and photocatalytic degradation of 18 pharmaceuticals and pesticides with distinguishing features (molecular size and volume, and photolysis) were investigated using mordenite zeolites with SiO(2)/Al(2)O(3) ratios of 18 and 240. Different quantities of carbon-doped TiO(2) were coated on the zeolites, and then the finished composite catalysts were tested in demineralized, surface, and hospital wastewater samples, respectively. The composite photocatalysts were characterized by X-ray diffraction, field emission scanning electron microscopy, and surface area and porosity analyses. Results showed that a dispersed layer of carbon-doped TiO(2) is formed on the zeolite surface; this layer blocks the micropores of zeolites and reduces their surface area. However, these reductions did not significantly affect adsorption onto the zeolites. Our results demonstrated that zeolite-supported carbon-doped TiO(2) systems can effectively degrade 18 pharmaceuticals and pesticides in demineralized water under natural and simulated solar light irradiation. In surface and hospital wastewaters, zeolite-supported carbon-doped TiO(2) systems present excellent anti-interference capability against radical scavengers and competitive organics for pollutants removal, and higher pollutants adsorption on zeolites evidently enhances the removal rate of target pollutants in surface and hospital wastewater samples with a complicated matrix. PMID:27332831

  4. Hydrogen "leakage" during methanogenesis from methanol and methylamine: implications for anaerobic carbon degradation pathways in aquatic sediments

    DEFF Research Database (Denmark)

    Finke, Niko; Hoehler, Tori Michael; Jørgensen, Bo Barker

    2007-01-01

      The effect of variations in H2 concentrations on methanogenesis from the non-competitive substrates methanol and methylamine (used by methanogens but not by sulfate reducers) was investigated in methanogenic marine sediments. Imposed variations in sulfate concentration and temperature were used...... to drive systematic variations in pore water H2 concentrations. Specifically, increasing sulfate concentrations and decreasing temperatures both resulted in decreasing H2 concentrations. The ratio of CO2 and CH4 produced from 14C-labelled methylamine and methanol showed a direct correlation with the...

  5. c-IAP1 Binds and Processes PCSK9 Protein: Linking the c-IAP1 in a TNF-α Pathway to PCSK9-Mediated LDLR Degradation Pathway

    Directory of Open Access Journals (Sweden)

    David Hornby

    2012-10-01

    Full Text Available Recent genetic studies have shown that PCSK9, one of the key genes in cholesterol metabolism, plays a critical role by controlling the level of low-density lipoprotein receptor. However, how PCSK9 mediates LDLR degradation is still unknown. By combining a shotgun proteomic method and differential analysis of natural occurring mutations of the PCSK9 gene, we found that an E3 ubiquitin ligase c-IAP1 binds and processes PCSK9 protein. One of the ‘gain-of-function’ mutations, S127R, is defective with respect to binding to c-IAP1, and thus has defective autocatalytic activity. Knockdown of c-IAP1 impairs PCSK9 processing and autocatalytic cleavage. In c-IAP1 null mouse embryonic fibroblasts (MEFs, there is a dramatic decrease in secreted mature PCSK9 protein accompanied by a significant increase in LDLR protein levels compared with matched wild-type MEF cells. c-IAP1 also acts as an E3 ligase for ubiquitination of PCSK9. Ubiquitin containing only lysine-27 mediated PCSK9 ubiquitination by c-IAP1. Given K27-linked polyubiquitination promotes lysosomal localization, the finding indicates the c-IAP1 acts on both secretion of PCSK9 and its lysosomal localization. The novel pathway described here will open new avenues for exploring novel disease treatments.

  6. Carbon-dependent control of electron transfer and central carbon pathway genes for methane biosynthesis in the Archaean, Methanosarcina acetivorans strain C2A

    Directory of Open Access Journals (Sweden)

    Gunsalus Robert P

    2010-02-01

    Full Text Available Abstract Background The archaeon, Methanosarcina acetivorans strain C2A forms methane, a potent greenhouse gas, from a variety of one-carbon substrates and acetate. Whereas the biochemical pathways leading to methane formation are well understood, little is known about the expression of the many of the genes that encode proteins needed for carbon flow, electron transfer and/or energy conservation. Quantitative transcript analysis was performed on twenty gene clusters encompassing over one hundred genes in M. acetivorans that encode enzymes/proteins with known or potential roles in substrate conversion to methane. Results The expression of many seemingly "redundant" genes/gene clusters establish substrate dependent control of approximately seventy genes for methane production by the pathways for methanol and acetate utilization. These include genes for soluble-type and membrane-type heterodisulfide reductases (hdr, hydrogenases including genes for a vht-type F420 non-reducing hydrogenase, molybdenum-type (fmd as well as tungsten-type (fwd formylmethanofuran dehydrogenases, genes for rnf and mrp-type electron transfer complexes, for acetate uptake, plus multiple genes for aha- and atp-type ATP synthesis complexes. Analysis of promoters for seven gene clusters reveal UTR leaders of 51-137 nucleotides in length, raising the possibility of both transcriptional and translational levels of control. Conclusions The above findings establish the differential and coordinated expression of two major gene families in M. acetivorans in response to carbon/energy supply. Furthermore, the quantitative mRNA measurements demonstrate the dynamic range for modulating transcript abundance. Since many of these gene clusters in M. acetivorans are also present in other Methanosarcina species including M. mazei, and in M. barkeri, these findings provide a basis for predicting related control in these environmentally significant methanogens.

  7. Pathways of carbon oxidation in continental margin sediments off central Chile

    DEFF Research Database (Denmark)

    Thamdrup, B; Canfield, Donald Eugene

    1996-01-01

    . Pathways of C oxidation were inferred from the depth distributions of the potential oxidants (O2, NO3-, and oxides of Mn and Fe) and from directly determined rates of SO4(2-) reduction. The study area is characterized by intense seasonal upwelling, and during sampling in late summer the bottom water over...

  8. Mimicking a natural pathway for de novo biosynthesis: natural vanillin production from accessible carbon sources.

    Science.gov (United States)

    Ni, Jun; Tao, Fei; Du, Huaiqing; Xu, Ping

    2015-01-01

    Plant secondary metabolites have been attracting people's attention for centuries, due to their potentials; however, their production is still difficult and costly. The rich diversity of microbes and microbial genome sequence data provide unprecedented gene resources that enable to develop efficient artificial pathways in microorganisms. Here, by mimicking a natural pathway of plants using microbial genes, a new metabolic route was developed in E. coli for the synthesis of vanillin, the most widely used flavoring agent. A series of factors were systematically investigated for raising production, including efficiency and suitability of genes, gene dosage, and culture media. The metabolically engineered strain produced 97.2 mg/L vanillin from l-tyrosine, 19.3 mg/L from glucose, 13.3 mg/L from xylose and 24.7 mg/L from glycerol. These results show that the metabolic route enables production of natural vanillin from low-cost substrates, suggesting that it is a good strategy to mimick natural pathways for artificial pathway design. PMID:26329726

  9. The Tissue Response and Degradation of Electrospun Poly(ε-caprolactone)/Poly(trimethylene-carbonate) Scaffold in Subcutaneous Space of Mice

    OpenAIRE

    2014-01-01

    Due to the advantage of controllability on the mechanical property and the degradation rates, electrospun PCL/PTMC nanofibrous scaffold could be appropriate for vascular tissue engineering. However, the tissue response and degradation of electrospun PCL/PTMC scaffold in vivo have never been evaluated in detail. So, electrospun PCL/PTMC scaffolds with different blend ratios were prepared in this study. Mice subcutaneous implantation showed that the continuous degradation of PCL/PTMC scaffolds ...

  10. Metabolic Pathway Involved in 2-Methyl-6-Ethylaniline Degradation by Sphingobium sp. Strain MEA3-1 and Cloning of the Novel Flavin-Dependent Monooxygenase System meaBA

    Science.gov (United States)

    Dong, Weiliang; Chen, Qiongzhen; Hou, Ying; Li, Shuhuan; Zhuang, Kai; Huang, Fei; Zhou, Jie; Li, Zhoukun; Wang, Jue; Fu, Lei; Zhang, Zhengguang; Huang, Yan; Wang, Fei

    2015-01-01

    2-Methyl-6-ethylaniline (MEA) is the main microbial degradation intermediate of the chloroacetanilide herbicides acetochlor and metolachlor. Sphingobium sp. strain MEA3-1 can utilize MEA and various alkyl-substituted aniline and phenol compounds as sole carbon and energy sources for growth. We isolated the mutant strain MEA3-1Mut, which converts MEA only to 2-methyl-6-ethyl-hydroquinone (MEHQ) and 2-methyl-6-ethyl-benzoquinone (MEBQ). MEA may be oxidized by the P450 monooxygenase system to 4-hydroxy-2-methyl-6-ethylaniline (4-OH-MEA), which can be hydrolytically spontaneously deaminated to MEBQ or MEHQ. The MEA microbial metabolic pathway was reconstituted based on the substrate spectra and identification of the intermediate metabolites in both the wild-type and mutant strains. Plasmidome sequencing indicated that both strains harbored 7 plasmids with sizes ranging from 6,108 bp to 287,745 bp. Among the 7 plasmids, 6 were identical, and pMEA02′ in strain MEA3-1Mut lost a 37,000-bp fragment compared to pMEA02 in strain MEA3-1. Two-dimensional electrophoresis (2-DE) and protein mass fingerprinting (PMF) showed that MEA3-1Mut lost the two-component flavin-dependent monooxygenase (TC-FDM) MeaBA, which was encoded by a gene in the lost fragment of pMEA02. MeaA shared 22% to 25% amino acid sequence identity with oxygenase components of some TC-FDMs, whereas MeaB showed no sequence identity with the reductase components of those TC-FDMs. Complementation with meaBA in MEA3-1Mut and heterologous expression in Pseudomonas putida strain KT2440 resulted in the production of an active MEHQ monooxygenase. PMID:26386060

  11. Photocatalytic degradation of different chromophoric dyes in aqueous phase using La and Mo doped TiO2 hybrid carbon spheres

    International Nuclear Information System (INIS)

    Highlights: • La and Mo doped TiO2 hybrid carbon spheres have been synthesized using hydrothermal method. • The characterization of La and Mo doped TiO2 hybrid carbon spheres uniform morphology having anatase phase and good structural stability. • TiO2 hybrid carbon spheres with dopant concentration of 2.0% (La) and 1.5% (Mo) showed the highest photocatalytic activity as compared to the other dopant concentrations for the degradation of all the dyes under investigation. - Abstract: La and Mo-doped TiO2 coated carbon spheres have been synthesized using the hydrothermal method. The prepared materials were characterized by standard analytical techniques, X-ray diffraction (XRD), UV–Vis spectrophotometry, scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDX) and Raman spectroscopy. The XRD and Raman spectroscopic analysis showed that the particles are in anatase phase. The EDX and SEM images showed that La/Mo-doped TiO2 are present on the surface of the carbon spheres. The photocatalytic activity of the synthesized particles were tested by studying the degradation of three different chromophoric dyes, i.e., Acid Yellow 29 (azo dye), Coomassie Brilliant Blue G250 (triphenylmethane dye) and Acid Green 25 (anthraquinone dye) as a function of time on irradiation in aqueous suspension. TiO2 particle with dopant concentration of 2.0% La and 1.5% Mo showed the highest photocatalytic activity as compared to the other dopant concentrations for the degradation of all the dyes under investigation

  12. Photocatalytic degradation of different chromophoric dyes in aqueous phase using La and Mo doped TiO{sub 2} hybrid carbon spheres

    Energy Technology Data Exchange (ETDEWEB)

    Raza, Waseem; Haque, M.M. [Department of Chemistry, Aligarh Muslim University, Aligarh 202002 (India); Muneer, M., E-mail: m.muneer.ch@amu.ac.in [Department of Chemistry, Aligarh Muslim University, Aligarh 202002 (India); Fleisch, M.; Hakki, A.; Bahnemann, D. [Institut fuer Technische Chemie, Leibniz Universität Hannover, Callinstrasse 3, D-30167 Hannover (Germany)

    2015-05-25

    Highlights: • La and Mo doped TiO{sub 2} hybrid carbon spheres have been synthesized using hydrothermal method. • The characterization of La and Mo doped TiO{sub 2} hybrid carbon spheres uniform morphology having anatase phase and good structural stability. • TiO{sub 2} hybrid carbon spheres with dopant concentration of 2.0% (La) and 1.5% (Mo) showed the highest photocatalytic activity as compared to the other dopant concentrations for the degradation of all the dyes under investigation. - Abstract: La and Mo-doped TiO{sub 2} coated carbon spheres have been synthesized using the hydrothermal method. The prepared materials were characterized by standard analytical techniques, X-ray diffraction (XRD), UV–Vis spectrophotometry, scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDX) and Raman spectroscopy. The XRD and Raman spectroscopic analysis showed that the particles are in anatase phase. The EDX and SEM images showed that La/Mo-doped TiO{sub 2} are present on the surface of the carbon spheres. The photocatalytic activity of the synthesized particles were tested by studying the degradation of three different chromophoric dyes, i.e., Acid Yellow 29 (azo dye), Coomassie Brilliant Blue G250 (triphenylmethane dye) and Acid Green 25 (anthraquinone dye) as a function of time on irradiation in aqueous suspension. TiO{sub 2} particle with dopant concentration of 2.0% La and 1.5% Mo showed the highest photocatalytic activity as compared to the other dopant concentrations for the degradation of all the dyes under investigation.

  13. Heme degradation by Staphylococcus aureus IsdG and IsdI liberates formaldehyde rather than carbon monoxide

    OpenAIRE

    Matsui, Toshitaka; Nambu, Shusuke; Ono, Yukari; Goulding, Celia W.; Tsumoto, Kouhei; Ikeda-Saito, Masao

    2013-01-01

    IsdG and IsdI from Staphylococcus aureus are novel heme degrading enzymes containing unusually non-planar (ruffled) heme. While canonical heme degrading enzymes, heme oxygenases, catalyze heme degradation coupled with the release of CO, in this study we demonstrate that the primary C1 product of the S. aureus enzymes is formaldehyde. This finding clearly reveals that both IsdG and IsdI degrade heme by an unusual mechanism distinct from the well-characterized heme oxygenase mechanism as recent...

  14. Trophic structure and pathways of biogenic carbon flow in the eastern North Water Polynya

    Science.gov (United States)

    Tremblay, Jean-Éric; Hattori, Hiroshi; Michel, Christine; Ringuette, Marc; Mei, Zhi-Ping; Lovejoy, Connie; Fortier, Louis; Hobson, Keith A.; Amiel, David; Cochran, Kirk

    2006-10-01

    In the eastern North Water, most of the estimated annual new and net production of carbon (C) occurred during the main diatom bloom in 1998. During the bloom, at least 30% of total and new phytoplankton production occurred as dissolved organic carbon (DOC) and was unavailable for short-term assimilation into the herbivorous food web or sinking export. Based on particle interceptor traps and 234Th deficits, 27% of the particulate primary production (PP) sank out of the upper 50 m, with only 7% and 1% of PP reaching the benthos at shallow (≈200 m) and deep (≈500 m) sites, respectively. Mass balance calculations and grazing estimates agree that ≈79% of PP was ingested by pelagic consumers between April and July. During this period, the vertical flux of biogenic silica (BioSi) at 50 m was equivalent to the total BioSi produced, indicating that all of the diatom production was removed from the euphotic zone as intact cells (direct sinking) or empty frustules (grazing or lysis). The estimated flux of empty frustules was consistent with rates of herbivory by the large, dominant copepods and appendicularians during incubations. Since the carbon demand of the dominant planktivorous bird, Alle alle, amounted to ≈2% of the biomass synthesized by its main prey, the large copepod Calanus hyperboreus, most of the secondary carbon production was available to pelagic carnivores. Stable isotopes indicated that the biomass of predatory amphipods, polar cod and marine mammals was derived from these herbivores, but corresponding carbon fluxes were not quantified. Our analysis shows that a large fraction of PP in the eastern North Water was ingested by consumers in the upper 50 m, leading to substantial carbon respiration and DOC accumulation in surface waters. An increasingly early and prolonged opening of the Artic Ocean is likely to promote the productivity of the herbivorous food web, but not the short-term efficiency of the particulate, biological CO 2 pump.

  15. Degradation of 1,4-Dioxane and Cyclic Ethers by an Isolated Fungus

    OpenAIRE

    Nakamiya, Kunichika; Hashimoto, Syunji; Ito, Hiroyasu; Edmonds, John S.; Morita, Masatoshi

    2005-01-01

    By using 1,4-dioxane as the sole source of carbon, a 1,4-dioxane-degrading microorganism was isolated from soil. The fungus, termed strain A, was able to utilize 1,4-dioxane and many kinds of cyclic ethers as the sole source of carbon and was identified as Cordyceps sinensis from its 18S rRNA gene sequence. Ethylene glycol was identified as a degradation product of 1,4-dioxane by the use of deuterated 1,4-dioxane-d8 and gas chromatography-mass spectrometry analysis. A degradation pathway invo...

  16. Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

    Science.gov (United States)

    Uhía, Iria; Galán, Beatriz; Medrano, Francisco Javier; García, José Luis

    2011-09-01

    The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P₅₂₂₈ promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P₅₂₂₈ promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P₅₂₂₈-β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P₅₂₂₈ promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism. PMID:21565928

  17. Measurement of black carbon at Syowa station, Antarctica: seasonal variation, transport processes and pathways

    OpenAIRE

    Hara, K.; K. Osada; Yabuki, M.; Hayashi, M; Yamanouchi, T; Shiobara, M.; Wada, M.

    2008-01-01

    Measurement of black carbon (BC) was carried out at Syowa station Antarctica (69° S, 39° E) from February 2004 until January 2007. The BC concentration at Syowa ranged from below detection to 176 ng m−3 during the measurements. Higher BC concentrations were observed mostly under strong wind (blizzard) conditions due to the approach of a cyclone and blocking event. The BC-rich air masses traveled from the lower troposphere of the Atlantic and In...

  18. Carbon antisite clusters in SiC: a possible pathway to the D_{II} center

    OpenAIRE

    Mattausch, Alexander; Bockstedte, Michel; Pankratov, Oleg

    2003-01-01

    The photoluminescence center D_{II} is a persistent intrinsic defect which is common in all SiC polytypes. Its fingerprints are the characteristic phonon replicas in luminescence spectra. We perform ab-initio calculations of vibrational spectra for various defect complexes and find that carbon antisite clusters exhibit vibrational modes in the frequency range of the D_{II} spectrum. The clusters possess very high binding energies which guarantee their thermal stability--a known feature of the...

  19. Degradation of indole by Alcaligenes spec.

    Science.gov (United States)

    Claus, G; Kutzner, H J

    1983-01-01

    Alcaligenes spec. strain In 3 was isolated from an enrichment culture with indole inoculated with activated sludge. The organism was able to grow with indole as sole source of carbon and nitrogen. During growth with this substrate indigo and anthranilate accumulated in the culture broth. By measurement of the oxidation of intermediates (O(2)-uptake) and determination of the activity of enzymes responsible for ring cleavage the following pathway for indole degradation could be established: indole → indoxyl → isatin → anthranilate → gentisate → maleyl pyruvate → fumaryl pyruvate → fumarate + pyruvate. - Alcaligenes spec. strain In 3 was also able to grow with various aromatic compounds; these were degraded by ortho- or meta-cleavage or via the gentisinic acid pathway. PMID:23194589

  20. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    Energy Technology Data Exchange (ETDEWEB)

    John J. Kilbane III

    2003-12-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project will focus on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate amidase. The objective of the final phase of the project will be to develop derivative CN bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. The project is on schedule and no major difficulties have been encountered. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments have resulted in the isolation of promising cultures that may be capable of cleaving C-N bonds in aromatic amides, several amidase genes have been cloned and are currently undergoing directed evolution to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. Future research will address expression of these genes in Rhodococcus erythropolis. Enrichment culture experiments and directed evolution experiments continue to be a main focus of research activity and further work is required to obtain an appropriate amidase that will selectively cleave C-N bonds in aromatic substrates. Once an appropriate amidase gene is obtained it must be combined with genes encoding an enzyme capable of converting carbazole to 2'aminobiphenyl-2,3-diol: specifically carA genes. The carA genes from two sources have been cloned and are ready for construction of C-N bond cleavage

  1. Pseudomonas aeruginosa RRALC3 Enhances the Biomass, Nutrient and Carbon Contents of Pongamia pinnata Seedlings in Degraded Forest Soil.

    Directory of Open Access Journals (Sweden)

    Parthasarathy Radhapriya

    Full Text Available The study was aimed at assessing the effects of indigenous Plant Growth Promoting Bacterium (PGPB on the legume Pongamia pinnata in the degraded soil of the Nanmangalam Reserve Forest (NRF under nursery conditions. In total, 160 diazotrophs were isolated from three different nitrogen-free semi-solid media (LGI, Nfb, and JMV. Amongst these isolates, Pseudomonas aeruginosa RRALC3 exhibited the maximum ammonia production and hence was selected for further studies. RRALC3 was found to possess multiple plant growth promoting traits such as nitrogen accumulation (120.6ppm; it yielded a positive amplicon with nifH specific primers, tested positive for Indole Acetic Acid (IAA; 18.3μg/ml and siderophore production, tested negative for HCN production and was observed to promote solubilization of phosphate, silicate and zinc in the plate assay. The 16S rDNA sequence of RRALC3 exhibited 99% sequence similarity to Pseudomonas aeruginosa JCM5962. Absence of virulence genes and non-hemolytic activity indicated that RRALC3 is unlikely to be a human pathogen. When the effects of RRALC3 on promotion of plant growth was tested in Pongamia pinnata, it was observed that in Pongamia seedlings treated with a combination of RRALC3 and chemical fertilizer, the dry matter increased by 30.75%. Nitrogen, phosphorus and potassium uptake increased by 34.1%, 27.08%, and 31.84%, respectively, when compared to control. Significant enhancement of total sugar, amino acids and organic acids content, by 23.4%, 29.39%, and 26.53% respectively, was seen in the root exudates of P. pinnata. The carbon content appreciated by 4-fold, when fertilized seedlings were treated with RRALC3. From the logistic equation, the rapid C accumulation time of Pongamia was computed as 43 days longer than the control when a combination of native PGPB and inorganic fertilizer was applied. The rapid accumulation time of N, P and K in Pongamia when treated with the same combination as above was 15, 40 and

  2. Pseudomonas aeruginosa RRALC3 Enhances the Biomass, Nutrient and Carbon Contents of Pongamia pinnata Seedlings in Degraded Forest Soil.

    Science.gov (United States)

    Radhapriya, Parthasarathy; Ramachandran, Andimuthu; Anandham, Rangasamy; Mahalingam, Sundararajan

    2015-01-01

    The study was aimed at assessing the effects of indigenous Plant Growth Promoting Bacterium (PGPB) on the legume Pongamia pinnata in the degraded soil of the Nanmangalam Reserve Forest (NRF) under nursery conditions. In total, 160 diazotrophs were isolated from three different nitrogen-free semi-solid media (LGI, Nfb, and JMV). Amongst these isolates, Pseudomonas aeruginosa RRALC3 exhibited the maximum ammonia production and hence was selected for further studies. RRALC3 was found to possess multiple plant growth promoting traits such as nitrogen accumulation (120.6ppm); it yielded a positive amplicon with nifH specific primers, tested positive for Indole Acetic Acid (IAA; 18.3μg/ml) and siderophore production, tested negative for HCN production and was observed to promote solubilization of phosphate, silicate and zinc in the plate assay. The 16S rDNA sequence of RRALC3 exhibited 99% sequence similarity to Pseudomonas aeruginosa JCM5962. Absence of virulence genes and non-hemolytic activity indicated that RRALC3 is unlikely to be a human pathogen. When the effects of RRALC3 on promotion of plant growth was tested in Pongamia pinnata, it was observed that in Pongamia seedlings treated with a combination of RRALC3 and chemical fertilizer, the dry matter increased by 30.75%. Nitrogen, phosphorus and potassium uptake increased by 34.1%, 27.08%, and 31.84%, respectively, when compared to control. Significant enhancement of total sugar, amino acids and organic acids content, by 23.4%, 29.39%, and 26.53% respectively, was seen in the root exudates of P. pinnata. The carbon content appreciated by 4-fold, when fertilized seedlings were treated with RRALC3. From the logistic equation, the rapid C accumulation time of Pongamia was computed as 43 days longer than the control when a combination of native PGPB and inorganic fertilizer was applied. The rapid accumulation time of N, P and K in Pongamia when treated with the same combination as above was 15, 40 and 33 days longer

  3. Carbon-dot-decorated TiO₂ nanotube arrays used for photo/voltage-induced organic pollutant degradation and the inactivation of bacteria.

    Science.gov (United States)

    Feng, Lingyan; Sun, Hanjun; Ren, Jinsong; Qu, Xiaogang

    2016-03-18

    Photoluminescent carbon dots (c-dots) have recently attracted growing interest as a new member of the carbon-nanomaterial family. Here, we report for the first time that c-dot-decorated TiO2 nanotube arrays (c-dot/TiNTs) exhibit highly enhanced abilities regarding photo/voltage-induced organic pollutant degradation and bacterial inactivation. By applying UV irradiation (365 nm) or an electrochemical potential over 3 V (versus Ag/AgCl), an organic dye and a herbicide were efficiently degraded. Moreover, the inactivation of Gram-positive S. aureus and Gram-negative E. coli bacteria was realized on a c-dot/TiNT film. The c-dots were able to absorb light efficiently resulting in multiple exciton generation and also a reduction in the recombination of the e(-)/h(+) pair produced in c-dot/TiNT film during photo/voltage-induced degradation. It was also possible to readily regenerate the surface using ultraviolet light irradiation, leaving the whole film structure undamaged and with high reproducibility and stability. PMID:26870882

  4. Self-assembly graphitic carbon nitride quantum dots anchored on TiO2 nanotube arrays: An efficient heterojunction for pollutants degradation under solar light.

    Science.gov (United States)

    Su, Jingyang; Zhu, Lin; Geng, Ping; Chen, Guohua

    2016-10-01

    In this study, an efficient heterojunction was constructed by anchoring graphitic carbon nitride quantum dots onto TiO2 nanotube arrays through hydrothermal reaction strategy. The prepared graphitic carbon nitride quantum dots, which were prepared by solid-thermal reaction and sequential dialysis process, act as a sensitizer to enhance light absorption. Furthermore, it was demonstrated that the charge transfer and separation in the formed heterojunction were significantly improved compared with pristine TiO2. The prepared heterojunction was used as a photoanode, exhibiting much improved photoelectrochemical capability and excellent photo-stability under solar light illumination. The photoelectrocatalytic activities of prepared heterojunction were demonstrated by degradation of RhB and phenol in aqueous solution. The kinetic constants of RhB and phenol degradation using prepared photoelectrode are 2.4 times and 4.9 times higher than those of pristine TiO2, respectively. Moreover, hydroxyl radicals are demonstrated to be dominant active radicals during the pollutants degradation. PMID:27232727

  5. Carbon-dot-decorated TiO2 nanotube arrays used for photo/voltage-induced organic pollutant degradation and the inactivation of bacteria

    Science.gov (United States)

    Feng, Lingyan; Sun, Hanjun; Ren, Jinsong; Qu, Xiaogang

    2016-03-01

    Photoluminescent carbon dots (c-dots) have recently attracted growing interest as a new member of the carbon-nanomaterial family. Here, we report for the first time that c-dot-decorated TiO2 nanotube arrays (c-dot/TiNTs) exhibit highly enhanced abilities regarding photo/voltage-induced organic pollutant degradation and bacterial inactivation. By applying UV irradiation (365 nm) or an electrochemical potential over 3 V (versus Ag/AgCl), an organic dye and a herbicide were efficiently degraded. Moreover, the inactivation of Gram-positive S. aureus and Gram-negative E. coli bacteria was realized on a c-dot/TiNT film. The c-dots were able to absorb light efficiently resulting in multiple exciton generation and also a reduction in the recombination of the e-/h+ pair produced in c-dot/TiNT film during photo/voltage-induced degradation. It was also possible to readily regenerate the surface using ultraviolet light irradiation, leaving the whole film structure undamaged and with high reproducibility and stability.

  6. The Tissue Response and Degradation of Electrospun Poly(ε-caprolactone/Poly(trimethylene-carbonate Scaffold in Subcutaneous Space of Mice

    Directory of Open Access Journals (Sweden)

    Tao Jiang

    2014-01-01

    Full Text Available Due to the advantage of controllability on the mechanical property and the degradation rates, electrospun PCL/PTMC nanofibrous scaffold could be appropriate for vascular tissue engineering. However, the tissue response and degradation of electrospun PCL/PTMC scaffold in vivo have never been evaluated in detail. So, electrospun PCL/PTMC scaffolds with different blend ratios were prepared in this study. Mice subcutaneous implantation showed that the continuous degradation of PCL/PTMC scaffolds induced a lasted macrophage-mediated foreign body reaction, which could be in favor of the tissue regeneration in graft.

  7. Carbon Fluxes between Primary Metabolism and Phenolic Pathway in Plant Tissues under Stress

    Directory of Open Access Journals (Sweden)

    Sofia Caretto

    2015-11-01

    Full Text Available Higher plants synthesize an amazing diversity of phenolic secondary metabolites. Phenolics are defined secondary metabolites or natural products because, originally, they were considered not essential for plant growth and development. Plant phenolics, like other natural compounds, provide the plant with specific adaptations to changing environmental conditions and, therefore, they are essential for plant defense mechanisms. Plant defensive traits are costly for plants due to the energy drain from growth toward defensive metabolite production. Being limited with environmental resources, plants have to decide how allocate these resources to various competing functions. This decision brings about trade-offs, i.e., promoting some functions by neglecting others as an inverse relationship. Many studies have been carried out in order to link an evaluation of plant performance (in terms of growth rate with levels of defense-related metabolites. Available results suggest that environmental stresses and stress-induced phenolics could be linked by a transduction pathway that involves: (i the proline redox cycle; (ii the stimulated oxidative pentose phosphate pathway; and, in turn, (iii the reduced growth of plant tissues.

  8. Metabolic Engineering to Develop a Pathway for the Selective Cleavage of Carbon-Nitrogen Bonds

    Energy Technology Data Exchange (ETDEWEB)

    John J. Kilbane II

    2005-10-01

    The objective of the project is to develop a biochemical pathway for the selective cleavage of C-N bonds in molecules found in petroleum. Specifically a novel biochemical pathway will be developed for the selective cleavage of C-N bonds in carbazole. The cleavage of the first C-N bond in carbazole is accomplished by the enzyme carbazole dioxygenase, that catalyzes the conversion of carbazole to 2-aminobiphenyl-2,3-diol. The genes encoding carbazole dioxygenase were cloned from Sphingomonas sp. GTIN11 and from Pseudomonas resinovorans CA10. The selective cleavage of the second C-N bond has been challenging, and efforts to overcome that challenge have been the focus of recent research in this project. Enrichment culture experiments succeeded in isolating bacterial cultures that can metabolize 2-aminobiphenyl, but no enzyme capable of selectively cleaving the C-N bond in 2-aminobiphenyl has been identified. Aniline is very similar to the structure of 2-aminobiphenyl and aniline dioxygenase catalyzes the conversion of aniline to catechol and ammonia. For the remainder of the project the emphasis of research will be to simultaneously express the genes for carbazole dioxygenase and for aniline dioxygenase in the same bacterial host and then to select for derivative cultures capable of using carbazole as the sole source of nitrogen.

  9. METABOLIC ENGINEERING TO DEVELOP A PATHWAY FOR THE SELECTIVE CLEAVAGE OF CARBON-NITROGEN BONDS

    Energy Technology Data Exchange (ETDEWEB)

    John J. Kilbane II

    2004-10-01

    The objective of the project is to develop biochemical pathways for the selective cleavage of C-N bonds in molecules found in petroleum. The initial phase of the project was focused on the isolation or development of an enzyme capable of cleaving the C-N bond in aromatic amides, specifically 2-aminobiphenyl. The objective of the second phase of the research will be to construct a biochemical pathway for the selective removal of nitrogen from carbazole by combining the carA genes from Sphingomonas sp. GTIN11 with the gene(s) encoding an appropriate deaminase. The objective of the final phase of the project will be to develop derivative C-N bond cleaving enzymes that have broader substrate ranges and to demonstrate the use of such strains to selectively remove nitrogen from petroleum. During the first year of the project (October, 2002-September, 2003) enrichment culture experiments resulted in the isolation of microbial cultures that utilize aromatic amides as sole nitrogen sources, several amidase genes were cloned and were included in directed evolution experiments to obtain derivatives that can cleave C-N bonds in aromatic amides, and the carA genes from Sphingomonas sp. GTIN11, and Pseudomonas resinovorans CA10 were cloned in vectors capable of replicating in Escherichia coli. During the second year of the project (October, 2003-September, 2004) enrichment culture experiments succeeded in isolating a mixed bacterial culture that can utilize 2-aminobiphenyl as a sole nitrogen source, directed evolution experiments were focused on the aniline dioxygenase enzyme that is capable of deaminating aniline, and expression vectors were constructed to enable the expression of genes encoding C-N bond cleaving enzymes in Rhodococcus hosts. The construction of a new metabolic pathway to selectively remove nitrogen from carbazole and other molecules typically found in petroleum should lead to the development of a process to improve oil refinery efficiency by reducing the

  10. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    Energy Technology Data Exchange (ETDEWEB)

    Snyder-Talkington, Brandi N. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Dymacek, Julian [Lane Department of Computer Science and Electrical Engineering, West Virginia University, Morgantown, WV 26506-6070 (United States); Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Porter, Dale W.; Wolfarth, Michael G.; Mercer, Robert R. [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Pacurari, Maricica [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States); Denvir, James [Department of Biochemistry and Microbiology, Marshall University, Huntington, WV 25755 (United States); Castranova, Vincent [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Qian, Yong, E-mail: yaq2@cdc.gov [Pathology and Physiology Research Branch, Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Guo, Nancy L., E-mail: lguo@hsc.wvu.edu [Mary Babb Randolph Cancer Center, West Virginia University, Morgantown, WV 26506-9300 (United States)

    2013-10-15

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 μg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung

  11. System-based identification of toxicity pathways associated with multi-walled carbon nanotube-induced pathological responses

    International Nuclear Information System (INIS)

    The fibrous shape and biopersistence of multi-walled carbon nanotubes (MWCNT) have raised concern over their potential toxicity after pulmonary exposure. As in vivo exposure to MWCNT produced a transient inflammatory and progressive fibrotic response, this study sought to identify significant biological processes associated with lung inflammation and fibrosis pathology data, based upon whole genome mRNA expression, bronchoaveolar lavage scores, and morphometric analysis from C57BL/6J mice exposed by pharyngeal aspiration to 0, 10, 20, 40, or 80 μg MWCNT at 1, 7, 28, or 56 days post-exposure. Using a novel computational model employing non-negative matrix factorization and Monte Carlo Markov Chain simulation, significant biological processes with expression similar to MWCNT-induced lung inflammation and fibrosis pathology data in mice were identified. A subset of genes in these processes was determined to be functionally related to either fibrosis or inflammation by Ingenuity Pathway Analysis and was used to determine potential significant signaling cascades. Two genes determined to be functionally related to inflammation and fibrosis, vascular endothelial growth factor A (vegfa) and C-C motif chemokine 2 (ccl2), were confirmed by in vitro studies of mRNA and protein expression in small airway epithelial cells exposed to MWCNT as concordant with in vivo expression. This study identified that the novel computational model was sufficient to determine biological processes strongly associated with the pathology of lung inflammation and fibrosis and could identify potential toxicity signaling pathways and mechanisms of MWCNT exposure which could be used for future animal studies to support human risk assessment and intervention efforts. - Highlights: • A novel computational model identified toxicity pathways matching in vivo pathology. • Systematic identification of MWCNT-induced biological processes in mouse lungs • MWCNT-induced functional networks of lung

  12. Energy outlook to 2035 in Asia and its pathways towards a low carbon energy system

    Energy Technology Data Exchange (ETDEWEB)

    Komiyama, Ryoichi

    2010-09-15

    This report analyzes energy outlook in Asia and the world to 2035. In Technologically Advanced Scenario, advanced low-carbon technology yields, in 2035, 2,305 Mtoe or 14% of the saving in world primary energy demand and 12.3 Gt or 30% of the reduction in global CO2 emissions compared with the Reference Scenario. In these savings, Asia will account for 58% in the world primary energy reduction and 55% of the world CO2 mitigation, emphasizing immense potential of energy and CO2 saving in Asia and the importance of the deployment of clean energy technology through technology transfer to Asian region.

  13. Tailoring the degradation kinetics of poly(ester-carbonate urethane)urea thermoplastic elastomers for tissue engineering scaffolds

    OpenAIRE

    Hong, Yi; Guan, Jianjun; Fujimoto, Kazuro L.; Hashizume, Ryotaro; Pelinescu, Anca L.; Wagner, William R.

    2010-01-01

    Biodegradable elastomeric scaffolds are of increasing interest for applications in soft tissue repair and regeneration, particularly in mechanically active settings. The rate at which such a scaffold should degrade for optimal outcomes, however, is not generally known and the ability to select from similar scaffolds that vary in degradation behavior to allow such optimization is limited. Our objective was to synthesize a family of biodegradable polyurethane elastomers where partial substituti...

  14. Transcript level coordination of carbon pathways during silicon starvation-induced lipid accumulation in the diatom Thalassiosira pseudonana.

    Science.gov (United States)

    Smith, Sarah R; Glé, Corine; Abbriano, Raffaela M; Traller, Jesse C; Davis, Aubrey; Trentacoste, Emily; Vernet, Maria; Allen, Andrew E; Hildebrand, Mark

    2016-05-01

    Diatoms are one of the most productive and successful photosynthetic taxa on Earth and possess attributes such as rapid growth rates and production of lipids, making them candidate sources of renewable fuels. Despite their significance, few details of the mechanisms used to regulate growth and carbon metabolism are currently known, hindering metabolic engineering approaches to enhance productivity. To characterize the transcript level component of metabolic regulation, genome-wide changes in transcript abundance were documented in the model diatom Thalassiosira pseudon