WorldWideScience

Sample records for carbon 18

  1. Adsorption of Acid Red 18 (AR18) by Activated Carbon from Poplar Wood- A Kinetic and Equilibrium Study

    OpenAIRE

    Reza Shokoohi; Vahid Vatanpoor; Mansuor Zarrabi; Akram Vatani

    2010-01-01

    Adsorption process by activated carbon is widely used for removal of dyes. Because of economical limits, activated carbon derived from low cost materials seem to be economical. The aim of this work is preparation of activated carbon from poplar wood and investigation of its ability to removal of (AR18) dye. In this work, we prepared the activated carbon by chemical activation method in electric furnace. In addition we have investigated effect of various parameters such as pH, contact time, dy...

  2. Adsorption of Acid Red 18 (AR18 by Activated Carbon from Poplar Wood- A Kinetic and Equilibrium Study

    Directory of Open Access Journals (Sweden)

    Reza Shokoohi

    2010-01-01

    Full Text Available Adsorption process by activated carbon is widely used for removal of dyes. Because of economical limits, activated carbon derived from low cost materials seem to be economical. The aim of this work is preparation of activated carbon from poplar wood and investigation of its ability to removal of (AR18 dye. In this work, we prepared the activated carbon by chemical activation method in electric furnace. In addition we have investigated effect of various parameters such as pH, contact time, dye concentration and adsorbent dosage on dye removal. Langmuir and Freundlich isotherm models have been investigated. Pseudo-first order, pseudo-second order and modified pseudo-first order kinetic models have been used for experimental data. The results showed that removal efficiency was increased with increasing of adsorbent dosage, contact time and decreasing of pH, but with increasing of dye concentration, the removal efficiency was decreased. Adsorption isotherm models showed that Langmuir isotherm model was best fitted onto collected data (r2>0.978. In addition, kinetic models showed that sorption of AR18 onto activated carbon prepared from poplar wood follows the pseudo-first order model (r2>0.9758.

  3. Disequilibrium δ18O values in microbial carbonates as a tracer of metabolic production of dissolved inorganic carbon

    Science.gov (United States)

    Thaler, Caroline; Millo, Christian; Ader, Magali; Chaduteau, Carine; Guyot, François; Ménez, Bénédicte

    2017-02-01

    Carbon and oxygen stable isotope compositions of carbonates are widely used to retrieve paleoenvironmental information. However, bias may exist in such reconstructions as carbonate precipitation is often associated with biological activity. Several skeleton-forming eukaryotes have been shown to precipitate carbonates with significant offsets from isotopic equilibrium with water. Although poorly understood, the origin of these biologically-induced isotopic shifts in biogenic carbonates, commonly referred to as "vital effects", could be related to metabolic effects that may not be restricted to mineralizing eukaryotes. The aim of our study was to determine whether microbially-mediated carbonate precipitation can also produce offsets from equilibrium for oxygen isotopes. We present here δ18O values of calcium carbonates formed by the activity of Sporosarcina pasteurii, a carbonatogenic bacterium whose ureolytic activity produces ammonia (thus increasing pH) and dissolved inorganic carbon (DIC) that precipitates as solid carbonates in the presence of Ca2+. We show that the 1000 lnαCaCO3-H2O values for these bacterially-precipitated carbonates are up to 24.7‰ smaller than those expected for precipitation at isotopic equilibrium. A similar experiment run in the presence of carbonic anhydrase (an enzyme able to accelerate oxygen isotope equilibration between DIC and water) resulted in δ18O values of microbial carbonates in line with values expected at isotopic equilibrium with water. These results demonstrate for the first time that bacteria can induce calcium carbonate precipitation in strong oxygen isotope disequilibrium with water, similarly to what is observed for eukaryotes. This disequilibrium effect can be unambiguously ascribed to oxygen isotope disequilibrium between DIC and water inherited from the oxygen isotope composition of the ureolytically produced CO2, probably combined with a kinetic isotope effect during CO2 hydration/hydroxylation. The fact that

  4. Synthesis of carbon-11, fluorine-18, and nitrogen-13 labeled radiotracers for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, J.S.; Wolf, A.P.

    1981-01-01

    A number of reviews, many of them recent, have appeared on various aspects of /sup 11/C, /sup 18/F and /sup 13/N-labeled radiotracers. This monograph treats the topic principally from the standpoint of synthetic organic chemistry while keeping in perspective the necessity of integrating the organic chemistry with the design and ultimate application of the radiotracer. Where possible, recent examples from the literature of organic synthesis are introduced to suggest potentially new routes which may be applied to problems in labeling organic molecules with the short-lived positron emitters, carbon-11, fluorine-18, and nitrogen-13. The literature survey of carbon-11, fluorine-18 and nitrogen-13 labeled compounds presented are of particular value to scientists working in this field. Two appendices are also included to provide supplementary general references. A subject index concludes this volume.

  5. Inorganic-Organic Hybrid 18-Molybdodiphosphate Nanoparticles Bulk-modified Carbon Paste Electrode and Its Electrocatalysis

    Institute of Scientific and Technical Information of China (English)

    WANG,Xiu-Li(王秀丽); KANG,Zhen-Hui(康振辉); WANG,En-Bo(王恩波); HU,Chang-Wen(胡长文)

    2002-01-01

    A kind of inorganic- organic hybrid 18-molybdodiphosphate nanoparticles ([(C4H9)4N]6P2Mo18O62 @4H2O) was firstly used as a bulk-modifier to fabricate a three-dimensional chemically modified carbon paste electrode (CPE) by direct mixing. The electrochemical behavior of the solid nanoparticles dispersed in the CPE in acidic aqueous solution was characterized by cyclic and square-wave voltammetry. The hybrid 18-molybdodiphosphate nanoparticles bulk-modified CPE (MNP-CPE) displayed a high electrocatalytic activity towards the reduction of nitrite,bromate and hydrogen peroxide. The remarkable advantages of the MNP-CPE over the traditional polyoxometalates-modified electrodes are their excellent reproducibility of surface-renewal and high stability owing to the insolubility of the hybrid 18-molybdodiphosphate nanoparticles.

  6. Priming effects of leaves of Laurus nobilis L. and 1,8-cineole on carbon mineralization

    Directory of Open Access Journals (Sweden)

    Burak Kocak

    2016-03-01

    Full Text Available Plant secondary compounds can have stimulating effect on C cycling and change its rate in soils. We examined how leaves of bay laurel (Laurus nobilis L.; Lauraceae and 1,8-cineole (CIN, one of its constituents, affect soil C mineralization and its rate. Leaves and soil samples of bay laurel were taken from Cukurova University Campus (Adana, Turkey growing naturally under Mediterranean climate conditions. Leaves and CIN were considered as the two forms of organic C sources. After determining the level of 1,8-cineole in leaves by gas chromatography-mass spectrometry, soils were mixed with powdered leaves and 1,8-cineole based on their C contents at same and half doses of soil organic C level. Carbon mineralization of all soils was determined over 54 d (28 °C, 80% field capacity. While 1,8-cineole was found as a major constituent of leaves (65% of essential oil, all doses of leaves and CIN increased soil microbial activity. There were significant differences for C mineralization rate between control and all applications (P < 0.05. High C levels of all treatments decreased C mineralization rate compared to control soils. In summary, all treatments stimulated C mineralization and it is possible to conclude that soil microorganisms adapted to use CIN as an energy source.

  7. Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants: a new approach to estimating in vivo carbonic anhydrase activity

    Energy Technology Data Exchange (ETDEWEB)

    Holtum, J.A.M.; Summons, R.; Roeske, C.A.; Comins, H.N.; O' Leary, M.H.

    1984-01-01

    Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with TC YO2, then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the ( TC) malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance or by mass spectrometry. Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum, 40 for Kalanchoee daigremontiana, and 100 or greater for Bryophyllum tubiflorum, Kalanchoee serrata, and Kalanchoae tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. 37 references, 2 figures, 8 tables.

  8. Analysis and theoretical modeling of 18O enriched carbon dioxide spectrum by CRDS near 1.35 μm: (II) 16O13C18O, 16O13C17O, 12C18O2, 17O12C18O, 12C17O2, 13C18O2 and 17O13C18O

    Science.gov (United States)

    Karlovets, E. V.; Campargue, A.; Kassi, S.; Tashkun, S. A.; Perevalov, V. I.

    2017-04-01

    This contribution is the second part of the analysis of the room temperature absorption spectrum of 18O enriched carbon dioxide by very high sensitivity Cavity Ring Down spectroscopy between 6977 and 7918 cm-1 (1.43-1.26 μm). Overall, more than 8600 lines belonging to 166 bands of eleven carbon dioxide isotopologues were rovibrationnally assigned. In a first part (Kassi et al. J Quant Spectrosc Radiat Transfer 187 (2017) 414-425, http://dx.doi.org/10.1016/j.jqsrt.2016.09.002), the results relative to mono-substituted isotopologues, 16O12C18O, 16O12C17O, 12C16O2 and 13C16O2, were presented. This second contribution is devoted to the multiply-substituted isotopologues or clumped isotopologues of particular importance in geochemistry: 16O13C18O, 16O13C17O, 12C18O2, 17O12C18O, 12C17O2, 13C18O2 and 17O13C18O. On the basis of the predictions of effective Hamiltonian models, a total of 3195 transitions belonging to 73 bands were rovibrationnally assigned for these seven species. Among the 73 observed bands, 55 are newly reported. All the identified bands correspond to ΔP=10 and 11 series of transitions, where P= 2V1+V2+3V3 is the polyad number (Vi are vibrational quantum numbers). The accurate spectroscopic parameters of 70 bands have been determined from the standard band-by-band analysis. Global fits of the measured line intensities of the ΔP=10 series of transitions of 17O12C18O and 16O13C18O and of the ΔP=11 series of transitions of 12C18O2, 17O12C18O, 16O13C18O and 13C18O2 were performed to determine the corresponding sets of the effective dipole moment parameters.

  9. Rapid uplift of the Altiplano revealed through 13C-18O bonds in paleosol carbonates.

    Science.gov (United States)

    Ghosh, Prosenjit; Garzione, Carmala N; Eiler, John M

    2006-01-27

    The elevation of Earth's surface is among the most difficult environmental variables to reconstruct from the geological record. Here we describe an approach to paleoaltimetry based on independent and simultaneous determinations of soil temperatures and the oxygen isotope compositions of soil waters, constrained by measurements of abundances of 13C-18O bonds in soil carbonates. We use this approach to show that the Altiplano plateau in the Bolivian Andes rose at an average rate of 1.03 +/- 0.12 millimeters per year between approximately 10.3 and approximately 6.7 million years ago. This rate is consistent with the removal of dense lower crust and/or lithospheric mantle as the cause of elevation gain.

  10. Adsorption properties of an activated carbon for 18 cytokines and HMGB1 from inflammatory model plasma.

    Science.gov (United States)

    Inoue, Satoru; Kiriyama, Kentaro; Hatanaka, Yoshihiro; Kanoh, Hirofumi

    2015-02-01

    The ability of an activated carbon (AC) to adsorb 18 different cytokines with molecular weights ranging from 8 kDa to 70 kDa and high mobility group box-1 (HMGB1) from inflammatory model plasma at 310 K and the mechanisms of adsorption were examined. Porosity analysis using N2 gas adsorption at 77K showed that the AC had micropores with diameters of 1-2 nm and mesopores with diameters of 5-20 nm. All 18 cytokines and HMGB1 were adsorbed on the AC; however, the shapes of the adsorption isotherms changed depending on the molecular weight. The adsorption isotherms for molecules of 8-10 kDa, 10-20 kDa, 20-30 kDa, and higher molecular weights were classified as H-2, L-3, S-3, and S-1 types, respectively. These results suggested that the adsorption mechanism for the cytokines and HMGB1 in the mesopores and on the surface of the AC differed as a function of the molecular weight. On the basis of these results, it can be concluded that AC should be efficient for cytokine adsorption.

  11. Using the Difference in 18O-enrichment in Pedogenic Carbonates and Freshwater Mollusk Shells as a Paleoaridity Proxy

    Science.gov (United States)

    Snell, K. E.; Koch, P. L.

    2008-12-01

    Aridity is an important climatic attribute, yet few proxies exist to reconstruct this parameter in the past. Here we present initial results from a study using the difference in oxygen isotope value between pedogenic carbonate and freshwater mollusk shells as a proxy for aridity. These carbonates record the oxygen isotope value of the soil water and surface water from which they precipitate, respectively, as well as temperature- dependent isotopic fractionation. Evaporation causes 18O-enrichment of water that may influence the isotopic composition of both reservoirs. Soil water is more susceptible to evaporative enrichment, however, whereas surface waters more closely track the oxygen isotope value of precipitation. If both carbonates are collected from the same region, and if we assume they form at essentially the same temperature, the 18O-enrichment of soil carbonate (soil water) relative to bivalve carbonate (surface water) may reflect aridity. Alternatively, it is possible to determine the temperature of formation of each carbonate independently using the carbonate clumped isotope thermometer (Ghosh, et al., 2006), and then to solve for the oxygen isotope value of soil and surface water. To test the premise that the extent of 18O-enrichment in pedogenic vs. bivalve carbonate will reflect aridity, we collected pedogenic carbonate, freshwater mollusk shells, and stream water samples across an aridity gradient in the midwestern United States (MN, IA, NE, SD). We discovered that while pedogenic carbonates apparently formed from soil waters that are 18O-enriched relative to meteoric water, samples from drier regions are not more strongly 18O-enriched than those from wetter regions. We will extend the study to include samples from even drier regions, such as those in the southwestern US, as 18O enrichment may only become highly pronounced under very arid conditions. While our results have not yet established this approach as a viable tool for reconstructing aridity

  12. Utilization of activated carbon produced from fruit juice industry solid waste for the adsorption of Yellow 18 from aqueous solutions.

    Science.gov (United States)

    Angin, Dilek

    2014-09-01

    The use of activated carbon obtained from sour cherry (Prunus cerasus L.) stones for the removal of a basic textile dye, which is Yellow 18, from aqueous solutions at different contact times, pH values and solution temperatures was investigated. The surface area and micropore volume of chemically modified activated carbon were 1704 m(2) g(-1) and 0.984 cm(3) g(-1), respectively. The experimental data indicated that the adsorption isotherms were well described by the Langmuir equilibrium isotherm equation and the calculated adsorption capacity was 75.76 mg g(-1) at 318 K. The adsorption kinetic of Yellow 18 obeys the pseudo-second-order kinetic model. The thermodynamic parameters were calculated to estimate the nature of adsorption. The activation energy of the system was calculated as 0.71-2.36 kJ/mol. According to these results, prepared activated carbon could be used as a low-cost adsorbent to compare with the commercial activated carbon for the removal of Yellow 18 from wastewater.

  13. Development of carbon-fiber gas cylinder of 18 liters%18L碳纤维缠绕气瓶的研制

    Institute of Scientific and Technical Information of China (English)

    刘平小; 马新; 王建华; 于峰涛; 史惠星; 苑玲

    2014-01-01

    Objective To design and develop a carbon-fiber gas cylinder of 18 liters, which could provide breathing gas to a portable medical chamber in the first aid and transfer of casualties with diving diseases and pulmonary barotrauma .Methods The di-mension, weight and layers of winding were determined , through the design of the winding method and the interior of the gas cylinder . Then a series of tests , such as water pressure test , fatigue test and demolition test were conducted to demonstrate that all the technical specifications were met .Results The capacity of the cylinder was 18.1 L, weight 9.86 kg, overall length 782 mm and outside diameter 201 mm.The pressure of water test was 30 MPa, which was maintained for 60 s.Residue distortion was <5%and the pressure for fa-tigue test for a succession of 1 500 times was 20 MPa, and actual demolition test pressure was 88.4 MPa.Conclusion Related cylinder tests were conducted in accordance with corresponding criteria , and test results indicated that all the criteria specified in《the Safety Su-pervision Procedures of Gas Cylinders》were met.%目的:设计一种18 L碳纤维缠绕气瓶,专门用于在急救、转运潜水疾病、肺气压伤病员过程中,为便携式医疗加压舱提供呼吸气体。方法通过气瓶内胆和缠绕设计,确定相应的尺寸、质量和缠绕层数,再通过水压试验、疲劳试验和爆破试验验证其技术指标。结果气瓶容积18.1 L,质量9.86 kg,长度782 mm,外径201 mm。水压试验压力30 MPa、保压60 s,残余变形<5%;疲劳试验压力20 MPa,1500次;实际爆破压力88.4 MPa。结论根据相关标准进行气瓶试验,试验情况满足《气瓶安全监察规程》的要求。

  14. The Orbiting Carbon Observatory-2: first 18 months of science data products

    Science.gov (United States)

    Eldering, Annmarie; O'Dell, Chris W.; Wennberg, Paul O.; Crisp, David; Gunson, Michael R.; Viatte, Camille; Avis, Charles; Braverman, Amy; Castano, Rebecca; Chang, Albert; Chapsky, Lars; Cheng, Cecilia; Connor, Brian; Dang, Lan; Doran, Gary; Fisher, Brendan; Frankenberg, Christian; Fu, Dejian; Granat, Robert; Hobbs, Jonathan; Lee, Richard A. M.; Mandrake, Lukas; McDuffie, James; Miller, Charles E.; Myers, Vicky; Natraj, Vijay; O'Brien, Denis; Osterman, Gregory B.; Oyafuso, Fabiano; Payne, Vivienne H.; Pollock, Harold R.; Polonsky, Igor; Roehl, Coleen M.; Rosenberg, Robert; Schwandner, Florian; Smyth, Mike; Tang, Vivian; Taylor, Thomas E.; To, Cathy; Wunch, Debra; Yoshimizu, Jan

    2017-02-01

    The Orbiting Carbon Observatory-2 (OCO-2) is the first National Aeronautics and Space Administration (NASA) satellite designed to measure atmospheric carbon dioxide (CO2) with the accuracy, resolution, and coverage needed to quantify CO2 fluxes (sources and sinks) on regional scales. OCO-2 was successfully launched on 2 July 2014 and has gathered more than 2 years of observations. The v7/v7r operational data products from September 2014 to January 2016 are discussed here. On monthly timescales, 7 to 12 % of these measurements are sufficiently cloud and aerosol free to yield estimates of the column-averaged atmospheric CO2 dry air mole fraction, XCO2, that pass all quality tests. During the first year of operations, the observing strategy, instrument calibration, and retrieval algorithm were optimized to improve both the data yield and the accuracy of the products. With these changes, global maps of XCO2 derived from the OCO-2 data are revealing some of the most robust features of the atmospheric carbon cycle. This includes XCO2 enhancements co-located with intense fossil fuel emissions in eastern US and eastern China, which are most obvious between October and December, when the north-south XCO2 gradient is small. Enhanced XCO2 coincident with biomass burning in the Amazon, central Africa, and Indonesia is also evident in this season. In May and June, when the north-south XCO2 gradient is largest, these sources are less apparent in global maps. During this part of the year, OCO-2 maps show a more than 10 ppm reduction in XCO2 across the Northern Hemisphere, as photosynthesis by the land biosphere rapidly absorbs CO2. As the carbon cycle science community continues to analyze these OCO-2 data, information on regional-scale sources (emitters) and sinks (absorbers) which impart XCO2 changes on the order of 1 ppm, as well as far more subtle features, will emerge from this high-resolution global dataset.

  15. Inlfuence of carbon content on microstructure and mechanical properties of Mn13Cr2 and Mn18Cr2 cast steels

    Institute of Scientific and Technical Information of China (English)

    Lu Dingshan; Liu Zhongyi; Li Wei

    2014-01-01

    In this paper, a comparison study was carried out to investigate the inlfuence of carbon content on the microstructure, hardness, and impact toughness of water-quenched Mn13Cr2 and Mn18Cr2 cast steels. The study results indicate that both steels' water-quenched microstructures are composed of austenite and a smal amount of carbide. The study also found that, when the carbon contents are the same, there is less carbide in Mn18Cr2 steel than in Mn13Cr2 steel. Therefore, the hardness of Mn18Cr2 steel is lower than that of Mn13Cr2 steel but the impact toughness of Mn18Cr2 steel is higher than that of Mn13Cr2 steel. With increasing the carbon content, the hardness increases and the impact toughness decreases in these two kinds of steels, and the impact toughness of Mn18Cr2 steel substantialy exceeds that of Mn13Cr2 steel. Therefore, the water-quenched Mn18Cr2 steel with high carbon content could be applied to relatively high impact abrasive working conditions, while the as-cast Mn18Cr2 steel could be only used under working conditions of relatively low impact abrasive load due to lower impact toughness.

  16. Linking water and carbon fluxes in a Mediterranean oak woodland using a combined flux and ?18O partitioning approach

    Science.gov (United States)

    Dubbert, M.; Piayda, A.; Costa e Silva, F.; Correia, A.; Pereira, J. S.; Cuntz, M.; Werner, C.

    2013-12-01

    Water is one of the key factors driving ecosystem productivity, especially in water-limited ecosystems, where global climate change is expected to intensify drought and alter precipitation patterns. One such ecosystem is the ';Montado', where two vegetation layers respond differently to drought: oak trees avoid drought due to their access to deeper soil layers and ground water while herbaceous plants, surviving the summer in the form of seeds. We aimed at 1) quantifying the impact of the understory herbaceous vegetation on ecosystem carbon and water fluxes throughout the year, 2) determining the driving environmental factors for evapotranspiration (ET) and net ecosystem exchange (NEE) and 3) disentangling how ET components of the ecosystem relate to carbon dioxide exchange. We present one year data set comparing modeled and measured stable oxygen isotope signatures (δ18O) of soil evaporation, confirming that the Craig and Gordon equation leads to good agreement with measured δ18O of evaporation (Dubbert et al. 2013). Partitioning ecosystem ET and NEE into its three sources revealed a strong contribution of soil evaporation (E) and herbaceous transpiration (T) to ecosystem ET during spring and fall. In contrast, soil respiration (R) and herbaceous net carbon gain contributed to a lesser amount to ecosystem NEE during spring and fall, leading to consistently smaller water use efficiencies (WUE) of the herbaceous understory compared to the cork-oaks. Here, we demonstrate that the ability to assess ET, NEE and WUE independent of soil evaporation dynamics enables the understanding of the mechanisms of the coupling between water and carbon fluxes and their responses to drought. Dubbert, M., Cuntz, M., Piayda, A., Maguas, C., Werner, C., 2013: Partitioning evapotranspiration - Testing the Craig and Gordon model with field measurements of oxygen isotope ratios of evaporative fluxes. J Hydrol. a) Oxygen isotope signatures of soil evaporation on bare soil plots calculated

  17. An isotope mass balance model for the correlation of freshwater bivalve shell (Unio pictorum carbonate δ18O to climatic conditions and water δ18O in Lake Balaton (Hungary

    Directory of Open Access Journals (Sweden)

    Gabriella SCHÖLL-BARNA

    2011-08-01

    describes the isotope variability of shell carbonate. As a practical application of the isotope mass balance model was used to present the effect of precipitation and evaporation on δ18Oshell. The relationship between intra-shell δ18O-variability and precipitation amount (precipitation/evaporation ratio were determined, which allows the quantified prediction the impact of meteorological parameters affecting the oxygen isotope composition of shell carbonate.

  18. Investigation on laser brazing AA6056 Al alloy to XC18 low-carbon steel

    Institute of Scientific and Technical Information of China (English)

    Jianjun Ding; Feiqun Li; Feng Qu; Patrice Peyre; Remy Fabbro

    2005-01-01

    @@ Based on the studies of influence of YAG laser heating conditions for Al alloy melt and steel on wettability,the mechanics of the laser overlap braze welding of 6056 Al and XC18 steel sheet has been investigated.Under the temperature range which is above the melting point of the Al alloy and below the melting point of the steel, two dissimilar metals can be joined by means of laser braze welding. There is no crack observed in the joining area, i.e. Al-Fe intermetallic phase (Fe3Al/FeAl/FeAl3/Fe2Al5) layer formed by solution and diffusion between liquid-solid interface. The temperature range can be defined as the process temperatures of laser braze welding of Al-Fe materials. Selecting a higher laser heating temperature can improve the wettability of Al melt to steel surface, but the intermetallic phase layer is also thicker. When the laser heating temperature is so high that the joining surface of steel is melted, there is a crack trend in the joining area.

  19. Solid phase extraction-capillary electrophoresis determination of sulphonamide residues in milk samples by use of C18-carbon nanotubes as hybrid sorbent materials.

    Science.gov (United States)

    Polo-Luque, M L; Simonet, B M; Valcárcel, M

    2013-07-07

    The exceptional sorption capabilities of carbon nanotubes were used to preconcentrate trace sulphonamides from milk samples. To this end, single walled carbon nanotubes (SWNTs) and multi-walled carbon nanotubes (MWNTs) dispersed in the ionic liquid 1-hexyl-3-methylimidazolium hexafluorophosphate were retained on a C18 stationary phase to obtain a hybrid material in a simple manner. In this approach ionic liquids are an excellent alternative to improve the dispersion of CNTs, without chemical modification or the use of solid substances or organic solvents. MWNTs provided better results than SWNTs. Carbon nanotubes retained in the C18 sorbent matrix were found to confer aromatic character, increasing its preconcentration capacity as a result. The conventional C18 stationary phase played a two-fold role: as a support to retain carbon nanotubes in the cartridge and as a medium to prevent their aggregation. The modified MWNT/C18 and SWNT/C18 materials were used to preconcentrate residual sulphonamides (SAs) in milk samples for their determination at concentrations as low as 0.03-0.069 mg L(-1) by capillary electrophoresis. Analyte recoveries from spiked samples ranged from 103.2 to 98.8% and precision, as RSD, from 8.2 to 5.4%.

  20. Inverse agonist histamine H3 receptor PET tracers labelled with carbon-11 or fluorine-18.

    Science.gov (United States)

    Hamill, Terence G; Sato, Nagaaki; Jitsuoka, Makoto; Tokita, Shigeru; Sanabria, Sandra; Eng, Waisi; Ryan, Christine; Krause, Stephen; Takenaga, Norihiro; Patel, Shil; Zeng, Zhizhen; Williams, David; Sur, Cyrille; Hargreaves, Richard; Burns, H Donald

    2009-12-01

    Two histamine H3 receptor (H3R) inverse agonist PET tracers have been synthesized and characterized in preclinical studies. Each tracer has high affinity for the histamine H3 receptor, has suitable lipophilicity, and neither is a substrate for the P-glycoprotein efflux pump. A common phenolic precursor was used to synthesize each tracer with high specific activity and radiochemical purity by an alkylation reaction using either [(11)C]MeI or [(18)F]FCD(2)Br. Autoradiographic studies in rhesus monkey and human brain slices showed that each tracer had a widespread distribution with high binding densities in frontal cortex, globus pallidus and striatum, and lower uptake in cerebellum. The specificity of this expression pattern was demonstrated by the blockade of the autoradiographic signal by either the H3R agonist R-alpha-methylhistamine or a histamine H3R inverse agonist. In vivo PET imaging studies in rhesus monkey showed rapid uptake of each tracer into the brain with the same distribution seen in the autoradiographic studies. Each tracer could be blocked by pretreatment with a histamine H3R inverse agonist giving a good specific signal. Comparison of the in vitro metabolism of each compound showed slower metabolism in human liver microsomes than in rhesus monkey liver microsomes, with each compound having a similar clearance rate in humans. The in vivo metabolism of 1b in rhesus monkey showed that at 60 min, approximately 35% of the circulating counts were due to the parent. These tracers are very promising candidates as clinical PET tracers to both study the histamine H3R system and measure receptor occupancy of H3R therapeutic compounds.

  1. Re-sampling of carbon stocks in forest soils and afforestation areas after 18 years – results from the 7x7 km Kvadratnet in Denmark

    DEFF Research Database (Denmark)

    Callesen, Ingeborg; Vesterdal, Lars; Stupak, Inge;

    Forest soil plots (N=112) of the size 50x50 meter were sampled in 1989-90 (C1) and re-sampled in 2007-9 (C2) by soil auger, producing composite samples from the depths 0-25, 25-50, 50-75 and 75-100 cm. The soils were classified according to the carbon concentration in the uppermost mineral soil h...... especially base rich loamy soils to take full advantage of the nitrogen deposition and CO2 fertilization effects.......Forest soil plots (N=112) of the size 50x50 meter were sampled in 1989-90 (C1) and re-sampled in 2007-9 (C2) by soil auger, producing composite samples from the depths 0-25, 25-50, 50-75 and 75-100 cm. The soils were classified according to the carbon concentration in the uppermost mineral soil...... horizon (0-25 cm) at C1. Soils with less than 1.8% carbon gained carbon during the 18 yr period, while initially very carbon rich (4soils and organic soils (C%>12) lost carbon. We hypothesize that the carbon losses reflect a very slow process of adaptation to the current more aerobic...

  2. Carbonates in the Martian meteorite Allan Hills 84001 formed at 18 +/- 4 degrees C in a near-surface aqueous environment.

    Science.gov (United States)

    Halevy, Itay; Fischer, Woodward W; Eiler, John M

    2011-10-11

    Despite evidence for liquid water at the surface of Mars during the Noachian epoch, the temperature of early aqueous environments has been impossible to establish, raising questions of whether the surface of Mars was ever warmer than today. We address this problem by determining the precipitation temperature of secondary carbonate minerals preserved in the oldest known sample of Mars' crust--the approximately 4.1 billion-year-old meteorite Allan Hills 84001 (ALH84001). The formation environment of these carbonates, which are constrained to be slightly younger than the crystallization age of the rock (i.e., 3.9 to 4.0 billion years), has been poorly understood, hindering insight into the hydrologic and carbon cycles of earliest Mars. Using "clumped" isotope thermometry we find that the carbonates in ALH84001 precipitated at a temperature of approximately 18 °C, with water and carbon dioxide derived from the ancient Martian atmosphere. Furthermore, covarying carbonate carbon and oxygen isotope ratios are constrained to have formed at constant, low temperatures, pointing to deposition from a gradually evaporating, subsurface water body--likely a shallow aquifer (meters to tens of meters below the surface). Despite the mild temperatures, the apparently ephemeral nature of water in this environment leaves open the question of its habitability.

  3. Estimating groundwater mixing and origin in an overexploited aquifer in Guanajuato, Mexico, using stable isotopes (strontium-87, carbon-13, deuterium and oxygen-18).

    Science.gov (United States)

    Horst, Axel; Mahlknecht, Jürgen; Merkel, Broder J

    2007-12-01

    Stable Isotopes (strontium-87, deuterium and oxygen-18, carbon-13) have been used to reveal different sources of groundwater and mixing processes in the aquifer of the Silao-Romita Valley in the state of Guanajuato, Mexico. Calcite dissolution appeared to be the main process of strontium release leading to relatively equal (87)Sr/(86)Sr ratios of 0.7042-0.7062 throughout the study area which could be confirmed by samples of carbonate rocks having similar Sr ratios (0.7041-0.7073). delta(13)C values (-11.91- -6.87 per thousand VPDB) of groundwaters confirmed the solution of carbonates but indicated furthermore influences of soil-CO(2). Deuterium and (18)O contents showed a relatively narrow range of-80.1- -70.0 per thousand VSMOW and -10.2- -8.8 per thousand, VSMOW, respectively but are affected by evaporation and mixing processes. The use of delta(13)C together with (87)Sr/(86)Sr revealed three possible sources: (i) carbonate-controlled waters showing generally higher Sr-concentrations, (ii) fissure waters with low-strontium contents and (iii) infiltrating water which is characterized by low delta(13)C and (87)Sr/(86)Sr ratios. The third component is affected by evaporation processes taking place before and during infiltration which might be increased by extraction and reinfiltration (irrigation return flow).

  4. Separation of some mono-, di- and tri-unsaturated fatty acids containing 18 carbon atoms by high-performance liquid chromatography and photodiode array detection.

    Science.gov (United States)

    Czauderna, M; Kowalczyk, J

    2001-08-25

    Positional and geometric isomers of mono-, di- and tri-unsaturated fatty acids containing 18 carbon atoms were separated on commercially available reversed-phase columns in gradient systems composed of acetonitrile and water, utilizing photodiode array detection. The biological samples were hydrolyzed with 2 M NaOH for 35-40 min at 85-90 degrees C. After cooling, the hydrolysates were acidified with 4 M HCl and the free fatty acids were extracted with dichloromethane. The organic solvent was removed in a gentle stream of argon. The fatty acids were determined after pre-column derivatization with dibromacetophenone in the presence of triethylamine. The reaction components were mixed and reacted for 2 h at 50 degrees C. Separations of derivatized fatty acids were performed on two C18 columns (Nova Pak C18, 4 microm, 250x4.6 mm, Waters) by binary or ternate gradient programs and UV detection at 254 and 235 nm. The geometric and positional isomers of some unsaturated fatty acids were substantially retained on the C18 columns and were distinct from some saturated fatty acids, endogenous substances in biological samples or background interference. Only slight separation of critical pairs of cis-9 C18:1/cis-11 C18:1 and cis-6 C18:1/trans-11 C18:1 was obtained. A ternate gradient program can be used for complete fractionation of a mixture of conjugated linoleic acid isomers (CLA) from cis-9, cis-12 and trans-9, trans-12 isomers of C18:2. The CLA isomers in the effluent were monitored at 235 nm. The CLA isomers were differentiated from saturated and unsaturated fatty acids using a photodiode array detector. The utility of the method was demonstrated by evaluating the fatty acid composition of duodenal digesta, rapeseed and maize oils.

  5. 梭菌MH18菌株诱导碳酸盐矿物的形成%Clostridium sp. MH18 strain induces the formation of carbonate minerals

    Institute of Scientific and Technical Information of China (English)

    郭文文; 马恒; 李福春; 王金平; 苏宁

    2012-01-01

    [目的]研究细菌作用下碳酸盐矿物的形成过程有助于了解微生物成矿的机理.[方法]在Lagoa Vermelha培养基中(Mg/Ca为6:1)对一株分离自土壤样品的梭菌MH18菌株进行了为期35天的碳酸盐矿物培养实验,同时还完成了一组无菌对照实验.利用X-射线衍射技术对沉淀物的矿物成分进行了测定,利用光学显微镜和扫描电子显微镜对沉淀物的形态进行了系统的观察.[结果]MH18菌株在Lagoa Vermelha 培养基中诱导形成了以高镁方解石为主的碳酸盐矿物;这些矿物起初具有哑铃状的外形,后来发展为球状;无菌对照实验中出现少量沉淀物,但X-射线衍射技术图谱显示它们是非晶态物质.[结论]MH18菌株具有促进碳酸盐矿物结晶的功能;碳酸盐矿物的特殊形态(哑铃状和球状)可能与细菌形态存在着某种成因上的联系.%Objective ] We studied the formation of carbonate minerals by bacteria to understand the mechanism of microbial mineralization. [Methods] Cultures of carbonate precipitation using Lagoa Vermelha medium with 6;1 molar ratio of Mg/Ca within 35 days were made under the mediation of Clostridium sp. ( MH18 strain) isolated from soil. At the same time, aseptic experiments without the inoculation were done as the control. Mineral species were determined by X-ray diffraction, and the morphologies of precipitated carbonates were observed using optical microscopy and scanning electron microscopy. [Results] In the LV medium, MH18 strain mediated the formation of carbonate mineral, in which high-magnesium calcite was dominant. In the initial stage, the minerals had shapes with dumbbell-like morphology, and finally transformed to spheres. Only a small amount of precipitation appeared in the control, but X-ray diffraction patterns showed that these precipitations were amorphous substance. [Conclusions] MH18 strain could induce crystallization of carbonate.

  6. Influence of carbon content on wear resistance and wear mechanism of Mn13Cr2 and Mn18Cr2 cast steels

    Directory of Open Access Journals (Sweden)

    Ding-shan Lu

    2015-01-01

    Full Text Available By means of impact abrasion tests, micro-hardness tests, and worn surface morphology observation via SEM, a comparison research based upon different impact abrasive wear conditions was conducted in this research to study the influence of different carbon contents (1.25wt.%, 1.35wt.%, and 1.45 wt.% on the wear resistance and wear mechanism of water-quenched Mn13Cr2 and Mn18Cr2 cast steels. The research results show that the wear resistance of the Mn18Cr2 cast steel is superior to that of the Mn13Cr2 cast steel under the condition of the same carbon content and different impact abrasive wear conditions because the Mn18Cr2 cast steel possesses higher worn work hardening capacity as well as a more desirable combination of high hardness and impact toughness than that of the Mn13Cr2 cast steel. When a 4.5 J impact abrasive load is applied, the wear mechanism of both steels is that plastic deformation fatigue spalling and micro-cutting coexist, and the former dominates. When the carbon content is increased, the worn work hardening effect becomes increasingly dramatic, while the wear resistance of both steels decreases, which implies that an increase in impact toughness is beneficial to improving the wear resistance under severe impact abrasive wear conditions. Under the condition of a 1.0 J impact abrasive load, the wear mechanism of both steels is that plastic deformation fatigue spalling and micro-cutting coexist, and the latter plays a leading role. The worn work hardening effect and wear resistance intensify when the carbon content is increased, which implies that a higher hardness can be conducive to better wear resistance under low impact abrasive condition.

  7. Carbon cycling in primary production bottle incubations: inferences from grazing experiments and photosynthetic studies using 14C and 18O in the Arabian Sea

    Science.gov (United States)

    Laws, Edward A.; Landry, Michael R.; Barber, Richard T.; Campbell, Lisa; Dickson, Mary-Lynn; Marra, John

    Estimates of photosynthesis based on the incorporation of 14C-labeled inorganic carbon into particulate carbon were compared to estimates of gross photosynthesis based on net O 2 production and the production of 18O2 from H218O during the US Joint Global Ocean Flux Study (US JGOFS) Arabian Sea process cruises. For samples incubated below the surface and at optical depthsphotorespiration, dark respiration, excretion, and grazing effects on the two estimates of photosynthesis. The 14C uptake : gross photosynthesis ratio was distinctly higher (0.62) for samples incubated at the surface. This result is likely due to UV light effects, since the O 2 and 14C incubations were done in quartz and polysulfone bottles, respectively. The 14C uptake : gross photosynthesis ratio was lower (0.31) for bottles incubated at optical depths>3. This result probably reflects an increase in the ratio of dark respiration to net photosynthesis in the vicinity of the compensation light level.

  8. A multi-transition study of carbon monoxide in the Orion A molecular cloud. II - C(O-18)

    Science.gov (United States)

    Dutrey, A.; Duvert, G.; Castets, A.; Langer, W. D.; Bally, J.; Wilson, R. W.

    1993-01-01

    We present an analysis of density, temperature, and excitation conditions in a one half square degree region around BN/KL in Orion A using new C(O-l8) J = 1 yields 0 and J = 2 yields 1 data. This paper extends a previous study of Orion A, based on a multitransition analysis of (C-13)O, to the optically thinner C(O-18) species that traces better the dense inner regions of giant molecular clouds. From the C(O-18) maps we identify several condensations and are able to derive their size, linewidth, average density, mass, and virial mass.

  9. Dating Cactus: Annual and Sub-annual Variations of Oxygen-18, Carbon-13 and Radiocarbon in Spines of a Columnar Cactus, Carnegiea gigantea.

    Science.gov (United States)

    Dettman, D. L.; English, N. B.; Sandquist, D. R.; Williams, D. G.

    2006-12-01

    We measured δ18O, δ13C and F14C of spines from a long-lived columnar cactus, Carnegiea gigantea (saguaro), to resolve a record of plant physiological responses to annual and sub-annual climate variation in the eastern Sonoran Desert. Spines grow from the apex of the cactus and are arranged serially along the side of the cactus oldest at the base, youngest at the apex. To establish the age of the spine series, we measured F14C of spines collected at 8 different heights from the apex (3.77 m) to the base of a naturally occurring saguaro. These spines yielded fractions of modern carbon (F14C) from 0.9679 and 1.5537, indicating the presence of carbon in spine tissue derived from atmospheric nuclear testing. We used the F14C of spine tissue to calculate the year of spine emergence for each of the 11 spines, assuming minimal re-allocation of stored carbon to growing spines. At the same 8 heights, we interpolated the date of spine emergence from observed height measurements made between 1964 and 2002. A very strong positive correlation (linear regression, r2 = 0.99, P spines and ages determined from direct height measurements was observed, with a two year offset suggesting incorporation of carbon from fossil fuel combustion sources in the Tucson basin. Additionally, spine tips from 97 spines collected serially from the top half of the same saguaro (between 1.77 and 3.50 m) and representing ~15 years of growth, yielded δ18O variations in spine bulk organic material from 38° to 50° (VSMOW) and in δ13C from ° to 11.5° (VPDB). The δ18O and δ13C values were positively correlated over the entire record (linear regression, r2 = 0.22, P spine organic material from the naturally occurring cactus were observed in spines grown shortly following the 1983 and 1993 strong El Niño winter precipitation events in Tucson, suggesting that isotopes in spine tissue are a good proxy of these climate anomalies. We found similar δ18O, δ13C and F14C variations and relationships in a

  10. The impact of Carbonic Anhydrase on the partitioning of leaf and soil CO18O and COS gas exchange across scales

    Science.gov (United States)

    Wingate, L.; Wehr, R. A.; Commane, R.; Ogee, J.; Sauze, J.; Jones, S.; Launois, T.; Wohl, S.; Whelan, M.; Meredith, L. K.; Genty, B.; Gimeno, T.; Kesselmeier, J.; Bosc, A.; Cuntz, M.; Munger, J. W.; Nelson, D. D.; Saleska, S. R.; Wofsy, S. C.; Zahniser, M. S.

    2015-12-01

    Photosynthesis (GPP), the largest CO2 flux to the land surface, is currently estimated with considerable uncertainty at between 100-175 Pg C yr-1. More robust estimates of global GPP could be obtained from the atmospheric budgets of other valuable tracers, such as carbonyl sulfide (COS) or the oxygen isotopic composition (δ18O) of atmospheric CO2. However, quantifying GPP using these tracers hinges on a better understanding of how soil micro-organisms modify the atmospheric concentrations of CO18O and COS at large scales. In particular, understanding better the role and activity of the enzyme Carbonic Anhydrase (CA) in soil micro-organisms is critical. We present novel datasets and model simulations demonstrating the progress in the collection of multi-tracer field datasets and how a new generation of multi-tracer land surface models can provide valuable constraints on photosynthesis and respiration across scales.

  11. High resolution ion microprobe investigation of the δ18O of carbonate cements (Jurassic, Paris Basin, France): New insights and pending questions

    Science.gov (United States)

    Vincent, Benoit; Brigaud, Benjamin; Emmanuel, Laurent; Loreau, Jean-Paul

    2017-04-01

    The scope of this work is to investigate, at a high resolution, the oxygen isotope composition (δ18Ocarb) of diagenetic products (synsedimentary and burial calcite cements) in shallow-marine carbonates. SIMS (Secondary Ion Mass Spectrometry) microprobe analyses were performed on thin sections from Oxfordian and Kimmeridgian Formations of the eastern Paris Basin and compared to data obtained on the same diagenetic products by conventional mass spectrometry (acid digestion). Hereby obtained, δ18O are similar, but the SIMS dataset displays a larger range of values. The isotopic zonation obtained by SIMS transects through sequences of cements filling pores, reveals an (expected) isotopic depletion from older stage synsedimentary calcites to younger stage blocky calcites and that follows the CL (cathodoluminescence) zonation. SIMS analyses however show that synsedimentary cements precipitated in intra-skeletal pores, have heavier δ18O than their inter-particle counterparts, with an offset of + 4‰V-PDB, despite similar petrographical characteristics. This difference is maintained in the δ18O of the first stages of blocky calcite cements, intra-skeletal blocky calcites showing heavier δ18O than the time equivalent and petrographically identical inter-particle calcites, with an offset of + 5‰V-PDB. These offsets are tentatively explained by the precipitation of cements under non-equilibrium conditions in intra-skeletal pores, where organic matter decay may have played a key role, acting notably on the pH. The occurrence of isolated micro-diagenetic environments, co-existing at the thin section scale, is tentatively proposed as an explanation to these small scale and high amplitude δ18O heterogeneities. These results may question the sampling strategy for future works. Microdrilling may miss the observed range of variation, but averaging the values may not necessarily lead to real misinterpretations if a critical selection of samples is performed, targeting

  12. Low-energy (30 keV) carbon ion induced mutation spectrum in the LacZ{alpha} gene of M13mp18 double-stranded DNA

    Energy Technology Data Exchange (ETDEWEB)

    Wang Quan; Zhang Gang; Du Yanhua; Zhao Yong; Qiu Guanying

    2003-07-25

    Double-stranded M13mp18 DNA was irradiated with 30 keV carbon ions in dry state under vacuum to investigate the low-energy heavy ion induced mutation spectra. When the irradiated DNA was used to transfect Escherichia coli JM105, 3.6-5.7-fold increases in mutation frequency were observed, in contrast to the spontaneous group. Sequences of the 92 induced mutants showed that the carbon ions in this study could induce an interesting mutation spectrum in the lacZ{alpha} gene. One-base mutations (96.8%) and base pair substitutions (56.4%) were predominant, most of which involved G:C base pairs (90.6%), especially G:C {yields} T:A transversions (49.6%) and G:C {yields} A:T transitions (39.6%). This is similar to the spectra induced by {gamma}-rays in the same ds M13, wild type E. coli system. We also found a considerable amount of carbon ion induced one-base deletion (38.5%) and the mutation sites distribution on the target lacZ{alpha} gene was obviously non-random. We compared this study with previous data employing {gamma}-rays to discuss the possible causes of the mutation spectrum.

  13. Carbon Fixation and Oxygen Release of 18 Shrub Greening Trees%18种常见灌木绿化树种光合特性及固碳释氧能力分析

    Institute of Scientific and Technical Information of China (English)

    林欣; 林晨菲; 刘素青; 李林锋

    2014-01-01

    采用Li-6400便携式光合仪对广州市区18种常见园林绿化灌木树种的净光合速率日变化进行测定,估测其日净固碳释氧量;以日净固碳量为指标,运用离差平方和对不同灌木树种的固碳释氧能力进行聚类分析。结果表明:不同树种的光合特性有差异,光合速率日变化曲线呈单峰型和双峰型2种类型。大多数植物净光合速率的日最高值出现在上午10:00~12:00,少数植物出现在下午14:00~16:00。不同树种固碳释氧能力也有所差异,其中固碳释氧能力最强的4种灌木分别为马缨丹、假连翘、黄叶榕和红桑,最弱的为棕竹。依据日净固碳量将灌木树种聚为3类,日净固碳量高的如马缨丹、假连翘、黄叶榕、红桑[固碳量为7~10 g/(m2·d),释氧量为5~7 g/(m2·d)],日净固碳量中等的如叶子花、朱槿、九里香、米仔兰、鹅掌藤、含笑花、狗牙花[(固碳量为5~7 g/(m2·d),释氧量为3~5 g/(m2·d)],日净固碳量低的如朱蕉、变叶木、红背桂花、茉莉花、江边针葵、基及树、棕竹[(固碳量为2~5 g/(m2·d),释氧量为1~3 g/(m2·d)]。本研究将为碳汇林业指导下的园林绿化树种选择提供一定的参考价值。%The net photosynthetic rate of 18 shrub species in Guangzhou city were measured by using the Li-6400 portable photosynthetic system in order to evaluate their daily net carbon fixation and oxygen release of each species. The cluster analysis was also used to compare their net amount of carbon storage and oxygen release capacity of different shrub species. The results showed that the photosynthetic characteristics of shrub species are different, and the single-peak and double-peak curve of diurnal change of photosynthetic rate variation were observed. The peak values of photosynthetic rate for most plant appeared between 10 00 and 12 00. Only a few of plant's photosynthetic rate peak appeared between

  14. High precision measurement by mass spectrometry of isotopic ratios {delta} {sup 13}C and {delta}{sup 18}O of carbon dioxide; Mesure haute precision par spectrometrie de masse des rapports isotopiques {delta} {sup 13}C et {delta}{sup 18}O du dioxyde de carbone

    Energy Technology Data Exchange (ETDEWEB)

    Bourg, Chr.; Ciais, Ph.

    1998-02-01

    Carbon dioxide (CO{sub 2}) is the second natural greenhouse gas in the Earth's atmosphere, after vapor water. Its concentration levels have been increasing by 25% due to human activities over the past 200 years, thus increasing the radiative forcing at the surface and potentially including major climate change for the next centuries. It is of primary importance to better quantify the role of carbon contained into the oceans and the land biota in moderating the anthropic perturbation. To do so, {sup 13}C and {sup 18}O isotopes are unique tools which allow to estimate indirectly the terrestrial CO{sub 2} fluxes based on atmospheric measurements. The present reports describes the experimental set-up used at the CFR-LMCE laboratory to measure the {sup 13}C and {sup 18}O natural abundance in atmospheric carbon dioxide. This technique requires high levels of both precision and accuracy because the geochemical signal nevertheless consists of very small changes in isotopic composition (on the order of 0.01 permits). Also, given the large number of samples to analyses routinely, it must be run in an automatic mode. Our experiment design consists of 'extraction line' where CO{sub 2} is separated cryogenically from the air, which is coupled to a (Finnigan MAT 252) mass spectrometer. (authors)

  15. Synthesis and biological evaluation of carbon-11- and fluorine-18-labeled 2-oxoquinoline derivatives for type 2 cannabinoid receptor positron emission tomography imaging

    Energy Technology Data Exchange (ETDEWEB)

    Evens, Nele [Laboratory for Radiopharmacy, K.U. Leuven, 3000 Leuven (Belgium); Muccioli, Giulio G. [Unite de Chimie Pharmaceutique et de Radiopharmacie, U.C. Louvain, 1200 Bruxelles (Belgium); Houbrechts, Nele [Laboratory for Radiopharmacy, K.U. Leuven, 3000 Leuven (Belgium); Lambert, Didier M. [Unite de Chimie Pharmaceutique et de Radiopharmacie, U.C. Louvain, 1200 Bruxelles (Belgium); Verbruggen, Alfons M. [Laboratory for Radiopharmacy, K.U. Leuven, 3000 Leuven (Belgium); Van Laere, Koen [Division of Nuclear Medicine, K.U. Leuven, 3000 Leuven (Belgium); Bormans, Guy M. [Laboratory for Radiopharmacy, K.U. Leuven, 3000 Leuven (Belgium)], E-mail: guy.bormans@pharm.kuleuven.be

    2009-05-15

    Introduction: The type 2 cannabinoid (CB{sub 2}) receptor is part of the endocannabinoid system and has been suggested as a mediator of several central and peripheral inflammatory processes. Imaging of the CB{sub 2} receptor has been unsuccessful so far. We synthesized and evaluated a carbon-11- and a fluorine-18-labeled 2-oxoquinoline derivative as new PET tracers with high specificity and affinity for the CB{sub 2} receptor. Methods: Two 2-oxoquinoline derivatives were synthesized and radiolabeled with either carbon-11 or fluorine-18. Their affinity and selectivity for the human CB{sub 2} receptor were determined. Biological evaluation was done by biodistribution, radiometabolite and autoradiography studies in mice. Results: In vitro studies showed that both compounds are high affinity CB{sub 2}-specific inverse agonists. Biodistribution study of the tracers in mice showed a high in vivo initial brain uptake and fast brain washout, in accordance with the low CB{sub 2} receptor expression levels in normal brain. A persistently high in vivo binding to the spleen was observed, which was inhibited by pretreatment with two structurally unrelated CB{sub 2} selective inverse agonists. In vitro autoradiography studies with the radioligands confirmed CB{sub 2}-specific binding to the mouse spleen. Conclusion: We synthesized two novel CB{sub 2} receptor PET tracers that show high affinity/selectivity for CB{sub 2} receptors. Both tracers show favourable characteristics as radioligands for central and peripheral in vivo visualization of the CB{sub 2} receptor and are promising candidates for primate and human CB{sub 2} PET imaging.

  16. Competition for water between walnut seedlings (Juglans regia) and rye grass (Lolium perenne) assessed by carbon isotope discrimination and delta18O enrichment.

    Science.gov (United States)

    Picon-Cochard, C; Nsourou-Obame, A; Collet, C; Guehl, J M; Ferhi, A

    2001-02-01

    Container-grown walnut seedlings (Juglans regia L.) were subjected to competition with rye grass (Lolium perenne L.) and to a 2-week soil drying cycle. One and 2 weeks after the beginning of the drought treatment, H2 18O (delta approximately equals +100%) was added to the bottom layer of soil in the plant containers to create a vertical H2 18O gradient. Rye grass competition reduced aboveground and belowground biomass of the walnut seedlings by 60%, whereas drought had no effect. The presence of rye grass reduced the dry weight of walnut roots in the upper soil layer and caused a 50% reduction in lateral root length. Rye grass competition combined with the drought treatment reduced walnut leaf CO2 assimilation rate (A) and leaf conductance (gw) by 20 and 39%, respectively. Transpiration rates in rye grass, both at the leaf level and at the plant or tiller level, were higher than in walnut seedlings. Leaf intrinsic water-use efficiency (A/gw) of walnut seedlings increased in response to drought and no differences were observed between the single-species and mixed-species treatments, as confirmed by leaf carbon isotope discrimination measurements. Measurement of delta18O in soil and in plant xylem sap indicated that the presence of rye grass did not affect the vertical profile of soil water uptake by walnut seedlings. Walnut seedlings and rye grass withdrew water from the top and middle soil layers in well-watered conditions, whereas during the drought treatment, walnut seedlings obtained water from all soil layers, but rye grass took up water from the bottom soil layer only.

  17. Recharge areas and hydrochemistry of carbonate springs issuing from Semmering Massif, Austria, based on long-term oxygen-18 and hydrochemical data evidence

    Science.gov (United States)

    Yehdegho, Beyene; Reichl, Peter

    2002-10-01

    Résumé. Les teneurs en oxygène-18 et l'hydrochimie des sources émergeant du massif de Semmering ont été suivies de manière intensive dans le but de caractériser les zones de recharge et l'évolution hydrochimique. L'effet d'altitude sur le δ18O a été déterminé grâce aux données isotopiques et hydrogéologiques de petites sources de référence, principalement en terrains cristallins; cet effet est d'environ -0,27 et -0,21‰ par 100 m pour les versants respectivement nord et sud du massif. En appliquant ces valeurs, l'altitude moyenne de recharge des sources a été calculée. Pour les sources à fort débit issues des carbonates, elle est comprise entre 1,100 et 1,400 m, compatible avec le cadre topographique et hydrogéologique des calcaires et des dolomies de l'Austro-alpin inférieur alimentant ces sources. La composition chimique des sources des carbonates est dominée par les ions Ca2+, Mg2+, HCO3- et SO42-. Les sources sont presque toutes proches de la saturation par rapport à la calcite, mais sont sous-saturées en dolomite (sauf quelques sources proches de la saturation). Comme cela est habituel en ce qui concerne le dioxyde de carbone fourni par les sols en régions montagneuses, la pCO2 équilibrante moyenne est faible, comprise entre 10-3.0 et 10-2.5 atm (0,1 à 0,3% en volume). En ce qui concerne les variations à long terme, le pH, SIc, Sid et la pCO2 équilibrante sont soumis à des variations saisonnières, alors que les concentrations en Ca2+, Mg2+ et HCO3- ne varient pratiquement pas. En intégrant les résultats de δ18O et les données hydrochimiques, la variabilité altitudinale du chimisme des eaux souterraines des carbonates est démontrée. Reflétant les variations d'activité biologique et des conditions de recharge dans les zones d'alimentation, une covariation négative résulte de l'altitude de recharge et de la pCO2 et la concentration en HCO3- n'est pas modifiée par aucun des termes source ou puits, ce qui fait varier

  18. Combined δ11B, δ13C, and δ18O analyses of coccolithophore calcite constrains the response of coccolith vesicle carbonate chemistry to CO2-induced ocean acidification

    Science.gov (United States)

    Liu, Yi-Wei; Tripati, Robert; Aciego, Sarah; Gilmore, Rosaleen; Ries, Justin

    2016-04-01

    Coccolithophorid algae play a central role in the biological carbon pump, oceanic carbon sequestration, and in marine food webs. It is therefore important to understand the potential impacts of CO2-induced ocean acidification on these organisms. Differences in the regulation of carbonate chemistry, pH, and carbon sources of the intracellular compartments where coccolith formation occurs may underlie the diverse calcification and growth responses to acidified seawater observed in prior experiments. Here we measured stable isotopes of boron (δ11B), carbon (δ13C) and oxygen (δ18O) within coccolith calcite, and δ13C of algal tissue to constrain carbonate system parameters in two strains of Pleurochrysis carterae (P. carterae). The two strains were cultured under variable pCO2, with water temperature, salinity, dissolved inorganic carbon (DIC), and alkalinity monitored. Notably, PIC, POC, and PIC/POC ratio did not vary across treatments, indicating that P. carterae is able to calcify and photosynthesize at relatively constant rates irrespective of pCO2 treatment. The δ11B data indicate that mean pH at the site of coccolith formation did not vary significantly in response to elevated CO2. These results suggest that P. carterae regulates calcifying vesicle pH, even amidst changes in external seawater pH. Furthermore, δ13C and δ18O data suggest that P. carterae may utilize carbon from a single internal DIC pool for both calcification and photosynthesis, and that a greater proportion of dissolved CO2 relative to HCO3- enters the internal DIC pool under acidified conditions. These results suggest that P. carterae is able to calcifyand photosynthesize at relatively constant rates across pCO2 treatments by maintaining pH homeostasis at their site of calcification and utilizing a greater proportion of aqueous CO2.

  19. Comparative studies of multi-walled carbon nanotubes (MWNTs) and octadecyl (C18) as sorbents in passive sampling devices for biomimetic uptake of polycyclic aromatic hydrocarbons (PAHs) from soils.

    Science.gov (United States)

    Li, Shibin; Anderson, Todd A; Maul, Jonathan D; Shrestha, Babina; Green, Micah J; Cañas-Carrell, Jaclyn E

    2013-09-01

    To avoid overestimating the risk of polycyclic aromatic hydrocarbons (PAHs), research is needed to evaluate the bioavailable portion of PAHs in the environment. However, limited PSDs were developed for a terrestrial soil system. In this study, two sorbents, octadecyl (C18) and multi-walled carbon nanotubes (MWNTs), were individually evaluated as sorbents in passive sampling devices (PSDs) as biomimetic samplers to assess the uptake of PAHs from soil. C18-PSDs were an excellent biomimetic tool for PAHs with a low molecular weight in complex exposure conditions with different soil types, types of PAHs, aging periods, and initial PAH concentrations in soil. The utility of MWNT-PSDs was limited by extraction efficiencies of PAHs from MWNTs. However, when compared to C18-PSDs, they had higher adsorption capacities and were less expensive. This study provides data regarding useful techniques that can be used in risk assessment to assess the bioavailability of PAHs in soil.

  20. Analysis and theoretical modeling of the 18O enriched carbon dioxide spectrum by CRDS near 1.35 μm: (I) 16O12C18O, 16O12C17O, 12C16O2 and 13C16O2

    Science.gov (United States)

    Kassi, S.; Karlovets, E. V.; Tashkun, S. A.; Perevalov, V. I.; Campargue, A.

    2017-01-01

    The room temperature absorption spectrum of 18O enriched carbon dioxide has been recorded by very high-sensitivity Cavity Ring Down spectroscopy between 6977 and 7918 cm-1 (1.43-1.26 μm). The achieved sensitivity (noise equivalent absorption αmin 8×10-11 cm-1) has allowed for the detection of more than 8600 lines belonging to 166 bands of eleven carbon dioxide isotopologues. Line intensities of the weakest observed transitions are on the order of 2×10-30 cm/molecule. In this first part, we present the results relative to the 16O12C18O, 16O12C17O, 12C16O2 and 13C16O2 isotopologues. Their absorption lines were rovibrationally assigned on the basis of the predictions of their respective effective Hamiltonian model. Overall 5476 lines were measured and assigned to 93 bands. Forty nine of them, all belonging to 16O12C18O and 16O12C17O, are reported for the first time. The studied spectral region is formed by ΔP=10-12 series of transitions, where P=2V1+V2+3V3 is the polyad number (Vi are vibrational quantum numbers). The spectroscopic parameters of 58 bands of 16O12C18O and 16O12C17O were determined from a fit of the measured line positions. An inter- and an intrapolyad resonance perturbation were identified and analyzed in the 16O12C18O spectrum. The comparison with the line positions and line intensities included in the AMES line list is discussed. Global fits of the line intensities were performed in order to (i) improve the ΔP=10 and 11 sets of the effective dipole moment parameters of 16O12C18O and the ΔP=11 set of parameters of 16O12C17O and (ii) derive for the first time the ΔP=10 and 12 parameters of 16O12C17O and 16O12C18O, respectively.

  1. Remove food dye (Acid Red 18 by using activated carbon of sunflower stalk modified with Iron nanoparticles Fe3O4 from aqueous solutions

    Directory of Open Access Journals (Sweden)

    Ali Namazi Zoweram

    2016-06-01

    Full Text Available Background and Objective: acid pale yellow dye(AY-6, acid yellow 23 (AY-23 and Acid Red 18 (AR-18 are of the most important dyes among artificial dyes that are used to create the colors orange and red. They are used in confectionery, beverage making, chips, corn, cereals, cake mixes, sports drinks, ice cream, candy, gelatins, pickles, Yakhmaks, fermented foods, prescription drugs and tablet, chewing gum, pudding, fruit juice, mustard sauce, soda, cosmetics, and other products.However, about 10-20% of the dye is lost during the manufacturing process and as a result large amounts of food dye enter the wastewater that must be refined. Absorption by using natural absorbents has found a significant usage among the methods of removal and treatment of colored wastewaters. For this purpose, activatedcarbon was produced from sunflower plantstalk in this study. It was modified by iron nanoparticles to recover and separate absorbent from aqueous solutions. Dye Acid Red 18 of Azo dyes was used in a laboratory environment to assess the efficiency, which is widely used in food and textile industries. Materials and Methods:The present study was done experimentally in laboratory scale, with the aim to examine the efficacy of removal of Acid Red 18 dye from aqueous solutions by using activatedcarbon produced from sunflower stalk, and modified with iron nanoparticles. Various parameters such as initial concentration of colored material, adsorbent material dosage, PH, and contact time were investigated in a batch system. Findings:The present study results show dye removal efficiency of 98.6% at a concentration of 25 milligrams per liter with 0.5 g adsorbent dosage and contact time of 120 minutes at a pH equal to 3. Conclusion: Based on the results obtained from the study it can be concluded activatedcarbon produced from sunflower stalk as an agricultural wastes has relatively good efficiency in absorption of acid red18 dye from aqueous solutions.

  2. Moss stable isotopes (carbon-13, oxygen-18) and testate amoebae reflect environmental inputs and microclimate along a latitudinal gradient on the Antarctic Peninsula.

    Science.gov (United States)

    Royles, Jessica; Amesbury, Matthew J; Roland, Thomas P; Jones, Glyn D; Convey, Peter; Griffiths, Howard; Hodgson, Dominic A; Charman, Dan J

    2016-07-01

    The stable isotope compositions of moss tissue water (δ(2)H and δ(18)O) and cellulose (δ(13)C and δ(18)O), and testate amoebae populations were sampled from 61 contemporary surface samples along a 600-km latitudinal gradient of the Antarctic Peninsula (AP) to provide a spatial record of environmental change. The isotopic composition of moss tissue water represented an annually integrated precipitation signal with the expected isotopic depletion with increasing latitude. There was a weak, but significant, relationship between cellulose δ(18)O and latitude, with predicted source water inputs isotopically enriched compared to measured precipitation. Cellulose δ(13)C values were dependent on moss species and water content, and may reflect site exposure to strong winds. Testate amoebae assemblages were characterised by low concentrations and taxonomic diversity, with Corythion dubium and Microcorycia radiata types the most cosmopolitan taxa. The similarity between the intra- and inter-site ranges measured in all proxies suggests that microclimate and micro-topographical conditions around the moss surface were important determinants of proxy values. Isotope and testate amoebae analyses have proven value as palaeoclimatic, temporal proxies of climate change, whereas this study demonstrates that variations in isotopic and amoeboid proxies between microsites can be beyond the bounds of the current spatial variability in AP climate.

  3. δ18O water isotope in the iLOVECLIM model (version 1.0 – Part 3: A palaeo-perspective based on present-day data–model comparison for oxygen stable isotopes in carbonates

    Directory of Open Access Journals (Sweden)

    T. Caley

    2013-09-01

    Full Text Available Oxygen stable isotopes (δ18O are among the most useful tools in palaeoclimatology/palaeoceanography. Simulation of oxygen stable isotopes allows testing how the past variability of these isotopes in water can be interpreted. By modelling the proxy directly in the model, the results can also be directly compared with the data. Water isotopes have been implemented in the global three-dimensional model of intermediate complexity iLOVECLIM, allowing fully coupled atmosphere–ocean simulations. In this study, we present the validation of the model results for present-day climate against the global database for oxygen stable isotopes in carbonates. The limitation of the model together with the processes operating in the natural environment reveal the complexity of use the continental calcite-δ18O signal of speleothems for a global quantitative data–model comparison exercise. On the contrary, the reconstructed surface ocean calcite-δ18O signal in iLOVECLIM does show a very good agreement with the late Holocene database (foraminifers at the global and regional scales. Our results indicate that temperature and the isotopic composition of the seawater are the main control on the fossil-δ18O signal recorded in foraminifer shells when all species are grouped together. Depth habitat, seasonality and other ecological effects play a more significant role when individual species are considered. We argue that a data–model comparison for surface ocean calcite δ18O in past climates, such as the Last Glacial Maximum (≈ 21 000 yr, could constitute an interesting tool for mapping the potential shifts of the frontal systems and circulation changes throughout time. Similarly, the potential changes in intermediate oceanic circulation systems in the past could be documented by a data (benthic foraminifers-model comparison exercise whereas future investigations are necessary in order to quantitatively compare the results with data for the deep ocean.

  4. WA18

    CERN Multimedia

    1977-01-01

    Front view. The target plates are cut from marble (3x3 m slabs surrounded by magnetized iron) and allow the use of the calorimeter as a muon polarimeter. WA18 was CHARM, the experiment of the CERN-Hamburg-Amsterdam-Rome(INFN)-Moskow(ITEP) Collaboration

  5. Paragraf 18

    DEFF Research Database (Denmark)

    Lundgaard Andersen, Linda; Neerup, Stine; Cauchi, Pernille

    Redegørelsen tegner et aktuelt billede af bredden og variationen af samarbejdet mellem de frivillige sociale foreninger og kommuner i fem udvalgte kommuner. Den giver et billede af hvilke opgaver der varetages inden for det frivillige sociale arbejde, støttet gennem § 18 midler i serviceloven og...

  6. Improved oil recovery in Mississippian carbonate reservoirs of Kansas near term Class 2. Annual report, September 18, 1994--March 15, 1997

    Energy Technology Data Exchange (ETDEWEB)

    Carr, T.R.; Green, D.W.; Willhite, G.P.

    1998-04-01

    This annual report describes progress during the second year of the project entitled {open_quotes}Improved Oil Recovery in Mississippian Carbonate Reservoirs in Kansas{close_quotes}. This project funded under the Department of Energy`s Class 2 program targets improving the reservoir performance of mature oil fields located in shallow shelf carbonate reservoirs. The focus of this project is development and demonstration of cost-effective reservoir description and management technologies to extend the economic life of mature reservoirs in Kansas and the mid-continent. As part of the project, several tools and techniques for reservoir description and management were developed, modified and demonstrated. These include: (1) a new approach to subsurface visualization using electric logs ({open_quotes}Pseudoseismic{open_quotes}); (2) a low-cost easy-to-use spreadsheet log analysis software (PfEFFER); and (3) an extension of the BOAST-3 computer program for full field reservoir simulation. The world-wide-web was used to provide rapid and flexible dissemination of the project results through the Internet. Included in this report is a summary of significant project results at the demonstration site (Schaben Field, Ness County, Kansas). These results include an outline of the reservoir description based on available and newly acquired data and reservoir simulation results. Detailed information is available on-line through the Internet. Based on the reservoir simulation, three infill wells will be drilled to validate the reservoir description and demonstrate the effectiveness of the proposed reservoir management strategies. The demonstration phase of the project has just begun and will be presented in the next annual report.

  7. Serum IL-18 Levels and Its Clinical Significance in the Blood of Patients with Delated Encephalopathy after Acute Carbon Monoxide Poisoning%急性一氧化碳中毒后迟发性脑病患者血清白介素18水平及临床意义研究

    Institute of Scientific and Technical Information of China (English)

    张萍; 王传升; 韩永凯; 赵国有; 顾家鹏; 魏蕤荭; 顾仁骏

    2013-01-01

    目的 探讨白介素18(IL-18)的水平动态变化与急性一氧化碳中毒后迟发性脑病(DEACMP)发生机制的关系,寻找其发生时可能引起的细胞因子的变化,为进一步研究DEACMP免疫学机制提供线索.方法 选择2009年1月-2011年1月住我院神经内科的DEACMP患者40例为DEACMP组及同期我院门诊体检健康者36例为对照组,应用酶联免疫吸附法分别测定DEACMP患者急性期及恢复期的血清IL-18水平,并与对照者进行比较分析.结果 DEACMP患者急性期、恢复期血清IL-18水平[(29.7±8.4)ng/L、(28.3±7.9)ng/L]均高于对照组[(24.1±5.3)ng/L、(24.1±5.3)ng/L],差异均有统计学意义(t=3.433,P=0.001;t=2.693,P=0.009).DEACMP组急性期血清IL-18水平高于恢复期差异有统计学意义(t=2.421,P=0.020).结论 IL-18可能通过迟发性免疫途径参与DEACMP的发病过程,对疾病的发展可能有一定的影响.%Objective To investigate the relationship between dynamic changes of serum IL - 18 level and mechanism of delayed encephalopathy after acute carbon monoxide poisoning ( DEACMP ) to find potential cytokine variation during DEAC-MP occurrence and to provide evidence for further study on immunological mechanism of DEACMP. Methods 40 DEACMP patients admitted to the Neurology Department of our hospital from January 2009 to January 2011 were selected as DEACMP group and another 36 healthy people underwent physical examination in the same period were selected as control group. Enzyme - linked Immunoassay ( ELISA ) method was used to detect the levels of IL - 18 in acute stage and recovery stage, and the results were compared with the control group. Results The levels of IL - 18 in DEACMP patients [ ( 29. 7 ± 8. 4 ) ng/L, ( 28. 3 ± 7. 9 ) ng/L ] were significantly higher than the control group [ ( 24. 1 ±5.3) ng/L, ( 24. 1 ±5.3 ) ng/L ] both in acute stage and recovery stage ( t =3. 433 , P = 0. 001 ; t = 2. 693 , P =0. 009 ). In DEACMP group, the IL - 18 level in

  8. LaI2@(18,3)SWNT: the unprecedented structure of a LaI2 "Crystal," encapsulated within a single-walled carbon nanotube.

    Science.gov (United States)

    Friedrichs, Steffi; Kirkland, Angus I; Meyer, Rüdiger R; Sloan, Jeremy; Green, Malcolm L H

    2005-10-01

    The novel crystallization properties of nano-materials represent a great challenge to researchers across all disciplines of materials science. Simple binary solids can be found to adopt unprecedented structures, when confined into nanometer-sized cavities, such as the inner cylindrical bore of single-walled carbon nanotubes (SWNT). Lanthanum iodide was encapsulated within SWNTs and the resulting encapsulation composite was analyzed using energy-dispersive X-ray microanalysis (EDX) and high-resolution transmission electron microscopy (HRTEM) imaging techniques, to reveal a one-dimensional crystal fragment, with the stoichiometry of LaI2, crystallizing in the structure of LaI3 with one third of the iodine positions unoccupied. A complete characterization of the encapsulation composite was achieved using an enhanced image restoration technique, which restores the object wave from a focal series of HRTEM images, providing information about the precise structural data of both filling material and host SWNT, and thereby enabling the identification of the SWNT chirality.

  9. Application of poly 1,8-diaminonaphthalene/multiwalled carbon nanotubes-COOH hybrid material as an efficient sorbent for trace determination of cadmium and lead ions in water samples.

    Science.gov (United States)

    Nabid, Mohammad Reza; Sedghi, Roya; Behbahani, Mohammad; Arvan, Behnoush; Heravi, Majid M; Oskooie, Hossein Abdi

    2014-07-01

    Poly 1,8-diaminonaphthalene/multiwalled carbon nanotubes-COOH hybrid material as an effective sorbents in solid phase extraction has been developed for the separation and preconcentration of Cd(II) and Pb(II) at trace levels in environmental water samples. The results indicate that the novel nanocomposite show a high affinity for these heavy metals due to the presence of several good extractive sites, which are introduced to the synthesized nanocomposite The maximum adsorption capacity of the synthesized sorbent for cadmium and lead ions was found to be 101.2 and 175.2 mg g(-1) , respectively. The detection limits of this method were 0.09 and 0.7 ng ml(-1) for Cd(II) and Pb(II), respectively.

  10. Carbon Tetrachloride Flow and Transport in the Subsurface of the 216-Z-18 Crib and 216-Z-1A Tile Field at the Hanford Site: Multifluid Flow Simulations and Conceptual Model Update

    Energy Technology Data Exchange (ETDEWEB)

    Oostrom, Mart; Rockhold, Mark L.; Thorne, Paul D.; Last, George V.; Truex, Michael J.

    2006-10-31

    Carbon tetrachloride (CT) was discharged to the 216-Z-9, Z-1A, and Z-18 waste sites that are included in the 200-PW-1 Operable Unit in Hanford 200 West Area. Fluor Hanford, Inc. is conducting a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) remedial investigation/feasibility study (RI/FS) for the 200-PW-1 Operable Unit. As part of this overall effort, Pacific Northwest National Laboratory (PNNL) was contracted to improve the conceptual model of how CT is distributed in the Hanford 200 West Area subsurface through use of numerical flow and transport modeling. This work supports the U.S. Department of Energy's (DOE's) efforts to characterize the nature and distribution of CT in the 200 West Area and subsequently select an appropriate final remedy.

  11. 我国9省(市)3~18岁儿童青少年碳酸饮料消费现状分析%Analysis on status of carbonated beverage consumption among children and adolescents aged 3 -18 years in ;nine provinces of China

    Institute of Scientific and Technical Information of China (English)

    刘飒娜; 陶婉亭; 毛伟峰; 刘爱东; 刘兆平; 张兵

    2015-01-01

    Objective To learn status of carbonated beverage consumption among children and adolescents aged 3 -18 years in nine provinces of China and provide scientific evidence for instruction on soft drinks consumption of children and youth .Methods Multi-stage stratified random sampling method was used and 2585 children of youth aged 3 -18 years among 9 provinces were selected in 2013.Consumption data were collected by using consecutive 3 day 24h recalls and one month food frequency survey.Results Differences of consumption were found among 3 -18 years old children and youth regarding to both amout and frequency in nine provinces.Subjectives in urban areas have higher consumption ratio of 45.1%than those in rural area (χ2 =19.529,P <0.01).Children aged 7 -13 years have the highest consumption frequency of 1 -3 times per week in view of soda drinks,which is around 45.4%.Children and youth in urban area consumed higher amount of carbonated beverage than those in rural area (P < 0.05 ), which is 31.4mL/d and 15.1mL/d respectively.Meanwhile,male subjectives drank more carbonated beverage than female subjectives (P <0.05),which is 28.8 mL/d and 19.5 mL/d respectively.The average amount of consumption was highest in subjectives from families at mid-dle income level,followed by that of families at high and low income levels,which were 19.7 mL/d,28.5 mL/d and 19.2 mL/d respectively.Conclusion The consumption of carbonated beverage manifested an increasing trend among children and youth in China .Subsequently,effective intervention measures should be applied to instruct children and youth to select and consume carbonated beverage wisely.%目的:了解我国9省(市)3~18岁儿童青少年碳酸饮料消费现状,为指导我国儿童青少年饮料合理消费提供科学依据。方法采用多阶段分层随机整群抽样方法,2013年在我国9个省(市)选取了2585名3~18岁儿童青少年;消费量数据采用非连续3d 24h 回顾法和

  12. Carbon black and vapor grown carbon fibers binary conductive additive for the Li{sub 1.18}Co{sub 0.15}Ni{sub 0.15}Mn{sub 0.52}O{sub 2} electrodes for Li-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Bian, Xiaofei; Fu, Qiang; Qiu, Chengguang; Bie, Xiaofei; Du, Fei; Wang, Yuhui; Zhang, Yongquan; Qiu, Hailong [Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics, Jilin University, Changchun 130012 (China); Chen, Gang [Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics, Jilin University, Changchun 130012 (China); State Key Laboratory of Superhard Materials, Jilin University, Changchun 130012 (China); Wei, Yingjin, E-mail: yjwei@jlu.edu.cn [Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics, Jilin University, Changchun 130012 (China)

    2015-04-15

    Carbon black (CB) and vapor-grown carbon fibers (VGCFs) are used as conductive additives for the Li{sub 1.18}Co{sub 0.15}Ni{sub 0.15}Mn{sub 0.52}O{sub 2} electrodes for Li-ion batteries. The fibrous VGCFs can bridge the isolated Li{sub 1.18}Ni{sub 0.15}Co{sub 0.15}Mn{sub 0.52}O{sub 2} regions, thus construct an effective conductive network for electron transport. In addition, incorporation of CB and VGCFs can improve the electrochemical kinetics of the cathode material by retarding the harmful side reactions, promoting the charge transfer reactions and increasing the apparent lithium diffusion coefficient. In all electrodes under investigation, the one prepared with 3 wt.% of VGCFs and 12 wt.% of CB shows the largest discharge capacity of 252 mAh g{sup −1} at the 0.2C rate with excellent capacity retention and rate capability. - Highlights: • CB/VGCFs binary conductive additive is used for Li-excess layered cathode electrode. • The binary conductive additive constructs a continuous network for electron transport. • The binary conductive additive improves the electrochemical kinetics of the electrode. • Improved electrochemical performance is gained using the binary conductive additive.

  13. Carbon dioxide, hydrographic, and chemical data obtained during the R/V Meteor Cruise 18/1 in the North Atlantic Ocean (WOCE Section A1E, September 1991)

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, K.M.; Wallace, D.W.R. [Brookhaven National Laboratory, Upton, NY (United States); Schneider, B. [Institut fuer Ostseeforschung, Rostock-Warnemuende (Germany); Mintrop, L. [Institut fuer Meereskunde, Kiel (Germany); Kozyr, A. [Oak Ridge National Laboratory, TN (United States)

    1996-07-01

    The North Atlantic Ocean is characterized by an intense meridional circulation cell carrying near-surface waters of tropical and subtropical origin northward and deep waters of arctic and subarctic origin southward. The related {open_quotes}overturning{close_quotes} is driven by the sinking of water masses at high latitudes. The overturning rate and thus the intensity of the meridional transports of mass, heat, and salt, is an important control parameter for the modeling of the ocean`s role in climate. The Research Vessel (R/V) Meteor Cruise 18/1 was one in a series of cruises in the North Atlantic that started in March 1991 and continued until 1995. This data documentation discusses the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations, as well as underway partial pressure of CO{sub 2} (pCO{sub 2}) measured during the RIV Meteor Cruise 18/1 in the North Atlantic Ocean (Section A1E). Conducted as part of the World Ocean Circulation Experiment (WOCE) and the German North Atlantic Overturning Rate Determination expedition, the cruise began in Reykjavik, Iceland, on September 2, 1991, and ended after 24 days at sea in Hamburg, Germany, on September 25, 1991. WOCE Zonal Section AlE began at 60{degrees}N and 42{degrees}30{prime} W (southeast of Greenland) and continued southeast with a closely spaced series of hydrocasts to 52{degrees}20{prime} N and 14{degrees}15{prime} W (Porcupine Shelves). Measurements made along WOCE Section AlE included pressure, temperature, salinity, and oxygen measured by a conductivity, temperature and depth (CTD) sensor; bottle salinity; oxygen; phosphate; nitrate; nitrite; silicate; TCO{sub 2}; TALK; and underway pCO{sub 2}. A total of 61 CTD casts were made, including 59 bottle casts and 2 calibration stations.

  14. A comparative study of carbon-11 methionine PET and Fluorine-18 fluorodeoxyglucose PET for the differentiation of benign lesion and low grade glioma%11碳-蛋氨酸与18氟-脱氧葡萄糖在脑良性病变及低级别胶质瘤诊断中的比较

    Institute of Scientific and Technical Information of China (English)

    王欣璐; 韩立新; 尹吉林; 王成; 姜丽莎; 谭思婷; 王伟民

    2015-01-01

    界的显示均明显优于18 F-FDG FDG,11 C-MET 还可检测和随访低级别胶质瘤(即惰性肿瘤)的生长情况,可为临床提供更多诊断、预后及治疗信息,因此,11 C-MET 可常规应用于脑内占位病变的显示,且其效果优于18 F-FDG.%Aim:As the study of Carbon-11 methionine (MET)and fluorine-18 fluorodeoxyglucose (FDG)in differentiating brain benign and low grade glioma was seldom.The aim of this study was to de-termine the effect of these two tracers for distinguishing two groups of patients and evaluating the extent of lesions.Methods:Both carbon-11 MET and fluorine-18 FDG have been used to evaluate brain benign and low grade glioma (LGG).MET positron emission tomography (PET)and FDG PET were all per-formed in 22 patients (5 brain benign lesions,17 low grade glioma WHO grade I and II)within one week for a single patient,Both MET and FDG uptake of the lesions were evaluated by a semiquantitative analy-sis using the standardized uptake value.The Tumor/normal brain uptake ratio (T/N ratio)were calculat-ed in two groups of patients.Results:MET uptake was not significantly different among these two groups (benign:1.59 ±0.28 and LGG:1.52 ±0.48).Similarily,FDG uptake was not significantly different among the two groups (benign:0.91 ±0.48 and 0.77 ±0.65)also.No significantly correlation was ob-served between MET uptake and FDG uptake.19 /22 hypermetabolization of patients were found in MET PET and 17 /22 hypometabolization of patients were found in FDG PET.The extents of increased MET uptake in 17 cases were larger than that of the increased FDG uptake.Conclusion:It is found that both MET and FDG are not useful for distinguishing with benign and LGG.MET was found to be highly useful for detecting benign and LGG,and for evaluating the extent of these lesions which were blurred in FDG PET.MET was also useful for monitoring the growth of LGG.In a word,MET was considered as routine examination for brain lesions.

  15. Etude de la migration des interstitiels dans des austenites Fe, Cr (18), Ni (14) pures et industrielles par irradiation dans un microscope a tres haute tension: Role du carbone et du titane

    Science.gov (United States)

    Housseau, N.; Pelissier, J.

    1983-12-01

    Nous avons étudié le rôle des impurtés (C ou Ti) dans la condensation et la migration des défauts interstitiels. Les échantillons étudiés sont des aciers austénitiques: (a) acier de synthèse de haute pureté (Cr 18, Ni 14, Fe) avec ou sans carbone; (b) acier industriel avec C (800 ppm) ou Ti (0,45%). Les échantillons ont été irradiés dans un microscope à très haute tension aux doses allant de 10 -4 jusqu'à 10 -1 dpa aux températures de 300°C à 400°C. Dans de telles conditions les défauts observés sont des boucles interstitielles. L'étude de la variation de l'épaisseur de la zone dénudée près du bord de la lame mince en fonction de la température nous a permis d'évaluer l'énergie de migration effective de l'interstitiel dans ces alliages. Dans l'austénite de synthèse carburée ou non sa valeur est de 0.8 eV. Dans l'acier industriel au titane carburé ou non on obtient 2.0 eV. Nous n'avons pas observé d'effet lié au carbone. L'examen de la densité de boucles à saturation dans les divers aciers suggère une forte énergie de liaison interstitiel-titane. Cette énergie de liaison, si l'ont admet que le titane est la seule impureté agissante du système, peut être estimée à 1.2 eV.

  16. Effects of carbon nanomaterials fullerene C{sub 60} and fullerol C{sub 60}(OH){sub 18-22} on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Socoowski Britto, Roberta; Longaray Garcia, Marcia; Martins da Rocha, Alessandra [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Artigas Flores, Juliana [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Pinheiro, Mauricio V. Brant [Departamento de Fisica, ICEx, Universidade Federal de Minas Gerais, MG (Brazil); Monserrat, Jose Maria [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Ribas Ferreira, Josencler L., E-mail: josenclerf@gmail.com [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil)

    2012-06-15

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C{sub 60}), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C{sub 60}(OH){sub 18-22}), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO{center_dot}) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO{center_dot} in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen ({sup 1}O{sub 2}) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p < 0.05) increase in lipid peroxidation (with greater damage under illumination), a decrease in GCL activity, and the depletion of GSH stocks (under illumination), all of which were attributed to {sup 1}O{sub 2} generation; and (3) fullerol also decreased GCL activity and GSH formation (p < 0.05) but without lipid damage. The overall results show that fullerene can be toxic with or without light incidence, whereas UV radiation seems to play a key role in the environmental toxicity of carbon NMs through {sup 1}O{sub 2} formation.

  17. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Atlantic Ocean from 2010-11-27 to 2013-02-18 (NODC Accession 0117059)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0117059 includes time series data collected from MOORINGS in the North Atlantic Ocean from 2010-11-27 to 2013-02-18 and retrieved during cruise...

  18. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 (NODC Accession 0084099)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0084099 includes time series data collected from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 and retrieved during cruise...

  19. F-18 labeled 3-fluorodiazepam

    Energy Technology Data Exchange (ETDEWEB)

    Luxen, A.; Barrio, J.R.; Bida, G.T.; Satyamurthy, N.; Phelps, M.E.

    1985-05-01

    3-Fluorodiazepam is a new and potent antianxiety agent with prolonged action. The authors found that molecular fluorine (0.5% in Ne) reacts cleanly with diazepam in freon or chloroform at room temperature to produce 3-fluorodiazepam in good yields. Successful syntheses have employed 2:1 to 5:1 molar ratios diazepam: fluorine to minimize the formation of byproducts. (/sup 18/F) 3-Fluorodiazepam, a potential candidate for PET studies, (specific activity 3-5 Ci/mmol) has been synthesized from /sup 18/F-F/sub 2/ using the same procedure, followed by column chromatographic purification (Silicagel, dichloromethane: ethyl acetate, 5:1) with a radiochemical yield of 12-20% (50% maximum) and a chemical and radiochemical purity >99% as judged by reversed-phase high pressure liquid chromatography analysis (Ultrasyl octyl column, 10 ..mu.. m, 4.6 x 250 mm i.d., 60% MeOH 40% water; flow rate, 1.0 ml/min; retention time for (/sup 18/F) fluorodiazepam, 11.4 min; for diazepam, 13.5 min; radioactivity and ultraviolet detectors). Lower radiochemical yields (5-7%), and significant formation of by-products were observed when (/sup 18/F)acetylhypofluorite, prepared in the gasphase, was used as the reagent. Readily accessible routes to /sup 18/F-labeled benzodiazepines of higher specific activity were also investigated. Approaches to the synthesis of high specific activity (>200 Ci/mmol) (/sup 18/F)3-fluorodiazepam involve nucleophilic displacement at carbon-3 (e.g. from 3-chlorodiazepam) with (/sup 18/F)fluoride ion. The results presented here demonstrate the synthetic accessibility of /sup 18/F-labeled benzodiazepines for application in neurotransmitter ligand studies with PET.

  20. [18F]Fluoride recovery via gaseous [18F]HF

    DEFF Research Database (Denmark)

    Mathiessen, Bente; Jensen, Mikael; Zhuravlev, Fedor

    2011-01-01

    Acidification of target water with H2SO4 in a specially constructed glassy carbon/polyethylene apparatus allowed for recovery of up to 82% of [18F]fluoride as [18F]HF gas. The [18F]HF distillate was found to be acid-free but moist; when passed through a solution of tBuPh2SiOTf, it yielded [18F......]tBuPh2SiF. The multivariate design of experiment showed that the key to high yield of [18F]HF was the efficient degassing of the reaction mixture....

  1. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the Hokusei Maru in the North Pacific Ocean from 1998-07-18 to 1998-08-18 (NODC Accession 0112239)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112239 includes chemical, discrete sample, physical and profile data collected from Hokusei Maru in the North Pacific Ocean from 1998-07-18 to...

  2. 6,12,18,24-Tetra-meth-oxy-4,10,16,22-tetra-kis-[(meth-oxy-carbon-yl)meth-oxy]-2,8,14,20-tetra-kis-(2-phenyl-eth-yl)resorcin[4]arene.

    Science.gov (United States)

    Pansuriya, Pramod B; Friedrich, Holger B; Maguire, Glenn E M

    2012-01-01

    The title compound, C(76)H(80)O(16), is a macrocyclic structure. This novel resorcin[4]arene derivative has (meth-oxy-carbon-yl)meth-oxy 'head' groups on the upper rim. The compound has a C(2v) 'boat' geometry and there are a range of C-H⋯O contacts in the crystal structure.

  3. Carbon Carbon Composites: An Overview .

    Directory of Open Access Journals (Sweden)

    G. Rohini Devi

    1993-10-01

    Full Text Available Carbon carbon composites are a new class of engineering materials that are ceramic in nature but exhibit brittle to pseudoplastic behaviour. Carbon-carbon is a unique all-carbon composite with carbon fibre embeded in carbon matrix and is known as an inverse composite. Due to their excellent thermo-structural properties, carbon-carbon composites are used in specialised application like re-entry nose-tips, leading edges, rocket nozzles, and aircraft brake discs apart from several industrial and biomedical applications. The multidirectional carbon-carbon product technology is versatile and offers design flexibility. This paper describes the multidirectional preform and carbon-carbon process technology and research and development activities within the country. Carbon-carbon product experience at DRDL has also been discussed. Development of carbon-carbon brake discs process technology using the liquid impregnation process is described. Further the test results on material characterisation, thermal, mechanical and tribological properties are presented.

  4. Selective determination of ascorbic acid with a novel hybrid material based 1-butyl-3-methylimidazolium tetrafluoroborate ionic liquid and the Dawson type ion [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} immobilized on glassy carbon

    Energy Technology Data Exchange (ETDEWEB)

    Ammam, Malika, E-mail: Malika.Ammam@uoit.c [Faculty of Science, University of Ontario Institute of Technology, 2000 Simcoe Street North, Oshawa, ON, L1H 7K4 (Canada); Easton, E. Bradley [Faculty of Science, University of Ontario Institute of Technology, 2000 Simcoe Street North, Oshawa, ON, L1H 7K4 (Canada)

    2011-02-28

    In this study, we synthesized a new hybrid material using well-Dawson K{sub 6}[P{sub 2}Mo{sub 18}O{sub 62}].nH{sub 2}O and a room temperature ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate ([BMIM][BF{sub 4}]). CHN elemental analysis showed that one mole of [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} reacts with 6 moles of [BMIM]{sup +} to form [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62}. FT-IR spectra showed the presence of both 1-butyl-3-methylimidazolium cation and the Dawson anion. TG analysis displayed a relative thermal stability of the hybrid material compared to the parent Dawson POM. The new hybrid material [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} was immobilized on glassy carbon (GC) electrode and the modified electrode was investigated by cyclic voltammetry and amperometry. Compared to the electrochemical behavior of dissolved [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-}, a slight shift in the redox peaks towards negative potentials is observed for the immobilized [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62}. The relationship between the peak currents of the deposited [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} film and scan rate is shown to be linear, which demonstrates a surface-confined electron transfer processes. [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified electrode showed high sensitivities towards pH and shown to be active even at neutral pH. [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified GC electrode was subjected to cyclic voltammetry and amperometry in the presence of ascorbic acid (AA) and found to exhibit a remarkable catalytic activity towards the oxidation of AA. The catalytic oxidation peak of AA at [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified GC electrode occurs at low potential of {approx}0 V vs Ag/AgCl at neutral pH and shifts to more positive potentials when pH decreases. Comparison between [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} and [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} modified GC films towards the oxidation of AA suggests that

  5. 27 CFR 18.18 - Execution under penalties of perjury.

    Science.gov (United States)

    2010-04-01

    ... of perjury. 18.18 Section 18.18 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... Administrative and Miscellaneous Provisions Document Requirements § 18.18 Execution under penalties of perjury... perjury, it will be so executed, as defined in § 18.11, and signed by an authorized person. (Act of...

  6. 喷射成形1.8C-1.6Al超高碳钢快速凝固组织研究%Microstructure of Rapid Solidification of Spray Formed 1.8C-1.6Al Ultra-High Carbon Steel

    Institute of Scientific and Technical Information of China (English)

    王军; 徐政; 史海生; 林一坚; 章靖国

    2003-01-01

    铸造1 8C-1.6Al超高碳钢(UHCS)由于冷速较低,晶粒粗大,珠光体片间距也较大,晶界形成了粗大的碳化物网络,同时合金元素产生偏析,晶内生成了大块的合金渗碳体,使得它在室温下为脆性,机加工性能极差.喷射成形1.8C-1.6Al超高碳钢则利用喷射成形工艺冷却速度大的特点细化了晶粒,减小了珠光体的片间距,提高了硬度与强度,同时降低了元素偏析程度.同时发现:在铸态1.8C-1.6Al超高碳钢中和在喷射成形1.8C-1.6Al超高碳钢中Al在晶内的分布情况正好相反,由反偏析转变为正偏析.

  7. Main: RSEPVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available RSEPVGRP18 S000289 10-Feb-2000 (last modified) seki RSE (root-specific element) fou...n in stem; See S000288, S000099; RSE; grp1.8; vascular; root; stem; shoot; bean (Phaseolus vulgaris) CATCCAACTTTCATATCCATGTGCTT ...

  8. 22 CFR 18.18 - Proposed findings and conclusions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Proposed findings and conclusions. 18.18 Section 18.18 Foreign Relations DEPARTMENT OF STATE PERSONNEL REGULATIONS CONCERNING POST EMPLOYMENT CONFLICT OF INTEREST Administrative Enforcement Proceedings § 18.18 Proposed findings and...

  9. 29 CFR 18.18 - Written interrogatories to parties.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Written interrogatories to parties. 18.18 Section 18.18 Labor Office of the Secretary of Labor RULES OF PRACTICE AND PROCEDURE FOR ADMINISTRATIVE HEARINGS BEFORE THE OFFICE OF ADMINISTRATIVE LAW JUDGES General § 18.18 Written interrogatories to parties....

  10. Anatomy of trisomy 18.

    Science.gov (United States)

    Roberts, Wallisa; Zurada, Anna; Zurada-ZieliŃSka, Agnieszka; Gielecki, Jerzy; Loukas, Marios

    2016-07-01

    Trisomy 18 is the second most common aneuploidy after trisomy 21. Due to its multi-systemic defects, it has a poor prognosis with a 50% chance of survival beyond one week and a trisomy 18. As a result, a review of the anatomy associated with this defect is imperative. While any of the systems can be affected by trisomy 18, the following areas are the most likely to be affected: craniofacial, musculoskeletal system, cardiac system, abdominal, and nervous system. More specifically, the following features are considered characteristic of trisomy 18: low-set ears, rocker bottom feet, clenched fists, and ventricular septal defect. Of particular interest is the associated cardiac defect, as surgical repairs of these defects have shown an improved survivability. In this article, the anatomical defects associated with each system are reviewed. Clin. Anat. 29:628-632, 2016. © 2016 Wiley Periodicals, Inc.

  11. Monosomy 18p

    Directory of Open Access Journals (Sweden)

    Turleau Catherine

    2008-02-01

    Full Text Available Abstract Monosomy 18p refers to a chromosomal disorder resulting from the deletion of all or part of the short arm of chromosome 18. The incidence is estimated to be about 1:50,000 live-born infants. In the commonest form of the disorder, the dysmorphic syndrome is very moderate and non-specific. The main clinical features are short stature, round face with short philtrum, palpebral ptosis and large ears with detached pinnae. Intellectual deficiency is mild to moderate. A small subset of patients, about 10–15 percent of cases, present with severe brain/facial malformations evocative of holoprosencephaly spectrum disorders. In two-thirds of the cases, the 18p- syndrome is due to a mere terminal deletion occurring de novo, in one-third the following are possible: a de novo translocation with loss of 18p, malsegregation of a parental translocation or inversion, or a ring chr18. Parental transmission of the 18p- syndrome has been reported. Cytogenetic analysis is necessary to make a definite diagnosis. Recurrence risk for siblings is low in de novo deletions and translocations, but is significant if a parental rearrangement is present. Deletion 18p can be detected prenatally by amniocentesis or chorionic villus sampling and cytogenetic testing. Differential diagnosis may include a wide number of syndromes with short stature and mild intellectual deficiency. In young children, deletion 18p syndrome may be vaguely evocative of either Turner syndrome or trisomy 21. No specific treatment exists but speech therapy and early educational programs may help to improve the performances of the children. Except for the patients with severe brain malformations, the life expectancy does not seem significantly reduced.

  12. 纯化处理对碳纳米管2~18GHz复介电常数与复磁导率的影响%Effect of purification on 2 ~ 18GHz complex permittivity and complex permeability of carbon nanotubes

    Institute of Scientific and Technical Information of China (English)

    李聃; 李泉注; 隋刚; 徐化明; 肖旭; 梁吉

    2004-01-01

    研究了纯化处理对多壁碳纳米管2~18GHz复介电常数与复磁导率的影响.纯化处理在部分频段降低了复介电常数的实部与虚部,增强了复磁导率的实部,而对复磁导率的虚部几乎没有影响.通过拉曼光谱对不同纯化处理的样品进行了表征,研究发现碳纳米管的晶化程度越好,介电常数降低和磁导率实部增强的幅度越大.

  13. Trisomi 18 Edwards Sendromu

    OpenAIRE

    Tüysüz, Beyhan; Yanar, Ufuk; ÖZGÜR, Bülent; Erginel, Ayten; Cenani, Asım

    1996-01-01

    İntrauterin gelişme geriliği kraniofasiyal dismorfizm fleksiyon kontraktürleri konjenital kalp anomalisi ve kliteromegalisi olan 45 günlük bir kız çocuğuna klinik olarak trisomi 18 tanısı kondu Kromozom analizi 47 XX 18 bulundu Down sendromundan sonra en sık rastlanan otosomal kromozom anomalisi olan trisomi 18 sendromunda yaşam süresi kısadır ve tekrarlama riski normal populasyona göre yüksektir Bu nedeniyle düşünüldüğünde gecikmeden karyogram yapılmalı ve aileye genetik danışma verilmelidir...

  14. The trisomy 18 syndrome

    Directory of Open Access Journals (Sweden)

    Cereda Anna

    2012-10-01

    Full Text Available Abstract The trisomy 18 syndrome, also known as Edwards syndrome, is a common chromosomal disorder due to the presence of an extra chromosome 18, either full, mosaic trisomy, or partial trisomy 18q. The condition is the second most common autosomal trisomy syndrome after trisomy 21. The live born prevalence is estimated as 1/6,000-1/8,000, but the overall prevalence is higher (1/2500-1/2600 due to the high frequency of fetal loss and pregnancy termination after prenatal diagnosis. The prevalence of trisomy 18 rises with the increasing maternal age. The recurrence risk for a family with a child with full trisomy 18 is about 1%. Currently most cases of trisomy 18 are prenatally diagnosed, based on screening by maternal age, maternal serum marker screening, or detection of sonographic abnormalities (e.g., increased nuchal translucency thickness, growth retardation, choroid plexus cyst, overlapping of fingers, and congenital heart defects . The recognizable syndrome pattern consists of major and minor anomalies, prenatal and postnatal growth deficiency, an increased risk of neonatal and infant mortality, and marked psychomotor and cognitive disability. Typical minor anomalies include characteristic craniofacial features, clenched fist with overriding fingers, small fingernails, underdeveloped thumbs, and short sternum. The presence of major malformations is common, and the most frequent are heart and kidney anomalies. Feeding problems occur consistently and may require enteral nutrition. Despite the well known infant mortality, approximately 50% of babies with trisomy 18 live longer than 1 week and about 5-10% of children beyond the first year. The major causes of death include central apnea, cardiac failure due to cardiac malformations, respiratory insufficiency due to hypoventilation, aspiration, or upper airway obstruction and, likely, the combination of these and other factors (including decisions regarding aggressive care. Upper airway

  15. Trisomy 18 (Edwards Syndrome

    Directory of Open Access Journals (Sweden)

    Masoud Poureisa

    2009-01-01

    Full Text Available Description and Definition "n"n Synonym: Edward syndrome Characterized by malformations of multiple organ systems, trisomy 18 has an incidence of 3 in 10000 live births. Abnormalities detectable by ultrasound Common findings Agenesis of the corpus callosum Choroid plexus cysts Posterior fossa abnormalities Micrognathia Low-set ears Microphthalmous Hypertelorism Short radial ray Clenched hand with overlapping index finger Clubbed foot Rocker-bottom foot Renal anomalies hydronephrosis Omphalocele Diaphragmatic hernia Cryptorchidism Heart defects Single umbilical artery Intrauterine growth restriction Polyhydramnios Nuchal lucency Occasional findings Meningomyelocele Ventriculomegaly Cleft lip and plate Major differential diagnoses Freeman-Sheldon syndrome (clenched hands and intrauterine growth restriction Pena Shokeir syndrome (pseudo-trisomy 18 Smith-Lemli-Opitz syndrome (clenched hands and intrauterine grown restriction Triploidy (intrauterine growth restriction Trisomy 9 Other multiple malformation syndromes associated with intrauterine growth retardation, limb anomalies and/ or heart defects. Ultrasound diagnosis Prenatal; ultrasound diagnosis has been established in the first trimester, based on the finding of a nuchal lucency. Detectable features on the early second trimester include abnormal forearms, clenched hands, clubbed feet, omphalocele and a major heart defect. The features of trisomy 18 are detectable in 80% of affected fetuses in the second trimester. Sonography is often used to evaluate fetuses for the prsence of trisomy 18 when choroid plexus cysts are present, or when the triple screen results in a low level of maternal serum alpha- fetoprotein, estriol and human chorionic  gonadotropin combination. Although trisomy 18 occurs in 1 in 100 fetuses with choroid plexus cysts, if it is an isolated finding, the risk for trisomy 18 falls below 1 in 400. Documenting an open hand is very helpful as most fetuses with trisomy 18 are

  16. EDITORIAL: Optical Fibre Sensors 18 (OFS-18)

    Science.gov (United States)

    Jones, Julian D. C.; Tatam, Ralph P.

    2007-10-01

    The International Conference on Optical Fibre Sensors (OFS-18) was held in October 2006 in Cancún, Mexico, under the general chairmanship of Dr Alexis Mendez (MCH Engineering LLC, USA) and Dr Fernando Mendoza (Centro de Investigaciones en Optica, Mexico). 'OFS', as it has become known, is firmly established as the leading international conference for the optical fibre sensor community. Since its inception, in London in 1983, and under the leadership of an international steering committee independent of any learned society or professional institution, it has been held approximately every eighteen months. The venue nominally rotates from Europe, to the Americas, and thence to Asia and the Pacific. OFS-18 demonstrated the continuing vigour of the community, with some 250 papers presented, plus two workshops, with attendance as international as ever. In recent years, it has become a tradition to publish a post-conference special issue in the journal Measurement Science and Technology, and these special issues offer a representative sample of the current status of the field. In the nearly 25 years since OFS began, many of the early ideas and laboratory-based proof-of-principle experiments have led to highly developed instrumentation systems, and to successful commercial products. Perhaps the most mature of all of these technologies is the optical fibre gyroscope, with the fibre hydrophone a close second—originally developed for defence applications for which it is now established, but with increasing relevance to the oil and gas industry; electromagnetic sensors based on the Faraday and electro-optic effects are of growing significance in the power generation and distribution industry; whilst in-fibre grating-based sensors occupy an expanding niche in structural monitoring, especially in civil engineering. It is therefore appropriate that the first day of OFS was devoted to workshops on structural health monitoring, and to commemorate the 30th anniversary of the

  17. At WA18

    CERN Multimedia

    1978-01-01

    By July 1978 the CERN-Hamburg-Amsterdam-Rome-Moskow Collaboration (CHARM) has set up the experiment WA18, behind WA1 (on the right), in the neutrino wide-band (WBB) and narrow-band (NBB) beams, at the West Area Neutrino Facility (WANF)and started data taking data.

  18. Carbon isotope anomalies in carbonates of the Karelian series

    Science.gov (United States)

    Iudovich, Ia. E.; Makarikhin, V. V.; Medvedev, P. V.; Sukhanov, N. V.

    1990-07-01

    Results are presented on carbon isotope distributions in carbonates of the Karelian complex. A highly anomalous isotopic composition was found in carbonate rocks aged from 2.6 to 1.9 b.y. In the stromatolitic carbonates of the Onega water table, delta-(C-13) reaches a value of +18 percent, while the shungite layer of the Zaonega horizon is characterized by a wide dispersion (from +7.9 to -11.8 percent). These data are in good agreement with the known geochemical boundary (about 2.2 b.y. ago) in the history of the earth.

  19. Microbially mediated mineral carbonation

    Science.gov (United States)

    Power, I. M.; Wilson, S. A.; Dipple, G. M.; Southam, G.

    2010-12-01

    implemented and economically efficient alternative to other technologies currently under development for mineral sequestration. Dismukes GC, Carrieri D, Bennette N, Ananyev GM, Posewitz MC (2008) Aquatic phototrophs: efficient alternatives to land-based crops for biofuels. Current Opinion in Biotechnology, 19, 235-240. Ferris FG, Wiese RG, Fyfe WS (1994) Precipitation of carbonate minerals by microorganisms: Implications of silicate weathering and the global carbon dioxide budget. Geomicrobiology Journal, 12, 1-13. Lackner KS, Wendt CH, Butt DP, Joyce EL, Jr., Sharp DH (1995) Carbon dioxide disposal in carbonate minerals. Energy, 20, 1153-1170. Power IM, Wilson SA, Thom JM, Dipple GM, Gabites JE, Southam G (2009) The hydromagnesite playas of Atlin, British Columbia, Canada: A biogeochemical model for CO2 sequestration. Chemical Geology, 206, 302-316. Thompson JB, Ferris FG (1990) Cyanobacterial precipitation of gypsum, calcite, and magnesite from natural alkaline lake water. Geology, 18, 995-998.

  20. Genetics Home Reference: trisomy 18

    Science.gov (United States)

    ... All Close All Description Trisomy 18 , also called Edwards syndrome, is a chromosomal condition associated with abnormalities in ... Names for This Condition complete trisomy 18 syndrome Edwards syndrome trisomy 18 syndrome trisomy E syndrome Related Information ...

  1. 18 CFR 808.18 - Settlement by agreement.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Settlement by agreement. 808.18 Section 808.18 Conservation of Power and Water Resources SUSQUEHANNA RIVER BASIN COMMISSION HEARINGS AND ENFORCEMENT ACTIONS Compliance and Enforcement § 808.18 Settlement by agreement. (a)...

  2. 18 CFR 1312.18 - Confidentiality of archaeological resource information.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Confidentiality of archaeological resource information. 1312.18 Section 1312.18 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY PROTECTION OF ARCHAEOLOGICAL RESOURCES: UNIFORM REGULATIONS § 1312.18 Confidentiality...

  3. 18 CFR 1b.18 - Right to submit statements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Right to submit statements. 1b.18 Section 1b.18 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.18 Right to...

  4. 18 CFR 2.18 - Phased electric rate increase filings.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Phased electric rate increase filings. 2.18 Section 2.18 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... Policy and Interpretations Under the Federal Power Act § 2.18 Phased electric rate increase filings....

  5. A carbon sink pathway increases carbon productivity in cyanobacteria.

    Science.gov (United States)

    Oliver, John W K; Atsumi, Shota

    2015-05-01

    The burning of fossil reserves, and subsequent release of carbon into the atmosphere is depleting the supply of carbon-based molecules used for synthetic materials including plastics, oils, medicines, and glues. To provide for future society, innovations are needed for the conversion of waste carbon (CO2) into organic carbon useful for materials. Chemical production directly from photosynthesis is a nascent technology, with great promise for capture of CO2 using sunlight. To improve low yields, it has been proposed that photosynthetic capacity can be increased by a relaxation of bottlenecks inherent to growth. The limits of carbon partitioning away from growth within the cell and the effect of partitioning on carbon fixation are not well known. Here we show that expressing genes in a pathway between carbon fixation and pyruvate increases partitioning to 2,3-butanediol (23BD) and leads to a 1.8-fold increase in total carbon yield in the cyanobacterium Synechococcus elongatus PCC 7942. Specific 2,3-butanediol production increases 2.4-fold. As partitioning increases beyond 30%, it leads to a steep decline in total carbon yield. The data suggests a local maximum for carbon partitioning from the Calvin Benson cycle that is scalable with light intensity.

  6. Carbonized asphaltene-based carbon-carbon fiber composites

    Energy Technology Data Exchange (ETDEWEB)

    Bohnert, George; Lula, James; Bowen, III, Daniel E.

    2016-12-27

    A method of making a carbon binder-reinforced carbon fiber composite is provided using carbonized asphaltenes as the carbon binder. Combinations of carbon fiber and asphaltenes are also provided, along with the resulting composites and articles of manufacture.

  7. EUROTHERM Seminar No. 18

    CERN Document Server

    Heggs, Peter; Butterworth, David

    1992-01-01

    The Eurotherm Committee was created in 1986 from member countries of the European Community. It has the purpose of organising and coordinating scientific events such as seminars and conferences in the thermal sciences. The series of Eurotherm Seminars established by the Committee has become a popular forum for high-level scientific and technical interchange of ideas in a wide range of specialist topics. While the presentation and publication of papers at the Seminars are encouraged, the primary aim is to stimulate discussion and liaison between specialist groups. The present Chairman of Eurotherm is Professor C.J. Hoogendoorn of the Technical University, Delft (Fax [NL] 15, 783251). Information on Mure Seminars is available from the Secretary, Keith Cornwell, Heriot-Watt University, Edinburgh (Fax [UK] 31, 451, 3129). This particular Seminar No. 18 on the Design and Operation of Heat Exchangers was the first one on this topic and was held at the Universitat der Bundeswehr Hamburg (University of the Federal Ar...

  8. DETERGENCY OF THE 12 TO 18 CARBON SATURATED FATTY ACIDS

    Science.gov (United States)

    saturated fatty acids ) were explored to determine the relationship of the detergencies of such systems to the physico-chemical nature (HLB, hydrophile...suggested that in such systems the chief action is van der Waals adsorption between hydr oxide mole ratio adducts of tridecyl alcohol are poor detergents of the saturated fatty acids .

  9. Meiotic functions of RAD18

    NARCIS (Netherlands)

    A. Inagaki (Akiko); E. Sleddens-Linkels (Esther); E. Wassenaar (Evelyne); M.P. Ooms (Marja); W.A. van Cappellen (Gert); J.H.J. Hoeijmakers (Jan); J. Seibler (Jost); T.F. Vogt (Thomas F.); M.K. Shin (Myung K.); J.A. Grootegoed (Anton); W.M. Baarends (Willy)

    2011-01-01

    textabstractRAD18 is an ubiquitin ligase that is involved in replication damage bypass and DNA double-strand break (DSB) repair processes in mitotic cells. Here, we investigated the testicular phenotype of Rad18-knockdown mice to determine the function of RAD18 in meiosis, and in particular, in the

  10. Carbonate aquifers

    Science.gov (United States)

    Cunningham, Kevin J.; Sukop, Michael; Curran, H. Allen

    2012-01-01

    Only limited hydrogeological research has been conducted using ichnology in carbonate aquifer characterization. Regardless, important applications of ichnology to carbonate aquifer characterization include its use to distinguish and delineate depositional cycles, correlate mappable biogenically altered surfaces, identify zones of preferential groundwater flow and paleogroundwater flow, and better understand the origin of ichnofabric-related karst features. Three case studies, which include Pleistocene carbonate rocks of the Biscayne aquifer in southern Florida and Cretaceous carbonate strata of the Edwards–Trinity aquifer system in central Texas, demonstrate that (1) there can be a strong relation between ichnofabrics and groundwater flow in carbonate aquifers and (2) ichnology can offer a useful methodology for carbonate aquifer characterization. In these examples, zones of extremely permeable, ichnofabric-related macroporosity are mappable stratiform geobodies and as such can be represented in groundwater flow and transport simulations.

  11. Carbon and nitrogen balances for six shrublands across Europe

    DEFF Research Database (Denmark)

    Beier, Claus; Emmett, Bridget A.; Tietema, Albert

    2009-01-01

    and nitrogen balances of six shrublands along a climatic gradient across the European continent. The aim of the study was to provide a basis for assessing the range and variability in carbon storage in European shrublands. Across the sites the net carbon storage in the systems ranged from 1,163 g C m−2 to 18...... with a cold and wet climate where soil C constitutes 95% of the total carbon in the ecosystem. Respiration of carbon from the soil organic matter pool dominated the carbon loss at all sites while carbon loss from aboveground litter decomposition appeared less important. Total belowground carbon allocation...

  12. Carbon classified?

    DEFF Research Database (Denmark)

    Lippert, Ingmar

    2012-01-01

    How does a corporation know it emits carbon? Acquiring such knowledge starts with the classification of environmentally relevant consumption information. This paper visits the corporate location at which this underlying element for their knowledge is assembled to give rise to carbon emissions. Us...

  13. Porous carbons

    Indian Academy of Sciences (India)

    Satish M Manocha

    2003-02-01

    Carbon in dense as well as porous solid form is used in a variety of applications. Activated porous carbons are made through pyrolysis and activation of carbonaceous natural as well as synthetic precursors. Pyrolysed woods replicate the structure of original wood but as such possess very low surface areas and poor adsorption capacities. On activation, these exhibit increased adsorption volumes of 0.5–0.8 cm3 /gm and surface areas of 700–1800 m2 /gm depending on activation conditions, whether physical or chemical. Former carbons possess mixed pore size distribution while chemically activated carbons predominantly possess micropores. Thus, these carbons can be used for adsorption of wide distributions of molecules from gas to liquid. The molecular adsorption within the pores is due to single layer or multilayer molecule deposition at the pore walls and hence results in different types of adsorption isotherm. On the other hand, activated carbon fibres with controlled microporous structure and surface area in the range of 2500 m2 /gm can be developed by controlled pyrolysis and physical activation of amorphous carbon fibres. Active carbon fibres with unmatchable pore structure and surface characteristics are present and futuristic porous materials for a number of applications from pollution control to energy storage.

  14. Carbon photonics

    Energy Technology Data Exchange (ETDEWEB)

    Konov, V I [A M Prokhorov General Physics Institute, Russian Academy of Sciences, Moscow (Russian Federation)

    2015-11-30

    The properties of new carbon materials (single-crystal and polycrystalline CVD diamond films and wafers, single-wall carbon nanotubes and graphene) and the prospects of their use as optical elements and devices are discussed. (optical elements of laser devices)

  15. A mechanistic model of H{sub 2}{sup 18}O and C{sup 18}OO fluxes between ecosystems and the atmosphere: Model description and sensitivity analyses

    Energy Technology Data Exchange (ETDEWEB)

    Riley, W.J.; Still, C.J.; Torn, M.S.; Berry, J.A.

    2002-01-01

    The concentration of 18O in atmospheric CO2 and H2O is a potentially powerful tracer of ecosystem carbon and water fluxes. In this paper we describe the development of an isotope model (ISOLSM) that simulates the 18O content of canopy water vapor, leaf water, and vertically resolved soil water; leaf photosynthetic 18OC16O (hereafter C18OO) fluxes; CO2 oxygen isotope exchanges with soil and leaf water; soil CO2 and C18OO diffusive fluxes (including abiotic soil exchange); and ecosystem exchange of H218O and C18OO with the atmosphere. The isotope model is integrated into the land surface model LSM, but coupling with other models should be straightforward. We describe ISOLSM and apply it to evaluate (a) simplified methods of predicting the C18OO soil-surface flux; (b) the impacts on the C18OO soil-surface flux of the soil-gas diffusion coefficient formulation, soil CO2 source distribution, and rooting distribution; (c) the impacts on the C18OO fluxes of carbonic anhydrase (CA) activity in soil and leaves; and (d) the sensitivity of model predictions to the d18O value of atmospheric water vapor and CO2. Previously published simplified models are unable to capture the seasonal and diurnal variations in the C18OO soil-surface fluxes simulated by ISOLSM. Differences in the assumed soil CO2 production and rooting depth profiles, carbonic anhydrase activity in soil and leaves, and the d18O value of atmospheric water vapor have substantial impacts on the ecosystem CO2 flux isotopic composition. We conclude that accurate prediction of C18OO ecosystem fluxes requires careful representation of H218O and C18OO exchanges and transport in soils and plants.

  16. 18 CFR 367.18 - Criteria for classifying leases.

    Science.gov (United States)

    2010-04-01

    ... classification of the lease under the criteria in paragraph (a) of this section had the changed terms been in... the lessee) must not give rise to a new classification of a lease for accounting purposes. ... classifying leases. 367.18 Section 367.18 Conservation of Power and Water Resources FEDERAL ENERGY...

  17. SM18 Visits and Access

    CERN Multimedia

    2012-01-01

      VISITS The rules and conditions to be followed for visits in the SM18 Hall are laid out in the EDMS 1205328 document. No visit is allowed without prior reservation.   ACCESS Special access right is needed ONLY from 7 p.m. to 7 a.m. and during week-ends. From 1 December, the current SM18 access database will be closed and a new one “SM18-OWH outside normal hours” started from scratch. Requests, via EDH SM18-OWH, will have to be duly justified.   For further information, please contact Evelyne Delucinge.

  18. Carbon-Carbon Piston Architectures

    Science.gov (United States)

    Rivers, H. Kevin (Inventor); Ransone, Philip O. (Inventor); Northam, G. Burton (Inventor); Schwind, Francis A. (Inventor)

    2000-01-01

    An improved structure for carbon-carbon composite piston architectures is disclosed. The improvement consists of replacing the knitted fiber, three-dimensional piston preform architecture described in U.S. Pat.No. 4,909,133 (Taylor et al.) with a two-dimensional lay-up or molding of carbon fiber fabric or tape. Initially, the carbon fabric of tape layers are prepregged with carbonaceous organic resins and/or pitches and are laid up or molded about a mandrel, to form a carbon-fiber reinforced organic-matrix composite part shaped like a "U" channel, a "T"-bar, or a combination of the two. The molded carbon-fiber reinforced organic-matrix composite part is then pyrolized in an inert atmosphere, to convert the organic matrix materials to carbon. At this point, cylindrical piston blanks are cored from the "U"-channel, "T"-bar, or combination part. These blanks are then densified by reimpregnation with resins or pitches which are subsequently carbonized. Densification is also accomplished by direct infiltration with carbon by vapor deposition processes. Once the desired density has been achieved, the piston billets are machined to final piston dimensions; coated with oxidation sealants; and/or coated with a catalyst. When compared to conventional steel or aluminum alloy pistons, the use of carbon-carbon composite pistons reduces the overall weight of the engine; allows for operation at higher temperatures without a loss of strength; allows for quieter operation; reduces the heat loss; and reduces the level of hydrocarbon emissions.

  19. High performance carbon-carbon composites

    Indian Academy of Sciences (India)

    Lalit M Manocha

    2003-02-01

    Carbon-carbon composites rank first among ceramic composite materials with a spectrum of properties and applications in various sectors. These composites are made of fibres in various directions and carbonaceous polymers and hydrocarbons as matrix precursors. Their density and properties depend on the type and volume fraction of reinforcement, matrix precursor used and end heat treatment temperature. Composites made with thermosetting resins as matrix precursors possess low densities (1.55–1.75 g/cm3) and well-distributed microporosity whereas those made with pitch as the matrix precursor, after densification exhibit densities of 1.8–2.0 g/cm3 with some mesopores, and those made by the CVD technique with hydrocarbon gases, possess intermediate densities and matrices with close porosities. The former (resin-based) composites exhibit high flexural strength, low toughness and low thermal conductivity, whereas the latter (pitch- and CVD-based) can be made with very high thermal conductivity (400–700 W/MK) in the fibre direction. Carbon-carbon composites are used in a variety of sectors requiring high mechanical properties at elevated temperatures, good frictional properties for brake pads in high speed vehicles or high thermal conductivity for thermal management applications. However, for extended life applications, these composites need to be protected against oxidation either through matrix modification with Si, Zr, Hf etc. or by multilayer oxidation protection coatings consisting of SiC, silica, zircon etc.

  20. Meiotic functions of RAD18.

    Science.gov (United States)

    Inagaki, Akiko; Sleddens-Linkels, Esther; Wassenaar, Evelyne; Ooms, Marja; van Cappellen, Wiggert A; Hoeijmakers, Jan H J; Seibler, Jost; Vogt, Thomas F; Shin, Myung K; Grootegoed, J Anton; Baarends, Willy M

    2011-08-15

    RAD18 is an ubiquitin ligase that is involved in replication damage bypass and DNA double-strand break (DSB) repair processes in mitotic cells. Here, we investigated the testicular phenotype of Rad18-knockdown mice to determine the function of RAD18 in meiosis, and in particular, in the repair of meiotic DSBs induced by the meiosis-specific topoisomerase-like enzyme SPO11. We found that RAD18 is recruited to a specific subfraction of persistent meiotic DSBs. In addition, RAD18 is recruited to the chromatin of the XY chromosome pair, which forms the transcriptionally silent XY body. At the XY body, RAD18 mediates the chromatin association of its interaction partners, the ubiquitin-conjugating enzymes HR6A and HR6B. Moreover, RAD18 was found to regulate the level of dimethylation of histone H3 at Lys4 and maintain meiotic sex chromosome inactivation, in a manner similar to that previously observed for HR6B. Finally, we show that RAD18 and HR6B have a role in the efficient repair of a small subset of meiotic DSBs.

  1. Carbon cyclist

    Science.gov (United States)

    Showstack, Randy

    A satellite launched in early August as part of NASA's Mission to Planet Earth could dramatically increase understanding of how carbon cycles through the Earth's biosphere and living organisms and how this process influences global climate. The Sea-viewing Wide Field-of-View Sensor (SeaWiFS) will measure the color of the oceans with a radiometer to determine the concentration of chlorophyll found in oceanic phytoplankton. The single-celled plants, at the base of food chains around the world, remove carbon dioxide from seawater through photosynthesis, which allows oceans to absorb more carbon dioxide from the atmosphere.

  2. Carbon Fiber Morphology. 2. Expanded Wide-Angle X-Ray Diffraction Studies of Carbon Fibers

    Science.gov (United States)

    1991-02-01

    X- Ray Diffraction," JPS. Polym. Phys. Ed., 16, 939 (1978). 17. Rosalind E. Franklin , "The Structure of Graphitic Carbons," Acta Cryst., 4, 253 (1951...18. Rosalind E. Franklin , "The Interpretation of Diffuse X-ray Diagrams of Carbon," Acta CrL, 3, 107 (1950). 19. K. Jain and A. S. Abhiraman...been generally mentioned much earlier by Franklin [17,18]. Jain and Abhiraman [19] demonstrated that these corrections can make significant differences

  3. Carbon Stars

    Indian Academy of Sciences (India)

    T. Lloyd Evans

    2010-12-01

    In this paper, the present state of knowledge of the carbon stars is discussed. Particular attention is given to issues of classification, evolution, variability, populations in our own and other galaxies, and circumstellar material.

  4. Carbon Nanoelectronics

    Directory of Open Access Journals (Sweden)

    Cory D. Cress

    2014-01-01

    Full Text Available Initiated by the first single-walled carbon nanotube (SWCNT transistors [1,2], and reinvigorated with the isolation of graphene [3], the field of carbon-based nanoscale electronic devices and components (Carbon Nanoelectronics for short has developed at a blistering pace [4]. Comprising a vast number of scientists and engineers that span materials science, physics, chemistry, and electronics, this field seeks to provide an evolutionary transition path to address the fundamental scaling limitations of silicon CMOS [5]. Concurrently, researchers are actively investigating the use of carbon nanomaterials in applications including back-end interconnects, high-speed optoelectronic applications [6], spin-transport [7], spin tunnel barrier [8], flexible electronics, and many more.

  5. Infiltrated carbon foam composites

    Science.gov (United States)

    Lucas, Rick D. (Inventor); Danford, Harry E. (Inventor); Plucinski, Janusz W. (Inventor); Merriman, Douglas J. (Inventor); Blacker, Jesse M. (Inventor)

    2012-01-01

    An infiltrated carbon foam composite and method for making the composite is described. The infiltrated carbon foam composite may include a carbonized carbon aerogel in cells of a carbon foam body and a resin is infiltrated into the carbon foam body filling the cells of the carbon foam body and spaces around the carbonized carbon aerogel. The infiltrated carbon foam composites may be useful for mid-density ablative thermal protection systems.

  6. ISS Expedition 18 Press Kit

    Data.gov (United States)

    National Aeronautics and Space Administration — Press kit for ISS mission Expedition 18 from 10/2008-04/2009. Press kits contain information about each mission overview, crew, mission timeline, benefits, and media...

  7. Health screening - women - ages 18 to 39

    Science.gov (United States)

    Health maintenance visit - women - ages 18 to 39; Physical exam - women - ages 18 to 39; Yearly exam - ... 39; Checkup - women - ages 18 to 39; Women's health - ages 18 to 39; Preventive care - women - ages ...

  8. Health screening - men - ages 18 to 39

    Science.gov (United States)

    Health maintenance visit - men - ages 18 to 39; Physical exam - men - ages 18 to 39; Yearly exam - ... 39; Checkup - men - ages 18 to 39; Men's health - ages 18 to 39; Preventive care exam - men - ...

  9. Dentine oxygen isotopes (δ (18)O) as a proxy for odontocete distributions and movements.

    Science.gov (United States)

    Matthews, Cory J D; Longstaffe, Fred J; Ferguson, Steven H

    2016-07-01

    Spatial variation in marine oxygen isotope ratios (δ (18)O) resulting from differential evaporation rates and precipitation inputs is potentially useful for characterizing marine mammal distributions and tracking movements across δ (18)O gradients. Dentine hydroxyapatite contains carbonate and phosphate that precipitate in oxygen isotopic equilibrium with body water, which in odontocetes closely tracks the isotopic composition of ambient water. To test whether dentine oxygen isotope composition reliably records that of ambient water and can therefore serve as a proxy for odontocete distribution and movement patterns, we measured δ (18)O values of dentine structural carbonate (δ (18) OSC) and phosphate (δ (18) OP) of seven odontocete species (n = 55 individuals) from regional marine water bodies spanning a surface water δ (18)O range of several per mil. Mean dentine δ (18) OSC (range +21.2 to +25.5‰ VSMOW) and δ (18) OP (+16.7 to +20.3‰) values were strongly correlated with marine surface water δ (18)O values, with lower dentine δ (18) OSC and δ (18) OP values in high-latitude regions (Arctic and Eastern North Pacific) and higher values in the Gulf of California, Gulf of Mexico, and Mediterranean Sea. Correlations between dentine δ (18) OSC and δ (18) OP values with marine surface water δ (18)O values indicate that sequential δ (18)O measurements along dentine, which grows incrementally and archives intra- and interannual isotopic composition over the lifetime of the animal, would be useful for characterizing residency within and movements among water bodies with strong δ (18)O gradients, particularly between polar and lower latitudes, or between oceans and marginal basins.

  10. Trisomy 18 clustering in Kuwait.

    Science.gov (United States)

    Naguib, K K; Al-Awadi, S A; Marafie, M J; Al-Hijji, S Y

    1987-12-01

    Thirteen cases of trisomy 18 (T18) were ascertained clinically and cytogenetically during the period 1984-1986. Eight cases were delivered during 1986 in the Maternity Hospital out of 17,318 live births, making an incidence of 4.61/10,000, which is significantly higher than the international incidence as well as the incidence in previous years. The female-to-male sex ratio was 1.8/1, the median maternal age 32.5, and the median paternal age 40. There was no history of polyhydramnios. Five cases were delivered by cesarean section and four cases died in the neonatal period. All cases proved to be full trisomy 18 with no mosaicism detected; in one case parental inversion 9 was detected.

  11. 18th International Cryocooler Conference

    CERN Document Server

    Ross, Ronald G

    2014-01-01

    Cryocoolers 18 Cryocoolers 18 archives developments and performance measurements in the field of cryocoolers based on the contributions of leading international experts at the 18th International Cryocooler Conference that was held in Syracuse, New York, on June 9-12, 2014. The program of this conference lead to the 76 peer-reviewed papers that are published here. Over the years the International Cryocoolers Conference has become the preeminent worldwide conference for the presentation of the latest developments and test experiences with cryocoolers. The typical applications of this technology include cooling space and terrestrial infrared focal plane arrays, space x-ray detectors, medical applications, and a growing number of high-temperature superconductor applications.

  12. Carbon fiber-reinforced carbon as a potential implant material.

    Science.gov (United States)

    Adams, D; Williams, D F; Hill, J

    1978-01-01

    A carbon fiber-reinforced carbon is being evaluated as a promising implant material. In a unidirectional composite, high strengths (1200 MN/m2 longitudinal flexural strength) and high modulus (140 GN/m2 flexural modulus) may be obtained with an interlaminar shear strength of 18 MN/m2. Alternatively, layers of fibers may be laid in two directions to give more isotopic properties. The compatibility of the material with bone has been studied by implanting specimens in holes drilled in rat femora. For a period of up to 8 weeks, a thin layer of fibrous tissue bridged the gap between bone and implant; but this tissue mineralizes and by 10 weeks, bone can be observed adjacent to the implant, giving firm fixation. Potential applications include endosseous dental implants where a greater strength in the neck than that provided by unreinforced carbon would be advantageous.

  13. Calcium Carbonate

    Science.gov (United States)

    ... doctor if you have or have ever had kidney disease or stomach conditions.tell your doctor if you are pregnant, plan to become pregnant, or are breast-feeding. If you become pregnant while taking calcium carbonate, call your doctor.

  14. Concerted nucleophilic aromatic substitution with 19F- and 18F-

    Science.gov (United States)

    Neumann, Constanze N.; Hooker, Jacob M.; Ritter, Tobias

    2016-06-01

    Nucleophilic aromatic substitution (SNAr) is widely used by organic chemists to functionalize aromatic molecules, and it is the most commonly used method to generate arenes that contain 18F for use in positron-emission tomography (PET) imaging. A wide range of nucleophiles exhibit SNAr reactivity, and the operational simplicity of the reaction means that the transformation can be conducted reliably and on large scales. During SNAr, attack of a nucleophile at a carbon atom bearing a ‘leaving group’ leads to a negatively charged intermediate called a Meisenheimer complex. Only arenes with electron-withdrawing substituents can sufficiently stabilize the resulting build-up of negative charge during Meisenheimer complex formation, limiting the scope of SNAr reactions: the most common SNAr substrates contain strong π-acceptors in the ortho and/or para position(s). Here we present an unusual concerted nucleophilic aromatic substitution reaction (CSNAr) that is not limited to electron-poor arenes, because it does not proceed via a Meisenheimer intermediate. We show a phenol deoxyfluorination reaction for which CSNAr is favoured over a stepwise displacement. Mechanistic insights enabled us to develop a functional-group-tolerant 18F-deoxyfluorination reaction of phenols, which can be used to synthesize 18F-PET probes. Selective 18F introduction, without the need for the common, but cumbersome, azeotropic drying of 18F, can now be accomplished from phenols as starting materials, and provides access to 18F-labelled compounds not accessible through conventional chemistry.

  15. All Road Density (18km)

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Density (km / km^2) of all roads in the western United States. Dataset was developed to generalize the 2000 US Census TIGER/Line Roads layer to a density within 18km...

  16. Ezekiel 18 and Human rights

    Directory of Open Access Journals (Sweden)

    H.F. van Rooy

    2000-08-01

    Full Text Available In South Africa the debate on Human Rights gained new impetus after the implementation of the interim constitution in 1994, followed by the new constitution in 1996, containing a charter of fundamental Human Rights. The question to be answered by this paper is whether Ezekiel 18 can contribute to this debate. This paper firstly discusses the question whether the Old Testament can be used in the debate on Human Rights. This is followed by a discussion of Ezekiel 18, with emphasis on the transgressions listed in this chapter in their Israelite context. Many of these injunctions are related to the laws of Deuteronomy, the Book of the Covenant and the Holiness Code. These injunctions are studied against the background of Israelite law in general and the three codes mentioned above in particular. Finally, the implications of Ezekiel 18 for the issue of Human Rights are discussed. The violation of rights of people guaranteed by divine law is seen as one of the major causes of divine punishment. God's law was meant to create a society found on justice. An unjust society is in contradiction to the will of God, according to Ezekiel 18. The implications of this view for the debate on Human Rights in South Africa need to be taken into consideration.

  17. Developmental milestones record - 18 months

    Science.gov (United States)

    ... concerned about your child's development, talk to your child's health care provider. PHYSICAL AND MOTOR SKILL MARKERS The typical 18-month-old: Has ... Read to the child. Encourage play dates with children of the same ... 2. Play simple games together, such as puzzles and shape sorting. Use ...

  18. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the MIRAI in the North Pacific Ocean from 2006-05-26 to 2006-06-18 (NODC Accession 0112266)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112266 includes chemical, discrete sample, physical and profile data collected from MIRAI in the North Pacific Ocean from 2006-05-26 to 2006-06-18...

  19. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the MIRAI in the North Pacific Ocean from 2001-06-04 to 2001-07-18 (NODC Accession 0112256)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112256 includes chemical, discrete sample, physical and profile data collected from MIRAI in the North Pacific Ocean from 2001-06-04 to 2001-07-18...

  20. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the JAN MAYEN in the Barents Sea from 2003-07-10 to 2003-07-18 (NODC Accession 0113565)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113565 includes chemical, discrete sample, physical and profile data collected from JAN MAYEN in the Barents Sea from 2003-07-10 to 2003-07-18 and...

  1. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the MARION DUFRESNE in the Indian Ocean from 1998-08-18 to 1998-09-09 (NODC Accession 0113573)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113573 includes biological, chemical, discrete sample, physical and profile data collected from MARION DUFRESNE in the Indian Ocean from 1998-08-18...

  2. Temperature, salinity and other variables collected from Surface underway observations using CTD, Carbon dioxide (CO2) gas analyzer and other instruments from the AIRCRAFT in the Arctic Ocean from 2005-05-02 to 2009-05-18 (NODC Accession 0117695)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0117695 includes Surface underway, chemical and physical data collected from AIRCRAFT in the Arctic Ocean from 2005-05-02 to 2009-05-18 and retrieved...

  3. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from DISCOVERY in the North Atlantic Ocean from 2010-01-06 to 2010-02-18 (NODC Accession 0112761)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0112761 includes discrete sample and profile data collected from DISCOVERY in the North Atlantic Ocean from 2010-01-06 to 2010-02-18 and retrieved...

  4. Dissolved inorganic carbon, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the TANKAI-MARU in the North Pacific Ocean from 1998-04-18 to 1998-04-20 (NODC Accession 0112316)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112316 includes chemical, discrete sample, physical and profile data collected from TANKAI-MARU in the North Pacific Ocean from 1998-04-18 to...

  5. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and HYDROSTATIC PRESSURE collected from discrete sample and profile observations using CTD, bottle and other instruments from the SEWARD JOHNSON in the North Atlantic Ocean from 2003-04-18 to 2003-05-22 (NODC Accession 0113596)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113596 includes chemical, discrete sample, physical and profile data collected from SEWARD JOHNSON in the North Atlantic Ocean from 2003-04-18 to...

  6. Production and test of {sup 18}F samples in the SNICS ion source

    Energy Technology Data Exchange (ETDEWEB)

    Rehm, K.E.; Paul, M. [Hebrew Univ., Jerusalem (Israel); Roberts, A.; Nickels, J. [Univ. of Wisconsin, Madison, MO (United States)

    1995-08-01

    For experiments with {sup 18}F beams the output of the SNICS ion source for fluorine ions was investigated. {sup 18}F, which is a well-studied PET isotope, is generated at the medical cyclotron of the University of Wisconsin. Aqueous [{sup 18}F] fluoride ions are produced via the {sup 18}O(p,n){sup 18}F reaction using a 30-{mu}A, 11.4-MeV proton beam bombarding a 95% enriched [{sup 18}O] water target. In order to minimize the {sup 18}O component of the {sup 18}F material the [{sup 18}F] fluoride must be separated from the [{sup 18}O] water. For this purpose the aqueous [{sup 18}F] fluoride solution ({approximately} 0.5-1 ml) is removed from the production target and placed in a glassy carbon vessel. The vessel is heated to 115{degrees}C with He bubbling through the solution, evaporating the water while the {sup 18}F adheres to the vessel walls. When dry, the vessel is filled with 1 ml {sup 18}O-depleted 99.98% [{sup 16}O] water which is again evaporated. After this step is repeated once more the vessel is filled with 1.5 ml [{sup 16}O] water and 200-300 mole of natural KF as carrier material.

  7. The standardisation of fluorine-18.

    Science.gov (United States)

    van der Gaast, H A

    1995-12-01

    The Australian Nuclear Science and Technology Organisation (ANSTO) maintains and disseminates the Australian standards of activity measurement. The standards include all nuclear medicine gamma-emitters and pure positron emitters. Calibration factors for the ANSTO 4 pi ionisation chamber for pure positron emitters have been traditionally determined from primary standardisations of cobalt-60 and sodium-22. Activity estimates of pure beta emitters have been previously determined by using 4 pi beta-gamma coincidence (efficiency tracer) counting. This method was adapted to test activity estimates of short-lived pure positron emitters made using the 4 pi ionisation chamber. Detailed are methods whereby the activity of fluorine-18 can be measured. The first method is an efficiency tracing method developed in this work. The method directly tests 4 pi ionisation chamber fluorine-18 activity estimates. The gamma-gamma method was carried out to confirm this.

  8. SOUTHWEST REGIONAL PARTNERSHIP ON CARBON SEQUESTRATION

    Energy Technology Data Exchange (ETDEWEB)

    Brian McPherson

    2005-08-01

    The Southwest Partnership on Carbon Sequestration completed several more tasks during the period of October 1, 2004--March 31, 2005. The main objective of the Southwest Partnership project is to achieve an 18% reduction in carbon intensity by 2012. Action plans for possible Phase 2 carbon sequestration pilot tests in the region are completed, and a proposal was developed and submitted describing how the Partnership may develop and carry out appropriate pilot tests. The content of this report focuses on Phase 1 objectives completed during this reporting period.

  9. Frontiers of graphene and carbon nanotubes devices and applications

    CERN Document Server

    2015-01-01

    This book focuses on carbon nanotubes and graphene as representatives of nano-carbon materials, and describes the growth of new technology and applications of new devices. As new devices and as new materials, nano-carbon materials are expected to be world pioneers that could not have been realized with conventional semiconductor materials, and as those that extend the limits of conventional semiconductor performance. This book introduces the latest achievements of nano-carbon devices, processes, and technology growth. It is anticipated that these studies will also be pioneers in the development of future research of nano-carbon devices and materials. This book consists of 18 chapters. Chapters 1 to 8 describe new device applications and new growth methods of graphene, and Chapters 9 to 18, those of carbon nanotubes. It is expected that by increasing the advantages and overcoming the weak points of nanocarbon materials, a new world that cannot be achieved with conventional materials will be greatly expanded. W...

  10. Carbonic inclusions

    Science.gov (United States)

    Van den Kerkhof, Alfons; Thiéry, Régis

    2001-01-01

    The paper gives an overview of the phase relations in carbonic fluid inclusions with pure, binary and ternary mixtures of the system CO 2-CH 4-N 2, compositions, which are frequently found in geological materials. Phase transitions involving liquid, gas and solid phases in the temperature range between -192°C and 31°C are discussed and presented in phase diagrams ( PT, TX and VX projections). These diagrams can be applied for the interpretation of microthermometry data in order to determine fluid composition and molar volume (or density).

  11. 40 CFR 86.224-94 - Carbon dioxide analyzer calibration.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Carbon dioxide analyzer calibration. 86.224-94 Section 86.224-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.224-94 Carbon...

  12. Carbonic Acid Pretreatment of Biomass

    Energy Technology Data Exchange (ETDEWEB)

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

    2003-05-31

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  13. Carbonic Acid Retreatment of Biomass

    Energy Technology Data Exchange (ETDEWEB)

    Baylor university

    2003-06-01

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  14. 47 CFR 18.301 - Operating frequencies.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Operating frequencies. 18.301 Section 18.301... Standards § 18.301 Operating frequencies. ISM equipment may be operated on any frequency above 9 kHz except as indicated in § 18.303. The following frequency bands, in accordance with § 2.106 of the rules,...

  15. Jilin Chemical Fiber Group Launches Its Largest Carbon Fiber Preject

    Institute of Scientific and Technical Information of China (English)

    Flora

    2011-01-01

    China's carbon fiber precursor production line with 5,000 tons of annual output was put into operation in Jilin Chemical Fiber Group on November 18th this year, creating the maximum production capacity currently in China, for which Jilin Chemical Fiber Group become China's largest carbon fiber precursor production base, The smooth operation of the project has laid a solid foundation for promoting China's carbon fiber industry steady, rapid, and healthy development,

  16. Dentine oxygen isotopes (δ 18O) as a proxy for odontocete distributions and movements

    OpenAIRE

    Matthews, Cory J. D.; Longstaffe, Fred J.; Ferguson, Steven H

    2016-01-01

    Abstract Spatial variation in marine oxygen isotope ratios (δ 18O) resulting from differential evaporation rates and precipitation inputs is potentially useful for characterizing marine mammal distributions and tracking movements across δ 18O gradients. Dentine hydroxyapatite contains carbonate and phosphate that precipitate in oxygen isotopic equilibrium with body water, which in odontocetes closely tracks the isotopic composition of ambient water. To test whether dentine oxygen isotope comp...

  17. Carbon Farming as a Carbon Negative Technology

    Science.gov (United States)

    Anderson, C.; Laird, D.; Hayes, D. J.

    2015-12-01

    Carbon farms have a pivotal role in national and international efforts to mitigate and adapt to climate change. A carbon farm in its broadest sense is one that reduces greenhouse gas (GHG) emissions or captures and holds carbon in vegetation and soils. Their capacity to remove carbon from the air and store it safely and permanently, while providing additional human and ecosystem benefits, means they could contribute significantly to national efforts to stabilize or reduce GHGs. We examine carbon farms in the context of corn and soybean production agriculture. We illustrate, using Iowa data but with relevance across United States corn and soybean production, the potential for carbon farms to reduce human GHG emissions and sequester carbon permanently at a rate that has meaningful impact on global greenhouse gas concentration. Carbon has been viewed as a next generation cash crop in Iowa for over a decade. The carbon farm perspective, however, goes beyond carbon as cash crop to make carbon the center of an entire farm enterprise. The transformation is possible through slight adjustment crop practices mixed with advances in technology to sequester carbon through biochar. We examine carbon balance of Iowa agriculture given only the combination of slight reduction in fertilizer and sequestration by biochar. We find the following. Iowa carbon farms could turn Iowa agriculture into a carbon sink. The estimated range of GHG reduction by statewide implementation of carbon farms is 19.46 to 90.27 MMt CO2-equivalent (CO2-e), while the current agricultural CO2-e emission estimate is 35.38 MMt CO2-e. Iowa carbon farm GHG reduction would exceed Iowa GHG reduction by wind energy (8.7 MMt CO2-e) and could exceed combined reductions from wind energy and corn grain ethanol (10.7 MMt CO2-e; 19.4 MMt CO2-e combined). In fact, Iowa carbon farms alone could exceed GHG reduction from national corn grain ethanol production (39.6 MMt CO2-e). A carbon price accessible to agricultural

  18. Carbon Monoxide Safety

    Science.gov (United States)

    ... Materials Working with the Media Fire Protection Technology Carbon monoxide safety outreach materials Help inform residents in ... with these messages and free materials. What is carbon monoxide? Carbon monoxide, also known as CO, is ...

  19. Carbon monoxide poisoning

    Science.gov (United States)

    ... and smokers. Carbon monoxide can harm a fetus (unborn baby still in the womb). Symptoms of carbon ... symptoms Outlook (Prognosis) Carbon monoxide poisoning can cause death. For those who survive, recovery is slow. How ...

  20. Net Ecosystem Carbon Flux

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Net Ecosystem Carbon Flux is defined as the year-over-year change in Total Ecosystem Carbon Stock, or the net rate of carbon exchange between an ecosystem and the...

  1. Global Carbon Budget 2016

    Science.gov (United States)

    Le Quéré, Corinne; Andrew, Robbie M.; Canadell, Josep G.; Sitch, Stephen; Korsbakken, Jan Ivar; Peters, Glen P.; Manning, Andrew C.; Boden, Thomas A.; Tans, Pieter P.; Houghton, Richard A.; Keeling, Ralph F.; Alin, Simone; Andrews, Oliver D.; Anthoni, Peter; Barbero, Leticia; Bopp, Laurent; Chevallier, Frédéric; Chini, Louise P.; Ciais, Philippe; Currie, Kim; Delire, Christine; Doney, Scott C.; Friedlingstein, Pierre; Gkritzalis, Thanos; Harris, Ian; Hauck, Judith; Haverd, Vanessa; Hoppema, Mario; Klein Goldewijk, Kees; Jain, Atul K.; Kato, Etsushi; Körtzinger, Arne; Landschützer, Peter; Lefèvre, Nathalie; Lenton, Andrew; Lienert, Sebastian; Lombardozzi, Danica; Melton, Joe R.; Metzl, Nicolas; Millero, Frank; Monteiro, Pedro M. S.; Munro, David R.; Nabel, Julia E. M. S.; Nakaoka, Shin-ichiro; O'Brien, Kevin; Olsen, Are; Omar, Abdirahman M.; Ono, Tsuneo; Pierrot, Denis; Poulter, Benjamin; Rödenbeck, Christian; Salisbury, Joe; Schuster, Ute; Schwinger, Jörg; Séférian, Roland; Skjelvan, Ingunn; Stocker, Benjamin D.; Sutton, Adrienne J.; Takahashi, Taro; Tian, Hanqin; Tilbrook, Bronte; van der Laan-Luijkx, Ingrid T.; van der Werf, Guido R.; Viovy, Nicolas; Walker, Anthony P.; Wiltshire, Andrew J.; Zaehle, Sönke

    2016-11-01

    .3 ± 0.5 GtC yr-1, ELUC 1.0 ± 0.5 GtC yr-1, GATM 4.5 ± 0.1 GtC yr-1, SOCEAN 2.6 ± 0.5 GtC yr-1, and SLAND 3.1 ± 0.9 GtC yr-1. For year 2015 alone, the growth in EFF was approximately zero and emissions remained at 9.9 ± 0.5 GtC yr-1, showing a slowdown in growth of these emissions compared to the average growth of 1.8 % yr-1 that took place during 2006-2015. Also, for 2015, ELUC was 1.3 ± 0.5 GtC yr-1, GATM was 6.3 ± 0.2 GtC yr-1, SOCEAN was 3.0 ± 0.5 GtC yr-1, and SLAND was 1.9 ± 0.9 GtC yr-1. GATM was higher in 2015 compared to the past decade (2006-2015), reflecting a smaller SLAND for that year. The global atmospheric CO2 concentration reached 399.4 ± 0.1 ppm averaged over 2015. For 2016, preliminary data indicate the continuation of low growth in EFF with +0.2 % (range of -1.0 to +1.8 %) based on national emissions projections for China and USA, and projections of gross domestic product corrected for recent changes in the carbon intensity of the economy for the rest of the world. In spite of the low growth of EFF in 2016, the growth rate in atmospheric CO2 concentration is expected to be relatively high because of the persistence of the smaller residual terrestrial sink (SLAND) in response to El Niño conditions of 2015-2016. From this projection of EFF and assumed constant ELUC for 2016, cumulative emissions of CO2 will reach 565 ± 55 GtC (2075 ± 205 GtCO2) for 1870-2016, about 75 % from EFF and 25 % from ELUC. This living data update documents changes in the methods and data sets used in this new carbon budget compared with previous publications of this data set (Le Quéré et al., 2015b, a, 2014, 2013). All observations presented here can be downloaded from the Carbon Dioxide Information Analysis Center (doi:10.3334/CDIAC/GCP_2016).

  2. Carbon dioxide sequestration by mineral carbonation

    NARCIS (Netherlands)

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept beh

  3. Carbon Residence Times in Pedogenic Carbonate Pools

    Science.gov (United States)

    Monger, H.; Feng, Y.; Karnjanapiboonwang, A.

    2013-12-01

    Soil carbonate is a huge pool of terrestrial carbon that contains at least 930 to 940 Pg C and has influx rates on the order of 1 to 12 g CaCO3/m2/yr. Such large mass to flux ratios yield long mean residence times for carbon (e.g., 85,000 years)--assuming steady state. Like other global carbon pools, the soil carbonate pool has smaller sub-pools with higher influx rates and shorter mean residence times. For example, pedogenic carbonate in coppice dunes known to have formed since 1858 and carbonate formed on lithic artifacts in soils at archaeology sites suggests mean residence times can be as short as 120 years--again assuming steady state. Harder to assess are efflux rates as CO2 emissions or bicarbonate leaching. Some Bowen-ratio studies have nevertheless found evidence for CO2 emissions resulting from carbonate dissolution, and other studies have found evidence for bicarbonate leaching based on dissolution pipes through calcic horizons using soil morphology studies. Since an understanding of mean residence times are prerequisite for a better understanding of soil carbonate in the global carbon cycle, especially in a scenario of an expanding Aridosphere, more influx and efflux measurements are needed to evaluate the possibility of carbon sequestration by soil carbonate in hyperarid, arid, semiarid, or subhumid soils.

  4. Desalination with carbon aerogel electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, J.C.; Richardson, J.H.; Fix, D.V.

    1996-10-21

    An electrically regenerated electrosorption process known as carbon aerogel CDI was developed for continuously removing ionic impurities from aqueous streams. A salt solution flows in a channel formed by pairs of parallel carbon aerogel electrodes. Each electrode has a very high BET surface area and very low resistivity. After polarization, anions and cations are removed from electrolyte by the electric field and electrosorbed onto the carbon aerogel. The solution is thus separated into two streams, brine and water. Based on this, carbon aerogel CDI appears to be an energy-efficient alternative to evaporation, electrodialysis, and reverse osmosis. The energy required by this process is about QV/2, plus losses. Estimated energy requirement for sea water desalination is 18-27 Wh gal{sup -1}, depending on cell voltage and flow rate. The requirement for brackish water desalination is less, 1.2-2.5 Wh gal{sup -1} at 1600 ppM. This is assuming that stored electrical energy is reclaimed during regeneration.

  5. 48 CFR 53.301-18 - SF 18 (Rev. 6/95), Request for Quotations.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false SF 18 (Rev. 6/95), Request for Quotations. 53.301-18 Section 53.301-18 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Illustrations of Forms 53.301-18 SF 18 (Rev. 6/95),...

  6. Composite carbon foam electrode

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, S.T.; Pekala, R.W.; Kaschmitter, J.L.

    1997-05-06

    Carbon aerogels used as a binder for granulated materials, including other forms of carbon and metal additives, are cast onto carbon or metal fiber substrates to form composite carbon thin film sheets. The thin film sheets are utilized in electrochemical energy storage applications, such as electrochemical double layer capacitors (aerocapacitors), lithium based battery insertion electrodes, fuel cell electrodes, and electrocapacitive deionization electrodes. The composite carbon foam may be formed by prior known processes, but with the solid particles being added during the liquid phase of the process, i.e. prior to gelation. The other forms of carbon may include carbon microspheres, carbon powder, carbon aerogel powder or particles, graphite carbons. Metal and/or carbon fibers may be added for increased conductivity. The choice of materials and fibers will depend on the electrolyte used and the relative trade off of system resistivity and power to system energy. 1 fig.

  7. Composite carbon foam electrode

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, Steven T. (San Leandro, CA); Pekala, Richard W. (Pleasant Hill, CA); Kaschmitter, James L. (Pleasanton, CA)

    1997-01-01

    Carbon aerogels used as a binder for granularized materials, including other forms of carbon and metal additives, are cast onto carbon or metal fiber substrates to form composite carbon thin film sheets. The thin film sheets are utilized in electrochemical energy storage applications, such as electrochemical double layer capacitors (aerocapacitors), lithium based battery insertion electrodes, fuel cell electrodes, and electrocapacitive deionization electrodes. The composite carbon foam may be formed by prior known processes, but with the solid particles being added during the liquid phase of the process, i.e. prior to gelation. The other forms of carbon may include carbon microspheres, carbon powder, carbon aerogel powder or particles, graphite carbons. Metal and/or carbon fibers may be added for increased conductivity. The choice of materials and fibers will depend on the electrolyte used and the relative trade off of system resistivty and power to system energy.

  8. Carbon Nanomembranes

    Science.gov (United States)

    Angelova, Polina; Gölzhäuser, Armin

    2017-03-01

    This chapter describes the formation and properties of one nanometer thick carbon nanomembranes (CNMs), made by electron induced cross-linking of aromatic self-assembled monolayers (SAMs). The cross-linked SAMs are robust enough to be released from the surface and placed on solid support or over holes as free-standing membranes. Annealing at 1000K transforms CNMs into graphene accompanied by a change of mechanical stiffness and electrical resistance. The developed fabrication approach is scalable and provides molecular level control over thickness and homogeneity of the produced CNMs. The mechanisms of electron-induced cross-linking process are discussed in details. A variety of polyaromatic thiols: oligophenyls as well as small and extended condensed polycyclic hydrocarbons have been successfully employed, demonstrating that the structural and functional properties of the resulting nanomembranes are strongly determined by the structure of molecular monolayers. The mechanical properties of CNMs (Young's modulus, tensile strength and prestress) are characterized by bulge testing. The interpretation of the bulge test data relates the Young's modulus to the properties of single molecules and to the structure of the pristine SAMs. The gas transport through the CNM is measured onto polydimethylsiloxane (PDMS) - thin film composite membrane. The established relationship of permeance and molecular size determines the molecular sieving mechanism of permeation through this ultrathin sheet.

  9. From carbon nanotubes to carbon atomic chains

    Science.gov (United States)

    Casillas García, Gilberto; Zhang, Weijia; José-Yacamán, Miguel

    2010-10-01

    Carbyne is a linear allotrope of carbon. It is formed by a linear arrangement of carbon atoms with sp-hybridization. We present a reliable and reproducible experiment to obtain these carbon atomic chains using few-layer-graphene (FLG) sheets and a HRTEM. First the FLG sheets were synthesized from worm-like exfoliated graphite and then drop-casted on a lacey-carbon copper grid. Once in the TEM, two holes are opened near each other in a FLG sheet by focusing the electron beam into a small spot. Due to the radiation, the carbon atoms rearrange themselves between the two holes and form carbon fibers. The beam is concentrated on the carbon fibers in order excite the atoms and induce a tension until multi wall carbon nanotube (MWCNT) is formed. As the radiation continues the MWCNT breaks down until there is only a single wall carbon nanotube (SWCNT). Then, when the SWCNT breaks, an atomic carbon chain is formed, lasts for several seconds under the radiation and finally breaks. This demonstrates the stability of this carbon structure.

  10. 18-Crown[6]ether functionalized reduced graphene oxide for membrane-free ion selective sensing

    DEFF Research Database (Denmark)

    Olsen, Gunnar; Ulstrup, Jens; Chi, Qijin

    The focus of this work is on the synthesis of a 1-Aza-18-crown[6]ether functionalized reduced graphene oxide (RGO-crown[6]) with specific K+ binding sites on the RGO surface. Glassy carbon electrodes (GCE) functionalized with RGO-crown[6] weretested for selective potentiometric sensing of K...

  11. 49 CFR 178.337-18 - Certification.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Certification. 178.337-18 Section 178.337-18... Specifications for Containers for Motor Vehicle Transportation § 178.337-18 Certification. (a) At or before the...) and (b) without the original date of certification stamped on the specification plate....

  12. 30 CFR 18.47 - Voltage limitation.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Voltage limitation. 18.47 Section 18.47 Mineral... § 18.47 Voltage limitation. (a) A tool or switch held in the operator's hand or supported against his... particular voltage(s) are provided in the design and construction of the equipment, its wiring,...

  13. 7 CFR 29.18 - Person.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Person. 29.18 Section 29.18 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Regulations Definitions § 29.18 Person. Individual, association, partnership, or corporation....

  14. 31 CFR 1.8 - Scope.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Scope. 1.8 Section 1.8 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Other Disclosure Provisions § 1.8 Scope. The regulations in this subpart concern access to information and records other...

  15. 29 CFR 18.13 - Discovery methods.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Discovery methods. 18.13 Section 18.13 Labor Office of the... ADMINISTRATIVE LAW JUDGES General § 18.13 Discovery methods. Parties may obtain discovery by one or more of the following methods: Depositions upon oral examination or written questions; written...

  16. 42 CFR 86.18 - Grantee accountability.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Grantee accountability. 86.18 Section 86.18 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH... Occupational Safety and Health Training Grants § 86.18 Grantee accountability. (a) Accounting for grant...

  17. 19 CFR 18.42 - Direct exportation.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Direct exportation. 18.42 Section 18.42 Customs... TRANSPORTATION IN BOND AND MERCHANDISE IN TRANSIT Merchandise Not Otherwise Subject to Customs Control Exported Under Cover of A Tir Carnet § 18.42 Direct exportation. At the port of exportation, the container...

  18. 30 CFR 18.45 - Cable reels.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Cable reels. 18.45 Section 18.45 Mineral... § 18.45 Cable reels. (a) A self-propelled machine, that receives electrical energy through a portable cable and is designed to travel at speeds exceeding 2.5 miles per hour, shall have a...

  19. 7 CFR 247.18 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 247.18 Section 247.18 Agriculture... CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.18 Nutrition education. (a) What are the State agency's responsibilities in ensuring that nutrition education is provided? The State...

  20. 38 CFR 18.438 - Adult education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Adult education. 18.438 Section 18.438 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED... Adult Education § 18.438 Adult education. A recipient that provides adult education may not, on...

  1. 7 CFR 75.18 - Sampling.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Sampling. 75.18 Section 75.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections... CERTIFICATION OF QUALITY OF AGRICULTURAL AND VEGETABLE SEEDS Inspection § 75.18 Sampling. Sampling,...

  2. 5 CFR 1631.18 - Annual report.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Annual report. 1631.18 Section 1631.18... Disclosure of Records Under the Freedom of Information Act, 5 U.S.C. 552 § 1631.18 Annual report. The Executive Director will submit annually, on or before February 1, a Freedom of Information report...

  3. 50 CFR 14.18 - Marine mammals.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Marine mammals. 14.18 Section 14.18....18 Marine mammals. Any person subject to the jurisdiction of the United States who has lawfully taken a marine mammal on the high seas and who is authorized to import such marine mammal in...

  4. 40 CFR 265.18 - Location standards.

    Science.gov (United States)

    2010-07-01

    ... FACILITIES General Facility Standards § 265.18 Location standards. The placement of any hazardous waste in a... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Location standards. 265.18 Section 265.18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES...

  5. 29 CFR 785.18 - Rest.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Rest. 785.18 Section 785.18 Labor Regulations Relating to... INTERPRETATION NOT DIRECTLY RELATED TO REGULATIONS HOURS WORKED Application of Principles Rest and Meal Periods § 785.18 Rest. Rest periods of short duration, running from 5 minutes to about 20 minutes, are common...

  6. 16 CFR 460.18 - Insulation ads.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Insulation ads. 460.18 Section 460.18 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.18 Insulation ads. (a) If your ad gives an R-value, you must give the type of insulation...

  7. 29 CFR 18.50 - Authenticity.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Authenticity. 18.50 Section 18.50 Labor Office of the Secretary of Labor RULES OF PRACTICE AND PROCEDURE FOR ADMINISTRATIVE HEARINGS BEFORE THE OFFICE OF ADMINISTRATIVE LAW JUDGES General § 18.50 Authenticity. The authenticity of all documents submitted as...

  8. 32 CFR 651.18 - Introduction.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Introduction. 651.18 Section 651.18 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY (CONTINUED) ENVIRONMENTAL QUALITY ENVIRONMENTAL ANALYSIS OF ARMY ACTIONS (AR 200-2) Records and Documents § 651.18 Introduction....

  9. 32 CFR 147.18 - Introduction.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.18 Section 147.18 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Standards § 147.18 Introduction. The following investigative standards are established for all United...

  10. 47 CFR 18.307 - Conduction limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Conduction limits. 18.307 Section 18.307... Standards § 18.307 Conduction limits. For the following equipment, when designed to be connected to the... on any frequency or frequencies shall not exceed the limits in the following tables. Compliance...

  11. 46 CFR Sec. 18 - Group classification.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Group classification. Sec. 18 Section 18 Shipping... Sec. 18 Group classification. In the preparation of specifications, Job Orders, Supplemental Job... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards...

  12. 29 CFR 401.18 - Office.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Office. 401.18 Section 401.18 Labor Regulations Relating to Labor OFFICE OF LABOR-MANAGEMENT STANDARDS, DEPARTMENT OF LABOR LABOR-MANAGEMENT STANDARDS MEANING OF TERMS USED IN THIS SUBCHAPTER § 401.18 Office. Office means the Office of Labor-Management...

  13. 21 CFR 26.18 - Regulatory collaboration.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Regulatory collaboration. 26.18 Section 26.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL... Specific Sector Provisions for Pharmaceutical Good Manufacturing Practices § 26.18 Regulatory...

  14. 33 CFR 273.18 - Clearinghouse coordination.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Clearinghouse coordination. 273.18 Section 273.18 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE AQUATIC PLANT CONTROL § 273.18 Clearinghouse coordination. Procedures prescribed...

  15. 10 CFR 35.18 - License issuance.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false License issuance. 35.18 Section 35.18 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL General Information § 35.18 License issuance. (a) The Commission shall issue a license for the medical use of byproduct material if— (1) The applicant has...

  16. 45 CFR 16.18 - Mediation.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Mediation. 16.18 Section 16.18 Public Welfare... BOARD § 16.18 Mediation. (a) In cases pending before the Board. If the Board decides that mediation... mediation techniques and will provide or assist in selecting a mediator. The mediator may take any...

  17. 7 CFR 966.18 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 966.18 Section 966.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 966.18 Export. Export means shipment of tomatoes beyond the boundaries of the...

  18. 7 CFR 959.18 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 959.18 Section 959.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 959.18 Export. Export means to ship onions to any destination which is not...

  19. 47 CFR 18.207 - Technical report.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Technical report. 18.207 Section 18.207... Applications and Authorizations § 18.207 Technical report. When required by the Commission a technical report...(s) under which the equipment is or will be marketed. (e) A statement of the rated...

  20. 30 CFR 18.34 - Motors.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Motors. 18.34 Section 18.34 Mineral Resources... PRODUCTS ELECTRIC MOTOR-DRIVEN MINE EQUIPMENT AND ACCESSORIES Construction and Design Requirements § 18.34 Motors. Explosion-proof electric motor assemblies intended for use in approved equipment in...

  1. 30 CFR 18.26 - Static electricity.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Static electricity. 18.26 Section 18.26 Mineral... § 18.26 Static electricity. Nonmetallic rotating parts, such as belts and fans, shall be provided with a means to prevent an accumulation of static electricity....

  2. 49 CFR 18.41 - Financial reporting.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Financial reporting. 18.41 Section 18.41... Enforcement § 18.41 Financial reporting. (a) General. (1) Except as provided in paragraphs (a) (2) and (5) of...) Submitting financial reports to Federal agencies, or (ii) Requesting advances or reimbursements when...

  3. 10 CFR 605.18 - National security.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false National security. 605.18 Section 605.18 Energy DEPARTMENT... PROGRAM § 605.18 National security. Activities under ER's Financial Assistance Program shall not involve classified information (i.e., Restricted Data, formerly Restricted Data, National Security...

  4. 27 CFR 18.19 - Security.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Security. 18.19 Section 18.19 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Provisions Document Requirements § 18.19 Security. The concentrate plant and equipment will be so...

  5. 29 CFR 452.18 - Constitutional officers.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Constitutional officers. 452.18 Section 452.18 Labor... DISCLOSURE ACT OF 1959 Coverage of Election Provisions § 452.18 Constitutional officers. A constitutional... identified as such or provided for in the constitution or other organic law of the labor organization. 17...

  6. 29 CFR 525.18 - Review.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Review. 525.18 Section 525.18 Labor Regulations Relating to... DISABILITIES UNDER SPECIAL CERTIFICATES § 525.18 Review. Any person aggrieved by any action of the... allow, file with the Administrator a petition for review. Such review, if granted, shall be made by...

  7. 31 CFR 92.18 - Judicial review.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Judicial review. 92.18 Section 92.18... States Mint § 92.18 Judicial review. A Final Notice of Assessment issued under the procedures in this subpart may be subject to judicial review pursuant to 5 U.S.C. 701 et seq....

  8. 13 CFR 117.18 - Judicial review.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Judicial review. 117.18 Section 117.18 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NONDISCRIMINATION IN FEDERALLY....18 Judicial review. (a) The complainant may file a civil action following the exhaustion...

  9. 32 CFR 18.3 - Organization.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Organization. 18.3 Section 18.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE MILITARY COMMISSIONS APPOINTING AUTHORITY FOR MILITARY COMMISSIONS § 18.3 Organization. (a) The Appointing Authority for Military Commissions...

  10. 38 CFR 18b.93 - Expeditious treatment.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Expeditious treatment. 18b.93 Section 18b.93 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Judicial Standards of Practice § 18b.93 Expeditious treatment. Requests for expeditious treatment...

  11. 28 CFR 542.18 - Response time.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Response time. 542.18 Section 542.18... REMEDY Administrative Remedy Program § 542.18 Response time. If accepted, a Request or Appeal is... later than the third calendar day after filing. If the time period for response to a Request or...

  12. 15 CFR 2301.18 - Selection process.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Selection process. 2301.18 Section 2301.18 Commerce and Foreign Trade Regulations Relating to Telecommunications and Information NATIONAL... PROGRAM Evaluation and Selection Process § 2301.18 Selection process. (a) The PTFP Director will...

  13. 29 CFR 18.56 - Restricted access.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Restricted access. 18.56 Section 18.56 Labor Office of the... ADMINISTRATIVE LAW JUDGES General § 18.56 Restricted access. On his or her own motion, or on the motion of any party, the administrative law judge may direct that there be a restricted access portion of the...

  14. 7 CFR 1709.18 - Civil rights.

    Science.gov (United States)

    2010-01-01

    ... benefits and on equal employment opportunity including 7 CFR parts 15 and 15b; and 45 CFR part 90, as... 7 Agriculture 11 2010-01-01 2010-01-01 false Civil rights. 1709.18 Section 1709.18 Agriculture... ASSISTANCE TO HIGH ENERGY COST COMMUNITIES General Requirements § 1709.18 Civil rights. This program will...

  15. 29 CFR 1917.18 - Log handling.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Log handling. 1917.18 Section 1917.18 Labor Regulations...) MARINE TERMINALS Marine Terminal Operations § 1917.18 Log handling. (a) The employer shall ensure that structures (bunks) used to contain logs have rounded corners and rounded structural parts to avoid...

  16. 12 CFR 725.18 - Creditworthiness.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Creditworthiness. 725.18 Section 725.18 Banks... UNION ADMINISTRATION CENTRAL LIQUIDITY FACILITY § 725.18 Creditworthiness. (a) Prior to Facility... advances for its liquidity needs....

  17. 1 CFR 18.7 - Signature.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Signature. 18.7 Section 18.7 General Provisions... PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.7 Signature. The original and each duplicate original... stamped beneath the signature. Initialed or impressed signatures will not be accepted. Documents...

  18. 7 CFR 946.18 - Container.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container. 946.18 Section 946.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Order Regulating Handling Definitions § 946.18 Container. Container means a sack, box, bag,...

  19. 32 CFR 552.18 - Administration.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Administration. 552.18 Section 552.18 National... CEMETERIES REGULATIONS AFFECTING MILITARY RESERVATIONS Post Commander § 552.18 Administration. (a) Purpose... economical operation, administration, service, and supply of all individuals, units, and activities...

  20. 30 CFR 18.69 - Adequacy tests.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Adequacy tests. 18.69 Section 18.69 Mineral... MINING PRODUCTS ELECTRIC MOTOR-DRIVEN MINE EQUIPMENT AND ACCESSORIES Inspections and Tests § 18.69 Adequacy tests. MSHA reserves the right to conduct appropriate test(s) to verify the adequacy of...

  1. 29 CFR 18.42 - Expedited proceedings.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Expedited proceedings. 18.42 Section 18.42 Labor Office of... OF ADMINISTRATIVE LAW JUDGES General § 18.42 Expedited proceedings. (a) When expedited proceedings are required by statute or regulation, or at any time after commencement of a proceeding, any...

  2. 39 CFR 960.18 - Further proceedings.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Further proceedings. 960.18 Section 960.18 Postal... JUSTICE ACT IN POSTAL SERVICE PROCEEDINGS Procedures for Considering Applications § 960.18 Further proceedings. (a) Ordinarily, the determination of an award will be made on the basis of the written...

  3. 1 CFR 18.9 - Style.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Style. 18.9 Section 18.9 General Provisions... PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.9 Style. Each document submitted by an agency for filing and publication shall conform to the current edition of the U.S. Government Printing Office...

  4. The dynamic response of carbon fiber-filled polymer composites

    OpenAIRE

    Patterson B.; Orler E.B.; Furmanski J.; Rigg P.A.; Scharff R.J.; Stahl D.B.; Sheffield S.A.; Gustavsen R.L.; Dattelbaum D.M.; Coe J.D.

    2012-01-01

    The dynamic (shock) responses of two carbon fiber-filled polymer composites have been quantified using gas gun-driven plate impact experimentation. The first composite is a filament-wound, highly unidirectional carbon fiber-filled epoxy with a high degree of porosity. The second composite is a chopped carbon fiber- and graphite-filled phenolic resin with little-to-no porosity. Hugoniot data are presented for the carbon fiber-epoxy (CE) composite to 18.6 GPa in the through-thickness direction,...

  5. Carbon nanotube composite materials

    Energy Technology Data Exchange (ETDEWEB)

    O' Bryan, Gregory; Skinner, Jack L; Vance, Andrew; Yang, Elaine Lai; Zifer, Thomas

    2015-03-24

    A material consisting essentially of a vinyl thermoplastic polymer, un-functionalized carbon nanotubes and hydroxylated carbon nanotubes dissolved in a solvent. Un-functionalized carbon nanotube concentrations up to 30 wt % and hydroxylated carbon nanotube concentrations up to 40 wt % can be used with even small concentrations of each (less than 2 wt %) useful in producing enhanced conductivity properties of formed thin films.

  6. Mutagenicity of carbon nanomaterials

    DEFF Research Database (Denmark)

    Wallin, Håkan; Jacobsen, Nicklas Raun; White, Paul A;

    2011-01-01

    Carbon nanomaterials such carbon nanotubes, graphene and fullerenes are some the most promising nanomaterials. Although carbon nanomaterials have been reported to possess genotoxic potential, it is imperitive to analyse the data on the genotoxicity of carbon nanomaterials in vivo and in vitro...

  7. Electroanalysis with carbon paste electrodes

    CERN Document Server

    Svancara, Ivan; Walcarius, Alain; Vytras, Karel

    2011-01-01

    Introduction to Electrochemistry and Electroanalysis with Carbon Paste-Based ElectrodesHistorical Survey and GlossaryField in Publication Activities and LiteratureCarbon Pastes and Carbon Paste ElectrodesCarbon Paste as the Binary MixtureClassification of Carbon Pastes and Carbon Paste ElectrodesConstruction of Carbon Paste HoldersCarbon Paste as the Electrode MaterialPhysicochemical Properties of Carbon PastesElectrochemical Characteristics of Carbon PastesTesting of Unmodified CPEsIntera

  8. Mesoporous carbon materials

    Science.gov (United States)

    Dai, Sheng; Fulvio, Pasquale Fernando; Mayes, Richard T.; Wang, Xiqing; Sun, Xiao-Guang; Guo, Bingkun

    2014-09-09

    A conductive mesoporous carbon composite comprising conductive carbon nanoparticles contained within a mesoporous carbon matrix, wherein the conductive mesoporous carbon composite possesses at least a portion of mesopores having a pore size of at least 10 nm and up to 50 nm, and wherein the mesopores are either within the mesoporous carbon matrix, or are spacings delineated by surfaces of said conductive carbon nanoparticles when said conductive carbon nanoparticles are fused with each other, or both. Methods for producing the above-described composite, devices incorporating them (e.g., lithium batteries), and methods of using them, are also described.

  9. Pyrolyzed thin film carbon

    Science.gov (United States)

    Tai, Yu-Chong (Inventor); Liger, Matthieu (Inventor); Harder, Theodore (Inventor); Konishi, Satoshi (Inventor); Miserendino, Scott (Inventor)

    2010-01-01

    A method of making carbon thin films comprises depositing a catalyst on a substrate, depositing a hydrocarbon in contact with the catalyst and pyrolyzing the hydrocarbon. A method of controlling a carbon thin film density comprises etching a cavity into a substrate, depositing a hydrocarbon into the cavity, and pyrolyzing the hydrocarbon while in the cavity to form a carbon thin film. Controlling a carbon thin film density is achieved by changing the volume of the cavity. Methods of making carbon containing patterned structures are also provided. Carbon thin films and carbon containing patterned structures can be used in NEMS, MEMS, liquid chromatography, and sensor devices.

  10. Carbon Footprint of Beef Cattle

    Directory of Open Access Journals (Sweden)

    Jim Dyer

    2012-12-01

    Full Text Available The carbon footprint of beef cattle is presented for Canada, The United States, The European Union, Australia and Brazil. The values ranged between 8 and 22 kg CO2e per kg of live weight (LW depending on the type of farming system, the location, the year, the type of management practices, the allocation, as well as the boundaries of the study. Substantial reductions have been observed for most of these countries in the last thirty years. For instance, in Canada the mean carbon footprint of beef cattle at the exit gate of the farm decreased from 18.2 kg CO2e per kg LW in 1981 to 9.5 kg CO2e per kg LW in 2006 mainly because of improved genetics, better diets, and more sustainable land management practices. Cattle production results in products other than meat, such as hides, offal and products for rendering plants; hence the environmental burden must be distributed between these useful products. In order to do this, the cattle carbon footprint needs to be reported in kg of CO2e per kg of product. For example, in Canada in 2006, on a mass basis, the carbon footprint of cattle by-products at the exit gate of the slaughterhouse was 12.9 kg CO2e per kg of product. Based on an economic allocation, the carbon footprints of meat (primal cuts, hide, offal and fat, bones and other products for rendering were 19.6, 12.3, 7 and 2 kg CO2e per kg of product, respectively.

  11. Association of interleukin-18 and asthma.

    Science.gov (United States)

    Xu, Ming-Hui; Yuan, Feng-Lai; Wang, Shu-Jing; Xu, Hui-Ying; Li, Cheng-Wan; Tong, Xiao

    2017-02-01

    Cytokine-mediated immunity plays a dominant role in the pathogenesis of various immune diseases, including asthma. The recent identification of the family interleukin (IL)-1-related cytokine IL-18 now contributes to our understanding of the fine-tuning of cellular immunity. IL-18 can act as a cofactor for Th2 cell development and IgE production and also plays an important role in the differentiation of Th1 cells. Recent work identified an IL-18 association with the pathogenesis of asthma, wherein increased IL-18 expression was found in the serum of patients. Furthermore, IL-18 polymorphisms with susceptibility to asthma were reported, suggesting that IL-18 may be therapeutically relevant to asthma. In this review, we discuss the role of IL-18 in the pathogenesis of asthma and its therapeutic potential based on current research.

  12. Carbon isotope fluctuations in Precambrian carbonate sequences of several localities in Brazil

    Directory of Open Access Journals (Sweden)

    SIAL ALCIDES N.

    2000-01-01

    Full Text Available Carbon isotope fluctuations in Precambrian sedimentary carbonates between 2.8 Ga and 0.60 Ga in Brazil are examined in this study. The carbonate facies of the BIF of the 2.8 Ga-old Carajás Formation, state of Pará in northern Brazil, has rather homogeneous delta13C (-5 o/ooPDB, compatible with carbonatization of a silicate protolith by a CO2-rich fluid from mantle degassing. The Paleoproterozoic Gandarela Formation, state of Minas Gerais, displays a narrow delta13C variation (-1.5 to +0.5 o/oo compatible with carbon isotope signatures of carbonates deposited around 2.4 Ga worldwide. The Fecho do Funil Formation has probably recorded the Lomagundi delta13C positive anomaly (+6.4 to +7.1 o/ooPDB. The magnesite-bearing carbonates of the Orós mobile belt, state of Ceará, exhibit carbon isotope fluctuation within the range for carbonates deposited at 1.8 Ga. The C-isotope record of the Frecheirinha Formation, northwestern state of Ceará, shows negative delta13C values in its lower portion (-2 o/oo and positive values up section (+1 to +3 o/oo, which suggests this sequence is a cap carbonate deposited after a glacial event around 0.95 Ga. The Jacoca and Acauã sedimentary carbonate Formations, state of Sergipe, NE Brazil, show carbon isotope fluctuations very similar to each other (average around -5 o/oo, compatible with a deposition around 0.76 Ga. The younger Olho D'Água carbonate Formation, however, also in the state of Sergipe, displays negative delta13C values at the lower portion of the Formation, changing dramatically up section to positive values as high as +10 o/oo, a characteristic compatible with a Sturtian cap carbonate deposited around 0.69 Ga. On the light of the C isotope data discussed in this study, it seems that delta13C fluctuations in Paleoproterozoic carbonates in Brazil are within the range found globally for metasedimentary carbonates of this age. Carbon isotope data proved to be very useful in establishing relative

  13. Imbalance of Interleukin 18 and Interleukin 18 Binding Protein in Patients with Lupus Nephritis

    Institute of Scientific and Technical Information of China (English)

    Dong Liang; Wenfeng Ma; Cuiwei Yao; Huafeng Liu; Xiaowen Chen

    2006-01-01

    To evaluate the balance status of interleukin 18 (IL-18) and interleukin 18 binding protein (IL-18BP) in circulation in patients with lupus nephritis (LN) and primary nephrotic syndrome (PNS), plasma levels as well as mRNA expression in peripheral blood mononuclear cells (PBMCs) of IL-18 and IL-18BP were measured by ELISA and RT-PCR respectively. The ratio of IL-18/IL-18BP was also calculated. Both plasma IL-18 and IL-18BP increased significantly in LN patients while only IL-18BP increased in PNS, which resulted in an elevated ratio of IL-18/IL-18BP in LN but not in PNS patients when compared with normal controls. In contrast, increased level of IL-18 mRNA was only detected in LN but not in PNS group, although IL-18BP mRNA expressions in PBMCs in both groups were higher than that in control. The imbalance of IL-18 and IL-18BP might be involved in the pathogenesis of LN, based on which a therapeutic approach is valuable to be developed for LN. Cellular & Molecular Immunology. 2006;3(4):303-306.

  14. Structural basis for antagonism of human interleukin 18 by poxvirus interleukin 18-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Krumm, Brian; Meng, Xiangzhi; Li, Yongchao; Xiang, Yan; Deng, Junpeng (Texas-HSC); (OKLU)

    2009-07-10

    Human interleukin-18 (hIL-18) is a cytokine that plays an important role in inflammation and host defense against microbes. Its activity is regulated in vivo by a naturally occurring antagonist, the human IL-18-binding protein (IL-18BP). Functional homologs of human IL-18BP are encoded by all orthopoxviruses, including variola virus, the causative agent of smallpox. They contribute to virulence by suppressing IL-18-mediated immune responses. Here, we describe the 2.0-{angstrom} resolution crystal structure of an orthopoxvirus IL-18BP, ectromelia virus IL-18BP (ectvIL-18BP), in complex with hIL-18. The hIL-18 structure in the complex shows significant conformational change at the binding interface compared with the structure of ligand-free hIL-18, indicating that the binding is mediated by an induced-fit mechanism. EctvIL-18BP adopts a canonical Ig fold and interacts via one edge of its {beta}-sandwich with 3 cavities on the hIL-18 surface through extensive hydrophobic and hydrogen bonding interactions. Most of the ectvIL-18BP residues that participate in these interactions are conserved in both human and viral homologs, explaining their functional equivalence despite limited sequence homology. EctvIL-18BP blocks a putative receptor-binding site on IL-18, thus preventing IL-18 from engaging its receptor. Our structure provides insights into how IL-18BPs modulate hIL-18 activity. The revealed binding interface provides the basis for rational design of inhibitors against orthopoxvirus IL-18BP (for treating orthopoxvirus infection) or hIL-18 (for treating certain inflammatory and autoimmune diseases).

  15. Carbon compound used in hydrogen storage; Compuesto de carbon utilizado en almacenamiento de hidrogeno

    Energy Technology Data Exchange (ETDEWEB)

    Iturbe G, J.L.; Lopez M, B.E. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2004-07-01

    In the present work it is studied the activated carbon of mineral origin for the sorption of hydrogen. The carbon decreased of particle size by means of the one alloyed mechanical. The time of mill was of 10 hours. The characterization one carries out by scanning electron microscopy and X-ray diffraction. The hydrogen sipped in the carbon material it was determined using the Thermal gravimetric method (TGA). The conditions of hydrogenation went at 10 atm of pressure and ambient temperature during 18 hours. They were also carried out absorption/desorption cycles of hydrogen in the same one system of thermal gravimetric analysis. The results showed percentages of sorption of 2% approximately in the cycles carried out in the system TGA and of 4.5% in weight of hydrogen at pressure of 10 atmospheres and ambient temperature during 18 hours. (Author)

  16. Adsorption of Carbon Dioxide on Activated Carbon

    Institute of Scientific and Technical Information of China (English)

    Bo Guo; Liping Chang; Kechang Xie

    2006-01-01

    The adsorption of CO2 on a raw activated carbon A and three modified activated carbon samples B, C, and D at temperatures ranging from 303 to 333 K and the thermodynamics of adsorption have been investigated using a vacuum adsorption apparatus in order to obtain more information about the effect of CO2 on removal of organic sulfur-containing compounds in industrial gases. The active ingredients impregnated in the carbon samples show significant influence on the adsorption for CO2 and its volumes adsorbed on modified carbon samples B, C, and D are all larger than that on the raw carbon sample A. On the other hand, the physical parameters such as surface area, pore volume, and micropore volume of carbon samples show no influence on the adsorbed amount of CO2. The Dubinin-Radushkevich (D-R) equation was the best model for fitting the adsorption data on carbon samples A and B, while the Freundlich equation was the best fit for the adsorption on carbon samples C and D. The isosteric heats of adsorption on carbon samples A, B, C, and D derived from the adsorption isotherms using the Clapeyron equation decreased slightly increasing surface loading. The heat of adsorption lay between 10.5 and 28.4 kJ/mol, with the carbon sample D having the highest value at all surface coverages that were studied. The observed entropy change associated with the adsorption for the carbon samples A, B, and C (above the surface coverage of 7 ml/g) was lower than the theoretical value for mobile adsorption. However, it was higher than the theoretical value for mobile adsorption but lower than the theoretical value for localized adsorption for carbon sample D.

  17. Stable Carbon and Oxygen Isotopes of Pedogenic Carbonates in Ustic Vertisols: Implications for Paleoenvironmental Change

    Institute of Scientific and Technical Information of China (English)

    HUANG Cheng-Min; WANG Cheng-Shan; TANG Ya

    2005-01-01

    Pedogenic carbonates, found extensively in arid and semiarid regions, are important in revealing regional climatic and environmental changes as well as the carbon cycle. In addition, stable carbon and oxygen isotopic compositions of pedogenic carbonates have been used to rebuild paleoecology (biomass and vegetation) and to estimate paleotemperature and paleoprecipitation during past geological time. By utilizing the stable carbon and oxygen isotopic compositions (δ13C and δ18O) of secondary nodules in Ustic Vertisols, this study looked into the climatic and environmental changes in the dry valleys of the Yuanmou Basin, Yunnan Province, in southwestern China. The results showed that during the early Holocene, a warm-humid or hot-humid climate existed in the Yuanmou Basin, but since then fluctuations in climate have occurred, with a dry climate prevailing. A highly significant correlation (r = 0.92, n= 9) between δ13C and δ18O values of carbonates illustrated that there had been a continual shifting between cold-humid and warm-dry climates in southwestern China including the Yuanmou Basin since the early Holocene.

  18. Carbon fuel cells with carbon corrosion suppression

    Science.gov (United States)

    Cooper, John F [Oakland, CA

    2012-04-10

    An electrochemical cell apparatus that can operate as either a fuel cell or a battery includes a cathode compartment, an anode compartment operatively connected to the cathode compartment, and a carbon fuel cell section connected to the anode compartment and the cathode compartment. An effusion plate is operatively positioned adjacent the anode compartment or the cathode compartment. The effusion plate allows passage of carbon dioxide. Carbon dioxide exhaust channels are operatively positioned in the electrochemical cell to direct the carbon dioxide from the electrochemical cell.

  19. 18 CFR 1301.18 - TVA review of request for correction or amendment of record.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false TVA review of request for correction or amendment of record. 1301.18 Section 1301.18 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY PROCEDURES Privacy Act § 1301.18 TVA review of request for...

  20. 18 CFR 1309.18 - Under what circumstances must recipients take remedial or affirmative action?

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Under what circumstances must recipients take remedial or affirmative action? 1309.18 Section 1309.18 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY NONDISCRIMINATION WITH RESPECT TO AGE § 1309.18...

  1. The Australian terrestrial carbon budget

    Directory of Open Access Journals (Sweden)

    V. Haverd

    2013-02-01

    Full Text Available This paper reports a study of the full carbon (C-CO2 budget of the Australian continent, focussing on 1990–2011 in the context of estimates over two centuries. The work is a contribution to the RECCAP (REgional Carbon Cycle Assessment and Processes project, as one of numerous regional studies. In constructing the budget, we estimate the following component carbon fluxes: net primary production (NPP; net ecosystem production (NEP; fire; land use change (LUC; riverine export; dust export; harvest (wood, crop and livestock and fossil fuel emissions (both territorial and non-territorial. Major biospheric fluxes were derived using BIOS2 (Haverd et al., 2012, a fine-spatial-resolution (0.05° offline modelling environment in which predictions of CABLE (Wang et al., 2011, a sophisticated land surface model with carbon cycle, are constrained by multiple observation types. The mean NEP reveals that climate variability and rising CO2 contributed 12 ± 24 (1σ error on mean and 68 ± 15 TgC yr−1, respectively. However these gains were partially offset by fire and LUC (along with other minor fluxes, which caused net losses of 26 ± 4 TgC yr−1 and 18 ± 7 TgC yr−1, respectively. The resultant net biome production (NBP is 36 ± 29 TgC yr−1, in which the largest contributions to uncertainty are NEP, fire and LUC. This NBP offset fossil fuel emissions (95 ± 6 TgC yr−1 by 38 ± 30%. The interannual variability (IAV in the Australian carbon budget exceeds Australia's total carbon emissions by fossil fuel combustion and is dominated by IAV in NEP. Territorial fossil fuel emissions are significantly smaller than the rapidly growing fossil fuel exports: in 2009–2010, Australia exported 2.5 times more carbon in fossil fuels than it emitted by burning fossil fuels.

  2. Structure-function study of mammalian Munc18-1 and C. elegans UNC-18 implicates domain 3b in the regulation of exocytosis.

    Directory of Open Access Journals (Sweden)

    Margaret E Graham

    Full Text Available Munc18-1 is an essential synaptic protein functioning during multiple stages of the exocytotic process including vesicle recruitment, docking and fusion. These functions require a number of distinct syntaxin-dependent interactions; however, Munc18-1 also regulates vesicle fusion via syntaxin-independent interactions with other exocytotic proteins. Although the structural regions of the Munc18-1 protein involved in closed-conformation syntaxin binding have been thoroughly examined, regions of the protein involved in other interactions are poorly characterised. To investigate this we performed a random transposon mutagenesis, identifying domain 3b of Munc18-1 as a functionally important region of the protein. Transposon insertion in an exposed loop within this domain specifically disrupted Mint1 binding despite leaving affinity for closed conformation syntaxin and binding to the SNARE complex unaffected. The insertion mutation significantly reduced total amounts of exocytosis as measured by carbon fiber amperometry in chromaffin cells. Introduction of the equivalent mutation in UNC-18 in Caenorhabditis elegans also reduced neurotransmitter release as assessed by aldicarb sensitivity. Correlation between the two experimental methods for recording changes in the number of exocytotic events was verified using a previously identified gain of function Munc18-1 mutation E466K (increased exocytosis in chromaffin cells and aldicarb hypersensitivity of C. elegans. These data implicate a novel role for an exposed loop in domain 3b of Munc18-1 in transducing regulation of vesicle fusion independent of closed-conformation syntaxin binding.

  3. IL-18 and IL-18 binding protein levels in patients with dengue virus infection

    Institute of Scientific and Technical Information of China (English)

    Chintana Chirathaworn; Yong Poovorawan; Viboonsak Vuthitanachot

    2010-01-01

    Objective:To determine the levels ofIL-18 andIL-18binding protein(BP) in patients with dengue virus infection.Methods: Acute and convalescent sera were collected from each patient. Control group was sera from blood donors. The levels of both IL-18 andIL-18BP were measured byELISA assays.Results: It was shown thatIL-18 andIL-18BPlevels were significantly higher in patients when compared with controls. In addition, the level ofIL-18BP was lower in convalescent than in acute sera.Conclusions: These data suggest that bothIL-18 andIL-18BP production was induced following dengue virus infection. Investigating the regulation of IL-18 by its natural regulator could lead to further understanding of the immune response or immunopathogenesis following dengue virus infection.

  4. Drought sensitivity of Amazonian carbon balance revealed by atmospheric measurements.

    Science.gov (United States)

    Gatti, L V; Gloor, M; Miller, J B; Doughty, C E; Malhi, Y; Domingues, L G; Basso, L S; Martinewski, A; Correia, C S C; Borges, V F; Freitas, S; Braz, R; Anderson, L O; Rocha, H; Grace, J; Phillips, O L; Lloyd, J

    2014-02-06

    Feedbacks between land carbon pools and climate provide one of the largest sources of uncertainty in our predictions of global climate. Estimates of the sensitivity of the terrestrial carbon budget to climate anomalies in the tropics and the identification of the mechanisms responsible for feedback effects remain uncertain. The Amazon basin stores a vast amount of carbon, and has experienced increasingly higher temperatures and more frequent floods and droughts over the past two decades. Here we report seasonal and annual carbon balances across the Amazon basin, based on carbon dioxide and carbon monoxide measurements for the anomalously dry and wet years 2010 and 2011, respectively. We find that the Amazon basin lost 0.48 ± 0.18 petagrams of carbon per year (Pg C yr(-1)) during the dry year but was carbon neutral (0.06 ± 0.1 Pg C yr(-1)) during the wet year. Taking into account carbon losses from fire by using carbon monoxide measurements, we derived the basin net biome exchange (that is, the carbon flux between the non-burned forest and the atmosphere) revealing that during the dry year, vegetation was carbon neutral. During the wet year, vegetation was a net carbon sink of 0.25 ± 0.14 Pg C yr(-1), which is roughly consistent with the mean long-term intact-forest biomass sink of 0.39 ± 0.10 Pg C yr(-1) previously estimated from forest censuses. Observations from Amazonian forest plots suggest the suppression of photosynthesis during drought as the primary cause for the 2010 sink neutralization. Overall, our results suggest that moisture has an important role in determining the Amazonian carbon balance. If the recent trend of increasing precipitation extremes persists, the Amazon may become an increasing carbon source as a result of both emissions from fires and the suppression of net biome exchange by drought.

  5. Indicators of δ13C and δ18O of gas hydrate-associated sediments

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The analyses of δ13C and δ18O of gas hydrate-associated sediments from two cores on Hydrate Ridge in Cascadia convergent margin offshore Oregon, eastern North Pacific show the values of d 13C from -29.81‰ to -48.28‰ (PDB) and d 18O from 2.56‰ to 4.28‰ (PDB), which could be plotted into a group called typical carbonate minerals influenced by the methane in cold venting. Moreover, the values of d 13C and d 18O show a consistent trend in both cores from top to bottom with increasing of d 13C and decreasing of d 18O. This trend could be explained as an effect caused by the anaerobic oxidation of methane (AOM) in depth and the oxygen fraction during the formation of gas hydrate in depth together. These characteristics of d 13C and d 18O indicate that the gas hydrate-associated sediments are significantly different from the normal marine carbonates, and they are deeply influenced by the formation and evolution of gas hydrate. So, the distinct characteristics of d 13C and d 18O of gas hydrate-associated sediments could be undoubtedly believed as one of parameters to determine the presence of gas hydrates in other unknown marine sediment cores.

  6. Metallic carbon materials

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, M.L.; Crespi, V.H.; Louie, S.G.S.; Zettl, A.K.

    1999-11-30

    Novel metallic forms of planar carbon are described, as well as methods of designing and making them. Nonhexagonal arrangements of carbon are introduced into a graphite carbon network essentially without destroying the planar structure. Specifically a form of carbon comprising primarily pentagons and heptagons, and having a large density of states at the Fermi level is described. Other arrangements of pentagons and heptagons that include some hexagons, and structures incorporating squares and octagons are additionally disclosed. Reducing the bond angle symmetry associated with a hexagonal arrangement of carbons increases the likelihood that the carbon material will have a metallic electron structure.

  7. Synthesis of carbon nanotubes.

    Science.gov (United States)

    Awasthi, Kalpana; Srivastava, Anchal; Srivastava, O N

    2005-10-01

    Carbon nanotubes play a fundamental role in the rapidly developing field of nanoscience and nanotechnology because of their unique properties and high potential for applications. In this article, the different synthesis methods of carbon nanotubes (both multi-walled and single-walled) are reviewed. From the industrial point of view, the chemical vapor deposition method has shown advantages over laser vaporization and electric arc discharge methods. This article also presents recent work in the controlled synthesis of carbon nanotubes with ordered architectures. Special carbon nanotube configurations, such as nanocoils, nanohorns, bamboo-shaped and carbon cylinder made up from carbon nanotubes are also discussed.

  8. 30 CFR 18.24 - Electrical clearances.

    Science.gov (United States)

    2010-07-01

    ... Requirements § 18.24 Electrical clearances. Minimum clearances between uninsulated electrical conductor surfaces, or between uninsulated conductor surfaces and grounded metal surfaces, within the enclosure...

  9. Substantial global carbon uptake by cement carbonation

    Science.gov (United States)

    Xi, Fengming; Davis, Steven J.; Ciais, Philippe; Crawford-Brown, Douglas; Guan, Dabo; Pade, Claus; Shi, Tiemao; Syddall, Mark; Lv, Jie; Ji, Lanzhu; Bing, Longfei; Wang, Jiaoyue; Wei, Wei; Yang, Keun-Hyeok; Lagerblad, Björn; Galan, Isabel; Andrade, Carmen; Zhang, Ying; Liu, Zhu

    2016-12-01

    Calcination of carbonate rocks during the manufacture of cement produced 5% of global CO2 emissions from all industrial process and fossil-fuel combustion in 2013. Considerable attention has been paid to quantifying these industrial process emissions from cement production, but the natural reversal of the process--carbonation--has received little attention in carbon cycle studies. Here, we use new and existing data on cement materials during cement service life, demolition, and secondary use of concrete waste to estimate regional and global CO2 uptake between 1930 and 2013 using an analytical model describing carbonation chemistry. We find that carbonation of cement materials over their life cycle represents a large and growing net sink of CO2, increasing from 0.10 GtC yr-1 in 1998 to 0.25 GtC yr-1 in 2013. In total, we estimate that a cumulative amount of 4.5 GtC has been sequestered in carbonating cement materials from 1930 to 2013, offsetting 43% of the CO2 emissions from production of cement over the same period, not including emissions associated with fossil use during cement production. We conclude that carbonation of cement products represents a substantial carbon sink that is not currently considered in emissions inventories.

  10. Potassium carbonate poisoning

    Science.gov (United States)

    Potassium carbonate is a white powder used to make soap, glass, and other items. This article discusses poisoning from swallowing or breathing in potassium carbonate. This article is for information only. Do ...

  11. Sodium carbonate poisoning

    Science.gov (United States)

    Sodium carbonate (known as washing soda or soda ash) is a chemical found in many household and ... products. This article focuses on poisoning due to sodium carbonate. This article is for information only. Do ...

  12. Carbon nanotube nanoelectrode arrays

    Science.gov (United States)

    Ren, Zhifeng; Lin, Yuehe; Yantasee, Wassana; Liu, Guodong; Lu, Fang; Tu, Yi

    2008-11-18

    The present invention relates to microelectode arrays (MEAs), and more particularly to carbon nanotube nanoelectrode arrays (CNT-NEAs) for chemical and biological sensing, and methods of use. A nanoelectrode array includes a carbon nanotube material comprising an array of substantially linear carbon nanotubes each having a proximal end and a distal end, the proximal end of the carbon nanotubes are attached to a catalyst substrate material so as to form the array with a pre-determined site density, wherein the carbon nanotubes are aligned with respect to one another within the array; an electrically insulating layer on the surface of the carbon nanotube material, whereby the distal end of the carbon nanotubes extend beyond the electrically insulating layer; a second adhesive electrically insulating layer on the surface of the electrically insulating layer, whereby the distal end of the carbon nanotubes extend beyond the second adhesive electrically insulating layer; and a metal wire attached to the catalyst substrate material.

  13. Carbon Monoxide (CO)

    Science.gov (United States)

    ... IAQ) Share Facebook Twitter Google+ Pinterest Contact Us Carbon Monoxide's Impact on Indoor Air Quality On this ... length of exposure. Top of Page Sources of Carbon Monoxide Sources of CO include: unvented kerosene and ...

  14. Soil Organic Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Soil organic carbon (SOC) is the carbon held within soil organic constituents (i.e., products produced as dead plants and animals decompose and the soil microbial...

  15. Biomass Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Biomass carbon includes carbon stored in above- and below-ground live plant components (such as leaf, branch, stem and root) as well as in standing and down dead...

  16. Trading forest carbon - OSU

    Science.gov (United States)

    Issues associate with trading carbon sequestered in forests are discussed. Scientific uncertainties associated with carbon measurement are discussed with respect to proposed accounting procedures. Major issues include: (1) Establishing baselines. (2) Determining additivity from f...

  17. SILICA SURFACED CARBON FIBERS.

    Science.gov (United States)

    carbon fibers . Several economical and simple processes were developed for obtaining research quantities of silica surfaced carbon filaments. Vat dipping processes were utilized to deposit an oxide such as silica onto the surface and into the micropores of available carbon or graphite base fibers. High performance composite materials were prepared with the surface treated carbon fibers and various resin matrices. The ablative characteristics of these composites were very promising and exhibited fewer limitations than either silica or...treated

  18. Ozone adsorption on carbon nanoparticles

    Science.gov (United States)

    Chassard, Guillaume; Gosselin, Sylvie; Visez, Nicolas; Petitprez, Denis

    2014-05-01

    Carbonaceous particles produced by incomplete combustion or thermal decomposition of hydrocarbons are ubiquitous in the atmosphere. On these particles are adsorbed hundreds of chemical species. Those of great concern to health are polycyclic aromatic hydrocarbons (PAHs). During atmospheric transport, particulate PAHs react with gaseous oxidants. The induced chemical transformations may change toxicity and hygroscopicity of these potentially inhalable particles. The interaction between ozone and carbon particles has been extensively investigated in literature. However ozone adsorption and surface reaction mechanisms are still ambiguous. Some studies described a fast catalytic decomposition of ozone initiated by an atomic oxygen chemisorption followed by a molecular oxygen release [1-3]. Others suggested a reversible ozone adsorption according to Langmuir-type behaviour [4,5]. The aim of this present study is a better understanding of ozone interaction with carbon surfaces. An aerosol of carbon nanoparticles was generated by flowing synthetic air in a glass tube containing pure carbon (primary particles p. 967-973. [2] Smith, D. and A. Chughtai, Reaction kinetics of ozone at low concentrations with n-hexane soot. Journal of geophysical research, 1996. 101(D14): p. 19607-19,620. [3] Kamm, S., et al., The heterogeneous reaction of ozone with soot aerosol. Atmospheric Environment, 1999. 33(28): p. 4651-4661. [4] Stephens, S., M.J. Rossi, and D.M. Golden, The heterogeneous reaction of ozone on carbonaceous surfaces. International journal of chemical kinetics, 1986. 18(10): p. 1133-1149. [5] Pöschl, U., et al., Interaction of ozone and water vapor with spark discharge soot aerosol particles coated with benzo [a] pyrene: O3 and H2O adsorption, benzo [a] pyrene degradation, and atmospheric implications. The Journal of Physical Chemistry A, 2001. 105(16): p. 4029-4041.

  19. Nanoparticle Decoration of Carbon Nanotubes by Sputtering

    Science.gov (United States)

    2013-02-01

    on metal morphology, as does diffusion activation energy. Comparison of the metal– graphene interfa- cial energy to the surface energy of the metal...Nanotechnology 2009;20:375501–11. [17] O. Yaglioglu, Thesis . Massachusetts Institute of Technology, Department of Mechanical Engineering; 2007. [18] Venables...25] Osswald S, Flahaut E, Ye H, Gogotsi Y. Elimination of D-band in Raman spectra of double-wall carbon nanotubes by oxidation . Chem Phys Lett

  20. 7 CFR 930.18 - Secretary.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Secretary. 930.18 Section 930.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE TART CHERRIES GROWN IN THE STATES...

  1. 36 CFR 331.18 - Restrictions.

    Science.gov (United States)

    2010-07-01

    ... public health, public safety, security, maintenance, or other reasons in the public interest. Entering or... 331.18 Parks, Forests, and Public Property CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY REGULATIONS..., KENTUCKY AND INDIANA § 331.18 Restrictions. The District Engineer may establish and post a schedule...

  2. 7 CFR 30.18 - Injury.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Injury. 30.18 Section 30.18 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... deformed leaves; or tobacco hurt by insects; or tobacco affected by wild-fire, black fire, rust,...

  3. 44 CFR 9.18 - Responsibilities.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Responsibilities. 9.18... HOMELAND SECURITY GENERAL FLOODPLAIN MANAGEMENT AND PROTECTION OF WETLANDS § 9.18 Responsibilities. (a) Regional Administrators' responsibilities. Regional Administrators shall, for all actions falling...

  4. 38 CFR 18.444 - Academic adjustments.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Academic adjustments. 18.444 Section 18.444 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED....444 Academic adjustments. (a) Academic requirements. A recipient shall make necessary modifications...

  5. 19 CFR 18.26 - Indirect exportation.

    Science.gov (United States)

    2010-04-01

    ... merchandise to be exported and provide such evidence of exportation as required by the port director under... 19 Customs Duties 1 2010-04-01 2010-04-01 false Indirect exportation. 18.26 Section 18.26 Customs... TRANSPORTATION IN BOND AND MERCHANDISE IN TRANSIT Exportation from Customs Custody of Merchandise Unentered...

  6. 19 CFR 18.43 - Indirect exportation.

    Science.gov (United States)

    2010-04-01

    .... port to another for actual exportation at the second port, any export declarations required to be... 19 Customs Duties 1 2010-04-01 2010-04-01 false Indirect exportation. 18.43 Section 18.43 Customs... TRANSPORTATION IN BOND AND MERCHANDISE IN TRANSIT Merchandise Not Otherwise Subject to Customs Control...

  7. 19 CFR 18.25 - Direct exportation.

    Science.gov (United States)

    2010-04-01

    ... to be exported and provide such evidence of exportation as required by the port director under § 113... 19 Customs Duties 1 2010-04-01 2010-04-01 false Direct exportation. 18.25 Section 18.25 Customs... TRANSPORTATION IN BOND AND MERCHANDISE IN TRANSIT Exportation from Customs Custody of Merchandise Unentered...

  8. 38 CFR 18.439 - Private education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Private education. 18.439... Adult Education § 18.439 Private education. (a) A recipient that provides private elementary or secondary education may not on the basis of handicap, exclude a qualified handicapped person if the...

  9. 27 CFR 18.65 - Annual report.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Annual report. 18.65... OF THE TREASURY LIQUORS PRODUCTION OF VOLATILE FRUIT-FLAVOR CONCENTRATE Records and Reports § 18.65 Annual report. An annual report, on Form 1695(5520.2), of concentrate plant operations shall be...

  10. 12 CFR 703.18 - Grandfathered investments.

    Science.gov (United States)

    2010-01-01

    ... for the investment consistent with generally accepted accounting principles. (b) All grandfathered... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Grandfathered investments. 703.18 Section 703... INVESTMENT AND DEPOSIT ACTIVITIES § 703.18 Grandfathered investments. (a) Subject to safety and...

  11. Normal free interleukin-18 (IL-18) plasma levels in dengue virus infection and the need to measure both total IL-18 and IL-18 binding protein levels

    NARCIS (Netherlands)

    Michels, M.; Mast, Q. de; Netea, M.G.; Joosten, L.A.B.; Dinarello, C.A.; Rudiman, P.I.; Sinarta, S.; Wisaksana, R.; Alisjahbana, B.; Ven, A. van der

    2015-01-01

    Activated monocytes/macrophages and T lymphocytes that produce a cytokine storm are assumed to play a pivotal role in the pathogenesis of dengue. Interleukin-18 (IL-18) is a proinflammatory cytokine that is increased during dengue and known to induce gamma interferon (IFN-gamma), which is crucial fo

  12. 38 CFR 18.543 - Mediation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Mediation. 18.543 Section... Enforcement Procedures § 18.543 Mediation. (a) Referral of complaints for mediation. VA will refer to the Federal Mediation and Conciliation Service all complaints that: (1) Fall within the jurisdiction of...

  13. 47 CFR 78.18 - Frequency assignments.

    Science.gov (United States)

    2010-10-01

    ... channel. Editorial Note: For Federal Register citations affecting § 78.18, see the List of CFR Sections....0625-13.0875 B16 1 13.0875-13.1125 B17 1 13.1125-13.1375 B18 1 2 13.1375-13.1625 B19 1 2...

  14. 10 CFR 431.18 - Testing laboratories.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Testing laboratories. 431.18 Section 431.18 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY EFFICIENCY PROGRAM FOR CERTAIN COMMERCIAL AND INDUSTRIAL... supplements NIST Handbook 150, National Voluntary Laboratory Accreditation Program Procedures and...

  15. 7 CFR 249.18 - Audits.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Audits. 249.18 Section 249.18 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SENIOR FARMERS' MARKET NUTRITION PROGRAM (SFMNP) Monitoring and Review of...

  16. 44 CFR 1.8 - Regulations review.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Regulations review. 1.8... HOMELAND SECURITY GENERAL RULEMAKING; POLICY AND PROCEDURES General § 1.8 Regulations review. (a) As part... and keep updated a plan for periodic review of existing rules at least within 10 years from date...

  17. Main: VSF1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available VSF1PVGRP18 S000249 19-August-2004 (last modified) kehi VSF-1 binding site in French...h NRE; Confers xylem-specific expression; VSF-1; vascular; grp1.8; VS-1; bZIP; Xylem; French bean (Phaseolus

  18. 9 CFR 3.18 - Terminal facilities.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Terminal facilities. 3.18 Section 3.18 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE STANDARDS Specifications for the Humane Handling, Care, Treatment, and Transportation of Dogs...

  19. 24 CFR 26.18 - Discovery.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Discovery. 26.18 Section 26.18 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HEARING... location of any books, documents, or other tangible things and the identity and location of persons...

  20. 15 CFR 8b.18 - New construction.

    Science.gov (United States)

    2010-01-01

    ... Standards (UFAS) (Appendix A to 41 CFR subpart 101-19.6) shall be deemed to comply with the requirements of... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false New construction. 8b.18 Section 8b.18... construction. (a) Design and construction. Each facility or part of a facility constructed by, on behalf of,...

  1. Protolytic carbon film technology

    Energy Technology Data Exchange (ETDEWEB)

    Renschler, C.L.; White, C.A.

    1996-04-01

    This paper presents a technique for the deposition of polyacrylonitrile (PAN) on virtually any surface allowing carbon film formation with only the caveat that the substrate must withstand carbonization temperatures of at least 600 degrees centigrade. The influence of processing conditions upon the structure and properties of the carbonized film is discussed. Electrical conductivity, microstructure, and morphology control are also described.

  2. Carbon Goes To…

    Science.gov (United States)

    Savasci, Funda

    2014-01-01

    The purposes of this activity are to help middle school students understand the carbon cycle and realize how human activities affect the carbon cycle. This activity consists of two parts. The first part of the activity focuses on the carbon cycle, especially before the Industrial Revolution, while the second part of the activity focuses on how…

  3. Carbon nanotube quantum dots

    NARCIS (Netherlands)

    Sapmaz, S.

    2006-01-01

    Low temperature electron transport measurements on individual single wall carbon nanotubes are described in this thesis. Carbon nanotubes are small hollow cylinders made entirely out of carbon atoms. At low temperatures (below ~10 K) finite length nanotubes form quantum dots. Because of its small si

  4. Carbon sequestration on Mars

    OpenAIRE

    Edwards, Christopher S.; Ehlmann, Bethany L.

    2015-01-01

    On Earth, carbon sequestration in geologic units plays an important role in the carbon cycle, scrubbing CO_2 from the atmosphere for long-term storage. While carbonate is identified in low abundances within the dust and soils of Mars, at

  5. Global Carbon Budget 2016

    NARCIS (Netherlands)

    Quéré, Le Corinne; Andrew, Robbie M.; Canadell, Josep G.; Sitch, Stephen; Korsbakken, Jan Ivar; Peters, Glen P.; Manning, Andrew C.; Boden, Thomas A.; Tans, Pieter P.; Houghton, Richard A.; Keeling, Ralph F.; Alin, Simone; Andrews, Oliver D.; Anthoni, Peter; Barbero, Leticia; Bopp, Laurent; Chevallier, Frédéric; Chini, Louise P.; Ciais, Philippe; Currie, Kim; Delire, Christine; Doney, Scott C.; Friedlingstein, Pierre; Gkritzalis, Thanos; Harris, Ian; Hauck, Judith; Haverd, Vanessa; Hoppema, Mario; Klein Goldewijk, Kees; Jain, Atul K.; Kato, Etsushi; Körtzinger, Arne; Landschützer, Peter; Lefèvre, Nathalie; Lenton, Andrew; Lienert, Sebastian; Lombardozzi, Danica; Melton, Joe R.; Metzl, Nicolas; Millero, Frank; Monteiro, Pedro M.S.; Munro, David R.; Nabel, Julia E.M.S.; Nakaoka, S.; O'Brien, Kevin; Olsen, Are; Omar, Abdirahman M.; Ono, Tsuneo; Pierrot, Denis; Poulter, Benjamin; Rödenbeck, Christian; Salisbury, Joe; Schuster, Ute; Schwinger, Jörg; Séférian, Roland; Skjelvan, Ingunn; Stocker, Benjamin D.; Sutton, Adrienne J.; Takahashi, Taro; Tian, Hanqin; Tilbrook, Bronte; Laan-Luijkx, van der Ingrid T.; Werf, van der Guido R.; Viovy, Nicolas; Walker, Anthony P.; Wiltshire, Andrew J.; Zaehle, Sönke

    2016-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2) emissions and their redistribution among the atmosphere, ocean, and terrestrial biosphere – the “global carbon budget” – is important to better understand the global carbon cycle, support the development of climate policies, and project futur

  6. Carbon emissions from fossil fuel consumption of Beijing in 2012

    Science.gov (United States)

    Shao, Ling; Guan, Dabo; Zhang, Ning; Shan, Yuli; Chen, G. Q.

    2016-11-01

    The present study analyzed the consumption-based carbon emissions from fossil fuel consumption of Beijing in 2012. The multi-scale input-output analysis method was applied. It is capable of tracing the carbon emissions embodied in imports based on a global multi-regional input-output analysis using Eora data. The results show that the consumption-based carbon emission of Beijing has increased by 18% since 2007, which is 2.57 times higher than the production-based carbon emission in 2012. Only approximately 1/10 of the total carbon emissions embodied in Beijing’s local final demand originated from local direct carbon emissions. Meanwhile, more than 4/5 were from domestically imported products. The carbon emission nexus between Beijing and other Chinese regions has become closer since 2007, while the imbalance as the carbon emission transfer from Beijing to other regions has been mitigated. Instead, Beijing has imported more carbon emissions from foreign countries. Some carbon emission reduction strategies for Beijing concerning different goals are presented on the basis of detailed discussion.

  7. SOUTHWEST REGIONAL PARTNERSHIP ON CARBON SEQUESTRATION

    Energy Technology Data Exchange (ETDEWEB)

    Brian McPherson; Rick Allis; Barry Biediger; Joel Brown; Jim Cappa; George Guthrie; Richard Hughes; Eugene Kim; Robert Lee; Dennis Leppin; Charles Mankin; Orman Paananen; Rajesh Pawar; Tarla Peterson; Steve Rauzi; Jerry Stuth; Genevieve Young

    2004-11-01

    The Southwest Partnership Region includes six whole states, including Arizona, Colorado, Kansas, New Mexico, Oklahoma, and Utah, roughly one-third of Texas, and significant portions of adjacent states. The Partnership comprises a large, diverse group of expert organizations and individuals specializing in carbon sequestration science and engineering, as well as public policy and outreach. The main objective of the Southwest Partnership project is to achieve an 18% reduction in carbon intensity by 2012. The Partnership made great progress in this first year. Action plans for possible Phase II carbon sequestration pilot tests in the region are almost finished, including both technical and non-technical aspects necessary for developing and carrying out these pilot tests. All partners in the Partnership are taking an active role in evaluating and ranking optimum sites and technologies for capture and storage of CO{sub 2} in the Southwest Region. We are identifying potential gaps in all aspects of potential sequestration deployment issues.

  8. A Clumped Isotope Calibration for Lacustrine Carbonates

    Science.gov (United States)

    Mitsunaga, B. A.; Mering, J. A.; Petryshyn, V. A.; Dunbar, R. B.; Cohen, A. S.; Liu, X.; Kaufman, D. S.; Eagle, R.; Tripati, A.

    2014-12-01

    Our capacity to understand Earth's environmental history is highly dependent on the accuracy of past climate reconstructions. Unfortunately, many terrestrial proxies—tree rings, speleothems, leaf margin analyses, etc.—are influenced by the effects of both temperature and precipitation. Methods that can isolate the effects of temperature alone are needed, and clumped isotope thermometry has the potential to be a useful tool for determining terrestrial climates. Multiple studies have shown that the fraction of 13C—18O bonds in carbonates is inversely related to the temperature at which the rocks formed and may be a useful proxy for reconstructing temperatures on land. An in-depth survey of lacustrine carbonates, however, has not yet been published. Therefore we have been measuring the abundance of 13C18O16O in the CO2 produced by the dissolution of modern lake samples' carbonate minerals in phosphoric acid and comparing results to independently known estimates of lake water temperature and air temperature. Some of the sample types we have investigated include endogenic carbonates, freshwater gastropods, bivalves, microbialites, and ooids.

  9. Intercontinental correlation of organic carbon and carbonate stable isotope records: evidence of climate and sea-level change during the Turonian (Cretaceous)

    NARCIS (Netherlands)

    Jarvis, I.; Trabucho-Alexandre, João; Gröcke, D.R.; Uličný, D.; Laurin, J.

    2015-01-01

    Carbon (d13Corg, d13Ccarb) and oxygen (d18Ocarb) isotope records are presented for an expanded Upper Cretaceous (Turonian–Coniacian) hemipelagic succession cored in the central Bohemian Cretaceous Basin, Czech Republic. Geophysical logs, biostratigraphy and stable carbon isotope chemostratigraphy pr

  10. Amorphous iron (II) carbonate

    DEFF Research Database (Denmark)

    Sel, Ozlem; Radha, A.V.; Dideriksen, Knud;

    2012-01-01

    exothermic than that of amorphous calcium carbonate (ACC). This suggests that enthalpy of crystallization in carbonate systems is ionic-size controlled, which may have significant implications in a wide variety of conditions, including geological sequestration of anthropogenic carbon dioxide.......Abstract The synthesis, characterization and crystallization energetics of amorphous iron (II) carbonate (AFC) are reported. AFC may form as a precursor for siderite (FeCO3). The enthalpy of crystallization (DHcrys) of AFC is similar to that of amorphous magnesium carbonate (AMC) and more...

  11. Tracking the migration of the Indian continent using the carbonate clumped isotope technique on Phanerozoic soil carbonates

    Science.gov (United States)

    Ghosh, Prosenjit; Vasiliev, Mikhail V.; Ghosh, Parthasarathi; Sarkar, Soumen; Ghosh, Sampa; Yamada, Keita; Ueno, Yuichiro; Yoshida, Naohiro; Poulsen, Christopher J.

    2016-03-01

    Approximately 140 million years ago, the Indian plate separated from Gondwana and migrated by almost 90° latitude to its current location, forming the Himalayan-Tibetan system. Large discrepancies exist in the rate of migration of Indian plate during Phanerozoic. Here we describe a new approach to paleo-latitudinal reconstruction based on simultaneous determination of carbonate formation temperature and δ18O of soil carbonates, constrained by the abundances of 13C-18O bonds in palaeosol carbonates. Assuming that the palaeosol carbonates have a strong relationship with the composition of the meteoric water, δ18O carbonate of palaeosol can constrain paleo-latitudinal position. Weighted mean annual rainfall δ18O water values measured at several stations across the southern latitudes are used to derive a polynomial equation: δ18Ow = -0.006 × (LAT)2 - 0.294 × (LAT) - 5.29 which is used for latitudinal reconstruction. We use this approach to show the northward migration of the Indian plate from 46.8 ± 5.8°S during the Permian (269 M.y.) to 30 ± 11°S during the Triassic (248 M.y.), 14.7 ± 8.7°S during the early Cretaceous (135 M.y.), and 28 ± 8.8°S during the late Cretaceous (68 M.y.). Soil carbonate δ18O provides an alternative method for tracing the latitudinal position of Indian plate in the past and the estimates are consistent with the paleo-magnetic records which document the position of Indian plate prior to 135 ± 3 M.y.

  12. The relationship between carbon and oxygen isotopic composition characteristics of carbonates in loess sediments and paleoclimate

    Institute of Scientific and Technical Information of China (English)

    李春园; 王先彬; 文启彬; 邵波

    1995-01-01

    Based on the carbon and oxygen isotopic compositions of carbonates in loess sediments meas-ured by the methods of stepwise heating and phosphoric acid decomposition from five pieces of samples ofpaleosol,loess and eolian sand,respectively,the distributive characteristics in different temperature steps andthe fractionation mechanisms of carbon and oxygen isotope and their relation to the paleoclirnate are discussed.The preliminary results show that,by means of stepwise heating,different carbon and oxygen isotopiccompositions are obtained in different temperature steps and carbon and oxygen isotopic compositions ofpaleosol,loess and eolian sand are in a different distributive pattern in the range of studied temperaturesteps.The results also show that the δ13C ratios in 700-800℃ are more sensitive tracers of paleoclimatethan those measured by the method of phosphoric acid decomposition.The susceptibility to climatic changesof δ18O ratios analysed by the method of phosphoric acid decomposition is higher than those analysed by themethod of stepwise heating,but the δ18O ratios measured by these two methods do not effectively reflect cli-matic changes.

  13. Using 18O as a Tracer of Oxygen in the Photochemical Alteration of Dissolved Organic Matter

    Science.gov (United States)

    Davis, J. A.; Stubbins, A.; Helms, J.; Dias, R. F.; Mopper, K.

    2006-12-01

    The biogeochemical cycling of dissolved organic matter (DOM) in natural waters is affected by numerous processes, including photochemical alteration. Photochemical processes result in the net oxidation and mineralization of DOM concomitant with dissolved oxygen consumption and production of dissolved inorganic carbon (DIC; principally CO2). The photochemical oxygen budget is not well constrained while DIC production accounts for nearly all the dissolved oxygen consumed, conflicting data suggests that more than half of the oxygen consumed is required to account for observed DOM oxidation and hydrogen peroxide production. An alternate source of oxygen is required to balance this budget; water itself may provide the answer. In order to determine the source of oxygen, a number of time series irradiations were performed using Great Dismal Swamp water (southeast Virginia) with 18O enrichments as either dissolved oxygen or water. Early results, upon irradiation in a UV solar simulator, show significant incorporation of 18O-enriched oxygen into high molecular weight (HMW) DOM from both sources. While the majority of the incorporated oxygen originated from the dissolved oxygen, at least 5 percent originated from water. Data will be presented showing the rate and degree of incorporation of 18O-enriched oxygen from both sources as well as the production of 18O-enriched carbon dioxide. The movement of 18O label will be discussed in relation to shifts in spectral qualities, including photobleaching and spectral slope, of the irradiated samples and selective incorporation as detailed by FT-ICRMS.

  14. CHARACTERIZATION OF THE TANK 18F SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Oji, L.; Click, D.; Diprete, D.

    2009-12-17

    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 18F closure samples. Tank 18F slurry samples analyzed included the liquid and solid fractions derived from the 'as-received' slurry materials along with the floor scrape bottom Tank 18F wet solids. These samples were taken from Tank 18F in March 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 18F samples, the samples from the north quadrants of the tank were combined into one North Tank 18F Hemisphere sample and similarly the south quadrant samples were combined into one South Tank 18F Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 18F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were 1E-04 {micro}Ci/g for most radionuclides and customer desired detection values of 1E-05 {micro}Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the minimum detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 18F, some were not met due to spectral interferences. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  15. Non-disjunction of chromosome 18

    DEFF Research Database (Denmark)

    Bugge, M; Collins, A; Petersen, M B

    1998-01-01

    A sample of 100 trisomy 18 conceptuses analysed separately and together with a published sample of 61 conceptuses confirms that an error in maternal meiosis II (MII) is the most frequent cause of non-disjunction for chromosome 18. This is unlike all other human trisomies that have been studied......, which show a higher frequency in maternal meiosis I (MI). Maternal MI trisomy 18 shows a low frequency of recombination in proximal p and medial q, but not the reduction in proximal q observed in chromosome 21 MI non-disjunction. Maternal MII non-disjunction does not fit the entanglement model...

  16. Population III Stars in I Zw 18

    CERN Document Server

    Heap, Sally; Hubeny, Ivan

    2015-01-01

    Ultraviolet and 21-cm observations suggest that the extremely low-metallicity galaxy, I Zw 18, is a stream-fed galaxy containing a "pocket" of pristine stars responsible for producing nebular He II recombination emission observed in I Zw18-NW. Far-UV spectra by Hubble/COS and the Far Ultraviolet Spectroscopic Explorer (FUSE) make this suggestion conclusive by demonstrating that the spectrum of I Zw 18-NW shows no metal lines like O VI 1032, 1038 of comparable ionization as the He II recombination emission.

  17. Metaphorical Language and Theophany in Psalm 18

    DEFF Research Database (Denmark)

    Nielsen, Kirsten

    2010-01-01

    This article focuses on metaphorical language and theophany in Ps 18 and the question of normativity. My results are the following: Point 1. Psalm 18 is placed in the mouth of King David as part of his “testament” and as such it becomes normative for speaking about Israel’s God, with regard...... not only to content but also to linguistic form. Psalm 18 contains a rich variety of imagery comprising both personal and non-personal metaphors, as well as metonymies, which together have a normative function. Point 2. The personal and non-personal metaphors are set in tension against one another, thereby...

  18. 18 CFR 157.18 - Applications to abandon facilities or service; exhibits.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Applications to abandon facilities or service; exhibits. 157.18 Section 157.18 Conservation of Power and Water Resources FEDERAL..., Concerning Any Operation, Sales, Service, Construction, Extension, Acquisition or Abandonment §...

  19. Hot, Massive Stars in the Extremely Metal-Poor Galaxy, I Zw 18

    Science.gov (United States)

    Heap, Sara R.; Malumuth, Eliot M.

    2010-01-01

    The carbon-enhanced metal-poor galaxy, I Zw 18, is the Rosetta Stone for understanding galaxies in the early universe by providing constraints on the IMF of massive stars, the role of galaxies in reionization of the universe, mixing of newly synthesized material in the ISM, and gamma-ray bursts at low metallicity, and on the earliest generations of stars producing the observed abundance pattern. We describe these constraints as derived from analyses of HST/COS spectra of I Zw 18 including stellar atmosphere analysis and photo-ionization modeling of both the emission and absorption spectra of the nebular material and interstellar medium.

  20. RESTORING SUSTAINABLE FORESTS ON APPALACHIAN MINED LANDS FOR WOOD PRODUCTS, RENEWABLE ENERGY, CARBON SEQUESTRATION, AND OTHER ECOSYSTEM SERVICES

    Energy Technology Data Exchange (ETDEWEB)

    J. Burger; J. Galbraith; T. Fox; G. Amacher; J. Sullivan; C. Zipper

    2003-12-18

    The overall purpose of this project is to evaluate the biological and economic feasibility of restoring high-quality forests on mined land, and to measure carbon sequestration and wood production benefits that would be achieved from forest restoration procedures. In this quarterly report, we present a preliminary comparison of the carbon sequestration benefits for two forest types used to convert abandoned grasslands for carbon sequestration. Annual mixed hardwood benefits, based on total stand carbon volume present at the end of a given year, range from a minimum of $0/ton of carbon to a maximum of $5.26/ton of carbon (low prices). White pine benefits based on carbon volume range from a minimum of $0/ton of carbon to a maximum of $18.61/ton of carbon (high prices). The higher maximum white pine carbon payment can primarily be attributed to the fact that the shorter rotation means that payments for white pine carbon are being made on far less cumulative carbon tonnage than for that of the long-rotation hardwoods. Therefore, the payment per ton of white pine carbon needs to be higher than that of the hardwoods in order to render the conversion to white pine profitable by the end of a rotation. These carbon payments may seem appealingly low to the incentive provider. However, payments (not discounted) made over a full rotation may add up to approximately $17,493/ha for white pine (30-year rotation), and $18,820/ha for mixed hardwoods (60-year rotation). The literature suggests a range of carbon sequestration costs, from $0/ton of carbon to $120/ton of carbon, although the majority of studies suggest a cost below $50/ ton of carbon, with van Kooten et al. (2000) suggesting a cutoff cost of $20/ton of carbon sequestered. Thus, the ranges of carbon payments estimated for this study fall well within the ranges of carbon sequestration costs estimated in previous studies.

  1. Catalysts in syntheses of carbon and carbon precursors

    OpenAIRE

    Mochida, Isao; Yoon, Seong-Ho; Qiao, Wenming

    2006-01-01

    Carbon materials have been applied in different fields because of their unique performances. Naturally, the physical and chemical structures of carbon precursors and carbon materials decide their properties and applications. Catalysts play a very important role in the synthesis of carbon precursors and carbon materials by controlling the molecular and compositional chemistry at the transformation of organic substrates into carbon through carbonaceous intermediates. Carbon materials of high pe...

  2. 50 CFR 18.23 - Native exemptions.

    Science.gov (United States)

    2010-10-01

    ... subject me to the criminal penalties of 18 U.S.C. 1001. (6) The signature of the applicant. The... biological data, harvest data, and other information regarding the effect of taking of marine mammals...

  3. 7 CFR 1230.18 - Porcine animal.

    Science.gov (United States)

    2010-01-01

    ... purposes as seed stock and included in the breeding herd; and (c) a market hog, slaughtered by the producer... CONSUMER INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.18...

  4. 7 CFR 926.18 - Records.

    Science.gov (United States)

    2010-01-01

    ... of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE DATA COLLECTION, REPORTING AND RECORDKEEPING REQUIREMENTS APPLICABLE TO CRANBERRIES NOT SUBJECT TO THE CRANBERRY MARKETING ORDER § 926.18 Records....

  5. 47 CFR 18.107 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... intended to be used by the general public in a residential environment, notwithstanding use in other areas... associated with each ISM frequency. See § 18.301. (i) Marketing. As used in this part, marketing...

  6. Hurricane Isabel Poster (September 18, 2003)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Isabel poster. Multi-spectral image from NOAA-17 shows Hurricane Isabel making landfall on the North Carolina Outer Banks on September 18, 2003. Poster...

  7. Echovirus 18 meningitis in southern Taiwan.

    Science.gov (United States)

    Wang, Shih-Min; Ho, Tzong-Shiann; Shen, Ching-Fen; Wang, Jen-Ren; Liu, Ching-Chuan

    2011-03-01

    Eighty cases of echovirus 18 infection among young children during an outbreak in 2006 in Taiwan were enrolled. Twenty percent of the patients had a comorbid condition. Twenty-five cases (31%) were complicated by aseptic meningitis. The most frequent diagnoses in children without meningitis were pharyngitis/tonsillitis (35%) and vesicular viral exanthem (33%). The case-fatality rate among the children with meningitis was 4%. Echovirus 18 was isolated from the cerebrospinal fluid of 68% of the children.

  8. Carbon dioxide sensor

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, Prabir K. (Worthington, OH); Lee, Inhee (Columbus, OH); Akbar, Sheikh A. (Hilliard, OH)

    2011-11-15

    The present invention generally relates to carbon dioxide (CO.sub.2) sensors. In one embodiment, the present invention relates to a carbon dioxide (CO.sub.2) sensor that incorporates lithium phosphate (Li.sub.3PO.sub.4) as an electrolyte and sensing electrode comprising a combination of lithium carbonate (Li.sub.2CO.sub.3) and barium carbonate (BaCO.sub.3). In another embodiment, the present invention relates to a carbon dioxide (CO.sub.2) sensor has a reduced sensitivity to humidity due to a sensing electrode with a layered structure of lithium carbonate and barium carbonate. In still another embodiment, the present invention relates to a method of producing carbon dioxide (CO.sub.2) sensors having lithium phosphate (Li.sub.3PO.sub.4) as an electrolyte and sensing electrode comprising a combination of lithium carbonate (Li.sub.2CO.sub.3) and barium carbonate (BaCO.sub.3).

  9. Strong Ionization in carbon Nanowires

    CERN Document Server

    Kaymak, Vural; Shlyaptsev, Vyacheslav N; Rocca, Jorge J

    2015-01-01

    Surfaces covered with nanostructures, such as nanowire arrays, have shown to facilitate a significantly higher absorption of laser energy as compared to flat surfaces. Due to the efficient coupling of the laser energy, highly energetic electrons are produced, which in turn can emit intense ultrafast X-ray pulses. In the present work we use full three dimensional PIC simulations to analyze the behavior of arrays of carbon nanowires $400 nm$ in diameter, irradiated by a $\\lambda_0 = 400 nm$ laser pulse of $60 fs$ duration at FWHM and a vector potential of $a_0 = 18$. We analyze the ionization dynamics of the nanowires. We investigate the difference of the ionization strength and structure between linearly and circularly polarized laser beam. The nanowires are found to be fully ionized after about 30 laser cycles. Circularly polarized light reveals a slightly stronger ionization effect.

  10. 18F-Labeling Using Click Cycloadditions

    Directory of Open Access Journals (Sweden)

    Kathrin Kettenbach

    2014-01-01

    Full Text Available Due to expanding applications of positron emission tomography (PET there is a demand for developing new techniques to introduce fluorine-18 (t1/2=109.8 min. Considering that most novel PET tracers are sensitive biomolecules and that direct introduction of fluorine-18 often needs harsh conditions, the insertion of 18F in those molecules poses an exceeding challenge. Two major challenges during 18F-labeling are a regioselective introduction and a fast and high yielding way under mild conditions. Furthermore, attention has to be paid to functionalities, which are usually present in complex structures of the target molecule. The Cu-catalyzed azide-alkyne cycloaddition (CuAAC and several copper-free click reactions represent such methods for radiolabeling of sensitive molecules under the above-mentioned criteria. This minireview will provide a quick overview about the development of novel 18F-labeled prosthetic groups for click cycloadditions and will summarize recent trends in copper-catalyzed and copper-free click 18F-cycloadditions.

  11. Oxygen-isotopic composition and high-resolution secondary ion mass spectrometry imaging of Martian carbonate in Lafayette meteorite

    OpenAIRE

    Vicenzi, E. P.; Eiler, J.

    1998-01-01

    Carbonate from SNC meteorites gives insight into a variety of processes on and/or beneath the surface of Mars. In Lafayette, carbonate occurs in unusually intimate association with hydrous phases when compared with other carbonate-bearing SNCs [1]. We have measured the ^(18)O/^(16)O ratio of carbonate in the alteration veins of Lafayette using the magnetic sector ion microprobe. In addition, we obtained isotope images of major- and minor-element cations in veinlets with the ...

  12. Estimation of soil organic carbon reservoir in China

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The paper respectively adopted physio-chemical properties of every soil stratum from 2473 soil profiles of the second national soil survey. The corresponding carbon content of soils is estimated by utilizing conversion coefficient 0.58. In the second soil survey, the total amount of soil organic carbon is about 924.18×108t and carbon density is about 10.53 kgC/m2 in China according to the area of 877.63×106 hm2 surveyed throughout the country. The spatial distribution characteristics of soil organic carbon in China is that the carbon storage increases when latitude increases in eastern China and the carbon storage decreases when longitude reduces in northern China. A transitional zone with great variation in carbon storage exists. Moreover, there is an increasing tendency of carbon density with decrease of latitude in western China. Soil circle is of great significance to global change, but with substantial difference in soil spatial distribution throughout the country. Because the structure of soil is inhomogeneous, it could bring some mistakes in estimating soil carbon reservoirs. It is necessary to farther resolve soil respiration and organic matter conversion and other questions by developing uniform and normal methods of measurement and sampling.

  13. Laser interaction with low-density carbon foam

    Indian Academy of Sciences (India)

    S Chaurasia; S Tripathi; D S Munda; G Mishra; C G Murali; N K Gupta; L J Dhareshwar; A K Rossall; G J Tallents; Rashmi Singh; D K Kohli; R K Khardekar

    2010-12-01

    Experiments were performed with a 15 J/500 ps Nd:glass laser ( = 1064 nm) focussed to an intensity > 1014 W/cm2 . X-ray emissions from carbon foam and 5 % Pt-doped carbon foam of density 150–300 mg/cc were compared with that of the solid carbon targets. The thickness of the carbon foam was 15 m on a graphite substrate. X-ray emission was measured using semiconductor X-ray diodes covered with various filters having transmissions in different X-ray spectral ranges. It covered X-ray spectrum of 0.8–8.5 keV range. The X-ray emission in the soft X-ray region was observed to increase to about 1.8 times and 2.3 times in carbon foam and Pt-doped foam, respectively with respect to solid carbon. In hard X-rays, there was no measurable difference amongst the carbon foam, Pt-doped carbon foam and solid carbon. Scanning electron microscope (SEM) analysis demonstrates that foam targets smoothens the crater formed by the laser irradiation.

  14. LOCAL LASER ALLOYING OF STAINLESS STEEL 12H18N10T

    Directory of Open Access Journals (Sweden)

    Mr. Vladimir A. Kim

    2016-06-01

    Full Text Available The article presents the research of local laser alloying of stainless steel 12X18H10T. The steel resists quenching, but it is widely used in food, chemical, oil-processing and other industries. The alloying was carried out by graphite that provided carbon increase in steel and improvement of surface capacity. The article shows details of the structural transformations leading to surfaces hardening, and micro hardness spreading inside the modified layer.

  15. 13C-18O isotope signatures and ‘clumped isotope’ thermometry in foraminifera and coccoliths

    Science.gov (United States)

    Tripati, Aradhna K.; Eagle, Robert A.; Thiagarajan, Nivedita; Gagnon, Alexander C.; Bauch, Henning; Halloran, Paul R.; Eiler, John M.

    2010-10-01

    Accurate constraints on past ocean temperatures and compositions are critical for documenting climate change and resolving its causes. Most proxies for temperature are not thermodynamically based, appear to be subject to biological processes, require regional calibrations, and/or are influenced by fluid composition. As a result, their interpretation becomes uncertain when they are applied in settings not necessarily resembling those in which they were empirically calibrated. Independent proxies for past temperature could provide an important means of testing and/or expanding on existing reconstructions. Here we report measurements of abundances of stable isotopologues of calcitic and aragonitic benthic and planktic foraminifera and coccoliths, relate those abundances to independently estimated growth temperatures, and discuss the possible scope of equilibrium and kinetic isotope effects. The proportions of 13C- 18O bonds in these samples exhibits a temperature dependence that is generally similar to that previously been reported for inorganic calcite and other biologically precipitated carbonate-containing minerals (apatite from fish, reptile, and mammal teeth; calcitic brachiopods and molluscs; aragonitic coral and mollusks). Most species that exhibit non-equilibrium 18O/ 16O (δ 18O) and 13C/ 12C (δ 13C) ratios are characterized by 13C- 18O bond abundances that are similar to inorganic calcite and are generally indistinguishable from apparent equilibrium, with possible exceptions among benthic foraminiferal samples from the Arctic Ocean where temperatures are near-freezing. Observed isotope ratios in biogenic carbonates can be explained if carbonate minerals generally preserve a state of ordering that reflects the extent of isotopic equilibration of the dissolved inorganic carbon species.

  16. Diet control on carbon isotopic composition of land snail shell carbonate

    Institute of Scientific and Technical Information of China (English)

    LIU ZongXiu; GU ZhaoYan; WU NaiQin; XU Bing

    2007-01-01

    Carbon isotope compositions for both the carbonate shells and soft bodies (organic tissue) of living land snails collected mostly from the Loess Plateau, China have been measured. The result shows that δ13C values range from -13.1‰ to -4.3‰ for the aragonite shell samples and from -26.8‰ to -18.0‰ for the soft body samples. Although the shells are enriched in 13C relative to the bodies averagely by 14.2(±0.8)‰, the shell δ13Ca values are closely correlated to the body δ13Corg values, expressed as δ13Ca = 1.021 δ13Corg + 14.38 (R = 0.965; N = 31). This relationship indicates that δ13Ca is primarily a function of the isotopic composition of the snail diets since previous studies have proved that the snail body is the same as their food in carbon isotope composition. In other words, carbon isotope compo-sition of the carbonate shell can be used as a proxy to estimate the dietary 13C abundance of the land snails. The data also support that the 13C enrichment of the carbonate shells results mainly from the equilibrium fractionations between the metabolic CO2, HCO3- in the hemolymph and shell aragonite, and partially from kinetic fractionations when snail shells form during their activity.

  17. The unprecedented recurrent diploid/tetraploid mosaicism of trisomy-18 (mixoploidy; 4n+18/2n+18): clinical report.

    Science.gov (United States)

    Ozler, Sibel; Ersoy, Ali O; Oztas, Efser; Topcu, Vehap; Celen, Sevki; Danisman, Nuri

    2015-07-01

    We report on a 32-year-old woman who presented at gestational age of 14 weeks. During ultrasonographic examination, we discovered that her fetus had several important abnormalities, including a cystic hygroma, craniofacial defects (low-set ears, broad nose), heart defects (single atrium, single ventricle), agenesis of corpus callosum, limb defects (clenched hands, pes equinovarus). Chorionic villus sampling and karyotyping revealed diploid/tetraploid mosaicism with trisomy 18 (mixoploidy; 4n+18/2n+18). Her second pregnancy was terminated because of the same clinical manifestations 1 year prior. Her first pregnancy resulted in the birth of an entirely healthy boy. As far as know, no other similar case has been presented in the literature.

  18. Graphitic Carbons and Biosignatures

    OpenAIRE

    Bernard, S.; Papineau, D

    2014-01-01

    The unambiguous identification of graphitic carbons as remains of life in ancient rocks is challenging because fossilized biogenic molecules are inevitably altered and degraded during diagenesis and metamorphism of the host rocks. Yet, recent studies have highlighted the possible preservation of biosignatures carried by some of the oldest graphitic carbons. Laboratory simulations are increasingly being used to better constrain the transformations of organic molecules into graphitic carbons in...

  19. Carbon Dioxide Absorbents

    Science.gov (United States)

    1950-05-17

    carbondioxide content of the solution was then determined. A gas mixture containing 2.6% carbon dioxide and 97.4% nitrogen was prepared in the...which carbon dioxide is removed by heat0 Since this step is usually carried out by "steam stripping ", that is, contacting the solution at its boiling...required to produce the steam required for stripping the carbon dioxide from the s olution. The method ueed in this investigation for determining the

  20. Carbon emissions Inventory Games

    OpenAIRE

    Al-Emadi, Eiman Ali

    2016-01-01

    Carbon emissions reduction has been the center of attention in many organizations during the past few decades. Many international entities developed rules and regulations to monitor and control carbon emissions especially under supply chain context. Furthermore, researchers investigated techniques and methods on how reduce carbon emissions under operational adjustment which can be done by cooperation or coordination. The main contribution of this thesis is to measure to what extend cooperatio...

  1. Animating the Carbon Cycle

    OpenAIRE

    2014-01-01

    Understanding the biogeochemical processes reg- ulating carbon cycling is central to mitigating atmospheric CO2 emissions. The role of living organisms has been accounted for, but the focus has traditionally been on contributions of plants and microbes. We develop the case that fully ‘‘animating’’ the carbon cycle requires broader consideration of the functional role of animals in mediating biogeochemical processes and quanti- fication of their effects on carbon storage and exchange among ter...

  2. Microwave absorption properties of helical carbon nanofibers-coated carbon fibers

    Directory of Open Access Journals (Sweden)

    Lei Liu

    2013-08-01

    Full Text Available Helical carbon nanofibers (HCNFs coated-carbon fibers (CFs were fabricated by catalytic chemical vapor deposition method. TEM and Raman spectroscopy characterizations indicate that the graphitic layers of the HCNFs changed from disorder to order after high temperature annealing. The electromagnetic parameters and microwave absorption properties were measured at 2–18 GHz. The maximum reflection loss is 32 dB at 9 GHz and the widest bandwidth under −10 dB is 9.8 GHz from 8.2 to 18 GHz for the unannealed HCNFs coated-CFs composite with 2.5 mm in thickness, suggesting that HCNFs coated-CFs should have potential applications in high performance microwave absorption materials.

  3. Elevated levels of circulating IL-18BP and perturbed regulation of IL-18 in schizophrenia

    Directory of Open Access Journals (Sweden)

    Palladino Ilaria

    2012-08-01

    Full Text Available Abstract Background The pleiotropic pro-inflammatory cytokine Interleukin (IL-18 has been proposed to play a role in schizophrenia, since elevated circulating levels of its protein and altered frequencies of genetic variants in its molecular system are reported in schizophrenic patients. Methods We analyzed 77 patients with schizophrenia diagnosis (SCZ and 77 healthy control subjects (HC for serum concentration of both IL-18 and its natural inhibitor, the IL-18 binding protein (IL-18BP. Results We confirmed that serum levels of total IL-18 are significantly increased in SCZ, as compared to HC. However, due to a highly significant increase in levels of circulating IL-18BP in SCZ, as compared to HC, the levels of free, bioactive IL-18 are not significantly different between the two groups. In addition, the relationships between the levels of IL-18 and its inhibitor, as well as between the two molecules and age appear dissimilar for SCZ and HC. In particular, the elevated levels of IL-18BP, likely a consequence of the body’s attempt to counteract the early prominent inflammation which characterizes schizophrenia, are maintained in earlier and later stages of the disease. However, the IL-18BP elevation appears ineffective to balance the IL-18 system in younger SCZ patients, while in older patients the levels of circulating bioactive IL-18 are comparable to those of HC, if not lower. Conclusions In conclusion, these findings indicate that the IL-18 system is perturbed in schizophrenia, supporting the idea that this pro-inflammatory cytokine might be part of a pathway of genetic and environmental components for vulnerability to the disease.

  4. Nanographene reinforced carbon/carbon composites

    Science.gov (United States)

    Bansal, Dhruv

    Carbon/Carbon Composites (CCC) are made of carbon reinforcement in carbon matrix and have high thermal stability and fatigue resistance. CCC are used in nose cones, heat shields and disc brakes of aircrafts due to their exceptional mechanical properties at high temperature. The manufacturing process of CCC involves a carbonization stage in which unwanted elements, except carbon, are eliminated from the polymer precursor. Carbonization results in the formation of voids and cracks due to the thermal mismatch between the reinforcement and the matrix and expulsion of volatiles from the polymer matrix. Thermal cracks and voids decrease the density and mechanical properties of the manufactured CCC. In this work, Nanographene Platelets (NGP) were explored as nanofillers to fill the voids/cracks and reduce thermal shrinkage in CCC. They were first compared with Vapor Grown Carbon Nanofibers (VGCNF) by dispersion of different concentrations (0.5wt%, 1.5wt%, 3wt%) in resole-type phenolic resin and were characterized to explore their effect on rheology, heat of reaction and wetting behavior. The dispersions were then cured to form nanocomposites and were characterized for morphology, flexure and thermal properties. Finally, NGP were introduced into the carbon/carboncomposites in two stages, first by spraying in different concentrations (0.5wt%, 1.5wt%, 3wt%, 5wt %) during the prepreg formation and later during densification by directly mixing in the corresponding densification mix. The manufactured NGP reinforced CCC were characterized for microstructure, porosity, bulk density and mechanical properties (Flexure and ILSS) which were further cross-checked by non-destructive techniques (vibration and ultrasonic). In this study, it was further found that at low concentration (≤ 1.5 wt%) NGP were more effective in increasing the heat of reaction and in decreasing the viscosity of the phenolic resin. The decrease in viscosity led to better wetting properties of NGP / phenolic

  5. CARBON DIOXIDE REDUCTION SYSTEM.

    Science.gov (United States)

    CARBON DIOXIDE , *SPACE FLIGHT, RESPIRATION, REDUCTION(CHEMISTRY), RESPIRATION, AEROSPACE MEDICINE, ELECTROLYSIS, INSTRUMENTATION, ELECTROLYTES, VOLTAGE, MANNED, YTTRIUM COMPOUNDS, ZIRCONIUM COMPOUNDS, NICKEL.

  6. Room-temperature synthesis of soluble, fluorescent carbon nanoparticles from organogel precursors.

    Science.gov (United States)

    Néabo, Jules Roméo; Vigier-Carrière, Cécile; Rondeau-Gagné, Simon; Morin, Jean-François

    2012-10-18

    Carbon nanoparticles were obtained at room temperature by irradiating an organogel made from a 1,8-diaryloctatetrayne derivative in chloroform. During the topochemical polymerization, the morphology of the gel changes from fibers to soluble, yellow fluorescent nanoparticles in high yield. Analyses suggest that the resulting nanoparticles are made of amorphous graphitic carbon.

  7. Study on the Microwave Permittivity of Single-Walled Carbon Nanotube

    Science.gov (United States)

    Liu, Xiaolai; Zhao, Donglin

    2009-01-01

    In this article, we studied the microwave permittivity of the complex of the single-walled carbon nanotube and paraffin in 2-18GHz. In the range, the dielectric loss of single-walled carbon nanotube is higher, and the real part and the imaginary part of the dielectric constant decrease with the increase of frequency, and the dielectric constant…

  8. A method for quantifying bioavailable organic carbon in aquifer sediments

    Science.gov (United States)

    Rectanus, H.V.; Widdowson, M.; Novak, J.; Chapelle, F.

    2005-01-01

    The fact that naturally occurring microorganisms can biodegrade PCE and TCE allows the use of monitored natural attenuation (MNA) as a remediation strategy at chlorinated solvent-contaminated sites. Research at numerous chlorinated solvent sites indicates an active dechlorinating microbial population coupled with an ample supply of organic carbon are conditions needed to sustain reductive dechlorination. A series of extraction experiments was used to compare the ability of the different extractants to remove organic carbon from aquifer sediments. The different extractants included pyrophosphate, sodium hydroxide, and polished water. Pyrophosphate served as a mild extractant that minimally alters the organic structure of the extracted material. Three concentrations (0.1, 0.5, and 1%) of pyrophosphate extracted 18.8, 24.9, and 30.8% of sediment organic carbon, respectively. Under alkali conditions (0.5 N NaOH), which provided the harshest extractant, 30.7% of the sediment organic carbon was recovered. Amorphous organic carbon, measured by potassium persulfate oxidization, consisted of 44.6% of the sediment organic carbon and served as a baseline control for maximum carbon removal. Conversely, highly purified water provided a minimal extraction control and extracted 5.7% of the sediment organic carbon. The removal of organic carbon was quantified by aqueous TOC in the extract and residual sediment organic carbon content. Characterization of the organic carbon extracts by compositional analysis prior and after exposure to the mixed culture might indicate the type organic carbon and functional groups used and/or generated by the organisms. This is an abstract of a paper presented at the 8th International In Situ and On-Site Bioremediation Symposium (Baltimore, MD 6/6-9/2005).

  9. Carbon dioxide released from subduction zones by fluid-mediated reactions

    Science.gov (United States)

    Ague, Jay J.; Nicolescu, Stefan

    2014-05-01

    The balance between the subduction of carbonate mineral-bearing rocks into Earth's mantle and the return of CO2 to the atmosphere by volcanic and metamorphic degassing is critical to the carbon cycle. Carbon is thought to be released from subducted rocks mostly by simple devolatilization reactions. However, these reactions will also retain large amounts of carbon within the subducting slab and have difficulty in accounting for the mass of CO2 emitted from volcanic arcs. Carbon release may therefore occur via fluid-induced dissolution of calcium carbonate. Here we use carbonate δ18O and δ13C systematics, combined with analyses of rock and fluid inclusion mineralogy and geochemistry, to investigate the alteration of the exhumed Eocene Cycladic subduction complex on the Syros and Tinos islands, Greece. We find that in marble rocks adjacent to two fluid conduits that were active during subduction, the abundance of calcium carbonate drastically decreases approaching the conduits, whereas silicate minerals increase. Up to 60-90% of the CO2 was released from the rocks--far greater than expected via simple devolatilization reactions. The δ18O of the carbonate minerals is 5-10 lighter than is typical for metamorphosed carbonate rocks, implying that isotopically light oxygen was transported by fluid infiltration from the surroundings. We suggest that fluid-mediated carbonate mineral removal, accompanied by silicate mineral precipitation, provides a mechanism for the release of enormous amounts of CO2 from subduction zones.

  10. Adipose tissue interleukin-18 mRNA and plasma interleukin-18: effect of obesity and exercise

    DEFF Research Database (Denmark)

    Leick, Lotte; Lindegaard, Birgitte; Stensvold, Dorthe

    2007-01-01

    at the studied time-points, exercise training reduced AT IL-18 mRNA content by 20% in both sexes. DISCUSSION: Because obesity and insulin resistance were associated with elevated AT IL-18 mRNA and plasma IL-18 levels, the training-induced lowering of AT IL-18 mRNA content may contribute to the beneficial effects...... of regular physical activity with improved insulin sensitivity.......OBJECTIVES: Obesity and a physically inactive lifestyle are associated with increased risk of developing insulin resistance. The hypothesis that obesity is associated with increased adipose tissue (AT) interleukin (IL)-18 mRNA expression and that AT IL-18 mRNA expression is related to insulin...

  11. Abundances in red giant stars - Carbon and oxygen isotopes in carbon-rich molecular envelopes

    Science.gov (United States)

    Wannier, P. G.; Sahai, R.

    1987-01-01

    Millimeter-wave observations have been made of isotopically substituted CO toward the envelopes of 11 carbon-rich stars. In every case, C-13O was detected and model calculations were used to estimate the C-12/C-13 abundance ratio. C-17O was detected toward three, and possibly four, envelopes, with sensitive upper limits for two others. The CO-18 variant was detected in two envelopes. New results include determinations of oxygen isotopic ratios in the two carbon-rich protoplanetary nebulae CRL 26688 and CRL 618. As with other classes of red giant stars, the carbon-rich giants seem to be significantly, though variably, enriched in O-17. These results, in combination with observations in interstellar molecular clouds, indicate that current knowledge of stellar production of the CNO nuclides is far from satisfactory.

  12. Synthesis of F-18 labeled raloxifene derivative

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K. C.; Moon, B. S.; Jun, K. S. [KIRAMS, Seoul (Korea, Republic of); Lee, J. H.; Ji, D. Y. [Inha University, Incheon (Korea, Republic of)

    2005-07-01

    Raloxifene, [6-hydroxy-2-(4-hydroxy-phenyl) benzo [b] thiophen-3-yl]-[4-(2-piperidin-1-yl-ethoxy)phenyl] methanone, a tissue-selective estrogen mixed agonist/antagonist, classified as a selective estrogen receptor modulator (SERM), is currently under clinical evaluation for the prevention and treatment of postmenopausal osteoporosis, breast cancer, uterine dysfunction, and other disorders of the female reproductive system. Based on SAR studies of substituted raloxifenes, we synthesized 3 kinds of fluoroalkylated raloxifene derivatives. These compounds show high relative binding affinities (RBA) to the estrogen receptor in vitro (RBA of estradiol = 100%). The RBA values for compounds 1, 2 and 3 are 89, 60, and 45%, respectively, which are all higher than that of raloxifene itself (34%). Among these compounds, we selected to take the best RBA value one and F-18 labeled. Using 2 kinds of labeling method ; 1) Radiolabeling using [{sup 18}F]KF was carried out in anhydrous acetonitrile for 10 min at 120 .deg. C. 2) Radiolabeling using [{sup 18}F]KF was carried out in anhydrous acetonitrile for 15 min at 120 .deg. C in ionic liquid, [bmim][OTf]. Deprotection step added 1N HCl and reacted for 3 min at 120 .deg. C. [{sup 18}F]Fluoroethyl raloxifene derivative obtained 5-23% decay corrected labeling yield by HPLC system (C18 xterra, 10 i, 34% Acetonitrile/0.1 M formate buffer, flow rate: 4 mL/1 min, collection time : 28-29 min) and total time was around 70 min. Fluoroethyl raloxifene derivative has the best RBA value among the other synthesized derivatives and chose it for radiolabeling. [{sup 18}F]Fluoroethyl raloxifene derivative prepared 5-23% decay corrected labeling yield. This preparation is on going for labeling optimizing and preparing of in vitro and in vivo test.

  13. [Evaluation of vital constants. 18th century].

    Science.gov (United States)

    Sánchez González, Natividad; Ortega Martínez, Carmen

    2002-05-01

    The evaluation of patients' vital statistics is part of health care and in many cases this is the first step in knowing what is the health status of a patient. Therefore, we are interested in analysing what knowledge nurses had regarding these vital statistics during the 18th century, how they evaluated these statistics and what treatment they applied in order to maintain or balance them whenever they became unstable. A manual written by a nurse in the 18th century in order to aid her colleagues in their treatment of patients is the source of the authors' research material.

  14. Calibration of speleothem δ18O records against hydroclimate instrumental records in Central Brazil

    Science.gov (United States)

    Moquet, J. S.; Cruz, F. W.; Novello, V. F.; Stríkis, N. M.; Deininger, M.; Karmann, I.; Santos, R. Ventura; Millo, C.; Apaestegui, J.; Guyot, J.-L.; Siffedine, A.; Vuille, M.; Cheng, H.; Edwards, R. L.; Santini, W.

    2016-04-01

    δ18O in speleothems is a powerful proxy for reconstruction of precipitation patterns in tropical and sub-tropical regions. The aim of this study is to calibrate the δ18O record of speleothems against historical precipitation and river discharge data in central Brazil, a region directly influenced by the Southern Atlantic Convergence Zone (SACZ), a major feature of the South American Monsoon System (SAMS). The present work is based on a sub-annual resolution speleothem record covering the last 141 years (the period between the years 1870 and 2011) from a cave in central Brazil. The comparison of this record with instrumental hydroclimate records since 1921 allows defining a strong relationship between precipitation variability and stable oxygen isotope ratios from speleothems. The results from a monitoring program of climatic parameters and isotopic composition of rainfall and cave seepage waters performed in the same cave, show that the rain δ18O variability is dominated by the amount effect in this region, while δ18O drip water remains almost constant over the monitored period (1.5 years). The δ18O of modern calcite, on the other hand, shows clear seasonal variations, with more negative values observed during the rainy season, which implies that other factors also influence the isotopic composition of carbonate. However, the relationship between δ18O of carbonate deposits and rainwater is supported by the results from the comparison between speleothem δ18O records and historical hydroclimate records. A significant correlation between speleothem δ18O and monsoon rainfall variability is observed on sub-decadal time scales, especially for the monsoon period (DJFM and NDJFM), once the rainfall record have been smoothed with a 7-9 years running mean. This study confirms that speleothem δ18O is directly associated with monsoon rainfall variability in central Brazil. The relationship between speleothem δ18O records and hydroclimatic historical records allows

  15. Carbon Dioxide Fountain

    Science.gov (United States)

    Kang, Seong-Joo; Ryu, Eun-Hee

    2007-01-01

    This article presents the development of a carbon dioxide fountain. The advantages of the carbon dioxide fountain are that it is odorless and uses consumer chemicals. This experiment also is a nice visual experiment that allows students to see evidence of a gaseous reagent being consumed when a pressure sensor is available. (Contains 3 figures.)…

  16. De-carbonizingChina

    Institute of Scientific and Technical Information of China (English)

    zhou; Xiaoyan

    2013-01-01

    Innovation in the energy sector will pave the way for the country’slow-carbon future Although its per-capita emission is roughly on par with the world’s average, China is the world’s largest carbon dioxide emitter,

  17. Carbon for sensing devices

    CERN Document Server

    Tagliaferro, Alberto

    2015-01-01

    This book reveals why carbon is playing such an increasingly prominent role as a sensing material. The various steps that transform a raw material in a sensing device are thoroughly presented and critically discussed.  The authors deal with all aspects of carbon-based sensors, starting from the various hybridization and allotropes of carbon, with specific focus on micro and nanosized carbons (e.g., carbon nanotubes, graphene) and their growth processes. The discussion then moves to the role of functionalization and the different routes to achieve it. Finally, a number of sensing applications in various fields are presented, highlighting the connection with the basic properties of the various carbon allotropes.  Readers will benefit from this book’s bottom-up approach, which starts from the local bonding in carbon solids and ends with sensing applications, linking the local hybridization of carbon atoms and its modification by functionalization to specific device performance. This book is a must-have in th...

  18. China's carbon conundrum

    Science.gov (United States)

    Qi, Ye; Wu, Tong; He, Jiankun; King, David A.

    2013-07-01

    China's carbon dioxide emissions are rising fast. Yet, per capita, gross domestic product and energy use are only a fraction of their United States equivalents. With a growing urban middle class, the trend will continue, but there is progress on the path to a low-carbon economy.

  19. Global carbon budget 2014

    NARCIS (Netherlands)

    Le Quéré, C.; Moriarty, R.; Andrew, R. M.; Peters, G. P.; Ciais, P.; Friedlingstein, P.; Jones, S. D.; Sitch, S.; Tans, P.; Arneth, A.; Boden, T. A.; Bopp, L.; Bozec, Y.; Canadell, J. G.; Chevallier, F.; Cosca, C. E.; Harris, I.; Hoppema, M.; Houghton, R. A.; House, J. I.; Jain, A.; Johannessen, T.; Kato, E.; Keeling, R. F.; Kitidis, V.; Klein Goldewijk, K.; Koven, C.; Landa, C. S.; Landschützer, P.; Lenton, A.; Lima, I. D.; Marland, G.; Mathis, J. T.; Metzl, N.; Nojiri, Y.; Olsen, A.; Ono, T.; Peters, W.; Pfeil, B.; Poulter, B.; Raupach, M. R.; Regnier, P.; Rödenbeck, C.; Saito, S.; Salisbury, J. E.; Schuster, U.; Schwinger, J.; Séférian, R.; Segschneider, J.; Steinhoff, T.; Stocker, B. D.; Sutton, A. J.; Takahashi, T.; Tilbrook, B.; van der Werf, G. R.; Viovy, N.; Wang, Y.-P.; Wanninkhof, R.; Wiltshire, A.; Zeng, N.

    2014-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2) emissions and their redistribution among the atmosphere, ocean, and terrestrial biosphere is important to better understand the global carbon cycle, support the development of climate policies, and project future climate change. Here we descr

  20. Global Carbon Budget 2015

    NARCIS (Netherlands)

    Quéré, Le C.; Moriarty, R.; Andrew, R.M.; Canadell, J.G.; Sitch, S.; Korsbakken, J.I.; Friedlingstein, P.; Peters, G.P.; Andres, R.J.; Boden, T.A.; Houghton, R.A.; House, J.I.; Keeling, R.F.; Tans, P.; Arneth, A.; Bakker, D.C.E.; Barbero, L.; Bopp, L.; Chang, J.; Chevallier, F.; Chini, L.P.; Ciais, P.; Fader, M.; Feely, R.A.; Gkritzalis, T.; Harris, I.; Hauck, J.; Ilyina, T.; Jain, A.K.; Kato, E.; Kitidis, V.; Klein Goldewijk, K.; Koven, C.; Landschützer, P.; Lauvset, S.K.; Lefèvre, N.; Lenton, A.; Lima, I.D.; Metzl, N.; Millero, F.; Munro, D.R.; Murata, A.; Nabel, J.E.M.S.; Nakaoka, S.; Nojiri, Y.; O'Brien, K.; Olsen, A.; Ono, T.; Pérez, F.F.; Pfeil, B.; Pierrot, D.; Poulter, B.; Rehder, G.; Rödenbeck, C.; Saito, S.; Schuster, U.; Schwinger, J.; Séférian, R.; Steinhoff, T.; Stocker, B.D.; Sutton, A.J.; Takahashi, T.; Tilbrook, B.; Laan-Luijkx, Van Der I.T.; Werf, Van Der G.R.; Heuven, Van S.; Vandemark, D.; Viovy, N.; Wiltshire, A.; Zaehle, S.; Zeng, N.

    2015-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2) emissions and their redistribution among the atmosphere, ocean, and terrestrial biosphere is important to better understand the global carbon cycle, support the development of climate policies, and project future climate change. Here we de

  1. Global carbon budget 2013

    NARCIS (Netherlands)

    Le Quéré, C.; Peters, G. P.; Andres, R. J.; Andrew, R. M.; Boden, T. A.; Ciais, P.; Friedlingstein, P.; Houghton, R. A.; Marland, G.; Moriarty, R.; Sitch, S.; Tans, P.; Arneth, A.; Arvanitis, A.; Bakker, D. C E; Bopp, L.; Canadell, J. G.; Chini, L. P.; Doney, S. C.; Harper, A.; Harris, I.; House, J. I.; Jain, A. K.; Jones, S. D.; Kato, E.; Keeling, R. F.; Klein Goldewijk, Kees; Körtzinger, A.; Koven, C.; Lefèvre, N.; Maignan, F.; Omar, A.; Ono, T.; Park, G. H.; Pfeil, B.; Poulter, B.; Raupach, M. R.; Regnier, Piere; Rödenbeck, C.; Saito, S.; Schwinger, J.; Segschneider, J.; Stocker, B. D.; Takahashi, T.; Tilbrook, B.; Van Heuven, S.; Viovy, N.; Wanninkhof, R.; Wiltshire, A.; Zaehle, S.

    2014-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2) emissions and their redistribution among the atmosphere, ocean, and terrestrial biosphere is important to better understand the global carbon cycle, support the development of climate policies, and project future climate change. Here we descr

  2. Global Carbon Budget 2015

    NARCIS (Netherlands)

    Le Quéré, C.; Moriarty, R.; Andrew, R. M.; Canadell, J. G.; Sitch, S.; Korsbakken, J. I.; Friedlingstein, P.; Peters, G. P.; Andres, R. J.; Boden, T. A.; Houghton, R. A.; House, J. I.; Keeling, R. F.; Tans, P.; Arneth, A.; Bakker, D. C. E.; Barbero, L.; Bopp, L.; Chang, J.; Chevallier, F.; Chini, L. P.; Ciais, P.; Fader, M.; Feely, R. A.; Gkritzalis, T.; Harris, I.; Hauck, J.; Ilyina, T.; Jain, A. K.; Kato, E.; Kitidis, V.; Klein Goldewijk, K.; Koven, C.; Landschützer, P.; Lauvset, S. K.; Lefèvre, N.; Lenton, A.; Lima, I. D.; Metzl, N.; Millero, F.; Munro, D. R.; Murata, A.; Nabel, J. E. M. S.; Nakaoka, S.; Nojiri, Y.; O'Brien, K.; Olsen, A.; Ono, T.; Pérez, F. F.; Pfeil, B.; Pierrot, D.; Poulter, B.; Rehder, G.; Rödenbeck, C.; Saito, S.; Schuster, U.; Schwinger, J.; Séférian, R.; Steinhoff, T.; Stocker, B. D.; Sutton, A. J.; Takahashi, T.; Tilbrook, B.; van der Laan-Luijkx, I. T.; van der Werf, G. R.; van Heuven, S.; Vandemark, D.; Viovy, N.; Wiltshire, A.; Zaehle, S.; Zeng, N.

    2015-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2) emissions and their redistribution among the atmosphere, ocean, and terrestrial biosphere is important to better understand the global carbon cycle, support the development of climate policies, and project future climate change. Here we descr

  3. Fly ash carbon passivation

    Science.gov (United States)

    La Count, Robert B; Baltrus, John P; Kern, Douglas G

    2013-05-14

    A thermal method to passivate the carbon and/or other components in fly ash significantly decreases adsorption. The passivated carbon remains in the fly ash. Heating the fly ash to about 500 and 800 degrees C. under inert gas conditions sharply decreases the amount of surfactant adsorbed by the fly ash recovered after thermal treatment despite the fact that the carbon content remains in the fly ash. Using oxygen and inert gas mixtures, the present invention shows that a thermal treatment to about 500 degrees C. also sharply decreases the surfactant adsorption of the recovered fly ash even though most of the carbon remains intact. Also, thermal treatment to about 800 degrees C. under these same oxidative conditions shows a sharp decrease in surfactant adsorption of the recovered fly ash due to the fact that the carbon has been removed. This experiment simulates the various "carbon burnout" methods and is not a claim in this method. The present invention provides a thermal method of deactivating high carbon fly ash toward adsorption of AEAs while retaining the fly ash carbon. The fly ash can be used, for example, as a partial Portland cement replacement in air-entrained concrete, in conductive and other concretes, and for other applications.

  4. Carbon Dioxide and Climate.

    Science.gov (United States)

    Brewer, Peter G.

    1978-01-01

    The amount of carbon dioxide in the atmosphere is increasing at a rate that could cause significant warming of the Earth's climate in the not too distant future. Oceanographers are studying the role of the ocean as a source of carbon dioxide and as a sink for the gas. (Author/BB)

  5. COMMITTED TO CARBON REDUCTION

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Chinese efforts to lower carbon emissions through environmentally friendly means begin gaining momentum Efforts to curb carbon emissions continue to take shape as China adheres to its pledge for a brighter, greener future. More importantly, as environmental measures take hold and develop

  6. Global carbon budget 2014

    NARCIS (Netherlands)

    Quéré, Le C.; Peters, W.; Moriarty, R.; Friedlingstein, P.

    2015-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2) emissions and their redistribution among the atmosphere, ocean, and terrestrial biosphere is important to better understand the global carbon cycle, support the development of climate policies, and project future climate change. Here we descr

  7. Carbon Capture and Storage

    NARCIS (Netherlands)

    Benson, S.M.; Bennaceur, K.; Cook, P.; Davison, J.; Coninck, H. de; Farhat, K.; Ramirez, C.A.; Simbeck, D.; Surles, T.; Verma, P.; Wright, I.

    2012-01-01

    Emissions of carbon dioxide, the most important long-lived anthropogenic greenhouse gas, can be reduced by Carbon Capture and Storage (CCS). CCS involves the integration of four elements: CO 2 capture, compression of the CO2 from a gas to a liquid or a denser gas, transportation of pressurized CO 2

  8. Evaporation induced 18O and 13C enrichment in lake systems: A global perspective on hydrologic balance effects

    Science.gov (United States)

    Horton, Travis W.; Defliese, William F.; Tripati, Aradhna K.; Oze, Christopher

    2016-01-01

    Growing pressure on sustainable water resource allocation in the context of global development and rapid environmental change demands rigorous knowledge of how regional water cycles change through time. One of the most attractive and widely utilized approaches for gaining this knowledge is the analysis of lake carbonate stable isotopic compositions. However, endogenic carbonate archives are sensitive to a variety of natural processes and conditions leaving isotopic datasets largely underdetermined. As a consequence, isotopic researchers are often required to assume values for multiple parameters, including temperature of carbonate formation or lake water δ18O, in order to interpret changes in hydrologic conditions. Here, we review and analyze a global compilation of 57 lacustrine dual carbon and oxygen stable isotope records with a topical focus on the effects of shifting hydrologic balance on endogenic carbonate isotopic compositions. Through integration of multiple large datasets we show that lake carbonate δ18O values and the lake waters from which they are derived are often shifted by >+10‰ relative to source waters discharging into the lake. The global pattern of δ18O and δ13C covariation observed in >70% of the records studied and in several evaporation experiments demonstrates that isotopic fractionations associated with lake water evaporation cause the heavy carbon and oxygen isotope enrichments observed in most lakes and lake carbonate records. Modeled endogenic calcite compositions in isotopic equilibrium with lake source waters further demonstrate that evaporation effects can be extreme even in lake records where δ18O and δ13C covariation is absent. Aridisol pedogenic carbonates show similar isotopic responses to evaporation, and the relevance of evaporative modification to paleoclimatic and paleotopographic research using endogenic carbonate proxies are discussed. Recent advances in stable isotope research techniques present unprecedented

  9. 18 CFR 154.305 - Tax normalization.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Tax normalization. 154... Changes § 154.305 Tax normalization. (a) Applicability. An interstate pipeline must compute the income tax component of its cost-of-service by using tax normalization for all transactions. (b) Definitions. (1)...

  10. 7 CFR 18.9 - Sanctions.

    Science.gov (United States)

    2010-01-01

    ... Secretary of Agriculture EQUAL EMPLOYMENT OPPORTUNITY IN THE STATE COOPERATIVE EXTENSION SERVICES § 18.9... action to refuse to authorize payment of funds for the Cooperative Extension Service, or take other appropriate action provided by law. (b) The remedies available to the Secretary under this part, and...

  11. 18 CFR 1317.540 - Advertising.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Advertising. 1317.540 Section 1317.540 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY NONDISCRIMINATION ON... Advertising. A recipient shall not in any advertising related to employment indicate preference,...

  12. 18 CFR 367.20 - Depreciation accounting.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Depreciation accounting. 367.20 Section 367.20 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.20 Depreciation accounting. (a) Method. Service companies must use a method of...

  13. 38 CFR 18.6 - Compliance information.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Compliance information... THE CIVIL RIGHTS ACT OF 1964 General § 18.6 Compliance information. (a) Cooperation and assistance... compliance reports at such times, and in such form and containing such information, as the responsible...

  14. 18 CFR 1317.410 - Comparable facilities.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Comparable facilities... facilities. A recipient may provide separate toilet, locker room, and shower facilities on the basis of sex, but such facilities provided for students of one sex shall be comparable to such facilities...

  15. 18 CFR 154.307 - Joint facilities.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Joint facilities. 154... Changes § 154.307 Joint facilities. The Statements required by § 154.312 must show all costs (investment... in the subject rate change and are associated with joint facilities. The methods used in making...

  16. 18 CFR 292.306 - Interconnection costs.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Interconnection costs... § 292.306 Interconnection costs. (a) Obligation to pay. Each qualifying facility shall be obligated to pay any interconnection costs which the State regulatory authority (with respect to any...

  17. 18 CFR 367.5 - Accounting period.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Accounting period. 367.5 Section 367.5 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.5 Accounting period. Each service company must keep its books on a monthly basis so that...

  18. 18 CFR 1b.21 - Enforcement hotline.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Enforcement hotline. 1b..., DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.21 Enforcement hotline. (a) The Hotline Staff may provide information to the public and give informal staff opinions. The opinions...

  19. 18 CFR 1317.515 - Compensation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Compensation. 1317.515... Compensation. A recipient shall not make or enforce any policy or practice that, on the basis of sex: (a) Makes distinctions in rates of pay or other compensation; (b) Results in the payment of wages to employees of one...

  20. All Orthogonal Arrays with 18 Runs

    NARCIS (Netherlands)

    Schoen, E.D.

    2009-01-01

    All combinatorially inequivalent orthogonal arrays with 18 runs and eight or less factors are generated. Their potential as practical experimental designs is evaluated by a classification using generalized word-length patterns of the original arrays and those of their projections into less factors.

  1. 18 CFR 5.28 - Competing applications.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Competing applications. 5.28 Section 5.28 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Competing applications. (a) Site access for a competing applicant. The provisions of § 16.5 of this...

  2. 18 CFR 5.20 - Deficient applications.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Deficient applications. 5.20 Section 5.20 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... competing application, the resubmittal is timely. The date the rejected application is resubmitted will...

  3. 18 CFR 50.4 - Stakeholder participation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Stakeholder... ELECTRIC TRANSMISSION FACILITIES § 50.4 Stakeholder participation. A Project Participation Plan is required to ensure stakeholders have access to accurate and timely information on the proposed project...

  4. 18 CFR 1304.2 - Application.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Application. 1304.2 Section 1304.2 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY APPROVAL OF...) 386-2228, Reservoirs: Pickwick, Bear Creek; (8) Suite 218, Heritage Federal Bank Building, 4105...

  5. 18 CFR 801.9 - Watershed management.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Watershed management... GENERAL POLICIES § 801.9 Watershed management. (a) The character, extent, and quality of water resources... management including soil and water conservation measures, land restoration and rehabilitation,...

  6. 18 CFR 358.2 - General principles.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General principles. 358... principles. (a) As more fully described and implemented in subsequent sections of this part, a transmission... independently from its marketing function employees, except as permitted in this part or otherwise permitted...

  7. 7 CFR 1485.18 - Advances.

    Science.gov (United States)

    2010-01-01

    ... MARKETS FOR AGRICULTURAL COMMODITIES Market Access Program § 1485.18 Advances. (a) Policy. In general, CCC... to an MAP participant for brand promotion activities. (b) Exception. Upon request, CCC may advance payments to an MAP participant for generic promotion activities. Prior to making an advance, CCC...

  8. 7 CFR 29.2634 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.2634 Rule 18. Any lot of tobacco containing 20 percent or more of green leaves or any lot which is not crude but contains 20 percent or more of green and crude combined shall...

  9. 7 CFR 29.3121 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.3121 Rule 18. Any lot of tobacco containing 20 percent or more of green leaves, or any lot which is not crude but contains 20 percent or more of green and crude combined,...

  10. 7 CFR 29.2409 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.2409 Rule 18. Any lot of tobacco containing 20 percent or more of green leaves or any lot which is not crude but contains 20 percent or more of green and crude combined shall...

  11. 38 CFR 18.436 - Procedural safeguards.

    Science.gov (United States)

    2010-07-01

    ... or are believed to need special instruction or related services. The system shall include: (1) Notice... THE CIVIL RIGHTS ACT OF 1964 Nondiscrimination on the Basis of Handicap Elementary, Secondary, and Adult Education § 18.436 Procedural safeguards. (a) A recipient that operates a public elementary...

  12. 18 CFR 401.121 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Definitions. 401.121 Section 401.121 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE... part, except as the context may otherwise require: (a) All words and phrases which are defined...

  13. Clean Cities Now, Vol. 18, No. 2

    Energy Technology Data Exchange (ETDEWEB)

    None

    2015-01-19

    This is version 18.2 of Clean Cities Now, the official biannual newsletter of the Clean Cities program. Clean Cities is an initiative designed to reduce petroleum consumption in the transportation sector by advancing the use of alternative and renewable fuels, fuel economy improvements, idle-reduction measures, and new technologies, as they emerge.

  14. Spitzer Secondary Eclipses of WASP-18b

    CERN Document Server

    Nymeyer, Sarah; Hardy, Ryan A; Stevenson, Kevin B; Campo, Christopher J; Madhusudhan, Nikku; Collier-Cameron, Andrew; Blecic, Jasmina; Bowman, William C; Britt, Christopher B T; Cubillos, Patricio; Hellier, Coel; Gillon, Michael; Maxted, Pierre F L; Hebb, Leslie; Wheatley, Peter J; Pollacco, Don; Anderson, David

    2010-01-01

    The transiting exoplanet WASP-18b was discovered in 2008 by the Wide Angle Search for Planets (WASP) project. The \\textit{Spitzer}\\ Exoplanet Target of Opportunity Program observed secondary eclipses of WASP-18b using \\textit{Spitzer}'s Infrared Array Camera (IR\\ AC) in the 3.6-{\\micron} and 5.8-{\\micron} bands on 2008 December 20, and in the 4.5-{\\micron} and 8.0-{\\micron} bands on 2008 Dece\\ mber 24. We report eclipse depths of \\math{0.31\\pm{0.02}, 0.38\\pm{0.03}, 0.41\\pm{0.02}, 0.43\\pm{0.03}\\%}, and brightness temperatu\\ res of 2920 \\pm {90}, 3150 \\pm {130}, 3040 \\pm {130} and 2960 \\pm {130} K, respectively. WASP-18b is one of the hottest planets ye\\ t discovered - as hot as an M-class star. The planet's pressure-temperature profile features a thermal inversion. The observation\\ s also require WASP-18b to have near-zero albedo and almost no redistribution of energy from the day-side to the night side of the \\ planet.

  15. 18 CFR 367.81 - Maintenance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Maintenance. 367.81... Expense Instructions § 367.81 Maintenance. (a) The cost of maintenance chargeable to the various operating... maintenance work. A list of work operations applicable generally to service company property is included...

  16. Diversity in Action Workshop | 18 September

    CERN Document Server

    CERN Diversity Programme

    2014-01-01

    Get an insight into diversity, develop greater sensitivity to differences, acquire new tools to recognise and overcome unconscious biases.   Thursday 18 September 2014 8.30 a.m. to 12.30 p.m.  Business Center Technoparc - Saint-Genis-Pouilly Registration mandatory through http://www.cern.ch/diversity

  17. 18 CFR 270.401 - Jurisdictional agency.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Jurisdictional agency. 270.401 Section 270.401 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Boston Boulevard, Springfield, VA 22153. (24) (i) Texas, east of the 100th Meridian—Field Office...

  18. 18 CFR 801.6 - Water supply.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Water supply. 801.6 Section 801.6 Conservation of Power and Water Resources SUSQUEHANNA RIVER BASIN COMMISSION GENERAL POLICIES § 801.6 Water supply. (a) The Susquehanna River Basin is rich in water resources. With...

  19. 18 CFR 420.44 - Cooling water.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Cooling water. 420.44 Section 420.44 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL BASIN REGULATIONS-WATER SUPPLY CHARGES Charges; Exemptions § 420.44 Cooling water. Water...

  20. 18 CFR 806.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Definitions. 806.3 Section 806.3 Conservation of Power and Water Resources SUSQUEHANNA RIVER BASIN COMMISSION REVIEW AND... the context indicates otherwise, the words listed in this section are defined as follows:...

  1. 18 CFR 401.0 - Introduction.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Introduction. 401.0 Section 401.0 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE § 401.0 Introduction. (a) The Delaware River Basin...

  2. 18 CFR 801.0 - Introduction.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Introduction. 801.0 Section 801.0 Conservation of Power and Water Resources SUSQUEHANNA RIVER BASIN COMMISSION GENERAL POLICIES § 801.0 Introduction. (a) The Governors of the States of New York, Pennsylvania, and Maryland,...

  3. 18 CFR 807.2 - Time limits.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Time limits. 807.2... WITHDRAWAL REGISTRATION § 807.2 Time limits. (a) Except for agricultural water use projects, all registration... limit the responsibility of a project sponsor to apply for and obtain an approval as may be...

  4. 18 CFR 367.26 - Departmental classification.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Departmental classification. 367.26 Section 367.26 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... ACT General Instructions § 367.26 Departmental classification. Salaries and wages and all other...

  5. 18 CFR 292.101 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... unscheduled outage of the facility. (10) Interruptible power means electric energy or capacity supplied by an...) Maintenance power means electric energy or capacity supplied by an electric utility during scheduled outages... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions....

  6. 7 CFR 29.3619 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Rule 18. 29.3619 Section 29.3619 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... as “mixed” and designated by the color symbol “M” when it is not green but contains (a) over...

  7. 18 CFR 157.37 - Project design.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Project design. 157.37... Seasons for Alaska Natural Gas Transportation Projects § 157.37 Project design. In reviewing any... proposed project has been designed to accommodate the needs of shippers who have made conforming...

  8. 18 CFR 1300.104 - Sexual harassment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Sexual harassment. 1300... CONDUCT FOR EMPLOYEES OF TENNESSEE VALLEY AUTHORITY § 1300.104 Sexual harassment. It is TVA policy that all TVA employees are responsible for assuring that the workplace is free from sexual...

  9. 30 CFR 18.37 - Lead entrances.

    Science.gov (United States)

    2010-07-01

    ... against loosening. (d) Compressed packing material shall be in contact with the cable jacket for a length... cable jacket and the nominal inside diameter of the packing material shall not exceed 1/32-inch, based... § 18.37 Lead entrances. (a) Insulated cable(s), which must extend through an outside wall of...

  10. 18 CFR 801.7 - Water quality.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Water quality. 801.7... POLICIES § 801.7 Water quality. (a) The signatory States have the primary responsibility in the basin for water quality management and control. However, protection of the water resources of the basin...

  11. BCS-18A command decoder-selector

    Science.gov (United States)

    Laping, H.

    1980-08-01

    This report describes an 18-channel command decoder-selector which operates in conjunction with an HF command receiver to allow secure and reliable radio control of high altitude balloon payloads. A detailed technical description and test results are also included.

  12. 18 CFR 430.15 - Conservation requirements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Conservation requirements. 430.15 Section 430.15 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION SPECIAL REGULATIONS GROUND WATER PROTECTION AREA: PENNSYLVANIA § 430.15 Conservation requirements....

  13. 18 CFR 376.102 - Organization.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Organization. 376.102... OF ENERGY REVISED GENERAL RULES ORGANIZATION, MISSION, AND FUNCTIONS; OPERATIONS DURING EMERGENCY CONDITIONS Organization, Mission, and Functions § 376.102 Organization. The Commission is established as...

  14. 18 CFR 701.5 - Organization pattern.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Organization pattern... ORGANIZATION Introduction § 701.5 Organization pattern. (a) The Office of the Water Resources Council is... Council Staff headed by a Director, and Field Organizations within its jurisdiction. (b) The...

  15. Familial deletion 18p syndrome: case report

    Directory of Open Access Journals (Sweden)

    Lemyre Emmanuelle

    2006-07-01

    Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.

  16. 18 CFR 342.3 - Indexing.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Indexing. 342.3 Section....3 Indexing. (a) Rate changes. A rate charged by a carrier may be changed, at any time, to a level... under this section proposing to change a rate that is under investigation and subject to refund,...

  17. 18 CFR 1301.43 - Open meetings.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Open meetings. 1301.43... in the Sunshine Act § 1301.43 Open meetings. Members shall not jointly conduct or dispose of TVA... every meeting of the agency shall be open to public observation, and TVA shall provide...

  18. 18 CFR 375.205 - Closed meetings.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Closed meetings. 375... § 375.205 Closed meetings. (a) Meetings will be closed to public observation where the Commission properly determines, according to the procedures set forth in § 375.206, that such meeting or portion...

  19. 18 CFR 375.203 - Open meetings.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Open meetings. 375.203... § 375.203 Open meetings. (a) General rule. Except as provided in § 375.206, meetings of the Commission will be open meetings. (b) Public participation in open meetings. (1) Members of the public are...

  20. 18 CFR 1304.402 - Wastewater outfalls.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Wastewater outfalls. 1304.402 Section 1304.402 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY APPROVAL... Miscellaneous § 1304.402 Wastewater outfalls. Applicants for a wastewater outfall shall provide copies of...

  1. 18 CFR 1317.430 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Financial assistance. 1317.430 Section 1317.430 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY... parental status. (b) Financial aid established by certain legal instruments. (1) A recipient may...

  2. 18 CFR 1307.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Discrimination... NONDISCRIMINATION WITH RESPECT TO HANDICAP § 1307.4 Discrimination prohibited. (a) General. No qualified handicapped... otherwise be subjected to discrimination under any program or activity to which this part applies....

  3. 18 CFR 705.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Discrimination... Discrimination prohibited. (a) General. No person in the United States shall, on the grounds of race, color, or... discrimination under, any program to which this part applies. (b) Specific discriminatory actions prohibited....

  4. 38 CFR 18.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... THE CIVIL RIGHTS ACT OF 1964 General § 18.3 Discrimination prohibited. (a) General. No person in the..., be denied the benefits of, or be otherwise subjected to discrimination under any program to...

  5. 38 CFR 18.421 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... Accessibility § 18.421 Discrimination prohibited. No qualified handicapped person shall, because a recipient's... from participation in, or otherwise be subjected to discrimination under any program or activity...

  6. 18 CFR 1302.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Discrimination... § 1302.4 Discrimination prohibited. (a) General. No person in the United States shall, on the ground of... otherwise subjected to discrimination under any program or activity receiving Federal financial...

  7. 18 CFR 8.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Discrimination prohibited. 8.3 Section 8.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... LICENSED PROJECTS § 8.3 Discrimination prohibited. Every licensee maintaining recreation facilities for...

  8. 38 CFR 18.411 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... Practices § 18.411 Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity to...

  9. 38 CFR 18.404 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... Provisions § 18.404 Discrimination prohibited. (a) General. No qualified handicapped person shall, on the... subjected to discrimination under any program or activity which receives Federal financial assistance....

  10. 18 CFR 701.56 - Observers.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Observers. 701.56... Headquarters Organization § 701.56 Observers. (a) Chairmen and Vice-Chairmen of River Basin Commissions established under Title II of the Act shall be Observers. (b) The Chairman, with the concurrence of...

  11. 18 CFR 701.4 - Functions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Functions. 701.4... Introduction § 701.4 Functions. The functions of the Water Resources Council are: (a) To maintain a continuing... accordance with Title III of the Act. (i) To perform such other functions as the Council may be authorized...

  12. 18 CFR 376.104 - Functions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Functions. 376.104... OF ENERGY REVISED GENERAL RULES ORGANIZATION, MISSION, AND FUNCTIONS; OPERATIONS DURING EMERGENCY CONDITIONS Organization, Mission, and Functions § 376.104 Functions. The functions of the Commission...

  13. 18 CFR 11.7 - Effective date.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Effective date. 11.7... Dams § 11.7 Effective date. All annual charges imposed under this subpart will be computed beginning on the effective date of the license unless some other date is fixed in the license....

  14. 18 CFR 1308.7 - Effective date.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Effective date. 1308.7... General Matters § 1308.7 Effective date. Subject to § 1308.3(a), this part applies to any TVA contract having an effective date on or after March 1, 1979....

  15. 18 CFR 808.19 - Effective date.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Effective date. 808.19 Section 808.19 Conservation of Power and Water Resources SUSQUEHANNA RIVER BASIN COMMISSION HEARINGS AND ENFORCEMENT ACTIONS Compliance and Enforcement § 808.19 Effective date. This part shall be effective...

  16. 18 CFR 807.4 - Effective date.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Effective date. 807.4 Section 807.4 Conservation of Power and Water Resources SUSQUEHANNA RIVER BASIN COMMISSION WATER WITHDRAWAL REGISTRATION § 807.4 Effective date. This part shall be effective on January 1, 2007....

  17. 18 CFR 801.5 - Comprehensive plan.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Comprehensive plan. 801... POLICIES § 801.5 Comprehensive plan. (a) The Compact requires that the Commission formulate and adopt a comprehensive plan for the immediate and long-range development and use of the water resources of the basin....

  18. 18 CFR 367.12 - Payroll distribution.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Payroll distribution... Instructions § 367.12 Payroll distribution. Underlying accounting data must be maintained so that the distribution of the cost of labor charged direct to the various accounts will be readily available....

  19. 18 CFR 3a.1 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Purpose. 3a.1 Section 3a.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES NATIONAL SECURITY INFORMATION General § 3a.1 Purpose. This part 3a describes...

  20. 18 CFR 3b.4 - Government contractors.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Government contractors. 3b.4 Section 3b.4 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF...

  1. 18 CFR 1b.12 - Transcripts.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  2. 18 CFR 3b.1 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Purpose. 3b.1 Section 3b.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

  3. 18 CFR 1b.14 - Subpoenas.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Subpoenas. 1b.14 Section 1b.14 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.14 Subpoenas. (a) Service of a...

  4. 18 CFR 2.51 - [Reserved

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false 2.51 Section 2.51 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES GENERAL POLICY AND INTERPRETATIONS Statements of General Policy and Interpretations Under...

  5. 18 CFR 2.69 - [Reserved

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false 2.69 Section 2.69 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES GENERAL POLICY AND INTERPRETATIONS Statements of General Policy and Interpretations Under...

  6. 18 CFR 2.201 - [Reserved

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false 2.201 Section 2.201 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES GENERAL POLICY AND INTERPRETATIONS Rules of General Applicability § 2.201 Statement of...

  7. 18 CFR 1.101 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 1.101 Section 1.101 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES OF GENERAL APPLICABILITY Definitions and Rules of Construction §...

  8. 18 CFR 3b.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 3b.2 Section 3b.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

  9. 18 CFR 2.8 - [Reserved

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false 2.8 Section 2.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES GENERAL POLICY AND INTERPRETATIONS Statements of General Policy and Interpretations Under...

  10. 18 CFR 1b.19 - Submissions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Submissions. 1b.19 Section 1b.19 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.19 Submissions. In the event...

  11. 18 CFR 1b.5 - Formal investigations.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Formal investigations. 1b.5 Section 1b.5 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.5 Formal investigations....

  12. 18 CFR 3b.3 - Notice requirements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF...

  13. 18 CFR 1b.6 - Preliminary investigations.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Preliminary investigations. 1b.6 Section 1b.6 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.6 Preliminary investigations....

  14. 18 CFR 2.2 - Transmission lines.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Transmission lines. 2.2 Section 2.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES GENERAL POLICY AND INTERPRETATIONS Statements of General Policy and...

  15. 18 CFR 3a.41 - Access requirements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Access requirements. 3a.41 Section 3a.41 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES NATIONAL SECURITY INFORMATION Access to Classified Materials §...

  16. 18 CFR 3a.2 - Authority.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Authority. 3a.2 Section 3a.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES NATIONAL SECURITY INFORMATION General § 3a.2 Authority. Official information...

  17. 18 CFR 1b.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 1b.1 Section 1b.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.1 Definitions. For purposes of this part—...

  18. 18 CFR 1b.2 - Scope.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Scope. 1b.2 Section 1b.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.2 Scope. This part applies to...

  19. 18 CFR 401.124 - Construction.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Construction. 401.124 Section 401.124 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE General Provisions § 401.124 Construction. This part...

  20. 38 CFR 18.423 - New construction.

    Science.gov (United States)

    2010-07-01

    ... sections 3-8 of the Uniform Federal Accessibility Standards (USAF) (appendix A to 41 CFR subpart 101-19.6... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false New construction. 18.423... construction. (a) Design and construction. Each facility or part of a facility constructed by, on behalf of,...

  1. Synthesis of hydrated lutetium carbonate

    Energy Technology Data Exchange (ETDEWEB)

    Song Liu [South China Univ. of Technology, Dept. of Applied Chemistry, Guangdong (China); Rong-jun Ma [Changsha Research Institute of Minig and Metallurgy, Hunan (China)

    1997-09-01

    Crystalline lutetium carbonate was synthesized for the corresponding chloride using ammonium bicarbonate as precipitant. The chemical analyses suggest that the synthesized lutetium carbonate is a hydrated basic carbonate or oxycarbonate. The X-ray powder diffraction data are presented. The IR data for the compound show the presence of two different carbonate groups. There is no stable intermediate carbonate in the process of thermal decomposition of the lutetium carbonate. (au) 15 refs.

  2. 40 CFR 721.3025 - Fatty acids C12-18, C18 unsaturated, C12-18 alkyl esters (generic).

    Science.gov (United States)

    2010-07-01

    ..., C12-18 alkyl esters (generic). 721.3025 Section 721.3025 Protection of Environment ENVIRONMENTAL... alkyl esters (generic). (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as fatty acids C12-18, C18 unsaturated, C12-18 alkyl esters...

  3. Inverse association between 18-carbon trans fatty acids and intelligence quotients in smoking schizophrenia patients.

    Science.gov (United States)

    Lohner, Szimonetta; Vágási, Judit; Marosvölgyi, Tamás; Tényi, Tamás; Decsi, Tamás

    2014-01-30

    This study aimed to investigate polyunsaturated (PUFA) and trans isomeric fatty acid status in schizophrenia patients. Fatty acid composition of plasma phospholipids (PL) and triacylglycerols (TG) was analyzed by gas chromatography in 29 schizophrenia patients and 15 healthy controls. We found no difference in PL n-3 fatty acid status between the two groups, while the values of 22:5n-6 were significantly higher in patients with schizophrenia than in controls. In TG, values of docosatrienoic acid (20:3n-3) and docosapentaenoic acid (20:5n-3) were significantly higher in schizophrenia patients than in controls. We found no difference in the trans fatty acid status between patients and controls. In smoking schizophrenia patients significant negative correlations were detected between Wechsler adult full-scale intelligence quotients and values of total trans fatty acids in PL lipids, whereas no such correlation was seen either in non-smoking schizophrenia patients, or in healthy controls. While data obtained in the present study fail to furnish evidence for n-3 PUFA supplementation to the diet of patients with schizophrenia, they indicate that in smoking schizophrenia patients high dietary exposure to trans fatty acids is associated with lower intelligence quotients.

  4. Production and application of synthetic precursors labeled with carbon-11 and fluorine-18

    Energy Technology Data Exchange (ETDEWEB)

    Ferrieri, R.A.

    2001-04-02

    It is evident from this chapter that there is enormous flexibility both in the selection of the nature of the radioisotope and ways to generate it, as well as in the selection of the labeling precursor to appropriately attach that radioisotope to some larger biomolecule of interest. The arsenal of radiolabeling precursors now available to the chemist is quite extensive, and without a doubt will continue to grow as chemists develop new ones. However, the upcoming years will perhaps reflect a greater effort in refining existing methods for preparing some of those precursors that are already available to us. For example, the use of solid-phase reactions to accomplish in a single step what would normally take several using conventional solvent-based reactions has already been shown to work in many occasions. The obvious advantage here is that processes become more amenable to system automation thus affording greater reliability in day-to-day operations. There are perhaps other technologies in science that have yet to be realized by the chemist in the PET laboratory that could provide a similar or even a greater benefit. One only needs to be open to new ideas, and imaginative enough to apply them to the problems at hand.

  5. The detection of the (J,K)=(18,18) line of NH3

    CERN Document Server

    Wilson, T L; Hüttemeister, S

    2006-01-01

    The first astronomical detection of the metastable ($J,K$) = (18,18) line of NH3 is reported. With 3130 K above the ground state, this is the NH3 line with by far the highest energy detected in interstellar space. It is observed in absorption toward the galactic center star forming region Sgr B2. There is a clear detection toward Sgr B2(M) and a likely one toward SgrB2(N). An upper limit for emission is determined for Orion-KL. If we combine the (18,18) line results from Sgr B2(M) with the previously measured (12,12) absorption line, we find a rotation temperature of >1300 K for the absorbing cloud. This is at least a factor of two higher than previously derived values from less highly excited ammonia lines, giving a lower limit to the kinetic temperature. There is a hot low density gas component in the envelope of SgrB2. It is possible that the (18,18) line arises in this region. The radial velocity of the low density, hot envelope is the same as that of the dense hot cores, so the (18,18) line could also ar...

  6. Carbon dioxide conversion over carbon-based nanocatalysts.

    Science.gov (United States)

    Khavarian, Mehrnoush; Chai, Siang-Piao; Mohamed, Abdul Rahman

    2013-07-01

    The utilization of carbon dioxide for the production of valuable chemicals via catalysts is one of the efficient ways to mitigate the greenhouse gases in the atmosphere. It is known that the carbon dioxide conversion and product yields are still low even if the reaction is operated at high pressure and temperature. The carbon dioxide utilization and conversion provides many challenges in exploring new concepts and opportunities for development of unique catalysts for the purpose of activating the carbon dioxide molecules. In this paper, the role of carbon-based nanocatalysts in the hydrogenation of carbon dioxide and direct synthesis of dimethyl carbonate from carbon dioxide and methanol are reviewed. The current catalytic results obtained with different carbon-based nanocatalysts systems are presented and how these materials contribute to the carbon dioxide conversion is explained. In addition, different strategies and preparation methods of nanometallic catalysts on various carbon supports are described to optimize the dispersion of metal nanoparticles and catalytic activity.

  7. Holocene record of precipitation seasonality from lake calcite δ18O in the central Rocky Mountains, United States

    Science.gov (United States)

    Anderson, Lesleigh

    2011-01-01

    A context for recent hydroclimatic extremes and variability is provided by a ~10 k.y. sediment carbonate oxygen isotope (??18O) record at 5-100 yr resolution from Bison Lake, 3255 m above sea level, in northwestern Colorado (United States). Winter precipitation is the primary water source for the alpine headwater lake in the Upper Colorado River Basin and lake water ??18O measurements reflect seasonal variations in precipitation ??18O. Holocene lake water ??18O variations are inferred from endogenic sedimentary calcite ??18O based on comparisons with historic watershed discharge records and tree-ring reconstructions. Drought periods (i.e., drier winters and/or a more rain-dominated seasonal precipitation balance) generally correspond with higher calcite ??18O values, and vice-versa. Early to middle Holocene ??18O values are higher, implying a rain-dominated seasonal precipitation balance. Lower, more variable ??18O values after ca. 3500 yr ago indicate a snow-dominated but more seasonally variable precipitation balance. The middle to late Holocene ??18O record corresponds with records of El Ni??o Southern Oscillation intensification that supports a teleconnection between Rocky Mountain climate and North Pacific sea-surface temperatures at decade to century time scales. ?? 2011 Geological Society of America.

  8. Expression of IL-18, IL-18 Binding Protein, and IL-18 Receptor by Normal and Cancerous Human Ovarian Tissues: Possible Implication of IL-18 in the Pathogenesis of Ovarian Carcinoma

    Directory of Open Access Journals (Sweden)

    Liat Medina

    2014-01-01

    Full Text Available Proinflammatory cytokine IL-18 has been shown to be elevated in the sera of ovarian carcinoma patients. The aim of the study was to examine the levels and cellular origin of IL-18, IL-18 binding protein, and IL-18 receptor in normal and cancerous ovarian tissues. Ovarian tissue samples were examined by immunohistochemical staining for IL-18, IL-18BP, and IL-18R and mRNA of these cytokines was analyzed with semiquantitative PT-PCR. IL-18 levels were significantly higher in cancerous ovarian tissues (P=0.0007, IL-18BP levels were significantly higher in normal ovarian tissues (P=0.04, and the ratio of IL-18/IL-18BP was significantly higher in cancerous ovarian tissues (P=0.036. Cancerous ovarian tissues expressed significantly higher IL-18 mRNA levels (P=0.025, while there was no difference in the expression of IL-18BP mRNA and IL-18R mRNA between cancerous and normal ovarian tissues. IL-18 and IL-18BP were expressed dominantly in the epithelial cells of both cancerous and normal ovarian tissues, while IL-18R was expressed dominantly in the epithelial cells of cancerous ovarian tissues but expressed similarly in the epithelial and stromal cells of normal cancerous tissues. This study indicates a possible role of IL-18, IL-18BP, and IL-18R in the pathogenesis of epithelial ovarian carcinoma.

  9. Occurrence of nephroblastomatosis with dup(18)(q11.2-q23) implicates trisomy 18 tumor screening protocol in select patients with 18q duplication.

    Science.gov (United States)

    Starr, Lois J; Sanmann, Jennifer N; Olney, Ann Haskins; Wandoloski, Melissa; Sanger, Warren G; Coulter, Donald W

    2014-04-01

    Duplications of the long arm of chromosome 18 have been previously reported in patients with phenotypic findings similar to full trisomy 18. Trisomy 18 increases the risk for Wilms tumor and it is currently recommended that these patients undergo abdominal ultrasonography screening every 6 months. We report on nephroblastomatosis in a 27-month-old male with a 55 Mb duplication of chromosome 18q11.2-q23 (chr18:22693370-77982126, hg 19) and propose that the trisomy 18 tumor screening protocol could also benefit patients with large 18q duplications.

  10. A modified procedure for measuring oxygen-18 content of nitrate

    Science.gov (United States)

    Ahmed, M. A.; Aly, A. I. M.; Abdel Monem, N.; Hanafy, M.; Gomaa, H. E.

    2012-11-01

    SummaryMass spectrometric analysis of O-isotopic composition of nitrate has many potential applications in studies of environmental processes. Through this work, rapid, reliable, precise, broadly applicable, catalyst-free, low-priced and less labor intensive procedure for measuring δ18O of nitrate using Isotope Ratio Mass Spectrometer has been developed and implemented. The conditions necessary to effect complete nitrate recovery and complete removal of other oxygen containing anions and dissolved organic carbon (DOC) without scarifying the isotopic signature of nitrate were investigated. The developed procedure consists of two main parts: (1) wet chemistry train for extraction and purification of nitrate from the liquid matrix; (2) off-line pyrolysis of extracted nitrate salt with activated graphite at 550 °C for 30 min. The conditions necessary to effect complete nitrate recovery and complete removal of other oxygen containing compounds were investigated. Dramatic reduction in processing times needed for analysis of δ18O of nitrate at natural abundance level was achieved. Preservation experiments revealed that chloroform (99.8%) is an effective preservative. Isotopic contents of some selected nitrate salts were measured using the modified procedure and some other well established methods at two laboratories in Egypt and Germany. Performance assessment of the whole developed analytical train was made using internationally distributed nitrate isotopes reference materials and real world sample of initial zero-nitrate content. The uncertainty budget was evaluated using the graphical nested hierarchal approach. The obtained results proved the suitability for handling samples of complicated matrices. Reduction of consumables cost by about 80% was achieved.

  11. Multifunctional Stiff Carbon Foam Derived from Bread.

    Science.gov (United States)

    Yuan, Ye; Ding, Yujie; Wang, Chunhui; Xu, Fan; Lin, Zaishan; Qin, Yuyang; Li, Ying; Yang, Minglong; He, Xiaodong; Peng, Qingyu; Li, Yibin

    2016-07-06

    The creation of stiff yet multifunctional three-dimensional porous carbon architecture at very low cost is still challenging. In this work, lightweight and stiff carbon foam (CF) with adjustable pore structure was prepared by using flour as the basic element via a simple fermentation and carbonization process. The compressive strength of CF exhibits a high value of 3.6 MPa whereas its density is 0.29 g/cm(3) (compressive modulus can be 121 MPa). The electromagnetic interference (EMI) shielding effectiveness measurements (specific EMI shielding effectiveness can be 78.18 dB·cm(3)·g(-1)) indicate that CF can be used as lightweight, effective shielding material. Unlike ordinary foam structure materials, the low thermal conductivity (lowest is 0.06 W/m·K) with high resistance to fire makes CF a good candidate for commercial thermal insulation material. These results demonstrate a promising method to fabricate an economical, robust carbon material for applications in industry as well as topics regarding environmental protection and improvement of energy efficiency.

  12. Low-carbon infrastructure strategies for cities

    Science.gov (United States)

    Kennedy, C. A.; Ibrahim, N.; Hoornweg, D.

    2014-05-01

    Reducing greenhouse gas emissions to avert potentially disastrous global climate change requires substantial redevelopment of infrastructure systems. Cities are recognized as key actors for leading such climate change mitigation efforts. We have studied the greenhouse gas inventories and underlying characteristics of 22 global cities. These cities differ in terms of their climates, income, levels of industrial activity, urban form and existing carbon intensity of electricity supply. Here we show how these differences in city characteristics lead to wide variations in the type of strategies that can be used for reducing emissions. Cities experiencing greater than ~1,500 heating degree days (below an 18 °C base), for example, will review building construction and retrofitting for cold climates. Electrification of infrastructure technologies is effective for cities where the carbon intensity of the grid is lower than ~600 tCO2e GWh-1 whereas transportation strategies will differ between low urban density (~6,000 persons km-2) cities. As nation states negotiate targets and develop policies for reducing greenhouse gas emissions, attention to the specific characteristics of their cities will broaden and improve their suite of options. Beyond carbon pricing, markets and taxation, governments may develop policies and target spending towards low-carbon urban infrastructure.

  13. Mel-18 gene and neoplasms%Mel-18基因与肿瘤

    Institute of Scientific and Technical Information of China (English)

    许学宗; 曹京燕; 于雁

    2013-01-01

    黑色素瘤核蛋白-18(Mel-18)基因是多梳基因(PcG)家族核心成员之一,在胚胎形成、细胞生长和增殖、干细胞自我更新的调节中发挥重要作用.Mel-18基因表达异常与人类肿瘤的发生、发展过程有关.作为肿瘤抑制基因,Mel-18基因通过对B淋巴瘤Mo-MLV插入区域1(Bmi-1)和髓细胞癌基因(c-myc)的转录抑制而抑制肿瘤增长.Mel-18表达在许多肿瘤细胞的转录水平和翻译水平减少,其中包括乳腺癌、前列腺癌和胃癌等肿瘤,有望成为一种新的肿瘤预后标志物.%Mel-18 gene is one of the core members of the PcG (polycomb group) family,which plays an important role in embryogenesis,cell growth and proliferation and self-renewal of stem cells.Mel-18 gene expressing abnormally has been related to human tumorigenesis,development process.Mel-18 serves as a tumor suppressor gene and inhibits tumor growth through transcriptional repression of Bmi-1 and c-myc.Mel-18 expression is decreased at transcriptional and translational levels in most human cancers including breast cancer,prostate cancer,and gastric cancer and other tumors.Mel-18 is expected to become a prognostic marker for human cancers.

  14. Pulmonary NO and C18O2 uptake during pressure-induced lung expansion in rabbits.

    Science.gov (United States)

    Heller, Hartmut; Schuster, Klaus-Dieter

    2007-01-01

    In artificially ventilated animals we investigated the dependence of the pulmonary diffusing capacities of nitric oxide (NO) and doubly 18O-labeled carbon dioxide (DLNO, DLC18O2) on lung expansion with respect to ventilator-driven increases in intrapulmonary pressure. For this purpose we applied computerized single-breath experiments to 11 anesthetized paralyzed rabbits (weight 2.8-3.8 kg) at various alveolar volumes (45-72 ml) by studying the almost entire inspiratory limb of the respective pressure/volume curves (intrapulmonary pressure: 6-27 cmH2O). The animals were ventilated with room air, employing a computerized ventilatory servo-system that we designed to maintain mechanical ventilation and to execute the particular lung function tests automatically. Each single-breath maneuver was started from residual volume (13.5+/-2 ml, mean+/-SD) by inflating the rabbit lungs with 35-55 ml indicator gas mixture containing 0.05% NO in N2 or 0.9% C18O2 in N2. Alveolar partial pressures of NO and C18O2 were measured by respiratory mass spectrometry. Values of DLNO and DLC18O2 ranged between 1.55 and 2.49 ml/(mmHg min) and 11.7 and 16.6 ml/(mmHg min), respectively. Linear regression analyses yielded a significant increase in DLNO with simultaneous increase in alveolar volume (P<0.005) and intrapulmonary pressure (P<0.023) whereas DLC18O2 was not improved. Our results suggest that the ventilator-driven lung expansion impaired the C18O2 blood uptake conductance, finally compensating for the beneficial effect of the increase in alveolar volume on DLC18O2 values.

  15. Small diameter carbon nanopipettes

    Science.gov (United States)

    Singhal, Riju; Bhattacharyya, Sayan; Orynbayeva, Zulfiya; Vitol, Elina; Friedman, Gary; Gogotsi, Yury

    2010-01-01

    Nanoscale multifunctional carbon probes facilitate cellular studies due to their small size, which makes it possible to interrogate organelles within living cells in a minimally invasive fashion. However, connecting nanotubes to macroscopic devices and constructing an integrated system for the purpose of fluid and electrical signal transfer is challenging, as is often the case with nanoscale components. We describe a non-catalytic chemical vapor deposition based method for batch fabrication of integrated multifunctional carbon nanopipettes (CNPs) with tip diameters much smaller (10-30 nm) than previously reported (200 nm and above) and approaching those observed for multiwalled carbon nanotubes. This eliminates the need for complicated attachment/assembly of nanotubes into nanofluidic devices. Variable tip geometries and structures were obtained by controlled deposition of carbon inside and outside quartz pipettes. We have shown that the capillary length and gas flow rate have a marked effect on the carbon deposition. This gives us a flexible protocol, useful for growing carbon layers of different thicknesses at selective locations on a glass pipette to yield a large variety of cellular probes in bulk quantities. The CNPs possess an open channel for fluid transfer with the carbon deposited inside at 875 °C behaving like an amorphous semiconductor. Vacuum annealing of the CNP tips at temperatures up to 2000 °C yields graphitic carbon structures with an increase in conductivity of two orders of magnitude. Penetration of the integrated carbon nanoprobes into cells was shown to produce minimal Ca2+ signals, fast recovery of basal Ca2+ levels and no adverse activation of the cellular metabolism during interrogation times as long as 0.5-1 h.

  16. Carbon Superatom Thin Films

    Energy Technology Data Exchange (ETDEWEB)

    Canning, A. [Cray Research, PSE, EPFL, 1015 Lausanne (Switzerland); Canning, A.; Galli, G. [Institut Romand de Recherche Numerique en Physique des Materiaux (IRRMA), IN-Ecublens, 1015 Lausanne (Switzerland); Kim, J. [Department of Physics, The Ohio State University, Columbus, Ohio 43210 (United States)

    1997-06-01

    We report on quantum molecular dynamics simulations of C{sub 28} deposition on a semiconducting surface. Our results show that under certain deposition conditions C{sub 28} {close_quote}s act as building blocks on a nanometer scale to form a thin film of nearly defect-free molecules. The C{sub 28} {close_quote}s behave as carbon superatoms, with the majority of them being threefold or fourfold coordinated, similar to carbon atoms in amorphous systems. The microscopic structure of the deposited film supports recent suggestions about the stability of a new form of carbon, the hyperdiamond solid. {copyright} {ital 1997} {ital The American Physical Society}

  17. Production of carbon nanotubes

    Science.gov (United States)

    Journet, C.; Bernier, P.

    Carbon nanostructures such as single-walled and multi-walled nanotubes (SWNTs and MWNTs) or graphitic polyhedral nanoparticles can be produced using various methods. Most of them are based on the sublimation of carbon under an inert atmosphere, such as the electric arc discharge process, the laser ablation method, or the solar technique. But chemical methods can also be used to synthesize these kinds of carbon materials: the catalytic decomposition of hydrocarbons, the production by electrolysis, the heat treatment of a polymer, the low temperature solid pyrolysis, or the in situ catalysis.

  18. Twelve year interannual and seasonal variability of stream carbon export from a boreal peatland catchment

    Science.gov (United States)

    Leach, J. A.; Larsson, A.; Wallin, M. B.; Nilsson, M. B.; Laudon, H.

    2016-07-01

    Understanding stream carbon export dynamics is needed to accurately predict how the carbon balance of peatland catchments will respond to climatic and environmental change. We used a 12 year record (2003-2014) of continuous streamflow and manual spot measurements of total organic carbon (TOC), dissolved inorganic carbon (DIC), methane (CH4), and organic carbon quality (carbon-specific ultraviolet absorbance at 254 nm per dissolved organic carbon) to assess interannual and seasonal variability in stream carbon export for a peatland catchment (70% mire and 30% forest cover) in northern Sweden. Mean annual total carbon export for the 12 year period was 12.2 gCm-2 yr-1, but individual years ranged between 6 and 18 gCm-2 yr-1. TOC, which was primarily composed of dissolved organic carbon (>99%), was the dominant form of carbon being exported, comprising 63% to 79% of total annual exports, and DIC contributed between 19% and 33%. CH4 made up less than 5% of total export. When compared to previously published annual net ecosystem exchange (NEE) for the studied peatland system, stream carbon export typically accounted for 12 to 50% of NEE for most years. However, in 2006 stream carbon export accounted for 63 to 90% (estimated uncertainty range) of NEE due to a dry summer which suppressed NEE, followed by a wet autumn that resulted in considerable stream export. Runoff exerted a primary control on stream carbon export from this catchment; however, our findings suggest that seasonal variations in biologic and hydrologic processes responsible for production and transport of carbon within the peatland were secondary influences on stream carbon export. Consideration of these seasonal dynamics is needed when predicting stream carbon export response to environmental change.

  19. Trisomy 18 mosaicism in a woman with normal intelligence, pigmentary dysplasia, and an 18 trisomic daughter

    Energy Technology Data Exchange (ETDEWEB)

    Ukita, Masahiko; Hasegawa, Masaaki; Nakahori, Takashi [Kurashiki Central Hospital (Japan)

    1997-01-20

    Survival beyond the age of 10 years is rare among 18-trisomic individuals. Most of these long-term survivors, when more than one tissue is studied, are normal/trisomy mosaics. They are usually mentally severely retarded with a variety of anomalies. There is another group of mosaic individuals: 7 women and a 13-year-old girl, with a low frequency of 18-trisomic cells, normal or mildly retarded intelligence, and minor anomalies. Two of them were diagnosed after delivering malformed stillborn infants. One of them was the mother of a trisomy 18 patient who was coincidentally found to have trisomy 18 mosaicism. Pigmentary dysplasia, previously called hypomelanosis of Ito, is a disorder with linear, swirly, or patchy, hypo- or hyperpigmented areas of skin, resulting from migration and interaction of melanoblasts of different pigmentary potential. The disorder is often accompanied by mosaic chromosomal abnormalities, including mosaic trisomy 18. Here we report a 26-year-old woman with low frequency trisomy 18 mosaicism, normal intelligence, and pigmentary dysplasia, who gave birth to an 18-trisomic girl. 12 refs., 1 fig.

  20. Prenatal Exposure to Carbon Black (Printex 90)

    DEFF Research Database (Denmark)

    Jackson, Petra; Vogel, Ulla; Wallin, Håkan;

    2011-01-01

    Maternal pulmonary exposure to ultrafine particles during pregnancy may affect the health of the child. Developmental toxicity of carbon black (Printex 90) nanoparticles was evaluated in a mouse model. Time-mated mice were intratracheally instilled with Printex 90 dispersed in Millipore water on ...... on gestation days (GD) 7, 10, 15 and 18, with total doses of 11, 54 and 268 mu g Printex 90/animal. The female offspring prenatally exposed to 268 mu g Printex 90/animal displayed altered habituation pattern during the Open field test....

  1. Isomer Spectrum of Small Carbon Clusters

    Institute of Scientific and Technical Information of China (English)

    SHENG Yang; LI Peng; NING Xi-Jing

    2004-01-01

    A theoretical method is developed to find isomers of cluster particles, and the isomer spectrum of carbon clusters Cn (n = 3-44) is obtained. It is found that the isomers of 3-11 atoms are in either mono-ring or line shapes,while the isomers of 12-18 atoms show flat sheet shapes. As cluster size increases, bowl isomers become more (n > 19) until cage isomers dominate the structures (n > 27). Based on the isomer spectrum, results of a previous experiment are interpreted.

  2. Boot Loader para Microcontroladores PIC serie 18

    Directory of Open Access Journals (Sweden)

    Francisco Javier Villalobos Piña

    2006-01-01

    Full Text Available El presente trabajo expone el diseño de un boot loader, programa que permanece residente en un microcontrolador PIC18F452. Dicho programa permite grabar cualquier aplicación en el PIC sin el uso de un programador. Esta ventaja, no solo facilita el diseño de aplicaciones de control digital mediante la familia 18 de Microchip, sino que evita que el procesador se monte y desmonte continuamente, debido a lo cual, disminuyen los daños que por mal manejo pudiera sufrir el procesador. Se reporta igualmente el programa en visual Delphi, que permite leer, grabar y ejecutar los archivos hexadecimales del procesador, y probar la integridad del dispositivo

  3. PET designated flouride-18 production and chemistry.

    Science.gov (United States)

    Jacobson, Orit; Chen, Xiaoyuan

    2010-01-01

    Positron emission tomography (PET) is a nuclear medicine imaging technology which allows for four-dimensional, quantitative determination of the distribution of labeled biological compounds within the human body. PET is becoming an increasingly important tool for the measurement of physiological, biochemical and pharmacological functions at the molecular level in healthy and pathological conditions. This review will focus on Flouride-18, one of the common isotopes used for PET imaging, which has a half life of 109.8 minutes. This isotope can be produced with an efficient yield in a cyclotron as a nucleophile or as an electrophile. Flouride-18 can be thereafter introduced into small molecules or biomolecules using various chemical synthetic routes, to give the desired imaging agent.

  4. Authigenic Carbonate and the History of the Global Carbon Cycle

    Science.gov (United States)

    Schrag, Daniel P.; Higgins, John. A.; Macdonald, Francis A.; Johnston, David T.

    2013-02-01

    We present a framework for interpreting the carbon isotopic composition of sedimentary rocks, which in turn requires a fundamental reinterpretation of the carbon cycle and redox budgets over Earth's history. We propose that authigenic carbonate, produced in sediment pore fluids during early diagenesis, has played a major role in the carbon cycle in the past. This sink constitutes a minor component of the carbon isotope mass balance under the modern, high levels of atmospheric oxygen but was much larger in times of low atmospheric O2 or widespread marine anoxia. Waxing and waning of a global authigenic carbonate sink helps to explain extreme carbon isotope variations in the Proterozoic, Paleozoic, and Triassic.

  5. Carbon Stock and Carbon Cycle of Wetland Ecosystem

    Institute of Scientific and Technical Information of China (English)

    Zhangquan; ZENG; Canming; ZHANG; Jiao; LI; Nan; YANG; Xihao; LI; Yandong; NIU; Zijian; WU

    2014-01-01

    Wetland ecosystem is an essential ecosystem in the world. Its organic carbon stock and carbon cycle are important basis of global carbon cycle researches and also major contents of global climate change researches. Researches have shown that wetland protection and restoration can promote carbon accumulation and reduce emission of greenhouse gases. This paper discussed influence of carbon stock and carbon balance of wetland ecosystem and emission of greenhouse gases,as well as the relationship between wetland and global climate changes. Finally,it made prospect on researches about carbon cycle of Dongting Lake.

  6. A novel carbon fiber based porous carbon monolith

    Energy Technology Data Exchange (ETDEWEB)

    Burchell, T.D.; Klett, J.W.; Weaver, C.E.

    1995-06-01

    A novel porous carbon material based on carbon fibers has been developed. The material, when activated, develops a significant micro- or mesopore volume dependent upon the carbon fiber type utilized (isotropic pitch or polyacrylonitrile). The materials will find applications in the field of fluid separations or as a catalyst support. Here, the manufacture and characterization of our porous carbon monoliths are described. A novel adsorbent carbon composite material has been developed comprising carbon fibers and a binder. The material, called carbon fiber composite molecular sieve (CFCMS), was developed through a joint research program between Oak Ridge National Laboratory (ORNL) and the University of Kentucky, Center for Applied Energy Research (UKCAER).

  7. Reference: 18 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 18 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u12566581i Kim Kyung-Nam et al. 2003 Fe...t regulates abscisic acid and cold signal transduction in Arabidopsis. 2 411-23 12566581 2003 Feb The Plant cell Cheong Yong Hwa|Grant John J|Kim Kyung-Nam|Luan Sheng|Pandey Girdhar K

  8. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Statistics JANUARY 07, 2016 Non-Fire Carbon Monoxide Deaths Associated with the Use of Consumer Products 2012 Annual Estimates OCTOBER 13, 2015 Incidents, Deaths, and In-Depth Investigations Associated with Non-Fire ...

  9. [Particle therapy: carbon ions].

    Science.gov (United States)

    Pommier, Pascal; Hu, Yi; Baron, Marie-Hélène; Chapet, Olivier; Balosso, Jacques

    2010-07-01

    Carbon ion therapy is an innovative radiation therapy. It has been first proposed in the forties by Robert Wilson, however the first dedicated centres for human care have been build up only recently in Japan and Germany. The interest of carbon ion is twofold: 1) the very sharp targeting of the tumour with the so called spread out Bragg peak that delivers most of the beam energy in the tumour and nothing beyond it, sparing very efficiently the healthy tissues; 2) the higher relative biological efficiency compared to X rays or protons, able to kill radioresistant tumour cells. Both properties make carbon ions the elective therapy for non resectable radioresistant tumours loco-regionally threatening. The technical and clinical experience accumulated during the recent decades is summarized in this paper along with a detailed presentation of the elective indications. A short comparison between conventional radiotherapy and hadrontherapy is proposed for the indications which are considered as priority for carbon ions.

  10. Global carbon budget 2014

    NARCIS (Netherlands)

    Le Quéré, C.; Moriarty, R.; Andrew, R. M.; Peters, G. P.; Ciais, P.; Friedlingstein, P.; Jones, S. D.; Sitch, S.; Tans, P.; Arneth, A.; Boden, T. A.; Bopp, L.; Bozec, Y.; Canadell, J. G.; Chevallier, F.; Cosca, C. E.; Harris, I.; Hoppema, M.; Houghton, R. A.; House, J. I.; Jain, A.; Johannessen, T.; Kato, E.; Keeling, R. F.; Kitidis, V.; Klein Goldewijk, K.; Koven, C.; Landa, C. S.; Landschützer, P.; Lenton, A.; Lima, I. D.; Marland, G.; Mathis, J. T.; Metzl, N.; Nojiri, Y.; Olsen, A.; Ono, T.; Peters, W.; Pfeil, B.; Poulter, B.; Raupach, M. R.; Regnier, P.; Rödenbeck, C.; Saito, S.; Salisbury, J. E.; Schuster, U.; Schwinger, J.; Séférian, R.; Segschneider, J.; Steinhoff, T.; Stocker, B. D.; Sutton, A. J.; Takahashi, T.; Tilbrook, B.; van der Werf, G. R.; Viovy, N.; Wang, Y.-P.; Wanninkhof, R.; Wiltshire, A.; Zeng, N.

    2015-01-01

    Accurate assessment of anthropogenic carbon dioxide (CO2)emissions and their redistribution among the atmosphere, ocean, andterrestrial biosphere is important to better understand the globalcarbon cycle, support the development of climate policies, and projectfuture climate change. Here we describe

  11. Total Ecosystem Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Total ecosystem carbon includes above- and below-ground live plant components (such as leaf, branch, stem and root), dead biomass (such as standing dead wood, down...

  12. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Community Outreach Resource Center Toy Recall Statistics CO Poster Contest Pool Safely Business & Manufacturing Business & Manufacturing Business ... Featured Resources CPSC announces winners of carbon monoxide poster contest Video View the blog Clues You Can ...

  13. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Unites States die every year from accidental non-fire related CO poisoning associated with consumer products, including ... CO Blogs Research & Statistics JANUARY 07, 2016 Non-Fire Carbon Monoxide Deaths Associated with the Use of ...

  14. Carbon Monoxide Information Center

    Science.gov (United States)

    ... and Criminal Penalties Federal Court Orders & Decisions Research & Statistics Research & Statistics Technical Reports Injury Statistics NEISS Injury Data ... On Safety Blogs: CO Safety More CO Blogs Research & Statistics JANUARY 07, 2016 Non-Fire Carbon Monoxide Deaths ...

  15. Carbon partitioning in photosynthesis.

    Science.gov (United States)

    Melis, Anastasios

    2013-06-01

    The work seeks to raise awareness of a fundamental problem that impacts the renewable generation of fuels and chemicals via (photo)synthetic biology. At issue is regulation of the endogenous cellular carbon partitioning between different biosynthetic pathways, over which the living cell exerts stringent control. The regulation of carbon partitioning in photosynthesis is not understood. In plants, microalgae and cyanobacteria, methods need be devised to alter photosynthetic carbon partitioning between the sugar, terpenoid, and fatty acid biosynthetic pathways, to lower the prevalence of sugar biosynthesis and correspondingly upregulate terpenoid and fatty acid hydrocarbons production in the cell. Insight from unusual but naturally occurring carbon-partitioning processes can help in the design of blueprints for improved photosynthetic fuels and chemicals production.

  16. Carbon Monoxide Nonattainment Areas

    Data.gov (United States)

    U.S. Environmental Protection Agency — This data layer identifies areas in the U.S. where air pollution levels have not met the National Ambient Air Quality Standards (NAAQS) for Carbon Monoxide and have...

  17. Mg/Ca and δ18O in the calcite of benthic foraminifera: does size matter?

    Science.gov (United States)

    de Nooijer, Lennart; Bijma, Jelle; -Jan Reichart, Gert; Hathorne, Ed

    2010-05-01

    Mg/Ca and del-18O are popular proxies for past sea water temperatures, ice volume and, together, salinity. The biological control that foraminifera have over calcification results in precipitation of calcium carbonate that has an isotope and element composition that is very different from those of inorganically precipitated calcium carbonates. Indications for an effect of ontogeny (i.e. size of a specimen) on the fractionation of oxygen isotopes are contradictory, while for the incorporation of most (trace) elements, data are lacking. The causes of size-based variability in element incorporation and isotope fractionation need to be understood and quantified in order to reliably use them as paleoproxies. In this study, we present Mg/Ca and oxygen isotope data from cultured specimens of the benthic foraminifer Ammonia tepida. When asexual reproduction takes place in this species, 50-300 genetically identical juveniles (i.e. clones) are produced. These juveniles are cultured at constant temperature, carbonate chemistry, salinity, etc to determine inter- and intra-specimen variability in Mg/Ca, Ba/Ca and Sr/Ca. From the same groups of clones, del-18O was determined from specimens with different sizes. Results show that the variability differs greatly between the analysed elements (e.g. relatively constant for Sr and Ba, variable for Mg) and isotopes, underscoring the need for a biological understanding of foraminiferal calcification pathways.

  18. Applications for alliform carbon

    Energy Technology Data Exchange (ETDEWEB)

    Gogotsi, Yury; Mochalin, Vadym; McDonough, IV, John Kenneth; Simon, Patrice; Taberna, Pierre Louis

    2017-02-21

    This invention relates to novel applications for alliform carbon, useful in conductors and energy storage devices, including electrical double layer capacitor devices and articles incorporating such conductors and devices. Said alliform carbon particles are in the range of 2 to about 20 percent by weight, relative to the weight of the entire electrode. Said novel applications include supercapacitors and associated electrode devices, batteries, bandages and wound healing, and thin-film devices, including display devices.

  19. Carbon footprint of thermowood

    OpenAIRE

    Nordlund, Teemu

    2013-01-01

    Purpose of this Bachelor’s Thesis was to evaluate the carbon footprint of thermally modified wood and its manufacturing process and transportation cycle for several different ThermoWood producer. Research included the whole production cycle from harvesting raw wood to ThermoWood transportation in destination area. Carbon dioxide emissions from these areas were determined and calculated for every ThermoWood producer at first hand. Calculations were based on the PAS 2050:2011, which is ...

  20. 18F-Labeled Silicon-Based Fluoride Acceptors: Potential Opportunities for Novel Positron Emitting Radiopharmaceuticals

    Directory of Open Access Journals (Sweden)

    Vadim Bernard-Gauthier

    2014-01-01

    Full Text Available Background. Over the recent years, radiopharmaceutical chemistry has experienced a wide variety of innovative pushes towards finding both novel and unconventional radiochemical methods to introduce fluorine-18 into radiotracers for positron emission tomography (PET. These “nonclassical” labeling methodologies based on silicon-, boron-, and aluminium-18F chemistry deviate from commonplace bonding of an [18F]fluorine atom (18F to either an aliphatic or aromatic carbon atom. One method in particular, the silicon-fluoride-acceptor isotopic exchange (SiFA-IE approach, invalidates a dogma in radiochemistry that has been widely accepted for many years: the inability to obtain radiopharmaceuticals of high specific activity (SA via simple IE. Methodology. The most advantageous feature of IE labeling in general is that labeling precursor and labeled radiotracer are chemically identical, eliminating the need to separate the radiotracer from its precursor. SiFA-IE chemistry proceeds in dipolar aprotic solvents at room temperature and below, entirely avoiding the formation of radioactive side products during the IE. Scope of Review. A great plethora of different SiFA species have been reported in the literature ranging from small prosthetic groups and other compounds of low molecular weight to labeled peptides and most recently affibody molecules. Conclusions. The literature over the last years (from 2006 to 2014 shows unambiguously that SiFA-IE and other silicon-based fluoride acceptor strategies relying on 18F− leaving group substitutions have the potential to become a valuable addition to radiochemistry.

  1. Normalization of stable isotope data for carbonate minerals: implementation of IUPAC guideline

    Science.gov (United States)

    Kim, Sang-Tae; Coplen, Tyler B.; Horita, Juske

    2015-01-01

    Carbonate minerals provide a rich source of geochemical information because their δ13C and δ18O values provide information about surface and subsurface Earth processes. However, a significant problem is that the same δ18O value is not reported for the identical carbonate sample when analyzed in different isotope laboratories in spite of the fact that the International Union of Pure and Applied Chemistry (IUPAC) has provided reporting guidelines for two decades. This issue arises because (1) the δ18O measurements are performed on CO2 evolved by reaction of carbonates with phosphoric acid, (2) the acid-liberated CO2 is isotopically fractionated (enriched in 18O) because it contains only two-thirds of the oxygen from the solid carbonate, (3) this oxygen isotopic fractionation factor is a function of mineralogy, temperature, concentration of the phosphoric acid, and δ18O value of water in the phosphoric acid, (4) researchers may use any one of an assortment of oxygen isotopic fractionation factors that have been published for various minerals at various reaction temperatures, and (5) it sometimes is not clear how one should calculate δ18OVPDB values on a scale normalized such that the δ18O value of SLAP reference water is −55.5 ‰ relative to VSMOW reference water.

  2. Southeast Regional Carbon Sequestration Partnership

    Energy Technology Data Exchange (ETDEWEB)

    Kenneth J. Nemeth

    2006-08-30

    The Southeast Regional Carbon Sequestration Partnership's (SECARB) Phase I program focused on promoting the development of a framework and infrastructure necessary for the validation and commercial deployment of carbon sequestration technologies. The SECARB program, and its subsequent phases, directly support the Global Climate Change Initiative's goal of reducing greenhouse gas intensity by 18 percent by the year 2012. Work during the project's two-year period was conducted within a ''Task Responsibility Matrix''. The SECARB team was successful in accomplishing its tasks to define the geographic boundaries of the region; characterize the region; identify and address issues for technology deployment; develop public involvement and education mechanisms; identify the most promising capture, sequestration, and transport options; and prepare action plans for implementation and technology validation activity. Milestones accomplished during Phase I of the project are listed below: (1) Completed preliminary identification of geographic boundaries for the study (FY04, Quarter 1); (2) Completed initial inventory of major sources and sinks for the region (FY04, Quarter 2); (3) Completed initial development of plans for GIS (FY04, Quarter 3); (4) Completed preliminary action plan and assessment for overcoming public perception issues (FY04, Quarter 4); (5) Assessed safety, regulatory and permitting issues (FY05, Quarter 1); (6) Finalized inventory of major sources/sinks and refined GIS algorithms (FY05, Quarter 2); (7) Refined public involvement and education mechanisms in support of technology development options (FY05, Quarter 3); and (8) Identified the most promising capture, sequestration and transport options and prepared action plans (FY05, Quarter 4).

  3. Digital Mapping of Soil Organic Carbon Contents and Stocks in Denmark

    DEFF Research Database (Denmark)

    Adhikari, Kabindra; Hartemink, Alfred E.; Minasny, Budiman

    2014-01-01

    Estimation of carbon contents and stocks are important for carbon sequestration, greenhouse gas emissions and national carbon balance inventories. For Denmark, we modeled the vertical distribution of soil organic carbon (SOC) and bulk density, and mapped its spatial distribution at five standard...... soil depth intervals (025, 5215, 15230, 30260 and 602 100 cm) using 18 environmental variables as predictors. SOC distribution was influenced by precipitation, land use, soil type, wetland, elevation, wetness index, and multi-resolution index of valley bottom flatness. The highest average SOC content...

  4. China’s Forests and Their Impact on Global Carbon Cycle

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Forests have multiple benefits and functions, including mitigation of climate change. The impacts of forests on the global carbon cycle include forests as carbon sinks, wood-based products as carbon sinks, bio-energy, and production and use of non-timber products. In the past decades, forest cover of China has increased from 8.6% to 18.21% by large-scale afforestation and conversion of cropland into forests. Forest biomass carbon (C) stock increased from 4.3 Pg C (1 Pg C = 1 015 g C) in the early 1980s to 5...

  5. Method for synthesizing carbon nanotubes

    Science.gov (United States)

    Fan, Hongyou

    2012-09-04

    A method for preparing a precursor solution for synthesis of carbon nanomaterials, where a polar solvent is added to at least one block copolymer and at least one carbohydrate compound, and the precursor solution is processed using a self-assembly process and subsequent heating to form nanoporous carbon films, porous carbon nanotubes, and porous carbon nanoparticles.

  6. Nano-Carbons as Theranostics

    Directory of Open Access Journals (Sweden)

    Zhuang Liu, Xing-Jie Liang

    2012-01-01

    Full Text Available Nano-carbons, including fullerenes, carbon nanoparticles, carbon nanotubes, graphene, and nano-diamonds, are an important class of nanostructures attracting tremendous interests in the past two decades. In this special issue, seven review articles and research reports are collected, to summarize and present the latest progress in the exploration of various nano-carbons for theranostic applications.

  7. Carbon based prosthetic devices

    Energy Technology Data Exchange (ETDEWEB)

    Devlin, D.J.; Carroll, D.W.; Barbero, R.S.; Archuleta, T. [Los Alamos National Lab., NM (US); Klawitter, J.J.; Ogilvie, W.; Strzepa, P. [Ascension Orthopedics (US); Cook, S.D. [Tulane Univ., New Orleans, LA (US). School of Medicine

    1998-12-31

    This is the final report of a one-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The project objective was to evaluate the use of carbon/carbon-fiber-reinforced composites for use in endoprosthetic devices. The application of these materials for the metacarpophalangeal (MP) joints of the hand was investigated. Issues concerning mechanical properties, bone fixation, biocompatibility, and wear are discussed. A system consisting of fiber reinforced materials with a pyrolytic carbon matrix and diamond-like, carbon-coated wear surfaces was developed. Processes were developed for the chemical vapor infiltration (CVI) of pyrolytic carbon into porous fiber preforms with the ability to tailor the outer porosity of the device to provide a surface for bone in-growth. A method for coating diamond-like carbon (DLC) on the articulating surface by plasma-assisted chemical vapor deposition (CVD) was developed. Preliminary results on mechanical properties of the composite system are discussed and initial biocompatibility studies were performed.

  8. Exploring cyclic changes of the ocean carbon reservoir

    Institute of Scientific and Technical Information of China (English)

    WANG Pinxian; TIAN Jun; CHENG Xinrong; LIU Quanlian; XU Jian

    2003-01-01

    A 5-Ma record from ODP Site 1143 has revealed the long-term cycles of 400-500 ka in the carbon isotope variations. The periodicity is correlatable all over the global ocean and hence indicative of low-frequency changes in the ocean carbon reservoir. As the same periodicity is also found in carbonate and eolian dust records in the tropical ocean, it may have been caused by such low-latitude processes like monsoon. According to the Quaternary records from Site 1143 and elsewhere, major ice-sheet expansion and major transition in glacial cyclicity (such as the Mid-Brunhes Event and the Mid-Pleistocene Revolution ) were all preceded by reorganization in the ocean carbon reservoir expressed as an episode of carbon isotope maximum (δ 13Cmax), implying the role of carbon cycling in modulating the glacial periodicity. The Quaternary glacial cycles, therefore, should no more be ascribed to the physical response to insolation changes at the Northern Hemisphere high latitudes alone; rather, they have been driven by the "double forcing", a combination of processes at both high and low latitudes, and of processes in both physical (ice-sheet) and biogeochemical (carbon cycling) realms. As the Earth is now passing through a new carbon isotope maximum, it is of vital importance to understand the cyclic variations in the ocean carbon reservoir and its climate impact. The Pre-Quaternary variations in carbon and oxygen isotopes are characterized by their co-variations at the 400-ka eccentricity band, but the response of δ 13C and δ 18O to orbital forcing in the Quaternary became diverged with the growth of the Arctic ice-sheet. The present paper is the second summary report of ODP Leg 184 to the South China Sea.

  9. 白细胞介素18(IL-18)的研究进展

    Institute of Scientific and Technical Information of China (English)

    刘亚普

    2008-01-01

    白细胞介素18(Interleukin-18,IL-18)最初名为干扰素诱生因子(Interferon gamma inducing factor,IGIF)或白细胞介素1r,现已了解它有重要的免疫调节和保护功能。它可诱生IFN—r及Fasl表达,增强IL-2和GM-CSF的活性,可与许多细胞因子相互作用,参与了自身免疫性疾病,变态反应性疾病的发生,在许多疾病的基础性研究和临床应用中有重要前景。现就IL-18的研究现状作一综述。

  10. Intramolecular carbon isotope distribution of acetic acid in vinegar.

    Science.gov (United States)

    Hattori, Ryota; Yamada, Keita; Kikuchi, Makiko; Hirano, Satoshi; Yoshida, Naohiro

    2011-09-14

    Compound-specific carbon isotope analysis of acetic acid is useful for origin discrimination and quality control of vinegar. Intramolecular carbon isotope distributions, which are each carbon isotope ratios of the methyl and carboxyl carbons in the acetic acid molecule, may be required to obtain more detailed information to discriminate such origin. In this study, improved gas chromatography-pyrolysis-gas chromatography-combustion-isotope ratio mass spectrometry (GC-Py-GC-C-IRMS) combined with headspace solid-phase microextraction (HS-SPME) was used to measure the intramolecular carbon isotope distributions of acetic acid in 14 Japanese vinegars. The results demonstrated that the methyl carbons of acetic acid molecules in vinegars produced from plants were mostly isotopically depleted in (13)C relative to the carboxyl carbon. Moreover, isotopic differences (δ(13)C(carboxyl) - δ(13)C(methyl)) had a wide range from -0.3 to 18.2‰, and these values differed among botanical origins, C3, C4, and CAM plants.

  11. Aspects of carbon dioxide utilization

    Energy Technology Data Exchange (ETDEWEB)

    Omae, Iwao [Omae Research Laboratories, 335-23 Mizuno, Sayama, Saitama 350-1317 (Japan)

    2006-06-30

    Carbon dioxide reacts with hydrogen, alcohols, acetals, epoxides, amines, carbon-carbon unsaturated compounds, etc. in supercritical carbon dioxide or in other solvents in the presence of metal compounds as catalysts. The products of these reactions are formic acid, formic acid esters, formamides, methanol, dimethyl carbonate, alkylene carbonates, carbamic acid esters, lactones, carboxylic acids, polycarbonate (bisphenol-based engineering polymer), aliphatic polycarbonates, etc. Especially, the productions of formic acid, formic acid methyl ester and dimethylformamide with a ruthenium catalyst; dimethyl carbonate and urethanes with a dialkyltin catalyst; 2-pyrone with a nickel-phosphine catalyst; diphenyl carbonate with a lead phenoxide catalyst; the alternating copolymerization of carbon dioxide and epoxides with a zinc catalyst has attracted attentions as the industrial utilizations of carbon dioxide. The further development of these production processes is expected. (author)

  12. Automated Synthesis of 18F Analogue of Paclitaxel (PAC): [18F]Paclitaxel (FPAC)

    OpenAIRE

    2006-01-01

    A positron-emitting paclitaxel (PAC) derivative could allow in-vivo measurement of multidrug resistance in tumors and, therefore, predict a potential chemotherapeutic benefit to patients. [18F]Paclitaxel was produced using a 2-reaction vessel automated synthesizer followed by HPLC purification. Optimized reaction conditions resulted in radiochemical yields of 21.2 ± 9.6% at end of bombardment, radiochemical purity > 99%, and specific activity of 159 ± 43 GBq/μmol. [18F]Paclitaxel activities o...

  13. Temporal and spatial heterogeneity in lacustrine δ13CDIC and δ18ODO signatures in a large mid-latitude temperate lake

    Directory of Open Access Journals (Sweden)

    Jane DRUMMOND

    2010-08-01

    Full Text Available Modelling limnetic carbon processes is necessary for accurate global carbon models and stable isotope analysis can provide additional insight of carbon flow pathways. This research examined the spatial and temporal complexity of carbon cycling in a large temperate lake. Dissolved inorganic carbon (DIC is utilised by photosynthetic organisms and dissolved oxygen (DO is used by heterotrophic organisms during respiration. Thus the spatial heterogeneity in the pelagic metabolic balance in Loch Lomond, Scotland was investigated using a combined natural abundance isotope technique. The isotopic signatures of dissolved inorganic carbon (δ13CDIC and dissolved oxygen (δ18ODO were measured concurrently on four different dates between November 2004 and September 2005. We measured isotopic variation over small and large spatial scales, both horizontal distance and depth. δ13CDIC and δ18ODO changed over a seasonal cycle, becoming concurrently more positive (negative in the summer (winter months, responding to increased photosynthetic and respiratory rates, respectively. With increasing depth, δ13CDIC became more negative and δ18ODO more positive, reflecting the shift to a respiration-dominated system. The horizontal distribution of δ13CDIC and δ18ODO in the epilimnion was heterogeneous. In general, the south basin had the most positive δ13CDIC, becoming more negative with increasing latitude, except in winter when the opposite pattern was observed. Areas of local variation were often observed near inflows. Clearly δ13CDIC and δ18ODO can show large spatial heterogeneity, as a result of varying metabolic balance coupled with inflow proximity and thus single point sampling to extrapolate whole lake metabolic patterns can result in error when modelling large lake systems Whilst we advise caution when using single point representation, we also show that this combined isotopic approach has potential to assist in constructing detailed lake carbon models.

  14. Organic modification of carbon nanotubes

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The organic modification of carbon nanotubes is a novel research field being developed recently. In this article, the history and newest progress of organic modification of carbon nanotubes are reviewed from two aspects:organic covalent modification and organic noncovalent modification of carbon nanotubes. The preparation and properties of organic modified carbon nanotubes are discussed in detail. In addition, the prospective development of organic modification of carbon nanotubes is suggested.

  15. Constant composition kinetics study of carbonated apatite dissolution

    Science.gov (United States)

    Tang, Ruikang; Henneman, Zachary J.; Nancollas, George H.

    2003-03-01

    The carbonated apatites (CAP) may be more suitable models for biominerals such as bone and dental hard tissues than is pure hydroxyapatite (HAP) since they have similar chemical compositions. Although they contain only a relatively small amount of carbonate, the solubility and dissolution properties are different. The solubility product of the CAP particles used in this dissolution study, 2.88×10 -112 mol 18 l -18, was significantly greater than that of HAP, 5.52×10 -118 mol 18 l -18. The kinetics of dissolution of CAP has been studied using the constant composition (CC) method. At low undersaturations, the dissolution reaction appeared to be controlled mainly by surface diffusion with an effective reaction order of 1.9±0.1 with respect to the relative undersaturation. These results together with those obtained by scanning electron microscopy (SEM) suggest a dissolution model. Based on the surface diffusion theory of Burton, Cabrera and Frank (BCF). The interfacial tension between CAP and the aqueous phase calculated from this dissolution model, 9.0 m J m -2, was consistent with its relatively low solubility. An abnormal but interesting dissolution behavior is that the CAP dissolution rate was relatively insensitive to changes in calcium and phosphate concentrations at higher undersaturations, suggesting the importance of the carbonate component under these conditions.

  16. Implications of carbon dust emission for terrestrail carbon cycling and carbon accounting

    Science.gov (United States)

    Wind erosion preferentially removes the finest carbon- and nutrient-rich soil fractions, and consequently its role may be significant within terrestrial carbon (C) cycles. However, the impacts of wind erosion on soil organic carbon (SOC) redistribution are not considered in most carbon cycle models,...

  17. Fabrication of carbon/SiO2 composites from the hydrothermal carbonization process of polysaccharide and their adsorption performance.

    Science.gov (United States)

    Li, Yinhui; Li, Kunyu; Su, Min; Ren, Yanmei; Li, Ying; Chen, Jianxin; Li, Liang

    2016-11-20

    In this work, carbon/SiO2 composites, using amylose and tetraethyl orthosilicate (TEOS) as raw materials, were successfully prepared by a facial hydrothermal carbonization process. The carbon/SiO2 composites were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), Energy Dispersive Spectroscopy (EDS), transmission electron microscope (TEM), N2 adsorption and Thermogravimetric (TG) analysis. The composites, which were made up of amorphous SiO2 and amorphous carbon, were found to have hierarchical porous structures. The mass ratios of amylose and SiO2 and the hydrothermal carbonization time had significant effects on the morphology of the composites, which had three shapes including monodispersed spheres, porous pieces and the nano-fibers combined with nano-spheres structures. The adsorption performance of the composites was studied using Pb(2+) as simulated contaminants from water. When the mass ratio of amylose and SiO2 was 9/1, the hydrothermal time was 30h and the hydrothermal temperature was 180°C, the adsorption capacity of the composites achieved to 52mg/g. Experimental data show that adsorption kinetics of the carbon/SiO2 composites can be fitted well by the Elovich model, while the isothermal data can be perfectly described by the Langmuir adsorption model and Freundlich adsorption model. The maximum adsorption capacity of the carbon/SiO2 composites is 56.18mgg(-1).

  18. [{sup 18}F]FE-SUPPY and [{sup 18}F]FE-SUPPY:2 - metabolic considerations

    Energy Technology Data Exchange (ETDEWEB)

    Haeusler, Daniela [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Dept. of Pharmaceutical Technology and Biopharmaceutics, Univ. of Vienna, A-1090 Vienna (Austria); Nics, Lukas [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Dept. of Nutritional Sciences, Univ. of Vienna, A-1090 Vienna (Austria); Mien, Leonhard-Key [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Dept. of Pharmaceutical Technology and Biopharmaceutics, Univ. of Vienna, A-1090 Vienna (Austria); Ungersboeck, Johanna [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Dept. of Inorganic Chemistry, Univ. of Vienna, A-1090 Vienna (Austria); Lanzenberger, Rupert R. [Dept. of Psychiatry and Psychotherapy, Medical Univ. of Vienna, A-1090 Vienna (Austria); Shanab, Karem [Dept. of Drug and Natural Product Synthesis, Univ. of Vienna, A-1090 Vienna (Austria); Sindelar, Karoline M. [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Viernstein, Helmut [Dept. of Pharmaceutical Technology and Biopharmaceutics, Univ. of Vienna, A-1090 Vienna (Austria); Wagner, Karl-Heinz [Dept. of Nutritional Sciences, Univ. of Vienna, A-1090 Vienna (Austria); Dudczak, Robert; Kletter, Kurt [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Wadsak, Wolfgang [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Dept. of Inorganic Chemistry, Univ. of Vienna, A-1090 Vienna (Austria); Mitterhauser, Markus [Dept. of Nuclear Medicine, Medical Univ. of Vienna, A-1090 Vienna (Austria); Dept. of Pharmaceutical Technology and Biopharmaceutics, Univ. of Vienna, A-1090 Vienna (Austria); Hospital Pharmacy of the General Hospital of Vienna, A-1090 Vienna (Austria)], E-mail: markus.mitterhauser@meduniwien.ac.at

    2010-05-15

    Introduction: Recently, [{sup 18}F]FE-SUPPY and [{sup 18}F]FE-SUPPY:2 were introduced as the first positron emission tomography (PET) tracers for the adenosine A{sub 3} receptor. Thus, aim of the present study was the metabolic characterization of the two adenosine A{sub 3} receptor PET tracers. Methods: In vitro carboxylesterase (CES) experiments were conducted using incubation mixtures containing different concentrations of the two substrates, porcine CES and phosphate-buffered saline. Enzymatic reactions were stopped by adding acetonitrile/methanol (10:1) after various time points and analyzed by a high-performance liquid chromatography (HPLC) standard protocol. In vivo experiments were conducted in male wild-type rats; tracers were injected through a tail vein. Rats were sacrificed after various time points (n=3), and blood and brain samples were collected. Sample cleanup was performed by an HPLC standard protocol. Results: The rate of enzymatic hydrolysis by CES demonstrated Michaelis-Menten constants in a micromolar range (FE-SUPPY, 20.15 {mu}M, and FE-SUPPY:2, 13.11 {mu}M) and limiting velocities of 0.035 and 0.015 {mu}M/min for FE-SUPPY and FE-SUPPY:2, respectively. Degree of metabolism in blood showed the following: 15 min pi 47.7% of [{sup 18}F]FE-SUPPY was intact compared to 33.1% of [{sup 18}F]FE-SUPPY:2; 30 min pi 30.3% intact [{sup 18}F]FE-SUPPY was found compared to 15.6% [{sup 18}F]FE-SUPPY:2. In brain, [{sup 18}F]FE-SUPPY:2 formed an early hydrophilic metabolite, whereas metabolism of [{sup 18}F]FE-SUPPY was not observed before 30 min pi Conclusion: Knowing that metabolism in rats is several times faster than in human, we conclude that [{sup 18}F]FE-SUPPY should be stable for the typical time span of a clinical investigation. As a consequence, from a metabolic point of view, one would tend to decide in favor of [{sup 18}F]FE-SUPPY.

  19. Measurement of carbon capture efficiency and stored carbon leakage

    Science.gov (United States)

    Keeling, Ralph F.; Dubey, Manvendra K.

    2013-01-29

    Data representative of a measured carbon dioxide (CO.sub.2) concentration and of a measured oxygen (O.sub.2) concentration at a measurement location can be used to determine whether the measured carbon dioxide concentration at the measurement location is elevated relative to a baseline carbon dioxide concentration due to escape of carbon dioxide from a source associated with a carbon capture and storage process. Optionally, the data can be used to quantify a carbon dioxide concentration increase at the first location that is attributable to escape of carbon dioxide from the source and to calculate a rate of escape of carbon dioxide from the source by executing a model of gas-phase transport using at least the first carbon dioxide concentration increase. Related systems, methods, and articles of manufacture are also described.

  20. SiC fibers with controllable thickness of carbon layer prepared directly by preceramic polymer pyrolysis routes

    Energy Technology Data Exchange (ETDEWEB)

    Hu Tianjiao, E-mail: tjhu617@gmail.com [College of Science, National University of Defense Technology, Changsha 410073 (China); Li Xiaodong; Li Gongyi [College of Science, National University of Defense Technology, Changsha 410073 (China); Wang Yingde; Wang Jun [State Key Laboratory of Advanced Ceramic Fibers and Composites, College of Aerospace and Materials Engineering, National University of Defense Technology, Changsha 410073 (China)

    2011-05-25

    Continuous SiC fibers with different thickness of carbon layer were prepared through three preceramic polymer pyrolysis routes. To make the carbon layer thickness controllable, a simple improvement by using a ceramic bushing was adopted to retard the deposition of the pyrolytic carbons. Auger electron spectroscopy (AES) analysis reveals that the carbon layer thickness varies from less than 5 nm to 40 nm. The specific resistivity of the fibers increases by 5 orders of magnitude as the carbon layer thickness decreases. All of the fibers exhibit a tensile strength of around 1.8 GPa which is independent of the carbon layer thickness. The formation process of the carbon layer is discussed in three steps: the decomposition, the carbonization and the deposition. The as-received fibers have a potential application as the reinforcement of functional materials.

  1. APRESENTAÇÃO N. 18

    OpenAIRE

    *** Os Editores da Prometeus

    2015-01-01

    A Prometeus chega ao seu número 18 em seu oitavo ano. Neste número temos as destacadas contribuições de Gabriele Cornelli, Rodolfo Lopes, Roberto Zarco, Rafael Huguenin e Luiz Bicca, além de uma série de outros excelentes artigos. Apresentamos também duas resenhas. A edição se encerra com uma tradução (feita por Rafael Huguenin e  Rodrigo Brito) de pare de 'Contra os Astrólogos', de Sexto Empírico Desejamos que os pesquisadores se beneficiem com os trabalhos que selecionamos. Agra...

  2. Microbially mediated carbon mineralization: Geoengineering a carbon-neutral mine

    Science.gov (United States)

    Power, I. M.; McCutcheon, J.; Harrison, A. L.; Wilson, S. A.; Dipple, G. M.; Southam, G.

    2013-12-01

    Ultramafic and mafic mine tailings are a potentially valuable feedstock for carbon mineralization, affording the mining industry an opportunity to completely offset their carbon emissions. Passive carbon mineralization has previously been documented at the abandoned Clinton Creek asbestos mine, and the active Diavik diamond mine and Mount Keith nickel mine, yet the majority of tailings remain unreacted. Examples of microbe-carbonate interactions at each mine suggest that biological pathways could be harnessed to promote carbon mineralization. In suitable environmental conditions, microbes can mediate geochemical processes to accelerate mineral dissolution, increase the supply of carbon dioxide (CO2), and induce carbonate precipitation, all of which may accelerate carbon mineralization. Tailings mineralogy and the availability of a CO2 point source are key considerations in designing tailings storage facilities (TSF) for optimizing carbon mineralization. We evaluate the efficacy of acceleration strategies including bioleaching, biologically induced carbonate precipitation, and heterotrophic oxidation of waste organics, as well as abiotic strategies including enhancing passive carbonation through modifying tailings management practices and use of CO2 point sources (Fig. 1). With the aim of developing carbon-neutral mines, implementation of carbon mineralization strategies into TSF design will be driven by economic incentives and public pressure for environmental sustainability in the mining industry. Figure 1. Schematic illustrating geoengineered scenarios for carbon mineralization of ultramafic mine tailings. Scenarios A and B are based on non-point and point sources of CO2, respectively.

  3. Carbon and water fluxes from ponderosa pine forests disturbed by wildfire and thinning.

    Science.gov (United States)

    Dore, S; Kolb, T E; Montes-Helu, M; Eckert, S E; Sullivan, B W; Hungate, B A; Kaye, J P; Hart, S C; Koch, G W; Finkral, A

    2010-04-01

    Disturbances alter ecosystem carbon dynamics, often by reducing carbon uptake and stocks. We compared the impact of two types of disturbances that represent the most likely future conditions of currently dense ponderosa pine forests of the southwestern United States: (1) high-intensity fire and (2) thinning, designed to reduce fire intensity. High-severity fire had a larger impact on ecosystem carbon uptake and storage than thinning. Total ecosystem carbon was 42% lower at the intensely burned site, 10 years after burning, than at the undisturbed site. Eddy covariance measurements over two years showed that the burned site was a net annual source of carbon to the atmosphere whereas the undisturbed site was a sink. Net primary production (NPP), evapotranspiration (ET), and water use efficiency were lower at the burned site than at the undisturbed site. In contrast, thinning decreased total ecosystem carbon by 18%, and changed the site from a carbon sink to a source in the first posttreatment year. Thinning also decreased ET, reduced the limitation of drought on carbon uptake during summer, and did not change water use efficiency. Both disturbances reduced ecosystem carbon uptake by decreasing gross primary production (55% by burning, 30% by thinning) more than total ecosystem respiration (TER; 33-47% by burning, 18% by thinning), and increased the contribution of soil carbon dioxide efflux to TER. The relationship between TER and temperature was not affected by either disturbance. Efforts to accurately estimate regional carbon budgets should consider impacts on carbon dynamics of both large disturbances, such as high-intensity fire, and the partial disturbance of thinning that is often used to prevent intense burning. Our results show that thinned forests of ponderosa pine in the southwestern United States are a desirable alternative to intensively burned forests to maintain carbon stocks and primary production.

  4. Detection of C3O in the low-mass protostar Elias 18

    CERN Document Server

    Palumbo, M E; Siringo, C; Trigilio, C

    2008-01-01

    We have performed new laboratory experiments which gave us the possibility to obtain an estimate of the amount of carbon chain oxides (namely C3O2, C2O, and C3O) formed after irradiation (with 200 keV protons) of pure CO ice, at 16 K. The analysis of laboratory data indicates that in dense molecular clouds, when high CO depletion occurs, an amount of carbon chain oxides as high as 2-3x10^-3 with respect to gas phase carbon monoxide can be formed after ion irradiation of icy grain mantles. Then we have searched for gas phase C2O and C3O towards ten low-mass young stellar objects. Among these we have detected the C3O line at 38486.891 MHz towards the low-mass protostar Elias 18. On the basis of the laboratory results we suggest that in dense molecular clouds gas phase carbon chain oxides are formed in the solid phase after cosmic ion irradiation of CO-rich icy mantles and released to the gas phase after desorption of icy mantles. We expect that the Atacama Large Millimeter Array (ALMA), thanks to its high sensi...

  5. 19 CFR 18.45 - Supervision of exportation.

    Science.gov (United States)

    2010-04-01

    ... Control Exported Under Cover of A Tir Carnet § 18.45 Supervision of exportation. The provisions of §§ 18.41 through 18.44 do not require the director of the port of actual exportation to verify that... 19 Customs Duties 1 2010-04-01 2010-04-01 false Supervision of exportation. 18.45 Section...

  6. 49 CFR 18.44 - Termination for convenience.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Termination for convenience. 18.44 Section 18.44 Transportation Office of the Secretary of Transportation UNIFORM ADMINISTRATIVE REQUIREMENTS FOR GRANTS AND... Enforcement § 18.44 Termination for convenience. Except as provided in § 18.43 awards may be terminated...

  7. Exon: CBRC-DRER-18-0131 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-18-0131 ccaaccaaccgaccaaccgaccaaccaaccaacctacacaatcagccaaccaaccaaccaaccaaccaacca...aacaacacaatcgttcaaccaaccaaccaaccaaccaactcaatcagccaaccaaccaaccaaacaaccaaacaaccgacacaatcattcaaccaaccaaccaacttaatcagcgaaccaacca...accaaccaaccaacctacacaatcagccaaccaaccaaccgaccaaccaaccaaccaacacaatcgttcaaccaaccaaccaaacaaccaaacaaccaacca...accgacacaatcgttcaaccaaccaaccaacttaatcagcgaaccaaccaaccaaccaaccgaccaaccaaccaaccaaccaaccaaccaaccaaccaaccaactcaattag ...

  8. Exon: CBRC-RNOR-18-0082 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-18-0082 CTGCCATTaccaccaccaccaccaccaccaccatcaccaccaccaccatcactaccatcatcaccactatcaccaccaccagcaccacca...ccactatcaccaccattatcaccacatcaccaccaccagcaccaccatcaccaccaccatcaccaccaccactatcactatcaccagtacctccaccaccaccaNNNN ...

  9. Leaf morphological effects predict effective path length and enrichment of 18O in leaf water of different Eucalyptus species

    Science.gov (United States)

    Kahmen, A.; Merchant, A.; Callister, A.; Dawson, T. E.; Arndt, S. K.

    2006-12-01

    Stable isotopes have been a valuable tool to study water or carbon fluxes of plants and ecosystems. In particular oxygen isotopes (δ18O) in leaf water or plant organic material are now beginning to be established as a simple and integrative measure for plant - water relations. Current δ18O models, however, are still limited in their application to a broad range of different species and ecosystems. It remains for example unclear, if species-specific effects such as different leaf morphologies need to be included in the models for a precise understanding and prediction of δ18O signals. In a common garden experiment (Currency Creek Arboretum, South Australia), where over 900 different Eucalyptus species are cultivated in four replicates, we tested effects of leaf morphology and anatomy on δ18O signals in leaf water of 25 different species. In particular, we determined for all species enrichment in 18O of mean lamina leaf water above source water (Δ18O) as related to leaf physiology as well as leaf thickness, leaf area, specific leaf area and weight and selected anatomical properties. Our data revealed that diurnal Δ18O in leaf water at steady state was significantly different among the investigated species and with differences up to 10% at midday. Fitting factors (effective path length) of leaf water Δ18O models were also significantly different among the investigated species and were highly affected by species-specific morphological parameters. For example, leaf area explained a high percentage of the differences in effective path length observed among the investigated species. Our data suggest that leaf water δ18O can act as powerful tool to estimate plant - water relations in comparative studies but that additional leaf morphological parameters need to be considered in existing δ18O models for a better interpretation of the observed δ18O signals.

  10. The clumped isotopic record of Neoproterozoic carbonates, Sultanate of Oman

    Science.gov (United States)

    Bergmann, K. D.; Eiler, J. M.; Fischer, W. W.; Osburn, M. R.; Grotzinger, J. P.

    2011-12-01

    The Huqf Supergroup of the Sultanate of Oman records several important events in latest Precambrian time, including two glaciations in the Abu Mahara Group (ca. 725 - isotope excursion in the Nafun Group (ca. isotopic excursions, hypothesized to record perturbations of the surficial Earth carbon cycle or post-depositional diagenetic processes. Rigorous interpretation of these records requires a more thorough assessment of diagenetic processes. To better understand the significance and cause of these large amplitude isotopic excursions, we employed carbonate clumped isotope thermometry. This method allows us to estimate the absolute temperature of carbonate precipitation, including recrystallization, based on the temperature dependent abundance of carbonate ions containing both 13C and 18O. These estimates are accompanied by a measurement of carbonate δ18O, which in conjunction with temperature, can be used to calculate the oxygen isotopic composition of the fluid from which the carbonate precipitated. We analyzed stratigraphically constrained samples from a range of paleoenvironments with differing burial histories (1 - >10km maximum burial depth) to constrain the temperature and fluid composition of recrystallization. Clumped isotope temperatures from Huqf Supergroup samples range from 35-175°C. The isotopic composition of the fluid these rocks equilibrated with ranges from -3.7 to 15.7% VSMOW. This large range in temperature and fluid composition separates into distinct populations that differ systematically with independent constraints on petrography, stratigraphy and burial history. The data indicate the Abu Mahara, Nafun and Ara groups have unique diagenetic histories. In central Oman, the post-glacial Abu Mahara cap dolostone shows high temperature, rock buffered diagenesis (Tavg = 176°C; δ18Ofluid = 15% VSMOW), the Nafun Group generally experienced lower temperature, fluid buffered diagenesis (Tavg = 69°C; δ18Ofluid = 1% VSMOW) and the Ara Group

  11. LED-based Fourier transform spectroscopy of 16O12C18O and 12C18O2 in the 11,260-11,430 cm-1 range

    Science.gov (United States)

    Serdyukov, V. I.; Sinitsa, L. N.; Lugovskoi, A. A.; Borkov, Yu. G.; Tashkun, S. A.; Perevalov, V. I.

    2016-07-01

    The absorption spectrum of the 16O12C18O and 12C18O2 carbon dioxide isotopologues has been recorded in the 11,260- 11,430 cm-1 spectral range using Bruker IFS 125 HR Fourier transform spectrometer with resolution 0.05 cm-1 at temperature 297 K and path length 24 m. The 18O enriched sample of carbon dioxide at total pressure 96.5 mbar was used for these purposes. The spectrometer used LED emitter as a light source. This gave possibility to reach the minimal detectable absorption coefficient αmin~1.4×10-7 cm-1 using 23,328 scans. In the recorded spectrum we have assigned the 00051-00001 band for both 16O12C18O and 12C18O2 isotopologues using the predictions performed within the framework of the method of effective operators. The line positions and intensities of the observed bands are found. The comparison of the observed and predicted line positions and intensities is performed confirming good accuracy of the predictions. The spectroscopic parameters for the observed bands are determined.

  12. Recombinant chromosome 18 resulting from a maternal pericentric inversion

    Energy Technology Data Exchange (ETDEWEB)

    Ayukawa, Hiroshi; Tsukahara, Masato; Fukuda, Masamichi; Kondoh, Osamu [Yamaguchi Univ. School of Medicine (Japan)

    1994-05-01

    We report on a newborn girl with duplication of 18q12.2{yields}18 qter and deficiency of 18p11.2{yields}18pter which resulted from meiotic recombination of the maternal pericentric inversion, inv(18)(p11.2q12.2). Her clinical manifestations were compatible with those of partial trisomy 18q syndrome. We review the previously reported 9 cases in 8 families of rec(18) resulting from recombination of a parental pericentric inversion. 8 refs., 3 figs., 1 tab.

  13. Terrestrial Carbon Cycle Variability

    Science.gov (United States)

    Baldocchi, Dennis; Ryu, Youngryel; Keenan, Trevor

    2016-01-01

    A growing literature is reporting on how the terrestrial carbon cycle is experiencing year-to-year variability because of climate anomalies and trends caused by global change. As CO 2 concentration records in the atmosphere exceed 50 years and as satellite records reach over 30 years in length, we are becoming better able to address carbon cycle variability and trends. Here we review how variable the carbon cycle is, how large the trends in its gross and net fluxes are, and how well the signal can be separated from noise. We explore mechanisms that explain year-to-year variability and trends by deconstructing the global carbon budget. The CO 2 concentration record is detecting a significant increase in the seasonal amplitude between 1958 and now. Inferential methods provide a variety of explanations for this result, but a conclusive attribution remains elusive. Scientists have reported that this trend is a consequence of the greening of the biosphere, stronger northern latitude photosynthesis, more photosynthesis by semi-arid ecosystems, agriculture and the green revolution, tropical temperature anomalies, or increased winter respiration. At the global scale, variability in the terrestrial carbon cycle can be due to changes in constituent fluxes, gross primary productivity, plant respiration and heterotrophic (microbial) respiration, and losses due to fire, land use change, soil erosion, or harvesting. It remains controversial whether or not there is a significant trend in global primary productivity (due to rising CO 2, temperature, nitrogen deposition, changing land use, and preponderance of wet and dry regions). The degree to which year-to-year variability in temperature and precipitation anomalies affect global primary productivity also remains uncertain. For perspective, interannual variability in global gross primary productivity is relatively small (on the order of 2 Pg-C y -1) with respect to a large and uncertain background (123 +/- 4 Pg-C y -1), and

  14. Silicon-[18F]Fluorine Radiochemistry: Basics, Applications and Challenges

    Directory of Open Access Journals (Sweden)

    Carmen Wängler

    2012-03-01

    Full Text Available Silicon-[18F]fluorine (Si-18F radiochemistry has recently emerged alongside other unconventional approaches such as aluminum-18F and boron-18F based labeling strategies, reshaping the landscape of modern 18F-radiochemistry. All these novel methodologies are driven by the demand for more convenient 18F-labeling procedures to further disseminate one of the most sophisticated imaging technologies, Positron Emission Tomography (PET. The PET methodology requires special radionuclides such as 18F (one of the most prominent examples to be introduced into bioactive molecules. Si-18F radiochemistry contributed greatly towards the development of new radiopharmaceuticals for PET imaging. Herein, we describe the radiochemical basics of Si-18F bond formation, the application of Si-18F tracers for PET imaging, and additionally, the inherent chemical intricacies of this methodology.

  15. Carbon fuel particles used in direct carbon conversion fuel cells

    Science.gov (United States)

    Cooper, John F.; Cherepy, Nerine

    2012-10-09

    A system for preparing particulate carbon fuel and using the particulate carbon fuel in a fuel cell. Carbon particles are finely divided. The finely dividing carbon particles are introduced into the fuel cell. A gas containing oxygen is introduced into the fuel cell. The finely divided carbon particles are exposed to carbonate salts, or to molten NaOH or KOH or LiOH or mixtures of NaOH or KOH or LiOH, or to mixed hydroxides, or to alkali and alkaline earth nitrates.

  16. Carbon Concentration of Austenite

    Directory of Open Access Journals (Sweden)

    Z. Ławrynowicz

    2007-07-01

    Full Text Available The investigation was carried out to examine the influence of temperature and times of austempering process on the maximum extend towhich the bainite reaction can proceed and the carbon content in retained austenite. It should be noted that a small percentage change in theaustenite carbon content can have a significant effect on the subsequent austempering reaction changing the volume fraction of the phasespresent and hence, the resulting mechanical properties. Specimens were prepared from an unalloyed ductile cast iron, austenitised at 950oCfor 60 minutes and austempered by the conventional single-step austempering process at four temperatures between BS and MS, eg., 250,300, 350 and 400oC. The samples were austempered at these temperatures for 15, 30, 60, 120 and 240 minutes and finally quenched toambient temperature. Volume fractions of retained austenite and carbon concentration in the residual austenite have been observed byusing X-ray diffraction. Additionally, carbon concentration in the residual austenite was calculated using volume fraction data of austeniteand a model developed by Bhadeshia based on the McLellan and Dunn quasi-chemical thermodynamic model. The comparison ofexperimental data with the T0, T0' and Ae3' phase boundaries suggests the likely mechanism of bainite reaction in cast iron is displacive rather than diffusional. The carbon concentration in retained austenite demonstrates that at the end of bainite reaction the microstructure must consist of not only ausferrite but additionally precipitated carbides.

  17. Overview of International Energy Agency Annex 18 on evaluation of integrated hydrogen energy systems

    Energy Technology Data Exchange (ETDEWEB)

    Miles, S. [Natural Resources Canada, Ottawa, ON (Canada); Schoenung, S. [Longitude 122 West Inc., Menlo Park, CA (United States); Dube, J. [Services Mij Inc., Ste. Thecle, Quebec, (Canada); Ulleberg, O. [Inst. of Energy Technology, Halden (Norway); Weeda, M. [Energy Research Center of the Netherlands, Petten (Netherlands)

    2007-07-01

    Hydrogen and fuel cell technologies have the potential to break the link between transportation and carbon dioxide emissions. As part of Annex 18, the International Energy Agency (IEA) provides information about hydrogen integration into society by providing data and analysis to the hydrogen community; evaluating hydrogen demonstration projects in member countries; and, synthesizing the lessons learned from projects. This paper presented projects that were motivated by the use of clean, renewable energy to produce hydrogen with reduced carbon emissions. Annex 18 has been underway since January 2003. Demonstration systems involving vehicle refuelling stations and electric power systems in different member countries were evaluated in the first phase of Annex 18 through detailed modeling and documentation. These projects included hydrogen refueling stations in Sweden, Iceland and Canada; a PV/MH-telecom showcase in Madrid, Spain; a regenerative PEM FC-power system in Aichi, Japan; a hydrogen and renewables integration (HARI) system in Leistershire, United Kingdom; a hydrogen from the sun/ecological house in Brunate, Italy; an RES2H2 wind-hydrogen project in Athens, Greece; a combined wind/hydrogen desalination plant in the Canary Islands, Spain; a renewable hydrogen system at a remote site Totara Valley, New Zealand; and, a hydrogen power park with combined wind and geothermal electricity generation in Hawaii, United States. Phase 2 and is now scheduled to continue through December 2009. It will involve an accounting of the emissions in order to quantify the carbon reductions. Participants will continue to evaluate the performance of these demonstration systems and determine how the use of hydrogen can mitigate climate change in the future. The final phase will determine best practices and general lessons learned regarding the commercialization and operation of integrated hydrogen systems. 7 refs., 2 tabs., 13 figs.

  18. Nutritional quality of 18 date fruit varieties.

    Science.gov (United States)

    Habib, Hosam M; Ibrahim, Wissam H

    2011-08-01

    The aim of the present study was to analyze and compare the chemical and physical properties of 18 varieties of the date fruits from date palm (Phoenix dactylifera), which are regarded as popular fruit commodities among the populace of the Middle Eastern peninsula. Dietary fiber, proximate analysis, micronutrients (micro-elements and macro-elements) and physical properties (weight, length, and density) of the selected 18 leading varieties of dates cultivated in the United Arab Emirates-namely Khalas, Barhe, Lulu, Shikat alkahlas, Sokkery, Bomaan, Sagay, Shishi, Maghool, Sultana, Fard, Maktoomi, Naptit saif, Jabri, Khodary, Dabbas, Raziz and Shabebe-were determined and compared. Significant differences (P date fruits, depending on the variety, contain significant but quite variable amounts of macro-elements and micro-elements. The macro-elements measured are calcium, phosphorous, sodium, potassium and magnesium, while the essential micro-elements and the possibly essential micro-elements are iron, zinc, copper, manganese, cobalt and molybdenum, and aluminum, arsenic, barium, cadmium, chromium, nickel, lead, strontium and vanadium, respectively.

  19. Temporal dynamics and sPatial variations of forest vegetation carbon stock in Liaoning Province, China

    Institute of Scientific and Technical Information of China (English)

    LI Qing; TANG Li-Na; REN Yin

    2011-01-01

    There are many uncertainties in the estimation of forest carbon sequestration in China,especially in Liaoning Province where various forest inventory data have not been fully utilized.By using forest inventory data,we estimated forest vegetation carbon stock of Liaoning Province between 1993 and 2005.Results showed that forest biomass carbon stock increased from 68.91 Tg C in 1993 to 97.51 Tg C in 2005,whereas mean carbon density increased from 18.48 Mg.ha-1 C to 22.33 Mg·ha-1 C.The carbon storage of young- and middle-aged forests increased by 22.1 Tg C and 5.95 Tg C,but that of mature forests has decreased by 0.25 Tg C.The carbon stock and density of forests in Liaoning Province varied greatly in space:larger carbon storage and higher carbon density were primarily found in the east area.The spatial distribution of carbon density was determined by many factors,of which human activities played an important role.The forests in Liauning Province played a positive role as a sink of atmospheric carbon dioxide.The carbun fixation ability of forests in this area was primarily derived from forest plantation and the total forest carbon sequestration can be enhanced by expanding young- and middle-aged forests.

  20. Tackling conference carbon footprints

    Science.gov (United States)

    Grozier, Jim

    2016-12-01

    In reply to Margaret Harris's Lateral Thoughts article "Putting my foot down", which discussed the challenges of attending a conference with a physical disability (October p76) and a subsequent letter by Anna Wood (November p18).