WorldWideScience

Sample records for carbon 22

  1. Sorption of UO22+ on calcium carbonate

    International Nuclear Information System (INIS)

    Sorption of uranyl ions on calcium carbonate from aqueous solutions featuring different concentration of calcium nitrate was studied experimentally. It is shown that uranium sorption decreases with calcium concentration growth in solution, irrespective of the ratio of solid phase and solution masses. Specific sorption of uranium per unit of the sorbent surface depends linearly on the ratio of UO22+ and Ca2+ ions activities in solution with proportionality factor (sorption equilibrium constant) 1.71 ± 0.16 mol/m2 at 20 deg C

  2. Building complex carbon skeletons with ethynyl[2.2]paracyclophanes

    OpenAIRE

    Ina Dix; Lidija Bondarenko; Jones, Peter G; Thomas Oeser; Henning Hopf

    2014-01-01

    Ethynyl[2.2]paracyclophanes are shown to be useful substrates for the preparation of complex, highly unsaturated carbon frameworks. Thus both the pseudo-geminal- 2 and the pseudo-ortho-diethynylcyclophane 4 can be dimerized by Glaser coupling to the respective dimers 9/10 and 11/12. Whereas the former isomer pair could not be separated so far, the latter provided the pure diastereomers after extensive column chromatography/recrystallization. Isomer 11 is chiral and could be separated on a col...

  3. Polarized absorption spectra of (2,2) carbon nanotubes aligned in channels of an AEL crystal

    Science.gov (United States)

    Chen, Yanping; Zhai, Jianpang; Li, Irene Ling; Ruan, Shuangchen; Tang, Zikang

    2015-11-01

    We report polarized absorption spectra for the (2,2) tubes arrayed in the one-dimensional channels of an AlPO4-11 (AEL) single crystal. Strong polarization dependence is observed indicating a preferential optical dipole along the axis of carbon nanotubes. By correlating with the absorption spectra and First-principles local density function (LDA) calculation, the absorption peak at 2.95 eV is uniquely assigned to semiconducting type (2,2) tubes, and peaks at 2.67 and 2.40 eV are corresponding to metallic type (2,2) tubes.

  4. Using the E22 transition of carbon nanotubes for fiber laser mode-locking

    International Nuclear Information System (INIS)

    We characterize the saturable absorption of the second (E22) electronic transition of a sample of single-walled carbon nanotubes and use it to mode-lock an ytterbium fiber ring laser. The modulation depth of ∼ 15% was found to be similar to the corresponding E11 transition (∼ 13%), but the saturation intensity (∼ 220 MW cm-2) about an order of magnitude larger (∼ 10 MW cm-2). We achieved a 15 MHz mode-locked pulse train with an output pulse duration of 6.5 ps. For comparison we also demonstrate stable mode-locking on the E11 transition, of the same nanotubes, with an erbium fiber ring laser, producing 1.1 ps pulses. Using the E22 transition should enable the use of carbon nanotube saturable absorbers at shorter wavelengths than currently possible with the E11 transition, which are limited by the smallest achievable nanotube dimensions

  5. Combined microcalorimetric and IR spectroscopic study on carbon dioxide adsorption in H-MCM-22

    International Nuclear Information System (INIS)

    Highlights: • Adsorption calorimetry and variable temperature IR spectroscopy is used to study adsorption of CO2 in the protonic zeolite H-MCM-22. • By simultaneously recording IR absorbance over a temperature range, temperature and equilibrium pressure, standard adsorption enthalpy and entropy of CO2 was determined. • The results are discussed in the broader context of carbon dioxide capture from the flue gas of fossil fuel fired power stations. - Abstract: The thermodynamics of carbon dioxide adsorption in the protonic zeolite H-MCM-22 (Si:Al = 16:1) was investigated by means of adsorption calorimetry and variable-temperature IR spectroscopy, a technique that affords determination of standard adsorption enthalpy (ΔH0) and entropy (ΔS0) from analysis of a series of IR spectra recorded over a temperature range while simultaneously measuring equilibrium pressure inside a closed IR cell. ΔH0 resulted to be −24.5 (±2) kJ mol−1, while for the entropy change the value of ΔS0 = −115 (±10) J mol−1 K−1 was obtained. The obtained ΔH0 value is compared with those reported in the literature for the adsorption of CO2 on other zeolites, and discussed in the context of carbon dioxide capture and sequestration

  6. Characterization of physiological responses to 22 gene knockouts in Escherichia coli central carbon metabolism.

    Science.gov (United States)

    Long, Christopher P; Gonzalez, Jacqueline E; Sandoval, Nicholas R; Antoniewicz, Maciek R

    2016-09-01

    Understanding the impact of gene knockouts on cellular physiology, and metabolism in particular, is centrally important to quantitative systems biology and metabolic engineering. Here, we present a comprehensive physiological characterization of wild-type Escherichia coli and 22 knockouts of enzymes in the upper part of central carbon metabolism, including the PTS system, glycolysis, pentose phosphate pathway and Entner-Doudoroff pathway. Our results reveal significant metabolic changes that are affected by specific gene knockouts. Analysis of collective trends and correlations in the data using principal component analysis (PCA) provide new, and sometimes surprising, insights into E. coli physiology. Additionally, by comparing the data-to-model predictions from constraint-based approaches such as FBA, MOMA and RELATCH we demonstrate the important role of less well-understood kinetic and regulatory effects in central carbon metabolism. PMID:27212692

  7. Combined microcalorimetric and IR spectroscopic study on carbon dioxide adsorption in H-MCM-22

    Science.gov (United States)

    Arean, C. O.; Delgado, M. R.; Bulánek, R.; Frolich, K.

    2014-10-01

    The thermodynamics of carbon dioxide adsorption in the protonic zeolite H-MCM-22 (Si:Al = 16:1) was investigated by means of adsorption calorimetry and variable-temperature IR spectroscopy, a technique that affords determination of standard adsorption enthalpy (ΔH0) and entropy (ΔS0) from analysis of a series of IR spectra recorded over a temperature range while simultaneously measuring equilibrium pressure inside a closed IR cell. ΔH0 resulted to be -24.5 (±2) kJ mol-1, while for the entropy change the value of ΔS0 = -115 (±10) J mol-1 K-1 was obtained. The obtained ΔH0 value is compared with those reported in the literature for the adsorption of CO2 on other zeolites, and discussed in the context of carbon dioxide capture and sequestration.

  8. Zeolite MCM-22 Modified with Au and Cu for Catalytic Total Oxidation of Methanol and Carbon Monoxide

    Czech Academy of Sciences Publication Activity Database

    Kaminski, P.; Sobczak, I.; Decyk, P.; Ziolek, M.; Roth, Wieslaw Jerzy; Campo, B.; Daturi, M.

    2013-01-01

    Roč. 117, č. 5 (2013), s. 2147-2159. ISSN 1932-7447 R&D Projects: GA ČR(CZ) GAP106/12/0189 Institutional support: RVO:61388955 Keywords : adsorption * carbon dioxide * MCM-22 zeolites Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.835, year: 2013

  9. Coating curly carbon nanotubes with monocrystalline Zn(BO2)2 and the mechanism of straightening the tubes

    Institute of Scientific and Technical Information of China (English)

    LIU; Jinzhang; YAN; Pengxun; YUE; Guanghui

    2006-01-01

    We overgrew single-crystalline Zn(BO2)2 coatings on carbon nanotubes (CNTs) for the first time. Scanning electron microscopy and transmission electron microscopy analyses revealed that the carbon nanotube-zinc borate composite rods are from tens to hundreds of nm in diameter. It is notable that the original curly tubes were straightened by the monocrystalline coatings. In addition, the crystal nucleation and growth on the surface of CNT were explained. We set a two-dimensional model, which is based on our experimental result, to qualitatively explain the mechanism of straightening the curly tubes by coating them with single-crystals.

  10. 2012 CHEMISTRY & PHYSICS OF GRAPHITIC CARBON MATERIALS GORDON RESEARCH CONFERENCE, JUNE 17-22, 2012

    Energy Technology Data Exchange (ETDEWEB)

    Fertig, Herbert

    2012-06-22

    This conference will highlight the urgency for research on graphitic carbon materials and gather scientists in physics, chemistry, and engineering to tackle the challenges in this field. The conference will focus on scalable synthesis, characterization, novel physical and electronic properties, structure-properties relationship studies, and new applications of the carbon materials. Contributors

  11. Properties of Lithium-11 and Carbon-22 at leading order in halo effective field theory

    Directory of Open Access Journals (Sweden)

    Acharya Bijaya

    2016-01-01

    Full Text Available We study the 11Li and 22C nuclei at leading order (LO in halo effective field theory (Halo EFT. Using the value of the 22C rms matter radius deduced in Ref. [1] as an input in a LO calculation, we simultaneously constrain the values of the two-neutron (2n separation energy of 22C and the virtual-state energy of the 20C−neutron system (hereafter denoted 21C. The 1−σ uncertainty of the input rms matter radius datum, along with the theory error estimated from the anticipated size of the higher-order terms in the Halo EFT expansion, gives an upper bound of about 100 keV for the 2n separation energy. We also study the electric dipole excitation of 2n halo nuclei to a continuum state of two neutrons and the core at LO in Halo EFT. We first compare our results with the 11Li data from a Coulomb dissociation experiment and obtain good agreement within the theoretical uncertainty of a LO calculation. We then obtain the low-energy spectrum of B(E1 of this transition at several different values of the 2n separation energy of 22C and the virtual-state energy of 21C. Our predictions can be compared to the outcome of an ongoing experiment on the Coulomb dissociation of 22C to obtain tighter constraints on the two- and three-body energies in the 22C system.

  12. Properties of Lithium-11 and Carbon-22 at leading order in halo effective field theory

    Science.gov (United States)

    Acharya, Bijaya; Phillips, Daniel R.

    2016-03-01

    We study the 11Li and 22C nuclei at leading order (LO) in halo effective field theory (Halo EFT). Using the value of the 22C rms matter radius deduced in Ref. [1] as an input in a LO calculation, we simultaneously constrain the values of the two-neutron (2n) separation energy of 22C and the virtual-state energy of the 20C-neutron system (hereafter denoted 21C). The 1-σ uncertainty of the input rms matter radius datum, along with the theory error estimated from the anticipated size of the higher-order terms in the Halo EFT expansion, gives an upper bound of about 100 keV for the 2n separation energy. We also study the electric dipole excitation of 2n halo nuclei to a continuum state of two neutrons and the core at LO in Halo EFT. We first compare our results with the 11Li data from a Coulomb dissociation experiment and obtain good agreement within the theoretical uncertainty of a LO calculation. We then obtain the low-energy spectrum of B(E1) of this transition at several different values of the 2n separation energy of 22C and the virtual-state energy of 21C. Our predictions can be compared to the outcome of an ongoing experiment on the Coulomb dissociation of 22C to obtain tighter constraints on the two- and three-body energies in the 22C system.

  13. Studies on electrochemical behaviour on NpO22+/NpO2+ redox couple at single walled carbon nanotube modified glassy carbon electrode (SWCNT-GC)

    International Nuclear Information System (INIS)

    Electrochemistry of NpO22+/NpO2+ couple in 1 M H2SO4 was studied on bare and modified glassy carbon (GC) electrodes by cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). The modified electrode (SWCNTs-GC) was characterized by scanning electron microscopy (SEM). Electrocatalysis of NpO22+/NpO2+ redox reaction was observed on SWCNT-GC electrode. The lower charge transfer resistance at SWCNT-GC reflects faster rate of electron transfer reaction of Np(VI)/Np(V) couple. These results are interesting to develop electroanalytical methodologies for neptunium determination using SWCNT modified electrode. To the best of our knowledge, this is the first study on the electrocatalysis of neptunium on SWCNT modified electrode.

  14. Measurement of the analyzing power for proton-carbon elastic scattering in the CNI region with a 22 GeV/c polarized proton beam

    International Nuclear Information System (INIS)

    We have carried out the experiment BNL-AGS E950 to measure the analyzing power for proton-carbon elastic scattering in the Coulomb-Nuclear Interference (CNI) region with a 22 GeV/c polarized proton beam. Recoil carbons from 300 keV to a few MeV in the CNI region, were detected inside the AGS ring to identify proton-carbon elastic scattering. The preliminary results of the analyzing power measurement are presented

  15. Bis(2,2-dimethyl-2,3-dihydro-1-benzofuran-7-yl carbonate

    Directory of Open Access Journals (Sweden)

    Lin-Tao Yang

    2011-02-01

    Full Text Available The title compound, C21H22O5, crystallizes with three molecules in the asymmetric unit. In one molecule, two methyl groups are disordered over two positions with a site occupation factor of 0.72 (2 for the major occupancy site. The benzene rings make dihedral angles of 35.3 (6, 29.7 (6 and 40.6 (7° in the three molecules.

  16. Properties of Lithium-11 and Carbon-22 at leading order in halo effective field theory

    CERN Document Server

    Acharya, Bijaya

    2015-01-01

    We study the $^{11}\\mathrm{Li}$ and $^{22}\\mathrm{C}$ nuclei at leading order (LO) in halo effective field theory (Halo EFT). Using the value of the $^{22}\\mathrm{C}$ rms matter radius deduced in Ref. [1] as an input in a LO calculation, we simultaneously constrained the values of the two-neutron (2$n$) separation energy of $^{22}\\mathrm{C}$ and the virtual-state energy of the $^{20}\\mathrm{C}-$neutron system (hereafter denoted $^{21}$C). The 1$-\\sigma$ uncertainty of the input rms matter radius datum, along with the theory error estimated from the anticipated size of the higher-order terms in the Halo EFT expansion, gave an upper bound of about 100 keV for the 2$n$ separation energy. We also study the electric dipole excitation of 2$n$ halo nuclei to a continuum state of two neutrons and the core at LO in Halo EFT. We first compare our results with the $^{11}\\mathrm{Li}$ data from a Coulomb dissociation experiment and obtain good agreement within the theoretical uncertainty of a LO calculation. We then obtai...

  17. Biochemical Contributions to Corrosion of Carbon Steel and Alloy 22 in a Continual Flow System

    International Nuclear Information System (INIS)

    Microbiologically influenced corrosion (MIC) may decrease the functional lifetime of nuclear waste packaging materials in the potential geologic repository at Yucca Mountain (YM), Nevada. Biochemical contributions to corrosion of package materials are being determined in reactors containing crushed repository-site rock with the endogenous microbial community, and candidate waste package materials. These systems are being continually supplied with simulated ground water. Periodically, bulk chemistries are analyzed on the system outflow, and surfacial chemistries are assessed on withdrawn material coupons. Both Fe and Mn dissolved from C1020 coupons under conditions that included the presence of YM microorganisms. Insoluble corrosion products remained in a reduced state at the coupon surface, indicating at least a localized anoxic condition; soluble reduced Mn and Fe were also detected in solution, while precipitated and spalled products were oxidized. Alloy 22 surfaces showed a layer of chrome oxide, almost certainly in the Cr(III) oxidation state, on microcosm-exposed coupons, while no soluble chrome was detected in solution. The results of these studies will be compared to identical testing on systems containing sterilized rock to generate, and ultimately predict, microbial contributions to waste package corrosion chemistries

  18. Hydrodynamic Gene Delivery of Interleukin-22 Protects the Mouse Liver from Concanavalin A-, Carbon Tetrachloride-, and Fas Ligand-Induced Injury via Activation of STAT3

    Institute of Scientific and Technical Information of China (English)

    Hongna Pan; Feng Hong; Svetlana Radaeva; Bin Gao

    2004-01-01

    Interleukin-22 (IL-22) is a recently identified T cell-derived cytokine whose biological significance remains obscure. Previously, we have shown that IL-22 plays a protective role in T cell-mediated hepatitis induced by Concanavalin A (Con A), acting as a survival factor for hepatocytes. In the present paper, we demonstrate that hydrodynamic gene delivery of IL-22 cDNA driven either by a liver-specific albumin promoter or a human cytomegalovirus (CMV) promoter results in IL-22 protein expression, STAT3 activation, and expression of several anti-apoptotic proteins, including Bcl-xL, Bcl-2, and Mcl-1 in the liver. Immunohistochemical analysis reveals that IL-22 protein expression is mainly detected in the cytoplasm of hepatocytes. Overexpression of IL-22 by hydrodynamic gene delivery significantly protects against liver injury, necrosis, and apoptosis induced by administration of Con A, carbon tetrachloride (CCl4), or the Fas agonist Jo-2 mAb. Western blot analyses show that overexpression of IL-22 significantly enhances activation of STAT3 and expression of Bcl-xL, Bcl-2,and Mcl-1 proteins in liver injury induced by Con A. In conclusion, hydrodynamic gene delivery of IL-22 protects against liver injury induced by a variety of toxins, suggesting the therapeutic potential of IL-22 in treating human liver disease. Cellular & Molecular Immunology. 2004;1(1):43-49.

  19. Hydrodynamic Gene Delivery of Interleukin-22 Protects the Mouse Liver from Concanavalin A-, Carbon Tetrachloride-, and Fas Ligand-Induced Injury via Activation of STAT3

    Institute of Scientific and Technical Information of China (English)

    HongnaPan; FengHong; SvetlanaRadaeva; BinGao

    2004-01-01

    Interleukin-22 (IL-22) is a recently identified T cell-derived cytokine whose biological significance remains obscure. Previously, we have shown that IL-22 plays a protective role in T cell-mediated hepatitis induced by Concanavalin A (Con A), acting as a survival factor for hepatocytes. In the present paper, we demonstrate that hydrodynamic gene delivery of IL-22 cDNA driven either by a liver-specific albumin promoter or a human cytomegalovirus (CMV) promoter results in IL-22 protein expression, STAT3 activation, and expression of several anti-apoptotic proteins, including Bcl-xL, Bcl-2, and Mcl-1 in the liver. Immunohistochemical analysis reveals that IL-22 protein expression is mainly detected in the cytoplasm of hepatocytes. Overexpression of IL-22 by hydrodynamic gene delivery significantly protects against liver injury, necrosis, and apoptosis induced by administration of Con A, carbon tetrachloride (CCl4), or the Fas agonist Jo-2 mAb. Western blot analyses show that overexpression of IL-22 significantly enhances activation of STAT3 and expression of Bcl-xL, Bcl-2, and Mcl-1 proteins in liver injury induced by Con A. In conclusion, hydrodynamic gene delivery of IL-22 protects against liver injury induced by a variety of toxins, suggesting the therapeutic potential of IL-22 in treating human liver disease. Cellular & Molecular Immunology. 2004;1(1):43-49.

  20. Congruent melting of calcium carbonate in a static experiment at 3500 K and 10-22 GPa: Its role in the genesis of ultradeep diamonds

    Science.gov (United States)

    Spivak, A. V.; Dubrovinskii, L. S.; Litvin, Yu. A.

    2011-08-01

    Resulting from static experiments performed to study the phase state of CaCO3, it was found that its melting is congruent at 20-22 GPa and 3500 K. The obtained experiment data show that the field of congruent melting of calcium carbonate is rather broad (form 2300 to 3500-3800 K at 20-22 GPa). However, the potential presence of a high-temperature phase boundary at which CaCO3 is decomposed into CaO and CO2 is not ruled out. The existence of a wide area of congruent melting of calcium carbonate (a common primary inclusion in diamonds of the transition zone and lower mantle of the Earth) allow one to consider deep-seated melts as potential parental media for ultradeep diamonds.

  1. Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the R/V Knorr Repeat Hydrography Cruise in the Atlantic Ocean: CLIVAR CO2 Sections A20_2003 (22 September-20 October 2003) and A22_2003 (23 October-13 November, 2003)

    Energy Technology Data Exchange (ETDEWEB)

    Kozyr, Alex [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Carbon Dioxide Information Analysis Center

    2008-09-30

    This report presents methods, and analytical and quality control procedures for salinity, oxygen, nutrient, inorganic carbon, organic carbon, chlorofluorocarbon (CFC), and bomb carbon-14 system parameters performed during the A20_2003 and A22_2003 cruises, which took place between September 22 and November 13, 2003, aboard research vessel (R/V) Knorr under the auspices of the National Oceanic and Atmospheric Administration (NOAA) and National Science Foundation (NSF). The R/V Knorr departed Woods Hole, Massachusetts, on September 22 for the Repeat Section A20, and ended this line in Port of Spain, Trinidad, on October 20. The Repeat Section A22 started on October 23 in Port of Spain, Trinidad, and finished on November 13, 2003, in Woods Hole, Massachusetts. The research conducted was one of a series of repeat hydrography sections jointly funded by NOAA and NSF as part of the Climate Variability Program (CLIVAR)/CO2/repeat hydrography/tracer program. Samples were taken from 36 depths at 88 stations on section A20 and 82 stations on section A22. The data presented in this report include the analyses of water samples for total inorganic carbon (TCO2), total alkalinity (TALK), dissolved organic carbon (DOC), CFC, carbon-14, hydrographic, and other chemical measurements.

  2. Distributions of C22-C30 even-carbon-number n-alkanes in Ocean Anoxic Event 1 samples from the Basque-Cantabrian Basin.

    Science.gov (United States)

    Chaler, R; Dorronsoro, C; Grimalt, J O; Agirrezabala, L M; Fernández-Mendiola, P A; García-Mondejar, J; Gómez-Pérez, I; López-Horgue, M

    2005-05-01

    The Ocean Anoxic Event 1 (OAE-1) in central sites of the Basque-Cantabrian Basin exhibits very reducing depositional conditions of sedimentation. These sedimentation events have left a distinct mixture of hydrocarbons that are represented by C22-C30 n-alkanes with a predominance of the even-carbon-number homologues, high relative proportions of squalane and C16-C24 n-alkylcyclopentanes predominated by n-undecyl-, n-tridecyl- and n-pentadecylcyclopentane. Other minor compounds encompass a series of C18-C21 n-alkylcyclohexanes and C18-C24 dimethyl n-alkylcyclohexanes maximized by the even-carbon-number homologues as well as iso- and anteiso-alkanes. This unusual distribution of n-alkanes in this environment provides a new case for comparison with previously reported hypersaline and phosphorite sedimentary deposits where the occurrence of similar n-alkane distributions was reported. In the present case, these major n-alkanes and squalane are indicative of transformation under strong reducing conditions. In contrast, the occurrence of the alkylcyclopentanes, irrespective of the presence of even-carbon-number n-alkanes or squalane, suggests that reductive cyclization of fatty acids is less dependent on strong reducing conditions. PMID:15776255

  3. Measurement of analyzing powers of π+ and π- produced on a hydrogen and a carbon target with a 22-GeV/c incident polarized proton beam

    International Nuclear Information System (INIS)

    The analyzing powers of π+ and π- were measured using an incident 22-GeV/c transversely polarized proton beam at the Brookhaven Alternating Gradient Synchrotron. A magnetic spectrometer measured π± inclusive asymmetries on a hydrogen and a carbon target. An elastic polarimeter with a CH2 target measured pp elastic-scattering asymmetries to determine the beam polarization using published data for the pp elastic analyzing power. Using the beam polarization determined from the elastic polarimeter and asymmetries from the inclusive spectrometer, analyzing powers AN for π± were determined in the xF and pT ranges (0.45-0.8) and (0.3-1.2 GeV/c), respectively. The analyzing power results are similar in both sign and character to other measurements at 200 and 11.7 GeV/c, confirming the expectation that high-energy pion inclusive analyzing powers remain large and relatively energy independent. This suggests that pion inclusive polarimetry may be a suitable method for measuring future beam polarizations at BNL RHIC or DESY HERA. Analyzing powers of π+ and π- produced on hydrogen and carbon targets are the same. Various models to explain inclusive analyzing powers are also discussed

  4. Electrochemical and quantum chemical studies of N,N'-bis(4-hydroxybenzaldehyde)-2,2-dimethylpropandiimine Schiff base as corrosion inhibitor for low carbon steel in HCl solution.

    Science.gov (United States)

    Jafari, Hojat; Danaee, Iman; Eskandari, Hadi; Rashvandavei, Mehdi

    2013-01-01

    A synthesized Schiff base N,N'-bis(4-hydroxybenzaldehyde)-2,2-dimethylpropandiimine (p-HBDP) was studied as green inhibitor for the corrosion of low carbon steel in 1 M HCl solution using electrochemical, surface and quantum chemical methods. Results showed that the inhibition occurs through the adsorption of the inhibitor molecules on the metal surface. The inhibition efficiency was found to increase with increasing inhibitor concentration and de-creased with increasing temper-ature, which is due to the fact that the rate of corrosion of steel is higher than the rate of adsorption. Thermodynamic parameters for adsorp-tion and activation processes were determined. Polarization data indicated that this compound act as mixed-type inhibitors and the adsorption isotherm basically obeys the Langmuir adsorption isotherm. The calculations of reactivity indices of p-HBDP such as softness and natural charge distributions together with local reactivity by means of Fukui indices were used to explain the electron transfer mechanism between the p-HBDP molecules and the steel surface. PMID:23947700

  5. Effects of carbon nanomaterials fullerene C60 and fullerol C60(OH)18–22 on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    International Nuclear Information System (INIS)

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C60), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C60(OH)18–22), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO·) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO· in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen (1O2) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p 1O2 generation; and (3) fullerol also decreased GCL activity and GSH formation (p 1O2 formation.

  6. Processing of carbon-fiber-reinforced Zr41.2Ti13.8Cu12.5Ni10.0Be22.5 bulk metallic glass composites

    OpenAIRE

    Kim, C. P.; Busch, R.; Masuhr, A.; Choi-Yim, H.; Johnson, W. L.

    2001-01-01

    Carbon-fiber-reinforced bulk metallic glass composites are produced by infiltrating liquid Zr41.2Ti13.8Cu12.5Ni10.0Be22.5 into carbon fiber bundles with diameter of the individual fiber of 5 mum. Reactive wetting occurs by the formation of a ZrC layer around the fibers. This results in a composite with a homogeneous fiber distribution. The volume fraction of the fibers is about 50% and the density of the composite amounts to 4.0 g/cm(^3).

  7. SYNTHESIS OF 2,2'-DICHLOROHYDRAZOBENZENE FROM ORTHO-NITROCHLOROBENZENE OVER MESOPOROUS CARBON SUPPORTED PLATINUM%介孔碳负载铂催化2,2'-二氯氢化偶氮苯的清洁合成

    Institute of Scientific and Technical Information of China (English)

    李波; 李明时; 鲁墨弘

    2012-01-01

    2,2'-Dichlorohydrazobenzene (DHB) is an important commercial intermediate for the synthesis of 3,3'-dichlorobenzidine (DCB). Selective hydrogenation of o-nitrochlorobenzene to DHB over 3% Pt/MC catalyst in alkaline solution was investigated. Some parameters were studied such as additives, reaction temperature, reaction pressure, sodium hydroxide and so on. The results show that the yield of DHB as high as 95. 7% was obtained at 85 ℃ and 0. 5 Mpa.%2,2'-二氯氢化偶氮苯(DHB)是合成3,3'-二氯联苯胺(DCB)的中间体.以邻硝基氯苯为原料,在碱性环境下以3% Pt/介孔碳(MC)为催化剂,通过加氢偶联的方法合成DHB.实验考察了助剂、温度、压力、NaOH溶液等因素对反应的影响,并根据实验结果确定了较佳的工艺条件.在优化的工艺条件下(反应温度为65℃,压力为0.5 MPa),DHB的收率可达95.7%.

  8. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C10H22O5 2,5,8,11,14-Pentaoxapentadecane (VMSD1112, LB4865_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C10H22O5 2,5,8,11,14-Pentaoxapentadecane (VMSD1112, LB4865_V)' providing data by calculation of mass density in the single-phase region(s) from low-pressure dilatometric measurements of the molar excess volume at variable mole fraction and constant temperature.

  9. Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C10H22O5 2,5,8,11,14-Pentaoxapentadecane (VMSD1211, LB4862_V)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume C 'Binary Liquid Systems of Nonelectrolytes III' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Volumetric Properties of the Mixture Dimethyl carbonate C3H6O3 + C10H22O5 2,5,8,11,14-Pentaoxapentadecane (VMSD1211, LB4862_V)' providing data from direct low-pressure dilatometric measurement of molar excess volume at variable mole fraction and constant temperature.

  10. Measurement of analyzing power for proton-carbon elastic scattering in the coulomb-nuclear interference region with a 22-GeV/c polarized proton beam.

    Science.gov (United States)

    Tojo, J; Alekseev, I; Bai, M; Bassalleck, B; Bunce, G; Deshpande, A; Doskow, J; Eilerts, S; Fields, D E; Goto, Y; Huang, H; Hughes, V; Imai, K; Ishihara, M; Kanavets, V; Kurita, K; Kwiatkowski, K; Lewis, B; Lozowski, W; Makdisi, Y; Meyer, H-O; Morozov, B V; Nakamura, M; Przewoski, B; Rinckel, T; Roser, T; Rusek, A; Saito, N; Smith, B; Svirida, D; Syphers, M; Taketani, A; Thomas, T L; Underwood, D; Wolfe, D; Yamamoto, K; Zhu, L

    2002-07-29

    The analyzing power for proton-carbon elastic scattering in the Coulomb-nuclear interference region of momentum transfer, 9.0x10(-3)<-t<4.1x10(-2) (GeV/c)(2), was measured with a 21.7 GeV/c polarized proton beam at the Alternating Gradient Synchrotron of Brookhaven National Laboratory. The ratio of hadronic spin-flip to nonflip amplitude, r(5), was obtained from the analyzing power to be Rer(5)=0.088+/-0.058 and Imr(5)=-0.161+/-0.226. PMID:12144435

  11. Measurement of analyzing power for proton-carbon elastic scattering in the Coulomb-nuclear interference region with a 22-GeV/c polarized proton beam

    International Nuclear Information System (INIS)

    The analyzing power for proton-carbon elastic scattering in the Coulomb-nuclear interference region of momentum transfer, 9.0x10-3-2 (GeV/c)2, was measured with a 21.7 GeV/c polarized proton beam at the Alternating Gradient Synchrotron of Brookhaven National Laboratory. The ratio of hadronic spin-flip to nonflip amplitude, r5, was obtained from the analyzing power to be Rer5=0.088±0.058 and Imr5=-0.161±0.226

  12. Electrogenerated chemiluminescence sensor for the determination of metoclopramide using ordered mesoporous carbon for immobilizing tris(2,2 -bipyridyl)ruthenium

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    A novel electrogenerated chemiluminescence(ECL)sensor for the determination of metoclopramide was developed by employing ruthenium complex as an ECL signal producer and an ordered mesoporous carbon(OMC)material as modified material.The ECL sensor was fabricated by adsorption ruthenium complex into a mixture of OMC and Nafion,which showed good electrochemical and ECL behaviors.It was found that the ECL intensity of the sensor fabricated was greatly enhanced in the presence of metoclopramide.Based on this fin...

  13. High-resolution CCD spectra of stars in globular clusters. V. Carbon, nitrogen, and oxygen abundances in stars in 47 Tuc, M4, and M22

    International Nuclear Information System (INIS)

    Results are reported from blue, red, and IR observations of 15 selected stars in 47 Tuc, M4, and M22, obtained at resolution 20,000 and SNR 60-160 using a CCD array, Schmidt camera, and echelle spectrograph on the 4-m telescope at CTIO during 1987-1989. The data are presented in tables and graphs and analyzed to determine the abundances of C, N, O, and Fe. The Fe/H and O/Fe ratios are found to be -0.85 to -0.9 and 0.43 + or - 0.07 for 47 Tuc, -1.3 and 0.31 + or - 0.06 for M4, and -1.59 and 0.35 or less, respectively. The implications for models of stellar chemical evolution are discussed. 72 refs

  14. Structure-reactivity relationships in aluminium alkoxides-catalysed co-polymerisation reactions : aluminium 2,2' methylenebisphenoxide in the synthesis of poly(ether-carbonate)s from cyclohexene oxide and carbon dioxide

    OpenAIRE

    Sypien, Jakub Konrad

    2006-01-01

    Das Design und die Synthese von "Single-Site"-Katalysatoren für die Copolymerisierung von Kohlendioxids und Cyclohexenoxid (CHO), Untersuchungen zu ihrer Struktur-Reaktivitätsbeziehung sowie die Optimierung der Reaktionsparameter waren Hauptaugenmerk dieser Arbeit. Die Liganden für das Katalysator-Design beruhen auf 2,2'-Bisphenol-Derivaten, entweder Methylen- (1-6 basierte Systeme) oder Sulfid-verbrückt (7 basierte Systeme). Die meisten der verwendeten Liganden wurden bereits in der Literatu...

  15. Simultaneous determination of hydrazine and phenyl hydrazine using 4′-(4-carboxyphenyl)-2,2′:6′,2″ terpyridine diacetonitrile triphenylphosphine ruthenium(II) tetrafluoroborate complex functionalized multiwalled carbon nanotubes modified electrode

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Ida, E-mail: idatiwari_2001@rediffmail.com [Department of Chemistry (Center of Advanced Study), Faculty of Science, Banaras Hindu University, Varanasi (India); Gupta, Mandakini; Sinha, Preeti [Department of Chemistry (Center of Advanced Study), Faculty of Science, Banaras Hindu University, Varanasi (India); Banks, Craig E. [Faculty of Science and Engineering, School of Science and the Environment, Division of Chemistry and Environmental Science, Manchester Metropolitan University, Chester Street, Manchester M1 5GD (United Kingdom)

    2014-12-15

    Highlights: • A nanocomposite of ruthenium(II) terpyridine, triphenylphosphine based complex and multiwalled carbon nanotubes have been used first time for simultaneous detection of hydrazine and phenyl hydrazine. • The detection limit reported is lower as compared to other reported works. • The paper also focuses towards effect of ligand variation attached to ruthenium(II) terpyridine based complexes complex for the hydrazine and phenyl hydrazine detection. • Nanocomposite does not involve any biological entity hence high stability. - Abstract: A nanocomposite based on the incorporation of the complex 4′-(4-carboxyphenyl)-2,2′:6′,2″ terpyridine triphenylphosphine diacetonitrile ruthenium(II) tetrafluoroborate with multiwalled carbon nanotubes and ionomer supported upon a glassy carbon electrode substrate is reported and characterized with scanning electron microscopy, transmission electron microscopy and infrared spectroscopy. The electrochemical behavior and stability of the composite electrode was investigated via cyclic voltammetry. The modified electrode exhibits an electro-catalytic activity towards the oxidation of both hydrazine and phenyl hydrazine in 0.1 M phosphate buffer solution (PBS, pH 7.4). The oxidation of hydrazine and phenyl hydrazine occurs at 0.81 V and 0.32 V with limit of detection found to be 3.7 × 10{sup −7} M and 1.15 × 10{sup −7} M and having a linear range from 5 × 10{sup −6} M to 6.5 × 10{sup −3} M, and 5 × 10{sup −6} M to 0.2 × 10{sup −3} M, respectively.

  16. 22 CFR 228.22 - Air transportation.

    Science.gov (United States)

    2010-04-01

    ... criteria for determining when U.S. flag air carriers are unavailable. See 48 CFR 47.403-1, or USAID... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Air transportation. 228.22 Section 228.22... for USAID Financing § 228.22 Air transportation. (a) The eligibility of air transportation...

  17. 22 CFR 1422.22 - Inconclusive elections.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Inconclusive elections. 1422.22 Section 1422.22... PROCEEDINGS § 1422.22 Inconclusive elections. (a) An inconclusive election is one in which none of the choices... results of the election, the Regional Director may declare the election a nullity and may order...

  18. Preconcentration of Cu(II), Fe(III) and Pb(II) with 2-((2-aminoethylamino)methyl)phenol-functionalized activated carbon followed by ICP-OES determination.

    Science.gov (United States)

    He, Qun; Hu, Zheng; Jiang, Yin; Chang, Xijun; Tu, Zhifeng; Zhang, Lina

    2010-03-15

    A procedure for separation and preconcentration trace amount of Cu(II), Fe(III) and Pb(II) by 2-((2-aminoethylamino)methyl)phenol-functionalized activated carbon (AC-AMP) packed column has been proposed. Under the optimized conditions (pH 4, flow rate 2.0 mL min(-1)), Cu(II), Fe(III) and Pb(II) were retained on the column, then quantitatively eluted by 2 mL 1 mol L(-1) nitric acid solution and determined by inductively coupled plasma-optical emission spectrometry (ICP-OES). The tolerance limits of electrolytes were very high. The adsorption capacity of AC-AMP was found to be 12.1, 67.1, and 16.2 mg g(-1) for Cu(II), Fe(III), and Pb(II), respectively. According to the definition of International Union of Pure and Applied Chemistry, the detection limits (3 sigma) of this method for Cu(II), Fe(III) and Pb(II) were 0.27, 0.41 and 0.16 microg L(-1), respectively. The relative standard deviation under optimum conditions is less than 3.0% (n=11). The proposed method has been validated by analyzing a certified reference material and successfully applied to the preconcentration and determination of Cu(II), Fe(III), and Pb(II) in actual samples with satisfactory results. PMID:19926213

  19. Extraction of ultra-traces of lead, chromium and copper using ruthenium nanoparticles loaded on activated carbon and modified with N,N-bis-(α-methylsalicylidene)-2,2-dimethylpropane-1,3-diamine

    International Nuclear Information System (INIS)

    We describe a novel adsorbent for effective extraction of lead(II), chromium(III) and copper(II). It consists of ruthenium nanoparticles loaded on activated carbon that were modified with N,N-bis-(α-methylsalicylidene)-2,2-dimethylpropane-1,3-diamine. The sorbent was applied to solid-phase extraction combined with ionic-liquid based dispersive liquid-liquid microextraction method. The effects of parameters such as amounts of adsorbent, type and volume of elution solvent, type and volume of extraction and dispersing solvents, etc. were evaluated. The ions were then quantified by flame atomic absorption spectrometry. Under the best conditions, limits of detection, linear dynamic ranges and enrichment factors for these ions ranged from 0.02 to 0.09 μg L−1, 0.08 to 45 μg L−1 and 328 to 356, respectively. The results showed that the method, in addition to its sensitivity, selectivity and good enrichment factor, is simple and efficient. It was applied to the determination of the three ions in blood plasma, food (broccoli, coriander and spinach), and in (spiked) samples of tap, spring and river water. (author)

  20. Effects of carbon nanomaterials fullerene C{sub 60} and fullerol C{sub 60}(OH){sub 18-22} on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Socoowski Britto, Roberta; Longaray Garcia, Marcia; Martins da Rocha, Alessandra [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Artigas Flores, Juliana [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Pinheiro, Mauricio V. Brant [Departamento de Fisica, ICEx, Universidade Federal de Minas Gerais, MG (Brazil); Monserrat, Jose Maria [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Ribas Ferreira, Josencler L., E-mail: josenclerf@gmail.com [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil)

    2012-06-15

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C{sub 60}), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C{sub 60}(OH){sub 18-22}), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO{center_dot}) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO{center_dot} in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen ({sup 1}O{sub 2}) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p < 0.05) increase in lipid peroxidation (with greater damage under illumination), a decrease in GCL activity, and the depletion of GSH stocks (under illumination), all of which were attributed to {sup 1}O{sub 2} generation; and (3) fullerol also decreased GCL activity and GSH formation (p < 0.05) but without lipid damage. The overall results show that fullerene can be toxic with or without light incidence, whereas UV radiation seems to play a key role in the environmental toxicity of carbon NMs through {sup 1}O{sub 2} formation.

  1. Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the R/V Meteor Cruise 22/5 in the South Atlantic Ocean (WOCE Section A10, December 1992-January 1993)

    Energy Technology Data Exchange (ETDEWEB)

    Kozyr, A.

    1998-12-01

    This data documentation discusses the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations, as well as the underway partial pressure of CO{sub 2} (pCO{sub 2}) during the R/V Meteor Cruise 22/5 in the South Atlantic Ocean (Section A10). Conducted as part of the World Ocean Circulation Experiment (WOCE), the cruise began in Rio de Janeiro on December 27, 1992, and ended after 36 days at sea in Capetown, South Africa, on January 31, 1993. Measurements made along WOCE Section A10 included pressure, temperature, and salinity [measured by conductivity, temperature, and depth (CTD) sensor], bottle salinity, bottle oxygen, phosphate, nitrate, nitrite, silicate, chlorofluorocarbons (CFC-1 1 , CFC-12), TCO{sub 2}, TALK, and underway pCO{sub 2}. The TCO{sub 2} was measured by using two Single-Operator Multiparameter Metabolic Analyzers (SOMMAs) for extracting CO{sub 2} from seawater samples that were coupled to a coulometer for detection of the extracted CO{sub 2}. The overall precision and accuracy of the analyses was {+-} 1.9 {micro}mol/kg. Samples collected for TALK were measured by potentiometric titration; precision was {+-}2.0 {micro}mol/kg. Underway pCO{sub 2} was measured by infrared photometry with a precision of {+-} 2.0 {micro}atm. The work aboard the R/V Meteor was supported by the U.S. Department of Energy under contract DE-AC02-76CHOO016, and the Bundesministerium fir Forschung und Technologies through grants 03F0545A and MPG 099/1.

  2. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Atlantic Ocean from 2005-10-22 to 2007-10-01 (NODC Accession 0100065)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0100065 includes chemical, physical and time series data collected from MOORINGS in the North Atlantic Ocean from 2005-10-22 to 2007-10-01. These...

  3. The Carbon Emission Game

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    When Chinese President Hu Jintao attended the UN climate summit on September22,he made a solemn commitment that China will cut its per GDP unit carbon emission to a significant amount in 2020 compared with that of 2005.

  4. 22q11-deletionssyndrom

    DEFF Research Database (Denmark)

    Olesen, Charlotte; Agergaard, Peter; Boers, Maria;

    2010-01-01

    22q11 deletion syndrome (formerly named CATCH22, DiGeorge, Velo-Cardio-Facial, Caylor, Kinouchi and Shprintzen syndrome) occurs in approximately 1/2000 to 4000 children. The genetic lesion is remarkably uniform, occurring mainly as 3 or 1.5 MB deletions in the 22q11.2 region. However, the clinical...

  5. Removal mechanism of 2,2′,4,4′-Tetrabromodiphenylether by carbon nanotubes supported bimetallic composites in water%碳纳米管负载双金属复合材料对水中2,2′,4,4′-四溴联苯醚的去除机制

    Institute of Scientific and Technical Information of China (English)

    刘总堂; 谷成刚; 叶茂; 程吟文; 生弘杰; 卞永荣; 蒋新

    2015-01-01

    Nickel lanthanum/carbon nanotubes (Ni-La/CNTs) and nickel cobalt/carbon nanotubes (Ni-Co/CNTs) composites were prepared by impregnation method. The structure and composition of the Ni-La/CNTs and Ni-Co/CNTs were characterized by TEM and XRD. The removal mechanism of 2,2′,4,4′-tetrabromodiphenylether (BDE-47) by Ni-La/CNTs and Ni-Co/CNTs in water solution were also investigated. The results of TEM images indicated that the Ni-La or Ni-Co bimetallic nanoparticles were loaded onto the composites surfaces successfully with an average diameter in the range of (20~30) nm. The XRD results illustrated that the bimetallic nanoparticles were mainly Ni-La or Ni-Co oxides without demonstrable zero valent nickel, lanthanum and cobalt. Ni-La/CNTs and Ni-Co/CNTs had good removal performance for BDE-47 in water solution. When the initial concentration of BDE-47 increased to 1.0 mg·L-1, the removal rates decreased and the adsorption capacities increased. The possible reason was that the active sites of Ni-La/CNTs and Ni-Co/CNTs were limited and the sorption processes needed more time to reach equilibrium at higher initial BDE-47 concentration. The removal processes of BDE-47 onto Ni-La/CNTs and Ni-Co/CNTs could be fitted by the pseudo-second order kinetic model perfectly, the adsorption rate order waskCNTs > kNi-La/CNTs> kNi-Co/CNTs. Predominant adsorption and weak degradation were coexisted in the removal process of BDE-47 by Ni-La/CNTs and Ni-Co/CNTs while there was only adsorption onto CNTs. In addition, the Ni-La/CNTs and Ni-Co/CNTs composites had good regeneration performance and the removal rates were still more than 80 % after four regeneration cycles.%采用浸渍法制备了碳纳米管负载镍镧(Ni-La)/镍钴(Ni-Co)双金属复合材料Ni-La/CNTs和Ni-Co/CNTs,采用投射电子显微镜(TEM)和X射线粉末衍射仪(XRD)对样品的结构特征和组成进行了表征。并通过吸附实验探讨了Ni-La/CNTs和Ni-Co/CNTs对水中2,2′,4,4

  6. Carbon dioxide effects research and assessment program. Proceedings of the International Meeting on Stable Isotopes in Tree-Ring Research, New Paltz, New York, May 22-25, 1979

    Energy Technology Data Exchange (ETDEWEB)

    Jacoby, G [ed.

    1980-12-01

    Information about the past and present concentrations of CO/sub 2/ in the atmosphere and variations in climate can be obtained from measurements of stable isotopes in tree rings; specifically carbon-13, oxygen-18 and deuterium. The analysis of these stable isotopes in tree rings is a relatively new and rapidly developing field. This proceedings volume contains most of the papers presented at the meeting. The first paper gives an overview of the status of carbon-13 research. Papers relating to carbon-13 are in section I and grouped separately from the contributions on carbon-14. Although the meeting was primarily concerned with stable isotopes, all carbon isotopic analysis may be helpful in understanding the carbon-13 record in tree rings. The papers on hydrogen and oxygen isotope studies are in sections II and III respectively. The remaining sections contain papers that consider more than one isotope at a time, general topics related to isotopes, atmospheric changes and tree growth, and methods of isotopic analysis.

  7. R-22 vapor explosions

    International Nuclear Information System (INIS)

    Previous experimental and theoretical studies of R-22 vapor explosions are reviewed. Results from two experimental investigations of vapor explosions in a medium scale R-22/water system are reported. Measurements following the drop of an unrestrained mass of R-22 into a water tank demonstrated the existence of two types of interaction behavior. Release of a constrained mass of R-22 beneath the surface of a water tank improved the visual resolution of the system thus allowing identification of two interaction mechansims: at low water temperatures, R-22/water contact would produce immediate violent boiling; at high water temperatures a vapor film formed around its R-22 as it was released, explosions were generated by a surface wave which initiated at a single location and propagated along the vapor film as a shock wave. A new vapor explosion model is proposed, it suggests explosions are the result of a sequence of three independent steps: an initial mixing phase, a trigger and growth phase, and a mature phase where a propagating shock wave accelerates the two liquids into a collapsing vapor layer causing a high velocity impact which finely fragments and intermixes the two liquids

  8. Reference: ABREATRD22 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ABREATRD22 Iwasaki T, Yamaguchi-Shinozaki K,Shinozaki K Identification of a cis-regulatory regio ... is mediated by abscisic acid and requires protein synthesis . Mol Gen Genet 247:391-398 (1995) PubMed: 7770045; ...

  9. 28 CFR 22.22 - Revelation of identifiable data.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Revelation of identifiable data. 22.22 Section 22.22 Judicial Administration DEPARTMENT OF JUSTICE CONFIDENTIALITY OF IDENTIFIABLE RESEARCH AND... subject, be expected to totally conceal subject identity....

  10. 22 CFR 40.22 - Multiple criminal convictions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Multiple criminal convictions. 40.22 Section 40.22 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Criminal and Related Grounds-Conviction of Certain Crimes § 40.22 Multiple...

  11. Nuclear Data Sheets for A = 22

    Energy Technology Data Exchange (ETDEWEB)

    Basunia, M. Shamsuzzoha

    2015-07-15

    Evaluated spectroscopic data and level schemes from radioactive decay and nuclear reaction studies are presented for {sup 22}C, {sup 22}N, {sup 22}O, {sup 22}F, {sup 22}Ne, {sup 22}Na, {sup 22}Mg, {sup 22}Al, and {sup 22}Si. This evaluation for A = 22 supersedes the earlier one by R. B. Firestone (2005Fi16)

  12. Carbon Carbon Composites: An Overview .

    OpenAIRE

    G. Rohini Devi; K. Rama Rao

    1993-01-01

    Carbon carbon composites are a new class of engineering materials that are ceramic in nature but exhibit brittle to pseudoplastic behaviour. Carbon-carbon is a unique all-carbon composite with carbon fibre embeded in carbon matrix and is known as an inverse composite. Due to their excellent thermo-structural properties, carbon-carbon composites are used in specialised application like re-entry nose-tips, leading edges, rocket nozzles, and aircraft brake discs apart from several indust...

  13. Marginalia no. 22

    OpenAIRE

    Library, Merrill-Cazier

    2007-01-01

    Issue Number 22: Spring 2007 A MESSAGE FROM THE Director- Linda Wolcott on our mission and strategic planning. SECURING OUR FUTURE- Information on USU’s new campaign, “Honoring Tradition, Securing the Future” INSPIRED BY THE MASTERS: PRESERVATION LIBRARIAN ALSO A FINE ARTIST-The talented Mr. Noel A. Carmack LATINO VOICES PROJECT-Patrick Williams describes the latest oral history project by Special Collections & Archives MERRILL-CAZIER LIBRARY STRATEGIC PLAN-The mission; the vis...

  14. VLT/UVES observations of extremely strong intervening damped Lyman-alpha systems: Molecular hydrogen and excited carbon, oxygen and silicon at log N(HI)=22.4

    CERN Document Server

    Noterdaeme, P; Rahmani, H; Petitjean, P; Pâris, I; Ledoux, C; Gupta, N; López, S

    2015-01-01

    We present a detailed analysis of three extremely strong intervening DLAs (log N(HI)>=21.7) observed towards quasars with VLT/UVES. We measure overall metallicities of [Zn/H]~-1.2, -1.3 and -0.7 at respectively zabs=2.34 towards SDSS J2140-0321 (log N(HI) = 22.4+/-0.1), zabs=3.35 towards SDSS J1456+1609 (log N(HI) = 21.7+/-0.1) and zabs=2.25 towards SDSS J0154+1935 (log N(HI) = 21.75+/-0.15). We detect H2 towards J2140-0321 (log N(H2) = 20.13+/-0.07) and J1456+1609 (log N(H2) = 17.10+/-0.09) and argue for a tentative detection towards J0154+1935. Absorption from the excited fine-structure levels of OI, CI and SiII are detected in the system towards J2140-0321, that has the largest HI column density detected so far in an intervening DLA. This is the first detection of OI fine-structure lines in a QSO-DLA, that also provides us a rare possibility to study the chemical abundances of less abundant atoms like Co and Ge. Simple single phase photo-ionisation models fail to reproduce all the observed quantities. Inst...

  15. DNA hybridization biosensor using chitosan-carbon nanotubes composite film as an immobilization platform and [Cu(bpy)(MBZ){sub 2}(H{sub 2}O)] (bpy = 2,2'-bipyridine, MBZ = p-methylbenzoate) as a novel redox indicator

    Energy Technology Data Exchange (ETDEWEB)

    Wang Qingxiang, E-mail: axiang236@126.co [Department of Chemistry and Environment Science, Zhangzhou Normal University, Zhangzhou 363000 (China) and Fujian Province University Key Laboratory of Analytical Science, Zhangzhou Normal University, Zhangzhou 363000 (China); Shi Juanlan; Ni Jiancong; Gao Fei; Gao Feng [Department of Chemistry and Environment Science, Zhangzhou Normal University, Zhangzhou 363000 (China); Weng Wen [Department of Chemistry and Environment Science, Zhangzhou Normal University, Zhangzhou 363000 (China); Fujian Province University Key Laboratory of Analytical Science, Zhangzhou Normal University, Zhangzhou 363000 (China); Jiao Kui, E-mail: kjiao@qust.edu.c [College of Chemistry and Molecular Engineering, Qingdao University and Science and Technology, Qingdao 266042 (China)

    2011-04-15

    Research highlights: Chitosan-carbon nanotubes composite was used as a platform for DNA immobilization. Discrimination of a synthetic copper complex to ds- and ss-DNA was obtained. Hybridization detection was performed using the copper complex as an indicator. Good specificity and high sensitivity were achieved on the constructed DNA biosensor. - Abstract: In this paper, a new DNA hybridization detection strategy was developed based on the immobilization of capture probe DNA on a chitosan (CS)-carbon nanotubes (CNTs) composite modified glassy carbon electrode (CS-CNTs/GCE) and the use of a copper complex, [Cu(bpy)(MBZ){sub 2}(H{sub 2}O)] (bpy = 2,2'-bipyridine, MBZ = p-methylbenzoate), as a new redox hybridization indicator. The electrochemical characterization experiments showed that the nanocomposite film of CS-CNTs could effectively immobilize the capture probe DNA and greatly improve the electron-transfer reactions of the electroactive molecules. Electrochemical and fluorescent spectroscopic analysis revealed that the polypyridyl copper complex of [Cu(bpy)(MBZ){sub 2}(H{sub 2}O)] bound to DNA via a typical intercalation mode. Surface studies further showed that the copper complex can discriminate between double-stranded and single-stranded DNA that immobilized on the surface of CS-CNTs/GCE. When being utilized as a redox indicator for the detection of hybridization for short DNA species related to phosphinothricin acetyltransferase (PAT), the indicator showed good specificity for recognizing the complementary, three-base mismatched and non-complementary DNA. Under the optimized conditions, the oxidation peak currents of the copper complex enhanced linearly with increases in the concentration of the complementary sequence in the range from 5.0 x 10{sup -10} to 1.0 x 10{sup -8} M. A detection limit of 5.0 x 10{sup -10} M was also obtained based on the constructed DNA biosensor.

  16. 22 CFR 42.22 - Returning resident aliens.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Returning resident aliens. 42.22 Section 42.22... Returning resident aliens. (a) Requirements for returning resident status. An alien shall be classifiable as... presented that: (1) The alien had the status of an alien lawfully admitted for permanent residence at...

  17. Carbon isotope anomalies in carbonates of the Karelian series

    Science.gov (United States)

    Iudovich, Ia. E.; Makarikhin, V. V.; Medvedev, P. V.; Sukhanov, N. V.

    1990-07-01

    Results are presented on carbon isotope distributions in carbonates of the Karelian complex. A highly anomalous isotopic composition was found in carbonate rocks aged from 2.6 to 1.9 b.y. In the stromatolitic carbonates of the Onega water table, delta-(C-13) reaches a value of +18 percent, while the shungite layer of the Zaonega horizon is characterized by a wide dispersion (from +7.9 to -11.8 percent). These data are in good agreement with the known geochemical boundary (about 2.2 b.y. ago) in the history of the earth.

  18. Dissolved inorganic carbon, total alkalinity, pH, fugacity of carbon dioxide, and other variables from surface observations using Niskin bottle, flow through pump and other instruments from the Ronald H. Brown in the Gulf of Mexico and East Coast of the United States during the second Gulf of Mexico and East Coast Carbon (GOMECC-2) Cruise from 2012-07-22 to 2012-08-13 (NODC Accession 0117971)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archival package contains ocean acidification related data from the the second Gulf of Mexico and East Coast Carbon (GOMECC-2) Cruise on board the R/V Ronald...

  19. Irradiation behavior of carbon-based composite materials

    International Nuclear Information System (INIS)

    Consideration is given to the data on radiation changes of sizes and some properties of different carbon-based composite materials (carbon-graphite and graphite-graphite compositions; carbon-carbon composite materials with carbon reinforcing fibers; carbon-silicon compositions), irradiated by neutrons at 320-1700 k. It is shown that change of sizes is dictated by the type and the ratio of components, forming (or not forming) the reinforcing uniform frame. 22 refs.; 10 figs

  20. Accelerated carbonation of brucite in mine tailings for carbon sequestration.

    Science.gov (United States)

    Harrison, Anna L; Power, Ian M; Dipple, Gregory M

    2013-01-01

    Atmospheric CO(2) is sequestered within ultramafic mine tailings via carbonation of Mg-bearing minerals. The rate of carbon sequestration at some mine sites appears to be limited by the rate of CO(2) supply. If carbonation of bulk tailings were accelerated, large mines may have the capacity to sequester millions of tonnes of CO(2) annually, offsetting mine emissions. The effect of supplying elevated partial pressures of CO(2) (pCO(2)) at 1 atm total pressure, on the carbonation rate of brucite [Mg(OH)(2)], a tailings mineral, was investigated experimentally with conditions emulating those at Mount Keith Nickel Mine (MKM), Western Australia. Brucite was carbonated to form nesquehonite [MgCO(3) · 3H(2)O] at a rate that increased linearly with pCO(2). Geochemical modeling indicated that HCO(3)(-) promoted dissolution accelerated brucite carbonation. Isotopic and aqueous chemistry data indicated that equilibrium between CO(2) in the gas and aqueous phases was not attained during carbonation, yet nesquehonite precipitation occurred at equilibrium. This implies CO(2) uptake into solution remains rate-limiting for brucite carbonation at elevated pCO(2), providing potential for further acceleration. Accelerated brucite carbonation at MKM offers the potential to offset annual mine emissions by ~22-57%. Recognition of mechanisms for brucite carbonation will guide ongoing work to accelerate Mg-silicate carbonation in tailings. PMID:22770473

  1. UO22+ sorption on bentonite

    International Nuclear Information System (INIS)

    The capacity of bentonite and purified bentonite to remove UO22+ ions from aqueous solutions has been investigated. The UO22+ uptake in these clays was determined for 0.2 and 0.002M uranyl nitrate solutions. It was found that under these conditions (0.2M) the maximum UO22+ uptake was 1.010±0.070 meq UO22+/g of bentonite and 0.787±0.020 meq UO22+/g of purified bentonite. In purified bentonite UO22+ sorption is irreversible up to 50 hours as no desorption was observed. Such is not the case in the natural bentonite. X-ray diffraction, thermal analyses, and transmission electron microscopy were used to characterize the solids. The uranium content was determined by neutron activation analysis. (author)

  2. 22 CFR 22.1 - Schedule of fees.

    Science.gov (United States)

    2010-04-01

    ... site (22 CFR 51.56(b)) (not applicable abroad) 60 4. Exemptions: The following applicants are exempted... for A, G, C-3, NATO and diplomatic visas as defined in 22 CFR 41.26 No fee. (b) Applicants for J visas... by an order of Federal court on behalf of an indigent party No fee. (Items nos. 54 through 60...

  3. 22 CFR 201.22 - Procurement under public sector procedures.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Procurement under public sector procedures. 201... APPLICABLE TO COMMODITY TRANSACTIONS FINANCED BY USAID Procurement Procedures; Responsibilities of Importers § 201.22 Procurement under public sector procedures. (a) General requirements. When the importer is...

  4. 22 CFR 41.22 - Officials of foreign governments.

    Science.gov (United States)

    2010-04-01

    ... official business for that government. (2) Official acting as courier. An alien not regularly and... proceeding to the United States as a courier on official business for that government. (3) Nonofficial... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Officials of foreign governments. 41.22...

  5. Heat transfer coeffcient for boiling carbon dioxide

    DEFF Research Database (Denmark)

    Knudsen, Hans Jørgen Høgaard; Jensen, Per Henrik

    1997-01-01

    Heat transfer coefficient and pressure drop for boiling carbon dioxide (R744) flowing in a horizontal pipe has been measured. The pipe is heated by condensing R22 outside the pipe. The heat input is supplied by an electrical heater wich evaporates the R22. With the heat flux assumed constant over...

  6. World cheating on the carbon market

    International Nuclear Information System (INIS)

    According to several non-governmental organizations, some industrial producers take advantage of a flaw in one of the carbon market mechanisms set up by the Kyoto protocol. These industrialists, mainly from China and India, are involved in the production of HCFC22 refrigerants, and make a substantial profit by artificially generating more greenhouse gases (HFC23) than necessary, then destroying them in order to collect carbon credits which they sell on the carbon market. Explanations about the cheat, details about companies and banks involved in the system, review of past trickeries in carbon quotas, and ways to improve the carbon market are presented

  7. 40 CFR 52.2089 - Control strategy: carbon monoxide.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Control strategy: carbon monoxide. 52... strategy: carbon monoxide. (a) Approval—On September 22, 2008, the Rhode Island Department of Environmental... Island has committed to year round carbon monoxide monitoring at the East Providence...

  8. Manufacturing of Nanocomposite Carbon Fibers and Composite Cylinders

    Science.gov (United States)

    Tan, Seng; Zhou, Jian-guo

    2013-01-01

    Pitch-based nanocomposite carbon fibers were prepared with various percentages of carbon nanofibers (CNFs), and the fibers were used for manufacturing composite structures. Experimental results show that these nanocomposite carbon fibers exhibit improved structural and electrical conductivity properties as compared to unreinforced carbon fibers. Composite panels fabricated from these nanocomposite carbon fibers and an epoxy system also show the same properties transformed from the fibers. Single-fiber testing per ASTM C1557 standard indicates that the nanocomposite carbon fiber has a tensile modulus of 110% higher, and a tensile strength 17.7% times higher, than the conventional carbon fiber manufactured from pitch. Also, the electrical resistance of the carbon fiber carbonized at 900 C was reduced from 4.8 to 2.2 ohm/cm. The manufacturing of the nanocomposite carbon fiber was based on an extrusion, non-solvent process. The precursor fibers were then carbonized and graphitized. The resultant fibers are continuous.

  9. Does soil fauna increase carbon mineralization or carbon sequestration in soil

    Czech Academy of Sciences Publication Activity Database

    Frouz, Jan

    České Budějovice : Institute of Soil Biology BC AS CR, 2009. s. 22. [Central European Workshop on Soil Zoology /10./. 21.04.2009-24.04.2009, České Budějovice] Institutional research plan: CEZ:AV0Z60660521 Keywords : soil fauna * carbon mineralization * carbon sequestration Subject RIV: EH - Ecology, Behaviour

  10. World cheating on the carbon market; Tricherie mondiale sur le marche carbone

    Energy Technology Data Exchange (ETDEWEB)

    James, O.

    2010-09-15

    According to several non-governmental organizations, some industrial producers take advantage of a flaw in one of the carbon market mechanisms set up by the Kyoto protocol. These industrialists, mainly from China and India, are involved in the production of HCFC22 refrigerants, and make a substantial profit by artificially generating more greenhouse gases (HFC23) than necessary, then destroying them in order to collect carbon credits which they sell on the carbon market. Explanations about the cheat, details about companies and banks involved in the system, review of past trickeries in carbon quotas, and ways to improve the carbon market are presented

  11. 22 CFR 62.22 - Trainees and interns.

    Science.gov (United States)

    2010-04-01

    ... eligibility requirements set forth in Subpart A of 22 CFR Part 62 and satisfying the Department that they have...; (vii) Hospitality and Tourism; (viii) Information Media and Communications; (iv) Management, Business... that all “Hospitality and Tourism” training and internship programs of six months or longer contain...

  12. Carbon thin film thermometry

    Science.gov (United States)

    Collier, R. S.; Sparks, L. L.; Strobridge, T. R.

    1973-01-01

    The work concerning carbon thin film thermometry is reported. Optimum film deposition parameters were sought on an empirical basis for maximum stability of the films. One hundred films were fabricated for use at the Marshall Space Flight Center; 10 of these films were given a precise quasi-continuous calibration of temperature vs. resistance with 22 intervals between 5 and 80 K using primary platinum and germanium thermometers. Sensitivity curves were established and the remaining 90 films were given a three point calibration and fitted to the established sensitivity curves. Hydrogen gas-liquid discrimination set points are given for each film.

  13. Sediment-dweling organism mimicking laminoid fenestral fabrics in shallow water carbonates

    Czech Academy of Sciences Publication Activity Database

    Nose, M.; Schlagintweit, F.; Hladil, Jindřich

    Geneve : Université de Geneve , 2014. s. 525-525. [International Sedimentological Congress /19./. 18.08.2014-22.08.2014, Geneve ] Institutional support: RVO:67985831 Keywords : sedimentology * carbonates * shallow water carbonates Subject RIV: DB - Geology ; Mineralogy

  14. High capacity carbon dioxide sorbent

    Energy Technology Data Exchange (ETDEWEB)

    Dietz, Steven Dean; Alptekin, Gokhan; Jayaraman, Ambalavanan

    2015-09-01

    The present invention provides a sorbent for the removal of carbon dioxide from gas streams, comprising: a CO.sub.2 capacity of at least 9 weight percent when measured at 22.degree. C. and 1 atmosphere; an H.sub.2O capacity of at most 15 weight percent when measured at 25.degree. C. and 1 atmosphere; and an isosteric heat of adsorption of from 5 to 8.5 kilocalories per mole of CO.sub.2. The invention also provides a carbon sorbent in a powder, a granular or a pellet form for the removal of carbon dioxide from gas streams, comprising: a carbon content of at least 90 weight percent; a nitrogen content of at least 1 weight percent; an oxygen content of at most 3 weight percent; a BET surface area from 50 to 2600 m.sup.2/g; and a DFT micropore volume from 0.04 to 0.8 cc/g.

  15. Zirconium sulfate interaction with sodium carbonate in solution

    International Nuclear Information System (INIS)

    Zirconium sulfate interaction with sodium carbonate is studied in aqueous solution. By pH-metry and infrared spectroscopy it is stated that depending on the carbonate concentration Zr(OH)2x(CO3)22-, ZrOH(CO3)33- and Zr(CO3)44- compounds can be formed in sulfatocarbonate solutions. pH range in which soluble carbonate complexes exist also depends on the concentration of sodium carbonate. Calculated is the fourth stability constant

  16. 78 FR 72863 - Circular Welded Carbon-Quality Steel Pipe From the People's Republic of China: Continuation of...

    Science.gov (United States)

    2013-12-04

    ...). \\3\\ See Circular Welded Carbon-Quality Steel Pipe From China, 78 FR 70069 (November 22, 2013). Scope... Carbon Quality Steel Pipe From the People's Republic of China, 73 FR 42547 (July 22, 2008). Continuation... International Trade Administration Circular Welded Carbon-Quality Steel Pipe From the People's Republic of...

  17. Porous carbons

    Indian Academy of Sciences (India)

    Satish M Manocha

    2003-02-01

    Carbon in dense as well as porous solid form is used in a variety of applications. Activated porous carbons are made through pyrolysis and activation of carbonaceous natural as well as synthetic precursors. Pyrolysed woods replicate the structure of original wood but as such possess very low surface areas and poor adsorption capacities. On activation, these exhibit increased adsorption volumes of 0.5–0.8 cm3 /gm and surface areas of 700–1800 m2 /gm depending on activation conditions, whether physical or chemical. Former carbons possess mixed pore size distribution while chemically activated carbons predominantly possess micropores. Thus, these carbons can be used for adsorption of wide distributions of molecules from gas to liquid. The molecular adsorption within the pores is due to single layer or multilayer molecule deposition at the pore walls and hence results in different types of adsorption isotherm. On the other hand, activated carbon fibres with controlled microporous structure and surface area in the range of 2500 m2 /gm can be developed by controlled pyrolysis and physical activation of amorphous carbon fibres. Active carbon fibres with unmatchable pore structure and surface characteristics are present and futuristic porous materials for a number of applications from pollution control to energy storage.

  18. Carbon Footprint of Beef Cattle

    OpenAIRE

    Jim Dyer; Darrel Cerkowniak; Dominique Maxime; Xavier P.C. Vergé; Devon E. Worth; Raymond L. Desjardins

    2012-01-01

    The carbon footprint of beef cattle is presented for Canada, The United States, The European Union, Australia and Brazil. The values ranged between 8 and 22 kg CO 2 e per kg of live weight (LW) depending on the type of farming system, the location, the year, the type of management practices, the allocation, as well as the boundaries of the study. Substantial reductions have been observed for most of these countries in the last thirty years. For instance, in Canada the mean carbon footprint of...

  19. 32 CFR 2700.22 - Classification guides.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Classification guides. 2700.22 Section 2700.22... SECURITY INFORMATION REGULATIONS Derivative Classification § 2700.22 Classification guides. OMSN shall issue classification guides pursuant to section 2-2 of E.O. 12065. These guides, which shall be used...

  20. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the HAKON MOSBY in the Barents Sea and Norwegian Sea from 2001-08-22 to 2001-08-29 (NODC Accession 0113887)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113887 includes chemical, discrete sample, physical and profile data collected from HAKON MOSBY in the Barents Sea and Norwegian Sea from 2001-08-22...

  1. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using Alkalinity titrator, CTD and other instruments from the AURORA AUSTRALIS in the Indian Ocean from 2008-03-22 to 2008-04-17 (NODC Accession 0109900)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0109900 includes biological, chemical, discrete sample, physical and profile data collected from AURORA AUSTRALIS in the Indian Ocean from 2008-03-22...

  2. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using Alkalinity titrator, CTD and other instruments from ROGER REVELLE in the Bay of Bengal and Indian Ocean from 2007-03-22 to 2007-05-01 (NODC Accession 0110791)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0110791 includes discrete sample and profile data collected from ROGER REVELLE in the Bay of Bengal and Indian Ocean from 2007-03-22 to 2007-05-01....

  3. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the Hokusei Maru in the North Pacific Ocean from 1998-06-22 to 1998-07-06 (NODC Accession 0112238)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112238 includes chemical, discrete sample, physical and profile data collected from Hokusei Maru in the North Pacific Ocean from 1998-06-22 to...

  4. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the SHUMPU MARU in the Philippine Sea from 1998-04-22 to 1998-04-30 (NODC Accession 0112302)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112302 includes biological, chemical, discrete sample, physical and profile data collected from SHUMPU MARU in the Philippine Sea from 1998-04-22 to...

  5. Developmental expression of otoconin-22 in the bullfrog endolymphatic sac and inner ear.

    Science.gov (United States)

    Yaoi, Yuichi; Onda, Tomoaki; Hidaka, Yoshie; Yajima, Shinya; Suzuki, Masakazu; Tanaka, Shigeyasu

    2004-05-01

    In amphibians, calcium carbonate crystals are present in the endolymphatic sac and the inner ear. The formation of these crystals is considered to be facilitated by a protein called otoconin-22. We examined the spatial and temporal expression of otoconin-22 during the development of the bullfrog (Rana catesbeiana) using RT-PCR, in situ hybridization (ISH), and immunofluorescence techniques. By RT-PCR, otoconin-22 mRNA was first detected in embryos at Shumway stage 20, and this expression pattern continues in late stages. The first otoconin-22 mRNA-positive reaction was detected in stage 22 embryos in the placode of the endolymphatic sac. Otoconin-22 protein was observed in the epithelial cells of the endolymphatic sac at stage 24. On the other hand, a whole-mount ISH technique showed the first expression of otoconin-22 mRNA in the inner ear, in addition to the endolymphatic sac, at the mid-phase of Shumway stage 25. We discuss the role of otoconin-22 in the formation of calcium carbonate crystals in the endolymphatic sac and inner ear. PMID:15100243

  6. Carbon tetrachloride under extreme conditions

    Energy Technology Data Exchange (ETDEWEB)

    Pravica, Michael, E-mail: pravica@physics.unlv.edu; Sneed, Daniel; Wang, Yonggang; Smith, Quinlan [High Pressure Science and Engineering Center (HiPSEC) and Department of Physics, University of Nevada Las Vegas (UNLV), Las Vegas, Nevada 89154-4002 (United States); Subrahmanyam, Garimella [Canadian Light Source, Department of Physics, University of Saskatchewan, Saskatoon, Saskatchewan S7N 2V3 (Canada)

    2014-05-21

    We report on three experiments on carbon tetrachloride subjected to extreme conditions. In the first experiment, Raman spectra of CCl{sub 4} were acquired up to 28 GPa. Evidence was observed for at least two new phases of CCl{sub 4} above 14 GPa (phase VI) and above 22 GPa (phase VII). Decompression of the sample showed no evidence of pressure-induced decomposition. In the second experiment, a synchrotron x-ray diffraction study was performed up to 30 GPa verifying phase V and potential phases above 14 (VI) and 22 GPa (VII), respectively. In the third study, we examined irradiated CCl{sub 4} using synchrotron infrared spectroscopy to reduce fluorescent contamination. Some sort of carbon allotrope appears as a byproduct suggesting the following reaction with hard x-rays: CCl{sub 4}+ hν → C + 2Cl{sub 2}.

  7. Performance assessment of carbonation process integrated with coal fired power plant to reduce CO2 (carbon dioxide) emissions

    International Nuclear Information System (INIS)

    This paper presents a novel approach to recover energy from mineral carbonation process, one of the CCS (carbon capture and storage) technologies, to reduce its additional energy demand and reports the feasibility of integrating a carbonation process with an existing power plant for reducing CO2 (carbon dioxide) emission. A thermodynamic mass and energy flow model of the carbonation process is developed using Matlab/Simulink software for a range of carbonation temperatures using two naturally available feedstocks, namely serpentine and olivine. The CO2 emissions are reduced if a carbonation system is implemented in the power plant, though the power generation efficiency and net power output are reduced too due to the large amount of extra energy required for the grinding of feedstock and the compression of CO2. The existing power plant efficiency was found to be 36.1%. If a carbonation system is incorporated, the plant efficiency reduces to 22% and 24% using serpentine and olivine feedstocks respectively. However, a significant amount of heat energy can be recovered from exothermic reaction of carbonation and carbonated products. The power plant efficiency can be increased to 35% and 34% again, respectively, when energy from carbonation reaction and carbonated products can be recovered appropriately. - Highlights: • Mineral carbonation technology is one of the carbon capture and storage technologies. • Exothermic heat energy can be recovered from mineral carbonation process. • Mineral carbonation process is energy self-sufficient. • Thermodynamic mass and energy balance model is developed for mineral carbonation

  8. Calcium Carbonate

    Science.gov (United States)

    ... before being swallowed; do not swallow them whole. Drink a full glass of water after taking either the regular or chewable tablets or capsules. Some liquid forms of calcium carbonate must be shaken well before use.Do not ...

  9. Carbon Stars

    Indian Academy of Sciences (India)

    T. Lloyd Evans

    2010-12-01

    In this paper, the present state of knowledge of the carbon stars is discussed. Particular attention is given to issues of classification, evolution, variability, populations in our own and other galaxies, and circumstellar material.

  10. TYPE Ia SUPERNOVA CARBON FOOTPRINTS

    International Nuclear Information System (INIS)

    We present convincing evidence of unburned carbon at photospheric velocities in new observations of five Type Ia supernovae (SNe Ia) obtained by the Nearby Supernova Factory. These SNe are identified by examining 346 spectra from 124 SNe obtained before +2.5 days relative to maximum. Detections are based on the presence of relatively strong C II λ6580 absorption 'notches' in multiple spectra of each SN, aided by automated fitting with the SYNAPPS code. Four of the five SNe in question are otherwise spectroscopically unremarkable, with ions and ejection velocities typical of SNe Ia, but spectra of the fifth exhibit high-velocity (v > 20, 000 km s–1) Si II and Ca II features. On the other hand, the light curve properties are preferentially grouped, strongly suggesting a connection between carbon-positivity and broadband light curve/color behavior: three of the five have relatively narrow light curves but also blue colors and a fourth may be a dust-reddened member of this family. Accounting for signal to noise and phase, we estimate that 22+10–6% of SNe Ia exhibit spectroscopic C II signatures as late as –5 days with respect to maximum. We place these new objects in the context of previously recognized carbon-positive SNe Ia and consider reasonable scenarios seeking to explain a physical connection between light curve properties and the presence of photospheric carbon. We also examine the detailed evolution of the detected carbon signatures and the surrounding wavelength regions to shed light on the distribution of carbon in the ejecta. Our ability to reconstruct the C II λ6580 feature in detail under the assumption of purely spherical symmetry casts doubt on a 'carbon blobs' hypothesis, but does not rule out all asymmetric models. A low volume filling factor for carbon, combined with line-of-sight effects, seems unlikely to explain the scarcity of detected carbon in SNe Ia by itself.

  11. Politisk danning etter 22. juli

    Directory of Open Access Journals (Sweden)

    Lars Løvlie

    2011-01-01

    Full Text Available Political education after july 22. This article makes the case fordeliberation as a major end-in-view for a political education in the general sense. The immediate backdrop is the neofascist ideology of Anders Behring Breivik and his ilk, an ideology that may partly explain the motive behind the devastation of government buildings in Oslo and the following mass shooting at Utøya on July 22. My intention here will, however, be limited to the question: what is basic to the idea of deliberation? My answer is twofold: deliberation is a reasonable method for arriving at a possible and temporary agreement on questions of truth and morality; and it is based on some – usually tacit – mutual presuppositions. These two aspects together make deliberation educative and part of an education for deliberative democracy. Without deliberation as a method we are unable to get at what John Dewey used to call “warranted assertibility”. Without deliberation as embedded in joint assumptions we would be unable to distinguish between method as wayward gibberish and as reasonable conversation. On pain of being presumptuous I invite the reader to this short educative stroll!

  12. Preparation and characterization of carbon nanotube-hybridized carbon fiber to reinforce epoxy composite

    International Nuclear Information System (INIS)

    Highlights: → CNTs were uniformly grown onto the carbon fibers. → No obvious mechanical properties of carbon fiber were observed after CNT growth. → The IFSS of multiscale epoxy composite was measured by single fiber pull-out tests. → Observing fractography of composite, the fracture modes of CNTs were discussed. -- Abstract: The multiscale carbon nanotube-hybridized carbon fiber was prepared by a newly developed aerosol-assisted chemical vapour deposition. Scanning electron microscopy and transmission electron microscope were carried out to characterize this multiscale material. Compared with the original carbon fibers, the fabrication of this hybrid fiber resulted in an almost threefold increase of BET surface area to reach 2.22 m2/g. Meanwhile, there was a slight degradation of fiber tensile strength within 10%, while the fiber modulus was not significantly affected. The interfacial shearing strength of a carbon fiber-reinforced polymer composite with carbon nanotube-hybridized carbon fiber and an epoxy matrix was determined from the single fiber pull-out tests of microdroplet composite. Due to an efficient increase of load transfer at the fiber/matrix interfaces, the interracial shear strength of composite reinforced by carbon nanotube-hybridized carbon fiber is almost 94% higher than that of one reinforced by the original carbon fiber. Based on the fractured morphologies of the composites, the interfacial reinforcing mechanisms were discussed through proposing different types of carbon nanotube fracture modes along with fiber pulling out from epoxy composites.

  13. 44 CFR 62.22 - Judicial review.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Judicial review. 62.22 Section 62.22 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF... ADJUSTMENT OF CLAIMS Claims Adjustment, Claims Appeals, and Judicial Review § 62.22 Judicial review. (a)...

  14. 31 CFR 3.22 - Legal review.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Legal review. 3.22 Section 3.22 Money and Finance: Treasury Office of the Secretary of the Treasury CLAIMS REGULATIONS AND INDEMNIFICATION OF DEPARTMENT OF TREASURY EMPLOYEES Claims Under the Small Claims Act § 3.22 Legal review....

  15. 12 CFR 1282.22 - Housing plans.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Housing plans. 1282.22 Section 1282.22 Banks and Banking FEDERAL HOUSING FINANCE AGENCY HOUSING GOALS AND MISSION ENTERPRISE HOUSING GOALS AND MISSION Housing Goals § 1282.22 Housing plans. (a) If the Director determines, under § 1282.21, that...

  16. 24 CFR 81.22 - Housing plans.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Housing plans. 81.22 Section 81.22 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development THE... LOAN MORTGAGE CORPORATION (FREDDIE MAC) Housing Goals § 81.22 Housing plans. (a) If the...

  17. 34 CFR 34.22 - Employer responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Employer responsibilities. 34.22 Section 34.22 Education Office of the Secretary, Department of Education ADMINISTRATIVE WAGE GARNISHMENT § 34.22 Employer responsibilities. (a)(1) Our garnishment order indicates a reasonable period of time within which an employer...

  18. 7 CFR 632.22 - Contracts.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Contracts. 632.22 Section 632.22 Agriculture... AGRICULTURE LONG TERM CONTRACTING RURAL ABANDONED MINE PROGRAM Participation § 632.22 Contracts. (a) Cost-sharing contracts. A land user who has an approved reclamation plan may enter into a contract with NRCS...

  19. 28 CFR 802.22 - Fees.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Fees. 802.22 Section 802.22 Judicial... Privacy Act § 802.22 Fees. The Agency shall charge fees under the Privacy Act for duplication of records only. These fees shall be at the same rate the Agency charges for duplication fees under the Freedom...

  20. 7 CFR 1221.22 - Production.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Production. 1221.22 Section 1221.22 Agriculture... INFORMATION ORDER Sorghum Promotion, Research, and Information Order Definitions § 1221.22 Production. Production, as used in § 1221.100, means: (a) for the purpose of establishing the initial Board in...

  1. 49 CFR 22.69 - Claim process.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Claim process. 22.69 Section 22.69 Transportation Office of the Secretary of Transportation SHORT-TERM LENDING PROGRAM (STLP) Loan Administration § 22.69 Claim process. After reasonable efforts have been exhausted to collect on a delinquent debt,...

  2. 49 CFR 1114.22 - Deposition.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 8 2010-10-01 2010-10-01 false Deposition. 1114.22 Section 1114.22 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION BOARD, DEPARTMENT OF TRANSPORTATION RULES OF PRACTICE EVIDENCE; DISCOVERY Discovery § 1114.22 Deposition. (a) Purpose. The...

  3. 32 CFR 806.22 - Time limits.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Time limits. 806.22 Section 806.22 National... INFORMATION ACT PROGRAM § 806.22 Time limits. Any FOIA appeals received after the 60-day time limit are not processed, unless the requester provides adequate justification for failing to comply with the time...

  4. 14 CFR 372.22 - Discrimination.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Discrimination. 372.22 Section 372.22... REGULATIONS OVERSEAS MILITARY PERSONNEL CHARTERS Conditions and Limitations § 372.22 Discrimination. No... any unjust discrimination or any undue or unreasonable prejudice or disadvantage in any...

  5. 30 CFR 735.22 - Audit.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Audit. 735.22 Section 735.22 Mineral Resources... ENFORCEMENT § 735.22 Audit. The agency shall arrange for an independent audit no less frequently than once..., Attachment P. The audits will be performed in accordance with the “Standards for Audit of...

  6. 13 CFR 307.22 - Variances.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Variances. 307.22 Section 307.22....22 Variances. EDA may approve variances to the requirements contained in this subpart, provided such variances: (a) Are consistent with the goals of the Economic Adjustment Assistance program and with an...

  7. 32 CFR 518.22 - Reports control.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Reports control. 518.22 Section 518.22 National... RELATIONS THE FREEDOM OF INFORMATION ACT PROGRAM Reports § 518.22 Reports control. (a) General. (1) The... requirement outlined is assigned Report Control Symbol DD-DA&M(A)1365, FOIA Report to Congress. (b)...

  8. 28 CFR 51.22 - Premature submissions.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Premature submissions. 51.22 Section 51.22 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) PROCEDURES FOR THE ADMINISTRATION OF... § 51.22 Premature submissions. The Attorney General will not consider on the merits: (a) Any...

  9. 49 CFR 22.19 - Credit criteria.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Credit criteria. 22.19 Section 22.19... STLP Loans § 22.19 Credit criteria. An applicant for a STLP loan must be creditworthy and demonstrate... debts. The Participating Lender and DOT OSDBU shall consider: (a) Character, reputation, and...

  10. 16 CFR 460.22 - Tax claims.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Tax claims. 460.22 Section 460.22 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.22 Tax claims. Do not say or imply that your product qualifies for a tax benefit unless it is true....

  11. 40 CFR 61.22 - Standard.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standard. 61.22 Section 61.22... EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS National Emission Standards for Radon Emissions From Underground Uranium Mines § 61.22 Standard. Emissions of radon-222 to the ambient air from an...

  12. 32 CFR 22.415 - Standards.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Standards. 22.415 Section 22.415 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DoD GRANT AND AGREEMENT REGULATIONS DoD... Procedures § 22.415 Standards. To be qualified, a potential recipient must: (a) Have the...

  13. 47 CFR 22.909 - Cellular markets.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Cellular markets. 22.909 Section 22.909... Cellular Radiotelephone Service § 22.909 Cellular markets. Cellular markets are standard geographic areas used by the FCC for administrative convenience in the licensing of cellular systems. Cellular...

  14. 50 CFR 654.22 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 654.22 Section 654.22 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE STONE CRAB FISHERY OF THE GULF OF MEXICO Management Measures § 654.22...

  15. 12 CFR 228.22 - Lending test.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Lending test. 228.22 Section 228.22 Banks and... REINVESTMENT (REGULATION BB) Standards for Assessing Performance § 228.22 Lending test. (a) Scope of test. (1) The lending test evaluates a bank's record of helping to meet the credit needs of its assessment...

  16. 28 CFR 104.22 - Advance Benefits.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Advance Benefits. 104.22 Section 104.22... Filing for Compensation; Application for Advance Benefits § 104.22 Advance Benefits. (a) Advance Benefits. Eligible Claimants may apply for immediate “Advance Benefits” in a fixed amount as follows: (1) $50,000...

  17. 47 CFR 22.357 - Emission types.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Emission types. 22.357 Section 22.357... Operational and Technical Requirements Technical Requirements § 22.357 Emission types. Any authorized station in the Public Mobile Services may transmit emissions of any type(s) that comply with the...

  18. 30 CFR 725.22 - Financial management.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Financial management. 725.22 Section 725.22... PROGRAM REGULATIONS REIMBURSEMENTS TO STATES § 725.22 Financial management. (a) The agency shall account for grant funds in accordance with the requirements of Office of Management and Budget Circular...

  19. Main: OPAQUE2ZM22Z [PLACE

    Lifescience Database Archive (English)

    Full Text Available OPAQUE2ZM22Z S000017 17-May-2001 (last modified) uchi Opaque-2 (O2) target sequence...ene: maize 22-kD zein; transacting factor: 02; O2; opaque; 22-kD zein; seed; ACGT; opaque-2; maize (Zea mays) TCCACGTAGA ...

  20. 4 CFR 2.2 - References.

    Science.gov (United States)

    2010-01-01

    ... 4 Accounts 1 2010-01-01 2010-01-01 false References. 2.2 Section 2.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM PURPOSE AND GENERAL PROVISION § 2.2 References. (a) Subchapters III and IV of Chapter 7 of Title 31 U.S.C. (b) Title 5, United States Code....

  1. 7 CFR 1218.22 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1218.22 Section 1218.22 Agriculture... INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.22 United States. United States means collectively the 50 states, the District of Columbia, the Commonwealth of Puerto...

  2. 40 CFR 230.22 - Water.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Water. 230.22 Section 230.22... Chemical Characteristics of the Aquatic Ecosystem § 230.22 Water. (a) Water is the part of the aquatic... the liquid phase and is contained by the substrate. Water forms part of a dynamic aquatic...

  3. 22 CFR 40.41 - Public charge.

    Science.gov (United States)

    2010-04-01

    ... Consular Services (22 CFR 22.1). (c) Joint Sponsors. Submission of one or more additional affidavits of... subscribed to before a notary public by the employer or an authorized employee or agent of the employer. The... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Public charge. 40.41 Section 40.41...

  4. 7 CFR 929.22 - Nomination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Nomination. 929.22 Section 929.22 Agriculture... LONG ISLAND IN THE STATE OF NEW YORK Order Regulating Handling Administrative Body § 929.22 Nomination. (a) Initial members. As soon as practicable after adoption of this amendment, the committee...

  5. 7 CFR 923.22 - Nomination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Nomination. 923.22 Section 923.22 Agriculture... COUNTIES IN WASHINGTON Order Regulating Handling Administrative Body § 923.22 Nomination. (a) Initial... committee, together with nominations for the initial alternate members for each position, may be...

  6. 7 CFR 920.22 - Nomination.

    Science.gov (United States)

    2010-01-01

    ... Administrative Body § 920.22 Nomination. (a) Except as provided in paragraph (b) of this section, the committee... recommended by the committee and approved by the Secretary. (c) Only growers may participate in the nomination... 7 Agriculture 8 2010-01-01 2010-01-01 false Nomination. 920.22 Section 920.22...

  7. 7 CFR 915.22 - Nomination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Nomination. 915.22 Section 915.22 Agriculture... Regulating Handling Administrative Body § 915.22 Nomination. (a) Initial members. Nominations for each of the five initial grower members and four initial handler members of the committee, together...

  8. 7 CFR 916.22 - Nomination.

    Science.gov (United States)

    2010-01-01

    .... After the nomination procedure or meetings have concluded, the nominating committee by February 15 will... 7 Agriculture 8 2010-01-01 2010-01-01 false Nomination. 916.22 Section 916.22 Agriculture... Regulating Handling Administrative Body § 916.22 Nomination. (a) Initial members. Nominations for each of...

  9. 7 CFR 925.22 - Nomination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Nomination. 925.22 Section 925.22 Agriculture... SOUTHEASTERN CALIFORNIA Administrative Body § 925.22 Nomination. (a) Initial members. Nominations for each of..., may be submitted to the Secretary by the Committee responsible for promulgation of this part....

  10. 28 CFR 551.22 - Pregnancy.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each...

  11. 10 CFR 75.22 - Accounting records.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Accounting records. 75.22 Section 75.22 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) SAFEGUARDS ON NUCLEAR MATERIAL-IMPLEMENTATION OF US/IAEA AGREEMENT Material Accounting and Control for Facilities § 75.22 Accounting records. (a) The accounting records required by §...

  12. 49 CFR 230.22 - Accident reports.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Accident reports. 230.22 Section 230.22... Requirements § 230.22 Accident reports. In the case of an accident due to failure, from any cause, of a steam... persons, the railroad on whose line the accident occurred shall immediately make a telephone report of...

  13. 50 CFR 401.22 - Civil rights.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Civil rights. 401.22 Section 401.22..., DEVELOPMENT AND ENHANCEMENT § 401.22 Civil rights. Each application for Federal assistance, grant-in-aid award... Assisted Programs of the Civil Rights Act of 1964 and with the Secretary's regulations...

  14. 29 CFR 22.34 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Evidence. 22.34 Section 22.34 Labor Office of the Secretary of Labor PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 22.34 Evidence. (a) The ALJ shall determine the admissibility of evidence. (b) Except as provided in this part, the ALJ shall not be bound by the Federal...

  15. 30 CFR 281.22 - Lease form.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Lease form. 281.22 Section 281.22 Mineral... OIL, GAS, AND SULPHUR IN THE OUTER CONTINENTAL SHELF Leasing Procedures § 281.22 Lease form. The OCS mineral leases shall be issued on the lease form prescribed by the Secretary in the leasing notice....

  16. 7 CFR 984.22 - Trade demand.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Trade demand. 984.22 Section 984.22 Agriculture... Regulating Handling Definitions § 984.22 Trade demand. (a) Inshell. The quantity of merchantable inshell walnuts that the trade will acquire from all handlers during a marketing year for distribution in...

  17. Stable carbon isotope biogeochemistry of lakes along a trophic gradient

    NARCIS (Netherlands)

    de Kluijver, A.; Schoon, P.L.; Downing, J.A.; Schouten, S.; Middelburg, J.J.

    2014-01-01

    The stable carbon (C) isotope variability of dissolved inorganic and organic C (DIC and DOC), particulate organic carbon (POC), glucose and polar-lipid derived fatty acids (PLFAs) was studied in a survey of 22 North American oligotrophic to eutrophic lakes. The d13C of different PLFAs were used as p

  18. Systematic AMD+GCM Study of Structure of Carbon Isotopes

    International Nuclear Information System (INIS)

    The structure of low-lying states of the carbon isotopes is investigated using the extended version of the Antisymmetrized Molecular Dynamics (AMD) Multi-Slater Determinant model. We can reproduce reasonably well many experimental data for carbon isotopes 12C-22C. A special approach is adopted for 15C to better describe the tail of the wave function

  19. 22nd International Meshing Roundtable

    CERN Document Server

    Staten, Matthew

    2014-01-01

    This volume contains the articles presented at the 22nd International Meshing Roundtable (IMR) organized, in part, by Sandia National Laboratories and was held on Oct 13-16, 2013 in Orlando, Florida, USA.  The first IMR was held in 1992, and the conference series has been held annually since.  Each year the IMR brings together researchers, developers, and application experts in a variety of disciplines, from all over the world, to present and discuss ideas on mesh generation and related topics.  The technical papers in this volume present theoretical and novel ideas and algorithms with practical potential, as well as technical applications in science and engineering, geometric modeling, computer graphics and visualization.

  20. Carbon particles

    Science.gov (United States)

    Hunt, Arlon J.

    1984-01-01

    A method and apparatus whereby small carbon particles are made by pyrolysis of a mixture of acetylene carried in argon. The mixture is injected through a nozzle into a heated tube. A small amount of air is added to the mixture. In order to prevent carbon build-up at the nozzle, the nozzle tip is externally cooled. The tube is also elongated sufficiently to assure efficient pyrolysis at the desired flow rates. A key feature of the method is that the acetylene and argon, for example, are premixed in a dilute ratio, and such mixture is injected while cool to minimize the agglomeration of the particles, which produces carbon particles with desired optical properties for use as a solar radiant heat absorber.

  1. Carbon classified?

    DEFF Research Database (Denmark)

    Lippert, Ingmar

    2012-01-01

    . Using an actor- network theory (ANT) framework, the aim is to investigate the actors who bring together the elements needed to classify their carbon emission sources and unpack the heterogeneous relations drawn on. Based on an ethnographic study of corporate agents of ecological modernisation over a...... corporations construing themselves as able and suitable to manage their emissions, and, additionally, given that the construction of carbon emissions has performative consequences, the underlying practices need to be declassified, i.e. opened for public scrutiny. Hence the paper concludes by arguing for a...

  2. JEF-2.2 radioactive decay data

    International Nuclear Information System (INIS)

    This work deals with the JEF-2.2 radioactive decay data and is divided into four tables. The first table presents the origin of the JEF-2.2 radioactive decay data and subsequent modifications. The second one is a summary of the JEF-2.2 radioactive decay data file. The third one describes the JEF-2.2 fission products and the main decay and fission yield data. The last one consists of the main decay parameters from the JEF-2.2, ENDF/B-VI and JNDC-2.0 libraries. (O.L.). 100 figs., 4 tabs

  3. Abiotic carbonate dissolution traps carbon in a semiarid desert

    Science.gov (United States)

    Fa, Keyu; Liu, Zhen; Zhang, Yuqing; Qin, Shugao; Wu, Bin; Liu, Jiabin

    2016-03-01

    It is generally considered that desert ecosystems release CO2 to the atmosphere, but recent studies in drylands have shown that the soil can absorb CO2 abiotically. However, the mechanisms and exact location of abiotic carbon absorption remain unclear. Here, we used soil sterilization, 13CO2 addition, and detection methods to trace 13C in the soil of the Mu Us Desert, northern China. After 13CO2 addition, a large amount of 13CO2 was absorbed by the sterilised soil, and 13C was found enriched both in the soil gaseous phase and dissolved inorganic carbon (DIC). Further analysis indicated that about 79.45% of the total 13C absorbed by the soil was trapped in DIC, while the amount of 13C in the soil gaseous phase accounted for only 0.22% of the total absorbed 13C. However, about 20.33% of the total absorbed 13C remained undetected. Our results suggest that carbonate dissolution might occur predominately, and the soil liquid phase might trap the majority of abiotically absorbed carbon. It is possible that the trapped carbon in the soil liquid phase leaches into the groundwater; however, further studies are required to support this hypothesis.

  4. Molecular cloning of otoconin-22 complementary deoxyribonucleic acid in the bullfrog endolymphatic sac: effect of calcitonin on otoconin-22 messenger ribonucleic acid levels.

    Science.gov (United States)

    Yaoi, Yuichi; Suzuki, Masakazu; Tomura, Hideaki; Sasayama, Yuichi; Kikuyama, Sakae; Tanaka, Shigeyasu

    2003-08-01

    Anuran amphibians have a special organ called the endolymphatic sac (ELS), containing many calcium carbonate crystals, which is believed to have a calcium storage function. The major protein of aragonitic otoconia, otoconin-22, which is considered to be involved in the formation of calcium carbonate crystals, has been purified from the saccule of the Xenopus inner ear. In this study, we cloned a cDNA encoding otoconin-22 from the cDNA library constructed for the paravertebral lime sac (PVLS) of the bullfrog, Rana catesbeiana, and sequenced it. The bullfrog otoconin-22 encoded a protein consisting of 147 amino acids, including a signal peptide of 20 amino acids. The protein had cysteine residues identical in a number and position to those conserved among the secretory phospholipase A(2) family. The mRNA of bullfrog otoconin-22 was expressed in the ELS, including the PVLS and inner ear. This study also revealed the presence of calcitonin receptor-like protein in the ELS, with the putative seven-transmembrane domains of the G protein-coupled receptors. The ultimobranchialectomy induced a prominent decrease in the otoconin-22 mRNA levels of the bullfrog PVLS. Supplementation of the ultimobranchialectomized bullfrogs with synthetic salmon calcitonin elicited a significant increase in the mRNA levels of the sac. These findings suggest that calcitonin secreted from the ultimobranchial gland, regulates expression of bullfrog otoconin-22 mRNA via calcitonin receptor-like protein on the ELS, thereby stimulating the formation of calcium carbonate crystals in the lumen of the ELS. PMID:12865304

  5. Carbon nanobuds based on carbon nanotube caps: A first-principles study

    OpenAIRE

    Choi, Ji Il; Kim, Hyo Seok; Kim, Han Seul; Lee, Ga In; Kang, Jeung Ku; Kim, Yong-Hoon

    2015-01-01

    Based on density functional theory calculations, we here show that the formation of a fullerene C$_{60}$ carbon "nanobud" (CNB) on carbon nanotube (CNT) caps is energetically more favorable than that on CNT sidewalls. The dominant CNB formation mode for CNT caps is found to be the [2+2] cycloaddition reaction as in the conventional CNT sidewall case. However, it is identified to be exothermic in contrast to the endothermic reaction on CNT sidewalls. Computed reaction pathways further demonstr...

  6. Health physics in JAERI, 22

    International Nuclear Information System (INIS)

    In the annual report No. 22 (fiscal 1979) are described the activities of health physics including radioactive waste management in Tokai Research Establishment, Takasaki Radiation Chemistry Research Establishment and Oarai Research Establishment. In all the three research establishments, radiation monitoring in nuclear facilities, individual monitoring, environmental monitoring and maintenance of measuring instruments were carried out as in previous years. There were no occupational exposures exceeding the maximum permissible doses and no release of radioactive gaseous and liquid wastes beyond the release limits specified according to regulations. In the environment there were observed no abnormal radioactivities due to facilities. In Tokai and Oarai Research Establishments radioactive waste management including decontamination works was also carried out and radioactive solid wastes were stored in the same way as in previous years. Construction of the Packaged Waste Storage Facility was completed, and of the Facility of Radiation Standards and the Medium-Level Waste Treatment Facility progressed on schedule in Tokai Research Establishment. In Oarai Research Establishment, construction was completed on the latter project of radioactive waste treatment facilities, starting in 1974. Technical development and research were made as in previous years for improving techniques and methods in monitoring of individuals, facilities and environment and also in waste management and decontamination. (author)

  7. Determination the Hydrogen Stored in Carbon Nanotubes by NO Titration Method

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A novel method was established to determine the H2-storage capacity in carbon nanotubes. According to 2NO+2H2 (or 4H) = N2+2H2O reaction, the H2-storage capacity in carbon nanotubes could be calculated. The H2-storage capacity in carbon nanotubes is at least 2.89 wt%.

  8. Supernumerary Chromosome Marker Der(22)t(11;22) Resulting from a Maternal Balanced Translocation

    OpenAIRE

    Jia-Woei Hou

    2003-01-01

    Derivative 22 [der(22)] syndrome is a rare disorder associated with multiple congenitalanomalies including pre-auricular skin tags or pits, conotruncal heart defects, and profoundmental retardation. Der(22)t(11;22) is one of the causes of supernumerary chromosomemarkers (mar) in humans. We present a boy with developmental delay and multiple anomaliesconsistent with the supernumerary der(22) syndrome. Cytogenetic analysis showed anabnormal chromosome complement of 47, XY, +mar in all 50 cells ...

  9. Volume-based thermodynamics: estimations for 2:2 salts.

    Science.gov (United States)

    Jenkins, H Donald Brooke; Glasser, Leslie

    2006-02-20

    The lattice energy of an ionic crystal, U(POT), can be expressed as a linear function of the inverse cube root of its formula unit volume (i.e., Vm(-1/3)); thus, U(POT) approximately 2I(alpha/Vm(1/3) + beta), where alpha and beta are fitted constants and I is the readily calculated ionic strength factor of the lattice. The standard entropy, S, is a linear function of Vm itself: S approximately kVm + c, with fitted constants k and c. The constants alpha and beta have previously been evaluated for salts with charge ratios of 1:1, 1:2, and 2:1 and for the general case q:p, while values of k and c applicable to ionic solids generally have earlier been reported. In this paper, we obtain alpha and beta, k and c, specifically for 2:2 salts (by studying the ionic oxides, sulfates, and carbonates), finding that U(POT)[MX 2:2]/(kJ mol(-1)) approximately 8(119/Vm(1/3) + 60) and S degree [MX 2:2]/(J K(-1) mol(-1)) approximately 1382V(m) + 16. PMID:16471990

  10. Fabrication of Implanted $^{22}$Na Targets

    CERN Multimedia

    2002-01-01

    A knowledge of the $^{22}$Na(p,$\\gamma$)$^{23}$ Mg reaction rate is of significant astrophysical interest. In order to complete previous studies of this reaction, radioactive $^{22}$Na targets of high purity are required. We ask for support to fabricate these targets via the implantation technique at ISOLDE GPS (off—line mode) using $^{22}$Na nuclides in an Al matrix produced in Nov. 1990 at the PSI (Zürich). The $^{22}$Na nuclides are released and ionized in a surface ionisation source, mass-analyzed at ISOLDE GPS, and implanted in a Ni-Ta backing and a C—foil in a special implantation setup.

  11. Biodegradation of Chlorpyrifos by Pseudomonas Resinovarans Strain AST2.2 Isolated from Enriched Cultures.

    Directory of Open Access Journals (Sweden)

    Anish Sharma*,

    2016-04-01

    Full Text Available A bacterial strain AST2.2 with chlorpyrifos degrading ability was isolated by enrichment technique from apple orchard soil with previous history of chlorpyrifos use. Based on the morphological, biochemical tests and 16S rRNA sequence analysis, AST2.2 strain was identified as Pseudomonas resinovarans. The strain AST2.2 utilized chlorpyrifos as the sole source of carbon and energy. This strain exhibited growth upto 400mg/l concentration of chlorpyrifos and exhibited high extracellular organophosphorus hydrolase (OPH activity. Gas chromatography-flame ionization detector (GC-FID studies revealed that Pseudomonas resinovarans AST2.2 degraded 43.90 % of chlorpyrifos (400 mg/l within 96 hrs. Intermediates of chlorpyrifos degradation were identified using GC-MS. This strain have potential to degrade chlorpyrifos and thus can be used for bioremediation and ecological restoration of sites contaminated with chlorpyrifos.

  12. Structure of a dinuclear cadmium complex with 2,2'-bi-pyridine, monodentate nitrate and 3-carb-oxy-6-methyl-pyridine-2-carboxyl-ate ligands: intra-molecular carbon-yl(lone pair)⋯π(ring) and nitrate(π)⋯π(ring) inter-actions.

    Science.gov (United States)

    Granifo, Juan; Suarez, Sebastián; Baggio, Ricardo

    2015-08-01

    The centrosymmetric dinuclear complex bis-(μ-3-carb-oxy-6-methyl-pyridine-2-carboxyl-ato)-κ(3) N,O (2):O (2);κ(3) O (2):N,O (2)-bis-[(2,2'-bi-pyridine-κ(2) N,N')(nitrato-κO)cadmium] methanol monosolvate, [Cd2(C8H6NO4)2(NO3)2(C10H8N2)2]·CH3OH, was isolated as colourless crystals from the reaction of Cd(NO3)2·4H2O, 6-methyl-pyridine-2,3-di-carb-oxy-lic acid (mepydcH2) and 2,2'-bi-pyridine in methanol. The asymmetric unit consists of a Cd(II) cation bound to a μ-κ(3) N,O (2):O (2)-mepydcH(-) anion, an N,N'-bidentate 2,2'-bi-pyridine group and an O-mono-dentate nitrate anion, and is completed with a methanol solvent mol-ecule at half-occupancy. The Cd complex unit is linked to its centrosymmetric image through a bridging mepydcH(-) carboxyl-ate O atom to complete the dinuclear complex mol-ecule. Despite a significant variation in the coordination angles, indicating a considerable departure from octa-hedral coordination geometry about the Cd(II) atom, the Cd-O and Cd-N distances in this complex are surprisingly similar. The crystal structure consists of O-H⋯O hydrogen-bonded chains parallel to a, further bound by C-H⋯O contacts along b to form planar two-dimensional arrays parallel to (001). The juxtaposed planes form inter-stitial columnar voids that are filled by the methanol solvent mol-ecules. These in turn inter-act with the complex mol-ecules to further stabilize the structure. A search in the literature showed that complexes with the mepydcH(-) ligand are rare and complexes reported previously with this ligand do not adopt the μ-κ(3) coordination mode found in the title compound. PMID:26396748

  13. Structure of a dinuclear cadmium complex with 2,2′-bi­pyridine, monodentate nitrate and 3-carb­oxy-6-methyl­pyridine-2-carboxyl­ate ligands: intra­molecular carbon­yl(lone pair)⋯π(ring) and nitrate(π)⋯π(ring) inter­actions

    Science.gov (United States)

    Granifo, Juan; Suarez, Sebastián; Baggio, Ricardo

    2015-01-01

    The centrosymmetric dinuclear complex bis­(μ-3-carb­oxy-6-methyl­pyridine-2-carboxyl­ato)-κ3 N,O 2:O 2;κ3 O 2:N,O 2-bis­[(2,2′-bi­pyridine-κ2 N,N′)(nitrato-κO)cadmium] methanol monosolvate, [Cd2(C8H6NO4)2(NO3)2(C10H8N2)2]·CH3OH, was isolated as colourless crystals from the reaction of Cd(NO3)2·4H2O, 6-methyl­pyridine-2,3-di­carb­oxy­lic acid (mepydcH2) and 2,2′-bi­pyridine in methanol. The asymmetric unit consists of a CdII cation bound to a μ-κ3 N,O 2:O 2-mepydcH− anion, an N,N′-bidentate 2,2′-bi­pyridine group and an O-mono­dentate nitrate anion, and is completed with a methanol solvent mol­ecule at half-occupancy. The Cd complex unit is linked to its centrosymmetric image through a bridging mepydcH− carboxyl­ate O atom to complete the dinuclear complex mol­ecule. Despite a significant variation in the coordination angles, indicating a considerable departure from octa­hedral coordination geometry about the CdII atom, the Cd—O and Cd—N distances in this complex are surprisingly similar. The crystal structure consists of O—H⋯O hydrogen-bonded chains parallel to a, further bound by C—H⋯O contacts along b to form planar two-dimensional arrays parallel to (001). The juxtaposed planes form inter­stitial columnar voids that are filled by the methanol solvent mol­ecules. These in turn inter­act with the complex mol­ecules to further stabilize the structure. A search in the literature showed that complexes with the mepydcH− ligand are rare and complexes reported previously with this ligand do not adopt the μ-κ3 coordination mode found in the title compound. PMID:26396748

  14. Preparation of composite electroheat carbon film

    Institute of Scientific and Technical Information of China (English)

    XIA Jin-tong; TU Chuan-jun; LI Yan; HU Li-min; DENG Jiu-hua

    2005-01-01

    A kind of conductive and heating unit, which can reach a high surface electroheat temperature at a low voltage, was developed in view of the traditional electroheat coating which has a low surface electroheat temperature and an insufficient heat resistance of its binder. The coating molded electroheat carbon film(CMECF) was prepared by carbonizing the coating which was prepared by adding modified resin into flake graphite and carbon fiber, coating molded onto the surface of the heat resisting matrix after dried, while the hot pressing molded electroheat thick carbon film(HPMETCF) was prepared by carbonizing the bodies whose powders were hot pressing molded directly.The surface and inner microstructure of the carbon film was characterized and analyzed by SEM and DSC/TG, while electroheat property was tested by voltage-current volume resistivity tester and electrical parameter tester. The results show that, close-packed carbon network configuration is formed within the composite electroheat carbon film film after anti-oxidizable treatment reaches a higher surface electroheat temperature than that of the existing electroheat coatings at a low voltage, and has excellent electroheat property, high thermal efficiency as well as stable physicochemical property. It is found that, at room temperature(19± 2 ℃) and 22 V for 5 min, the surface electroheat temperature of the self-produced CMECF (mfiller/mresin = 1. 8/1) reaches 112 ℃ while HPMETCF (mfiller/mresin = 3. 6/1) reaches 265 ℃.

  15. 36 CFR 1275.22 - Security.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Security. 1275.22 Section... THE NIXON ADMINISTRATION Preservation and Protection § 1275.22 Security. The Archivist is responsible for providing adequate security for the Presidential historical materials....

  16. 22 CFR 504.14 - Fees.

    Science.gov (United States)

    2010-04-01

    ... charged by the BBG in its Freedom of Information Act regulations at 22 CFR Part 503. (c) Witness fees... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 504.14 Section 504.14 Foreign Relations... OFFICIAL INFORMATION IN LEGAL PROCEEDINGS Schedule of Fees § 504.14 Fees. (a) Generally. The...

  17. 7 CFR 1730.22 - Borrower analysis.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Borrower analysis. 1730.22 Section 1730.22... Borrower analysis. (a) Each borrower shall periodically analyze and document its security, operations and... any, the borrower's written analysis would also include a review of the operator's performance...

  18. 34 CFR 101.22 - Amici curiae.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Amici curiae. 101.22 Section 101.22 Education Regulations of the Offices of the Department of Education OFFICE FOR CIVIL RIGHTS, DEPARTMENT OF EDUCATION... completed their initial examination of a witness, any amicus curiae may request the presiding officer...

  19. 28 CFR 22.20 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Applicability. 22.20 Section 22.20 Judicial Administration DEPARTMENT OF JUSTICE CONFIDENTIALITY OF IDENTIFIABLE RESEARCH AND STATISTICAL... public. (c) The regulations do not apply to information gained regarding future criminal conduct....

  20. 28 CFR 22.23 - Privacy certification.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Privacy certification. 22.23 Section 22.23 Judicial Administration DEPARTMENT OF JUSTICE CONFIDENTIALITY OF IDENTIFIABLE RESEARCH AND... been agreed upon for future maintenance of such data. (7) Project plans will be designed to...

  1. 28 CFR 22.27 - Notification.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Notification. 22.27 Section 22.27 Judicial Administration DEPARTMENT OF JUSTICE CONFIDENTIALITY OF IDENTIFIABLE RESEARCH AND STATISTICAL... of subject, be expected to totally conceal subject identity, an individual shall be so advised....

  2. 40 CFR 194.22 - Quality assurance.

    Science.gov (United States)

    2010-07-01

    ... COMPLIANCE WITH THE 40 CFR PART 191 DISPOSAL REGULATIONS Compliance Certification and Re-certification General Requirements § 194.22 Quality assurance. (a)(1) As soon as practicable after April 9, 1996, the... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Quality assurance. 194.22 Section...

  3. 22 CFR 23.3 - Refunds.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Refunds. 23.3 Section 23.3 Foreign Relations DEPARTMENT OF STATE FEES AND FUNDS FINANCE AND ACCOUNTING § 23.3 Refunds. (a) Rectifications and readjustments. See § 22.6 of this chapter for outline of circumstances under which fees which have...

  4. 7 CFR 1219.22 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... in the United States, including paid advertising, sales promotion, and publicity. Promotion... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1219.22 Section 1219.22 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION,...

  5. 33 CFR 2.22 - Territorial sea.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Territorial sea. 2.22 Section 2... Jurisdictional Terms § 2.22 Territorial sea. (a) With respect to the United States, the following apply— (1) Territorial sea means the waters, 12 nautical miles wide, adjacent to the coast of the United States...

  6. 48 CFR 22.202 - Contract clause.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contract clause. 22.202 Section 22.202 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC... employment of convict labor; (b) The supplies or services are to be purchased from Federal Prison...

  7. 7 CFR 1230.22 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1230.22 Section 1230.22 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PORK PROMOTION, RESEARCH,...

  8. Reference: OPAQUE2ZM22Z [PLACE

    Lifescience Database Archive (English)

    Full Text Available OPAQUE2ZM22Z Ueda T, Waverczak W, Ward K, Sher N, Ketudat M, Schmidt RJ, Messing J ...Mutations of the 22- and 27-kD zein promoters affect transactivation by the opaque-2 protein Plant Cell 4:701-709 (1992) PubMed: 1392591; ...

  9. 40 CFR 71.22 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Definitions. 71.22 Section 71.22 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) FEDERAL... drafted pursuant to section 112(i)(5)(B) of the Act and signed by a responsible company official...

  10. What's New in Apache Web Server 22?

    CERN Document Server

    Bowen, Rich

    2007-01-01

    What's New in Apache Web Server 2.2? shows you all the new features you'll know to set up and administer the Apache 2.2 web server. Learn how to take advantage of its improved caching, proxying, authentication, and other improvements in your Web 2.0 applications.

  11. 48 CFR 22.101-1 - General.

    Science.gov (United States)

    2010-10-01

    ... notify the Government of actual or potential labor disputes that are delaying or threaten to delay the... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false General. 22.101-1 Section 22.101-1 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC...

  12. 7 CFR 2902.22 - Fertilizers.

    Science.gov (United States)

    2010-01-01

    ... Procurement Guideline, 40 CFR 247.15. EPA provides recovered materials content recommendations for fertilizers... constituents they contain, as required under 40 CFR 266.20(d). (b) Minimum biobased content. The preferred... 7 Agriculture 15 2010-01-01 2010-01-01 false Fertilizers. 2902.22 Section 2902.22...

  13. 22 CFR 9.6 - Derivative classification.

    Science.gov (United States)

    2010-04-01

    ... CFR 2001.22. (c) Department of State Classification Guide. The Department of State Classification... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Derivative classification. 9.6 Section 9.6... classification. (a) Definition. Derivative classification is the incorporating, paraphrasing, restating...

  14. 32 CFR 2001.22 - Derivative classification.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Derivative classification. 2001.22 Section 2001... Identification and Markings § 2001.22 Derivative classification. (a) General. Information classified derivatively on the basis of source documents or classification guides shall bear all markings prescribed...

  15. 22 CFR 9a.4 - Classification.

    Science.gov (United States)

    2010-04-01

    ... State shall follow the standards in E.O. 11652 and the provisions of 22 CFR 9.5 through 9.8. ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Classification. 9a.4 Section 9a.4 Foreign... ENERGY PROGRAMS; RELATED MATERIAL § 9a.4 Classification. (a) Section 1 of E.O. 11932, August 4,...

  16. 5 CFR 1312.22 - Responsibilities.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Responsibilities. 1312.22 Section 1312.22 Administrative Personnel OFFICE OF MANAGEMENT AND BUDGET OMB DIRECTIVES CLASSIFICATION, DOWNGRADING... possession of OMB offices. Each employee has a responsibility to protect and account for all...

  17. 48 CFR 22.1702 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Definitions. 22.1702 Section 22.1702 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC... not applied toward the liquidation of the debt or the length and nature of those services are...

  18. 40 CFR 31.22 - Allowable costs.

    Science.gov (United States)

    2010-07-01

    ... not subject to that circular 48 CFR part 31, Contract Cost Principles and Procedures, or uniform cost... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Allowable costs. 31.22 Section 31.22 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE...

  19. 22 CFR 127.10 - Civil penalty.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Civil penalty. 127.10 Section 127.10 Foreign... Civil penalty. (a) The Assistant Secretary of State for Political-Military Affairs is authorized to impose a civil penalty in an amount not to exceed that authorized by 22 U.S.C. 2778, 2779a and 2780...

  20. 9 CFR 145.22 - Participation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Participation. 145.22 Section 145.22 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR BREEDING POULTRY Special Provisions...

  1. Carbon Footprints

    OpenAIRE

    Rahel Aichele; Gabriel Felbermayr

    2011-01-01

    Lässt sich der Beitrag eines Landes zum weltweiten Klimaschutz an der Veränderung seines CO2-Ausstoßes messen, wie es im Kyoto-Abkommen implizit unterstellt wird? Oder ist aufgrund der Bedeutung des internationalen Güterhandels der Carbon Footprint – der alle CO2-Emissionen erfasst, die durch die Absorption (d.h. Konsum und Investitionen) eines Landes entstehen – das bessere Maß? Die Autoren erstellen eine Datenbank mit den Footprints von 40 Ländern für den Zeitraum 1995–2007. Die deskriptive...

  2. Passive Corrosion Behavior of Alloy 22

    International Nuclear Information System (INIS)

    Alloy 22 (NO6022) was designed to stand the most aggressive industrial applications, including both reducing and oxidizing acids. Even in the most aggressive environments, if the temperature is lower than 150 F (66 C) Alloy 22 would remain in the passive state having particularly low corrosion rates. In multi-ionic solutions that may simulate the behavior of concentrated ground water, even at near boiling temperatures, the corrosion rate of Alloy 22 is only a few nano-meters per year because the alloy is in the complete passive state. The corrosion rate of passive Alloy 22 decreases as the time increases. Immersion corrosion testing also show that the newer generation of Ni-Cr-Mo alloys may offer a better corrosion resistance than Alloy 22 only in some highly aggressive conditions such as in hot acids

  3. Research on the Method of Recoverying Microtopography of Epeiric Carbonate Platform in Depositional Stage:A case study from the layer A of Jia 22 Member in Moxi Gas Field , Sichuan Basin%陆表海碳酸盐岩台地沉积期微地貌恢复方法研究——以四川盆地磨溪气田嘉二2亚段A层为例

    Institute of Scientific and Technical Information of China (English)

    谭秀成; 聂勇; 刘宏; 周彦; 李凌; 赵路子; 张本健; 冯钰

    2011-01-01

    ;③intargranular solution extremely develops;④the freshwater cements in early stage and cement unconformity exist;⑤lens-diagenesis reservoir of atmospheric genesis positively associates with the grainstone gross-thickness. Based on this, the paper then takes the view that microtopography prominence can be inverted by the reservoir study of the grain shoal. Followed by that principle,it also suggestes that the concrete study procedure can be like this:the isochronous geologic body to be chosen as the main body of grainstone deposition, the confirmation of reservoir genesis and exposured time, the topography recovering during depositional stage and the application of achievement verification.Sichuan Basin was characterized by developing epeiric carbonate platform during the period of Jialingjiang in early Triassic. The basin was also hit by an fierce transgression in the period of early Jia 22, which made the salinity of the seawater normal on the whole. Moxi gas field locates in the south of genfie-oblique tectonic zone of the palaeohigh in the central of the basin, where the tectonic body is about 280 km2, and the exploration wells penetrating the Jia 2 member sum up to 42( data by 2005 ) ,of which the total cored wells of Jia 2 member sum up to 16 ,besides, the distribution is relatively uniform. Hence, the gas field was used in the case study, where the result indicates that highland mainly develop in the well areas of eastern side of Mo 24-Mo 205, southern side of Mo 206, the rim of Mo 207, Mo 151-Mo 36, Mo 208 and its southern part, Mo 48 ,Northern part of Mo 202(7 in all),which distribute in the direction of southwest-northeast, swales mainly develop in Mo 12-Mo 201, Mo 005-2-Mo 150, southern part of Mo 22 and eastern part of Mo 206. There is thick deposition of underwater-gypsum ( dark-gray and massive gypsum, no exposed marks found) developing in the well areas of Mo 005-2-Mo 150, Mo 207 ,which has come into being by the shoal development around the micro-highland , resulting in

  4. Carbon-14 measurement using carbon dioxide absorption method - Our experience

    International Nuclear Information System (INIS)

    Carbon-C14 measurement using absorption technique consists of direct absorption of sample carbon dioxide into an absorber - scintillator mixture. This technique is a simple, fast, less expensive and less hazardous technique compared to benzene synthesis or any other technique. This techniques enable us in preparing six/seven samples in a day while benzene synthesis technique takes two days for the preparation of one sample. It is useful for radiocarbon age up to about 38,000 a BP (∼1 pMC), which is adequate for most of the hydrological investigations. All the total dissolved inorganic carbon (TDIC) is precipitated as barium carbonate from the ∼60 to 70 liters of water at the site. In the laboratory, it is reacted with orthophosphoric acid to give carbon dioxide (CO2). This carbon dioxide is transferred into 0.5 L capacity cylinder. The reaction and collection of gas is done under vacuum using a glass vacuum line. Carbon dioxide is directly absorbed in 11.5 ml of carbasorb + 11 ml of Permaflour V (commercially not available) or its equivalent scintillator in the specially made absorption apparatus. Since, absorption process is exothermic, temperature of the medium is maintained at about 220 deg. C, it results in the absorption of ∼7 m moles of carbon dioxide per mL of cabasorb. As reaction progresses, bubbles can be seen rising slowly. The end point is marked by rapid rise in the solution level. Carbon dioxide obtained from oxalic acid (Standard) and background carbon dioxide are also absorbed in the same quantity of absorber and scintillator mixture. Samples, standard and background are transferred in 22 mL teflon vials and counted in low level liquid scintillation counter (LKB Wallac 1220 Quantulus) for 1000 minutes. The counting efficiency at best factor of merit (AON/ON/√B) is ∼60 % where AON is normalized net count rate of standard and B is the background count rate. The mean count rate of last fifteen background samples is 0.64 ± .0005 cpm with an

  5. Synthesis of 2-(2-Aminopyrimidine)-2,2-difluoroethanols as Potential Bioisosters of Salicylidene Acylhydrazides

    OpenAIRE

    Dahlgren, Markus K.; Öberg, Christopher T; Wallin, Erika A.; Pär G. Janson; Mikael Elofsson

    2010-01-01

    Salicylidene acylhydrazides are inhibitors of type III secretion in several Gram-negative pathogens. To further develop the salicylidene acylhydrazides, scaffold hopping was applied to replace the core fragment of the compounds. The novel 2-(2-amino-pyrimidine)-2,2-difluoroethanol scaffold was identified as a possible analog to the salicylidene acylhydrazide core structure. The synthesis of a library of 2-(2-amino-pyrimidine)-2,2-difluoro-ethanols is described in this paper.

  6. Synthesis of 2-(2-Aminopyrimidine-2,2-difluoroethanols as Potential Bioisosters of Salicylidene Acylhydrazides

    Directory of Open Access Journals (Sweden)

    Markus K. Dahlgren

    2010-06-01

    Full Text Available Salicylidene acylhydrazides are inhibitors of type III secretion in several Gram-negative pathogens. To further develop the salicylidene acylhydrazides, scaffold hopping was applied to replace the core fragment of the compounds. The novel 2-(2-amino-pyrimidine-2,2-difluoroethanol scaffold was identified as a possible analog to the salicylidene acylhydrazide core structure. The synthesis of a library of 2-(2-amino-pyrimidine-2,2-difluoro-ethanols is described in this paper.

  7. Synthesis of 2-(2-aminopyrimidine)-2,2-difluoroethanols as potential bioisosters of salicylidene acylhydrazides.

    Science.gov (United States)

    Dahlgren, Markus K; Oberg, Christopher T; Wallin, Erika A; Janson, Pär G; Elofsson, Mikael

    2010-06-01

    Salicylidene acylhydrazides are inhibitors of type III secretion in several gram-negative pathogens. To further develop the salicylidene acylhydrazides, scaffold hopping was applied to replace the core fragment of the compounds. The novel 2-(2-amino-pyrimidine)-2,2-difluoroethanol scaffold was identified as a possible analog to the salicylidene acylhydrazide core structure. The synthesis of a library of 2-(2-amino-pyrimidine)-2,2-difluoro-ethanols is described in this paper. PMID:20657451

  8. Carbon Nanomembranes.

    Science.gov (United States)

    Turchanin, Andrey; Gölzhäuser, Armin

    2016-08-01

    Carbon nanomembranes (CNMs) are synthetic 2D carbon sheets with tailored physical or chemical properties. These depend on the structure, molecular composition, and surroundings on either side. Due to their molecular thickness, they can be regarded as "interfaces without bulk" separating regions of different gaseous, liquid, or solid components and controlling the materials exchange between them. Here, a universal scheme for the fabrication of 1 nm-thick, mechanically stable, functional CNMs is presented. CNMs can be further modified, for example perforated by ion bombardment or chemically functionalized by the binding of other molecules onto the surfaces. The underlying physical and chemical mechanisms are described, and examples are presented for the engineering of complex surface architectures, e.g., nanopatterns of proteins, fluorescent dyes, or polymer brushes. A simple transfer procedure allows CNMs to be placed on various support structures, which makes them available for diverse applications: supports for electron and X-ray microscopy, nanolithography, nanosieves, Janus nanomembranes, polymer carpets, complex layered structures, functionalization of graphene, novel nanoelectronic and nanomechanical devices. To close, the potential of CNMs in filtration and sensorics is discussed. Based on tests for the separation of gas molecules, it is argued that ballistic membranes may play a prominent role in future efforts of materials separation. PMID:27281234

  9. Trading forest carbon

    Science.gov (United States)

    The nature of carbon in forests is discussed from the perspective of carbon trading. Carbon inventories, specifically in the area of land use and forestry are reviewed for the Pacific Northwest. Carbon turnover in forests is discussed as it relates to carbon sequestration. Scient...

  10. Condensed Matter Theories - Volume 22

    Science.gov (United States)

    Reinholz, Heidi; Röpke, Gerd; de Llano, Manuel

    2007-09-01

    pt. A. Fermi liquids. Pressure comparison between the spherical cellular model and the Thomas-Fermi model / G.A. Baker, Jr. Pair excitations and vertex corrections in Fermi fluids and the dynamic structure function of two-dimension 3He / H.M. Böhm, H. Godfrin, E. Krotscheck, H.J. Lauter, M. Meschke and M. Panholzer. Condensation of helium in wedges / E.S. Hernádez ... [et al.]. Non-Fermi liquid behavior from the Fermi-liquid approach / V.A. Khodel ... [et al.]. Theory of third sound and stability of thin 3He-4He superfluid films / E. Krotscheck and M.D. Miller. Pairing in asymmetrical Fermi systems / K.F. Quader and R. Liao. Ground-state properties of small 3He drops from quantum Monte Carlo simulations / E. Sola, J. Casulleras and J. Boronat. Ground-state energy and compressibility of a disordered two-dimensional electron gas / Tanatar ... [et al.]. Quasiexcitons in photoluminescence of incompressible quantum liquids / A. Wójs, A.G ladysiewicz and J.J. Quinn -- pt. B. Bose liquids. Quantum Boltzmann liquids / K.A. Gernoth, M L. Ristig and T. Lindenau. Condensate fraction in the dynamic structure function of Bose fluids / M. Saarela, F. Mazzanti and V. Apaja -- pt. C. Strongly-correlated electronic systems. Electron gas in high-field nanoscopic transport: metallic carbon nanotubes / F. Green and D. Neilson. Evolution and destruction of the Kondo effect in a capacitively coupled double dot system / D.E. Logan and M.R. Galpin. The method of increments-a wavefunction-based Ab-Initio correlation method for solids / B. Paulus. Fractionally charged excitations on frustrated lattices / E. Runge, F. Pollmann and P. Fulde. 5f Electrons in actinides: dual nature and photoemission spectra / G. Zwicknagl -- pt. D. Magnetism. Magnetism in disordered two-dimensional Kondo-Necklace / W. Brenig. On the de Haas-can Alphen oscillation in 2D / S. Fujita and D.L. Morabito. Dynamics in one-dimensional spin systems-density matrix reformalization group study / S. Nishimoto and M

  11. Carbon Farming as a Carbon Negative Technology

    Science.gov (United States)

    Anderson, C.; Laird, D.; Hayes, D. J.

    2015-12-01

    Carbon farms have a pivotal role in national and international efforts to mitigate and adapt to climate change. A carbon farm in its broadest sense is one that reduces greenhouse gas (GHG) emissions or captures and holds carbon in vegetation and soils. Their capacity to remove carbon from the air and store it safely and permanently, while providing additional human and ecosystem benefits, means they could contribute significantly to national efforts to stabilize or reduce GHGs. We examine carbon farms in the context of corn and soybean production agriculture. We illustrate, using Iowa data but with relevance across United States corn and soybean production, the potential for carbon farms to reduce human GHG emissions and sequester carbon permanently at a rate that has meaningful impact on global greenhouse gas concentration. Carbon has been viewed as a next generation cash crop in Iowa for over a decade. The carbon farm perspective, however, goes beyond carbon as cash crop to make carbon the center of an entire farm enterprise. The transformation is possible through slight adjustment crop practices mixed with advances in technology to sequester carbon through biochar. We examine carbon balance of Iowa agriculture given only the combination of slight reduction in fertilizer and sequestration by biochar. We find the following. Iowa carbon farms could turn Iowa agriculture into a carbon sink. The estimated range of GHG reduction by statewide implementation of carbon farms is 19.46 to 90.27 MMt CO2-equivalent (CO2-e), while the current agricultural CO2-e emission estimate is 35.38 MMt CO2-e. Iowa carbon farm GHG reduction would exceed Iowa GHG reduction by wind energy (8.7 MMt CO2-e) and could exceed combined reductions from wind energy and corn grain ethanol (10.7 MMt CO2-e; 19.4 MMt CO2-e combined). In fact, Iowa carbon farms alone could exceed GHG reduction from national corn grain ethanol production (39.6 MMt CO2-e). A carbon price accessible to agricultural

  12. Magnetoresistance of Multiwalled Carbon Nanotube Yarns

    Institute of Scientific and Technical Information of China (English)

    SHENG Lei-Mei; GAO Wei; CAO Shi-Xun; ZHANG Jin-Cang

    2008-01-01

    We measure zero-field resistivity and magnetoresistance of multiwalled carbon nanotube yarns (CNTYs). The CNTYs are drawn from superaligned multiwalled carbon nanotube arrays synthesized by the low-pressure chemical vapour deposition method. The zero-field resistivity shows a logarithmic decrease from 2 K to 300 K. In the presence of a magnetic field applied perpendicular to the yarn axis, a pronounced negative magnetoresistance is observed. A magnetoresistance ratio of 22% is obtained. These behaviours can be explained by the weak localization effect.

  13. Carbon Monoxide Poisoning

    Science.gov (United States)

    ... Recommend on Facebook Tweet Share Compartir What is Carbon Monoxide? Carbon monoxide, or “CO,” is an odorless, colorless gas that can kill you. Carbon monoxide detector Where is CO found? CO is ...

  14. Net Ecosystem Carbon Flux

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Net Ecosystem Carbon Flux is defined as the year-over-year change in Total Ecosystem Carbon Stock, or the net rate of carbon exchange between an ecosystem and the...

  15. Carbon Monoxide (CO)

    Science.gov (United States)

    ... IAQ) » Carbon Monoxide's Impact on Indoor Air Quality Carbon Monoxide's Impact on Indoor Air Quality On this ... length of exposure. Top of Page Sources of Carbon Monoxide Sources of CO include: unvented kerosene and ...

  16. Global deforestation: contribution to atmospheric carbon dioxide.

    Science.gov (United States)

    Woodwell, G M; Hobbie, J E; Houghton, R A; Melillo, J M; Moore, B; Peterson, B J; Shaver, G R

    1983-12-01

    A study of effects of terrestrial biota on the amount of carbon dioxide in the atmosphere suggests that the global net release of carbon due to forest clearing between 1860 and 1980 was between 135 x 10(15) and 228 x 10(15) grams. Between 1.8 x 10(15) and 4.7 x 10(15) grams of carbon were released in 1980, of which nearly 80 percent was due to deforestation, principally in the tropics. The annual release of carbon from the biota and soils exceeded the release from fossil fuels until about 1960. Because the biotic release has been and remains much larger than is commonly assumed, the airborne fraction, usually considered to be about 50 percent of the release from fossil fuels, was probably between 22 and 43 percent of the total carbon released in 1980. The increase in carbon dioxide in the atmosphere is thought by some to be increasing the storage of carbon in the earth's remaining forests sufficiently to offset the release from deforestation. The interpretation of the evidence presented here suggests no such effect; deforestation appears to be the dominant biotic effect on atmospheric carbon dioxide. If deforestation increases in proportion to population, the biotic release of carbon will reach 9 x 10(15) grams per year before forests are exhausted early in the next century. The possibilities for limiting the accumulation of carbon dioxide in the atmosphere through reduction in use of fossil fuels and through management of forests may be greater than is commonly assumed. PMID:17747369

  17. Power Systems Development Facility Gasification Test Campaign TC22

    Energy Technology Data Exchange (ETDEWEB)

    Southern Company Services

    2008-11-01

    In support of technology development to utilize coal for efficient, affordable, and environmentally clean power generation, the Power Systems Development Facility (PSDF), located in Wilsonville, Alabama, routinely demonstrates gasification technologies using various types of coals. The PSDF is an engineering scale demonstration of key features of advanced coal-fired power systems, including a KBR Transport Gasifier, a hot gas particulate control device, advanced syngas cleanup systems, and high-pressure solids handling systems. This report summarizes the results of TC22, the first test campaign using a high moisture lignite from Mississippi as the feedstock in the modified Transport Gasifier configuration. TC22 was conducted from March 24 to April 17, 2007. The gasification process was operated for 543 hours, increasing the total gasification operation at the PSDF to over 10,000 hours. The PSDF gasification process was operated in air-blown mode with a total of about 1,080 tons of coal. Coal feeder operation was challenging due to the high as-received moisture content of the lignite, but adjustments to the feeder operating parameters reduced the frequency of coal feeder trips. Gasifier operation was stable, and carbon conversions as high as 98.9 percent were demonstrated. Operation of the PCD and other support equipment such as the recycle gas compressor and ash removal systems operated reliably.

  18. 22 CFR 99.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... the Convention on Protection of Children and Co-operation in Respect of Intercountry Adoption done at The Hague on May 29, 1993. (b) Such other terms as are defined in 22 CFR 96.2 shall have the...

  19. Strasti po 22 sentjabrja / Eldar Efendijev

    Index Scriptorium Estoniae

    Efendijev, Eldar, 1954-

    2005-01-01

    Isamaaliidu algatatud pühade ja tähtpäevade seaduse muutmise eelnõust 1944. a. 22. septembril tegutsenud Otto Tiefi valitsuse mälestuse jäädvustamiseks. Keskerakonna seisukohta tutvustab Ain Seppik

  20. Hurricane Rita Poster (September 22, 2005)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Rita poster. Multi-spectral image from NOAA-16 shows Hurricane Rita as a category-4 hurricane in the Gulf of Mexico on September 22, 2005. Poster size is...

  1. African Studies Abstracts Online: number 22, 2008

    OpenAIRE

    African Studies Centre

    2008-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 22 (2008). African Studies Centre, Leiden.

  2. 7 CFR 3431.22 - Waiver.

    Science.gov (United States)

    2010-01-01

    ... SERVICE, DEPARTMENT OF AGRICULTURE VETERINARY MEDICINE LOAN REPAYMENT PROGRAM Administration of the Veterinary Medicine Loan Repayment Program § 3431.22 Waiver. (a) A program participant may seek a waiver...

  3. Capital Region Awards 22 Natural Resource certificates

    OpenAIRE

    Davis, Lynn

    2004-01-01

    Virginia Tech's College of Natural Resources in the Capital Region awarded 22 students a Certificate of Graduate Study in Natural Resources in a special ceremony recently at the Tower Club in Vienna, Va.

  4. 22 CFR 223.11 - Appropriate action.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Appropriate action. 223.11 Section 223.11...-EMPLOYMENT RESTRICTIONS § 223.11 Appropriate action. The Administrator may take appropriate action in the... action....

  5. 48 CFR 22.1500 - Scope.

    Science.gov (United States)

    2010-10-01

    ... APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Prohibition of Acquisition of Products Produced by Forced or Indentured Child Labor 22.1500 Scope. This subpart applies to acquisitions of supplies that...

  6. ISS Expedition 21/22 Press Kit

    Data.gov (United States)

    National Aeronautics and Space Administration — Press kit for ISS mission Expedition 21/22 from 10/2009-03/2010. Press kits contain information about each mission overview, crew, mission timeline, benefits, and...

  7. Integral Ring Carbon-Carbon Piston

    Science.gov (United States)

    Northam, G. Burton (Inventor)

    1999-01-01

    An improved structure for a reciprocating internal combustion engine or compressor piston fabricate from carbon-carbon composite materials is disclosed. An integral ring carbon-carbon composite piston, disclosed herein, reduces the need for piston rings and for small clearances by providing a small flexible, integral component around the piston that allows for variation in clearance due to manufacturing tolerances, distortion due to pressure and thermal loads, and variations in thermal expansion differences between the piston and cylinder liner.

  8. Carbon dioxide sequestration by mineral carbonation

    OpenAIRE

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept behind mineral CO2 sequestration is the mimicking of natural weathering processes in which calcium or magnesium containing minerals react with gaseous CO2 and form solid calcium or magnesium carbonate...

  9. Ectrodactyly and 7q22.1

    Energy Technology Data Exchange (ETDEWEB)

    Rivera, H. [Salisbury District Hospital, Odstock (United Kingdom)

    1994-10-15

    This succinct `Letter to the Editor` was written in response to a report on a family exhibiting both a t(2;7)(q21.2;q22.1) and split hand/foot anomaly by Genuardi et al. [1993]. Pertinent sections of the article are discussed, with disagreement taken with a lack of mention to work conducted in 1991 by Rivera et al. in assigning the crucial locus to band 7q22 near to the proximal interface. 3 refs.

  10. The bare uranyl(2+) ion, UO22+

    International Nuclear Information System (INIS)

    Ion-molecule reactions between U2+ and oxygen donors or charge-stripping collisions between singly charged UO22 ions and O2 collision partners generate uranyl(2+) ions in the gas phase. These do not readily dissociate into singly charged fragments. The standard enthalpy of formation for UO22+ is estimated to be 371±60 kcal mol-1, in accord with the results of ab initio calculations. (orig.)

  11. 22 CFR 1101.11 - Fees.

    Science.gov (United States)

    2010-04-01

    ... statute (for example, 22 CFR part 1102—Freedom of Information Act.) (d) Remittances shall be in the form... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 1101.11 Section 1101.11 Foreign Relations... § 1101.11 Fees. (a) Under the Act, fees can only be charged for the cost of copying records. No fees...

  12. Deletion 22q13.3 syndrome

    OpenAIRE

    Phelan Mary C

    2008-01-01

    Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndr...

  13. Carbon dioxide sequestration by mineral carbonation

    NARCIS (Netherlands)

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept beh

  14. Supernumerary Chromosome Marker Der(22t(11;22 Resulting from a Maternal Balanced Translocation

    Directory of Open Access Journals (Sweden)

    Jia-Woei Hou

    2003-01-01

    Full Text Available Derivative 22 [der(22] syndrome is a rare disorder associated with multiple congenitalanomalies including pre-auricular skin tags or pits, conotruncal heart defects, and profoundmental retardation. Der(22t(11;22 is one of the causes of supernumerary chromosomemarkers (mar in humans. We present a boy with developmental delay and multiple anomaliesconsistent with the supernumerary der(22 syndrome. Cytogenetic analysis showed anabnormal chromosome complement of 47, XY, +mar in all 50 cells analyzed. The karyotypeof his mother showed a reciprocal translocation over the distal bands 11q23 and 22q11,respectively, i.e., 46,XX,t(11;22(q23.3;q11.2, and that of his father was 46,XY. Thus, thenature of the supernumerary chromosome markers was of der(22t(11;22(q23.3;q11.2. Theclinical features, including craniofacial dysmorphism, hypotonia, psychomotor retardation,heart defects, and urogenital anomalies, were the combined effects of partial trisomies forboth distal 11q and pericentromeric 22q.

  15. Reaction rates for the s-process neutron source 22Ne+{\\alpha}

    CERN Document Server

    Longland, Richard; Karakas, Amanda I

    2012-01-01

    The 22Ne({\\alpha},n)25Mg reaction is an important source of neutrons for the s-process. In massive stars responsible for the weak component of the s-process, 22Ne({\\alpha},n)25Mg is the dominant source of neutrons, both during core helium burning and in shell carbon burning. For the main s-process component produced in Asymptotic Giant Branch (AGB) stars, the 13C({\\alpha},n)16O reaction is the dominant source of neutrons operating during the interpulse period, with the 22Ne+{\\alpha} source affecting mainly the s-process branchings during a thermal pulse. Rate uncertainties in the competing 22Ne({\\alpha},n)25Mg and 22Ne({\\alpha},{\\gamma})26Mg reactions result in large variations of s-process nucleosynthesis. Here, we present up-to-date and statistically rigorous 22Ne+{\\alpha} reaction rates using recent experimental results and Monte Carlo sampling. Our new rates are used in post-processing nucleosynthesis calculations both for massive stars and AGB stars. We demonstrate that the nucleosynthesis uncertainties ...

  16. Asymmetry in inclusive π±, p production at 22 GeV, BNL E925

    International Nuclear Information System (INIS)

    Preliminary results from Experiment E925 on inclusive pion asymmetries from a 22 GeV/c polarized proton beam on a carbon target show significant asymmetries for π± production similar to those observed earlier at the ZGS and Fermilab with beams of 12 and 200 GeV respectively. This experiment demonstrates the viability of using the analyzing power in inclusive pion production for high energy beam polarimetry at RHIC. Inclusive proton asymmetries are consistent with zero

  17. Composite carbon foam electrode

    Science.gov (United States)

    Mayer, S.T.; Pekala, R.W.; Kaschmitter, J.L.

    1997-05-06

    Carbon aerogels used as a binder for granulated materials, including other forms of carbon and metal additives, are cast onto carbon or metal fiber substrates to form composite carbon thin film sheets. The thin film sheets are utilized in electrochemical energy storage applications, such as electrochemical double layer capacitors (aerocapacitors), lithium based battery insertion electrodes, fuel cell electrodes, and electrocapacitive deionization electrodes. The composite carbon foam may be formed by prior known processes, but with the solid particles being added during the liquid phase of the process, i.e. prior to gelation. The other forms of carbon may include carbon microspheres, carbon powder, carbon aerogel powder or particles, graphite carbons. Metal and/or carbon fibers may be added for increased conductivity. The choice of materials and fibers will depend on the electrolyte used and the relative trade off of system resistivity and power to system energy. 1 fig.

  18. Carborane-based inhibitors of carbonic anhydrases

    Czech Academy of Sciences Publication Activity Database

    Brynda, Jiří; Pachl, Petr; Šícha, Václav; Fábry, Milan; Grüner, Bohumír; Cígler, Petr; Řezáčová, Pavlína

    2015-01-01

    Roč. 22, č. 1 (2015), s. 3. ISSN 1211-5894. [Discussions in Structural Molecular Biology . Annual Meeting of the Czech Society for Structural Biology /13./. 19.03.2015-21.03.2015, Nové Hrady] R&D Projects: GA ČR GA15-05677S Institutional support: RVO:61388963 ; RVO:68378050 ; RVO:61388980 Keywords : carboranes * carbonic anhydrase Subject RIV: CE - Biochemistry

  19. Protective Effects of Dimethyl—4,4‘—Dinmethoxy—5,6,5’,6‘—Dimethylene Dioxybiphenyl—2,2’—Dicarboxylate on Damages of Isolated Rat Hepatocytes Induced by Carbon Tetrachloride and D—galactosam

    Institute of Scientific and Technical Information of China (English)

    FUTIEBO; LIUGENGTAO

    1992-01-01

    The rotective effect of biphenyl dimethyl dicarboxylate(DDB)on chemically induced damages was studied in isolated suspended rat hepatocytes.The experimental results showed that DDB(200μg/106cells) efficiently protected the hepatocytes against carbon tetrachloride(CCl4 10mmol·L-1)and D-galactosamine(1mmol·L1)induce damages.Membranal lipid peroxidation(malondialdehyde,MDA formation(and glutamic pyruvic transaminase(GPT) release from the hepatocytes were markedly decreased.The damage of the cell surfaces of the hepatocytes were also reduced as seen under a scanning electrom microscope(SEM). Pretreatment with DDB(300mg·kg-1)orally ameliorated the reduction of liver glycogen and blood glucose caused by ip injection of D-galactosamine(800mg·kg-1)in mice.When normal rats were given DDB 300mg·kg-1 once daily for 10d,the free ribosomal protein and RNA in the liver increased significantly.These results indicate that DDB is of beneficial effects on both damaged and normal hepatocytes.

  20. Carbon isotopes in tree rings of Norway spruce (Bohemian Forest, Central Europe) exposed to atmospheric pollution

    Czech Academy of Sciences Publication Activity Database

    Šantrůčková, H.; Šantrůček, Jiří; Svoboda, M.

    Brno : ISBE CAS, 2006. s. 22. [15 Years of EU Supported Ecophysiological Research in the Czech Republic. 18.09.2006-21.09.2006, Olomouc] Keywords : Carbon isotopes * Norway spruce Subject RIV: ED - Physiology

  1. Solution structure of human sorting nexin 22.

    Science.gov (United States)

    Song, Jikui; Zhao, Kate Qin; Newman, Carrie L Loushin; Vinarov, Dmitriy A; Markley, John L

    2007-05-01

    The sorting nexins (SNXs) constitute a large group of PX domain-containing proteins that play critical roles in protein trafficking. We report here the solution structure of human sorting nexin 22 (SNX22). Although SNX22 has <30% sequence identity with any PX domain protein of known structure, it was found to contain the alpha/beta fold and compact structural core characteristic of PX domains. Analysis of the backbone dynamics of SNX22 by NMR relaxation measurements revealed that the two walls of the ligand binding cleft undergo internal motions: on the picosecond timescale for the beta1/beta2 loop and on the micro- to millisecond timescale for the loop between the polyproline motif and helix alpha2. Regions of the SNX22 structure that differ from those of other PX domains include the loop connecting strands beta1 and beta2 and the loop connecting helices alpha1 and alpha2, which appear to be more mobile than corresponding loops in other known structures. The interaction of dibutanoyl-phosphatidylinositol-3-phosphate (dibutanoyl-PtdIns(3)P) with SNX22 was investigated by an NMR titration experiment, which identified the binding site in a basic cleft and indicated that ligand binding leads only to a local structural rearrangement as has been found with other PX domains. Because motions in the loops are damped out when dibutanoyl-PtdIns(3)P binds, entropic effects could contribute to the lower affinity of SNX22 for this ligand compared to other PX domains. PMID:17400918

  2. Global carbon budget 2014

    Science.gov (United States)

    Le Quéré, C.; Moriarty, R.; Andrew, R. M.; Peters, G. P.; Ciais, P.; Friedlingstein, P.; Jones, S. D.; Sitch, S.; Tans, P.; Arneth, A.; Boden, T. A.; Bopp, L.; Bozec, Y.; Canadell, J. G.; Chini, L. P.; Chevallier, F.; Cosca, C. E.; Harris, I.; Hoppema, M.; Houghton, R. A.; House, J. I.; Jain, A. K.; Johannessen, T.; Kato, E.; Keeling, R. F.; Kitidis, V.; Klein Goldewijk, K.; Koven, C.; Landa, C. S.; Landschützer, P.; Lenton, A.; Lima, I. D.; Marland, G.; Mathis, J. T.; Metzl, N.; Nojiri, Y.; Olsen, A.; Ono, T.; Peng, S.; Peters, W.; Pfeil, B.; Poulter, B.; Raupach, M. R.; Regnier, P.; Rödenbeck, C.; Saito, S.; Salisbury, J. E.; Schuster, U.; Schwinger, J.; Séférian, R.; Segschneider, J.; Steinhoff, T.; Stocker, B. D.; Sutton, A. J.; Takahashi, T.; Tilbrook, B.; van der Werf, G. R.; Viovy, N.; Wang, Y.-P.; Wanninkhof, R.; Wiltshire, A.; Zeng, N.

    2015-05-01

    component of the global carbon budget. For the last decade available (2004-2013), EFF was 8.9 ± 0.4 GtC yr-1, ELUC 0.9 ± 0.5 GtC yr-1, GATM 4.3 ± 0.1 GtC yr-1, SOCEAN 2.6 ± 0.5 GtC yr-1, and SLAND 2.9 ± 0.8 GtC yr-1. For year 2013 alone, EFF grew to 9.9 ± 0.5 GtC yr-1, 2.3% above 2012, continuing the growth trend in these emissions, ELUC was 0.9 ± 0.5 GtC yr-1, GATM was 5.4 ± 0.2 GtC yr-1, SOCEAN was 2.9 ± 0.5 GtC yr-1, and SLAND was 2.5 ± 0.9 GtC yr-1. GATM was high in 2013, reflecting a steady increase in EFF and smaller and opposite changes between SOCEAN and SLAND compared to the past decade (2004-2013). The global atmospheric CO2 concentration reached 395.31 ± 0.10 ppm averaged over 2013. We estimate that EFF will increase by 2.5% (1.3-3.5%) to 10.1 ± 0.6 GtC in 2014 (37.0 ± 2.2 GtCO2 yr-1), 65% above emissions in 1990, based on projections of world gross domestic product and recent changes in the carbon intensity of the global economy. From this projection of EFF and assumed constant ELUC for 2014, cumulative emissions of CO2 will reach about 545 ± 55 GtC (2000 ± 200 GtCO2) for 1870-2014, about 75% from EFF and 25% from ELUC. This paper documents changes in the methods and data sets used in this new carbon budget compared with previous publications of this living data set (Le Quéré et al., 2013, 2014). All observations presented here can be downloaded from the Carbon Dioxide Information Analysis Center (doi:10.3334/CDIAC/GCP_2014).

  3. Global Carbon Budget 2015

    Science.gov (United States)

    Le Quéré, C.; Moriarty, R.; Andrew, R. M.; Canadell, J. G.; Sitch, S.; Korsbakken, J. I.; Friedlingstein, P.; Peters, G. P.; Andres, R. J.; Boden, T. A.; Houghton, R. A.; House, J. I.; Keeling, R. F.; Tans, P.; Arneth, A.; Bakker, D. C. E.; Barbero, L.; Bopp, L.; Chang, J.; Chevallier, F.; Chini, L. P.; Ciais, P.; Fader, M.; Feely, R. A.; Gkritzalis, T.; Harris, I.; Hauck, J.; Ilyina, T.; Jain, A. K.; Kato, E.; Kitidis, V.; Klein Goldewijk, K.; Koven, C.; Landschützer, P.; Lauvset, S. K.; Lefèvre, N.; Lenton, A.; Lima, I. D.; Metzl, N.; Millero, F.; Munro, D. R.; Murata, A.; Nabel, J. E. M. S.; Nakaoka, S.; Nojiri, Y.; O'Brien, K.; Olsen, A.; Ono, T.; Pérez, F. F.; Pfeil, B.; Pierrot, D.; Poulter, B.; Rehder, G.; Rödenbeck, C.; Saito, S.; Schuster, U.; Schwinger, J.; Séférian, R.; Steinhoff, T.; Stocker, B. D.; Sutton, A. J.; Takahashi, T.; Tilbrook, B.; van der Laan-Luijkx, I. T.; van der Werf, G. R.; van Heuven, S.; Vandemark, D.; Viovy, N.; Wiltshire, A.; Zaehle, S.; Zeng, N.

    2015-12-01

    carbon budget. For the last decade available (2005-2014), EFF was 9.0 ± 0.5 GtC yr-1, ELUC was 0.9 ± 0.5 GtC yr-1, GATM was 4.4 ± 0.1 GtC yr-1, SOCEAN was 2.6 ± 0.5 GtC yr-1, and SLAND was 3.0 ± 0.8 GtC yr-1. For the year 2014 alone, EFF grew to 9.8 ± 0.5 GtC yr-1, 0.6 % above 2013, continuing the growth trend in these emissions, albeit at a slower rate compared to the average growth of 2.2 % yr-1 that took place during 2005-2014. Also, for 2014, ELUC was 1.1 ± 0.5 GtC yr-1, GATM was 3.9 ± 0.2 GtC yr-1, SOCEAN was 2.9 ± 0.5 GtC yr-1, and SLAND was 4.1 ± 0.9 GtC yr-1. GATM was lower in 2014 compared to the past decade (2005-2014), reflecting a larger SLAND for that year. The global atmospheric CO2 concentration reached 397.15 ± 0.10 ppm averaged over 2014. For 2015, preliminary data indicate that the growth in EFF will be near or slightly below zero, with a projection of -0.6 [range of -1.6 to +0.5] %, based on national emissions projections for China and the USA, and projections of gross domestic product corrected for recent changes in the carbon intensity of the global economy for the rest of the world. From this projection of EFF and assumed constant ELUC for 2015, cumulative emissions of CO2 will reach about 555 ± 55 GtC (2035 ± 205 GtCO2) for 1870-2015, about 75 % from EFF and 25 % from ELUC. This living data update documents changes in the methods and data sets used in this new carbon budget compared with previous publications of this data set (Le Quéré et al., 2015, 2014, 2013). All observations presented here can be downloaded from the Carbon Dioxide Information Analysis Center (doi:10.3334/CDIAC/GCP_2015).

  4. 27 CFR 22.20 - Delegations of the Administrator.

    Science.gov (United States)

    2010-04-01

    ... in TTB Order 1135.22, Delegation of the Administrator's Authorities in 27 CFR Part 22, Distribution... Administrator. 22.20 Section 22.20 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Provisions Authorities § 22.20 Delegations of the Administrator. The regulatory authorities of...

  5. Carbon Monoxide Concentration in Different Districts of Tehran

    OpenAIRE

    K A'azam; Mojgan Baniardalani; F. Changani

    2003-01-01

    Air pollution is a major problem in Tehran. Most important agents responsible for the high pollution include carbon monoxide, sulfur dioxide, nitrogen dioxide, hydrocarbons and suspended particles. Determination of quality and quantity of polluting agents is of great importance for sustaining the inhabitants health level. We studied carbon monoxide, one of the most hazardous air-polluting agents, in 22 urban districts of Tehran. The results showed that in average 4.39% of the air in Tehran ha...

  6. Mutagenicity of carbon nanomaterials

    DEFF Research Database (Denmark)

    Wallin, Håkan; Jacobsen, Nicklas Raun; White, Paul A;

    2011-01-01

    Carbon nanomaterials such carbon nanotubes, graphene and fullerenes are some the most promising nanomaterials. Although carbon nanomaterials have been reported to possess genotoxic potential, it is imperitive to analyse the data on the genotoxicity of carbon nanomaterials in vivo and in vitro and...

  7. Sunspot random walk and 22-year variation

    Science.gov (United States)

    Love, Jeffrey J.; Rigler, E. Joshua

    2012-01-01

    We examine two stochastic models for consistency with observed long-term secular trends in sunspot number and a faint, but semi-persistent, 22-yr signal: (1) a null hypothesis, a simple one-parameter random-walk model of sunspot-number cycle-to-cycle change, and, (2) an alternative hypothesis, a two-parameter random-walk model with an imposed 22-yr alternating amplitude. The observed secular trend in sunspots, seen from solar cycle 5 to 23, would not be an unlikely result of the accumulation of multiple random-walk steps. Statistical tests show that a 22-yr signal can be resolved in historical sunspot data; that is, the probability is low that it would be realized from random data. On the other hand, the 22-yr signal has a small amplitude compared to random variation, and so it has a relatively small effect on sunspot predictions. Many published predictions for cycle 24 sunspots fall within the dispersion of previous cycle-to-cycle sunspot differences. The probability is low that the Sun will, with the accumulation of random steps over the next few cycles, walk down to a Dalton-like minimum. Our models support published interpretations of sunspot secular variation and 22-yr variation resulting from cycle-to-cycle accumulation of dynamo-generated magnetic energy.

  8. Electroanalysis with carbon paste electrodes

    CERN Document Server

    Svancara, Ivan; Walcarius, Alain; Vytras, Karel

    2011-01-01

    Introduction to Electrochemistry and Electroanalysis with Carbon Paste-Based ElectrodesHistorical Survey and GlossaryField in Publication Activities and LiteratureCarbon Pastes and Carbon Paste ElectrodesCarbon Paste as the Binary MixtureClassification of Carbon Pastes and Carbon Paste ElectrodesConstruction of Carbon Paste HoldersCarbon Paste as the Electrode MaterialPhysicochemical Properties of Carbon PastesElectrochemical Characteristics of Carbon PastesTesting of Unmodified CPEsIntera

  9. Two-Dimensional Crystallization of P22 Virus-Like Particles.

    Science.gov (United States)

    Yoshimura, Hideyuki; Edwards, Ethan; Uchida, Masaki; McCoy, Kimberly; Roychoudhury, Raj; Schwarz, Benjamin; Patterson, Dustin; Douglas, Trevor

    2016-07-01

    Virus-like particles (VLPs) are well established platforms for constructing functional biomimetic materials. The VLP from the bacteriophage P22 can be used as a nanocontainer to sequester active enzymes, at high concentration, within its cavity through a process of directed self-assembly. Construction of ordered 2D assemblies of these catalytic VLPs can be envisioned as a functional membrane. To achieve this, it is important to establish methods to fabricate densely packed monolayers of VLPs. Highly ordered assemblies of P22 can also be utilized as a two-dimensional (2D) crystal for electron crystallography to get precise structural information on the VLP. Here we report 2D crystallization of different P22 morphologies: P22 procapsid (PC), enzyme encapsulated PC (β-glycosidase and enhanced green fluorescent protein), empty shell (PC without scaffold proteins, ES), the expanded form of P22 (EX), and enzyme encapsulated EX (NADH oxidase). The 2D crystals of P22 VLPs were formed on a positively charged lipid monolayer at the water-air interface with a subphase containing 1% trehalose. A P22 solution, injected underneath the lipid monolayer, floated to the surface because of the density difference between the subphase and protein solution. The lipid monolayer, with adsorbed P22, was transferred to a holey carbon grid and was examined by electron microscopy. 2D crystals were obtained from a subphase containing 100 mM NaCl, 10 mM MES (pH 5.0), and 1% trehalose. The diffraction spots from the transferred film extended to the sixth order in negatively stained samples and the 10th order in cryo-electron microscopy samples. PMID:27125277

  10. Carbon and oxygen isotopic composition of the carbonates from the Jacupiranga and Catalao I carbonatite complexes, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Morikiyo, Toshiro (Shinshu Univ., Matsumoto, Nagano (Japan). Faculty of Science); Hirano, Hideo; Matsuhisa, Yukihiro

    1990-11-01

    Carbon and oxygen isotope compositions were measured for carbonates from the Jacupiranga and Catalao I carbonatite complexes in Brazil. The {delta}{sup 13}C values of the Jacupiranga carbonates are uniform, ranging from -6.4 to -5.6 per mille with the average of -6.07 per mille. Except for one sample, the {delta}{sup 18}O values of the carbonates are between 7.1 and 8.1 per mille, and the average value is 7.6 per mille. The isotopic compositions of the Jacupiranga carbonates represent the value of primary igneous carbonatite. The {delta}{sup 13}C values of dolomites are about 0.5 per mille higher than those of calcites. The {delta}{sup 13}C values of carbonates from the Catalao I complex range from -6.8 to -5.2 per mille with the average of -5.83 per mille. Those values are similar to the values of the Jacupiranga carbonates. However, oxygen isotopic compositions of the Catalao I carbonates show a wide range of 8.4 to 22.3 per mille. Carbonates with the lowest {delta}{sup 18}O values in the complex are considered to represent the igneous stage. Carbonates with extremely high {delta}{sup 18}O values of about 22 per mille are considered to have precipitated from low-temperature hydrothermal fluids. The group of intermediate {delta}{sup 18}O values indicates a variable degree of contamination by the {delta}{sup 18}O-rich hydrothermal carbonates. The contribution of secondary stage hydrothermal carbonates seems to be significant in the Catalao I complex as compared with the Jacupiranga complex. The development of a network structure in the Catalao I complex may have enhanced the circulation of the later stage hydrothermal fluids. (author).

  11. Pyrolyzed thin film carbon

    Science.gov (United States)

    Tai, Yu-Chong (Inventor); Liger, Matthieu (Inventor); Harder, Theodore (Inventor); Konishi, Satoshi (Inventor); Miserendino, Scott (Inventor)

    2010-01-01

    A method of making carbon thin films comprises depositing a catalyst on a substrate, depositing a hydrocarbon in contact with the catalyst and pyrolyzing the hydrocarbon. A method of controlling a carbon thin film density comprises etching a cavity into a substrate, depositing a hydrocarbon into the cavity, and pyrolyzing the hydrocarbon while in the cavity to form a carbon thin film. Controlling a carbon thin film density is achieved by changing the volume of the cavity. Methods of making carbon containing patterned structures are also provided. Carbon thin films and carbon containing patterned structures can be used in NEMS, MEMS, liquid chromatography, and sensor devices.

  12. Beyond temperature: Clumped isotope signatures in dissolved inorganic carbon species and the influence of solution chemistry on carbonate mineral composition

    OpenAIRE

    Tripati, Aradhna K.; Hill, Pamela S.; Eagle, Robert A.; Mosenfelder, Jed L.; Tang, Jianwu; Schauble, Edwin A.; Eiler, John M.; Zeebe, Richard E.; Uchikawa, Joji; Coplen, Tyler B.; Ries, Justin B; Henry, Drew

    2015-01-01

    “Clumped-isotope” thermometry is an emerging tool to probe the temperature history of surface and subsurface environments based on measurements of the proportion of ^(13)C and ^(18)O isotopes bound to each other within carbonate minerals in ^(13)C^(18)O^(16)O_2^(2−) groups (heavy isotope “clumps”). Although most clumped isotope geothermometry implicitly presumes carbonate crystals have attained lattice equilibrium (i.e., thermodynamic equilibrium for a mineral, which is independent of solutio...

  13. Rhodium(i)-catalysed skeletal reorganisation of benzofused spiro[3.3]heptanes via consecutive carbon-carbon bond cleavage.

    Science.gov (United States)

    Matsuda, Takanori; Yuihara, Itaru; Kondo, Kazuki

    2016-08-01

    Skeletal reorganisation of benzofused spiro[3.3]heptanes has been achieved using rhodium(i) catalysts. The reaction of benzofused 2-(2-pyridylmethylene)spiro[3.3]heptanes proceeds via sequential C-C bond oxidative addition and β-carbon elimination. On the other hand, benzofused spiro[3.3]heptan-2-ols undergo two consecutive β-carbon elimination processes. In both cases, substituted naphthalenes are obtained. PMID:27357097

  14. Environmental Green Chemistry Applications of Nanoporous Carbons

    Energy Technology Data Exchange (ETDEWEB)

    Matos, J.; Garcia, A; Poon, P

    2010-01-01

    Influence of surface properties of nanoporous carbons on activity and selectivity during the photooxidation of 4-chlorophenol on UV-irradiated TiO{sub 2} was performed. Characterization by infrared spectroscopy, X-ray photoelectronic spectroscopy and X-ray absorption near edge structure spectroscopy confirm the presence of a contact interface between both solids and suggest the coordination of some functional organic groups of the carbon surface, mainly ethers and carboxylic acids, to metallic centre Ti{sup +4} in TiO{sub 2}. Changes in surface pH of carbons from basic to neutral or acid remarkably increase the production of 4-chlorocathecol by a factor of 22 on TiO{sub 2}-Carbon in comparison of TiO{sub 2} alone. A scheme of interaction between TiO{sub 2} and carbon is proposed to the increased photoactivity of TiO{sub 2} and a reaction mechanism for the different intermediate products detected is also proposed. Results showed that TiO{sub 2}-Carbon can be used as an alternative photocatalyst for environmental green chemistry and selective organic synthesis applications.

  15. Microwave-assisted regeneration of activated carbon.

    Science.gov (United States)

    Foo, K Y; Hameed, B H

    2012-09-01

    Microwave heating was used in the regeneration of methylene blue-loaded activated carbons produced from fibers (PFAC), empty fruit bunches (EFBAC) and shell (PSAC) of oil palm. The dye-loaded carbons were treated in a modified conventional microwave oven operated at 2450 MHz and irradiation time of 2, 3 and 5 min. The virgin properties of the origin and regenerated activated carbons were characterized by pore structural analysis and nitrogen adsorption isotherm. The surface chemistry was examined by zeta potential measurement and determination of surface acidity/basicity, while the adsorptive property was quantified using methylene blue (MB). Microwave irradiation preserved the pore structure, original active sites and adsorption capacity of the regenerated activated carbons. The carbon yield and the monolayer adsorption capacities for MB were maintained at 68.35-82.84% and 154.65-195.22 mg/g, even after five adsorption-regeneration cycles. The findings revealed the potential of microwave heating for regeneration of spent activated carbons. PMID:22728787

  16. Systematic structure of the neutron drip-line {sup 22}C nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Ismail, Atef [Fundamental and Applied Sciences Department, Universiti Teknologi Petronas, Bandar Seri Iskandar, 31750 Tronoh, Perak, Malaysia and Department of Physics, Al-Azhar University, 71524 Assiut (Egypt); Cheong, Lee Yen; Yahya, Noorhana [Fundamental and Applied Sciences Department, Universiti Teknologi PETRONAS, Bandar Seri Iskandar, 31750 Tronoh, Perak (Malaysia); Tammam, M. [Department of Physics, Al-Azhar University, 71524 Assiut (Egypt)

    2014-10-24

    In the present work we systematically discuss the nuclear structure of the the heaviest particle-bound carbon isotope, {sup 22}C. The ground state wave function of the carbon isotope is calculated using the {sup 20}C core plus two-valence neutron based on a phenomenological mean-field MF potential. We apply the deduced wave function to provide the nuclear matter density which is necessary in the calculations of the total reaction cross section. Calculations show that there is a reasonable good description of the experimental binding energy BE and root-mean square RMS radius. The exotic structure and configuration of the ground state carbon isotope is explained and a consistent explanation on the two-neutron halo (Borromean) nucleus is given.

  17. SU(2|2) supersymmetric mechanics

    CERN Document Server

    Ivanov, Evgeny; Sidorov, Stepan

    2016-01-01

    We introduce a new kind of non-relativistic ${\\cal N}{=}\\,8$ supersymmetric mechanics, associated with worldline realizations of the supergroup $SU(2|2)$ treated as a deformation of flat ${\\cal N}{=}\\,8$, $d{=}1$ supersymmetry. Various worldline $SU(2|2)$ superspaces are constructed as coset manifolds of this supergroup, and the corresponding superfield techniques are developed. For the off-shell $SU(2|2)$ multiplets $({\\bf 3,8,5})$, $({\\bf 4,8,4})$ and $({\\bf 5,8,3})$, we construct and analyze the most general superfield and component actions. Common features are mass oscillator-type terms proportional to the deformation parameter and a trigonometric realization of the superconformal group $OSp(4^*|4)$ in the conformal cases. For the simplest $({\\bf 5, 8, 3})$ model the quantization is performed.

  18. Wood - a carbon depot

    OpenAIRE

    Lipušček, Igor; Tišler, Vesna

    2003-01-01

    The article examines the global movement of carbon dioxide, the most important greenhouse gas due to its large quantities. We studied the carbon cycle with possibilities of its extension, and analysed the mechanisms that remove carbon dioxide from the atmosphere and bind it into solid substances for a longer period of time. The focus was on carbon dioxide sink into biomass and carbon deposit in wood. On the basis of wood component data and chemical analysis of the components, we calculated th...

  19. Sodium 22+ washout from cultured rat cells

    International Nuclear Information System (INIS)

    The washout of Na+ isotopes from tissues and cells is quite complex and not well defined. To further gain insight into this process, we have studied 22Na+ washout from cultured Wistar rat skin fibroblasts and vascular smooth muscle cells (VSMCs). In these preparations, 22Na+ washout is described by a general three-exponential function. The exponential factor of the fastest component (k1) and the initial exchange rate constant (kie) of cultured fibroblasts decrease in magnitude in response to incubation in K+-deficient medium or in the presence of ouabain and increase in magnitude when the cells are incubated in a Ca++-deficient medium. As the magnitude of the kie declines (in the presence of ouabain) to the level of the exponential factor of the middle component (k2), 22Na+ washout is adequately described by a two-exponential function. When the kie is further diminished (in the presence of both ouabain and phloretin) to the range of the exponential factor of the slowest component (k3), the washout of 22Na+ is apparently monoexponential. Calculations of the cellular Na+ concentrations, based on the 22Na+ activity in the cells at the initiation of the washout experiments, and the medium specific activity agree with atomic absorption spectrometry measurements of the cellular concentration of this ion. Thus, all three components of 22Na+ washout from cultured rat cells are of cellular origin. Using the exponential parameters, compartmental analyses of two models (in parallel and in series) with three cellular Na+ pools were performed. The results indicate that, independent of the model chosen, the relative size of the largest Na+ pool is 92-93% in fibroblasts and approximately 96% in VSMCs. This pool is most likely to represent the cytosol

  20. Characterization Well R-22 Geochemistry Report

    Energy Technology Data Exchange (ETDEWEB)

    Patrick Longmire

    2002-09-01

    This report provides analytical results for groundwater collected during four characterization-sampling rounds conducted at well R-22 from March 2001 through March 2002. Characterization well R-22 was sampled from March 6 through 13, 2001; June 19 through 26, 2001; November 30 through December 10, 2001; and February 27 through March 7, 2002. The goal of the characterization efforts was to assess the hydrochemistry and to determine whether or not contaminants are present in the regional aquifer in the vicinity of the well. A geochemical evaluation of the analytical results for the well is also presented in this report.

  1. Organisasjonstenkningen i 22.juli-kommisjonens rapport

    OpenAIRE

    Røgenes, Kristine Nordbø

    2013-01-01

    Sammendrag Denne studien omhandler organisasjonstenkningen i 22.juli-kommisjonens rapport. Fredag 22.juli 2011 ble Norge rammet av den verste terrorhandlingen på norsk jord i fredstid. Ufattelige tragedier utspant seg og viktige samfunnsorganisasjoner som politiet, helsevesenet, brannvesenet og regjeringen ble satt på en kraftig prøve. For å gi befolkningen de svar de hadde krav på, nedsatte regjeringen en uavhengig kommisjon. Kommisjonen fikk ett år på seg til å finne svarene og legge ...

  2. Characterization Well R-22 Geochemistry Report

    International Nuclear Information System (INIS)

    This report provides analytical results for groundwater collected during four characterization-sampling rounds conducted at well R-22 from March 2001 through March 2002. Characterization well R-22 was sampled from March 6 through 13, 2001; June 19 through 26, 2001; November 30 through December 10, 2001; and February 27 through March 7, 2002. The goal of the characterization efforts was to assess the hydrochemistry and to determine whether or not contaminants are present in the regional aquifer in the vicinity of the well. A geochemical evaluation of the analytical results for the well is also presented in this report

  3. Characterization of UO22+ exchanged Y zeolite

    International Nuclear Information System (INIS)

    The present study discusses the incorporation of uranyl ion into Y-zeolite framework. The UO22+ sorption was measured by neutron activation analyses. The Y-zeolite framework distorts in response to the cations present in the structure. Hence, depending on the amount and the location of the exchanged cations, the features of the X-ray diffraction pattern may vary. From the Rietveld analysis of these patterns, the positions occupied by the UO22+ cations in the zeolite network were determined. (author)

  4. 27 CFR 22.22 - Alternate methods or procedures; and emergency variations from requirements.

    Science.gov (United States)

    2010-04-01

    ... OF TAX-FREE ALCOHOL Administrative Provisions Authorities § 22.22 Alternate methods or procedures... to the revenue; (iii) It is not contrary to law; and (iv) It will not cause an increase in cost to... are conditioned upon compliance with the conditions and limitations set forth in the approval....

  5. Soil Carbon Sequestration in India

    International Nuclear Information System (INIS)

    With a large land area and diverse ecoregions, there is a considerable potential of terrestrial/soil carbon sequestration in India. Of the total land area of 329 million hectares (Mha), 297 Mha is the land area comprising 162 Mha of arable land, 69 Mha of forest and woodland, 11 Mha of permanent pasture, 8 Mha of permanent crops and 58 Mha is other land uses. The soil organic carbon (SOC) pool is estimated at 21 Pg (petagram = Pg = 1 x 1015 g billion ton) to 30-cm depth and 63 Pg to 150-cm depth. The soil inorganic carbon (SIC) pool is estimated at 196 Pg to 1-m depth. The SOC concentration in most cultivated soils is less than 5 g/kg compared with 15 to 20 g/kg in uncultivated soils. Low SOC concentration is attributed to plowing, removal of crop residue and other biosolids, and mining of soil fertility. Accelerated soil erosion by water leads to emission of 6 Tg C/y. Important strategies of soil C sequestration include restoration of degraded soils, and adoption of recommended management practices (RMPs) of agricultural and forestry soils. Potential of soil C sequestration in India is estimated at 7 to 10 Tg C/y for restoration of degraded soils and ecosystems, 5 to 7 Tg C/y for erosion control, 6 to 7 Tg C/y for adoption of RMPs on agricultural soils, and 22 to 26 Tg C/y for secondary carbonates. Thus, total potential of soil C sequestration is 39 to 49 (44± 5) Tg C/y

  6. The role of urbanization in the global carbon cycle

    Directory of Open Access Journals (Sweden)

    Galina eChurkina

    2016-01-01

    Full Text Available Urban areas account for more than 70% of CO2 emissions from burning fossil fuels. Urban expansion in tropics is responsible for 5% of the annual emissions from land use change. Here I show that the effect of urbanization on the global carbon cycle extends beyond these emissions. I quantify the contribution of urbanization to the major carbon fluxes and pools globally and identify gaps crucial for predicting the evolution of the carbon cycle in the future. Urban residents currently control ~22 (12-40 % of the land carbon uptake (112 PgC/yr and ~24 (15-39 % of the carbon emissions (117 PgC/yr from land globally. Urbanization resulted in the creation of new carbon pools on land such as buildings (~6.7 PgC and landfills (~30 PgC. Together these pools store 1.6 (±0.3 % of the total vegetation and soil carbon pools globally. The creation and maintenance of these new pools has been associated with high emissions of CO2, which are currently better understood than the processes associated with the dynamics of these pools and accompanying uptake of carbon. Predictions of the future trajectories of the global carbon cycle will require a much better understanding of how urban development affects the carbon cycle over the long term.

  7. Accelerating Mineral Carbonation Using Carbonic Anhydrase.

    Science.gov (United States)

    Power, Ian M; Harrison, Anna L; Dipple, Gregory M

    2016-03-01

    Carbonic anhydrase (CA) enzymes have gained considerable attention for their potential use in carbon dioxide (CO2) capture technologies because they are able to catalyze rapidly the interconversion of aqueous CO2 and bicarbonate. However, there are challenges for widespread implementation including the need to develop mineralization process routes for permanent carbon storage. Mineral carbonation of highly reactive feedstocks may be limited by the supply rate of CO2. This rate limitation can be directly addressed by incorporating enzyme-catalyzed CO2 hydration. This study examined the effects of bovine carbonic anhydrase (BCA) and CO2-rich gas streams on the carbonation rate of brucite [Mg(OH)2], a highly reactive mineral. Alkaline brucite slurries were amended with BCA and supplied with 10% CO2 gas while aqueous chemistry and solids were monitored throughout the experiments (hours to days). In comparison to controls, brucite carbonation using BCA was accelerated by up to 240%. Nesquehonite [MgCO3·3H2O] precipitation limited the accumulation of hydrated CO2 species, apparently preventing BCA from catalyzing the dehydration reaction. Geochemical models reproduce observed reaction progress in all experiments, revealing a linear correlation between CO2 uptake and carbonation rate. Data demonstrates that carbonation in BCA-amended reactors remained limited by CO2 supply, implying further acceleration is possible. PMID:26829491

  8. Carbon fuel cells with carbon corrosion suppression

    Science.gov (United States)

    Cooper, John F.

    2012-04-10

    An electrochemical cell apparatus that can operate as either a fuel cell or a battery includes a cathode compartment, an anode compartment operatively connected to the cathode compartment, and a carbon fuel cell section connected to the anode compartment and the cathode compartment. An effusion plate is operatively positioned adjacent the anode compartment or the cathode compartment. The effusion plate allows passage of carbon dioxide. Carbon dioxide exhaust channels are operatively positioned in the electrochemical cell to direct the carbon dioxide from the electrochemical cell.

  9. Identification of Effective Organic Carbon for Biofloc Shrimp Culture System

    Directory of Open Access Journals (Sweden)

    K. Sakkaravarthi

    2015-01-01

    Full Text Available This study aims to identify an effective carbon source which enhances not only the microbial load but also the shrimps growth. The carbon source cane sugar, molasses and jaggery were tested in 100 L culture tanks with stocking density of 30 m‾2 Peneus monodon seeds for a culture period of 40 days. Jaggery biofloc tank shows highest floc formation (22 mL, highest survival (86% and highest ABW (6 g, proximate composition of jagerry biofloc had higher protein level (35% followed by mollases and sugar culture tanks. It confirms jaggery is a new efficient carbon source for shrimp culture system.

  10. 22 CFR 62.10 - Program administration.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Program administration. 62.10 Section 62.10 Foreign Relations DEPARTMENT OF STATE PUBLIC DIPLOMACY AND EXCHANGES EXCHANGE VISITOR PROGRAM General Provisions § 62.10 Program administration. Sponsors are responsible for the effective administration of...

  11. 22 CFR 1502.1 - Introduction.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Introduction. 1502.1 Section 1502.1 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION AVAILABILITY OF RECORDS § 1502.1 Introduction. (a) It is the policy... Administration and Finance (A&F) shall be responsible for the Foundation's compliance with the...

  12. 22 CFR 98.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... function. (c) Such other terms as are defined in 22 CFR 96.2 shall have the meaning given to them therein. ... Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES INTERCOUNTRY ADOPTION-CONVENTION RECORD... Children and Co-operation in Respect of Intercountry Adoption, done at The Hague on May 29, 1993....

  13. 22 CFR 309.16 - Review.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Review. 309.16 Section 309.16 Foreign Relations PEACE CORPS DEBT COLLECTION Salary Offset § 309.16 Review. (a) Request for outside hearing. Except as... hearing or a review of the documentary evidence is requested. If an oral hearing is desired, the...

  14. 22 CFR 911.7 - Review.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Review. 911.7 Section 911.7 Foreign Relations FOREIGN SERVICE GRIEVANCE BOARD IMPLEMENTATION DISPUTES § 911.7 Review. Resolution of disputes under this section shall not be subject to judicial review....

  15. 48 CFR 22.402 - Applicability.

    Science.gov (United States)

    2010-10-01

    ... repair of a public building or public work); (iii) Employees of railroads operating under collective... Construction 22.402 Applicability. (a) Contracts for construction work. (1) The requirements of this subpart... commercial supplier or materialman; (ii) Contracts requiring construction work that is so closely related...

  16. 22 CFR 142.45 - Housing.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 142.45 Section 142.45 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Postsecondary Education § 142.45 Housing. (a) Housing provided by the recipient. A recipient that provides housing to its nonhandicapped students shall...

  17. 22 CFR 146.405 - Housing.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to...

  18. 22 CFR 217.45 - Housing.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 217.45 Section 217.45 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Postsecondary Education § 217.45 Housing. (a) Housing provided by the recipient. A recipient that provides housing to its nonhandicapped students shall...

  19. 22 CFR 229.405 - Housing.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 229.405 Section 229.405 Foreign... Programs or Activities Prohibited § 229.405 Housing. (a) Generally. A recipient shall not, on the basis of... services or benefits related to housing, except as provided in this section (including housing...

  20. 22 CFR 210.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 210.650 Section 210.650 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE... authorized by a law of the United States, rather than to acquire property or services for the...

  1. 22 CFR 1509.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Grant. 1509.650 Section 1509.650 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  2. 22 CFR 1008.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Grant. 1008.650 Section 1008.650 Foreign Relations INTER-AMERICAN FOUNDATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  3. 22 CFR 133.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 133.650 Section 133.650 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL... authorized by a law of the United States, rather than to acquire property or services for the...

  4. 22nd Annual seminar on theoretical physics

    International Nuclear Information System (INIS)

    The 22nd Annual Seminar on Theoretical Physics, held from 14-17 July on the Durban campus of the University of Natal, could be described as very successful from a number of different considerations. Seventeen papers were delivered on the Seminar which covered a wide spectrum of theoretical physics with emphasis on quantum chromodynamics and nuclear theory

  5. 22 CFR 8.7 - Security.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Security. 8.7 Section 8.7 Foreign Relations DEPARTMENT OF STATE GENERAL ADVISORY COMMITTEE MANAGEMENT § 8.7 Security. (a) All officers and members of a committee must have a security clearance for the subject matter level of security at which the...

  6. 19 CFR 177.22 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) ADMINISTRATIVE RULINGS Government Procurement; Country-of-Origin Determinations § 177.22 Definitions. (a) Country of origin. For the purpose of this subpart, an article is a product of a country or... or principal of law relating to the country of origin, without applying it to a particular set...

  7. 22 CFR 229.500 - Employment.

    Science.gov (United States)

    2010-04-01

    ... in Education Programs or Activities Prohibited § 229.500 Employment. (a) General. (1) No person shall... assistance. (2) A recipient shall make all employment decisions in any education program or activity operated... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 229.500 Section 229.500...

  8. 22 CFR 146.500 - Employment.

    Science.gov (United States)

    2010-04-01

    ... Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the... assistance. (2) A recipient shall make all employment decisions in any education program or activity operated... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500...

  9. 22 CFR 92.60 - Examination procedures.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Examination procedures. 92.60 Section 92.60... memory by reference to written records. A witness may be permitted to refresh his memory by referring to... notes, papers or other documents to refresh his memory or for the sake of testifying to matters not...

  10. 22 CFR 120.24 - Port Directors.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Port Directors. 120.24 Section 120.24 Foreign... Port Directors. Port Directors of U.S. Customs and Border Protection means the U.S. Customs and Border Protection Port Directors at the U.S. Customs and Border Protection Ports of Entry (other than the port...

  11. 22 CFR 228.21 - Ocean transportation.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Ocean transportation. 228.21 Section 228.21... for USAID Financing § 228.21 Ocean transportation. (a) The Cargo Preference Act of 1954, Section 901(b... transportation services is determined by the flag registry of the vessel. (1) When the authorized source...

  12. 22 CFR 1102.8 - Exemptions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Exemptions. 1102.8 Section 1102.8 Foreign Relations INTERNATIONAL BOUNDARY AND WATER COMMISSION, UNITED STATES AND MEXICO, UNITED STATES SECTION...) Could reasonably be expected to disclose the identity of a confidential source, including a State,...

  13. 22 CFR 225.102 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 225.102 Section 225.102 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT PROTECTION OF HUMAN SUBJECTS § 225.102 Definitions. (a... example, a medical record). Private information must be individually identifiable (i.e., the identity...

  14. 22 CFR 208.905 - Affiliate.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Affiliate. 208.905 Section 208.905 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE DEBARMENT AND SUSPENSION (NONPROCUREMENT... ownership; (b) Identity of interests among family members; (c) Shared facilities and equipment; (d)...

  15. 22 CFR 226.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... Identity (Identity) means the official marking for the United States Agency for International Development... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL... that receives a USAID subaward, as defined in 22 CFR 226.2. Supplies means all personal...

  16. 22 CFR 127.12 - Voluntary disclosures.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Voluntary disclosures. 127.12 Section 127.12 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS VIOLATIONS AND PENALTIES...) The complete identities and addresses of all persons known or suspected to be involved in...

  17. 22 CFR 62.27 - Alien physicians.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Alien physicians. 62.27 Section 62.27 Foreign... Provisions § 62.27 Alien physicians. (a) Purpose. Pursuant to the Mutual Educational and Cultural Exchange... Foreign Medical Graduates must sponsor alien physicians who wish to pursue programs of graduate...

  18. 22 CFR 146.430 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... assist in the administration of scholarships, fellowships, or other forms of financial assistance... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial assistance. 146.430 Section 146.430... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex...

  19. 22 CFR 229.430 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... assist in the administration of scholarships, fellowships, or other forms of financial assistance... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial assistance. 229.430 Section 229.430... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex...

  20. 22 CFR 1002.7 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 1002.7 Section 1002.7 Foreign Relations INTER-AMERICAN FOUNDATION AVAILABILITY OF RECORDS § 1002.7 Fees. Except as otherwise specifically provided by the Foundation, a fee will be levied for all searches for, or copies of, records. These...

  1. 22 CFR 521.25 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 521.25 Section 521.25 Foreign Relations BROADCASTING BOARD OF GOVERNORS IMPLEMENTATION OF THE PROGRAM FRAUD CIVIL REMEDIES ACT § 521.25 Fees. The party requesting a subpoena shall pay the cost of the fee and mileage of any witness subpoenaed in the amounts...

  2. 22 CFR 1502.7 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 1502.7 Section 1502.7 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION AVAILABILITY OF RECORDS § 1502.7 Fees. (a) When charged. Fees shall be... information primarily benefits the general public. Fees shall also not be charged where they would amount,...

  3. 22 CFR 505.11 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 505.11 Section 505.11 Foreign Relations BROADCASTING BOARD OF GOVERNORS PRIVACY ACT REGULATION § 505.11 Fees. (a) The first copy of any Agency record about you will be provided free of charge. A fee of $0.15 per page will be charged for any...

  4. 22 CFR 1411.10 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 1411.10 Section 1411.10 Foreign Relations... AVAILABILITY OF OFFICIAL INFORMATION § 1411.10 Fees. Persons requesting records from the Board, the General Counsel or the Panel shall be subject to a charge of fees for the direct cost of document search...

  5. 22 CFR 707.23 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 707.23 Section 707.23 Foreign Relations... INFORMATION IN RECORDS OF THE CORPORATION Notification; Access to Records; Amendment; Fees § 707.23 Fees. The fees to be charged by the Corporation for making copies of any records provided to any individual...

  6. 22 CFR 1304.9 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 1304.9 Section 1304.9 Foreign Relations MILLENNIUM CHALLENGE CORPORATION FREEDOM OF INFORMATION ACT PROCEDURES § 1304.9 Fees. (a) General. Fees... for services rendered by MCC in response to requests for records under this part. MCC's fee...

  7. 22 CFR 303.13 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 303.13 Section 303.13 Foreign Relations PEACE CORPS PROCEDURES FOR DISCLOSURE OF INFORMATION UNDER THE FREEDOM OF INFORMATION ACT § 303.13 Fees... business, such as informational or recruiting brochures, no fees will be charged. (b) For each a...

  8. 22 CFR 308.18 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 308.18 Section 308.18 Foreign Relations PEACE CORPS IMPLEMENTATION OF THE PRIVACY ACT OF 1974 § 308.18 Fees. No fees shall be charged for search time or for any other time expended by the agency to produce a record. Copies of records may be...

  9. 22 CFR 1507.8 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 1507.8 Section 1507.8 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION RULES SAFEGUARDING PERSONAL INFORMATION § 1507.8 Fees. Fees to be charged... as true copies, attestation under the seal of the Foundation, etc.), the question of charging...

  10. 22 CFR 503.7 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 503.7 Section 503.7 Foreign Relations BROADCASTING BOARD OF GOVERNORS FREEDOM OF INFORMATION ACT REGULATION § 503.7 Fees. (a) Fees to be charged... category of request and the type of fees that we will generally charge. However, for each of...

  11. 22 CFR 226.52 - Financial reporting.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial reporting. 226.52 Section 226.52...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Reports and Records § 226.52 Financial reporting. USAID requires recipients to use the Standard Form 425 or Standard Form 425a, Federal Financial Report, or...

  12. 22 CFR 145.52 - Financial reporting.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial reporting. 145.52 Section 145.52....52 Financial reporting. (a) The following forms or such other forms as may be approved by OMB are..., in obtaining this information, shall comply with report clearance requirements of 5 CFR part 1320....

  13. 22 CFR 135.41 - Financial reporting.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial reporting. 135.41 Section 135.41... Enforcement § 135.41 Financial reporting. (a) General. (1) Except as provided in paragraphs (a) (2) and (5) of...) Submitting financial reports to Federal agencies, or (ii) Requesting advances or reimbursements when...

  14. 27 CFR 22.162 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Inventories. 22.162... Inventories. Each permittee shall take a physical inventory of the tax-free and recovered alcohol in its possession semi-annually for the periods ending June 30 and December 31 of each year; or other...

  15. 22 CFR 228.51 - Commodities.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Commodities. 228.51 Section 228.51 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT RULES ON SOURCE, ORIGIN AND NATIONALITY FOR COMMODITIES AND SERVICES FINANCED BY USAID Waivers § 228.51 Commodities. (a) Waiver criteria. Any waiver must be based...

  16. 22 CFR 120.17 - Export.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Export. 120.17 Section 120.17 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS § 120.17 Export. (a) Export means: (1) Sending or taking a defense article out of the United States in any manner, except...

  17. 22 CFR 92.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 92.1 Section 92.1 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Introduction § 92.1... connection with the execution of some document. (b) The term notarial act means an act recognized by law...

  18. 22 CFR 229.510 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 229.510 Section 229.510 Foreign... in Education Programs or Activities Prohibited § 229.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and...

  19. 22 CFR 146.310 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and...

  20. 22 CFR 229.310 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 229.310 Section 229.310 Foreign... and Recruitment Prohibited § 229.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 229.300 through 229.310 apply shall not discriminate on the basis of sex in the recruitment...

  1. 22 CFR 146.510 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of...

  2. 22 CFR 901.14 - Service.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Service. 901.14 Section 901.14 Foreign Relations FOREIGN SERVICE GRIEVANCE BOARD GENERAL Meanings of Terms As Used in This Chapter § 901.14 Service. Service means the Foreign Service of the United States....

  3. 22 CFR 305.2 - Eligibility.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Eligibility. 305.2 Section 305.2 Foreign Relations PEACE CORPS ELIGIBILITY AND STANDARDS FOR PEACE CORPS VOLUNTEER SERVICE § 305.2 Eligibility. In addition to those skills, personal attributes and aptitudes required for available Volunteer assignments, the following are the basic requirements...

  4. 22 CFR 135.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 135.3 Section 135.3 Foreign Relations DEPARTMENT OF STATE MISCELLANEOUS UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND COOPERATIVE...) school district, special district, intrastate district, council of governments (whether or...

  5. 22 CFR 120.16 - Foreign person.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Foreign person. 120.16 Section 120.16 Foreign... Foreign person. Foreign person means any natural person who is not a lawful permanent resident as defined... also means any foreign corporation, business association, partnership, trust, society or any...

  6. Consumption of HCFC-22 Increases Steadily

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ Chlorodifluoromethane (HCFC-22) is an important fluorine chemical product. It can be directly used as refrigerant in household air-conditioners and refrigerators and also as chemical raw material to produce fluorine-containing polymer monomer tetrafluoroethylene (TFE) to extend the fluorine chemical industrial chain.

  7. 22 CFR 228.34 - Joint ventures.

    Science.gov (United States)

    2010-04-01

    ... Financing § 228.34 Joint ventures. A joint venture or unincorporated association is eligible only if each of... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Joint ventures. 228.34 Section 228.34 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT RULES ON SOURCE, ORIGIN AND NATIONALITY FOR COMMODITIES...

  8. 22 CFR 71.12 - Dietary supplements.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Dietary supplements. 71.12 Section 71.12... Incarcerated Abroad § 71.12 Dietary supplements. (a) Eligibility criteria. A prisoner is considered eligible for the dietary supplement program under the following general criteria: (1) An evaluation by...

  9. 22 CFR 209.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 209.4 Section 209.4 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT NON-DISCRIMINATION IN FEDERALLY-ASSISTED PROGRAMS... § 209.4 Discrimination prohibited. (a) General. No person in the United States shall, on the grounds...

  10. 22 CFR 141.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 141.3 Section 141.3... DEPARTMENT OF STATE-EFFECTUATION OF TITLE VI OF THE CIVIL RIGHTS ACT OF 1964 § 141.3 Discrimination... discrimination under any program to which this part applies. (b) Specific discriminatory actions prohibited....

  11. 22 CFR 217.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 217.4 Section 217.4... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General Provisions § 217.4 Discrimination... participation in, be denied the benefits of, or otherwise be subjected to discrimination under any program...

  12. 22 CFR 142.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 142.4 Section 142.4... OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General Provisions § 142.4 Discrimination... participation in, be denied the benefits of, or otherwise be subjected to discrimination under any program...

  13. 22 CFR 1203.735-101 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Purpose. 1203.735-101 Section 1203.735-101 Foreign Relations UNITED STATES INTERNATIONAL DEVELOPMENT COOPERATION AGENCY EMPLOYEE RESPONSIBILITIES AND... maintenance of these standards. To accord with these concepts the regulations in this part prescribe...

  14. 22 CFR 401.10 - General rule.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true General rule. 401.10 Section 401.10 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE General § 401.10... to carry out the true intent and meaning of the Treaty....

  15. 22 CFR 901.11 - Agency.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Agency. 901.11 Section 901.11 Foreign Relations FOREIGN SERVICE GRIEVANCE BOARD GENERAL Meanings of Terms As Used in This Chapter § 901.11 Agency. Agency means the Department of State, the Agency for International Development, the U.S. Information...

  16. 22 CFR 1500.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...: Board or Board of Directors means the collegial body that conducts the business of the African Development Foundation as specified in title V, section 507 of the International Security and Development Cooperation Act of 1980, Pub. L. 96-533 (22 U.S.C. 290 h-5). Meeting means the deliberations of a quorum...

  17. 22 CFR 62.28 - International visitors.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false International visitors. 62.28 Section 62.28... Program Provisions § 62.28 International visitors. (a) Purpose. The international visitor category is for... programs are designed to enable the international visitors to better understand American culture...

  18. The National Writing Project after 22 Years.

    Science.gov (United States)

    Smith, Mary Ann

    1996-01-01

    For 22 years, at 166 sites around the world, over 1 million teachers have been teaching each other in nearly identical National Writing Project summer institutes. This article discusses the lessons learned about teacher leadership, the qualities of worthwhile staff development, writing instruction, and educational reform's bumpy landscape. (MLH)

  19. 22 CFR 1502.10 - Judicial review.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Judicial review. 1502.10 Section 1502.10 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION AVAILABILITY OF RECORDS § 1502.10 Judicial review. On complaint, the district court of the United States in the district in which the complainant resides, or has...

  20. 22 CFR 1507.9 - Judicial review.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Judicial review. 1507.9 Section 1507.9 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION RULES SAFEGUARDING PERSONAL INFORMATION § 1507.9 Judicial review. Any person may file a complaint against the Foundation in the appropriate U.S. district court,...

  1. 22 CFR 62.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... but does not mean independent contractors, as defined in 8 CFR 274a.1(j). Exchange visitor means a... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 62.2 Section 62.2 Foreign... territories or possessions, or who has been lawfully admitted for permanent residence, within the meaning...

  2. 22 CFR 51.28 - Minors.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Minors. 51.28 Section 51.28 Foreign Relations... residence is necessary to permit a court of competent jurisdiction to adjudicate or enforce a custody... court of competent jurisdiction to be a U.S. state or federal court or a foreign court located in...

  3. 22 CFR 215.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 215.2 Section 215.2 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT REGULATIONS FOR IMPLEMENTATION OF PRIVACY ACT OF 1974 § 215.2... citizen of the United States or an alien lawfully admitted for permanent residence; (e) Maintain...

  4. 22 CFR 308.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Definitions. 308.3 Section 308.3 Foreign Relations PEACE CORPS IMPLEMENTATION OF THE PRIVACY ACT OF 1974 § 308.3 Definitions. (a) Record means any... residence. (f) The term maintain includes the maintenance, collection, use or dissemination of any...

  5. 22 CFR 1507.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Definitions. 1507.3 Section 1507.3 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION RULES SAFEGUARDING PERSONAL INFORMATION § 1507.3 Definitions. (a... permanent residence. (f) The term maintain includes the maintenance, collection, use or dissemination of...

  6. 22 CFR 1003.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Definitions. 1003.2 Section 1003.2 Foreign Relations INTER-AMERICAN FOUNDATION RULES SAFEGUARDING PERSONAL INFORMATION IN IAF RECORDS § 1003.2... for permanent residence. (c) The term maintain includes maintain, collect, use, or disseminate....

  7. 22 CFR 62.29 - Government visitors.

    Science.gov (United States)

    2010-04-01

    ..., to be paid to the government visitor. (f) Issuance of Form DS-2019. The Form DS-2019 shall be issued... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Government visitors. 62.29 Section 62.29... Program Provisions § 62.29 Government visitors. (a) Purpose. The government visitor category is for...

  8. 29 CFR 1910.22 - General requirements.

    Science.gov (United States)

    2010-07-01

    ... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR OCCUPATIONAL SAFETY AND HEALTH STANDARDS Walking-Working Surfaces § 1910.22 General requirements. This section... roof of a building or other structure a load greater than that for which such floor or roof is...

  9. 22 CFR 707.31 - Public information.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Public information. 707.31 Section 707.31 Foreign Relations OVERSEAS PRIVATE INVESTMENT CORPORATION ADMINISTRATIVE PROVISIONS ACCESS TO AND SAFEGUARDING OF PERSONAL INFORMATION IN RECORDS OF THE CORPORATION Exceptions § 707.31 Public...

  10. 22 CFR 212.21 - Public records.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Public records. 212.21 Section 212.21 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT PUBLIC INFORMATION Availability of Information for Public Inspection and Copying § 212.21 Public records. In accordance with this subpart, USAID makes the...

  11. 22 CFR 216.8 - Public hearings.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Public hearings. 216.8 Section 216.8 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ENVIRONMENTAL PROCEDURES § 216.8 Public hearings. (a) In most instances AID will be able to gain the benefit of public participation in the impact statement...

  12. 22 CFR 214.34 - Public participation.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Public participation. 214.34 Section 214.34... Committees § 214.34 Public participation. (a) Each advisory committee meeting is to be open to the public except where: (1) The Director, OMB, has determined that public notice of a meeting would be...

  13. 22 CFR 8.14 - Public inquiries.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Public inquiries. 8.14 Section 8.14 Foreign Relations DEPARTMENT OF STATE GENERAL ADVISORY COMMITTEE MANAGEMENT § 8.14 Public inquiries. Public inquiries concerning the implementation of the Federal Advisory Committee Act and the management of...

  14. 22 CFR 171.12 - Processing requests.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Processing requests. 171.12 Section 171.12 Foreign Relations DEPARTMENT OF STATE ACCESS TO INFORMATION AVAILABILITY OF INFORMATION AND RECORDS TO THE... basis could reasonably be expected to: Pose an imminent threat to the life or physical safety of...

  15. 22 CFR 171.11 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 171.11 Section 171.11 Foreign Relations DEPARTMENT OF STATE ACCESS TO INFORMATION AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC..., regardless of physical form or characteristics, made in or received by the Department and preserved...

  16. 22 CFR 171.20 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 171.20 Section 171.20 Foreign Relations DEPARTMENT OF STATE ACCESS TO INFORMATION AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC... documentary material, regardless of its physical form or characteristics that is owned by, produced by or...

  17. 22 CFR 226.43 - Competition.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Competition. 226.43 Section 226.43 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL.... The recipient shall be alert to organizational conflicts of interest as well as...

  18. 22 CFR 67.3 - Management.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Management. 67.3 Section 67.3 Foreign Relations....3 Management. (a) NED's operations and staff are managed by a President selected by the Board of... Office of the President provides policy direction and is responsible for day-to-day management of...

  19. 22 CFR 96.30 - State licensing.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false State licensing. 96.30 Section 96.30 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES ACCREDITATION OF AGENCIES AND APPROVAL OF PERSONS UNDER THE INTERCOUNTRY ADOPTION ACT OF 2000 (IAA) Standards for Convention Accreditation and Approval Licensing and Corporate Governance §...

  20. 22 CFR 518.34 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Equipment. 518.34 Section 518.34 Foreign... Property Standards § 518.34 Equipment. (a) Title to equipment acquired by a recipient with Federal funds... equipment acquired with Federal funds to provide services to non-Federal outside organizations for a...

  1. 22 CFR 135.32 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Equipment. 135.32 Section 135.32 Foreign... Equipment. (a) Title. Subject to the obligations and conditions set forth in this section, title to equipment acquired under a grant or subgrant will vest upon acquisition in the grantee or...

  2. 22 CFR 145.34 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Equipment. 145.34 Section 145.34 Foreign..., HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS Post-Award Requirements Property Standards § 145.34 Equipment. (a) Title to equipment acquired by a recipient with Federal funds shall vest in the...

  3. 22 CFR 226.34 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Equipment. 226.34 Section 226.34 Foreign... ORGANIZATIONS Post-award Requirements Property Standards § 226.34 Equipment. (a) Unless the agreement provides otherwise, title to equipment acquired by a recipient with Federal funds shall vest in the...

  4. 22 CFR 518.52 - Financial reporting.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Financial reporting. 518.52 Section 518.52... Requirements Reports and Records § 518.52 Financial reporting. (a) The following forms or such other forms as... awarding agency requires accrual information and the recipient's accounting records are not normally...

  5. 22 CFR 143.11 - Standards.

    Science.gov (United States)

    2010-04-01

    ... out in part 90 (primarily subpart B) of 45 CFR. ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Standards. 143.11 Section 143.11 Foreign... RECEIVING FEDERAL FINANCIAL ASSISTANCE Standards for Determining Age Discrimination § 143.11 Standards....

  6. 22 CFR 218.11 - Standards.

    Science.gov (United States)

    2010-04-01

    ... prohibited are set out in part 90 (primarily subpart B) of 45 CFR. ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Standards. 218.11 Section 218.11 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Standards for Determining Age Discrimination §...

  7. 22 CFR 228.40 - Local procurement.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Local procurement. 228.40 Section 228.40... COMMODITIES AND SERVICES FINANCED BY USAID Conditions Governing Source and Nationality of Local Procurement Transactions for USAID Financing § 228.40 Local procurement. Local procurement in the cooperating...

  8. 22 CFR 145.46 - Procurement records.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Procurement records. 145.46 Section 145.46... EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS Post-Award Requirements Procurement Standards § 145.46 Procurement records. Procurement records and files for purchases in excess of the small...

  9. 22 CFR 226.46 - Procurement records.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Procurement records. 226.46 Section 226.46...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Procurement Standards § 226.46 Procurement records. Procurement records and files for purchases in excess of the small purchase threshold shall include...

  10. 22 CFR 62.73 - Academic training.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Academic training. 62.73 Section 62.73 Foreign... Visitor Information System (SEVIS) § 62.73 Academic training. (a) Students meeting the definition listed... responsible officer or alternate responsible officer, engage in academic training pursuant to § 62.23(f)....

  11. 22 CFR 95.3 - Procedures.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Procedures. 95.3 Section 95.3 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES IMPLEMENTATION OF TORTURE CONVENTION IN EXTRADITION CASES § 95... torture are made or the issue is otherwise brought to the Department's attention, appropriate policy...

  12. 22 CFR 312.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Grant. 312.650 Section 312.650 Foreign Relations PEACE CORPS GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 312... the recipient to carry out a public purpose of support or stimulation authorized by a law of...

  13. 22 CFR 213.5 - Fraud claims.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fraud claims. 213.5 Section 213.5 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT CLAIMS COLLECTION General § 213.5 Fraud claims. (a) The CFO will refer claims involving fraud, the presentation of a false claim, or misrepresentation on the...

  14. 22 CFR 145.31 - Insurance coverage.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Insurance coverage. 145.31 Section 145.31 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS GRANTS AND AGREEMENTS WITH INSTITUTIONS OF HIGHER... Insurance coverage. Recipients shall, at a minimum, provide the equivalent insurance coverage for...

  15. 22 CFR 62.14 - Insurance.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Insurance. 62.14 Section 62.14 Foreign... § 62.14 Insurance. (a) Sponsors shall require each exchange visitor to have insurance in effect which... amount of $10,000; and (4) A deductible not to exceed $500 per accident or illness. (b) An...

  16. 22 CFR 226.31 - Insurance coverage.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Insurance coverage. 226.31 Section 226.31...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Property Standards § 226.31 Insurance coverage. Recipients shall, at a minimum, provide the equivalent insurance coverage for real property and equipment...

  17. 22 CFR 518.31 - Insurance coverage.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Insurance coverage. 518.31 Section 518.31... Requirements Property Standards § 518.31 Insurance coverage. Recipients shall, at a minimum, provide the equivalent insurance coverage for real property and equipment acquired with Federal funds as provided...

  18. 22 CFR 142.17 - New construction.

    Science.gov (United States)

    2010-04-01

    ... Uniform Federal Accessibility Standards (USAF) (appendix A to 41 CFR subpart 101-19.6) shall be deemed to... 22 Foreign Relations 1 2010-04-01 2010-04-01 false New construction. 142.17 Section 142.17 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS...

  19. 22 CFR 41.71 - Transit aliens.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Transit aliens. 41.71 Section 41.71 Foreign... NATIONALITY ACT, AS AMENDED Transit Aliens § 41.71 Transit aliens. (a) Transit aliens—general. An alien is classifiable as a nonimmigrant transit alien under INA 101(a) (15) (C) if the consular officer is...

  20. 22 CFR 41.108 - Medical examination.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Medical examination. 41.108 Section 41.108... AND NATIONALITY ACT, AS AMENDED Application for Nonimmigrant Visa § 41.108 Medical examination. (a) Requirements for medical examination. An applicant for a nonimmigrant visa shall be required to take a...

  1. 22 CFR 42.66 - Medical examination.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Medical examination. 42.66 Section 42.66... NATIONALITY ACT, AS AMENDED Application for Immigrant Visas § 42.66 Medical examination. (a) Medical examination required of all applicants. Before the issuance of an immigrant visa, the consular officer...

  2. 22 CFR 217.21 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 217.21 Section 217... Discrimination prohibited. No qualified handicapped person shall, because a recipient's facilities within the... excluded from participation in, or otherwise be subjected to discrimination under any program or...

  3. 22 CFR 217.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 217.11 Section 217... Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity to which this part applies. (2)...

  4. 22 CFR 142.11 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 142.11 Section 142... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Employment Practices § 142.11 Discrimination... discrimination in employment under any program or activity receiving Federal financial assistance. (2)...

  5. 22 CFR 142.15 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discrimination prohibited. 142.15 Section 142... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Accessibility § 142.15 Discrimination... be subjected to discrimination under any program or activity to which the part applies....

  6. 22 CFR 103.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... entered into force on April 29, 1997. CWCIA. The Chemical Weapons Convention Implementation Act of 1998... Department of Commerce. (15 CFR parts 710 through 722.) Executive Director. The Executive Director, Office of... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 103.2 Section 103.2...

  7. 22 CFR 20.4 - Retirement benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Retirement benefits. 20.4 Section 20.4 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR CERTAIN FORMER SPOUSES § 20.4 Retirement benefits. (a) Type of benefits. (1) A former spouse who meets the qualification requirements of § 20.3 is entitled...

  8. 22 CFR 192.21 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 192.21 Section 192.21... Soldiers' and Sailors' Civil Relief Act to Captive Situations § 192.21 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50...

  9. 22 CFR 191.21 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 191.21 Section 191.21 Foreign Relations DEPARTMENT OF STATE HOSTAGE RELIEF HOSTAGE RELIEF ASSISTANCE Medical Benefits § 191.21 Applicable benefits. A person eligible for benefits under this part shall be eligible for authorized...

  10. 22 CFR 191.11 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 191.11 Section 191.11...' and Sailors' Civil Relief Act § 191.11 Applicable benefits. (a) Eligible persons are entitled to the benefits provided by the Soldiers' and Sailors' Civil Relief Act of 1940 (50 U.S.C. App. 501, et...

  11. 22 CFR 19.11 - Survivor benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Survivor benefits. 19.11 Section 19.11 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR SPOUSES AND FORMER SPOUSES OF PARTICIPANTS IN THE FOREIGN SERVICE RETIREMENT AND DISABILITY SYSTEM § 19.11 Survivor benefits....

  12. 22 CFR 192.11 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 192.11 Section 192.11 Foreign Relations DEPARTMENT OF STATE HOSTAGE RELIEF VICTIMS OF TERRORISM COMPENSATION Payment of Salary and Other Benefits for Captive Situations § 192.11 Applicable benefits. (a) Captives are entitled...

  13. Event 22 February 2012: The Impact Agenda

    OpenAIRE

    Blog Admin, Impact of Social Sciences,

    2012-01-01

    The Impact Agenda – an ESRC-funded seminar series – will host speakers at Seminar 5: New Frontiers of Impact on Wednesday, 22nd February 2012 from 9.00am until 5.00pm at Manchester Business School West.

  14. 22 CFR 192.31 - Applicable benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Applicable benefits. 192.31 Section 192.31 Foreign Relations DEPARTMENT OF STATE HOSTAGE RELIEF VICTIMS OF TERRORISM COMPENSATION Medical Benefits for Captive Situations § 192.31 Applicable benefits. A person eligible for benefits under this...

  15. 22 CFR 20.5 - Survivor benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Survivor benefits. 20.5 Section 20.5 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR CERTAIN FORMER SPOUSES § 20.5 Survivor benefits. (a) Type of benefits. A former spouse who meets the eligibility requirements of § 20.3 is entitled...

  16. 22 CFR 229.525 - Fringe benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 229.525 Section 229.525... Employment in Education Programs or Activities Prohibited § 229.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical,...

  17. 22 CFR 146.525 - Fringe benefits.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical,...

  18. 29 CFR 1470.22 - Allowable costs.

    Science.gov (United States)

    2010-07-01

    ... to that circular 48 CFR part 31. Contract Cost Principles and Procedures, or uniform cost accounting... Financial Administration § 1470.22 Allowable costs. (a) Limitation on use of funds. Grant funds may be used... grantee or subgrantee. (b) Applicable cost principles. For each kind of organization, there is a set...

  19. 24 CFR 85.22 - Allowable costs.

    Science.gov (United States)

    2010-04-01

    ... Circular A-122 as not subject to that circular 48 CFR part 31. Contract Cost Principles and Procedures, or uniform cost accounting standards that comply with cost principles acceptable to the Federal agency. ... TRIBAL GOVERNMENTS Post-Award Requirements Financial Administration § 85.22 Allowable costs....

  20. A note on Lysias 1.22

    OpenAIRE

    Edwards, Michael J.

    2005-01-01

    Solución de la notoria crux de Lys. 1.22, donde la mayoría de editores desde Reiske ha propuesto la existencia de una laguna. Propongo que la lectura preservada μεγλοις es una corrupción del original μν λλοις.

  1. 22 CFR 135.21 - Payment.

    Science.gov (United States)

    2010-04-01

    ... CFR part 205. (c) Advances. Grantees and subgrantees shall be paid in advance, provided they maintain... reimburse the grantee for its actual cash disbursements. The working capital advance method of payment shall... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Payment. 135.21 Section 135.21...

  2. 34 CFR 74.22 - Payment.

    Science.gov (United States)

    2010-07-01

    ... Management § 74.22 Payment. (a) Payment methods shall minimize the time elapsing between the transfer of... other means by the recipients. Payment methods of State agencies or instrumentalities shall be... check, and electronic funds transfer. (2) Advance payment mechanisms are subject to 31 CFR part 205....

  3. 32 CFR 32.22 - Payment.

    Science.gov (United States)

    2010-07-01

    ... ORGANIZATIONS Post-Award Requirements Financial and Program Management § 32.22 Payment. (a) Payment methods... issuance or redemption of checks, warrants, or payment by other means by the recipients. Payment methods of... CFR part 206), interest should be remitted to the HHS Payment Management System through an...

  4. 15 CFR 14.22 - Payment.

    Science.gov (United States)

    2010-01-01

    ... ORGANIZATIONS Post-Award Requirements Financial and Program Management § 14.22 Payment. (a) Payment methods... issuance or redemption of checks, warrants, or payment by other means by the recipients. Payment methods of... procedures codified at 31 CFR part 205. Federal payments to recipients shall be made by electronic...

  5. 45 CFR 2543.22 - Payment.

    Science.gov (United States)

    2010-10-01

    ... Requirements Financial and Program Management § 2543.22 Payment. (a) Payment methods shall minimize the time... checks, warrants, or payment by other means by the recipients. Payment methods of State agencies or... funds transfer. (2) Advance payment mechanisms are subject to 31 CFR part 205. (3) Recipients shall...

  6. 22 CFR 120.6 - Defense article.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Defense article. 120.6 Section 120.6 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS § 120.6 Defense article. Defense article means any item or technical data designated in § 121.1 of this...

  7. 22 CFR 219.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Communications. 219.160 Section 219.160 Foreign... DEVELOPMENT § 219.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants, participants, personnel of other Federal entities, and members of the public....

  8. 22 CFR 1103.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 1103.160 Section 1103.160 Foreign Relations INTERNATIONAL BOUNDARY AND WATER COMMISSION, UNITED STATES AND MEXICO, UNITED STATES... Communications. (a) The agency shall take appropriate steps to ensure effective communication with...

  9. 22 CFR 1701.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 1701.160 Section 1701.160 Foreign Relations UNITED STATES INSTITUTE OF PEACE ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF... Communications. (a) The agency shall take appropriate steps to ensure effective communication with...

  10. 22 CFR 530.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 530.160 Section 530.160 Foreign... PROGRAMS OR ACTIVITIES CONDUCTED BY THE BROADCASTING BOARD OF GOVERNORS § 530.160 Communications. (a) The Board shall take appropriate steps to ensure effective communication with applicants,...

  11. 22 CFR 711.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 711.160 Section 711.160 Foreign... CORPORATION § 711.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants, participants, personnel of other Federal entities, and members of the public....

  12. 22 CFR 1005.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 1005.160 Section 1005.160... PROGRAMS OR ACTIVITIES CONDUCTED BY THE INTER-AMERICAN FOUNDATION § 1005.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants, participants,...

  13. 22 CFR 1510.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 1510.160 Section 1510.160... IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE AFRICAN DEVELOPMENT FOUNDATION § 1510.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with...

  14. 22 CFR 144.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Communications. 144.160 Section 144.160 Foreign... PROGRAMS OR ACTIVITIES CONDUCTED BY THE UNITED STATES DEPARTMENT OF STATE § 144.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants,...

  15. 22 CFR 1600.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Communications. 1600.160 Section 1600.160 Foreign Relations JAPAN-UNITED STATES FRIENDSHIP COMMISSION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS... § 1600.160 Communications. (a) The agency shall take appropriate steps to ensure effective...

  16. 28 CFR 541.22 - Administrative detention.

    Science.gov (United States)

    2010-07-01

    ... INMATE DISCIPLINE AND SPECIAL HOUSING UNITS Inmate Discipline and Special Housing Units § 541.22... program may not be available outside of post-discipline detention, the Warden may approve an extension of... radio, provided that the radio is equipped with ear plugs. Exercise periods, at a minimum, will meet...

  17. 22 CFR 143.33 - Mediation.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Mediation. 143.33 Section 143.33 Foreign... Mediation. (a) Referral of complaints for mediation. The agency will refer to the Federal Mediation and... participate in the mediation process to the extent necessary to reach an agreement or make an...

  18. 22 CFR 218.33 - Mediation.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Mediation. 218.33 Section 218.33 Foreign... § 218.33 Mediation. (a) Referral of complaints for mediation. The agency will refer to the Federal Mediation and Conciliation Service all complaints that: (1) fall within the jurisdiction of...

  19. 22 CFR 231.14 - Arbitration.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Arbitration. 231.14 Section 231.14 Foreign... § 231.14 Arbitration. Any controversy or claim between USAID and any noteholder arising out of this Guarantee shall be settled by arbitration to be held in Washington, DC in accordance with the...

  20. 22 CFR 221.41 - Arbitration.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Arbitration. 221.41 Section 221.41 Foreign... Administration § 221.41 Arbitration. Any controversy or claim between A.I.D. and any noteholder arising out of this Guarantee shall be settled by arbitration to be held in Washington, DC in accordance with the...

  1. 22 CFR 230.14 - Arbitration.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Arbitration. 230.14 Section 230.14 Foreign... SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUB. L. 108-11-STANDARD TERMS AND CONDITIONS § 230.14 Arbitration. Any... arbitration to be held in Washington, DC in accordance with the then prevailing rules of the...

  2. 22 CFR 204.41 - Arbitration.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Arbitration. 204.41 Section 204.41 Foreign... § 204.41 Arbitration. Any controversy or claim between A.I.D. and the Lender or any Assignee arising out of this Guaranty shall be settled by arbitration to be held in Washington, DC in accordance with...

  3. 15 CFR 996.22 - Certification.

    Science.gov (United States)

    2010-01-01

    ... products; and conveys no automatic, direct or indirect NOAA endorsement of any product or service. (c... NOAA HYDROGRAPHIC PRODUCTS AND SERVICES Certification of a Hydrographic Product and Decertification. § 996.22 Certification. (a) A hydrographic product that has passed the compliance tests...

  4. 22 CFR 503.9 - Electronic records.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Electronic records. 503.9 Section 503.9 Foreign Relations BROADCASTING BOARD OF GOVERNORS FREEDOM OF INFORMATION ACT REGULATION § 503.9 Electronic records... the Government's use of computers enhances the public's access to Government information. This...

  5. 22 CFR 120.13 - United States.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false United States. 120.13 Section 120.13 Foreign... United States. United States, when used in the geographical sense, includes the several states, the Commonwealth of Puerto Rico, the insular possessions of the United States, the District of Columbia,...

  6. 22 CFR 171.6 - Archival records.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Archival records. 171.6 Section 171.6 Foreign Relations DEPARTMENT OF STATE ACCESS TO INFORMATION AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC General Policy and Procedures § 171.6 Archival records. The Department ordinarily transfers records to...

  7. 22 CFR 1101.9 - Exemptions.

    Science.gov (United States)

    2010-04-01

    ... established by an executive order to be kept secret in the interest of national defense or foreign policy, and... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Exemptions. 1101.9 Section 1101.9 Foreign Relations INTERNATIONAL BOUNDARY AND WATER COMMISSION, UNITED STATES AND MEXICO, UNITED STATES...

  8. 22 CFR 16.13 - Decisions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Decisions. 16.13 Section 16.13 Foreign Relations DEPARTMENT OF STATE PERSONNEL FOREIGN SERVICE GRIEVANCE SYSTEM § 16.13 Decisions. (a) Upon... proceedings. In each case the decision of the Board shall be in writing, shall include findings of fact,...

  9. 22 CFR 1003.10 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Reports. 1003.10 Section 1003.10 Foreign Relations INTER-AMERICAN FOUNDATION RULES SAFEGUARDING PERSONAL INFORMATION IN IAF RECORDS § 1003.10 Reports... or systems will be separately listed and reported to the Office of Management and Budget...

  10. 22 CFR 1507.13 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Reports. 1507.13 Section 1507.13 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION RULES SAFEGUARDING PERSONAL INFORMATION § 1507.13 Reports. (a) The... to establish or alter any system or records as defined herein. This report will be submitted...

  11. 22 CFR 1300.2 - Organization.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Organization. 1300.2 Section 1300.2 Foreign Relations MILLENNIUM CHALLENGE CORPORATION ORGANIZATION AND FUNCTIONS OF THE MILLENNIUM CHALLENGE CORPORATION § 1300.2 Organization. (a) MCC's Board consists of: (1) The Secretary of State, the Secretary...

  12. 22 CFR 96.31 - Corporate structure.

    Science.gov (United States)

    2010-04-01

    ... Approval Licensing and Corporate Governance § 96.31 Corporate structure. (a) The agency qualifies for... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Corporate structure. 96.31 Section 96.31 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES ACCREDITATION OF AGENCIES AND APPROVAL...

  13. 22 CFR 9.4 - Original classification.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Original classification. 9.4 Section 9.4... classification. (a) Definition. Original classification is the initial determination that certain information... classification. (b) Classification levels. (1) Top Secret shall be applied to information the...

  14. 49 CFR 218.22 - Utility employee.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF TRANSPORTATION RAILROAD OPERATING PRACTICES Blue Signal Protection of Workers § 218.22 Utility... uncouple air hoses and other electrical or mechanical connections; prepare rail cars for coupling; set... railroad rolling equipment must be provided with blue signal protection in accordance with §§...

  15. 22 CFR 192.51 - Death benefit.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Death benefit. 192.51 Section 192.51 Foreign... or Death § 192.51 Death benefit. (a) The Secretary of State or Agency Head may provide for payment, by the employing agency, of a death benefit to the surviving dependents of any eligible...

  16. 22 CFR 141.5 - Compliance information.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Compliance information. 141.5 Section 141.5... DEPARTMENT OF STATE-EFFECTUATION OF TITLE VI OF THE CIVIL RIGHTS ACT OF 1964 § 141.5 Compliance information... such information, as a responsible Departmental official or his designee may determine to be...

  17. 22 CFR 61.9 - General information.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false General information. 61.9 Section 61.9 Foreign Relations DEPARTMENT OF STATE PUBLIC DIPLOMACY AND EXCHANGES WORLD-WIDE FREE FLOW OF AUDIO-VISUAL MATERIALS § 61.9 General information. General information and application forms may be obtained by writing to...

  18. 22 CFR 171.13 - Business information.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Business information. 171.13 Section 171.13 Foreign Relations DEPARTMENT OF STATE ACCESS TO INFORMATION AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC Freedom of Information Act Provisions § 171.13 Business information. (a) Business...

  19. 22 CFR 126.13 - Required information.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Required information. 126.13 Section 126.13... PROVISIONS § 126.13 Required information. (a) All applications for licenses (DSP-5, DSP-61, DSP-73, and DSP... are multiple consignors, consignees or freight forwarders, and all the required information cannot...

  20. 22 CFR 209.6 - Compliance information.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Compliance information. 209.6 Section 209.6... § 209.6 Compliance information. (a) Cooperation and assistance. The Administrator shall to the fullest... and accurate compliance reports at such times, and in such form and containing such information,...

  1. 48 CFR 22.102-1 - Policy.

    Science.gov (United States)

    2010-10-01

    ... labor requirements such as— (a) Safety; (b) Health and sanitation; (c) Maximum hours and minimum wages; (d) Equal employment opportunity; (e) Child and convict labor; (f) Age discrimination; (g) Disabled... APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Basic Labor Policies 22.102-1 Policy. Agencies...

  2. 22 CFR 196.4 - Administering office.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Administering office. 196.4 Section 196.4 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.4 Administering office. The Department of...

  3. 22 CFR 512.28 - Assessment.

    Science.gov (United States)

    2010-04-01

    ... the Federal Claims Collection Standards (4 CFR part 103) relating to the compromise of claims or if... be suspended under § 104.2(c)(1) of the Federal Claims Collection Standards (4 CFR part 104). ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Assessment. 512.28 Section 512.28...

  4. 22 CFR 1508.920 - Civil judgment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Civil judgment. 1508.920 Section 1508.920...) Definitions § 1508.920 Civil judgment. Civil judgment means the disposition of a civil action by any court of... creates a civil liability for the complained of wrongful acts, or a final determination of liability...

  5. 22 CFR 208.920 - Civil judgment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Civil judgment. 208.920 Section 208.920 Foreign...) Definitions § 208.920 Civil judgment. Civil judgment means the disposition of a civil action by any court of... creates a civil liability for the complained of wrongful acts, or a final determination of liability...

  6. 22 CFR 1006.920 - Civil judgment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Civil judgment. 1006.920 Section 1006.920...) Definitions § 1006.920 Civil judgment. Civil judgment means the disposition of a civil action by any court of... creates a civil liability for the complained of wrongful acts, or a final determination of liability...

  7. 48 CFR 22.1502 - Policy.

    Science.gov (United States)

    2010-10-01

    ... APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Prohibition of Acquisition of Products Produced by Forced or Indentured Child Labor 22.1502 Policy. Agencies must take appropriate action to enforce the laws... or in part by forced or indentured child labor (19 U.S.C. 1307, 29 U.S.C. 201, et seq., and 41...

  8. 48 CFR 22.1501 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... Produced by Forced or Indentured Child Labor 22.1501 Definitions. As used in this subpart— Forced or indentured child labor means all work or service— (1) Exacted from any person under the age of 18 under the... Forced or Indentured Child Labor means the list published by the Department of Labor in accordance...

  9. 22 CFR 146.540 - Advertising.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment...

  10. 22 CFR 229.540 - Advertising.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 229.540 Section 229.540 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in...

  11. 22 CFR 231.16 - Governing law.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Governing law. 231.16 Section 231.16 Foreign... EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11-STANDARD TERMS AND CONDITIONS § 231.16 Governing law. This Guarantee shall be governed by and construed in accordance with the laws...

  12. 22 CFR 204.43 - Governing law.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Governing law. 204.43 Section 204.43 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT HOUSING GUARANTY STANDARD TERMS AND CONDITIONS Administration § 204.43 Governing law. This Guaranty shall be governed by and construed in accordance with the laws...

  13. 22 CFR 221.43 - Governing law.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Governing law. 221.43 Section 221.43 Foreign... Administration § 221.43 Governing law. This Guarantee shall be governed by and construed in accordance with the laws of the United States of America governing contracts and commercial transactions of the...

  14. 22 CFR 230.16 - Governing law.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Governing law. 230.16 Section 230.16 Foreign... SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUB. L. 108-11-STANDARD TERMS AND CONDITIONS § 230.16 Governing law. This Guarantee shall be governed by and construed in accordance with the laws of the United States...

  15. 22 CFR 224.34 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Evidence. 224.34 Section 224.34 Foreign....34 Evidence. (a) The ALJ shall determine the admissibility of evidence. (b) Except as provided in this part, the ALJ shall not be bound by the Federal Rules of Evidence. However, the ALJ may apply...

  16. 22 CFR 18.16 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Evidence. 18.16 Section 18.16 Foreign Relations... Enforcement Proceedings § 18.16 Evidence. The rules of evidence prevailing in courts of law and equity are not controlling in hearings under this part. However, the hearing examiner shall exclude evidence which...

  17. 22 CFR 35.34 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Evidence. 35.34 Section 35.34 Foreign Relations DEPARTMENT OF STATE CLAIMS AND STOLEN PROPERTY PROGRAM FRAUD CIVIL REMEDIES § 35.34 Evidence. (a) The ALJ shall determine the admissibility of evidence. (b) Except as provided herein, the ALJ shall not be...

  18. Deletion 22q13.3 syndrome

    Directory of Open Access Journals (Sweden)

    Phelan Mary C

    2008-05-01

    Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements

  19. Deep Soil: Quantifying and Modeling Subsurface Carbon

    Science.gov (United States)

    James, J. N.; Devine, W.; Harrison, R. B.

    2014-12-01

    Some soil carbon datasets that are spatially rich, such as the USDA Forest Service Inventory and Analysis National Program dataset, sample soil to only 20 cm (8 inches), despite evidence that substantial stores of soil C can be found deeper in the soil profile. The maximum extent of tree rooting is typically many meters deep and provides: direct exchange with the soil solution; redistribution of water from deep horizons toward the surface during times of drought; resources for active microbial communities in deep soil around root channels; and direct carbon inputs through exudates and root turnover. This study examined soil carbon to a depth of 2.5 meters across 22 soils in Pacific Northwest Douglas-fir forests. Excavations at 20 additional sites took place in summer 2014, greatly expanding the spatial coverage and extent of the data set. Forest floor and mineral soil bulk density samples were collected at depths of 0.1, 0.5, 1.0, 1.5, 2.0 and 2.5 meters. Pool estimates from systematic sampling depths shallower than 1.5 m yielded significantly smaller estimates than the total soil stock to 2.5 meters (PAndisols with non-crystalline minerals, which can adsorb large quantities of carbon on mineral surfaces and preserve it from decomposition. An accurate spatial dataset of soil depth to bedrock would be extremely useful to constrain models of the vertical distribution of soil carbon. Efforts to represent carbon in spatial models would benefit from considering the vertical distribution of carbon in soil. Sampling deep soil will avoid biased estimates of soil carbon and create a more complete picture of soil pools and changes over time.

  20. Chrysotile dissolution rates: Implications for carbon sequestration

    International Nuclear Information System (INIS)

    Highlights: • Uncertainties in serpentine dissolution kinetics hinder carbon sequestration models. • A pH dependent, far from equilibrium dissolution rate law for chrysotile. • Fchrysotile (mol/m2/s) = 10−0.21pH−10.57 at 22 °C over pH 2–10. • Laboratory dissolution rates consistent with mine waste weathering observations. • Potential for carbon sequestration in mine tailings and aquifers is assessed. - Abstract: Serpentine minerals (e.g., chrysotile) are a potentially important medium for sequestration of CO2 via carbonation reactions. The goals of this study are to report a steady-state, far from equilibrium chrysotile dissolution rate law and to better define what role serpentine dissolution kinetics will have in constraining rates of carbon sequestration via serpentine carbonation. The steady-state dissolution rate of chrysotile in 0.1 m NaCl solutions was measured at 22 °C and pH ranging from 2 to 8. Dissolution experiments were performed in a continuously stirred flow-through reactor with the input solutions pre-equilibrated with atmospheric CO2. Both Mg and Si steady-state fluxes from the chrysotile surface, and the overall chrysotile flux were regressed and the following empirical relationships were obtained: FMg=-0.22pH-10.02;FSi=-0.19pH-10.37;Fchrysotile=-0.21pH-10.57 where FMg, FSi, and Fchrysotile are the log10 Mg, Si, and molar chrysotile fluxes in mol/m2/s, respectively. Element fluxes were used in reaction-path calculations to constrain the rate of CO2 sequestration in two geological environments that have been proposed as potential sinks for anthropogenic CO2. Carbon sequestration in chrysotile tailings at 10 °C is approximately an order of magnitude faster than carbon sequestration in a serpentinite-hosted aquifer at 60 °C on a per kilogram of water basis. A serpentinite-hosted aquifer, however, provides a larger sequestration capacity. The chrysotile dissolution rate law determined in this study has important implications for

  1. New binary R 22-alternative: SUVA 9100; Neue binaere R 22-Alternative: SUVA 9100

    Energy Technology Data Exchange (ETDEWEB)

    Gerstel, J. [Du-Pont de Nemours (Deutschland) GmbH, Bad Homburg v.d.H. (Germany); Zakrzewski, U. [Du-Pont de Nemours (Deutschland) GmbH, Bad Homburg v.d.H. (Germany)

    1995-07-01

    The environmental impact, the safety (e.g. non-flammability) and better efficiencies are the main criteria in development of new alternative refrigerants. R22 can not be replaced in all areas by one single new product. The four refrigerant SUVA 9100 (registered as R410B), R 134a, R 407 c and R 404A will have a major sole in the replacement of R22. (orig.) [Deutsch] R22 wird gegenwaertig in der Klimatisierung, der Gewerbe- und Transportkaelte, in Kaltwassersaetzen und in Waermepumpen eingesetzt. Als Ersatz fuer R22 fuer diese Anwendungen wurden HFKW`s untersucht. Bei den von Anlagenherstellern durchgefuehrten Untersuchungen entstanden unterschiedliche Anforderungen an die zukuenftige Alternative. Einige Hersteller benoetigen bereits jetzt einen Ersatzstoff. Andere erwarten ein Kaeltemittel, das in vorhandenen Anlagen eingesetzt werden kann. Eine weitere Gruppe moechte gern einen neuen Ersatzstoff mit hoeherer Kaelte- bzw. Waermeleistung und hoeherer Leistungszahl im Vergleich zu R22. Aufgrund der deutlich unterschiedlichen Anforderungen kann es nicht nur eine Ersatzloesung geben. Um dieser Markterwartung zu entsprechen, entwickelte DuPont eine Familie von R22-Alternativen. Die darin enthaltenen Produkte sind: SUVA 9100, SUVA 134a, SUVA 9000 und SUVA HP 62. Im folgenden werden die vier Ersatzkaeltemittel fuer R22 kurz vorgestellt. Danach wird dargelegt, wie die verschiedenen Zusammensetzungen fuer SUVA 9100 untersucht wurden (Leistungs- und Entflammbarkeitsmessungen) und welche Zusammensetzung letztendlich ausgewaehlt wurde. (orig.)

  2. Novel carborane based inhibitors of carbonic anhydrase IX

    Czech Academy of Sciences Publication Activity Database

    Štěpánková, J.; Řezáčová, Pavlína; Brynda, Jiří; Harvanová, M.; Mašek, V.; Nová, A.; Siller, M.; Das, V.; Doležal, D.; Grüner, Bohumír; Šícha, Václav; Konečný, P.; Znojek, P.; Džubák, P.; Hajdúch, M.

    2015-01-01

    Roč. 75, 15 Suppl (2015), s. 4492. ISSN 0008-5472. [Annual Meeting of the American Association for Cancer Research (AACR) /106./. 18.04.2015-22.04.2015, Philadelphia] Institutional support: RVO:61388963 ; RVO:61388980 Keywords : carbonic anhydrase * carborane based inhibitors Subject RIV: CE - Biochemistry

  3. A contribution to the study of excited states of Neon 22 and Sodium 22

    International Nuclear Information System (INIS)

    The experimental study of 22Ne has been performed. A differentially pump gas target has been used, in conjunction with E+ΔE detectors. Angular distribution measurements have been performed on the 21Ne(d,p)22Ne reaction in the Esub(d) energy range from 3 to 3.6MeV. Angular momentum has been identified and spectroscopic factors extracted for 18 levels by comparison with DWBA predictions. Spin and parities of some excited levels were deduced. The study of the 21Ne(t,d)22Ne reaction corroborates the results concerning the first excited state (2+). Experimental results are compared with the predictions of the unified rotational model and of the shell-model. The 20Ne(t,p)22Ne reaction was studied at 3MeV and 3.4MeV bombarding energies. The total cross-section of most groups was analyzed in terms of Hauser-Feshbach theory and several final-state spin predictions are made. The angular distribution of the 20Ne(t,p)22Ne (Esub(x)=6.24MeV) reaction was analyzed by double stripping DWBA theory and indicates 0+ for this state, the isobaric analog of which has been identified at 6.83MeV in 22Na. Furthermore, several new isobaric analog pairs in 22Na and 22Ne are identified via the study of excitation functions for the reactions 21Ne(p,p)21Ne and 21Ne(p,p')21Ne for Esub(p)=0.6-2MeV. Implications of the present results with regard to the identification of band structure in 22Na are discussed

  4. Complexity of carbon market from multi-scale entropy analysis

    Science.gov (United States)

    Fan, Xinghua; Li, Shasha; Tian, Lixin

    2016-06-01

    Complexity of carbon market is the consequence of economic dynamics and extreme social political events in global carbon markets. The multi-scale entropy can measure the long-term structures in the daily price return time series. By using multi-scale entropy analysis, we explore the complexity of carbon market and mean reversion trend of daily price return. The logarithmic difference of data Dec16 from August 6, 2010 to May 22, 2015 is selected as the sample. The entropy is higher in small time scale, while lower in large. The dependence of the entropy on the time scale reveals the mean reversion of carbon prices return in the long run. A relatively great fluctuation over some short time period indicates that the complexity of carbon market evolves consistently with economic development track and the events of international climate conferences.

  5. Carbon nanotube cathode with capping carbon nanosheet

    Science.gov (United States)

    Li, Xin; Zhao, Dengchao; Pang, Kaige; Pang, Junchao; Liu, Weihua; Liu, Hongzhong; Wang, Xiaoli

    2013-10-01

    Here, we report a vertically aligned carbon nanotube (VACNT) film capped with a few layer of carbon nanosheet (FLCN) synthesized by chemical vapor deposition using a carbon source from iron phthalocyanine pyrolysis. The square resistance of the VACNT film is significantly reduced from 1500 Ω/□ to 300 Ω/□ when it is capped with carbon nanosheet. The VACNT capped with carbon nanosheet was transferred to an ITO glass substrate in an inverted configuration so that the carbon nanosheet served as a flexible transparent electrode at the bottom and the VACNT roots served as emission tips. Because all of the VACNTs start growing from a flat silicon substrate, the VACNT roots are very neat and uniform in height. A field emission test of the carbon nanosheet-capped VACNT film proved that the CNT roots show better uniformity in field emission and the carbon nanosheet cap could also potentially serve as a flexible transparent electrode, which is highly desired in photo-assisted field emission.

  6. Exon: CBRC-TNIG-22-0208 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0208 gcggtgcgagcggagggtggaggcggtgccgcgcggagggtggaggcggggccgggcggaggctggaggcggtgccgggcggagggtgg...aggcggggccgggcggaggctggaggcggtgccgggcggagggtggaggcggggccggggggaggctggaggcggggccgggcggaggctggaggcggtgccgggcggaggctggaggcggggccgggcggaggctggag ...

  7. Exon: CBRC-TNIG-22-0176 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0176 tgggttctggtgggtctggtgggtctagtggttctgatggttctggtggttctggtgggtctggtgggtctagtggttctggtggg...tctggtgggtctagtggttctggtgggtctggtgggtctagtggttttggtggttctggtgggtctggtgggtctagtggttctggtgggtctggtggttctggtgg...ttctggtggttctggtgggtctggtggttctggtgggtctggtgggtctggtgggtctggtgggtctagtgggtctggtggttctggtgggtctggtgggtctggtggttctg ...

  8. Trading forest carbon - OSU

    Science.gov (United States)

    Issues associate with trading carbon sequestered in forests are discussed. Scientific uncertainties associated with carbon measurement are discussed with respect to proposed accounting procedures. Major issues include: (1) Establishing baselines. (2) Determining additivity from f...

  9. Potassium carbonate poisoning

    Science.gov (United States)

    Potassium carbonate is a white powder used to make soap, glass, and other items. This article discusses poisoning from swallowing or breathing in potassium carbonate. This article is for information only. Do ...

  10. Sodium carbonate poisoning

    Science.gov (United States)

    Sodium carbonate (known as washing soda or soda ash) is a chemical found in many household and ... products. This article focuses on poisoning due to sodium carbonate. This article is for information only. Do ...

  11. Biomass Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Biomass carbon includes carbon stored in above- and below-ground live plant components (such as leaf, branch, stem and root) as well as in standing and down dead...

  12. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Home / Safety Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known as CO, is called the "Invisible ...

  13. Carbon Monoxide Safety

    Science.gov (United States)

    ... with the Media Fire Protection Technology Carbon monoxide safety outreach materials Help inform residents in your community ... KB | Spanish PDF 645 KB Handout: carbon monoxide safety Download this handout and add your organization's logo ...

  14. Soil Organic Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Soil organic carbon (SOC) is the carbon held within soil organic constituents (i.e., products produced as dead plants and animals decompose and the soil microbial...

  15. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known ... Install one and check its batteries regularly. View Information About CO Alarms Other CO Topics Safety Tips ...

  16. Calcium carbonate overdose

    Science.gov (United States)

    Tums overdose; Calcium overdose ... Calcium carbonate can be dangerous in large amounts. ... Some products that contain calcium carbonate are certain: ... and mineral supplements Other products may also contain calcium ...

  17. Carbon nanotube nanoelectrode arrays

    Science.gov (United States)

    Ren, Zhifeng; Lin, Yuehe; Yantasee, Wassana; Liu, Guodong; Lu, Fang; Tu, Yi

    2008-11-18

    The present invention relates to microelectode arrays (MEAs), and more particularly to carbon nanotube nanoelectrode arrays (CNT-NEAs) for chemical and biological sensing, and methods of use. A nanoelectrode array includes a carbon nanotube material comprising an array of substantially linear carbon nanotubes each having a proximal end and a distal end, the proximal end of the carbon nanotubes are attached to a catalyst substrate material so as to form the array with a pre-determined site density, wherein the carbon nanotubes are aligned with respect to one another within the array; an electrically insulating layer on the surface of the carbon nanotube material, whereby the distal end of the carbon nanotubes extend beyond the electrically insulating layer; a second adhesive electrically insulating layer on the surface of the electrically insulating layer, whereby the distal end of the carbon nanotubes extend beyond the second adhesive electrically insulating layer; and a metal wire attached to the catalyst substrate material.

  18. Transformation of acetate carbon into carbohydrate and amino acid metabilites during decomposition in soil

    DEFF Research Database (Denmark)

    Sørensen, Lasse Holst; Paul, E. A.

    1971-01-01

    Carbon-14-labelled acetate was added to a heavy clay soil of pH 7.6 to study the transformation of acetate carbon into carbohydrate and amino acid metabolites during decomposition. The acetate was totally metabolized after 6 days of incubation at 25°C when 70% of the labelled carbon had been...... evolved as CO2. Maximum incorporation of trace-C into the various organic fractions was observed after 4 days when 19% of residual, labelled carbon in the soil was located in carbohydrates, 29 % in amino acids and 21 % in the insoluble residue of the soil. The curves showing the amounts of labelled carbon...... days of incubation, 2.2% of the labelled carbon originally added to the soil was located in carbohydrate metabolites, 7% in amino acid metabolites and 5% in the insoluble residue. The carbon in these fractions accounted for 77% of the total, residual, labelled carbon in the soil; 12% in carbohydrates...

  19. Benchmark values for forest soil carbon stocks in Europe

    DEFF Research Database (Denmark)

    De Vos, Bruno; Cools, Nathalie; Ilvesniemi, Hannu;

    2015-01-01

    Soil organic carbon (SOC) stocks in forest floors and in mineral and peat forest soils were estimated at the European scale. The assessment was based on measured C concentration, bulk density, coarse fragments and effective soil depth data originating from 4914 plots in 22 EU countries belonging to...... the UN/ECE ICP Forests 16 × 16 km Level I network. Plots were sampled and analysed according to harmonized methods during the 2nd European Forest Soil Condition Survey. Using continuous carbon density depth functions, we estimated SOC stocks to 30-cm and 1-m depth, and stratified these stocks...... according to 22 WRB Reference Soil Groups (RSGs) and 8 humus forms to provide European scale benchmark values. Average SOC stocks amounted to 22.1 t C ha− 1 in forest floors, 108 t C ha− 1 in mineral soils and 578 t C ha− 1 in peat soils, to 1 m depth. Relative to 1-m stocks, the vertical SOC distribution...

  20. Metal filled porous carbon

    Science.gov (United States)

    Gross, Adam F.; Vajo, John J.; Cumberland, Robert W.; Liu, Ping; Salguero, Tina T.

    2011-03-22

    A porous carbon scaffold with a surface and pores, the porous carbon scaffold containing a primary metal and a secondary metal, where the primary metal is a metal that does not wet the surface of the pores of the carbon scaffold but wets the surface of the secondary metal, and the secondary metal is interspersed between the surface of the pores of the carbon scaffold and the primary metal.

  1. Mass measurements and evaluation around A=22

    International Nuclear Information System (INIS)

    Frequency ratio measurements with different combinations of the singly charged ions from 21,22,23Na, 22,24Mg, and 37,39K were performed at the on-line Penning trap mass spectrometer ISOLTRAP, CERN, Geneva. The masses and mass differences were deduced with a relative uncertainty of about or even below one part in 108 for the ions of interest using a least-squares analysis of all measured relations. The results have direct consequences for weak-interaction study as they give additional input to the test of CVC, and for nuclear astrophysics, because they help to establish the minimum observable signal for a NeNa cycle in a nova burst. We report here about the measurements and the detailed evaluation. (orig.)

  2. Bisphenol A removal from water by activated carbon. Effects of carbon characteristics and solution chemistry.

    Science.gov (United States)

    Bautista-Toledo, I; Ferro-García, M A; Rivera-Utrilla, J; Moreno-Castilla, C; Vegas Fernández, F J

    2005-08-15

    The present study aimed to analyze the behavior of different activated carbons in the adsorption and removal of bisphenol A (2-2-bis-4-hydroxypheniyl propane) from aqueous solutions in order to identify the parameters that determine this process. Two commercial activated carbons and one prepared in our laboratory from almond shells were used; they were texturally and chemically characterized, obtaining the surface area, pore size distribution, mineral matter content, elemental analysis, oxygen surface groups, and pH of the point of zero charge (pH(PZC)), among other parameters. Adsorption isotherms of bisphenol A and adsorption capacities were obtained. The capacity of the carbons to remove bisphenol A was related to their characteristics. Thus, the adsorption of bisphenol A on activated carbon fundamentally depends on the chemical nature of the carbon surface and the pH of the solution. The most favorable experimental conditions for this process are those in which the net charge density of the carbon is zero and the bisphenol A is in molecular form. Under these conditions, the adsorbent-adsorbate interactions that govern the adsorption mechanism are enhanced. Influences of the mineral matter present in the carbon samples and the solution chemistry (pH and ionic strength) were also analyzed. The presence of mineral matter in carbons reduces their adsorption capacity because of the hydrophilic nature of the matter. The presence of electrolytes in the solution favor the adsorption process because of the screening effect produced between the positively charged carbon surface and the bisphenol A molecules, with a resulting increase in adsorbent-adsorbate interactions. PMID:16173588

  3. 22 CFR 192.52 - Disability benefits.

    Science.gov (United States)

    2010-04-01

    .... 8107 and 20 CFR 10.304. The Director General of the Foreign Service of State or the Agency Head, may at... members of the body specified in 5 U.S.C. 8107 and in 20 CFR 10.304. The provisions of 20 CFR part 10... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Disability benefits. 192.52 Section...

  4. Intrauterine Device Removal after 22 Years

    Directory of Open Access Journals (Sweden)

    Tahereh Boryri

    2014-01-01

    Full Text Available IUD T380A is one of the most effective, reversible, long term methods of contraception all over the world based on the experience of World Health Organization and our own observation of women who continued to use the IUD beyond 10 years or even longer years. In this article one case of Intrauterine device removal after 22 years is reported without complications and pregnancy.

  5. 9q22 Deletion - First Familial Case

    Directory of Open Access Journals (Sweden)

    Yamamoto Toshiyuki

    2011-06-01

    Full Text Available Abstract Background Only 29 cases of constitutional 9q22 deletions have been published and all have been sporadic. Most associate with Gorlin syndrome or nevoid basal cell carcinoma syndrome (NBCCS, MIM #109400 due to haploinsufficiency of the PTCH1 gene (MIM *601309. Methods and Results We report two mentally retarded female siblings and their cognitively normal father, all carrying a similar 5.3 Mb microdeletion at 9q22.2q22.32, detected by array CGH (244 K. The deletion does not involve the PTCH1 gene, but instead 30 other gene,s including the ROR2 gene (MIM *602337 which causing both brachydactyly type 1 (MIM #113000 and Robinow syndrome (MIM #268310, and the immunologically active SYK gene (MIM *600085. The deletion in the father was de novo and FISH analysis of blood lymphocytes did not suggest mosaicism. All three patients share similar mild dysmorphic features with downslanting palpebral fissures, narrow, high bridged nose with small nares, long, deeply grooved philtrum, ears with broad helix and uplifted lobuli, and small toenails. All have significant dysarthria and suffer from continuous middle ear and upper respiratory infections. The father also has a funnel chest and unilateral hypoplastic kidney but the daughters have no malformations. Conclusions This is the first report of a familial constitutional 9q22 deletion and the first deletion studied by array-CGH which does not involve the PTCH1 gene. The phenotype and penetrance are variable and the deletion found in the cognitively normal normal father poses a challenge in genetic counseling.

  6. Protolytic carbon film technology

    Energy Technology Data Exchange (ETDEWEB)

    Renschler, C.L.; White, C.A.

    1996-04-01

    This paper presents a technique for the deposition of polyacrylonitrile (PAN) on virtually any surface allowing carbon film formation with only the caveat that the substrate must withstand carbonization temperatures of at least 600 degrees centigrade. The influence of processing conditions upon the structure and properties of the carbonized film is discussed. Electrical conductivity, microstructure, and morphology control are also described.

  7. Carbon Goes To…

    Science.gov (United States)

    Savasci, Funda

    2014-01-01

    The purposes of this activity are to help middle school students understand the carbon cycle and realize how human activities affect the carbon cycle. This activity consists of two parts. The first part of the activity focuses on the carbon cycle, especially before the Industrial Revolution, while the second part of the activity focuses on how…

  8. Carbon/Carbon Pistons for Internal Combustion Engines

    Science.gov (United States)

    Taylor, A. H.

    1986-01-01

    Carbon/carbon piston performs same function as aluminum pistons in reciprocating internal combustion engines while reducing weight and increasing mechanical and thermal efficiencies of engine. Carbon/carbon piston concept features low piston-to-cylinder wall clearance - so low piston rings and skirts unnecessary. Advantages possible by negligible coefficient of thermal expansion of carbon/carbon.

  9. DUMB22@. Distribució urbana de mercaderies en bicicleta al 22@

    OpenAIRE

    Sanclimens Hoja, Elisenda

    2012-01-01

    [ANGLÈS] In 2000, Barcelona undertook the remodeling of an entire district, reconsidered its functions and, without altering the urban net by Cerdà, designed a compact model in which dwelling, industry and services could stand together properly. This place was named 22@. The companies, which have settled in the area since then, have in common the commodities they work with: knowledge and innovation. In this work the viability of an Urban Delivery of Goods by Bicycle in 22@ is anal...

  10. Temporal dynamics and sPatial variations of forest vegetation carbon stock in Liaoning Province, China

    Institute of Scientific and Technical Information of China (English)

    LI Qing; TANG Li-Na; REN Yin

    2011-01-01

    There are many uncertainties in the estimation of forest carbon sequestration in China,especially in Liaoning Province where various forest inventory data have not been fully utilized.By using forest inventory data,we estimated forest vegetation carbon stock of Liaoning Province between 1993 and 2005.Results showed that forest biomass carbon stock increased from 68.91 Tg C in 1993 to 97.51 Tg C in 2005,whereas mean carbon density increased from 18.48 Mg.ha-1 C to 22.33 Mg·ha-1 C.The carbon storage of young- and middle-aged forests increased by 22.1 Tg C and 5.95 Tg C,but that of mature forests has decreased by 0.25 Tg C.The carbon stock and density of forests in Liaoning Province varied greatly in space:larger carbon storage and higher carbon density were primarily found in the east area.The spatial distribution of carbon density was determined by many factors,of which human activities played an important role.The forests in Liauning Province played a positive role as a sink of atmospheric carbon dioxide.The carbun fixation ability of forests in this area was primarily derived from forest plantation and the total forest carbon sequestration can be enhanced by expanding young- and middle-aged forests.

  11. A synthesis of carbon in international trade

    Directory of Open Access Journals (Sweden)

    G. P. Peters

    2012-08-01

    Full Text Available In a globalised world, the transfer of carbon between regions, either physically or embodied in production, represents a substantial fraction of global carbon emissions. The resulting emission transfers are important for balancing regional carbon budgets and for understanding the drivers of emissions. In this paper we synthesise current understanding in two parts: (1 CO2 emissions embodied in goods and services that are produced in one country but consumed in others, and (2 carbon physically present in fossil fuels, petroleum-derived products, harvested wood products, crops, and livestock products. We describe the key differences between studies and provide a consistent set of estimates using the same definitions, modelling framework, and consistent data. We find the largest trade flows of carbon in international trade in 2004 were fossil fuels (2673 MtC, 37 % of global emissions, CO2 embodied in traded goods and services (1661 MtC, 22 % of global emissions, crops (522 MtC, 31 % of total harvested crop carbon, petroleum-based products (183 MtC, 50 % of their total production, harvested wood products (149 MtC, 40 % of total roundwood extraction, and livestock products (28 MtC, 22 % of total livestock carbon. We find that for embodied CO2 emissions, estimates from independent studies are robust, and that differences between individual studies are not a reflection of the uncertainty in consumption-based estimates, but rather these differences result from the use of different production-based emissions input data and different definitions for allocating emissions to international trade. After adjusting for these issues, results across independent studies converge to give less uncertainty than previously assumed. For physical carbon flows there are relatively few studies to be synthesised, but differences between existing studies are due to the method of allocating to international trade, with some studies using

  12. A synthesis of carbon in international trade

    Science.gov (United States)

    Peters, G. P.; Davis, S. J.; Andrew, R.

    2012-08-01

    In a globalised world, the transfer of carbon between regions, either physically or embodied in production, represents a substantial fraction of global carbon emissions. The resulting emission transfers are important for balancing regional carbon budgets and for understanding the drivers of emissions. In this paper we synthesise current understanding in two parts: (1) CO2 emissions embodied in goods and services that are produced in one country but consumed in others, and (2) carbon physically present in fossil fuels, petroleum-derived products, harvested wood products, crops, and livestock products. We describe the key differences between studies and provide a consistent set of estimates using the same definitions, modelling framework, and consistent data. We find the largest trade flows of carbon in international trade in 2004 were fossil fuels (2673 MtC, 37 % of global emissions), CO2 embodied in traded goods and services (1661 MtC, 22 % of global emissions), crops (522 MtC, 31 % of total harvested crop carbon), petroleum-based products (183 MtC, 50 % of their total production), harvested wood products (149 MtC, 40 % of total roundwood extraction), and livestock products (28 MtC, 22 % of total livestock carbon). We find that for embodied CO2 emissions, estimates from independent studies are robust, and that differences between individual studies are not a reflection of the uncertainty in consumption-based estimates, but rather these differences result from the use of different production-based emissions input data and different definitions for allocating emissions to international trade. After adjusting for these issues, results across independent studies converge to give less uncertainty than previously assumed. For physical carbon flows there are relatively few studies to be synthesised, but differences between existing studies are due to the method of allocating to international trade, with some studies using "apparent consumption" as opposed to "final

  13. Determination of Key Metabolites during Biodegradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine with Rhodococcus sp. Strain DN22

    OpenAIRE

    Fournier, Diane; Halasz, Annamaria; Spain, Jim; Fiurasek, Petr; Hawari, Jalal

    2002-01-01

    Rhodococcus sp. strain DN22 can convert hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) to nitrite, but information on degradation products or the fate of carbon is not known. The present study describes aerobic biodegradation of RDX (175 μM) when used as an N source for strain DN22. RDX was converted to nitrite (NO2−) (30%), nitrous oxide (N2O) (3.2%), ammonia (10%), and formaldehyde (HCHO) (27%), which later converted to carbon dioxide. In experiments with ring-labeled [15N]-RDX, gas chromato...

  14. 从炭材料到低碳社会——2012世界炭会议介绍%How will carbon material lead to a low carbon society——A review of Carbon 2012

    Institute of Scientific and Technical Information of China (English)

    刘旭光

    2012-01-01

    A review is given of the Annual World Conference on Carbon, which was held on June 17-22, 2012 in Krakow, Poland and organized by the Polish Carbon Society. In this conference, 5 plenary lectures, 30 keynote lectures, 220 oral presentations and 465 posters were divided into 10 topics, i. e. , carbons for energy storage ; carbons for health and environmental protection; precursors, processing and technology; carbon nanomate-rials; porous carbons; carbon-based composites; graphene; new methods for carbon characterization; computation and modeling; and industrial news. Besides traditional modification on surface area and porosity, doping with hetero atoms such as N, B and P or compositing with metals or metal oxides have been developed into effective means for modifying carbon materials for improved adsorption, catalysis and energy-storage performance. The applications of novel carbon structures like nanotubes are still limited by the controllable and scalable preparation, processability and reactivity. Research on the structure and properties of graphene is moving from curiosity-oriented to application-oriented. Mathematical formulation or modeling of pore structures has been promoted by the progress in characterization methods. The modification of the surface/interface in carbon materials, which plays important roles in determining their physical, chemical or mechanical properties is still a focus of research activity in carbon materials.

  15. Methodological comparison for quantitative analysis of fossil and recently derived carbon in mine soils with high content of aliphatic kerogen

    Czech Academy of Sciences Publication Activity Database

    Vindušková, O.; Sebag, D.; Cailleau, G.; Brus, Jiří; Frouz, J.

    89-90, December (2015), s. 14-22. ISSN 0146-6380 Institutional support: RVO:61389013 Keywords : kerogen * geogenic carbon * soil organic matter Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.072, year: 2014

  16. Multi-scale geospatial agroecosystem modeling: A case study on the influence of soil data resolution on carbon budget estimates

    Science.gov (United States)

    The development of effective measures to stabilize atmospheric 22 CO2 concentration and mitigate negative impacts of climate change requires accurate quantification of the spatial variation and magnitude of the terrestrial carbon (C) flux. However, the spatial pattern and strengt...

  17. Activated carbons and gold

    International Nuclear Information System (INIS)

    The literature on activated carbon is reviewed so as to provide a general background with respect to the effect of source material and activation procedure on carbon properties, the structure and chemical nature of the surface of the activated carbon, and the nature of absorption processes on carbon. The various theories on the absorption of gold and silver from cyanide solutions are then reviewed, followed by a discussion of processes for the recovery of gold and silver from cyanide solutions using activated carbon, including a comparison with zinc precipitation

  18. Carbon-14 waste management

    International Nuclear Information System (INIS)

    Carbon-14 occurs in nature, but is also formed in nuclear reactors. Because of its long half-life and the biological significance of carbon, releases from nuclear facilities could have a significant radiological impact. Waste management strategies for carbon-14 are therefore of current concern. Carbon-14 is present in a variety of waste streams both at reactors and at reprocessing plants. A reliable picture of the production and release of carbon-14 from various reactor systems has been built up for the purposes of this study. A possible management strategy for carbon-14 might be the reduction of nitrogen impurity levels in core materials, since the activation of 14N is usually the dominant source of carbon-14. The key problem in carbon-14 management is its retention of off-gas streams, particularly in the dissolver off-gas stream at reprocessing plants. Three alternative trapping processes that convert carbon dioxide into insoluble carbonates have been suggested. The results show that none of the options considered need be rejected on the grounds of potential radiation doses to individuals. All exposures should be as low as reasonably achievable, economic and social factors being taken into account. If, on these grounds, retention and disposal of carbon-14 is found to be beneficial, then, subject to the limitations noted, appropriate retention, immobilization and disposal technologies have been identified

  19. Localized Corrosion of Alloy 22 -Fabrication Effects-

    Energy Technology Data Exchange (ETDEWEB)

    Rebak, R B

    2005-11-05

    This report deals with the impact of fabrication processes on the localized corrosion behavior of Alloy 22 (N06022). The four fabrication processes that were analyzed are: (1) Surface stress mitigation of final closure weld, (2) Manufacturing of the mockup container, (3) Black annealing of the container and (4) Use of different heats of Alloy 22 for container fabrication. Immersion and Electrochemical tests performed in the laboratory are generally aggressive and do not represent actual repository environments in Yucca Mountain. For example, to determine the intergranular attack in the heat affected zone of a weldment, tests are conducted in boiling acidic and oxidizing solutions according to ASTM standards. These solutions are used to compare the behavior of differently treated metallic coupons. Similarly for electrochemical tests many times pure sodium chloride or calcium chloride solutions are used. Pure chloride solutions are not representative of the repository environment. (1) Surface Stress Mitigation: When metallic plates are welded, for example using the Gas Tungsten Arc Welding (GTAW) method, residual tensile stresses may develop in the vicinity of the weld seam. Processes such as Low Plasticity Burnishing (LPB) and Laser Shock Peening (LSP) could be applied locally to eliminate the residual stresses produced by welding. In this study, Alloy 22 plates were welded and then the above-mentioned surface treatments were applied to eliminate the residual tensile stresses. The aim of the current study was to comparatively test the corrosion behavior of as-welded (ASW) plates with the corrosion behavior of plates with stress mitigated surfaces. Immersion and electrochemical tests were performed. Results from both immersion and electrochemical corrosion tests show that the corrosion resistance of the mitigated plates was not affected by the surface treatments applied. (2) Behavior of Specimens from a Mockup container: Alloy 22 has been extensively tested for

  20. Seagrass meadows as a globally significant carbonate reservoir

    KAUST Repository

    Mazarrasa, I.

    2015-03-06

    There has been a growing interest in quantifying the capacity of seagrass ecosystems to act as carbon sinks as a natural way of offsetting anthropogenic carbon emissions to the atmosphere. However, most of the efforts have focused on the organic carbon (POC) stocks and accumulation rates and ignored the inorganic carbon (PIC) fraction, despite important carbonate pools associated with calcifying organisms inhabiting the meadows, such as epiphytes and benthic invertebrates, and despite the relevance that carbonate precipitation and dissolution processes have in the global carbon cycle. This study offers the first assessment of the global PIC stocks in seagrass sediments using a synthesis of published and unpublished data on sediment carbonate concentration from 402 vegetated and 34 adjacent un-vegetated sites. PIC stocks in the top 1 m sediments ranged between 3 and 1660 Mg PIC ha-1, with an average of 654 ± 24 Mg PIC ha-1, exceeding about 5 fold those of POC reported in previous studies. Sedimentary carbonate stocks varied across seagrass communities, with meadows dominated by Halodule, Thalassia or Cymodocea supporting the highest PIC stocks, and tended to decrease polewards at a rate of -8 ± 2 Mg PIC ha-1 degree-1 of latitude (GLM, p < 0.0003). Using PIC concentration and estimates of sediment accretion in seagrass meadows, mean PIC accumulation rates in seagrass sediments is 126.3 ± 0.7 g PIC m-2 y-1. Based on the global extent of seagrass meadows (177 000 to 600 000 km2), these ecosystems globally store between 11 and 39 Pg of PIC in the top meter of sediment and accumulate between 22 and 76 Tg PIC y-1, representing a significant contribution to the carbonate dynamics of coastal areas. Despite that these high rates of carbonate accumulation imply CO2 emissions from precipitation, seagrass meadows are still strong CO2 sinks as demonstrates the comparison of carbon (POC and POC) stocks between vegetated and adjacent un-vegetated sediments.

  1. Seagrass meadows as a globally significant carbonate reservoir

    Directory of Open Access Journals (Sweden)

    I. Mazarrasa

    2015-03-01

    Full Text Available There has been a growing interest in quantifying the capacity of seagrass ecosystems to act as carbon sinks as a natural way of offsetting anthropogenic carbon emissions to the atmosphere. However, most of the efforts have focused on the organic carbon (POC stocks and accumulation rates and ignored the inorganic carbon (PIC fraction, despite important carbonate pools associated with calcifying organisms inhabiting the meadows, such as epiphytes and benthic invertebrates, and despite the relevance that carbonate precipitation and dissolution processes have in the global carbon cycle. This study offers the first assessment of the global PIC stocks in seagrass sediments using a synthesis of published and unpublished data on sediment carbonate concentration from 402 vegetated and 34 adjacent un-vegetated sites. PIC stocks in the top 1 m sediments ranged between 3 and 1660 Mg PIC ha-1, with an average of 654 ± 24 Mg PIC ha-1, exceeding about 5 fold those of POC reported in previous studies. Sedimentary carbonate stocks varied across seagrass communities, with meadows dominated by Halodule, Thalassia or Cymodocea supporting the highest PIC stocks, and tended to decrease polewards at a rate of -8 ± 2 Mg PIC ha-1 degree-1 of latitude (GLM, p -2 y-1. Based on the global extent of seagrass meadows (177 000 to 600 000 km2, these ecosystems globally store between 11 and 39 Pg of PIC in the top meter of sediment and accumulate between 22 and 76 Tg PIC y-1, representing a significant contribution to the carbonate dynamics of coastal areas. Despite that these high rates of carbonate accumulation imply CO2 emissions from precipitation, seagrass meadows are still strong CO2 sinks as demonstrates the comparison of carbon (POC and POC stocks between vegetated and adjacent un-vegetated sediments.

  2. Seagrass meadows as a globally significant carbonate reservoir

    Science.gov (United States)

    Mazarrasa, I.; Marbà, N.; Lovelock, C. E.; Serrano, O.; Lavery, P. S.; Fourqurean, J. W.; Kennedy, H.; Mateo, M. A.; Krause-Jensen, D.; Steven, A. D. L.; Duarte, C. M.

    2015-08-01

    There has been growing interest in quantifying the capacity of seagrass ecosystems to act as carbon sinks as a natural way of offsetting anthropogenic carbon emissions to the atmosphere. However, most of the efforts have focused on the particulate organic carbon (POC) stocks and accumulation rates and ignored the particulate inorganic carbon (PIC) fraction, despite important carbonate pools associated with calcifying organisms inhabiting the meadows, such as epiphytes and benthic invertebrates, and despite the relevance that carbonate precipitation and dissolution processes have in the global carbon cycle. This study offers the first assessment of the global PIC stocks in seagrass sediments using a synthesis of published and unpublished data on sediment carbonate concentration from 403 vegetated and 34 adjacent un-vegetated sites. PIC stocks in the top 1 m of sediment ranged between 3 and 1660 Mg PIC ha-1, with an average of 654 ± 24 Mg PIC ha-1, exceeding those of POC reported in previous studies by about a factor of 5. Sedimentary carbonate stocks varied across seagrass communities, with meadows dominated by Halodule, Thalassia or Cymodocea supporting the highest PIC stocks, and tended to decrease polewards at a rate of -8 ± 2 Mg PIC ha-1 per degree of latitude (general linear model, GLM; p seagrass meadows, the mean PIC accumulation rate in seagrass sediments is found to be 126.3 ± 31.05 g PIC m-2 yr-1. Based on the global extent of seagrass meadows (177 000 to 600 000 km2), these ecosystems globally store between 11 and 39 Pg of PIC in the top metre of sediment and accumulate between 22 and 75 Tg PIC yr-1, representing a significant contribution to the carbonate dynamics of coastal areas. Despite the fact that these high rates of carbonate accumulation imply CO2 emissions from precipitation, seagrass meadows are still strong CO2 sinks as demonstrated by the comparison of carbon (PIC and POC) stocks between vegetated and adjacent un-vegetated sediments.

  3. Carbon cycle uncertainty in the Alaskan Arctic

    Directory of Open Access Journals (Sweden)

    J. B. Fisher

    2014-02-01

    Full Text Available Climate change is leading to a disproportionately large warming in the high northern latitudes, but the magnitude and sign of the future carbon balance of the Arctic are highly uncertain. Using 40 terrestrial biosphere models for Alaska, we provide a baseline of terrestrial carbon cycle structural and parametric uncertainty, defined as the multi-model standard deviation (σ against the mean (x for each quantity. Mean annual uncertainty (σ/x was largest for net ecosystem exchange (NEE (−0.01± 0.19 kg C m−2 yr−1, then net primary production (NPP (0.14 ± 0.33 kg C m−2 yr−1, autotrophic respiration (Ra (0.09 ± 0.20 kg C m−2 yr−1, gross primary production (GPP (0.22 ± 0.50 kg C m−2 yr−1, ecosystem respiration (Re (0.23 ± 0.38 kg C m−2 yr−1, CH4 flux (2.52 ± 4.02 g CH4 m−2 yr−1, heterotrophic respiration (Rh (0.14 ± 0.20 kg C m−2 yr−1, and soil carbon (14.0± 9.2 kg C m−2. The spatial patterns in regional carbon stocks and fluxes varied widely with some models showing NEE for Alaska as a strong carbon sink, others as a strong carbon source, while still others as carbon neutral. Additionally, a feedback (i.e., sensitivity analysis was conducted of 20th century NEE to CO2 fertilization (β and climate (γ, which showed that uncertainty in γ was 2x larger than that of β, with neither indicating that the Alaskan Arctic is shifting towards a certain net carbon sink or source. Finally, AmeriFlux data are used at two sites in the Alaskan Arctic to evaluate the regional patterns; observed seasonal NEE was captured within multi-model uncertainty. This assessment of carbon cycle uncertainties may be used as a baseline for the improvement of experimental and modeling activities, as well as a reference for future trajectories in carbon cycling with climate change in the Alaskan Arctic.

  4. Functional Carbon Materials for Electrochemical Energy Storage

    Science.gov (United States)

    Zhou, Huihui

    The ability to harvest and convert solar energy has been associated with the evolution of human civilization. The increasing consumption of fossil fuels since the industrial revolution, however, has brought to concerns in ecological deterioration and depletion of the fossil fuels. Facing these challenges, humankind is forced to seek for clean, sustainable and renewable energy resources, such as biofuels, hydraulic power, wind power, geothermal energy and other kinds of alternative energies. However, most alternative energy sources, generally in the form of electrical energy, could not be made available on a continuous basis. It is, therefore, essential to store such energy into chemical energy, which are portable and various applications. In this context, electrochemical energy-storage devices hold great promises towards this goal. The most common electrochemical energy-storage devices are electrochemical capacitors (ECs, also called supercapacitors) and batteries. In comparison to batteries, ECs posses high power density, high efficiency, long cycling life and low cost. ECs commonly utilize carbon as both (symmetric) or one of the electrodes (asymmetric), of which their performance is generally limited by the capacitance of the carbon electrodes. Therefore, developing better carbon materials with high energy density has been emerging as one the most essential challenges in the field. The primary objective of this dissertation is to design and synthesize functional carbon materials with high energy density at both aqueous and organic electrolyte systems. The energy density (E) of ECs are governed by E = CV 2/2, where C is the total capacitance and V is the voltage of the devices. Carbon electrodes with high capacitance and high working voltage should lead to high energy density. In the first part of this thesis, a new class of nanoporous carbons were synthesized for symmetric supercapacitors using aqueous Li2SO4 as the electrolyte. A unique precursor was adopted to

  5. Identification of Serratia marcescens SE1 and determination of its Herbicide 2,2-dichloropropionate (2,2-DCP Degradation Potential

    Directory of Open Access Journals (Sweden)

    Abel, E.

    2012-01-01

    Full Text Available Aims: The goal of the study is to isolate species of bacteria that capable of utilizing 2,2-dichloropropionic acid (2,2-DCP as sole carbon source from soil sample collected from surrounding lake water located in Universiti Teknologi Malaysia, Skudai, Johor. Methodology and Results: Genomic DNA from bacterium SE1 was extracted and PCR amplification was carried out using universal primers, Fd1 (5’ - AGA GTT TGA TCC TGGCTC AG - 3’ and rP1 (5’- ACG GTC ATA CCT TGT TAC GAC TT - 3’ before sending for sequencing. The 16S rDNA nucleotide sequences were compared with Basic Local Alignment Search Tool nucleotide (BLASTn and further analyzed using phylogenetic tree of Neighbour-Joining method (MEGA 5. Phylogenetic analysis indicated that SE1 strain clearly shared 97% homology to the genus of Serratia marcescens and therefore designated as Serratia marcescens sp. SE1. SE1 exhibited the ability to utilize 2,2-DCP as sole carbon source at 20 mM concentration with cell doubling time of 5 h and maximum chloride ion release of 38 μmolCl-/mL. This result suggests that the dehalogenase enzyme present in the bacteria has high affinity towards the substrate. Based on morphological and partial biochemical characteristics, strain SE1 was a non-motile Gram negative bacterium with red colonies, that gave a catalase positive reaction. Conclusion, significance and impact of study: A better understanding of dehalogenases enzyme produce by this S. marcescens sp. SE1 in general will be useful to be used as bioremediation tools for environmental management. This is the first reported case that Serratia sp. has the ability to degrade halogenated compound.

  6. Bioleaching of UO22+ ions from a Romanian poor uranium ore

    International Nuclear Information System (INIS)

    An experimental study on the bioleaching of a poor uranium ore by means of hydrophytic plants Lemna minor and Riccia fluitans, under various operating conditions is discussed. The maximum degree of bioleaching (42%) of the reduced uranium species to U(VI) has been attained for the ore-Lemna minor-alkaline carbonate solution system. The UO22+ ions amount accumulated in the plants is negligible as compared to the dissolved quantity, owing to the ionic competition between uranyl ions and the cations necessary to the mineral nutrition. The X-ray diffraction patterns prove that the uranium species in pyrochlore mineral are completely oxidized to U(VI), while thucolite is only partially turned into UO22+ ions, in the presence of living plants. (author)

  7. Ruptured rudimentary horn at 22 weeks

    Directory of Open Access Journals (Sweden)

    Hansa Dhar

    2012-01-01

    Full Text Available Rudimentary horn is a developmental anomaly of the uterus. Pregnancy in a non-communicating rudimentary horn is very difficult to diagnose before it ruptures. A case of undiagnosed rudimentary horn pregnancy at 22 weeks presented to Nizwa regional referral hospital in shock with features of acute abdomen. Chances of rupture in first or second trimester are increased with catastrophic haemorrhage leading to increased maternal and perinatal morbidity and mortality. Management of such cases is a challenge till today due to diagnostic dilemma. Expertise in ultrasonography and early resort to surgical management is life saving in such cases.

  8. Ruptured rudimentary horn at 22 weeks.

    Science.gov (United States)

    Dhar, Hansa

    2012-07-01

    Rudimentary horn is a developmental anomaly of the uterus. Pregnancy in a non-communicating rudimentary horn is very difficult to diagnose before it ruptures. A case of undiagnosed rudimentary horn pregnancy at 22 weeks presented to Nizwa regional referral hospital in shock with features of acute abdomen. Chances of rupture in first or second trimester are increased with catastrophic haemorrhage leading to increased maternal and perinatal morbidity and mortality. Management of such cases is a challenge till today due to diagnostic dilemma. Expertise in ultrasonography and early resort to surgical management is life saving in such cases. PMID:23293421

  9. β-K(VO22(PO4

    Directory of Open Access Journals (Sweden)

    Safa Ezzine Yahmed

    2013-01-01

    Full Text Available A new vanadium oxide, potassium bis(dioxovanadyl phosphate, β-K(VO22(PO4, has been synthesized by a solid-state reaction. In the title compound, the [V2PO8] framework is built up from infinite pyramidal [V2O8]∞ and [VPO7]∞ chains linked together by V—O—P bridges, leading to a three-dimensional framework which delimits two types of intersecting tunnels running along [100] and [010] in which the four unique K+ ions, showing coordination numbers of nine and ten, are located.

  10. 22nd IAS Meeting of Sedimentology

    Institute of Scientific and Technical Information of China (English)

    DavorPavelic; IgorVlahovic; JosipHalamic

    2004-01-01

    The 22nd IAS Meeting of Sedimentology was held in the Convention Centre of the Grand Hotel Adriatic, in a small touristic town Opatija, located on the eastern Adriatic coast where Central Europe and the Mediterranean meet. It was the second IAS Meeting held in Croatia--the first one, 4th IAS Regional Meeting of Sedimentology, was held in Split in 1983. The Meeting in Opatija was organized by the Institute of Geology (Zagreb) and the Croatian Geological Society. The sponsor was Ministry of Science and Technology of the Reoublic of Croatia.

  11. Computer-controlled neutron spectrometer SV 22

    International Nuclear Information System (INIS)

    The neutron spectrometer SV22 is a combined time of flight and back scattering spectrometer. It is located at the tangential beam tube TAN2 of the research reactor FRJ2 DIDO at Kernforschungsanlage Juelich (West-Germany). Both versions are described in their hardware layout. The neutron optical characteristics of the already functioning time of flight spectrometer are summarized. Selected experiments show some possible fields for further research with this instrument. Experimental data for the backscattering version is not yet available. The features of the operating system RSX11M are explained. Examples show the use of indirect command files in control of the experiment. (orig.)

  12. UO22+/protein complexation sites screening

    International Nuclear Information System (INIS)

    Uranium(VI) is likely to make strong coordination with some proteins in the plasma and in targeted cells. In the frame of a nuclear toxicology program, a biochemical strategy has been developed to identify these targets in complex biological media. The present work focuses on an approach based on the screening of 3D protein structures in order to identify proteins able to bind UO22+ and the corresponding complexation sites in these proteins. Our preliminary results show that indeed a few proteins display a high affinity to uranyl salt. The site of interaction may be mapped using molecular modeling, providing coherent results with the biochemical data. (authors)

  13. Activationless charge transport across 4.5 to 22 nm in molecular electronic junctions.

    Science.gov (United States)

    Yan, Haijun; Bergren, Adam Johan; McCreery, Richard; Della Rocca, Maria Luisa; Martin, Pascal; Lafarge, Philippe; Lacroix, Jean Christophe

    2013-04-01

    In this work, we bridge the gap between short-range tunneling in molecular junctions and activated hopping in bulk organic films, and greatly extend the distance range of charge transport in molecular electronic devices. Three distinct transport mechanisms were observed for 4.5-22-nm-thick oligo(thiophene) layers between carbon contacts, with tunneling operative when d  16 nm for high temperatures and low bias, and a third mechanism consistent with field-induced ionization of highest occupied molecular orbitals or interface states to generate charge carriers when d = 8-22 nm. Transport in the 8-22-nm range is weakly temperature dependent, with a field-dependent activation barrier that becomes negligible at moderate bias. We thus report here a unique, activationless transport mechanism, operative over 8-22-nm distances without involving hopping, which severely limits carrier mobility and device lifetime in organic semiconductors. Charge transport in molecular electronic junctions can thus be effective for transport distances significantly greater than the 1-5 nm associated with quantum-mechanical tunneling. PMID:23509271

  14. [Determination of 4 dithiocarbamate residues in 22 matrices by gas chromatography].

    Science.gov (United States)

    Qin, Shu; Qiao, Xiongwu; Wang, Xia; Zhao, Lijuan

    2010-12-01

    A gas chromatographic method with flame photometric detection (FPD (sulfur filter)) for analyzing the residues of 4 dithiocarbamates in 22 matrices in a heated closed vial has been established. The dithiocarbamate residues were decomposed to carbon disulfide (CS2) by SnCl2-HCl solution. The liberated CS2 was absorbed by hexane in the vial, and then determined by gas chromatography with FPD (sulfur filter). The results were expressed as the residues of dithiocabamates. The residue analysis method was validated by mancozeb, metiram, propineb and thiram in 22 matrices (apple, grape, etc). The average recovery ranges were from 72% to 110% with the relative standard deviations (RSD) between 0.8% and 22.0% when the fortified concentrations were between 0.06 and 3.0 mg/kg, and the quantitative analysis was performed by using external standard method. The limits of detection were in the range of 0.01-0.1 mg/kg (S/N = 3), and the limits of quantification were between 0.02 and 0.2 mg/kg (S/N = 10) for the 4 dithiocarbamate residues in the 22 matrices. This method is simple, fast, accurate, reproducible, and suitable for the determination of the 4 dithiocarbamate residues in the matrices mentioned in this paper. PMID:21438370

  15. Carbon isotopes in mollusk shell carbonates

    Science.gov (United States)

    McConnaughey, Ted A.; Gillikin, David Paul

    2008-10-01

    Mollusk shells contain many isotopic clues about calcification physiology and environmental conditions at the time of shell formation. In this review, we use both published and unpublished data to discuss carbon isotopes in both bivalve and gastropod shell carbonates. Land snails construct their shells mainly from respired CO2, and shell δ13C reflects the local mix of C3 and C4 plants consumed. Shell δ13C is typically >10‰ heavier than diet, probably because respiratory gas exchange discards CO2, and retains the isotopically heavier HCO3 -. Respired CO2 contributes less to the shells of aquatic mollusks, because CO2/O2 ratios are usually higher in water than in air, leading to more replacement of respired CO2 by environmental CO2. Fluid exchange with the environment also brings additional dissolved inorganic carbon (DIC) into the calcification site. Shell δ13C is typically a few ‰ lower than ambient DIC, and often decreases with age. Shell δ13C retains clues about processes such as ecosystem metabolism and estuarine mixing. Ca2+ ATPase-based models of calcification physiology developed for corals and algae likely apply to mollusks, too, but lower pH and carbonic anhydrase at the calcification site probably suppress kinetic isotope effects. Carbon isotopes in biogenic carbonates are clearly complex, but cautious interpretation can provide a wealth of information, especially after vital effects are better understood.

  16. Accurate variational calculations of the ground 2Po(1s22s22p) and excited 2S(1s22s2p2) and 2Po(1s22s23p) states of singly ionized carbon atom.

    Science.gov (United States)

    Bubin, Sergiy; Adamowicz, Ludwik

    2011-12-01

    In this article we report accurate nonrelativistic variational calculations of the ground and two excited states of C(+) ion. We employ extended and well optimized basis sets of all-electron explicitly correlated Gaussians to represent the wave functions of the states. The optimization of the basis functions is performed with a procedure employing the analytic gradient of the energy with respect to the nonlinear parameters of the Gaussians. The calculations explicitly include the effects due to the finite nuclear mass. The calculated transition energies between the three states are compared to the experimentally derived values. Finally, we present expectation values of some small positive and negative powers of the interparticle distances and contact densities. PMID:22149776

  17. Refining temperature measures in thermal/optical carbon analysis

    Directory of Open Access Journals (Sweden)

    J. C. Chow

    2005-01-01

    Full Text Available Thermal/optical methods have been widely used for quantifying total carbon (TC, organic carbon (OC, and elemental carbon (EC in ambient and source particulate samples. Thermally defined carbon fractions have been used for source identification. Temperature precision in thermal carbon analysis is critical to the allocation of carbon fractions. The sample temperature is determined by a thermocouple, which is usually located in the oven near the sample. Sample and thermocouple temperature may differ owing to different thermal properties between the sample filter punch and the thermocouple, or inhomogeneities in the heating zone. Quick-drying temperature-indicating liquids (Tempil Inc., South Plainfield, NJ of different liquefying points are used as temperature calibration standards. These consist of chemicals that change their appearance at specific temperatures and can be optically monitored to determine the sample temperature. Temperature measures were evaluated for three different models of carbon analyzers. Sample temperatures were found to differ from sensor temperatures by 10 to 50°C. Temperature biases of 14 to 22°C during thermal analysis were found to change carbon fraction measurements. The temperature indicators allow calibration curves to be constructed that relate the sample temperature to the temperature measured by a thermocouple.

  18. Th22 Cells Contribution in Immunopathogenesis of Rheumatic Diseases

    Directory of Open Access Journals (Sweden)

    Gholamreza Azizi

    2015-10-01

    Full Text Available Newly  identified  T  helper  cell  22  (Th22  is  a  subset  of  CD4+T  cells  with  specific properties apart from other known CD4+ T cell subsets with distinguished gene expression and function. Th22 cells are characterized by production of a distinct profile of effector cytokines, including interleukin (IL-22, IL-13, and tumor necrosis factor-α (TNF-α. The levels of Th22 and related cytokine IL-22 are increased in various autoimmune diseases and positively associated with some rheumatic diseases such as rheumatoid arthritis, systemic lupus erythematosus, behcet's disease, ankylosing spondylitis and psoriatic arthritis. In summary, IL-22 and Th22 cells play a significant and complicated role in inflammatory and autoimmune  rheumatic  diseases,  therefore,  targeting  IL-22  or  Th22  have  unique  and attractive advantages due to the fact that Th22 subset is recently identified and its associated research is extremely limited. This review discusses the role of Th22 and its cytokine IL-22 in the immunopathogenesis of rheumatic disease.

  19. Bursting emission from B0611+22

    CERN Document Server

    Seymour, Andrew; Ridley, Josh

    2014-01-01

    Over the past decade it has become apparent that a class of `bursting pulsars' exist with the discovery of PSR J1752+2359 and PSR J1938+2213. In these pulsars, a sharp increase in the emission is observed that then tends to systematically drop-off from pulse-to-pulse. In this paper we describe the discovery of such a relationship in high-sensitivity observations of the young (characteristic age of 90,000 yrs) 0.33 s pulsar B0611+22 at both 327 MHz and 1400 MHz with the Arecibo radio telescope. While Nowakowski previously showed that B0611+22 has mode-switching properties, the data presented here show, for the first time, that this pulsar emits bursts with characteristic time-scales of several hundred seconds. At 327 MHz, the pulsar shows steady behaviour in one emission mode which is enhanced by bursting emission slightly offset in pulse phase from this steady emission. Contrastingly at 1400 MHz, the two modes appear to behave in a competing operation while still offset in phase. Using a fluctuation spectrum ...

  20. Tracheoesophageal fistula in utero: 22 cases

    International Nuclear Information System (INIS)

    A retrospective review of 22 infants born with tracheoesophageal fistula (TEF) detected on in utero US was performed. In addition, ten cases reported in the literature were reviewed. TEF or esophageal atresia should be considered when there is polydramnios and the stomach is not fluid filled; these findings were seen in 32% of the cases. Amniotic fluid flows freely through some TEFs, resulting in a normal amount of amniotic fluid and a fluid-filled stomach (6 of 22 cases), while in other cases the fluid does not traverse the fistula easily and polyhydramnios results. Polyhdramnios was present in 62% of the cases we reviewed and was the most common sonographic finding. The earliest age at which polyhdramnios was diagnosed was 24 weeks. Associated abnormalities are seen in 50%-70% of cases of TEF and are a major contributing factor to morbidity and mortality. Sonography will continue to miss many cases of TEF; however, when TEF is suspected from fetal US (i.e., polyhdramnios and no fluid-filled stomach, or polyhdramnios with no etiology identified), an improved outcome is expected