WorldWideScience

Sample records for carbon 18

  1. The Reactions of Hot Fluorine-18 with Gaseous Carbon Tetrafluoride

    International Nuclear Information System (INIS)

    Studies on the reactions of hot Fie atoms with carbon tetrafluoride are reported. Gaseous samples were exposed to the 40-60 MeV (maximum) bremsstrahlung beam of the Yale University Electron Accelerator. The F19 (γ, n) F18 process produces F18 with a kinetic energy of the order of 105-106 eV. These species lose energy by collision and are expected to reach the ''chemical'' energy range (18 atoms. Analysis of products was made using standard radio-gas chromatography techniques. The system was found to be quite sensitive to extraneous radiation damage effects and appropriate precautions were taken. Hot displacement reactions, similar to those observed for hot hydrogen, but much less efficient, were found: F18 + CF4 --> CF3F18 + F, F18 +CF4 --> CF2F18 + (F + F), It was impossible to study the abstraction reaction F18 + CF4 --> CF3 + FF18 directly. However, indirect evidence suggests that it also has a low efficiency. Detailed studies of the effect of moderator on the F18 + CF4 system have been made. The data obtained were analysed by means of the kinetic theory of hot reactions. The system was found to be in accord with this formalism, providing quantitative confirmation of the present interpretation of the results. The carbon tetrafluoride and methane systems provide a basis for some tentative conclusions on the mechanisms of hot fluorine atom reactions. At present it appears that with certain important, but natural, modifications the model first developed for hot hydrogen atoms is applicable

  2. Water, hydrogen, deuterium, carbon, carbon-13, and oxygen-18 content of selected lunar material

    Science.gov (United States)

    Friedman, I.; O'Neil, J.R.; Adami, L.H.; Gleason, J.D.; Hardcastle, K.

    1970-01-01

    The water content of the breccia is 150 to 455 ppm, with a ??D from -580 to -870 per mil. Hydrogen gas content is 40 to 53 ppm with a ??D of -830 to -970 per mil. The CO2 is 290 to 418 ppm with S 13C = + 2.3 to + 5.1 per mil and ??18O = 14.2 to 19.1 per mil. Non-CO2 carbon is 22 to 100 ppm, ??18C = -6.4 to -23.2 per mil. Lunar dust is 810 ppm H2O (D = 80 ppm) and 188 ppm total carbon (??13C = -17.6 per mil). The 18O analyses of whole rocks range from 5.8 to 6.2 per mil. The temperature of crystallization of type B rocks is 1100?? to 1300??C, based on the oxygen isotope fractionation between coexisting plagioclase and ilmenite.

  3. Groningen experience in production and application of fluorine-18 and carbon-11 labeled radiopharmaceuticals

    International Nuclear Information System (INIS)

    In this presentation the preparation of these tracers (fluorine-18 and carbon-11 labeled radiopharmaceuticals), as well as the present stage of development and evaluation, and the potential application in oncology will be discussed. (author)

  4. Oxygen-18 Carbon Dioxide Isotope Ratio in Mars Atmosphere

    Science.gov (United States)

    Kostiuk, T.; Livengood, T. A.; Hewagama, T.; Smith, R.; Fast, K. E.; Annen, J.; Sonnabend, G.; Sornig, M.

    2012-09-01

    The determination of isotopic ratios on Mars is important to the study of atmospheric evolution [1]. The relative abundance of isotopes of CO2 provides insight into the loss of Mars' primordial atmosphere. Isotopic ratios also provide markers in the study of geochemistry of Mars meteorites and future returned samples formed in equilibrium with ambient atmosphere, and are probes of biogenic and abiotic chemistry, which differ in isotope fractionation. Due to its lesser gravity and relatively thin residual atmosphere, Mars' atmosphere should be enriched in heavy isotopes [1]. However Viking [2] results indicated an Earth-like singly substituted oxygen-18 CO2 isotopic ratio, 18OCO/OCO, with δ18O = 0±50‰ relative to Vienna Standard Mean Ocean Water (VSMOW). By comparison, isotopic ratios in Earth atmospheric CO2 are not uniquely defined due to seasonal and biotic variability, but have a range 0-41‰ relative to VSMOW [3, 4]. Phoenix lander TEGA [3] measurements found a modest enrichment of δ18O = 31.0±5.7‰. Only the Viking and Phoenix landers have carried a mass spectrometer to Mars, so far, until the arrival of Mars Science Laboratory in August 2012. Using ground-based spectroscopic techniques Krasnopolsky et al. [5] also found modest enrichment δ18O = 18±18‰. We present results from fully resolved spectroscopic measurements near 10.6 μm of both the normal and singly substituted oxygen- 18 CO2 lines, taken with the Goddard Space Flight Center Heterodyne Instrument for Planetary Winds And Composition (HIPWAC) at the NASA Infrared Telescope Facility on Mauna Kea, Hawaii. Measurements with spectral resolving power λ/Δλ=107 were obtained in October 2007 with an instantaneous field-of-view on the planet of ~1 arcsec, at the locations shown in Fig. 1 as open squares. The solid and broken line tracks show Mars SPICAM measurements of ozone corresponding to ozone measurements also obtained with HIPWAC and shown as hatched and solid regions [6]. Figure 1

  5. Production of fluorine-18 from eithium carbonate in a research reactor

    International Nuclear Information System (INIS)

    A method for the production of fluorine-18 in a research reactor, from irradiated lithium carbonate, is described. Fluorine-18 is separated from impurities in a alumina column, which is an appropriate procedure for its production as a carrier-free radioisotope for oral administration. Characteristics of the product, when fluorine is separated from irradiated target in an usual alumina column, are compared with those when fluorine is separated in a previously calcined(10000C) alumina column: Yields of chemical separation and chemical forms of radioisotope obtained are studied. Fluorine elution is investigated for several eluant concentrations and the use of a lower concentrated eluant is emphasized. Purity degree of fluorine-18 solutions separated. A routine production procedure is determined by irradiating enriched lithium carbonate (95% 6Li). Theoretical yields are compared with fluorine-18 production yields obtained in several irradiations

  6. Enhancing the Accuracy of Carbonate δ18O and δ13C Measurements by SIMS

    Science.gov (United States)

    Orland, I. J.; Kozdon, R.; Linzmeier, B.; Wycech, J.; Sliwinski, M.; Kitajima, K.; Kita, N.; Valley, J. W.

    2015-12-01

    The precision and accuracy of carbonate δ18O & δ13C analysis by multicollector SIMS is well established if standards match samples in structure and major/minor element chemistry. However, low-T- and bio-carbonates used to construct paleoclimate archives can include complex internal structures and some samples analyzed at WiscSIMS (and other SIMS labs) have a consistent, sample-dependent offset between average SIMS δ18O measurements and bulk δ18O analyses by phosphoric-acid digestion. The offset is typically hydrogen peroxide), for which there is no agreed procedure in conventional bulk analyses. For SIMS analyses, pre-treatments had varied influence on the δ18O value, [16O1H], the concentration of "organic markers" like 12C14N and 31P, and mineralogy (of aragonite samples).

  7. Preparation of 18F in a research reactor, from irradiated lithium carbonate

    International Nuclear Information System (INIS)

    A procedure for preparation of carrier - free fluorine-18 is described. The 18F is produced by neutron irradiation of lithium carbonate and is separated by passing the dissolved material through a 10000 C calcinated aluminium oxyde column. The yield is about 90%, the tritium content 2%; other radioactive impurities are not found. The radiochemical purity is about 93% and the lithium content of the solution is <0.2 ppm

  8. Synthesis of carbon-11, fluorine-18, and nitrogen-13 labeled radiotracers for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, J.S.; Wolf, A.P.

    1981-01-01

    A number of reviews, many of them recent, have appeared on various aspects of /sup 11/C, /sup 18/F and /sup 13/N-labeled radiotracers. This monograph treats the topic principally from the standpoint of synthetic organic chemistry while keeping in perspective the necessity of integrating the organic chemistry with the design and ultimate application of the radiotracer. Where possible, recent examples from the literature of organic synthesis are introduced to suggest potentially new routes which may be applied to problems in labeling organic molecules with the short-lived positron emitters, carbon-11, fluorine-18, and nitrogen-13. The literature survey of carbon-11, fluorine-18 and nitrogen-13 labeled compounds presented are of particular value to scientists working in this field. Two appendices are also included to provide supplementary general references. A subject index concludes this volume.

  9. Synthesis of carbon-11, fluorine-18, and nitrogen-13 labeled radiotracers for biomedical applications

    International Nuclear Information System (INIS)

    A number of reviews, many of them recent, have appeared on various aspects of 11C, 18F and 13N-labeled radiotracers. This monograph treats the topic principally from the standpoint of synthetic organic chemistry while keeping in perspective the necessity of integrating the organic chemistry with the design and ultimate application of the radiotracer. Where possible, recent examples from the literature of organic synthesis are introduced to suggest potentially new routes which may be applied to problems in labeling organic molecules with the short-lived positron emitters, carbon-11, fluorine-18, and nitrogen-13. The literature survey of carbon-11, fluorine-18 and nitrogen-13 labeled compounds presented are of particular value to scientists working in this field. Two appendices are also included to provide supplementary general references. A subject index concludes this volume

  10. Influence of Carbonic Anhydrase Activity in Terrestrial Vegetation on the 18O Content of Atmospheric CO2

    Science.gov (United States)

    Gillon, Jim; Yakir, Dan

    2001-03-01

    The oxygen-18 (18O) content of atmospheric carbon dioxide (CO2) is an important indicator of CO2 uptake on land. It has generally been assumed that during photosynthesis, oxygen in CO2 reaches isotopic equilibrium with oxygen in 18O-enriched water in leaves. We show, however, large differences in the activity of carbonic anhydrase (which catalyzes CO2 hydration and 18O exchange in leaves) among major plant groups that cause variations in the extent of 18O equilibrium (θeq). A clear distinction in θeq between C3 trees and shrubs, and C4 grasses makes atmospheric C18OO a potentially sensitive indicator to changes in C3 and C4 productivity. We estimate a global mean θeq value of ~0.8, which reasonably reconciles inconsistencies between 18O budgets of atmospheric O2 (Dole effect) and CO2.

  11. Priming effects of leaves of Laurus nobilis L. and 1,8-cineole on carbon mineralization

    Directory of Open Access Journals (Sweden)

    Burak Kocak

    2016-03-01

    Full Text Available Plant secondary compounds can have stimulating effect on C cycling and change its rate in soils. We examined how leaves of bay laurel (Laurus nobilis L.; Lauraceae and 1,8-cineole (CIN, one of its constituents, affect soil C mineralization and its rate. Leaves and soil samples of bay laurel were taken from Cukurova University Campus (Adana, Turkey growing naturally under Mediterranean climate conditions. Leaves and CIN were considered as the two forms of organic C sources. After determining the level of 1,8-cineole in leaves by gas chromatography-mass spectrometry, soils were mixed with powdered leaves and 1,8-cineole based on their C contents at same and half doses of soil organic C level. Carbon mineralization of all soils was determined over 54 d (28 °C, 80% field capacity. While 1,8-cineole was found as a major constituent of leaves (65% of essential oil, all doses of leaves and CIN increased soil microbial activity. There were significant differences for C mineralization rate between control and all applications (P < 0.05. High C levels of all treatments decreased C mineralization rate compared to control soils. In summary, all treatments stimulated C mineralization and it is possible to conclude that soil microorganisms adapted to use CIN as an energy source.

  12. Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants: a new approach to estimating in vivo carbonic anhydrase activity

    Energy Technology Data Exchange (ETDEWEB)

    Holtum, J.A.M.; Summons, R.; Roeske, C.A.; Comins, H.N.; O' Leary, M.H.

    1984-01-01

    Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with TC YO2, then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the ( TC) malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance or by mass spectrometry. Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum, 40 for Kalanchoee daigremontiana, and 100 or greater for Bryophyllum tubiflorum, Kalanchoee serrata, and Kalanchoae tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. 37 references, 2 figures, 8 tables.

  13. Use of laser spectroscopy to measure the 13C/12C and 18O/16O compositions of carbonate minerals.

    Science.gov (United States)

    Barker, Shaun L L; Dipple, Gregory M; Dong, Feng; Baer, Douglas S

    2011-03-15

    The stable carbon and oxygen isotope compositions of carbonate minerals are utilized throughout the earth and environmental sciences for various purposes. Here, we demonstrate the first application of a prototype instrument, based on off-axis integrated cavity output laser spectroscopy, to measure the carbon and oxygen isotope composition of CO(2) gas evolved from the acidification of carbonate minerals. The carbon and oxygen isotope ratios were recorded from absorption spectra of (12)C(16)O(16)O, (13)C(16)O(16)O, and (12)C(16)O(18)O in the near-infrared wavelength region. The instrument was calibrated using CaCO(3) minerals with known δ(13)C(VPDB) and δ(18)O(VSMOW) values, which had been previously calibrated by isotope ratio mass spectrometry relative to the international isotopic standards NBS 18 and NBS 19. Individual analyses are demonstrated to have internal precision (1 SE) of better than 0.15‰ for δ(13)C and 0.6‰ for δ(18)O. Analysis of four carbonate standards of known isotopic composition over 2 months, determined using the original instrumental calibration, indicates that analyses are accurate to better than 0.5‰ for both δ(13)C and δ(18)O without application of standard-sample-standard corrections. PMID:21341717

  14. Preferential formation of 13C- 18O bonds in carbonate minerals, estimated using first-principles lattice dynamics

    Science.gov (United States)

    Schauble, Edwin A.; Ghosh, Prosenjit; Eiler, John M.

    2006-05-01

    Equilibrium constants for internal isotopic exchange reactions of the type: Ca12C18O16O2+Ca13C16O3↔Ca13C18O16O2+Ca12C16O3 for individual CO 32- groups in the carbonate minerals calcite (CaCO 3), aragonite (CaCO 3), dolomite (CaMg(CO 3) 2), magnesite (MgCO 3), witherite (BaCO 3), and nahcolite (NaHCO 3) are calculated using first-principles lattice dynamics. Calculations rely on density functional perturbation theory (DFPT) with norm-conserving planewave pseudopotentials to determine the vibrational frequencies of isotopically substituted crystals. Our results predict an ˜0.4‰ excess of 13C18O16O22- groups in all studied carbonate minerals at room-temperature equilibrium, relative to what would be expected in a stochastic mixture of carbonate isotopologues with the same bulk 13C/ 12C, 18O/ 16O, and 17O/ 16O ratios. The amount of excess 13C18O16O22- decreases with increasing temperature of equilibration, from 0.5‰ at 0 °C to <0.1‰ at 300 °C, suggesting that measurements of multiply substituted isotopologues of carbonate could be used to infer temperatures of ancient carbonate mineral precipitation and alteration events, even where the δ 18O of coexisting fluids is uncertain. The predicted temperature sensitivity of the equilibrium constant is ˜0.003‰/°C at 25 °C. Estimated equilibrium constants for the formation of 13C18O16O22- are remarkably uniform for the variety of minerals studied, suggesting that temperature calibrations will also be applicable to carbonate minerals not studied here without greatly compromising accuracy. A related equilibrium constant for the reaction: Ca12C18O16O2+Ca12C17O16O2↔Ca12C18O17O16O+Ca12C16O3 in calcite indicates formation of 0.1‰ excess 12C 18O 17O 16O 2- at 25 °C. In a conventional phosphoric acid reaction of carbonate to form CO 2 for mass-spectrometric analysis, molecules derived from 13C18O16O22- dominate (˜96%) the mass 47 signal, and 12C 18O 17O 16O 2- contributes most of the remainder (3%). This suggests

  15. Lake carbonate18 records from the Yukon Territory, Canada: Little Ice Age moisture variability and patterns

    Science.gov (United States)

    Anderson, Lesleigh; Finney, Bruce P.; Shapley, Mark D.

    2011-01-01

    A 1000-yr history of climate change in the central Yukon Territory, Canada, is inferred from sediment composition and isotope geochemistry from small, groundwater fed, Seven Mile Lake. Recent observations of lake-water δ18O, lake level, river discharge, and climate variations, suggest that changes in regional effective moisture (precipitation minus evaporation) are reflected by the lake’s hydrologic balance. The observations indicate that the lake is currently 18O-enriched by summer evaporation and that during years of increased precipitation, when groundwater inflow rates to the lake increase, lake-water δ18O values decrease. Past lake-water δ18O values are inferred from oxygen isotope ratios of fine-grained sedimentary endogenic carbonate. Variations in carbonate δ18O, supplemented by those in carbonate and organic δ13C, C/N ratios, and organic carbon, carbonate and biogenic silica accumulation rates, document changes in effective moisture at decadal time scales during the early Little Ice Age period to present. Results indicate that between ∼AD 1000 and 1600, effective moisture was higher than today. A shift to more arid climate conditions occurred after ∼AD 1650. The 19th and 20th centuries have been the driest of the past millennium. Temporal variations correspond with inferred shifts in summer evaporation from Marcella Lake δ18O, a similarly small, stratified, alkaline lake located ∼250 km to the southwest, suggesting that the combined reconstructions accurately document the regional paleoclimate of the east-central interior. Comparison with regional glacial activity suggests differing regional moisture patterns during early and late Little Ice Age advances.

  16. Effects of intraleaf variations in carbonic anhydrase activity and gas exchange on leaf C18OO isoflux in Zea mays.

    Science.gov (United States)

    Affek, Hagit P; Krisch, Maria J; Yakir, Dan

    2006-01-01

    Variation in the C18OO content of atmospheric CO2 (delta18Oa) can be used to distinguish photosynthesis from soil respiration, which is based on carbonic anhydrase (CA)-catalyzed 18O exchange between CO2 and 18O-enriched leaf water (delta18Ow). Here we tested the hypothesis that mean leaf delta18Ow and assimilation rates can be used to estimate whole-leaf C18OO flux (isoflux), ignoring intraleaf variations in CA activity and gas exchange parameters. We observed variations in CA activity along the leaf (> 30% decline from the leaf center toward the leaf ends), which were only partially correlated to those in delta18Ow (7 to 21 per thousand), delta18O and delta13C of leaf organic matter (25 to 30 per thousand and -12.8 to -13.2 per thousand, respectively), and substomatal CO2 concentrations (intercellular CO2 concentrations, c(i), at the leaf center were approximately 40% of those at the leaf tip). The combined effect of these variations produced a leaf-integrated isoflux that was different from that predicted based on bulk leaf values. However, because of canceling effects among the influencing parameters, isoflux overestimations were only approximately 10%. Conversely, use of measured parameters from a leaf segment could produce large errors in predicting leaf-integrated C18OO fluxes. PMID:16411935

  17. In folio study of carbonic anhydrase and Rubisco activities in higher C3 plants using 18O and mass spectrometry

    International Nuclear Information System (INIS)

    This document studies the effects of a mild water stress and carbonic anhydrase activity by ethoxyzolamide (EZA) on the diffusion of CO2 in leaves, by 18O labelling of O2 and of CO2 associated to mass spectrometry. (A.B.). 5 refs., 2 figs

  18. 13C/12C and 18O/16O in calcium carbonate-cemented beach sands ('beach rocks')

    International Nuclear Information System (INIS)

    A study of the stable isotope composition (C13/C12 and O18/O16) of the cement and the local groundwater in Itaparica Island (Salvador-Brazil) is carried out to determine the origin of the carbonate cement. For area A, the cement has Δ13C = 9% showing that CO2 in groundwater charged by decay of organic material is the source of carbonate in the cement. Probably comentation occurs during loss of excess CO2 from groundwater as comes into an environment where loss of CO2 is possible . In area B, where the cements contain, on the average Δ18O v=1,3%, the cement is formed from carbonate typical of sea water or a mixture of sea water and fresh water. (Autor)

  19. Utilization of activated carbon produced from fruit juice industry solid waste for the adsorption of Yellow 18 from aqueous solutions.

    Science.gov (United States)

    Angin, Dilek

    2014-09-01

    The use of activated carbon obtained from sour cherry (Prunus cerasus L.) stones for the removal of a basic textile dye, which is Yellow 18, from aqueous solutions at different contact times, pH values and solution temperatures was investigated. The surface area and micropore volume of chemically modified activated carbon were 1704 m(2) g(-1) and 0.984 cm(3) g(-1), respectively. The experimental data indicated that the adsorption isotherms were well described by the Langmuir equilibrium isotherm equation and the calculated adsorption capacity was 75.76 mg g(-1) at 318 K. The adsorption kinetic of Yellow 18 obeys the pseudo-second-order kinetic model. The thermodynamic parameters were calculated to estimate the nature of adsorption. The activation energy of the system was calculated as 0.71-2.36 kJ/mol. According to these results, prepared activated carbon could be used as a low-cost adsorbent to compare with the commercial activated carbon for the removal of Yellow 18 from wastewater. PMID:24656549

  20. The potential of carbon-11 and fluorine-18 chemistry: illustration through the development of positron emission tomography radioligands targeting the translocator protein 18 kDa

    International Nuclear Information System (INIS)

    The TSPO (translocator protein), also known as the peripheral benzodiazepine receptor, is up-regulated in the brain of subjects suffering from neuro-degenerative disorders such as Alzheimer's, Parkinson's and Huntington's disease. Moreover, this overexpression has been proved to be linked to micro-glia activation making thus the TSPO a marker of choice of neuro-inflammatory processes and therefore a potential target for the development of radioligands for positron emission tomography imaging. The discovery of selective TSPO ligands and their labelling with the short-lived positron-emitter isotopes carbon-11 and fluorine-18 emerged in the mid-1980's with the preparation of the 3-iso-quinolinecarboxamide [11C]PK11195. To date, an impressive number of promising compounds - [11C]PK11195-challengers - have been developed; some radioligands - for example, [11C]PBR28, [11C]DPA-713, [18F]FEDAA1106 and [18F]DPA-714 - are currently used in clinical trials. As illustrated in this review, the methodologies applied for the preparation of these compounds remain mainly [11C]methylations using [11C]MeI or [11C]MeOTf and SN2- type nucleophilic aliphatic [18F]fluorinations - two processes illustrating the state-of-the-art arsenal of reactions that involves these two short-lived radioisotopes - but alternative processes, such as [11C]carbonylations using [11C]CO and [11C]COCl2 as well as SNAr-type nucleophilic [18F]fluorinations, have also been reported and as such, reviewed herein. (authors)

  1. The multiPrep - a new on line system for combined isotopic analysis of deuterium and 18O of water as well as 13C and 18O in individual carbonate samples

    International Nuclear Information System (INIS)

    Classical dual inlet IRMS techniques for the measurement of 18O in water, deuterium in water and 13C and 18O in carbonates have, until now involved the use of analysis dedicated on-line preparation systems or a mix of offline preparation followed by automated analysis

  2. Carbon-11 and fluorine-18 chemistry devoted to molecular probes for imaging the brain with positron emission tomography

    International Nuclear Information System (INIS)

    Exploration of the living human brain in real-time and in a noninvasive way was for centuries only a dream, made, however, possible today with the remarkable development during the four last decades of powerful molecular imaging techniques, and especially positron emission tomography (PET). Molecular PET imaging relies, from a chemical point of view, on the use and preparation of a positron-emitting radiolabelled probe or radiotracer, notably compounds incorporating one of two short-lived radionuclides fluorine-18 (T1/2: 109.8 min) and carbon-11 (T1/2: 20.38 min). The growing availability and interest for the radio-halogen fluorine-18 in radiopharmaceutical chemistry undoubtedly results from its convenient half-life and the successful use in clinical oncology of 2-[18F]fluoro-2-deoxy-D-glucose ([18F]FDG). The special interest of carbon-11 is not only that carbon is present in virtually all biomolecules and drugs allowing therefore for isotopic labelling of their chemical structures but also that a given molecule could be radiolabelled at different functions or sites, permitting to explore (or to take advantage of) in vivo metabolic pathways. PET chemistry includes production of these short-lived radioactive isotopes via nuclear transmutation reactions using a cyclotron, and is directed towards the development of rapid synthetic methods, at the trace level, for the introduction of these nuclides into a molecule, as well as the use of fast purification, analysis and formulation techniques. PET chemistry is the driving force in molecular PET imaging, and this special issue of the Journal of Labelled Compounds and Radiopharmaceuticals, which is strongly chemistry and radiochemistry-oriented, aims at illustrating, be it in part only, the state-of-the-art arsenal of reactions currently available and its potential for the research and development of specific molecular probes labelled with the positron emitters carbon-11 and fluorine-18,with optimal imaging properties for

  3. The influence of temperature and seawater carbonate saturation state on 13C–18O bond ordering in bivalve mollusks

    Directory of Open Access Journals (Sweden)

    R. A. Eagle

    2013-07-01

    Full Text Available The shells of marine mollusks are widely used archives of past climate and ocean chemistry. Whilst the measurement of mollusk δ18O to develop records of past climate change is a commonly used approach, it has proven challenging to develop reliable independent paleothermometers that can be used to deconvolve the contributions of temperature and fluid composition on molluscan oxygen isotope compositions. Here we investigate the temperature dependence of 13C–18O bond abundance, denoted by the measured parameter Δ47, in shell carbonates of bivalve mollusks and assess its potential to be a useful paleothermometer. We report measurements on cultured specimens spanning a range in water temperatures of 5 to 25 °C, and field collected specimens spanning a range of −1 to 29 °C. In addition we investigate the potential influence of carbonate saturation state on bivalve stable isotope compositions by making measurements on both calcitic and aragonitic specimens that have been cultured in seawater that is either supersaturated or undersaturated with respect to aragonite. We find a robust relationship between Δ47 and growth temperature. We also find that the slope of a linear regression through all the Δ47 data for bivalves plotted against seawater temperature is significantly shallower than previously published inorganic and biogenic carbonate calibration studies produced in our laboratory and go on to discuss the possible sources of this difference. We find that changing seawater saturation state does not have significant effect on the Δ47 of bivalve shell carbonate in two taxa that we examined, and we do not observe significant differences between Δ47-temperature relationships between calcitic and aragonitic taxa.

  4. Spontaneous oxygen isotope exchange between carbon dioxide and solid Ti18O2

    Czech Academy of Sciences Publication Activity Database

    Civiš, Svatopluk; Ferus, Martin; Zukalová, Markéta; Kavan, Ladislav

    Poznań : Adam Mickiewicz University, 2010. s. 49. [International conference on high resolution molecular spectroscopy /21./. 07.09.2010-11.09.2010, Poznań] R&D Projects: GA AV ČR IAA400400705; GA AV ČR KAN100500652 Institutional research plan: CEZ:AV0Z40400503 Keywords : carbon dioxide * TiO2 Subject RIV: CG - Electrochemistry

  5. An isotope mass balance model for the correlation of freshwater bivalve shell (Unio pictorum carbonate δ18O to climatic conditions and water δ18O in Lake Balaton (Hungary

    Directory of Open Access Journals (Sweden)

    Gabriella SCHÖLL-BARNA

    2011-08-01

    describes the isotope variability of shell carbonate. As a practical application of the isotope mass balance model was used to present the effect of precipitation and evaporation on δ18Oshell. The relationship between intra-shell δ18O-variability and precipitation amount (precipitation/evaporation ratio were determined, which allows the quantified prediction the impact of meteorological parameters affecting the oxygen isotope composition of shell carbonate.

  6. Hydrological budget, carbon sources and biogeochemical processes in Lac Pavin (France): Constraints from δ18O of water and δ13C of dissolved inorganic carbon

    International Nuclear Information System (INIS)

    Lac Pavin (French Massif Central) is a permanently stratified lake: the upper water layers (mixolimnion, from 0 to 60 m depth) are affected by seasonal overturns, whereas the bottom water layers (monimolimnion, from 60 to 90 m depth) remain isolated and are never mixed. Hence, they are capable of storing important quantities of dissolved gases, mainly CO2. With the aim of better constraining the water balance and of gaining new insights into the carbon cycle of Lac Pavin, an isotopic approach is used. The δ18OH2O profiles lead the authors to give a new evaluation of the evaporation flow rate (8 L s-1), and to propose and characterize two sub-surface springs. The sub-surface spring located at the bottom of the lake can be deduced from the 1% isotopic difference between the upper water layers (mean δ18OH2O value: -7.3 per mille ) and the bottom water layers (δ18OH2O=-8.4 per mille ). It is argued that this sub-surface spring has isotopic and chemical characteristics similar to those of the magmatic CO2-rich spring (i.e. Fontaine Goyon, δ18OH2O=-9.4 per mille ), and we calculate its flow rate of 1.6 L s-1. The second sub-surface spring is located around 45 m depth, with a composition close to those of the water surface streams (δ18OH2O13CDIC ∼ +7 per mille ) and 2/3 from the magmatic CO2-rich spring (δ13CDIC ∼ -5 per mille ). Above 80 m depth, the variations in DIC concentrations (ranging from 0.5 to 10 mM) and δ13CDIC values (ranging from -6.5 per mille to 4.4 per mille ) are partly explained by the usual methanotrophy, organic matter oxidation, photosynthesis and CO2 equilibrium with atmosphere. The unusually high δ13CDIC values in the upper water layers (ranging from -6 per mille to 0 per mille ) compared to the expected δ13CDIC values assuming only organic matter oxidation, demonstrate the leakage of 13C-enriched DIC from the bottom water layers of Lac Pavin (δ13CDIC values ranging from -5 per mille to 3 per mille )

  7. Thermometry using 1/8 W carbon resistors in a temperature region around 10 mK

    International Nuclear Information System (INIS)

    The resistance-temperature characteristics of 1/8 W carbon resistors of grade ERC-18SG, manufactured by Matsushita, with the nominal values of 48, 82, 100, 220 and 330 Ω have been measured in the region 4.2 K to 25 mK and their application as thermometers in this region is confirmed. For the 82 Ω resistor, measurements were taken at temperatures below 10mK. The temperature dependence of the resistance was found to be linear on the log-log plot over a wide range below 50 mK. The sensitivity remains finite even at 6 mK, but below 10 mK rapid measurements were prevented by a considerable increase in the thermal relaxation time. Measurement of the characteristics of several 100 Ω resistors from two different sets showed that resistors from the same set separate into two groups with different characteristics. This become appreciable at temperatures below 4.2 K, so it is difficult to predict the behaviour of Matsushite resistors below 4.2 K from the characteristics at higher temperatures. (author)

  8. Infrared spectroscopy of 17O- and 18O-enriched carbon dioxide: Line positions and intensities in the 4681-5337 cm-1 region

    Science.gov (United States)

    Borkov, Yu. G.; Jacquemart, D.; Lyulin, O. M.; Tashkun, S. A.; Perevalov, V. I.

    2015-07-01

    The line positions and intensities of carbon dioxide isotopologues have been retrieved in the 4681-5337 cm-1 spectral range from Fourier transform spectra of carbon dioxide recorded in LADIR (Paris, France) with the Bruker IFS 125-HR [Jacquemart D, et al., J Quant Spectrosc Radiat Transf 2012;113:961-975]. In total 6386 line positions and intensities of 89 bands of 12 isotopologues 16O12C16O, 16O13C16O, 16O12C18O, 16O12C17O, 16O13C18O, 16O13C17O, 18O12C18O, 17O12C18O, 17O12C17O, 18O13C18O, 17O13C18O, and 17O13C17O have been retrieved. 23 bands were newly assigned. All studied bands belong to the ΔP=7 series of transitions, where P = 2V1 +V2 + 3V3 is the polyad number (Vi are vibrational quantum numbers). The accuracy of the line position measurement is about 0.3×10-3 cm-1 for the unblended and not very weak lines. The accuracy of the line intensities varies from 4% to 15% depending on the isotopologue, on the intensity of the line and on the extent of the line overlapping. The observed intensities were used to fit the effective dipole moment parameters for the ΔP=7 series of transitions in 16O12C18O, 16O12C17O, 12C17O2, 17O12C18O, 16O13C17O, 13C17O2 and 17O13C18O isotopologues of carbon dioxide.

  9. Synthesis and biological evaluation of carbon-11 and fluorine-18 labeled tracers for in vivo visualization of PDE10A

    International Nuclear Information System (INIS)

    Introduction: In vivo visualization of PDE10A using PET provides a tool to evaluate the role of PDE10A in various neuropsychiatric diseases and can also be useful in the clinical evaluation of PDE10A inhibitor drug candidates. We evaluated several carbon-11 and fluorine-18 labeled PDE10A inhibitors as potential PDE10A PET radioligands. Materials and Methods: [11C]MP10, [11C]JNJ42071965 and four other tracers were developed. Their biodistribution was evaluated in rats. Rat plasma and brain radiometabolites were quantified. Baseline microPET imaging was performed in normal rats and PDE10A knockout (KO) and wild-type (WT) mice. Blocking and displacement studies were conducted. The selectivity of the tracer binding was further studied in an ex vivo autoradiography experiment in PDE10A KO and WT mice. Results: Biodistribution showed brain uptake for all tracers in the striatum and wash-out from the cerebellum. [11C]1 (11C-MP10) had the highest specific uptake index (striatum (S) vs. cerebellum (C) ratios (S/C)-1) at 60 min (7.4). [11C]5 ([11C]JNJ42071965) had a high index at the early time points (1.0 and 3.7 at 2 and 30 min p.i., respectively). The affinity of [11C]4, [18 F]3 and [18 F]6 was too low to visualize PDE10A using microPET. [11C] 2 showed a specific binding, while kinetics of [11C]1 were too slow. [11C]5 reached equilibrium after 10 min (uptake index = 1.2). Blocking and displacement experiments in rats and baseline imaging in PDE10A KO mice showed specific and reversible binding of [11C]5 to PDE10A. Conclusions: We successfully radiolabeled and evaluated six radiotracers for their potential to visualize PDE10A in vivo. While [11C]1 had the highest striatal specific uptake index, its slow kinetics likely compromise clinical use of this tracer. [11C]5 has a relatively high striatum-to-background ratio and fast kinetic profile, which makes it a valuable carbon-11 alternative

  10. Oxygen-18 exchange as a measure of accessibility of CO2 and HCO3- to carbonic anhydrase in Chlorella vulgaris (UTEX 263)

    International Nuclear Information System (INIS)

    The exchange of 18O between CO2 and H2O in stirred suspensions of Chlorella vulgaris (UTEX 263) was measured using a membrane inlet to a mass spectrometer. The depletion of 18O from CO2 in the fluid outside the cells provides a method to study CO2 and HCO3- kinetics in suspensions of algae that contain carbonic anhydrase since 18O loss to H2O is catalyzed inside the cells but not in the external fluid. Low-CO2 cells of Chlorella vulgaris (grown with air) were added to a solution containing 18O enriched CO2 and HCO3- with 2 to 15 millimolar total inorganic carbon. The observed depletion of 18O from CO2 was biphasic and the resulting 18O content of CO2 was much less than the 18O content of HCO3- in the external solution. Analysis of the slopes showed that the Fick's law rate constant for entry of HCO3- into the cell was experimentally indistinguishable from zero (bicarbonate impermeable) with an upper limit of 3 x 10-4 s-1 due to experimental errors. The Fick's law rate constant for entry of CO2 to the sites of intracellular carbonic anhydrase was large, 0.013 per second, but not as great as calculated for no membrane barrier to CO2 flux (6 per second). The experimental value may be explained by a nonhomogeneous distribution of carbonic anhydrase in the cell (such as membrane-bound enzyme) or by a membrane barrier to CO2 entry into the cell or both. The CO2 hydration activity inside the cells was 160 times the uncatalyzed CO2 hydration rate

  11. Effect of temperature on the oxygen isotope composition of carbon dioxide (δ18O) prepared from carbonate minerals by reaction with polyphosphoric acid: An example of the rhombohedral CaCO 3-MgCO 3 group minerals

    Science.gov (United States)

    Crowley, Stephen F.

    2010-11-01

    Measurement of the ratio of 18O to 16O in CO 2(δ18O) produced from rhombohedral carbonate minerals in the compositional range CaCO 3-MgCO 3 by reaction with polyphosphoric acid (PPA), at temperatures of between 25 and 110 °C, shows that values of δ18O are linearly correlated ( r o > 0.99) with the reciprocal of absolute reaction temperature (K/ T). This observation is consistent with earlier studies documenting the effect of temperature on the kinetic fractionation of oxygen isotopes between parent carbonate and product CO 2 and H 2O during acid decomposition. However, analysis of the resultant data reveals: (1) a progressive increase in dδ18O/dT-1 with increasing Mg content, and (2) a significant variation in dδ18O/dT-1 between individual samples of carbonate of identical lattice symmetry and similar chemical composition. The overall increase in gradient with increasing Mg content is assumed to reflect cation radius dependent factors that control the bonding environment at the interface between the metal cation exposed at the surface of the reacting carbonate solid and a H 2CO 3 transitional species during disproportionation of H 2CO 3 to CO 2 and H 2O ("cluster model" of Guo et al., 2009). Phase-specific variations in dδ18O/dT-1 might result from differences in lattice structure variables (e.g., degree of lattice distortion, extent of positional disorder, and non-ideal mixing of substituent cations where carbonates depart from end-member compositions). Lattice structure variables may be dependent on geochemical conditions pertaining at the time of carbonate precipitation (e.g., biosynthetic versus inorganic precipitates) and suggests that dδ18O/dT-1 has the potential to vary, within limits, in response to both the chemical composition and structure of each carbonate sample. Because the oxygen isotope composition of carbonate minerals (δ18O) measured on the VPDB scale is defined by the oxygen isotope composition of CO 2 prepared from NBS19 (calcite) by

  12. High sensitivity Cavity Ring Down spectroscopy of 18O enriched carbon dioxide between 5850 and 7000 cm−1: Part II—Analysis and theoretical modeling of the 12C18O2, 13C18O2 and 16O13C18O spectra

    International Nuclear Information System (INIS)

    More than 19000 transitions belonging to 11 isotopologues of carbon dioxide have been assigned in the room temperature absorption spectrum of highly 18O enriched carbon dioxide recorded by very high sensitivity CW-Cavity Ring Down spectroscopy between 5851 and 6990 cm−1 (1.71–1.43 μm). The line positions were determined with accuracy better than 1×10−3 cm−1 while the absolute line intensities are reported with an uncertainty better than 10%. This second report is devoted to the analysis of the bands of three multiply substituted isotopologues: 12C18O2, 13C18O2 and 16O13C18O (828, 838 and 638 in short hand notation). On the basis of the predictions of effective Hamiltonian models, a total of 2870, 538 and 1375 transitions belonging to 59, 11 and 15 bands were rovibrationnally assigned for 828, 838 and 638, respectively. For comparison, only 11 bands were previously measured by Fourier Transform spectroscopy in the region, for the 828 species. All the identified bands correspond to a ΔP=9 variation of the polyad number (P=2V1+V2+3V3, where Vi are vibrational quantum numbers). The band-by-band analysis has allowed deriving accurate spectroscopic parameters of 81 bands from a fit of the measured line positions. A few resonance perturbations were identified. In particular, the 31113 and 51106 states of 638 belonging to different polyads (P=10 and P=11, respectively) are anharmonically coupled. Using the large set of newly measured line positions and those collected from the literature, the global modeling of the line positions within the effective Hamiltonian approach was performed and a new set of Hamiltonian parameters was obtained for each of the three considered isopotologues. Using a similar approach, the global fits of the obtained intensity values of the ΔP=9 series of transitions were used to derive the corresponding ΔP=9 effective dipole moment parameters of the three considered isotopologues. The obtained results will help to improve the quality

  13. Long-term biobarriers to plant and animal intrusions of uranium tailings. [24% trifluralin, 18% carbon black, and 58% polymer

    Energy Technology Data Exchange (ETDEWEB)

    Cline, J.F.; Burton, F.G.; Cataldo, D.A.; Skiens, W.E.; Gano, K.A.

    1982-09-01

    The objective of this project was to develop and evaluate the effectiveness of physical and chemical barriers designed to prevent plant and animal breachment of uranium mill tailings containment systems for an extended period of time. A polymeric carrier/biocide delivery system was developed and tested in the laboratory, greenhouse and field. A continuous flow technique was established to determine the release rates of the biocides from the PCD systems; polymeric carrier specifications were established. Studies were conducted to determine effective biocide concentrations required to produce a phytotoxic response and the relative rates of phytotoxin degradation resulting from chemical and biological breakdown in soils. The final PCD system developed was a pelletized system containing 24% trifluralin, 18% carbon black and 58% polymer. Pellets were placed in the soil at the Grand Junction U-tailings site at one in. and two in. intervals. Data obtained in the field determined that the pellets released enough herbicide to the soil layer to stop root elongation past the barrier. Physical barriers to subsurface movement of burrowing animals were investigated. Small crushed stone (1 to 1 1/2 in. diameter) placed over asphalt emulsion and multilayer soil seals proved effective as barriers to a small mammal (ground squirrels) but were not of sufficient size to stop a larger animal (the prairie dog). No penetrations were made through the asphalt emulsion or the clay layer of the multilayer soil seals by either of the two mammals tested. A literature survey was prepared and published on the burrowing habits of the animals that may be found at U-tailings sites.

  14. Au/Ce0.72Zr0.18Pr0.1O2 nanodisperse catalyst for oxidation of carbon monoxide

    Science.gov (United States)

    Liberman, E. Yu.; Naumkin, A. V.; Mikhailichenko, A. I.; Batrakova, M. K.; Maslakov, K. I.; Revina, A. A.; Papkova, M. V.; Kon'kova, T. V.; Grunskii, V. N.; Gasparyan, M. D.; Karpovich, A. L.; Lizunova, A. A.

    2016-01-01

    The nanodisperse Au/Ce0.72Zr0.18Pr0.1O2 catalysts for low-temperature oxidation of carbon monoxide were synthesized. The compounds were identified by XRD, XPS, TEM, ISP-MS, and gas chromatography. The samples containing gold nanoparticles obtained by radiation chemical reduction in reverse micellar dispersion exhibited higher activity than the catalysts obtained by deposition-precipitation (DP) despite the higher content of the active component.

  15. Kinetics and Equilibrium Studies on Adsorption of Acid Red 18 (Azo-Dye) Using Multiwall Carbon Nanotubes (MWCNTs) from Aqueous Solution

    OpenAIRE

    Shirmardi, Mohammad; Mesdaghinia, Alireza; MAHVI, Amir Hossein; Nasseri, Simin; Nabizadeh, Ramin

    2012-01-01

    Azo dyes are one of the synthetic dyes that are used in many textile industries. Adsorption is one of the most effective techniques for removal of dye-contaminated wastewater. In this work, efficiency of multiwalled carbon nanotubes (MWCNTs) as an adsorbent for removal of Acid Red 18 (azo-dye) from aqueous solution was determined. The parameters affecting the adsorption process such as contact time, pH, adsorbent dosage, and initial dye concentration were studied. Experimental results have sh...

  16. Tight-binding molecular dynamic simulations of (18,0), (19,0) and (20,0) single walled carbon nanotubes under uniaxial strain

    International Nuclear Information System (INIS)

    Single Walled Carbon Nanotubes (SWCNTs) have attracted wide attention for application in nano-devices due to their electronic and mechanic properties. The electronic structure of SWCNT's is mostly determined by the chirality of the tubes. Depending on their chirality, they could be metal or semiconductor. Electrical conductivity of SWCNTs may also change due to deformations such as uniaxial strain. We have studied the behavior of electronic properties of (18,0), (19,0) and (20,0) SWCNTs under uniaxial strain. Mechanical properties of the zig-zag SWCNTs are also obtained. During our simulations we used the parallel, Order N Tight-Binding Molecular Dynamics technique which is improved and successfully applied to SWCNT simulations by G. Dereli et. al. The research reported here was supported through the Yildiz Technical University Research Found Project No: 24-01-01-04. Simulations are performed in parallel environment at Carbon Nanotube Simulation Laboratory of Yildiz Technical University.

  17. Carbon cycling in primary production bottle incubations: inferences from grazing experiments and photosynthetic studies using 14C and 18O in the Arabian Sea

    Science.gov (United States)

    Laws, Edward A.; Landry, Michael R.; Barber, Richard T.; Campbell, Lisa; Dickson, Mary-Lynn; Marra, John

    Estimates of photosynthesis based on the incorporation of 14C-labeled inorganic carbon into particulate carbon were compared to estimates of gross photosynthesis based on net O 2 production and the production of 18O2 from H218O during the US Joint Global Ocean Flux Study (US JGOFS) Arabian Sea process cruises. For samples incubated below the surface and at optical depthsphotorespiration, dark respiration, excretion, and grazing effects on the two estimates of photosynthesis. The 14C uptake : gross photosynthesis ratio was distinctly higher (0.62) for samples incubated at the surface. This result is likely due to UV light effects, since the O 2 and 14C incubations were done in quartz and polysulfone bottles, respectively. The 14C uptake : gross photosynthesis ratio was lower (0.31) for bottles incubated at optical depths>3. This result probably reflects an increase in the ratio of dark respiration to net photosynthesis in the vicinity of the compensation light level.

  18. Dating Cactus: Annual and Sub-annual Variations of Oxygen-18, Carbon-13 and Radiocarbon in Spines of a Columnar Cactus, Carnegiea gigantea.

    Science.gov (United States)

    Dettman, D. L.; English, N. B.; Sandquist, D. R.; Williams, D. G.

    2006-12-01

    We measured δ18O, δ13C and F14C of spines from a long-lived columnar cactus, Carnegiea gigantea (saguaro), to resolve a record of plant physiological responses to annual and sub-annual climate variation in the eastern Sonoran Desert. Spines grow from the apex of the cactus and are arranged serially along the side of the cactus oldest at the base, youngest at the apex. To establish the age of the spine series, we measured F14C of spines collected at 8 different heights from the apex (3.77 m) to the base of a naturally occurring saguaro. These spines yielded fractions of modern carbon (F14C) from 0.9679 and 1.5537, indicating the presence of carbon in spine tissue derived from atmospheric nuclear testing. We used the F14C of spine tissue to calculate the year of spine emergence for each of the 11 spines, assuming minimal re-allocation of stored carbon to growing spines. At the same 8 heights, we interpolated the date of spine emergence from observed height measurements made between 1964 and 2002. A very strong positive correlation (linear regression, r2 = 0.99, P saguaro (between 1.77 and 3.50 m) and representing ~15 years of growth, yielded δ18O variations in spine bulk organic material from 38° to 50° (VSMOW) and in δ13C from ° to 11.5° (VPDB). The δ18O and δ13C values were positively correlated over the entire record (linear regression, r2 = 0.22, P saguaro 30 km distant. Temporal isotopic records from saguaro and potentially other long-lived succulent plants may provide useful high-frequency records of ecological responses to climate variation in desert environments where other such records are lacking.

  19. Oxygène-18, carbone-13, carbone-14 et diatomées dans les quatre carottes du lac Huynamarca (Bolivie) : premiers résultats

    OpenAIRE

    Wirrmann, Denis; Servant Vildary, Simone; Fontes, J.C.

    1982-01-01

    L'étude de géochimie isotopique des carbonates coquilliers de quatre carottes du lac Huynamarca (Bolivie), ainsi que les datations au carbone-14 de quelques échantillons montrent qu'au cours des dix derniers millénaires le bilan hydrologique du lac Titicaca a considérablement varié. Une phase sèche, située entre 3650 et 5325 ans B.P. se traduit par une baisse du niveau du lac d'au moins dix mètres par rapport à l'actuel, avec comme corrolaire l'augmentation de la teneur en sels dissous dans l...

  20. What drives the δ18O signal in European carbonates during LGM and Termination II - multi-archive approach revised

    Science.gov (United States)

    Kwiecien, Ola; Marwan, Norbert

    2016-04-01

    Due to their natural occurrence in a wide spectrum of environmental settings (marine, lacustrine, terrestrial) carbonates constitute one of the most widely used archives of (paleo)environmental information Although the thermodynamic laws controlling isotopic fractionation are universal, each of the different environments leaves its characteristic imprint on the carbonate chemistry. Consequently, individual carbonate-based records are a combination of regional-scale and archive- or site-specific factors. Environmental heterogeneity, even within a confined geographical area, remains a challenge in teasing out the regional or local nature of the recorded climatic signal. Similarly, interpretation of new data often pays tribute to outdated assumptions. Here we compare and contrast published oxygen isotope records from different archives (lake sediments and stalagmites) from central Europe and the Black Sea region covering the time span between 26 and 8 ka BP. This exercise aims at (1) identification of the regional-scale mechanisms responsible for common trends and (2) better understanding of archive- and site-specific factors accounting for differences in the records. Additionally, this approach allows for testing 'closed vs outflowing' scenarios for the glacial Black Sea basin. It appears that changes in isotopic composition of atmospheric precipitation are a common denominator for the analyzed records. Site-specific factors include moisture source (stalagmites) and volume of the basin (lakes). Both, comparison of available geochemical records and data-based theoretical calculations suggest that since the LGM and until reconnection with Mediterranean at ca. 8 ka BP the Black Sea was an open system.

  1. The effect of carbonic anhydrase on the kinetics and equilibrium of the oxygen isotope exchange in the CO2-H2O system: Implications for δ18O vital effects in biogenic carbonates

    Science.gov (United States)

    Uchikawa, Joji; Zeebe, Richard E.

    2012-10-01

    Interpretations of the primary paleoceanographic information recorded in stable oxygen isotope values (δ18O) of biogenic CaCO3 can be obscured by disequilibrium effects. CaCO3 is often depleted in 18O relative to the δ18O values expected for precipitation in thermodynamic equilibrium with ambient seawater as a result of vital effects. Vital effects in δ18O have been explained in terms of the influence of fluid pH on the overall δ18O of the sum of dissolved inorganic carbon (DIC) species (often referred to as "pH model") and in terms of 18O depletion as a result of the kinetic effects associated with CO2 hydration (CO2 + H2O ↔ H2CO3 ↔ HCO3- + H+) and CO2 hydroxylation (CO2 + OH- ↔ HCO3-) in the calcification sites (so-called "kinetic model"). This study addresses the potential role of an enzyme, carbonic anhydrase (CA), that catalyzes inter-conversion of CO2 and HCO3- in relation to the underlying mechanism of vital effects. We performed quantitative inorganic carbonate precipitation experiments in order to examine the changes in 18O equilibration rate as a function of CA concentration. Experiments were performed at pH 8.3 and 8.9. These pH values are comparable to the average surface ocean pH and elevated pH levels observed in the calcification sites of some coral and foraminiferal species, respectively. The rate of uncatalyzed 18O exchange in the CO2-H2O system is governed by the pH-dependent DIC speciation and the kinetic rate constant for CO2 hydration and hydroxylation, which can be summarized by a simple mathematical expression. The results from control experiments (no CA addition) are in agreement with this expression. The results from control experiments also suggest that the most recently published kinetic rate constant for CO2 hydroxylation has been overestimated. When CA is present, the 18O equilibration process is greatly enhanced at both pH levels due to the catalysis of CO2 hydration by the enzyme. For example, the time required for 18O

  2. Palaeoclimatic information from deuterium and oxygen-18 in carbon-14-dated north Saharian groundwaters. Groundwater formation in the past

    International Nuclear Information System (INIS)

    A statistical presentation of 14C groundwater ages for various regions of the northern Sahara reflects the alternating sequence of humid and arid periods in the late Pleistocene and Holocene. Groundwaters older than 20,000 years BP are found all over the Sahara. Isoline-presentation of the continental effect in deuterium and oxygen-18 of Saharian groundwater is similar to the one in modern European groundwater. This similarity proves the Western Drift influence when, in the past, winter rain was sufficient for groundwater formation in the Sahara (great pluvial). The postpluvial humid phases of the Sahara during the Holocene were probably of decreasing importance from west to east. The lower deuterium excess d=deltaD - 8xdelta18O observed in old Saharian groundwaters is interpreted to be due to a lower moisture deficit of the air over the ocean during the last ice-age. Extremely high D and 18O contents of modern groundwater in the Sahel zone south of the Sahara are probably due to summer rain originating from tropical rain forest evapotranspiration. (author)

  3. Stable isotope composition of inorganic carbonates from Lake Abiyata (Ethiopia): Attempt of reconstructing δ18O palaeohydrological changes during the Holocene

    International Nuclear Information System (INIS)

    Due to the sensitivity of its regional climate to the African monsoon seasonal shifting, Ethiopia has been designated as a key site for palaeoenvironmental reconstructions mainly within the IGBP-PAGES-PEPIII programme. Under the French-Ethiopian ERICA project, we focused on Lake Abiyata located in the Ziway-Shala basin (Central Ethiopia) which has experienced several lacustrine highstands during the Late Pleistocene and Holocene. At present, Lake Abiyata is a closed lake with a very flat catchment area, and corresponds to a half, deep graben infilled by 600-m of sedimentary deposits. In 1995, a 12.6-m-long sequence ABII was cored in Lake Abiyata. A reliable 14C-AMS chronology was defined on both organic matter and inorganic carbonates. Both the modern hydrologeological and geochemical balances of the 'groundwater-lake' system indicate that (i) carbonate cristallization mainly occurs at the water-sediment interface via the mixing of lake water and 14C-depleted groundwaters, and that (ii) modern algae form in equilibrium with the atmospheric reservoir. Phytoplankton is thus considered as an authigenic material, and Core ABII has registered 13,500 cal. yr B.P. of environmental history. The evidence of calcite precipitation at the water-sediment interface calls into question the direct palaeoclimatic reconstruction based on inorganic carbonates. Since the evolution of isotopic contents of carbonates might be linked to the variable proportion of the 'lake/groundwater' end-members in the mixing, calculations based on isotopic mass balance models may allow for the reconstruction of δ18O composition of the lake water. Two major changes can be highlighted: (i) the ∼12,000-5500 cal. yr B.P. period is associated to low 18O contents of lake water, and corresponds to an open hydrological system, with a high lacustrine phytoplanktonic productivity, and (ii) from ∼5500 cal. yr B.P. to Present, regressive conditions are suggested by the δ18O enrichment of the lake water

  4. Low-energy (30 keV) carbon ion induced mutation spectrum in the LacZα gene of M13mp18 double-stranded DNA

    International Nuclear Information System (INIS)

    Double-stranded M13mp18 DNA was irradiated with 30 keV carbon ions in dry state under vacuum to investigate the low-energy heavy ion induced mutation spectra. When the irradiated DNA was used to transfect Escherichia coli JM105, 3.6-5.7-fold increases in mutation frequency were observed, in contrast to the spontaneous group. Sequences of the 92 induced mutants showed that the carbon ions in this study could induce an interesting mutation spectrum in the lacZα gene. One-base mutations (96.8%) and base pair substitutions (56.4%) were predominant, most of which involved G:C base pairs (90.6%), especially G:C → T:A transversions (49.6%) and G:C → A:T transitions (39.6%). This is similar to the spectra induced by γ-rays in the same ds M13, wild type E. coli system. We also found a considerable amount of carbon ion induced one-base deletion (38.5%) and the mutation sites distribution on the target lacZα gene was obviously non-random. We compared this study with previous data employing γ-rays to discuss the possible causes of the mutation spectrum

  5. High sensitivity Cavity Ring Down spectroscopy of 18O enriched carbon dioxide between 5850 and 7000 cm-1: Part III-Analysis and theoretical modeling of the 12C17O2, 16O12C17O, 17O12C18O, 16O13C17O and 17O13C18O spectra

    CERN Document Server

    Karlovets, E V; Mondelain, D; Kassi, S; Tashkun, S A; Perevalov, V I

    2014-01-01

    More than 19,700 transitions belonging to 11 isotopologues of carbon dioxide have been assigned in the room temperature absorption spectrum of highly 18O enriched carbon dioxide recorded by very high sensitivity CW-Cavity Ring Down spectroscopy between 5851 and 6990 cm-1 (1.71-1.43 \\mum). This third and last report is devoted to the analysis of the bands of five 17O containing isotopologues present at very low concentration in the studied spectra: 16O12C17O, 17O12C18O, 16O13C17O, 17O13C18O and 12C17O2 (627, 728, 637, 738 and 727 in short hand notation). On the basis of the predictions of effective Hamiltonian models, a total of 1759, 1786, 335, 273 and 551 transitions belonging to 24, 24, 5, 4 and 7 bands were rovibrationally assigned for 627, 728, 637, 738 and 727, respectively. For comparison, only five bands were previously measured in the region for the 728 species. All the identified bands belong to the \\deltaP=8 and 9 series of transitions, where P=2V1+V2+3V3 is the polyad number (Vi are vibrational qua...

  6. Carbon black and vapor grown carbon fibers binary conductive additive for the Li1.18Co0.15Ni0.15Mn0.52O2 electrodes for Li-ion batteries

    International Nuclear Information System (INIS)

    Carbon black (CB) and vapor-grown carbon fibers (VGCFs) are used as conductive additives for the Li1.18Co0.15Ni0.15Mn0.52O2 electrodes for Li-ion batteries. The fibrous VGCFs can bridge the isolated Li1.18Ni0.15Co0.15Mn0.52O2 regions, thus construct an effective conductive network for electron transport. In addition, incorporation of CB and VGCFs can improve the electrochemical kinetics of the cathode material by retarding the harmful side reactions, promoting the charge transfer reactions and increasing the apparent lithium diffusion coefficient. In all electrodes under investigation, the one prepared with 3 wt.% of VGCFs and 12 wt.% of CB shows the largest discharge capacity of 252 mAh g−1 at the 0.2C rate with excellent capacity retention and rate capability. - Highlights: • CB/VGCFs binary conductive additive is used for Li-excess layered cathode electrode. • The binary conductive additive constructs a continuous network for electron transport. • The binary conductive additive improves the electrochemical kinetics of the electrode. • Improved electrochemical performance is gained using the binary conductive additive

  7. Polyamine-Cladded 18-Ring-Channel Gallium Phosphites with High-Capacity Hydrogen Adsorption and Carbon Dioxide Capture.

    Science.gov (United States)

    Sie, Ming-Jhe; Lin, Chia-Her; Wang, Sue-Lein

    2016-06-01

    In this study, we synthesized a unique inorganic framework bearing the largest 18-membered-ring channels in gallium phosphites, denoted as NTHU-15, which displayed genuine porosity even though large organic templates were present. The idea of using the "template-cladded" strategy succeeded in releasing channel space of up to ∼24% of the unit-cell volume as highly positive-charged organic templates were manipulated to cling to the anionic inorganic walls. NTHU-15 showed both high H2 uptake of 3.8 mmol/g at 77 K and effective CO2 adsorption of ∼2.4 mmol/g at 298 K, which surpassed those of all other known extra-large-channel inorganic framework structures. NTHU-15 has been successful at overcoming the long-standing problem of organic-templated extra-large-channel structures as opposed to a "true open" framework. Moreover, it realized practical gas sorption functionality in innovated metal phosphites. In view of its high stability in hot water and high selectivity for CO2 adsorption, NTHU-15 may be the first novel inorganic framework material to be applied to the field of flue gas cleaning. PMID:27181272

  8. Recharge areas and hydrochemistry of carbonate springs issuing from Semmering Massif, Austria, based on long-term oxygen-18 and hydrochemical data evidence

    Science.gov (United States)

    Yehdegho, Beyene; Reichl, Peter

    2002-10-01

    Résumé. Les teneurs en oxygène-18 et l'hydrochimie des sources émergeant du massif de Semmering ont été suivies de manière intensive dans le but de caractériser les zones de recharge et l'évolution hydrochimique. L'effet d'altitude sur le δ18O a été déterminé grâce aux données isotopiques et hydrogéologiques de petites sources de référence, principalement en terrains cristallins; cet effet est d'environ -0,27 et -0,21‰ par 100 m pour les versants respectivement nord et sud du massif. En appliquant ces valeurs, l'altitude moyenne de recharge des sources a été calculée. Pour les sources à fort débit issues des carbonates, elle est comprise entre 1,100 et 1,400 m, compatible avec le cadre topographique et hydrogéologique des calcaires et des dolomies de l'Austro-alpin inférieur alimentant ces sources. La composition chimique des sources des carbonates est dominée par les ions Ca2+, Mg2+, HCO3- et SO42-. Les sources sont presque toutes proches de la saturation par rapport à la calcite, mais sont sous-saturées en dolomite (sauf quelques sources proches de la saturation). Comme cela est habituel en ce qui concerne le dioxyde de carbone fourni par les sols en régions montagneuses, la pCO2 équilibrante moyenne est faible, comprise entre 10-3.0 et 10-2.5 atm (0,1 à 0,3% en volume). En ce qui concerne les variations à long terme, le pH, SIc, Sid et la pCO2 équilibrante sont soumis à des variations saisonnières, alors que les concentrations en Ca2+, Mg2+ et HCO3- ne varient pratiquement pas. En intégrant les résultats de δ18O et les données hydrochimiques, la variabilité altitudinale du chimisme des eaux souterraines des carbonates est démontrée. Reflétant les variations d'activité biologique et des conditions de recharge dans les zones d'alimentation, une covariation négative résulte de l'altitude de recharge et de la pCO2 et la concentration en HCO3- n'est pas modifiée par aucun des termes source ou puits, ce qui fait varier

  9. Recharge areas and hydrochemistry of carbonate springs issuing from Semmering Massif, Austria, based on long-term oxygen-18 and hydrochemical data evidence

    Science.gov (United States)

    Yehdegho, Beyene; Reichl, Peter

    2002-10-01

    Résumé. Les teneurs en oxygène-18 et l'hydrochimie des sources émergeant du massif de Semmering ont été suivies de manière intensive dans le but de caractériser les zones de recharge et l'évolution hydrochimique. L'effet d'altitude sur le δ18O a été déterminé grâce aux données isotopiques et hydrogéologiques de petites sources de référence, principalement en terrains cristallins; cet effet est d'environ -0,27 et -0,21‰ par 100 m pour les versants respectivement nord et sud du massif. En appliquant ces valeurs, l'altitude moyenne de recharge des sources a été calculée. Pour les sources à fort débit issues des carbonates, elle est comprise entre 1,100 et 1,400 m, compatible avec le cadre topographique et hydrogéologique des calcaires et des dolomies de l'Austro-alpin inférieur alimentant ces sources. La composition chimique des sources des carbonates est dominée par les ions Ca2+, Mg2+, HCO3- et SO42-. Les sources sont presque toutes proches de la saturation par rapport à la calcite, mais sont sous-saturées en dolomite (sauf quelques sources proches de la saturation). Comme cela est habituel en ce qui concerne le dioxyde de carbone fourni par les sols en régions montagneuses, la pCO2 équilibrante moyenne est faible, comprise entre 10-3.0 et 10-2.5 atm (0,1 à 0,3% en volume). En ce qui concerne les variations à long terme, le pH, SIc, Sid et la pCO2 équilibrante sont soumis à des variations saisonnières, alors que les concentrations en Ca2+, Mg2+ et HCO3- ne varient pratiquement pas. En intégrant les résultats de δ18O et les données hydrochimiques, la variabilité altitudinale du chimisme des eaux souterraines des carbonates est démontrée. Reflétant les variations d'activité biologique et des conditions de recharge dans les zones d'alimentation, une covariation négative résulte de l'altitude de recharge et de la pCO2 et la concentration en HCO3- n'est pas modifiée par aucun des termes source ou puits, ce qui fait varier

  10. Effects of carbon nanomaterials fullerene C60 and fullerol C60(OH)18–22 on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    International Nuclear Information System (INIS)

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C60), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C60(OH)18–22), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO·) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO· in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen (1O2) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p 1O2 generation; and (3) fullerol also decreased GCL activity and GSH formation (p 1O2 formation.

  11. Pathway focused protein profiling indicates differential function for IL-1B, -18 and VEGF during initiation and resolution of lung inflammation evoked by carbon nanoparticle exposure in mice

    Directory of Open Access Journals (Sweden)

    Hamelmann Eckard

    2009-12-01

    Full Text Available Abstract Background Carbonaceous nanoparticles possess an emerging source of human exposure due to the massive release of combustion products and the ongoing revolution in nanotechnology. Pulmonary inflammation caused by deposited nanoparticles is central for their adverse health effects. Epidemiological studies suggest that individuals with favourable lung physiology are at lower risk for particulate matter associated respiratory diseases probably due to efficient control of inflammation and repair process. Therefore we selected a mouse strain C3H/HeJ (C3 with robust lung physiology and exposed it to moderately toxic carbon nanoparticles (CNP to study the elicited pulmonary inflammation and its resolution. Methods 5 μg, 20 μg and 50 μg CNP were intratracheally (i.t. instilled in C3 mice to identify the optimal dose for subsequent time course studies. Pulmonary inflammation was assessed using histology, bronchoalveolar lavage (BAL analysis and by a panel of 62 protein markers. Results 1 day after instillation of CNP, C3 mice exhibited a typical dose response, with the lowest dose (5 μg representing the 'no effect level' as reflected by polymorphonuclear leucocyte (PMN, and BAL/lung concentrations of pro-inflammatory proteins. Histological analysis and BAL-protein concentration did not reveal any evidence of tissue injury in 20 μg CNP instilled animals. Accordingly time course assessment of the inflammatory response was performed after 3 and 7 days with this dose (20 μg. Compared to day 1, BAL PMN counts were significantly decreased at day 3 and completely returned to normal by day 7. We have identified protein markers related to the acute response and also to the time dependent response in lung and BAL. After complete resolution of PMN influx on day 7, we detected elevated concentrations of 20 markers that included IL1B, IL18, FGF2, EDN1, and VEGF in lung and/or BAL. Biological pathway analysis revealed these factors to be involved in a

  12. Partitioning Net Ecosystem Carbon Exchange Into net Assimilation and Respiration With Canopy-scale Isotopic Measurements: an Error Propagation Analysis With Both 13C and 18O Data

    Science.gov (United States)

    Peylin, P.; Ogee, J.; Cuntz, M.; Bariac, T.; Ciais, P.; Brunet, Y.

    2003-12-01

    Stable CO2 isotope measurements are increasingly used to partition the net CO2 exchange between terrestrial ecosystems and the atmosphere in terms of non-foliar respiration (FR) and gross photosynthesis (FA). However the accuracy of the partitioning strongly depends on the isotopic disequilibrium between these two gross fluxes and a rigorous estimation of the errors on FA and FR is needed. In this study we account and propagate uncertainties on all terms in the mass balance equations for total and "labeled" CO2 in order to get precise estimates of the errors on FA and FR. We applied our method to a maritime pine forest in the Southwest of France. Using the δ 13C-CO2 and CO2 measurements, we show that the resulting uncertainty associated to the gross fluxes can be as large as 4 æmol m-2 s-1. In addition, even if we could get more precise estimates of the isoflux and the isotopic signature of FA we show that this error would not be significantly reduced. This is because the isotopic disequilibrium between FA and FR is around 2-3‰ , i.e. the order of magnitude of the uncertainty on the isotopic signature of FR (δ R). With δ 18O-CO2 and CO2 measurements, the uncertainty associated to the gross fluxes lies also around 4 æmol m-2 s-1. On the other hand, it could be dramatically reduced if we were able to get more precise estimates of the CO18O isoflux and the associated discrimination during photosynthesis. This is because the isotopic disequilibrium between FA and FR is large, of the order of 10-15‰ , i.e. much larger than the uncertainty on δ R. The isotopic disequilibrium between FA and FR or the uncertainty on δ R vary among ecosystems and over the year. Our approach may help to choose the best strategy to study the carbon budget of a given ecosystem using stable isotopes.

  13. Combined δ11B, δ13C, and δ18O analyses of coccolithophore calcite constrains the response of coccolith vesicle carbonate chemistry to CO2-induced ocean acidification

    Science.gov (United States)

    Liu, Yi-Wei; Tripati, Robert; Aciego, Sarah; Gilmore, Rosaleen; Ries, Justin

    2016-04-01

    Coccolithophorid algae play a central role in the biological carbon pump, oceanic carbon sequestration, and in marine food webs. It is therefore important to understand the potential impacts of CO2-induced ocean acidification on these organisms. Differences in the regulation of carbonate chemistry, pH, and carbon sources of the intracellular compartments where coccolith formation occurs may underlie the diverse calcification and growth responses to acidified seawater observed in prior experiments. Here we measured stable isotopes of boron (δ11B), carbon (δ13C) and oxygen (δ18O) within coccolith calcite, and δ13C of algal tissue to constrain carbonate system parameters in two strains of Pleurochrysis carterae (P. carterae). The two strains were cultured under variable pCO2, with water temperature, salinity, dissolved inorganic carbon (DIC), and alkalinity monitored. Notably, PIC, POC, and PIC/POC ratio did not vary across treatments, indicating that P. carterae is able to calcify and photosynthesize at relatively constant rates irrespective of pCO2 treatment. The δ11B data indicate that mean pH at the site of coccolith formation did not vary significantly in response to elevated CO2. These results suggest that P. carterae regulates calcifying vesicle pH, even amidst changes in external seawater pH. Furthermore, δ13C and δ18O data suggest that P. carterae may utilize carbon from a single internal DIC pool for both calcification and photosynthesis, and that a greater proportion of dissolved CO2 relative to HCO3‑ enters the internal DIC pool under acidified conditions. These results suggest that P. carterae is able to calcifyand photosynthesize at relatively constant rates across pCO2 treatments by maintaining pH homeostasis at their site of calcification and utilizing a greater proportion of aqueous CO2.

  14. 纯牛奶中18碳TFA及9c,11 t-CLA含量的测定研究%Study on 18-carbon trans fatty acid and 9c,11t-conjugated linoleic acid contents in milk

    Institute of Scientific and Technical Information of China (English)

    章萍萍; 赵培城

    2010-01-01

    为了精确测量出纯牛奶中18碳TFA及9c,11t-CLA的含量,本实验通过毛细管气相色谱法,并采用内标法,对纯牛奶进行了检测,结果显示,纯牛奶中18碳脂肪酸的质量百分比约为35.43% ,18碳TFA的质量百分比约为2.27%,而其中C18:1-llt的质量百分比达到1.28%,占所有18碳TFA的一半以上,约为56.36%,同时,牛奶中C18:2 -9c,11t的质量百分比只为0.11%,其含量远少于TFA.

  15. Glacial- interglacial temperature change based on 13C18O carbonate bond with in fish bone otoliths from Red Sea sediments

    Science.gov (United States)

    Ghosh, P.; Eiler, J.; Feeney, R.

    2006-12-01

    Determining the past record of temperature and salinity of ocean surface waters is essential for understanding past changes in climate, such as those which occur across glacial-interglacial transitions. As a useful proxy, the clumped isotope of CO2 in carbonate (13C18O16O or ?47) from inorganic precipitation experiment has been shown to reflect surface temperature with high degree of confidence (Ghosh et al., 2006). The last glacial cycle was characterized by climate fluctuations, but the extent of any associated changes in global sea level (or, equivalently, ice volume) remains elusive. High stands of sea level can be reconstructed from dated fossil and isotopic analyses of foraminifera and terapods, and these data are complemented by a compilation of global sea-level estimates based on deep-sea oxygen isotope ratios. Salinity derived from the records of oxygen isotopes ratios, however, contains uncertainties due to lack of information about the sea surface temperature change. Here we used combination of clumped isotopes technique and oxygen isotope measurement from fish otoliths (Myctophiformes; lanternfishes) extracted from two piston cores (Ku et al., 1969) (CH-154 and CH-153) to understand the temperature evolution and salinity variation of Red Sea water (300-800m) during the last 70 k.y. We analyzed well preserved unaltered otoliths from 7 different stratigraphic horizons from sediment core CH-154. Our preliminary observation suggests ~20 degree Celsius differences in sea water temperatures between glacial and interglacial time. We showed that the region has experienced fluctuation in climatic and tectonic processes during glacial interglacial time and the otoliths developed within the fishes captured the information about temperature change and salinity variation. Our results indicate a drop in temperature and restricted exchange of water with the open ocean during glaciations. The Red Sea environment was also highly saline even during the interglacial event

  16. Constraints on the factors controlling 13C-18O bond abundances in biologically precipitated carbonates from measurements of marine calcifiers cultured at variable temperature, pH, and salinity

    Science.gov (United States)

    Conchas, T. E.; Eagle, R.; Eiler, J. M.; Ries, J. B.; Freitas, P. S.; Hiebenthal, C.; Wanamaker, A. D.; Tripati, A. K.

    2012-12-01

    Marine mollusks and corals are widely used as archives of past climate change; oxygen isotopic composition (δ18O value) of their carbonate minerals is perhaps the most commonly used proxy to reconstruct paleoclimate from these marine calcifiers. However, oxygen isotope paleothermometry of mollusks and corals is complicated by non-equilibrium "vital effects" and variations in seawater pH changes, both of which influence the net fractionation of oxygen isotopes between carbonate and water. Carbonate "clumped isotope" thermometry is an emerging approach that potentially addresses these ambiguities. Here we report measurements of abundance of 13C-18O bonds (described by the measured parameter Δ47) in a variety of marine calcifiers cultured under controlled conditions. Previous studies on biologically precipitated samples such as foraminifera, coccoliths, and corals have shown that Δ47 values are related to calcification temperature with a relationship that is generally similar to inorganic carbonate. However, the influence of effects other than temperature has not been extensively studied and little work has been done to explore the potential for small non-equilibrium effects in cultured specimens that were grown under controlled conditions. In this study, we report δ18O and Δ47 measurements of mollusk specimens that were cultured at several temperatures ranging from 5 to 25°C, as well as different pH and salinity values. We also report data for other marine calcifiers including the temperate coral species Oculina arbuscula and the coralline red algae Neogoniolithon sp., that were cultured at a single temperature but variable pH.

  17. Synthesis and carbon-11-labeling of p-MeO-SSR180575, a novel indoleacetamide-based candidate for PET imaging of the peripheral benzodiazepine receptor (TSPO 18 kDa)

    International Nuclear Information System (INIS)

    Complete text of publication follows: Objectives: The 3-iso-quinolinecarboxamide [11C]PK11195, despite its low brain uptake and high level of nonspecific binding, is still the most widely used PET-radioligand for the in vivo imaging of the peripheral benzodiazepine receptor (PBR or TSPO 18 kDa). Several new PBR radioligands are currently developed to replace [11C]PK11195, e.g the pyrazolo[1, 5-a]pyrimidine-acetamides [11C]DPA-713 and [18F]DPA-714, the imidazo[1, 2-a]pyridine-acetamides [11C]CLINME and [18F]PBR111 and the N-benzyl-N-(2-phenoxy-aryl)- acetamides [11C]PBR28 and [18F]FEDAA1106. Another attractive newly identified chemical class of structures are the indole-acetamides and notably compounds derived from the lead compound SSR180575. Herein are reported the synthesis and the labelling with the positron-emitter carbon-11 (half-life: 20.38 min) of a novel derivative of SSR180575, bearing a para methoxy function on its phenyl ring. Methods: p-MeO-SSR180575 (1) was synthesized from commercially available 4-chloro-2-nitrotoluene in 10 steps. O-demethylation, performed with a boron tribromide solution in dichloromethane at low temperature, afforded the free phenol derivative 2. Carbon-11 labeling of p-MeO-SSR180575 (1) was performed using a TRACERLab FX-C Pro synthesizer (GEMS) and comprised (1) trapping of [11C]MeOTf at -10 C in acetone (0.3 mL) containing the nor-derivative 2 (O-demethylated, 0.6-0.9 mg) and aq. 3N NaOH (8 μL); (2) heating at 110 C for 2 min; (3) concentration to dryness and taking up the residue in 1.0 mL of the HPLC mobile phase; (4) purification using semi-preparative reversed-phase HPLC (Waters Symmetry C-18 - eluent: CH3CN / H2O / TFA: 50 / 50 / 0.1 (v:v:v) - flow rate: 5 mL/min - detection at 254 nm) and (5) SepPakR Plus C-18-based formulation for i.v. injection. Results: p-MeO-SSR180575 (1) was obtained in 10% overall yield. The tricky and low-yielding step in our approach was the pyridazine ring formation reaction that proceeded

  18. Evaluation of fused-core and monolithic versus porous silica-based C18 columns and porous graphitic carbon for ion-pairing liquid chromatography analysis of catecholamines and related compounds.

    Science.gov (United States)

    Chirita, Raluca-Ioana; Finaru, Adriana-Luminita; Elfakir, Claire

    2011-03-15

    This paper evaluates the performances of reversed-phase (RPLC) and ion-pairing chromatography (IPLC) coupled with UV detection for the analysis of a set of 12 catecholamines and related compounds. Different chromatographic columns (porous C18-silica, perfluorinated C18-silica, porous graphitic carbon, monolithic and fused-core silica-based C18 columns) were tested using semi-long perfluorinated carboxylic acids as volatile ion-pairing reagents. Much more promising results were obtained by IPLC than by RPLC and important improvements in analytes peak symmetry and separation resolution were observed when using the "fast chromatography" columns (monolithic and fused-core C18) under IPLC conditions. For UV detection, a satisfactory separation of the 12 selected analytes was achieved in less than 20 min by using a fused-core particles column (Halo C18) and a mobile phase composed of a 1.25 mM nonafluoropentanoic acid aqueous solution and methanol under gradient elution mode. The chromatographic method developed can be directly coupled with electrospray ionization tandem mass spectrometry (ESI-MS/MS) in positive ionization mode and 10 solutes among those selected can be observed. The presence of the acidic ion-pairing reagent in the mobile phase makes this system incompatible with negative ionization mode and thus unable to detect the two acidic compounds that only responded in negative mode. In terms of MS detection, Monolithic C18 column proved to be the best one to reach the lowest detection limits (LODs) (from 0.5 ngmL(-1) to 10 ngmL(-1) depending on the neurotransmitter). The applicability of the optimized LC-MS/MS method to a "real world" sample was finally evaluated. The presence of the matrix leads to signal suppression for several solutes and thus to higher LODs. PMID:21345749

  19. Re-sampling of carbon stocks in forest soils and afforestation areas after 18 years – results from the 7x7 km Kvadratnet in Denmark

    DEFF Research Database (Denmark)

    Callesen, Ingeborg; Vesterdal, Lars; Stupak, Inge; Georgiadis, Petros; Johannsen, Vivian Kvist

    Forest soil plots (N=112) of the size 50x50 meter were sampled in 1989-90 (C1) and re-sampled in 2007-9 (C2) by soil auger, producing composite samples from the depths 0-25, 25-50, 50-75 and 75-100 cm. The soils were classified according to the carbon concentration in the uppermost mineral soil...

  20. Cocatalyzed oxidation of carbon monoxide and triphenylphosphine using complexes derived from hexarhodium hexadecacarbonyl as homogeneous catalyst. Characterization of rhodium carbonyl intermediates, oxygen-18 labeling to identify oxygen atom sources, and observation of catalyzed oxygen atom exchange between carbon dioxide and water

    International Nuclear Information System (INIS)

    Hexarhodium hexadecacarbonyl, Rh6(CO)16, will cocatalyze a reaction with molecular oxygen involving the conversion both of carbon monoxide to carbon dioxide and of triphenylphosphine (PPh3) to triphenylphosphine oxide (OPPh3). Solution infrared spectroscopy in the carbonyl region in benzene solvent shows that the catalytic cycle passes through the red Rh2(CO)2-(PPh3)4(C6H6)2, the yellow Rh2(CO)6(PPh3)2, and the red Rh4(CO)10(PPh3)2. Final return to Rh6(CO)16 does not occur under the ambient temperature and pressure conditions used but can be achieved by elevating these conditions. Addition of carbon dioxide to a mixture of Rh6(CO)16, CO, and PPh3 in the presence of added 18OH2 shows that the rhodium compounds will catalyze oxygen exchange between carbon dioxide and the oxygen atom of water. A pathway for equilibration of oxygen isotope in the catalyzed conversion of coordinated carbonyl to carbon dioxide via metallocarboxylate intermediates is proposed. The equilibration of oxygen isotope from water into carbon dioxide catalyzed by rhodium carbonyl clusters is suggested to proceed via hydroxyrhodium intermediates. 3 figures, 3 tables

  1. δ18O water isotope in the iLOVECLIM model (version 1.0 – Part 3: A paleoperspective based on present-day data-model comparison for oxygen stable isotopes in carbonates

    Directory of Open Access Journals (Sweden)

    T. Caley

    2013-03-01

    Full Text Available Oxygen stable isotopes (18O are among the most usual tools in paleoclimatology/paleoceanography. Simulation of oxygen stable isotopes allows testing how the past variability of these isotopes in water can be interpreted. By modelling the proxy directly in the model, the results can also be directly compared with the data. Water isotopes have been implemented in the global three-dimensional model of intermediate complexity iLOVECLIM allowing fully coupled atmosphere-ocean simulations. In this study, we present the validation of the model results for present day climate against global database for oxygen stable isotopes in carbonates. The limitation of the model together with the processes operating in the natural environment reveal the complexity of use the continental calcite 18O signal of speleothems for a data-model comparison exercise. On the contrary, the reconstructed surface ocean calcite δ18O signal in iLOVECLIM does show a very good agreement with late Holocene database (foraminifers at the global and regional scales. Our results indicate that temperature and the isotopic composition of the seawater are the main control on the fossil δ18O signal recorded in foraminifer shells and that depth habitat and seasonality play a role but have secondary importance. We argue that a data-model comparison for surface ocean calcite δ18O in past climate, such as the last glacial maximum (≈21 000 yr, could constitute an interesting tool for mapping the potential shifts of the frontal systems and circulation changes throughout time. Similarly, the potential changes in intermediate oceanic circulation systems in the past could be documented by a data (benthic foraminifers-model comparison exercise whereas future investigations are necessary in order to quantitatively compare the results with data for the deep ocean.

  2. δ18O water isotope in the iLOVECLIM model (version 1.0 – Part 3: A palaeo-perspective based on present-day data–model comparison for oxygen stable isotopes in carbonates

    Directory of Open Access Journals (Sweden)

    T. Caley

    2013-09-01

    Full Text Available Oxygen stable isotopes (δ18O are among the most useful tools in palaeoclimatology/palaeoceanography. Simulation of oxygen stable isotopes allows testing how the past variability of these isotopes in water can be interpreted. By modelling the proxy directly in the model, the results can also be directly compared with the data. Water isotopes have been implemented in the global three-dimensional model of intermediate complexity iLOVECLIM, allowing fully coupled atmosphere–ocean simulations. In this study, we present the validation of the model results for present-day climate against the global database for oxygen stable isotopes in carbonates. The limitation of the model together with the processes operating in the natural environment reveal the complexity of use the continental calcite-δ18O signal of speleothems for a global quantitative data–model comparison exercise. On the contrary, the reconstructed surface ocean calcite-δ18O signal in iLOVECLIM does show a very good agreement with the late Holocene database (foraminifers at the global and regional scales. Our results indicate that temperature and the isotopic composition of the seawater are the main control on the fossil-δ18O signal recorded in foraminifer shells when all species are grouped together. Depth habitat, seasonality and other ecological effects play a more significant role when individual species are considered. We argue that a data–model comparison for surface ocean calcite δ18O in past climates, such as the Last Glacial Maximum (≈ 21 000 yr, could constitute an interesting tool for mapping the potential shifts of the frontal systems and circulation changes throughout time. Similarly, the potential changes in intermediate oceanic circulation systems in the past could be documented by a data (benthic foraminifers-model comparison exercise whereas future investigations are necessary in order to quantitatively compare the results with data for the deep ocean.

  3. WA18

    CERN Multimedia

    1977-01-01

    Front view. The target plates are cut from marble (3x3 m slabs surrounded by magnetized iron) and allow the use of the calorimeter as a muon polarimeter. WA18 was CHARM, the experiment of the CERN-Hamburg-Amsterdam-Rome(INFN)-Moskow(ITEP) Collaboration

  4. Paragraf 18

    DEFF Research Database (Denmark)

    Lundgaard Andersen, Linda; Neerup, Stine; Cauchi, Pernille

    Redegørelsen tegner et aktuelt billede af bredden og variationen af samarbejdet mellem de frivillige sociale foreninger og kommuner i fem udvalgte kommuner. Den giver et billede af hvilke opgaver der varetages inden for det frivillige sociale arbejde, støttet gennem § 18 midler i serviceloven og...

  5. The effect of nitrogen and vanadium on hardenability of medium carbon 0.4 %C and 1.8 %Cr steel

    Directory of Open Access Journals (Sweden)

    R. Staoeko

    2008-10-01

    Full Text Available Purpose: To investigate the effect of V and N on hardenability of steel containing 0.4 % C and 1.8 % Cr.Design/methodology/approach: Four laboratory melts with different N and V contents were used. Hardenability of steel was investigated using standard Jominy test and Grossmann analytical method. The effect of calculated undissolved carbonitride V(C,N content on austenite grain size was investigated.Findings: Nitrogen addition without microalloying elements increased the austenite grain size. Very high hardenability was obtained in steel containing 0.004 %N and 0.08 %V at 870oC. Addition of 0.08 %V at elevated nitrogen content significantly decreased the grain size and at 870oC increased the hardenability of steel.Practical implications: Investigated steel showed very high hardenability with ideal critical diameter DiJ approximately 200 mm, at appropriate austenitizing temperature. Higher nitrogen content in steel with vanadium addition retards austenite grain growth in broad austenitizing temperature range.Originality/value: Results of investigations provide valuable information on the effect of vanadium and nitrogen content on the hardenability of quenched and tempered steel with 1.8 % Cr. Thermodynamic calculations enable to select the optimum austenitizing temperature range.

  6. Carbon Tetrachloride Flow and Transport in the Subsurface of the 216-Z-18 Crib and 216-Z-1A Tile Field at the Hanford Site: Multifluid Flow Simulations and Conceptual Model Update

    Energy Technology Data Exchange (ETDEWEB)

    Oostrom, Mart; Rockhold, Mark L.; Thorne, Paul D.; Last, George V.; Truex, Michael J.

    2006-10-31

    Carbon tetrachloride (CT) was discharged to the 216-Z-9, Z-1A, and Z-18 waste sites that are included in the 200-PW-1 Operable Unit in Hanford 200 West Area. Fluor Hanford, Inc. is conducting a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) remedial investigation/feasibility study (RI/FS) for the 200-PW-1 Operable Unit. As part of this overall effort, Pacific Northwest National Laboratory (PNNL) was contracted to improve the conceptual model of how CT is distributed in the Hanford 200 West Area subsurface through use of numerical flow and transport modeling. This work supports the U.S. Department of Energy's (DOE's) efforts to characterize the nature and distribution of CT in the 200 West Area and subsequently select an appropriate final remedy.

  7. Monitoring bone and soft-tissue tumors after carbon-ion radiotherapy using 18F-FDG positron emission tomography: a retrospective cohort study

    International Nuclear Information System (INIS)

    The results of treatment for malignant bone and soft-tissue tumors arising from the deep trunk and pelvis are still not acceptable due to the relatively high recurrence and low overall survival rates. Recently, carbon ion radiotherapy (CIRT) was applied for several malignancies, including bone and soft-tissue sarcomas, and provided favorable results. However, it has been unclear what modalities should be used for evaluating the response and for the follow-up of these patients. Here, we analyzed the methods used to predict local recurrence and to find local failures or metastases. We analyzed 37 patients with bone and soft-tissue tumors who received CIRT at our institute. The patients were examined with FDG positron emission tomography (PET) and enhanced MRI before and three months after CIRT. The pre-treatment maximum standardized uptake value (SUVmax), and that three months after treatment, the difference between the pre- and post-CIRT SUVmax, the ratio of the post- to pre-SUVmax in FDG-PET and the size of the tumors were evaluated as predictors for local recurrence. FDG-PET and enhanced MRI were used to detect local recurrence. Local recurrence appeared in 10 cases after CIRT. Nine of the 10 lesions (90.0 %) were detected with FDG-PET, while enhanced MRI detected just 50.0 % of the recurrences. One case of local recurrence, in which the lesion was negative on FDG-PET, was detected using enhanced MRI. A receiver operating characteristic curve analysis showed that neither the SUVmax on FDG-PET nor the tumor size before or three months after CIRT could be used to predict local recurrence. The combination of FDG-PET and enhanced MRI is recommended to detect local recurrence for patients with sarcomas who have received CIRT; however, no parameters obtained during the examinations performed before and three months after CIRT accurately predicted the development of local recurrence

  8. 我国9省(市)3~18岁儿童青少年碳酸饮料消费现状分析%Analysis on status of carbonated beverage consumption among children and adolescents aged 3 -18 years in ;nine provinces of China

    Institute of Scientific and Technical Information of China (English)

    刘飒娜; 陶婉亭; 毛伟峰; 刘爱东; 刘兆平; 张兵

    2015-01-01

    Objective To learn status of carbonated beverage consumption among children and adolescents aged 3 -18 years in nine provinces of China and provide scientific evidence for instruction on soft drinks consumption of children and youth .Methods Multi-stage stratified random sampling method was used and 2585 children of youth aged 3 -18 years among 9 provinces were selected in 2013.Consumption data were collected by using consecutive 3 day 24h recalls and one month food frequency survey.Results Differences of consumption were found among 3 -18 years old children and youth regarding to both amout and frequency in nine provinces.Subjectives in urban areas have higher consumption ratio of 45.1%than those in rural area (χ2 =19.529,P <0.01).Children aged 7 -13 years have the highest consumption frequency of 1 -3 times per week in view of soda drinks,which is around 45.4%.Children and youth in urban area consumed higher amount of carbonated beverage than those in rural area (P < 0.05 ), which is 31.4mL/d and 15.1mL/d respectively.Meanwhile,male subjectives drank more carbonated beverage than female subjectives (P <0.05),which is 28.8 mL/d and 19.5 mL/d respectively.The average amount of consumption was highest in subjectives from families at mid-dle income level,followed by that of families at high and low income levels,which were 19.7 mL/d,28.5 mL/d and 19.2 mL/d respectively.Conclusion The consumption of carbonated beverage manifested an increasing trend among children and youth in China .Subsequently,effective intervention measures should be applied to instruct children and youth to select and consume carbonated beverage wisely.%目的:了解我国9省(市)3~18岁儿童青少年碳酸饮料消费现状,为指导我国儿童青少年饮料合理消费提供科学依据。方法采用多阶段分层随机整群抽样方法,2013年在我国9个省(市)选取了2585名3~18岁儿童青少年;消费量数据采用非连续3d 24h 回顾法和

  9. Partitioning net ecosystem carbon exchange into net assimilation and respiration with canopy-scale isotopic measurements: An error propagation analysis with 13CO2 and CO18O data

    Science.gov (United States)

    OgéE, J.; Peylin, P.; Cuntz, M.; Bariac, T.; Brunet, Y.; Berbigier, P.; Richard, P.; Ciais, P.

    2004-06-01

    Stable CO2 isotope measurements are increasingly used to partition the net CO2 exchange between terrestrial ecosystems and the atmosphere in terms of nonfoliar respiration (FR) and net photosynthesis (FA) in order to better understand the variations of this exchange. However, the accuracy of the partitioning strongly depends on the isotopic disequilibrium between these two gross fluxes, and a rigorous estimation of the errors on FA and FR is needed. In this study, we account for and propagate uncertainties on all terms in the mass balance and isotopic mass balance equations for CO2 in order to get accurate estimates of the errors on FA and FR. We apply our method to a maritime pine forest in the southwest of France. Nighttime Keeling plots are used to estimate the 13C and 18O isotopic signature of FR (δR), and for both isotopes the a priori uncertainty associated with this term is estimated to be around 2‰ at our site. Using δ13C-CO2 and [CO2] measurements, we then show that the uncertainty on instantaneous values of FA and FR can be as large as 4 μmol m-2 s-1. Even if we could get more accurate estimates of the net CO2 flux, the isoflux, and the isotopic signatures of FA and FR, this uncertainty would not be significantly reduced because the isotopic disequilibrium between FA and FR is too small, around 2-3‰. With δ18O-CO2 and [CO2] measurements the uncertainty associated with the gross fluxes lies also around 4 μmol m-2 s-1 but could be dramatically reduced if we were able to get more accurate estimates of the CO18O isoflux and the associated discrimination during photosynthesis. This is because the isotopic disequilibrium between FA and FR is large, of the order of 12-17‰. The isotopic disequilibrium between FA and FR and the uncertainty on δR vary among ecosystems and over the year. Our approach should help to choose the best strategy to study the carbon budget of a given ecosystem using stable isotopes.

  10. [18F]Fluoride recovery via gaseous [18F]HF

    DEFF Research Database (Denmark)

    Mathiessen, Bente; Jensen, Mikael; Zhuravlev, Fedor

    2011-01-01

    Acidification of target water with H2SO4 in a specially constructed glassy carbon/polyethylene apparatus allowed for recovery of up to 82% of [18F]fluoride as [18F]HF gas. The [18F]HF distillate was found to be acid-free but moist; when passed through a solution of tBuPh2SiOTf, it yielded [18F...

  11. Effects of carbon nanomaterials fullerene C{sub 60} and fullerol C{sub 60}(OH){sub 18-22} on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Socoowski Britto, Roberta; Longaray Garcia, Marcia; Martins da Rocha, Alessandra [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Artigas Flores, Juliana [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Pinheiro, Mauricio V. Brant [Departamento de Fisica, ICEx, Universidade Federal de Minas Gerais, MG (Brazil); Monserrat, Jose Maria [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Ribas Ferreira, Josencler L., E-mail: josenclerf@gmail.com [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil)

    2012-06-15

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C{sub 60}), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C{sub 60}(OH){sub 18-22}), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO{center_dot}) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO{center_dot} in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen ({sup 1}O{sub 2}) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p < 0.05) increase in lipid peroxidation (with greater damage under illumination), a decrease in GCL activity, and the depletion of GSH stocks (under illumination), all of which were attributed to {sup 1}O{sub 2} generation; and (3) fullerol also decreased GCL activity and GSH formation (p < 0.05) but without lipid damage. The overall results show that fullerene can be toxic with or without light incidence, whereas UV radiation seems to play a key role in the environmental toxicity of carbon NMs through {sup 1}O{sub 2} formation.

  12. Predictive value of 3'-deoxy-3'-[18F] fluorothymidine positron emission tomography/computed tomography for outcome of carbon ion radiotherapy in patients with head and neck mucosal malignant melanoma

    International Nuclear Information System (INIS)

    The purpose of this prospective study was to assess the prognostic value of 3'-deoxy-3'-[18F]fluorothymidine (FLT) positron emission tomography/computed tomography (PET/CT) for the outcome of carbon ion radiotherapy (CIRT) in patients with mucosal malignant melanoma (MMM) of the head and neck. Thirteen patients (69±13 years) with histologically proven MMM tumor were enrolled. CIRT was performed with a total dose of 57.6-64.0 gray equivalents per 16 fractions over a period of 4 weeks. FLT-PET/CT was performed before and again 1 month after CIRT. Tumor FLT uptake was quantitatively assessed using the maximum standardized uptake value (SUVmax). FLT-PET parameters [pre-CIRT SUVmax, post-CIRT SUVmax, and the reduction rate (RR)] and clinical parameters [age, gender, tumor site, tumor status, gross tumor volume (GTV), and regional lymph node involvement] were evaluated in relation to survival estimates. The follow-up period was 16.1±5.9 months for 9 deceased patients, and 36.7±7.9 months for 4 survivors. Pre-CIRT SUVmax of ≥4.3, age of ≥80 years old, sinonasal cavity tumor site, and GTV of ≥39 mL were found to be statistically significant prognostic factors for better overall survival. Pre-CIRT SUVmax of ≥5.0, age of ≥80 years old, sinonasal cavity tumor site, and the absence of regional lymph node involvement were statistically significant prognostic factors for better metastasis-free survival. RR of ≥35% and GTV of <73 mL were predictive of better local control. The present study indicated for the first time that in patients with the head and neck MMM, FLT-PET/CT imaging was useful for predicting the therapeutic outcome of CIRT. Our results will contribute to the establishment of an effective staging system for MMM based on prognostic factors, depending on treatment choice. (author)

  13. 40 CFR 86.316-79 - Carbon monoxide and carbon dioxide analyzer specifications.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Carbon monoxide and carbon dioxide... Test Procedures § 86.316-79 Carbon monoxide and carbon dioxide analyzer specifications. (a) Carbon monoxide and carbon dioxide measurements are to be made with nondispersive infrared (NDIR) an analyzers....

  14. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Atlantic Ocean from 2010-11-27 to 2013-02-18 (NODC Accession 0117059)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0117059 includes time series data collected from MOORINGS in the North Atlantic Ocean from 2010-11-27 to 2013-02-18 and retrieved during cruise...

  15. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 (NODC Accession 0084099)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0084099 includes time series data collected from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 and retrieved during cruise...

  16. Carbon Deposition and Sulfur Tolerant La0.4Sr0.5Ba0.1TiO3–La0.4Ce0.6O1.8 Anode Catalysts for Solid Oxide Fuel Cells

    International Nuclear Information System (INIS)

    Highlights: • Carbon deposition and sulfur tolerant perovskite LSBT–LDC anode was prepared. • LSBT–LDC showed higher electrochemical performance than LSBT anode in sour CH4. • The addition of LDC contributed to the removal of carbon deposition on anode. - Abstract: In this work, LSBT–LDC (La0.4Sr0.5Ba0.1TiO3–La0.4Ce0.6O1.8) was successfully prepared by impregnating LSBT and LDC solutions on porous YSZ matrix. The prepared anode material exhibited higher catalytic performance and better resistance against carbon deposition than LSBT anode material in 5000 ppm H2S containing methane. Electrochemical impedance spectra (EIS) characterizations revealed that the addition of LDC significantly reduces the activation polarization resistance. Energy-dispersive X-ray spectroscopy (EDX) results indicated that the distribution of impregnated oxides in the matrix was uniform. The results of X-ray photoelectron spectroscopy (XPS) and temperature-programed oxidation (TPO) indicated that LSBT–LDC anode could enhance the tolerance against carbon deposition. The gas chromatography (GC) analysis proved that the modification of LDC could effectively promote the activation of methane and contribute to remove carbon deposition formed on the catalyst simultaneously

  17. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the Hokusei Maru in the North Pacific Ocean from 1998-07-18 to 1998-08-18 (NODC Accession 0112239)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112239 includes chemical, discrete sample, physical and profile data collected from Hokusei Maru in the North Pacific Ocean from 1998-07-18 to...

  18. Global Carbon Cycle

    OpenAIRE

    Probst, Jean-Luc; Faure, Hugues; Veizer, Jan

    1999-01-01

    The European Union of Geosciences held its 9th biannual meeting in Strasbourg, March 23–27, 1997. During this meeting, Symposium N8 18, Global carbon Cycle, was held under the sponsorship of the IGCP 1 n8404 on the «Terrestrial Carbon in the past 125 Ka», the INQUA 2 Carbon Commission and the ESCOBA-Biosphere 3 project of the EC Environment and Climate Programme. The «Global Carbon Cycle» Symposium attracted 28 oral and poster presentations and about one hundred par...

  19. Selective determination of ascorbic acid with a novel hybrid material based 1-butyl-3-methylimidazolium tetrafluoroborate ionic liquid and the Dawson type ion [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} immobilized on glassy carbon

    Energy Technology Data Exchange (ETDEWEB)

    Ammam, Malika, E-mail: Malika.Ammam@uoit.c [Faculty of Science, University of Ontario Institute of Technology, 2000 Simcoe Street North, Oshawa, ON, L1H 7K4 (Canada); Easton, E. Bradley [Faculty of Science, University of Ontario Institute of Technology, 2000 Simcoe Street North, Oshawa, ON, L1H 7K4 (Canada)

    2011-02-28

    In this study, we synthesized a new hybrid material using well-Dawson K{sub 6}[P{sub 2}Mo{sub 18}O{sub 62}].nH{sub 2}O and a room temperature ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate ([BMIM][BF{sub 4}]). CHN elemental analysis showed that one mole of [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} reacts with 6 moles of [BMIM]{sup +} to form [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62}. FT-IR spectra showed the presence of both 1-butyl-3-methylimidazolium cation and the Dawson anion. TG analysis displayed a relative thermal stability of the hybrid material compared to the parent Dawson POM. The new hybrid material [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} was immobilized on glassy carbon (GC) electrode and the modified electrode was investigated by cyclic voltammetry and amperometry. Compared to the electrochemical behavior of dissolved [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-}, a slight shift in the redox peaks towards negative potentials is observed for the immobilized [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62}. The relationship between the peak currents of the deposited [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} film and scan rate is shown to be linear, which demonstrates a surface-confined electron transfer processes. [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified electrode showed high sensitivities towards pH and shown to be active even at neutral pH. [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified GC electrode was subjected to cyclic voltammetry and amperometry in the presence of ascorbic acid (AA) and found to exhibit a remarkable catalytic activity towards the oxidation of AA. The catalytic oxidation peak of AA at [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified GC electrode occurs at low potential of {approx}0 V vs Ag/AgCl at neutral pH and shifts to more positive potentials when pH decreases. Comparison between [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} and [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} modified GC films towards the oxidation of AA suggests that

  20. IL–18 AND IMMUNITY

    Directory of Open Access Journals (Sweden)

    E. V. Yakushenko

    2014-07-01

    Full Text Available Abstract. Interleukin–18 is one of the main cytokines, inducing production of IFNg. It is the important factor of anti–infectious and anti–tumor immunity. The review represent molecular–genetic and biochemical characteristics of IL–18. The data about producers, the structure of the receptor and of IL–18 binding protein, as well as signal transduction in the cell are considered. Besides that, the main immune effects of IL–18 are discussed. (Med. Immunol., 2005, vol.7, № 4, pp 355–364

  1. Influence of organic carbon sources and isotope exchange processes between water and nitrate on the fractionation of the stable isotopes 15N/14N and 18O/16O in dissolved nitrate during microbial dentrification in groundwater

    International Nuclear Information System (INIS)

    Stable isotopes of nitrate are commonly used to determine sources and degradation of nitrate. In this study, nitrite oxidizing bacteria were found to promote an oxygen isotope exchange between water and nitrate under anoxic conditions. Also, different carbon sources were found to influence the enrichment of stable isotopes in nitrate during microbial denitrification. Both results refine the stable isotope model of nitrate in respect to nitrate source determination and microbial nitrate reduction.

  2. Lake highstands on the Altiplano (Tropical Andes) contemporaneous with Heinrich 1 and the Younger Dryas : new insights from (14)C, U-Th dating and delta(18)O of carbonates

    OpenAIRE

    Blard, P.H.; Sylvestre, Florence; A. K. Tripati; Claude, C.; Causse, C.; Coudrain, Anne; Condom, Thomas; Seidel, J.L.; Vimeux, Françoise; Moreau, C; Dumoulin, J.P.; J. Lavé

    2011-01-01

    This study provides new geochronological and stable isotope constraints on Late Pleistocene fluctuations in lake level that occurred in the closed-watershed of the Central Altiplano between similar to 25 and similar to 12 ka. U-series isochrons and (14)C ages from carbonates are used to confirm and refine the previous chronology published (Placzek et al., 2006b). Our new data support three successive lake highstands during the Late Pleistocene: (i) the lake Sajsi cycle, from similar to 25 to ...

  3. Contribution to analysis of fatigue crack propagation at room temperature in low carbon austenitic steels type 18-10(304L) and Mo 17-12(316L). Relation between macroscopic and microscopic phenomena

    International Nuclear Information System (INIS)

    Low cycle fatigue phenomenon on the structural components of reactors is one of the most important problem. In this paper were carried out some fatigue tests on stainless steels type Z2CN18-10 (AISI 304L) and Z2CND17-12 (AISI 316L) at room temperature in air and in a corrosive medium (NaCl solution at different pH values). Length of cracks and crack propagation under stresses were determined. Z2CND17-12 has a better behavior than Z2CN18-10 because of a better structural stability both in air and in a corrosive environment. Structure was examined by transmission electron microscopy and microhardness was measured in the perturbed zones

  4. Carbon Carbon Composites: An Overview .

    OpenAIRE

    G. Rohini Devi; K. Rama Rao

    1993-01-01

    Carbon carbon composites are a new class of engineering materials that are ceramic in nature but exhibit brittle to pseudoplastic behaviour. Carbon-carbon is a unique all-carbon composite with carbon fibre embeded in carbon matrix and is known as an inverse composite. Due to their excellent thermo-structural properties, carbon-carbon composites are used in specialised application like re-entry nose-tips, leading edges, rocket nozzles, and aircraft brake discs apart from several indust...

  5. Main: RSEPVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available RSEPVGRP18 S000289 10-Feb-2000 (last modified) seki RSE (root-specific element) found in bean (P.V.) grp1...n in stem; See S000288, S000099; RSE; grp1.8; vascular; root; stem; shoot; bean (Phaseolus vulgaris) CATCCAACTTTCATATCCATGTGCTT ...

  6. Reference: RSEPVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available lled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928 ... ...RSEPVGRP18 Keller B, Heierli D Vascular expression of the grp1.8 promoter is contro

  7. Fluorine-18 labelled compounds

    International Nuclear Information System (INIS)

    The work presented in this thesis deals with the problems involved in the adaption of reactor-produced fluorine-18 to the synthesis of 18F-labelled organic fluorine compounds. Several 18F-labelling reagents were prepared and successfully applied. The limitations to the synthetic possibilities of reactor-produced fluoride-18 become manifest in the last part of the thesis. An application to the synthesis of labelled aliphatic fluoro amino acids has appeared to be unsuccessful as yet, although some other synthetic approaches can be indicated. Seven journal articles (for which see the availability note) are used to compose the four chapters and three appendices. The connecting text gives a survey of known 18F-compounds and methods for preparing such compounds. (Auth.)

  8. Vapor-liquid equilibrium data for the carbon dioxide and nitrogen (CO2+N2) system at the temperatures 223, 270, 298 and 303 K and pressures up to 18 MPa

    OpenAIRE

    Westman, Snorre Foss; Stang, Hans Georg Jacob; Løvseth, Sigurd Weidemann; Austegard, Anders; Snustad, Ingrid; Størset, Sigmund Østtveit; Ertesvåg, Ivar Ståle

    2015-01-01

    A new setup for the measurement of vapor-liquid phase equilibria of CO2-rich mixtures relevant for carbon capture and storage (CCS) transport conditions is presented. An isothermal analytical method with a variable volume cell is used. The apparatus is capable of highly accurate measurements in terms of pressure, temperature and composition, also in the critical region. Vapor-liquid equilibrium (VLE) measurements for the binary system CO2+N2 are reported at 223, 270, 298 and 303 K, with estim...

  9. Automated radiosynthesis of [18F]ciprofloxacin

    International Nuclear Information System (INIS)

    We transferred the previously published manual synthesis of [18F]ciprofloxacin (decay-corrected RCY: 5.5±1.0%) to an automated synthesis module (TRACERlabTM FXFDG, GE Healthcare) and observed a strong decrease in RCY (0.4±0.4%). When replacing the standard 15-mL glassy carbon reactor of the synthesis module with a 3-mL V-shaped borosilicate glass reactor a considerable improvement in RCY was observed. [18F]Ciprofloxacin was obtained in a RCY of 2.7±1.4% (n=23) with a specific activity at EOS of 1.4±0.5 GBq/µmol in a synthesis time of 160 min. - Highlights: • Automated synthesis of [18F]ciprofloxacin in a TRACERlabTM FXFDG (GE Healthcare) synthesis module was developed. • Dependence of radiochemical yield on reactor type was observed. • 3-mL V-shaped borosilicate glass reactor gave higher radiochemical yield as compared with standard 15-mL glassy carbon reactor. • V-shaped borosilicate glass reactor might also give higher radiochemical yield for other [18F]radiotracers than [18F]ciprofloxacin

  10. Internal Dosimetry. Chapter 18

    International Nuclear Information System (INIS)

    The Committee on Medical Internal Radiation Dose (MIRD) is a committee within the Society of Nuclear Medicine. The MIRD Committee was formed in 1965 with the mission to standardize internal dosimetry calculations, improve the published emission data for radionuclides and enhance the data on pharmacokinetics for radiopharmaceuticals [18.1]. A unified approach to internal dosimetry was published by the MIRD Committee in 1968, MIRD Pamphlet No. 1 [18.2], which was updated several times thereafter. Currently, the most well known version is the MIRD Primer from 1991 [18.3]. The latest publication on the formalism was published in 2009 in MIRD Pamphlet No. 21 [18.4], which provides a notation meant to bridge the differences in the formalism used by the MIRD Committee and the International Commission on Radiological Protection (ICRP) [18.5]. The formalism presented in MIRD Pamphlet No. 21 [18.4] will be used here, although some references to the quantities and parameters used in the MIRD primer [18.3] will be made. All symbols, quantities and units are presented

  11. Chilean experience in production of 18F-FDG from 18F of reactor

    International Nuclear Information System (INIS)

    18F-FDG (fluorine-deoxy-D-glucose) is an important and useful radiopharmaceutical for imaging and study of miocardial viability. Usually cyclotron produced 18F is used to label 18F-FDG. Due to the availability of a 5MW Nuclear Reactor in Chile and the absence of a qualified Cyclotron to produce 18F we have developed a method in order to obtain suitable 18F to label 18F-FDG using the facilities we have at the Nuclear Center of La Reina, Chilean Nuclear Energy Commission. The nuclear reactions involved are: 6Li(n,alpha) 3H and 16O(3H,n)18F. Li-2CO-3, enrich (6Li =95%) was irradiated in a 5 MW swimming pool type Nuclear Reactor at a Neutron flux of 5.7x 1013 n cm-2sec-1during 4 hours. The irradiated Li-2CO-3 was dissolved in H-2SO-4(1:1) and distilled as trimethylsilyl (18F) fluoride (18F-TMS). The labelling of the sugar was carried out using the method described by Hamacker. The 18F-TMS was trapped in a solution of acetonitrile, water, potassium carbonate and kriptofix and hydrolysed to form 18F fluoride. The nucleofilic complex reacts with 1,3,4,6, tetra-O-acetyl-2-O-trifluormethanesulfonyl-beta-D-mannopyranose. The acetiled carbohydrate by acid hydrolysis produce 18FDG. The final product was purified using a ion retarding resin (AG11-A8) and a system a two Sep Pak Plus: Alumina and C-18 cartridge and sterilised by Millipore 0,22 um filter. The 18F-FDG was obtained in an apyrogenic and sterile solution. The 18F Radionucleidic Purity was higher than 99,9% and the Radiochemical Purity of the 18F-FDG obtained was over than 99%. Residual 3H content was as low as 20 (Bq3 H/MBq 18F-FDG). The yield of the process of 18F-FDG was 37 %. Studies in patient with recently myocardial disease have showed the successful of the 18F-FDG. The C.CH.E.N supports an active diagnostic nuclear cardiology program

  12. Catalytic carbon deposition on 3-dimensional carbon fibre supports

    OpenAIRE

    Thornton, Matthew James

    2005-01-01

    Catalytic carbon deposition reactions, using methane, ethane or synthetic natural gas (1.8 vol. % propane, 6.7 vol. % ethane and balance methane) as the carbon-containing gas feedstock with or without the addition of hydrogen, have been investigated over nickel, cobalt and iron catalysts supported on 3-dimensional carbon fibre supports, using both a horizontal tube furnace and an isothermal, isobaric induction furnace. The transition metal catalysts were prepared by impregnating 3-dimens...

  13. Monosomy 18p.

    Science.gov (United States)

    Turleau, Catherine

    2008-01-01

    Monosomy 18p refers to a chromosomal disorder resulting from the deletion of all or part of the short arm of chromosome 18. The incidence is estimated to be about 1:50,000 live-born infants. In the commonest form of the disorder, the dysmorphic syndrome is very moderate and non-specific. The main clinical features are short stature, round face with short philtrum, palpebral ptosis and large ears with detached pinnae. Intellectual deficiency is mild to moderate. A small subset of patients, about 10-15 percent of cases, present with severe brain/facial malformations evocative of holoprosencephaly spectrum disorders. In two-thirds of the cases, the 18p- syndrome is due to a mere terminal deletion occurring de novo, in one-third the following are possible: a de novo translocation with loss of 18p, malsegregation of a parental translocation or inversion, or a ring chr18. Parental transmission of the 18p- syndrome has been reported. Cytogenetic analysis is necessary to make a definite diagnosis. Recurrence risk for siblings is low in de novo deletions and translocations, but is significant if a parental rearrangement is present. Deletion 18p can be detected prenatally by amniocentesis or chorionic villus sampling and cytogenetic testing. Differential diagnosis may include a wide number of syndromes with short stature and mild intellectual deficiency. In young children, deletion 18p syndrome may be vaguely evocative of either Turner syndrome or trisomy 21. No specific treatment exists but speech therapy and early educational programs may help to improve the performances of the children. Except for the patients with severe brain malformations, the life expectancy does not seem significantly reduced. PMID:18284672

  14. Monosomy 18p

    Directory of Open Access Journals (Sweden)

    Turleau Catherine

    2008-02-01

    Full Text Available Abstract Monosomy 18p refers to a chromosomal disorder resulting from the deletion of all or part of the short arm of chromosome 18. The incidence is estimated to be about 1:50,000 live-born infants. In the commonest form of the disorder, the dysmorphic syndrome is very moderate and non-specific. The main clinical features are short stature, round face with short philtrum, palpebral ptosis and large ears with detached pinnae. Intellectual deficiency is mild to moderate. A small subset of patients, about 10–15 percent of cases, present with severe brain/facial malformations evocative of holoprosencephaly spectrum disorders. In two-thirds of the cases, the 18p- syndrome is due to a mere terminal deletion occurring de novo, in one-third the following are possible: a de novo translocation with loss of 18p, malsegregation of a parental translocation or inversion, or a ring chr18. Parental transmission of the 18p- syndrome has been reported. Cytogenetic analysis is necessary to make a definite diagnosis. Recurrence risk for siblings is low in de novo deletions and translocations, but is significant if a parental rearrangement is present. Deletion 18p can be detected prenatally by amniocentesis or chorionic villus sampling and cytogenetic testing. Differential diagnosis may include a wide number of syndromes with short stature and mild intellectual deficiency. In young children, deletion 18p syndrome may be vaguely evocative of either Turner syndrome or trisomy 21. No specific treatment exists but speech therapy and early educational programs may help to improve the performances of the children. Except for the patients with severe brain malformations, the life expectancy does not seem significantly reduced.

  15. Chilean experience in production of 18F-FDG from 18F in a reactor

    International Nuclear Information System (INIS)

    18F-FDG (fluorine-deoxy-D-glucose) is an important and useful radiopharmaceutical for imaging and study of myocardial viability. Usually cyclotron-produced 18F is used to label 18F-FDG. The availability of a 5 MW Nuclear Reactor in Chile and the absence of a quality cyclotron to produce 18F required that we developed a method in order to obtain suitable 18F to label 18F-FDG using the facilities we have at the Nuclear Center of La Reina, Chilean Nuclear Energy Commission. The nuclear reactions involved are: 6Li(n,aα)3H and 16O(3H,n)18F. Enriched Li2CO3 (6Li = 95 %) was irradiated in a 5 MW swimming pool type nuclear reactor with a neutron flux of 5. 7 x 1013 n cm-2 s-1 for 4 hours. The irradiated Li2CO3 was dissolved in H2SO4 (1:1) and distilled as trimethylsilyl(18F)fluoride (18F-TMS). The labelling of the sugar was carried out using the method described by Hamacker. The 18F-TMS was trapped in a solution of acetonitrile, water, potassium carbonate, and kriptofix and hydrolysed to form 18F fluoride. The nucleophilic complex reacts with 1,3,4,6, tetra-O-acetyl- 2-O-trifluoromethanesulfonyl-bβ-D-mannopyranose. The acetylated carbohydrate by acid hydrolysis produces 18F-FDG. The final product was purified using an ion retarding resin (AG11-A8) and a system two Sep Pak Plus: Alumina and C-18 cartridge and sterilised by Millipore 0.22 μm filter. The 18F-FDG was obtained in an apyrogenic and sterile solution. The 18F radionuclide purity was higher than 99.9% and the radiochemical purity ofthe18F-FDG obtained was over than 99%. Residual 3H content was as low as 20 (Bq 3H/MBq 18F-FDG.). The yield of the process 18F-FDG was 13.2 %. (authors)

  16. Powernext, newsletter no.18

    International Nuclear Information System (INIS)

    This newsletter provides information and statistical data on the four business unit of Powernext: Powernext Day-Ahead, Powernext Carbon, Powernext Futures and Powernext Weather. Powernext Day-Ahead provides a short term price reference to manage the volume risk. Powernext Day-Ahead counts close to 50 members among producers, suppliers, eligible consumers, etc. Powernext Carbon is a spot market of CO2 allowances. The market model is the result of a three-fold partnership between Powernext, Caisse des Depots and Euronext. Powernext Carbon counts close to 30 active members. More than 2 Million tonnes of CO2 have been traded since the launch of the market on 24 June. Powernext Carbon has made a name for itself as the most liquid CO2 allowances spot market in Europe to date. Powernext Futures has made a name for itself as a price reference for the medium term market. Its market makers and members guarantee a high-quality market over a time period going up until 2008. Powernext Weather is a range of economically weather driven temperature indices provided by our partner Meteo France. These indices are decision making or hedging tools. This analysis concerns February and March 2004. (A.L.B.)

  17. The trisomy 18 syndrome

    Directory of Open Access Journals (Sweden)

    Cereda Anna

    2012-10-01

    Full Text Available Abstract The trisomy 18 syndrome, also known as Edwards syndrome, is a common chromosomal disorder due to the presence of an extra chromosome 18, either full, mosaic trisomy, or partial trisomy 18q. The condition is the second most common autosomal trisomy syndrome after trisomy 21. The live born prevalence is estimated as 1/6,000-1/8,000, but the overall prevalence is higher (1/2500-1/2600 due to the high frequency of fetal loss and pregnancy termination after prenatal diagnosis. The prevalence of trisomy 18 rises with the increasing maternal age. The recurrence risk for a family with a child with full trisomy 18 is about 1%. Currently most cases of trisomy 18 are prenatally diagnosed, based on screening by maternal age, maternal serum marker screening, or detection of sonographic abnormalities (e.g., increased nuchal translucency thickness, growth retardation, choroid plexus cyst, overlapping of fingers, and congenital heart defects . The recognizable syndrome pattern consists of major and minor anomalies, prenatal and postnatal growth deficiency, an increased risk of neonatal and infant mortality, and marked psychomotor and cognitive disability. Typical minor anomalies include characteristic craniofacial features, clenched fist with overriding fingers, small fingernails, underdeveloped thumbs, and short sternum. The presence of major malformations is common, and the most frequent are heart and kidney anomalies. Feeding problems occur consistently and may require enteral nutrition. Despite the well known infant mortality, approximately 50% of babies with trisomy 18 live longer than 1 week and about 5-10% of children beyond the first year. The major causes of death include central apnea, cardiac failure due to cardiac malformations, respiratory insufficiency due to hypoventilation, aspiration, or upper airway obstruction and, likely, the combination of these and other factors (including decisions regarding aggressive care. Upper airway

  18. Trisomy 18 (Edwards Syndrome

    Directory of Open Access Journals (Sweden)

    Masoud Poureisa

    2009-01-01

    Full Text Available Description and Definition "n"n Synonym: Edward syndrome Characterized by malformations of multiple organ systems, trisomy 18 has an incidence of 3 in 10000 live births. Abnormalities detectable by ultrasound Common findings Agenesis of the corpus callosum Choroid plexus cysts Posterior fossa abnormalities Micrognathia Low-set ears Microphthalmous Hypertelorism Short radial ray Clenched hand with overlapping index finger Clubbed foot Rocker-bottom foot Renal anomalies hydronephrosis Omphalocele Diaphragmatic hernia Cryptorchidism Heart defects Single umbilical artery Intrauterine growth restriction Polyhydramnios Nuchal lucency Occasional findings Meningomyelocele Ventriculomegaly Cleft lip and plate Major differential diagnoses Freeman-Sheldon syndrome (clenched hands and intrauterine growth restriction Pena Shokeir syndrome (pseudo-trisomy 18 Smith-Lemli-Opitz syndrome (clenched hands and intrauterine grown restriction Triploidy (intrauterine growth restriction Trisomy 9 Other multiple malformation syndromes associated with intrauterine growth retardation, limb anomalies and/ or heart defects. Ultrasound diagnosis Prenatal; ultrasound diagnosis has been established in the first trimester, based on the finding of a nuchal lucency. Detectable features on the early second trimester include abnormal forearms, clenched hands, clubbed feet, omphalocele and a major heart defect. The features of trisomy 18 are detectable in 80% of affected fetuses in the second trimester. Sonography is often used to evaluate fetuses for the prsence of trisomy 18 when choroid plexus cysts are present, or when the triple screen results in a low level of maternal serum alpha- fetoprotein, estriol and human chorionic  gonadotropin combination. Although trisomy 18 occurs in 1 in 100 fetuses with choroid plexus cysts, if it is an isolated finding, the risk for trisomy 18 falls below 1 in 400. Documenting an open hand is very helpful as most fetuses with trisomy 18 are

  19. EDITORIAL: Optical Fibre Sensors 18 (OFS-18)

    Science.gov (United States)

    Jones, Julian D. C.; Tatam, Ralph P.

    2007-10-01

    The International Conference on Optical Fibre Sensors (OFS-18) was held in October 2006 in Cancún, Mexico, under the general chairmanship of Dr Alexis Mendez (MCH Engineering LLC, USA) and Dr Fernando Mendoza (Centro de Investigaciones en Optica, Mexico). 'OFS', as it has become known, is firmly established as the leading international conference for the optical fibre sensor community. Since its inception, in London in 1983, and under the leadership of an international steering committee independent of any learned society or professional institution, it has been held approximately every eighteen months. The venue nominally rotates from Europe, to the Americas, and thence to Asia and the Pacific. OFS-18 demonstrated the continuing vigour of the community, with some 250 papers presented, plus two workshops, with attendance as international as ever. In recent years, it has become a tradition to publish a post-conference special issue in the journal Measurement Science and Technology, and these special issues offer a representative sample of the current status of the field. In the nearly 25 years since OFS began, many of the early ideas and laboratory-based proof-of-principle experiments have led to highly developed instrumentation systems, and to successful commercial products. Perhaps the most mature of all of these technologies is the optical fibre gyroscope, with the fibre hydrophone a close second—originally developed for defence applications for which it is now established, but with increasing relevance to the oil and gas industry; electromagnetic sensors based on the Faraday and electro-optic effects are of growing significance in the power generation and distribution industry; whilst in-fibre grating-based sensors occupy an expanding niche in structural monitoring, especially in civil engineering. It is therefore appropriate that the first day of OFS was devoted to workshops on structural health monitoring, and to commemorate the 30th anniversary of the

  20. Carbon and oxygen isotope microanalysis of carbonate.

    Science.gov (United States)

    Velivetskaya, Tatiana A; Ignatiev, Alexander V; Gorbarenko, Sergey A

    2009-08-30

    Technical modification of the conventional method for the delta(13)C and delta(18)O analysis of 10-30 microg carbonate samples is described. The CO(2) extraction is carried out in vacuum using 105% phosphoric acid at 95 degrees C, and the isotopic composition of CO(2) is measured in a helium flow by gas chromatography/isotope ratio mass spectrometry (GC/IRMS). The feed-motion of samples to the reaction vessel provides sequential dropping of only the samples (without the sample holder) into the acid, preventing the contamination of acid and allowing us to use the same acid to carry out very large numbers of analyses. The high accuracy and high reproducibility of the delta(13)C and delta(18)O analyses were demonstrated by measurements of international standards and comparison of results obtained by our method and by the conventional method. Our method allows us to analyze 10 microg of the carbonate with a standard deviation of +/-0.05 per thousand for delta(13)C and delta(18)O. The method has been used successfully for the analyses of the oxygen and carbon isotopic composition of the planktonic and benthic foraminifera in detailed palaeotemperature reconstructions of the Okhotsk Sea. PMID:19603476

  1. Aluminum Sulfate 18 Hydrate

    Science.gov (United States)

    Young, Jay A.

    2004-01-01

    A chemical laboratory information profile (CLIP) of the chemical, aluminum sulfate 18 hydrate, is presented. The profile lists physical and harmful properties, exposure limits, reactivity risks, and symptoms of major exposure for the benefit of teachers and students using the chemical in the laboratory.

  2. Carbon isotope anomalies in carbonates of the Karelian series

    Science.gov (United States)

    Iudovich, Ia. E.; Makarikhin, V. V.; Medvedev, P. V.; Sukhanov, N. V.

    1990-07-01

    Results are presented on carbon isotope distributions in carbonates of the Karelian complex. A highly anomalous isotopic composition was found in carbonate rocks aged from 2.6 to 1.9 b.y. In the stromatolitic carbonates of the Onega water table, delta-(C-13) reaches a value of +18 percent, while the shungite layer of the Zaonega horizon is characterized by a wide dispersion (from +7.9 to -11.8 percent). These data are in good agreement with the known geochemical boundary (about 2.2 b.y. ago) in the history of the earth.

  3. Microbially mediated mineral carbonation

    Science.gov (United States)

    Power, I. M.; Wilson, S. A.; Dipple, G. M.; Southam, G.

    2010-12-01

    implemented and economically efficient alternative to other technologies currently under development for mineral sequestration. Dismukes GC, Carrieri D, Bennette N, Ananyev GM, Posewitz MC (2008) Aquatic phototrophs: efficient alternatives to land-based crops for biofuels. Current Opinion in Biotechnology, 19, 235-240. Ferris FG, Wiese RG, Fyfe WS (1994) Precipitation of carbonate minerals by microorganisms: Implications of silicate weathering and the global carbon dioxide budget. Geomicrobiology Journal, 12, 1-13. Lackner KS, Wendt CH, Butt DP, Joyce EL, Jr., Sharp DH (1995) Carbon dioxide disposal in carbonate minerals. Energy, 20, 1153-1170. Power IM, Wilson SA, Thom JM, Dipple GM, Gabites JE, Southam G (2009) The hydromagnesite playas of Atlin, British Columbia, Canada: A biogeochemical model for CO2 sequestration. Chemical Geology, 206, 302-316. Thompson JB, Ferris FG (1990) Cyanobacterial precipitation of gypsum, calcite, and magnesite from natural alkaline lake water. Geology, 18, 995-998.

  4. Nearly carrier-free 18F-fluorine alkylation and 18F-fluorine acylation

    International Nuclear Information System (INIS)

    Preparation and introduction of n.c.a. [18F]-fluoroalkyl and n.c.a. [18F]-fluoroacyl moieties as small prosthetic groups were studied as alternatives to n.c.a. labeling via direct nucleophilic substitution. Starting materials for the n.c.a. [18F]-fluoroalkylation were symmetrical disubstituted alkanes and α-substituted carboxylic acid esters for the n.c.a. [18F]-fluoroacylation. The nucleophilic fluorination of these precursors were systematically investigated with regard to the effect of various important reaction parameters. The monofluorinated prosthetic groups, both monofluorinated alkanes and α-fluorinated carboxylic acid esters, were obtained under optimized conditions with radiochemical yields of about 90% using the efficient fluorination system aminopolyether 2.2.2./potassium carbonate in acetonitrile as solvent. The n.c.a. [18F]-fluoroalkylation of protic functional groups via condensation were performed as a one pot synthesis under basic conditions. The radiochemical yields of these condensation reactions depended on the acid constant of the organic substrates. The highest yields of about 90% of fluoroalkylated products were achieved in acetonitrile with phenols as substrates and n.c.a. [18F]-fluorotosyloxyalkanes as the most valuable fluoroalkylating agents. The n.c.a. [18F]-fluoroacylation of -OH and -NHR functional groups were carried out in two steps. The highest yields of about 85% of fluoroacylated products were obtained in the presence of acids in polar protic solvents when simple primary amines were used as substrates and α-fluoropropionic acid methylester as the best n.c.a. [18F]-fluoroacylating agent. The [18F]-fluoroalkylation via bistosyloxyalkanes was applied to the synthesis of n.c.a. [18F]-fluoroalkylspiperones, potent dopamine receptor ligands to be used for receptor mapping in conjunction with positron emission tomography. (orig.)

  5. Carbone-14, carbone-13 et oxygène-18 dans les sédiments carbonatés du lac Titicaca: premières estimations des vitesses de sédimentation et essai de paléoclimatologie

    OpenAIRE

    Fontes, J.C.; Boulangé, Bruno; Rodrigo, L

    1981-01-01

    La précipitation des carbonates se produit et s'est produite dans des conditions voisines de l'équilibre avec l'eau du lac et le CO2 de l'atmosphère. La vitesse moyenne de sédimentation est de l'ordre de 0,5 mm.an-1 au cours du dernier millenaire qui a vu le bilan hydrologique du lac fluctuer assez largement. (Résumé d'auteur)

  6. Sindrom prstenastog kromosoma 18

    OpenAIRE

    Pereza, Nina; Buretić-Tomljanović, Alena; Vraneković, Jadranka; Ostojić, Saša; Kapović, Miljenko

    2010-01-01

    Cilj: Prstenasti ili ring kromosom rijetka je strukturna promjena kromosoma koja najčešće nastaje zbog terminalne delecije na oba kraka kromosoma te ponovnog spajanja preostalih dijelova kratkog i dugog kraka kromosoma u prstenastu strukturu. Sindromi prstenastih kromosoma iznimno su rijetki s incidencijom od 1 : 50.000 živorođene djece. U ovom radu prikazujemo prvi slučaj djevojčice sa sindromom prstenastog kromosoma 18 zabilježenog na Zavodu za biologiju i medicinsku genetiku (Medicin...

  7. Fluorine-18 - ED 4311

    International Nuclear Information System (INIS)

    This sheet presents the characteristics of fluorine-18, its origin, and its radio-physical and biological properties. It briefly describes its use in nuclear medicine. It indicates its dosimetric parameters for external exposure, cutaneous contamination, and internal exposure due to acute contamination or to chronic contamination. It indicates and comments the various exposure measurement techniques: ambient dose rate measurement, surface contamination measurement, atmosphere contamination. It addresses the means of protection: premise design, protection against external exposure and against internal exposure. It describes how areas are delimited and controlled within the premises: regulatory areas, controls to be performed. It addresses the personnel classification, training and medical survey. It addresses the issue of solid and liquid wastes and liquid effluents. It briefly recalls the administrative procedures related to the authorization and declaration of possession and use of sealed and unsealed sources. It indicates regulatory aspects related to the transport of fluorine-18, describes what is to be done in case of incident or accident (for the different types of contamination or exposure)

  8. EUROTHERM Seminar No. 18

    CERN Document Server

    Heggs, Peter; Butterworth, David

    1992-01-01

    The Eurotherm Committee was created in 1986 from member countries of the European Community. It has the purpose of organising and coordinating scientific events such as seminars and conferences in the thermal sciences. The series of Eurotherm Seminars established by the Committee has become a popular forum for high-level scientific and technical interchange of ideas in a wide range of specialist topics. While the presentation and publication of papers at the Seminars are encouraged, the primary aim is to stimulate discussion and liaison between specialist groups. The present Chairman of Eurotherm is Professor C.J. Hoogendoorn of the Technical University, Delft (Fax [NL] 15, 783251). Information on Mure Seminars is available from the Secretary, Keith Cornwell, Heriot-Watt University, Edinburgh (Fax [UK] 31, 451, 3129). This particular Seminar No. 18 on the Design and Operation of Heat Exchangers was the first one on this topic and was held at the Universitat der Bundeswehr Hamburg (University of the Federal Ar...

  9. 18 CFR 35.18 - Asset retirement obligations.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Asset retirement obligations. 35.18 Section 35.18 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... not seeking recovery of the asset retirement costs in rates, must remove all...

  10. 18F-Labeled Silicon-Based Fluoride Acceptors: Potential Opportunities for Novel Positron Emitting Radiopharmaceuticals

    OpenAIRE

    Vadim Bernard-Gauthier; Carmen Wängler; Esther Schirrmacher; Alexey Kostikov; Klaus Jurkschat; Bjoern Wängler; Ralf Schirrmacher

    2014-01-01

    Background. Over the recent years, radiopharmaceutical chemistry has experienced a wide variety of innovative pushes towards finding both novel and unconventional radiochemical methods to introduce fluorine-18 into radiotracers for positron emission tomography (PET). These “nonclassical” labeling methodologies based on silicon-, boron-, and aluminium-18F chemistry deviate from commonplace bonding of an [18F]fluorine atom (18F) to either an aliphatic or aromatic carbon atom. One method in part...

  11. Application of fluorine-18 in the syntheses of PET Radiotracers

    International Nuclear Information System (INIS)

    'Full text:' Positron emission tomography (PET) is a nuclear medicine imaging technique that uses physiologically active compounds labelled with positron-emitting radionuclides to image and measure the function of in vivo biological processes with minimal disturbance. Fluorine-18 (18F; 97%β+, Emax = 0.635 MeV, t1/2 = 109.7 min) is the most commonly used radionuclide in PET. At McMaster University, 18F has been produced by the use of a reactor (6Li(n,α)3H;16O(t,n)18F)), a tandem Van de Graaf accelerator (20Ne(d,α)18F) and a negative ion proton cyclotron. Neither the reactor nor the accelerator is suitable for the production of 18F for clinical use because of the co-production of tritium (reactor) and low 18F yield (accelerator). Presently, a Siemens RDS 112 proton cyclotron operating at 11 MeV is used for the routine production of 18F by the nuclear reaction, 18O(p,n)18F. The present study focuses on the radiofluorination of the carbon-carbon double bond in 3,4,6-tri-O-acetyl-D-glucal (TAG) by 18F labelled F2 ([18F]F2) to produce 2-[18F]fluoro-2-deoxy-D-glucose (2-FDG) and 2-[18F]fluoro-2-deoxy-β-D-allose (2-FDβA). 2-[18F]fluoro-2-deoxy-D-glucose has proven to be an invaluable probe for the study of local glucose metabolism in humans when used in conjunction with PET and has become the standard PET imaging agent against which other imaging agents for tumor detection are compared. 2-[18F]fluoro-2-deoxy-β-D-allose is an analogue of the rare sugar, D-allose. It has been suggested that D-allose may be useful for the treatment of ischemia/reperfusion injury and leukemia. (author)

  12. A mechanistic model of H{sub 2}{sup 18}O and C{sup 18}OO fluxes between ecosystems and the atmosphere: Model description and sensitivity analyses

    Energy Technology Data Exchange (ETDEWEB)

    Riley, W.J.; Still, C.J.; Torn, M.S.; Berry, J.A.

    2002-01-01

    The concentration of 18O in atmospheric CO2 and H2O is a potentially powerful tracer of ecosystem carbon and water fluxes. In this paper we describe the development of an isotope model (ISOLSM) that simulates the 18O content of canopy water vapor, leaf water, and vertically resolved soil water; leaf photosynthetic 18OC16O (hereafter C18OO) fluxes; CO2 oxygen isotope exchanges with soil and leaf water; soil CO2 and C18OO diffusive fluxes (including abiotic soil exchange); and ecosystem exchange of H218O and C18OO with the atmosphere. The isotope model is integrated into the land surface model LSM, but coupling with other models should be straightforward. We describe ISOLSM and apply it to evaluate (a) simplified methods of predicting the C18OO soil-surface flux; (b) the impacts on the C18OO soil-surface flux of the soil-gas diffusion coefficient formulation, soil CO2 source distribution, and rooting distribution; (c) the impacts on the C18OO fluxes of carbonic anhydrase (CA) activity in soil and leaves; and (d) the sensitivity of model predictions to the d18O value of atmospheric water vapor and CO2. Previously published simplified models are unable to capture the seasonal and diurnal variations in the C18OO soil-surface fluxes simulated by ISOLSM. Differences in the assumed soil CO2 production and rooting depth profiles, carbonic anhydrase activity in soil and leaves, and the d18O value of atmospheric water vapor have substantial impacts on the ecosystem CO2 flux isotopic composition. We conclude that accurate prediction of C18OO ecosystem fluxes requires careful representation of H218O and C18OO exchanges and transport in soils and plants.

  13. 18 CFR 1b.18 - Right to submit statements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Right to submit... COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.18 Right to submit statements. Any person may, at any time during the course of an investigation, submit documents,...

  14. SM18 Visits and Access

    CERN Multimedia

    2012-01-01

      VISITS The rules and conditions to be followed for visits in the SM18 Hall are laid out in the EDMS 1205328 document. No visit is allowed without prior reservation.   ACCESS Special access right is needed ONLY from 7 p.m. to 7 a.m. and during week-ends. From 1 December, the current SM18 access database will be closed and a new one “SM18-OWH outside normal hours” started from scratch. Requests, via EDH SM18-OWH, will have to be duly justified.   For further information, please contact Evelyne Delucinge.

  15. Study of delta18O calcite-dolomite mixtures

    International Nuclear Information System (INIS)

    Isotope ratio of oxygen in carbonate mixtures has been studied. For the purpose samples of calcite and dolomite with the known values delta18O are mixed in the ratios 9:1, 3:1, 1:1, 1:3, 1:9. Then from the mixtures prepared CO2 gas is separated using the McCrea method, delta18O of the gas is measured using mass-srectrometer. It has been established that to obtain delta18O calcite in the mixtures with calcite excess CO2 gas should be collected in the interval 15-30 min of the reaction duration and for the mixtures with dolomite excess - in the interval 5-15 min. To determine delta18O of dolomite the optimum time of CO2 gas collection for all the mixtures is 4-24 h

  16. Porous carbons

    Indian Academy of Sciences (India)

    Satish M Manocha

    2003-02-01

    Carbon in dense as well as porous solid form is used in a variety of applications. Activated porous carbons are made through pyrolysis and activation of carbonaceous natural as well as synthetic precursors. Pyrolysed woods replicate the structure of original wood but as such possess very low surface areas and poor adsorption capacities. On activation, these exhibit increased adsorption volumes of 0.5–0.8 cm3 /gm and surface areas of 700–1800 m2 /gm depending on activation conditions, whether physical or chemical. Former carbons possess mixed pore size distribution while chemically activated carbons predominantly possess micropores. Thus, these carbons can be used for adsorption of wide distributions of molecules from gas to liquid. The molecular adsorption within the pores is due to single layer or multilayer molecule deposition at the pore walls and hence results in different types of adsorption isotherm. On the other hand, activated carbon fibres with controlled microporous structure and surface area in the range of 2500 m2 /gm can be developed by controlled pyrolysis and physical activation of amorphous carbon fibres. Active carbon fibres with unmatchable pore structure and surface characteristics are present and futuristic porous materials for a number of applications from pollution control to energy storage.

  17. High performance carbon-carbon composites

    Indian Academy of Sciences (India)

    Lalit M Manocha

    2003-02-01

    Carbon-carbon composites rank first among ceramic composite materials with a spectrum of properties and applications in various sectors. These composites are made of fibres in various directions and carbonaceous polymers and hydrocarbons as matrix precursors. Their density and properties depend on the type and volume fraction of reinforcement, matrix precursor used and end heat treatment temperature. Composites made with thermosetting resins as matrix precursors possess low densities (1.55–1.75 g/cm3) and well-distributed microporosity whereas those made with pitch as the matrix precursor, after densification exhibit densities of 1.8–2.0 g/cm3 with some mesopores, and those made by the CVD technique with hydrocarbon gases, possess intermediate densities and matrices with close porosities. The former (resin-based) composites exhibit high flexural strength, low toughness and low thermal conductivity, whereas the latter (pitch- and CVD-based) can be made with very high thermal conductivity (400–700 W/MK) in the fibre direction. Carbon-carbon composites are used in a variety of sectors requiring high mechanical properties at elevated temperatures, good frictional properties for brake pads in high speed vehicles or high thermal conductivity for thermal management applications. However, for extended life applications, these composites need to be protected against oxidation either through matrix modification with Si, Zr, Hf etc. or by multilayer oxidation protection coatings consisting of SiC, silica, zircon etc.

  18. Carbon dioxide gasification of carbon black: isotope study of carbonate catalysis

    International Nuclear Information System (INIS)

    Temperature-programmed reaction was used with labeled isotopes (13C and 18O) to study interactions between carbon black and potassium carbonate in pure He and 10% CO2/90% He atmospheres. Catalytic gasification precursor complexes were observed. Carbon and oxygen-bearing carbon surface groups interacted with the carbonate above 500 K to form surface complexes. Between 500 and 950 K, and in the presence of gaseous CO2, the complexes participated in C and O exchange with the gas phase while oxygen atoms within the complexes also exchanged with those on the carbon surface. As the temperature rose, the complexes decomposed, with CO2 the initial product. Decomposition started around 500 K in pure He, and around 950 K in CO2/He. Catalytic gasification began only after decomposition of significant portions of the complexes. Elemental potassium formed, and the active catalyst appears to alternate between being potassium metal and a potassium-oxygen-carbon complex. Potassium carbonate is not part of the catalytic cycle. 20 references, 10 figures

  19. Health screening - men - ages 18 to 39

    Science.gov (United States)

    Health maintenance visit - men - ages 18 to 39; Physical exam - men - ages 18 to 39; Yearly exam - ... 39; Checkup - men - ages 18 to 39; Men's health - ages 18 to 39; Preventive care exam - men - ...

  20. Health screening - women - ages 18 to 39

    Science.gov (United States)

    Health maintenance visit - women - ages 18 to 39; Physical exam - women - ages 18 to 39; Yearly exam - ... 39; Checkup - women - ages 18 to 39; Women's health - ages 18 to 39; Preventive care - women - ages ...

  1. Carbon and Carbon Isotope Cycling in the Western Canadian Arctic

    Science.gov (United States)

    Mol, Jacoba; Thomas, Helmuth

    2016-04-01

    Increasing carbon dioxide levels in the atmosphere are having drastic effects on the global oceans. The Arctic Ocean is particularly susceptible to change as warming, sea-ice loss and a weak buffering capacity all influence this complicated semi-enclosed sea. In order to investigate the inorganic carbon system in the Canadian Arctic, water samples were collected in the Beaufort Sea, on the Alaskan shelf, at the Mackenzie river delta, and in Amundsen Gulf during the summer of 2014 and were analyzed for dissolved inorganic carbon (DIC), total alkalinity (TA), DI13C and 18O isotopes. Carbon isotopes are used to investigate the role of biological production on the uptake and transfer of inorganic carbon to depth. A preferential uptake of the lighter 12C relative to the heavier 13C isotope during biological production leads to a fractionation of the 13C/12C isotopes in both the organic matter and the water column. This results in an enrichment of DI13C in the high productivity surface waters and a depletion of DI13C at depth. Physical processes including freshwater input, brine rejection, and water mass mixing are investigated through the measurement of oxygen isotopes. Differences in the carbon system across the study area due to both biological and physical processes are assessed using depth profiles of DI13C and related carbon system parameters.

  2. ISS Expedition 18 Press Kit

    Data.gov (United States)

    National Aeronautics and Space Administration — Press kit for ISS mission Expedition 18 from 10/2008-04/2009. Press kits contain information about each mission overview, crew, mission timeline, benefits, and...

  3. Adults with Chromosome 18 Abnormalities.

    Science.gov (United States)

    Soileau, Bridgette; Hasi, Minire; Sebold, Courtney; Hill, Annice; O'Donnell, Louise; Hale, Daniel E; Cody, Jannine D

    2015-08-01

    The identification of an underlying chromosome abnormality frequently marks the endpoint of a diagnostic odyssey. However, families are frequently left with more questions than answers as they consider their child's future. In the case of rare chromosome conditions, a lack of longitudinal data often makes it difficult to provide anticipatory guidance to these families. The objective of this study is to describe the lifespan, educational attainment, living situation, and behavioral phenotype of adults with chromosome 18 abnormalities. The Chromosome 18 Clinical Research Center has enrolled 483 individuals with one of the following conditions: 18q-, 18p-, Tetrasomy 18p, and Ring 18. As a part of the ongoing longitudinal study, we collect data on living arrangements, educational level attained, and employment status as well as data on executive functioning and behavioral skills on an annual basis. Within our cohort, 28 of the 483 participants have died, the majority of whom have deletions encompassing the TCF4 gene or who have unbalanced rearrangement involving other chromosomes. Data regarding the cause of and age at death are presented. We also report on the living situation, educational attainment, and behavioral phenotype of the 151 participants over the age of 18. In general, educational level is higher for people with all these conditions than implied by the early literature, including some that received post-high school education. In addition, some individuals are able to live independently, though at this point they represent a minority of patients. Data on executive function and behavioral phenotype are also presented. Taken together, these data provide insight into the long-term outcome for individuals with a chromosome 18 condition. This information is critical in counseling families on the range of potential outcomes for their child. PMID:25403900

  4. Calcium Carbonate

    Science.gov (United States)

    ... before being swallowed; do not swallow them whole. Drink a full glass of water after taking either the regular or chewable tablets or capsules. Some liquid forms of calcium carbonate must be shaken well before use.Do not ...

  5. Carbon Stars

    Indian Academy of Sciences (India)

    T. Lloyd Evans

    2010-12-01

    In this paper, the present state of knowledge of the carbon stars is discussed. Particular attention is given to issues of classification, evolution, variability, populations in our own and other galaxies, and circumstellar material.

  6. Development of highly corrosion resistant 18-8 stainless steel for nuclear fuel reprocessing plants

    International Nuclear Information System (INIS)

    Corrosion behavior of ultra low carbon 18-8 stainless steel was evaluated in boiling nitric acid environment. Although ultra low carbon stainless steel shows excellent corrosion resistance, it is, due to low carbon content, easily induced martensite by cold work. Increasing the strain induced martensite by cold work, the corrosion rate of 18-8 stainless steel increased. Corrosion rate is summarized as a function of stability factor with represents a resistance to martensite transformation induced by cold work and highly austenitic stabilized steel showed better corrosion resistance. Ultra low carbon 18-8 stainless steel which is highly stabilized austenite was designed and manufactured with commercial mill. The development steel showed an excellent corrosion resistance in boiling nitric acid even after cold work. The corrosion rate of the welded joint was also excellent as well as matrix

  7. Carbonate Ion Effects on Coccolith Carbon and Oxygen Isotopes

    Science.gov (United States)

    Ziveri, P.; Probert, I.; Stoll, H. M.

    2006-12-01

    The stable oxygen and carbon isotopic composition of biogenic calcite constitutes one of the primary tools used in paleoceanographic reconstructions. The δ18O of shells of ocean floor microfossils and corals reflects the composition of the paleo-seawater as they use the oxygen to build up their calcite and aragonite shells. The δ13C is used to reconstruct variations in the carbon isotopic composition of dissolved inorganic carbon in the ocean, which is controlled by biological productivity through the removal of isotopically light carbon in organic matter. To be effective and sensitive tools for understanding photic zone processes it is first necessary to understand the various biological fractionations associated with carbonate precipitation. To date, isotopic fractionation models are mainly based on foraminifera and corals but not on coccoliths, tiny plates produced by coccolithophore algae, which are often the most dominant carbonate contributors to pelagic sediments. As photosynthetic organisms, their chemistry can provide a sensitive tool for understanding photic zone processes. Coccoliths may be the most important carbonate phase for geochemical analysis in sediments where foraminifera are less common and/or core material is limited, such as in subpolar regions and for Early Cenozoic and Mesozoic sediments. Here we report experimental results on a common living coccolithophore species showing that the 13C/12C and 18O/16O ratios decrease with the increase of HCO^{3-} (CO32-). The selected species are among the heaviest calcifying extant coccolithophores and are major contributors to present coccolith carbonate export production. Because coccolithophores are photosynthetic organisms that calcify intracellularly in specialized vesicles, the challenge lies in ascertaining how kinetic and thermodynamic processes of isotopic fractionation are linked to cellular carbon "transport" and carbonate precipitation. This is a daunting challenge since studies have not

  8. Sediment-dweling organism mimicking laminoid fenestral fabrics in shallow water carbonates

    Czech Academy of Sciences Publication Activity Database

    Nose, M.; Schlagintweit, F.; Hladil, Jindřich

    Geneve : Université de Geneve , 2014. s. 525-525. [International Sedimentological Congress /19./. 18.08.2014-22.08.2014, Geneve ] Institutional support: RVO:67985831 Keywords : sedimentology * carbonates * shallow water carbonates Subject RIV: DB - Geology ; Mineralogy

  9. Concerted nucleophilic aromatic substitution with 19F‑ and 18F‑

    Science.gov (United States)

    Neumann, Constanze N.; Hooker, Jacob M.; Ritter, Tobias

    2016-06-01

    Nucleophilic aromatic substitution (SNAr) is widely used by organic chemists to functionalize aromatic molecules, and it is the most commonly used method to generate arenes that contain 18F for use in positron-emission tomography (PET) imaging. A wide range of nucleophiles exhibit SNAr reactivity, and the operational simplicity of the reaction means that the transformation can be conducted reliably and on large scales. During SNAr, attack of a nucleophile at a carbon atom bearing a ‘leaving group’ leads to a negatively charged intermediate called a Meisenheimer complex. Only arenes with electron-withdrawing substituents can sufficiently stabilize the resulting build-up of negative charge during Meisenheimer complex formation, limiting the scope of SNAr reactions: the most common SNAr substrates contain strong π-acceptors in the ortho and/or para position(s). Here we present an unusual concerted nucleophilic aromatic substitution reaction (CSNAr) that is not limited to electron-poor arenes, because it does not proceed via a Meisenheimer intermediate. We show a phenol deoxyfluorination reaction for which CSNAr is favoured over a stepwise displacement. Mechanistic insights enabled us to develop a functional-group-tolerant 18F-deoxyfluorination reaction of phenols, which can be used to synthesize 18F-PET probes. Selective 18F introduction, without the need for the common, but cumbersome, azeotropic drying of 18F, can now be accomplished from phenols as starting materials, and provides access to 18F-labelled compounds not accessible through conventional chemistry.

  10. 18 CFR 367.18 - Criteria for classifying leases.

    Science.gov (United States)

    2010-04-01

    ... classification of the lease under the criteria in paragraph (a) of this section had the changed terms been in... the lessee) must not give rise to a new classification of a lease for accounting purposes. ... ACT General Instructions § 367.18 Criteria for classifying leases. (a) If, at its inception, a...

  11. Production and test of {sup 18}F samples in the SNICS ion source

    Energy Technology Data Exchange (ETDEWEB)

    Rehm, K.E.; Paul, M. [Hebrew Univ., Jerusalem (Israel); Roberts, A.; Nickels, J. [Univ. of Wisconsin, Madison, MO (United States)

    1995-08-01

    For experiments with {sup 18}F beams the output of the SNICS ion source for fluorine ions was investigated. {sup 18}F, which is a well-studied PET isotope, is generated at the medical cyclotron of the University of Wisconsin. Aqueous [{sup 18}F] fluoride ions are produced via the {sup 18}O(p,n){sup 18}F reaction using a 30-{mu}A, 11.4-MeV proton beam bombarding a 95% enriched [{sup 18}O] water target. In order to minimize the {sup 18}O component of the {sup 18}F material the [{sup 18}F] fluoride must be separated from the [{sup 18}O] water. For this purpose the aqueous [{sup 18}F] fluoride solution ({approximately} 0.5-1 ml) is removed from the production target and placed in a glassy carbon vessel. The vessel is heated to 115{degrees}C with He bubbling through the solution, evaporating the water while the {sup 18}F adheres to the vessel walls. When dry, the vessel is filled with 1 ml {sup 18}O-depleted 99.98% [{sup 16}O] water which is again evaporated. After this step is repeated once more the vessel is filled with 1.5 ml [{sup 16}O] water and 200-300 mole of natural KF as carrier material.

  12. Carbon particles

    Science.gov (United States)

    Hunt, Arlon J.

    1984-01-01

    A method and apparatus whereby small carbon particles are made by pyrolysis of a mixture of acetylene carried in argon. The mixture is injected through a nozzle into a heated tube. A small amount of air is added to the mixture. In order to prevent carbon build-up at the nozzle, the nozzle tip is externally cooled. The tube is also elongated sufficiently to assure efficient pyrolysis at the desired flow rates. A key feature of the method is that the acetylene and argon, for example, are premixed in a dilute ratio, and such mixture is injected while cool to minimize the agglomeration of the particles, which produces carbon particles with desired optical properties for use as a solar radiant heat absorber.

  13. Carbon classified?

    DEFF Research Database (Denmark)

    Lippert, Ingmar

    2012-01-01

    . Using an actor- network theory (ANT) framework, the aim is to investigate the actors who bring together the elements needed to classify their carbon emission sources and unpack the heterogeneous relations drawn on. Based on an ethnographic study of corporate agents of ecological modernisation over a...... corporations construing themselves as able and suitable to manage their emissions, and, additionally, given that the construction of carbon emissions has performative consequences, the underlying practices need to be declassified, i.e. opened for public scrutiny. Hence the paper concludes by arguing for a...

  14. Thai 18-Week Course: Glossary.

    Science.gov (United States)

    Defense Language Inst., Washington, DC.

    This glossary is part of the Defense Language Institute's 18-week "Short Course in Thai." Other course materials include six 10-lesson volumes and accompanying tape recordings together with an "Introduction to Thai Script." The course is designed to train native-English speakers to level 1, elementary proficiency in speaking, understanding, and…

  15. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the JAN MAYEN in the Barents Sea from 2003-07-10 to 2003-07-18 (NODC Accession 0113565)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113565 includes chemical, discrete sample, physical and profile data collected from JAN MAYEN in the Barents Sea from 2003-07-10 to 2003-07-18 and...

  16. Temperature, salinity and other variables collected from Surface underway observations using CTD, Carbon dioxide (CO2) gas analyzer and other instruments from the AIRCRAFT in the Arctic Ocean from 2005-05-02 to 2009-05-18 (NODC Accession 0117695)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0117695 includes Surface underway, chemical and physical data collected from AIRCRAFT in the Arctic Ocean from 2005-05-02 to 2009-05-18 and retrieved...

  17. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and HYDROSTATIC PRESSURE collected from discrete sample and profile observations using CTD, bottle and other instruments from the SEWARD JOHNSON in the North Atlantic Ocean from 2003-04-18 to 2003-05-22 (NODC Accession 0113596)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113596 includes chemical, discrete sample, physical and profile data collected from SEWARD JOHNSON in the North Atlantic Ocean from 2003-04-18 to...

  18. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the MARION DUFRESNE in the Indian Ocean from 1998-08-18 to 1998-09-09 (NODC Accession 0113573)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113573 includes biological, chemical, discrete sample, physical and profile data collected from MARION DUFRESNE in the Indian Ocean from 1998-08-18...

  19. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from DISCOVERY in the North Atlantic Ocean from 2010-01-06 to 2010-02-18 (NODC Accession 0112761)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0112761 includes discrete sample and profile data collected from DISCOVERY in the North Atlantic Ocean from 2010-01-06 to 2010-02-18 and retrieved...

  20. Bis(adamantan-1-aminium carbonate

    Directory of Open Access Journals (Sweden)

    Monika Nowakowska

    2012-04-01

    Full Text Available In the title compound, 2C10H18N+·CO32−, the adamantan-1-aminium cation forms three N—H...O hydrogen bonds to three carbonate ions, resulting in a layer parallel to (001 with the adamantane groups located on its surface so that adjacent layers form only C—H...H—C contacts. The carbonate anions occupy special positions of 32 symmetry, whereas the adamantan-1-aminium cations occupy special positions of 3 symmetry.

  1. High temperature neutron irradiation of carbon materials

    International Nuclear Information System (INIS)

    The radiation change in dimensions and certain properties of carbon structural materials, irradiated at 2100-2300 K by fluence up to 3x1020 neutr/cm2 (E >= 0.18 MeV) is considered. It is established that crystal structure of composite materials and carbon fibers improves as the result of high-temperature irradiation. The crystal lattice parameter decreases, whereas the dimensions of crystals and texture index grow

  2. Carbon accumulation in arid croplands of northwest China: pedogenic carbonate exceeding organic carbon

    Science.gov (United States)

    Wang, Xiujun; Wang, Jiaping; Xu, Minggang; Zhang, Wenju; Fan, Tinglu; Zhang, Juan

    2015-06-01

    Soil carbonate (SIC) exceeds organic carbon (SOC) greatly in arid lands, thus may be important for carbon sequestration. However, field data for quantifying carbonate accumulation have been lacking. This study aims to improve our understanding of SIC dynamics and its role in carbon sequestration. We analyzed two datasets of SOC and SIC and their 13C compositions , one with over 100 soil samples collected recently from various land uses in the Yanqi Basin, Xinjiang, and the other with 18 archived soil samples from a long-term experiment (LTE) in Pingliang, Gansu. The data from the Yanqi Basin showed that SOC had a significant relationship with SIC and pedogenic carbonate (PIC); converting shrub land to cropland increased PIC stock by 5.2 kg C m-2, which was 3.6 times of that in SOC stock. The data from the LTE showed greater accumulation of PIC (21-49 g C m-2 year-1) than SOC (10-39 g C m-2 year-1) over 0-20 cm. Our study points out that intensive cropping in the arid and semi-arid regions leads to an increase in both SOC and PIC. Increasing SOC through straw organic amendments enhances PIC accumulation in the arid cropland of northwestern China.

  3. Toward explaining the Holocene carbon dioxide and carbon isotope records: Results from transient ocean carbon cycle-climate simulations

    OpenAIRE

    Menviel, L.; F. Joos

    2012-01-01

    [1] The Bern3D model was applied to quantify the mechanisms of carbon cycle changes during the Holocene (last 11,000 years). We rely on scenarios from the literature to prescribe the evolution of shallow water carbonate deposition and of land carbon inventory changes over the glacial termination (18,000 to 11,000 years ago) and the Holocene and modify these scenarios within uncertainties. Model results are consistent with Holocene records of atmospheric CO2 and δ13C as well as the spatiotempo...

  4. Carbon and oxygen isotopic composition of the carbonates from the Jacupiranga and Catalao I carbonatite complexes, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Morikiyo, Toshiro (Shinshu Univ., Matsumoto, Nagano (Japan). Faculty of Science); Hirano, Hideo; Matsuhisa, Yukihiro

    1990-11-01

    Carbon and oxygen isotope compositions were measured for carbonates from the Jacupiranga and Catalao I carbonatite complexes in Brazil. The {delta}{sup 13}C values of the Jacupiranga carbonates are uniform, ranging from -6.4 to -5.6 per mille with the average of -6.07 per mille. Except for one sample, the {delta}{sup 18}O values of the carbonates are between 7.1 and 8.1 per mille, and the average value is 7.6 per mille. The isotopic compositions of the Jacupiranga carbonates represent the value of primary igneous carbonatite. The {delta}{sup 13}C values of dolomites are about 0.5 per mille higher than those of calcites. The {delta}{sup 13}C values of carbonates from the Catalao I complex range from -6.8 to -5.2 per mille with the average of -5.83 per mille. Those values are similar to the values of the Jacupiranga carbonates. However, oxygen isotopic compositions of the Catalao I carbonates show a wide range of 8.4 to 22.3 per mille. Carbonates with the lowest {delta}{sup 18}O values in the complex are considered to represent the igneous stage. Carbonates with extremely high {delta}{sup 18}O values of about 22 per mille are considered to have precipitated from low-temperature hydrothermal fluids. The group of intermediate {delta}{sup 18}O values indicates a variable degree of contamination by the {delta}{sup 18}O-rich hydrothermal carbonates. The contribution of secondary stage hydrothermal carbonates seems to be significant in the Catalao I complex as compared with the Jacupiranga complex. The development of a network structure in the Catalao I complex may have enhanced the circulation of the later stage hydrothermal fluids. (author).

  5. Alpha clustering in 18F

    International Nuclear Information System (INIS)

    We review some of the key experimental and theoretical studies of α-clustering in 18F. Particular attention is given to the 4p-2h nature of such α-clustered states, and the interaction between the holes and clusters is examined in terms of both weak and strongcoupling regimes. The experimental work focuses on α-transfer spectroscopy and α resonant scattering as tools for investigating α-clustering

  6. Texture recrystallization formation in 08Kh18T1

    International Nuclear Information System (INIS)

    Effect of heat treatment of semi-finished hot-rolled products before cold rolling and the strain degree on texture formation and the value of a plastic anisotropy coefficient in a cold-rolled sheet of the 08Kh18T1 steel after recrystallization has been investigated. The cold-rolled sheet of the ferritic stainless 08Kh18T1 steel after recrystallization at 950 deg C during 3 min is shown to have texture components like low-carbon steels: (111)(110), (111)(112), (112)(110), (100)(110) and axial component with axis (111). The quantative ratio of ideal oreientations in the steel depends on the degree of cold metal strain and to a larger extent on the structural state of semi-finished rolled products before cold rolling. Titanium addition in a stainless steel with 18% Cr affects formation, being favourable for texture sheet stamping with predominance of grain orientation with plane (111) only then, when titanium binds carbon and nitrogen in heat stable and disperse carbonitrides, which be in a cold-rolled sheet before recrystallization semi-finished hot-rolled products is to be subjected to stabilizing heat treatment before rolling. Increase in metal of orientations with plane (111) affects favourably increase of the plastic anisotropy coefficient of sheet rolling

  7. Beyond temperature: Clumped isotope signatures in dissolved inorganic carbon species and the influence of solution chemistry on carbonate mineral composition

    OpenAIRE

    Tripati, Aradhna K.; Hill, Pamela S.; Eagle, Robert A.; Mosenfelder, Jed L.; Tang, Jianwu; Schauble, Edwin A.; Eiler, John M.; Zeebe, Richard E.; Uchikawa, Joji; Coplen, Tyler B.; Ries, Justin B; Henry, Drew

    2015-01-01

    “Clumped-isotope” thermometry is an emerging tool to probe the temperature history of surface and subsurface environments based on measurements of the proportion of ^(13)C and ^(18)O isotopes bound to each other within carbonate minerals in ^(13)C^(18)O^(16)O_2^(2−) groups (heavy isotope “clumps”). Although most clumped isotope geothermometry implicitly presumes carbonate crystals have attained lattice equilibrium (i.e., thermodynamic equilibrium for a mineral, which is independent of solutio...

  8. 50 CFR 14.18 - Marine mammals.

    Science.gov (United States)

    2010-10-01

    ... with the Marine Mammal Protection Act of 1972 and implementing regulations (50 CFR parts 18 and 216... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Marine mammals. 14.18 Section 14.18....18 Marine mammals. Any person subject to the jurisdiction of the United States who has lawfully...

  9. Frontiers of graphene and carbon nanotubes devices and applications

    CERN Document Server

    2015-01-01

    This book focuses on carbon nanotubes and graphene as representatives of nano-carbon materials, and describes the growth of new technology and applications of new devices. As new devices and as new materials, nano-carbon materials are expected to be world pioneers that could not have been realized with conventional semiconductor materials, and as those that extend the limits of conventional semiconductor performance. This book introduces the latest achievements of nano-carbon devices, processes, and technology growth. It is anticipated that these studies will also be pioneers in the development of future research of nano-carbon devices and materials. This book consists of 18 chapters. Chapters 1 to 8 describe new device applications and new growth methods of graphene, and Chapters 9 to 18, those of carbon nanotubes. It is expected that by increasing the advantages and overcoming the weak points of nanocarbon materials, a new world that cannot be achieved with conventional materials will be greatly expanded. W...

  10. 40 CFR 52.1179 - Control strategy: Carbon monoxide.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 4 2010-07-01 2010-07-01 false Control strategy: Carbon monoxide. 52.1179 Section 52.1179 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS...: Carbon monoxide. (a) Approval—On March 18, 1999, the Michigan Department of Environmental...

  11. Acidity controls on dissolved organic carbon mobility in organic soils

    Czech Academy of Sciences Publication Activity Database

    Evans, Ch. D.; Jones, T.; Burden, A.; Ostle, N.; Zielinski, P.; Cooper, M.; Peacock, M.; Clark, J.; Oulehle, Filip; Cooper, D.; Freeman, Ch.

    2012-01-01

    Roč. 18, č. 11 (2012), s. 3317-3331. ISSN 1354-1013 Institutional support: RVO:67179843 Keywords : acidity * dissolved organic carbon * organic soil * peat * podzol * soil carbon * sulphur Subject RIV: EH - Ecology, Behaviour Impact factor: 6.910, year: 2012

  12. 18-FDG in diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Fares, Y. (Dept. of Biophysics, Faculty of Medicine, UAE Univ., Al Ain (United Arab Emirates)); Itoh, M. (Cyclotron and Radioisotope Centre, Tohoku Univ., Sendai (Japan)); Watabe, H. (Cyclotron and Radioisotope Centre, Tohoku Univ., Sendai (Japan)); Ghista, D.N. (Dept. of Biophysics, Faculty of Medicine, UAE Univ., Al Ain (United Arab Emirates))

    1993-06-01

    The intravenous glucose tolerance test, IVGTT, has been used to evaluate patients in whom abnormalities in carbohydrate metabolism and diabetes mellitus are suspected. IVGTT, if analyzed using 'minimal models', or discrete-time methods, provides information on the sensitivity of glucose disappearance to insulin and on pancreatic sensitivity to glucose, information that cannot be obtained from direct analysis of the dynamic response alone. In a preliminary study, data obtained by intravenously injecting 18-FDG in four subjects was analyzed using a discrete-time model. The experimental details, the results and their implications will be discussed. (orig.)

  13. Preparation of n.c.a. [18F]-CH2BrF via aminopolyether supported nucleophilic substitution

    International Nuclear Information System (INIS)

    A complex of the macrocyclic aminopolyether Kryptofix 2.2.2. and potassium carbonate was used to synthesize the positron emission tomography radiopharmaceutical, [18F]-CH2BrF, from dibromomethane. At the no-carrier-added level the nucleophilic 18F-for-Br exchange gives rise to a corrected radiochemical yield up to 62%. (author)

  14. Carbonate clumped isotope thermometry in continental tectonics

    Science.gov (United States)

    Huntington, Katharine W.; Lechler, Alex R.

    2015-04-01

    Reconstructing the thermal history of minerals and fluids in continental environments is a cornerstone of tectonics research. Paleotemperature constraints from carbonate clumped isotope thermometry have provided important tests of geodynamic, structural, topographic and basin evolution models. The thermometer is based on the 13C-18O bond ordering in carbonates (mass-47 anomaly, Δ47) and provides estimates of the carbonate formation temperature independent of the δ18O value of the water from which the carbonate grew; Δ47 is measured simultaneously with conventional measurements of carbonate δ13C and δ18O values, which together constrain the isotopic composition of the parent water. Depending on the geologic setting of carbonate growth, this information can help constrain paleoenvironmental conditions or basin temperatures and fluid sources. This review examines how clumped isotope thermometry can shed new light on problems in continental tectonics, focusing on paleoaltimetry, basin evolution and structural diagenesis applications. Paleoaltimetry is inherently difficult, and the precision in carbonate growth temperature estimates is at the limit of what is useful for quantitative paleoelevation reconstruction. Nevertheless, clumped isotope analyses have enabled workers to address previously intractable problems and in many settings offer the best chance of understanding topographic change from the geologic record. The portion of the shallow crust residing at temperatures up to ca. 200 °C is important as host to economic resources and records of tectonics and climate, and clumped isotope thermometry is one of the few proxies that can access this critical range with sensitivity to temperature alone. Only a handful of studies to date have used clumped isotopes to investigate diagenesis and other sub-surface processes using carbonate crystallization temperatures or the sensitivity of Δ47 values to a sample's thermal history. However, the thermometer is

  15. Carbon Footprints

    OpenAIRE

    Rahel Aichele; Gabriel Felbermayr

    2011-01-01

    Lässt sich der Beitrag eines Landes zum weltweiten Klimaschutz an der Veränderung seines CO2-Ausstoßes messen, wie es im Kyoto-Abkommen implizit unterstellt wird? Oder ist aufgrund der Bedeutung des internationalen Güterhandels der Carbon Footprint – der alle CO2-Emissionen erfasst, die durch die Absorption (d.h. Konsum und Investitionen) eines Landes entstehen – das bessere Maß? Die Autoren erstellen eine Datenbank mit den Footprints von 40 Ländern für den Zeitraum 1995–2007. Die deskriptive...

  16. A molecular organic carbon isotope record of Miocene climate changes

    NARCIS (Netherlands)

    Schoell, M.; Schouten, S.; Sinninghe Damsté, J.S.; Leeuw, J.W. de; Summons, R.E.

    1994-01-01

    The difference in carbon-13 (13C) contents of hopane and sterane biomarkers in the Monterey formation (Naples Beach, California) parallels the Miocene inorganic record of the change in 18O (δ18O), reflecting the Miocene evolution from a well-mixed to a highly stratified photic zone (upper 100 meters

  17. Carbonic Acid Retreatment of Biomass

    Energy Technology Data Exchange (ETDEWEB)

    Baylor university

    2003-06-01

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  18. Carbonic Acid Pretreatment of Biomass

    Energy Technology Data Exchange (ETDEWEB)

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

    2003-05-31

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  19. Respiratory health effects of carbon black: a survey of European carbon black workers.

    OpenAIRE

    Gardiner, K; Trethowan, N W; Harrington, J M; Rossiter, C E; Calvert, I A

    1993-01-01

    A study population of 3086 employees was identified in 18 carbon black production plants in seven European countries. Respiratory health questionnaires, spirometry, and chest radiographs were used to estimate effects on health and personal monitoring procedures were employed to measure current exposure to inspirable and respirable dust along with sulphur and carbon monoxide. The low concentrations of gaseous contaminants made the generation of their current and cumulative exposure indices imp...

  20. Carbon Nanomembranes.

    Science.gov (United States)

    Turchanin, Andrey; Gölzhäuser, Armin

    2016-08-01

    Carbon nanomembranes (CNMs) are synthetic 2D carbon sheets with tailored physical or chemical properties. These depend on the structure, molecular composition, and surroundings on either side. Due to their molecular thickness, they can be regarded as "interfaces without bulk" separating regions of different gaseous, liquid, or solid components and controlling the materials exchange between them. Here, a universal scheme for the fabrication of 1 nm-thick, mechanically stable, functional CNMs is presented. CNMs can be further modified, for example perforated by ion bombardment or chemically functionalized by the binding of other molecules onto the surfaces. The underlying physical and chemical mechanisms are described, and examples are presented for the engineering of complex surface architectures, e.g., nanopatterns of proteins, fluorescent dyes, or polymer brushes. A simple transfer procedure allows CNMs to be placed on various support structures, which makes them available for diverse applications: supports for electron and X-ray microscopy, nanolithography, nanosieves, Janus nanomembranes, polymer carpets, complex layered structures, functionalization of graphene, novel nanoelectronic and nanomechanical devices. To close, the potential of CNMs in filtration and sensorics is discussed. Based on tests for the separation of gas molecules, it is argued that ballistic membranes may play a prominent role in future efforts of materials separation. PMID:27281234

  1. Carbon compound used in hydrogen storage

    International Nuclear Information System (INIS)

    In the present work it is studied the activated carbon of mineral origin for the sorption of hydrogen. The carbon decreased of particle size by means of the one alloyed mechanical. The time of mill was of 10 hours. The characterization one carries out by scanning electron microscopy and X-ray diffraction. The hydrogen sipped in the carbon material it was determined using the Thermal gravimetric method (TGA). The conditions of hydrogenation went at 10 atm of pressure and ambient temperature during 18 hours. They were also carried out absorption/desorption cycles of hydrogen in the same one system of thermal gravimetric analysis. The results showed percentages of sorption of 2% approximately in the cycles carried out in the system TGA and of 4.5% in weight of hydrogen at pressure of 10 atmospheres and ambient temperature during 18 hours. (Author)

  2. Trading forest carbon

    Science.gov (United States)

    The nature of carbon in forests is discussed from the perspective of carbon trading. Carbon inventories, specifically in the area of land use and forestry are reviewed for the Pacific Northwest. Carbon turnover in forests is discussed as it relates to carbon sequestration. Scient...

  3. Determination of 13C and 18O isotopic abundances of carboxyl substances; application to amino acids

    International Nuclear Information System (INIS)

    Flash pyrolysis of organic acids or of their salts gives off carbon dioxide which can be analysed by mass spectrometry for 13C and 18O abundance. This principle has been applied to Cd13C18O3 using an induction furnace, and used to determine the 13C and 18O content of the carboxylic group of some amino acids. The technique described has many advantages over the classical pyrolysis methods using sealed tubes. It is rapid and simple and especially effective in determining the isotopic composition of hygroscopic carboxyl substances. (U.K.)

  4. 18-24 Months: Your Child's Development

    Science.gov (United States)

    ... Resources & Services Parenting Resource 18–24 Months: Your Child’s Development Download Files Feb 10, 2016 This is a ... home language in the same sentence. Downloads Your Child's Development: 18–24 Months PDF 464 KB Read more ...

  5. Carbon Farming as a Carbon Negative Technology

    Science.gov (United States)

    Anderson, C.; Laird, D.; Hayes, D. J.

    2015-12-01

    Carbon farms have a pivotal role in national and international efforts to mitigate and adapt to climate change. A carbon farm in its broadest sense is one that reduces greenhouse gas (GHG) emissions or captures and holds carbon in vegetation and soils. Their capacity to remove carbon from the air and store it safely and permanently, while providing additional human and ecosystem benefits, means they could contribute significantly to national efforts to stabilize or reduce GHGs. We examine carbon farms in the context of corn and soybean production agriculture. We illustrate, using Iowa data but with relevance across United States corn and soybean production, the potential for carbon farms to reduce human GHG emissions and sequester carbon permanently at a rate that has meaningful impact on global greenhouse gas concentration. Carbon has been viewed as a next generation cash crop in Iowa for over a decade. The carbon farm perspective, however, goes beyond carbon as cash crop to make carbon the center of an entire farm enterprise. The transformation is possible through slight adjustment crop practices mixed with advances in technology to sequester carbon through biochar. We examine carbon balance of Iowa agriculture given only the combination of slight reduction in fertilizer and sequestration by biochar. We find the following. Iowa carbon farms could turn Iowa agriculture into a carbon sink. The estimated range of GHG reduction by statewide implementation of carbon farms is 19.46 to 90.27 MMt CO2-equivalent (CO2-e), while the current agricultural CO2-e emission estimate is 35.38 MMt CO2-e. Iowa carbon farm GHG reduction would exceed Iowa GHG reduction by wind energy (8.7 MMt CO2-e) and could exceed combined reductions from wind energy and corn grain ethanol (10.7 MMt CO2-e; 19.4 MMt CO2-e combined). In fact, Iowa carbon farms alone could exceed GHG reduction from national corn grain ethanol production (39.6 MMt CO2-e). A carbon price accessible to agricultural

  6. Carbon Monoxide Poisoning

    Science.gov (United States)

    ... Recommend on Facebook Tweet Share Compartir What is Carbon Monoxide? Carbon monoxide, or “CO,” is an odorless, colorless gas that can kill you. Carbon monoxide detector Where is CO found? CO is ...

  7. Net Ecosystem Carbon Flux

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Net Ecosystem Carbon Flux is defined as the year-over-year change in Total Ecosystem Carbon Stock, or the net rate of carbon exchange between an ecosystem and the...

  8. Carbon Monoxide (CO)

    Science.gov (United States)

    ... IAQ) » Carbon Monoxide's Impact on Indoor Air Quality Carbon Monoxide's Impact on Indoor Air Quality On this ... length of exposure. Top of Page Sources of Carbon Monoxide Sources of CO include: unvented kerosene and ...

  9. Desalination with carbon aerogel electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Farmer, J.C.; Richardson, J.H.; Fix, D.V.

    1996-10-21

    An electrically regenerated electrosorption process known as carbon aerogel CDI was developed for continuously removing ionic impurities from aqueous streams. A salt solution flows in a channel formed by pairs of parallel carbon aerogel electrodes. Each electrode has a very high BET surface area and very low resistivity. After polarization, anions and cations are removed from electrolyte by the electric field and electrosorbed onto the carbon aerogel. The solution is thus separated into two streams, brine and water. Based on this, carbon aerogel CDI appears to be an energy-efficient alternative to evaporation, electrodialysis, and reverse osmosis. The energy required by this process is about QV/2, plus losses. Estimated energy requirement for sea water desalination is 18-27 Wh gal{sup -1}, depending on cell voltage and flow rate. The requirement for brackish water desalination is less, 1.2-2.5 Wh gal{sup -1} at 1600 ppM. This is assuming that stored electrical energy is reclaimed during regeneration.

  10. 25 CFR 75.18 - Adoption.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Adoption. 75.18 Section 75.18 Indians BUREAU OF INDIAN... OF CHEROKEE INDIANS, NORTH CAROLINA § 75.18 Adoption. The Tribal Council of the Eastern Band of Cherokee Indians shall be empowered to enact ordinances governing the adoption of new members....

  11. 29 CFR 525.18 - Review.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Review. 525.18 Section 525.18 Labor Regulations Relating to... DISABILITIES UNDER SPECIAL CERTIFICATES § 525.18 Review. Any person aggrieved by any action of the... allow, file with the Administrator a petition for review. Such review, if granted, shall be made by...

  12. 31 CFR 92.18 - Judicial review.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Judicial review. 92.18 Section 92.18... States Mint § 92.18 Judicial review. A Final Notice of Assessment issued under the procedures in this subpart may be subject to judicial review pursuant to 5 U.S.C. 701 et seq....

  13. 28 CFR 542.18 - Response time.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Response time. 542.18 Section 542.18... REMEDY Administrative Remedy Program § 542.18 Response time. If accepted, a Request or Appeal is... later than the third calendar day after filing. If the time period for response to a Request or...

  14. 32 CFR 552.18 - Administration.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Administration. 552.18 Section 552.18 National... CEMETERIES REGULATIONS AFFECTING MILITARY RESERVATIONS Post Commander § 552.18 Administration. (a) Purpose... economical operation, administration, service, and supply of all individuals, units, and activities...

  15. 50 CFR 401.18 - Contracts.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Contracts. 401.18 Section 401.18 Wildlife..., DEVELOPMENT AND ENHANCEMENT § 401.18 Contracts. A Cooperator may use its own regulations or guidelines in obtaining services by contract or otherwise, provided that they adhere to applicable Federal...

  16. 10 CFR 605.18 - National security.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false National security. 605.18 Section 605.18 Energy DEPARTMENT... PROGRAM § 605.18 National security. Activities under ER's Financial Assistance Program shall not involve classified information (i.e., Restricted Data, formerly Restricted Data, National Security...

  17. 27 CFR 18.19 - Security.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Security. 18.19 Section 18.19 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Provisions Document Requirements § 18.19 Security. The concentrate plant and equipment will be so...

  18. 22 CFR 308.18 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 308.18 Section 308.18 Foreign Relations PEACE CORPS IMPLEMENTATION OF THE PRIVACY ACT OF 1974 § 308.18 Fees. No fees shall be charged for search time or for any other time expended by the agency to produce a record. Copies of records may be...

  19. 49 CFR 18.41 - Financial reporting.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Financial reporting. 18.41 Section 18.41... Enforcement § 18.41 Financial reporting. (a) General. (1) Except as provided in paragraphs (a) (2) and (5) of...) Submitting financial reports to Federal agencies, or (ii) Requesting advances or reimbursements when...

  20. 30 CFR 18.26 - Static electricity.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Static electricity. 18.26 Section 18.26 Mineral... § 18.26 Static electricity. Nonmetallic rotating parts, such as belts and fans, shall be provided with a means to prevent an accumulation of static electricity....

  1. 29 CFR 18.13 - Discovery methods.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Discovery methods. 18.13 Section 18.13 Labor Office of the... ADMINISTRATIVE LAW JUDGES General § 18.13 Discovery methods. Parties may obtain discovery by one or more of the following methods: Depositions upon oral examination or written questions; written...

  2. 7 CFR 1209.18 - Region.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Region. 1209.18 Section 1209.18 Agriculture....18 Region. Region means one of the described geographic subdivisions of the production areas described in § 1209.30 (b) or as later realigned or reapportioned pursuant thereto, or the import...

  3. 7 CFR 1735.18 - Additional equity.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Additional equity. 1735.18 Section 1735.18 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF... Basic Policies § 1735.18 Additional equity. If determined by the Administrator to be necessary for...

  4. 10 CFR 95.18 - Key personnel.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Key personnel. 95.18 Section 95.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FACILITY SECURITY CLEARANCE AND SAFEGUARDING OF NATIONAL SECURITY INFORMATION AND RESTRICTED DATA Physical Security § 95.18 Key personnel. The senior management official...

  5. 7 CFR 959.18 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 959.18 Section 959.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 959.18 Export. Export means to ship onions to any destination which is not...

  6. 7 CFR 966.18 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 966.18 Section 966.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 966.18 Export. Export means shipment of tomatoes beyond the boundaries of the...

  7. 25 CFR 140.18 - Intoxicating liquors.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Intoxicating liquors. 140.18 Section 140.18 Indians....18 Intoxicating liquors. No trader shall use or permit to be used his premises for any unlawful... manufacture, sale, gift, transportation, drinking or storage of intoxicating liquors or beverages in...

  8. 47 CFR 18.307 - Conduction limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Conduction limits. 18.307 Section 18.307... Standards § 18.307 Conduction limits. For the following equipment, when designed to be connected to the... on any frequency or frequencies shall not exceed the limits in the following tables. Compliance...

  9. 29 CFR 18.35 - Legal assistance.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Legal assistance. 18.35 Section 18.35 Labor Office of the Secretary of Labor RULES OF PRACTICE AND PROCEDURE FOR ADMINISTRATIVE HEARINGS BEFORE THE OFFICE OF ADMINISTRATIVE LAW JUDGES General § 18.35 Legal assistance. The Office of Administrative Law Judges does not...

  10. 28 CFR 100.18 - Audit.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Audit. 100.18 Section 100.18 Judicial... ENFORCEMENT ACT OF 1994 § 100.18 Audit. (a) General. In order to evaluate the accuracy, completeness, and... examine and audit all of the carrier's supporting materials. (1) These materials include, but are...

  11. 7 CFR 1218.18 - Research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Research. 1218.18 Section 1218.18 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.18...

  12. 7 CFR 1206.18 - Research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Research. 1206.18 Section 1206.18 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.18 Research. Research...

  13. 42 CFR 73.18 - Inspections.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inspections. 73.18 Section 73.18 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES QUARANTINE, INSPECTION, LICENSING SELECT AGENTS AND TOXINS § 73.18 Inspections. (a) Without prior notification, the HHS Secretary, shall...

  14. 40 CFR 78.18 - Proposed decision.

    Science.gov (United States)

    2010-07-01

    ... decision on the factual, policy, and legal issues referred by the Environmental Appeals Board for decision... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Proposed decision. 78.18 Section 78.18... PROCEDURES § 78.18 Proposed decision. (a) The Presiding Officer will review and evaluate the...

  15. 40 CFR 24.18 - Final decision.

    Science.gov (United States)

    2010-07-01

    ... Administrator modifies the recommended decision, he shall insure that the final decision indicates the legal and... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Final decision. 24.18 Section 24.18... ADMINISTRATIVE HEARINGS ON INTERIM STATUS CORRECTIVE ACTION ORDERS Post-Hearing Procedures § 24.18 Final...

  16. 29 CFR 18.411 - Liability insurance.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Liability insurance. 18.411 Section 18.411 Labor Office of... OF ADMINISTRATIVE LAW JUDGES Rules of Evidence Relevancy and Its Limits § 18.411 Liability insurance... evidence of insurance against liability when offered for another purpose, such as proof of...

  17. 30 CFR 778.18 - Insurance.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Insurance. 778.18 Section 778.18 Mineral... APPLICATIONS-MINIMUM REQUIREMENTS FOR LEGAL, FINANCIAL, COMPLIANCE, AND RELATED INFORMATION § 778.18 Insurance. An application shall contain either a certificate of liability insurance or evidence of...

  18. 40 CFR 1502.18 - Appendix.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Appendix. 1502.18 Section 1502.18 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY ENVIRONMENTAL IMPACT STATEMENT § 1502.18 Appendix. If an agency prepares an appendix to an environmental impact statement the appendix shall:...

  19. 38 CFR 18b.2 - Reviewing authority.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Reviewing authority. 18b.2 Section 18b.2 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED... Rules § 18b.2 Reviewing authority. The term reviewing authority means the Secretary of Veterans...

  20. 1 CFR 18.8 - Seal.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Seal. 18.8 Section 18.8 General Provisions ADMINISTRATIVE COMMITTEE OF THE FEDERAL REGISTER PREPARATION, TRANSMITTAL, AND PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.8 Seal. Use of a seal on an original document...

  1. 45 CFR 16.18 - Mediation.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Mediation. 16.18 Section 16.18 Public Welfare... BOARD § 16.18 Mediation. (a) In cases pending before the Board. If the Board decides that mediation... mediation techniques and will provide or assist in selecting a mediator. The mediator may take any...

  2. 38 CFR 18b.93 - Expeditious treatment.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Expeditious treatment. 18b.93 Section 18b.93 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Judicial Standards of Practice § 18b.93 Expeditious treatment. Requests for expeditious treatment...

  3. 32 CFR 18.3 - Organization.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Organization. 18.3 Section 18.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE MILITARY COMMISSIONS APPOINTING AUTHORITY FOR MILITARY COMMISSIONS § 18.3 Organization. (a) The Appointing Authority for Military Commissions...

  4. 46 CFR Sec. 18 - Group classification.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Group classification. Sec. 18 Section 18 Shipping... Sec. 18 Group classification. In the preparation of specifications, Job Orders, Supplemental Job... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards...

  5. 7 CFR 247.18 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 247.18 Section 247.18 Agriculture... CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.18 Nutrition education. (a) What are the State agency's responsibilities in ensuring that nutrition education is provided? The State...

  6. 38 CFR 18.438 - Adult education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Adult education. 18.438 Section 18.438 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED... Adult Education § 18.438 Adult education. A recipient that provides adult education may not, on...

  7. 29 CFR 18.50 - Authenticity.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Authenticity. 18.50 Section 18.50 Labor Office of the Secretary of Labor RULES OF PRACTICE AND PROCEDURE FOR ADMINISTRATIVE HEARINGS BEFORE THE OFFICE OF ADMINISTRATIVE LAW JUDGES General § 18.50 Authenticity. The authenticity of all documents submitted as...

  8. 7 CFR 1709.18 - Civil rights.

    Science.gov (United States)

    2010-01-01

    ... benefits and on equal employment opportunity including 7 CFR parts 15 and 15b; and 45 CFR part 90, as... 7 Agriculture 11 2010-01-01 2010-01-01 false Civil rights. 1709.18 Section 1709.18 Agriculture... ASSISTANCE TO HIGH ENERGY COST COMMUNITIES General Requirements § 1709.18 Civil rights. This program will...

  9. 40 CFR 766.18 - Method sensitivity.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Method sensitivity. 766.18 Section 766.18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT DIBENZO-PARA-DIOXINS/DIBENZOFURANS General Provisions § 766.18 Method sensitivity. The target level...

  10. 38 CFR 18b.57 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Evidence. 18b.57 Section 18b.57 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) PRACTICE AND... § 18b.57 Evidence. Irrelevant, immaterial, unreliable, and unduly repetitious evidence will be excluded....

  11. 22 CFR 18.16 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Evidence. 18.16 Section 18.16 Foreign Relations... Enforcement Proceedings § 18.16 Evidence. The rules of evidence prevailing in courts of law and equity are not controlling in hearings under this part. However, the hearing examiner shall exclude evidence which...

  12. 39 CFR 952.18 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Evidence. 952.18 Section 952.18 Postal Service... AND LOTTERY ORDERS § 952.18 Evidence. (a) Except as otherwise provided in these rules, the Federal Rules of Evidence shall govern. However, such rules may be relaxed to the extent that the...

  13. 30 CFR 18.34 - Motors.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Motors. 18.34 Section 18.34 Mineral Resources... PRODUCTS ELECTRIC MOTOR-DRIVEN MINE EQUIPMENT AND ACCESSORIES Construction and Design Requirements § 18.34 Motors. Explosion-proof electric motor assemblies intended for use in approved equipment in...

  14. 12 CFR 1.8 - Nonconforming investments.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Nonconforming investments. 1.8 Section 1.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY INVESTMENT SECURITIES § 1.8 Nonconforming investments. (a) A national bank's investment in securities that no longer conform to this part but conformed when made will not be...

  15. 12 CFR 703.18 - Grandfathered investments.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Grandfathered investments. 703.18 Section 703.18 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS AFFECTING CREDIT UNIONS INVESTMENT AND DEPOSIT ACTIVITIES § 703.18 Grandfathered investments. (a) Subject to safety and...

  16. 21 CFR 349.18 - Ophthalmic vasoconstrictors.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Ophthalmic vasoconstrictors. 349.18 Section 349.18... FOR HUMAN USE OPHTHALMIC DRUG PRODUCTS FOR OVER-THE-COUNTER HUMAN USE Active Ingredients § 349.18 Ophthalmic vasoconstrictors. The active ingredient of the product consists of one of the following,...

  17. Direct carbon emissions from Canadian forest fires, 1959-1999

    International Nuclear Information System (INIS)

    Fire is recognised as driving most of the boreal forest carbon balance in North America, therefore fires not only impact on carbon sequestration by forests, but emit greenhouse gases that have the potential to affect the environment. In this paper direct emissions of carbon from Canadian forest fires were estimated for all of Canada and for each ecozone for the period 1959 to 1999. Estimates were based on large fires ; fuel consumption for each fire was calculated using the Canadian Forest Fire Behaviour Prediction System. There were about 11,400 forest fires, averaging 2 x 106 hectare per year during this period. Boreal and taiga areas experienced the greatest area burned, releasing most of the carbon. The mean area-weighted fuel consumption for all fires was 2.6 kg of dry fuel per m2 (1.3 kg carbon per m2) varying from 1.8 kg to 3.9 kg per m2 among ecozones. The mean annual direct carbon emission was estimated at 27 + or - 6 Tg carbon per year, or about 18 per cent of current carbon dioxide emissions from the Canadian energy sector, on average. This excludes post-fire effects, which cause an additional loss of carbon; changes to the forest also affect the strength of the forest carbon sink. Fire emissions have shown an increase over the past two decades and are likely to remain high due to anticipated changes in fire weather resulting from climate warming. 48 refs., 3 tabs., 6 figs

  18. Validating methods for measuring delta18O and delta13C in otoliths from freshwater fish.

    Science.gov (United States)

    Guiguer, K R R A; Drimmie, R; Power, M

    2003-01-01

    The ability of the phosphoric acid digestion technique to extract carbon dioxide from biogenic carbonates and reliably reproduce delta(18)O and delta(13)C signatures from standard reference materials (NBS-18, NBS-19) was tested and shown to produce accurate, unbiased measurements of non-biologic materials. The effects of roasting preparation methods commonly reported when analyzing biogenic carbonates were also tested in a series of experiments using reference standards and otoliths obtained from aquacultured Arctic charr and rainbow trout. Roasting had no effect on the isotope measurement of reference standards. No significant differences between mean oxygen isotope signatures from paired experiments with roasted and non-roasted fish otoliths were found. However, otolith oxygen isotope measurements were significantly enriched in comparison to rearing water-based measurements for both species. Agreement between expected isotopic equilibrium and measured otolith delta(18)O values varied as a function of roasting temperature and between species. Criteria for the selection of appropriate roasting temperatures are suggested and favour 350 degrees C in freshwater fish where unbiased estimates of average rearing water temperatures and known differences in rearing temperatures were obtained. Carbon isotopic disequilibria were observed for both species. A mixing model analysis established differences in the percentage of metabolically derived carbon in studied otoliths, with Arctic charr deriving a greater proportion of otolith delta(13)C from metabolism as a result of higher metabolic rates. PMID:12590395

  19. Integral Ring Carbon-Carbon Piston

    Science.gov (United States)

    Northam, G. Burton (Inventor)

    1999-01-01

    An improved structure for a reciprocating internal combustion engine or compressor piston fabricate from carbon-carbon composite materials is disclosed. An integral ring carbon-carbon composite piston, disclosed herein, reduces the need for piston rings and for small clearances by providing a small flexible, integral component around the piston that allows for variation in clearance due to manufacturing tolerances, distortion due to pressure and thermal loads, and variations in thermal expansion differences between the piston and cylinder liner.

  20. Carbon dioxide sequestration by mineral carbonation

    OpenAIRE

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept behind mineral CO2 sequestration is the mimicking of natural weathering processes in which calcium or magnesium containing minerals react with gaseous CO2 and form solid calcium or magnesium carbonate...

  1. Carbon dioxide sequestration by mineral carbonation

    NARCIS (Netherlands)

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept beh

  2. 2-deoxy-2-[18F]fluoro-D-mannose positron emission tomography imaging in atherosclerosis.

    Science.gov (United States)

    Tahara, Nobuhiro; Mukherjee, Jogeshwar; de Haas, Hans J; Petrov, Artiom D; Tawakol, Ahmed; Haider, Nezam; Tahara, Atsuko; Constantinescu, Cristian C; Zhou, Jun; Boersma, Hendrikus H; Imaizumi, Tsutomu; Nakano, Masataka; Finn, Aloke; Fayad, Zahi; Virmani, Renu; Fuster, Valentin; Bosca, Lisardo; Narula, Jagat

    2014-02-01

    Progressive inflammation in atherosclerotic plaques is associated with increasing risk of plaque rupture. Molecular imaging of activated macrophages with 2-deoxy-2-[(18)F]fluoro-D-glucose ([(18)F]FDG) has been proposed for identification of patients at higher risk for acute vascular events. Because mannose is an isomer of glucose that is taken up by macrophages through glucose transporters and because mannose receptors are expressed on a subset of the macrophage population in high-risk plaques, we applied (18)F-labeled mannose (2-deoxy-2-[(18)F]fluoro-D-mannose, [(18)F]FDM) for targeting of plaque inflammation. Here, we describe comparable uptake of [(18)F]FDM and [(18)F]FDG in atherosclerotic lesions in a rabbit model; [(18)F]FDM uptake was proportional to the plaque macrophage population. Our FDM competition studies in cultured cells with 2-deoxy-2-[(14)C]carbon-D-glucose ([(14)C]2DG) support at least 35% higher [(18)F]FDM uptake by macrophages in cell experiments. We also demonstrate that FDM restricts binding of anti-mannose receptor antibody to macrophages by approximately 35% and that mannose receptor targeting may provide an additional avenue for imaging of plaque inflammation. PMID:24412923

  3. Routine quality control of recycled target [18O]water by capillary electrophoresis and gas chromatography

    International Nuclear Information System (INIS)

    Recycling of [18O]water for [18F]fluoride production can be accomplished with reliable results. We have developed sensitive, robust, and rapid analyses of impurities in [18O]water. Anions were quantitated by capillary electrophoresis and organic residuals were quantitated by gas chromatography using methods with excellent reproducibility and linearity. Kryptofix 222 (K-222) was quantitated by a sensitive LC-MS-MS technique. Isotopic composition was determined by GC-MS with satisfactory accuracy and precision. These methods were employed to evaluate recovered [18O]water purified by a novel electrolysis method. 2-[18F]FDG yields using purified [18O]water with very low levels of impurities are indistinguishable from newly purchased [18O]water. High (> 300 ppm) carbonate concentration reduces the fluoride trapping efficiency of QMA. The analyses of anions, organics, and isotopic enrichment were applied routinely for quality control of [18O]water to predict a satisfactory outcome of 2-[18F]FDG production

  4. Composite carbon foam electrode

    Science.gov (United States)

    Mayer, S.T.; Pekala, R.W.; Kaschmitter, J.L.

    1997-05-06

    Carbon aerogels used as a binder for granulated materials, including other forms of carbon and metal additives, are cast onto carbon or metal fiber substrates to form composite carbon thin film sheets. The thin film sheets are utilized in electrochemical energy storage applications, such as electrochemical double layer capacitors (aerocapacitors), lithium based battery insertion electrodes, fuel cell electrodes, and electrocapacitive deionization electrodes. The composite carbon foam may be formed by prior known processes, but with the solid particles being added during the liquid phase of the process, i.e. prior to gelation. The other forms of carbon may include carbon microspheres, carbon powder, carbon aerogel powder or particles, graphite carbons. Metal and/or carbon fibers may be added for increased conductivity. The choice of materials and fibers will depend on the electrolyte used and the relative trade off of system resistivity and power to system energy. 1 fig.

  5. Imbalance of Interleukin 18 and Interleukin 18 Binding Protein in Patients with Lupus Nephritis

    Institute of Scientific and Technical Information of China (English)

    Dong Liang; Wenfeng Ma; Cuiwei Yao; Huafeng Liu; Xiaowen Chen

    2006-01-01

    To evaluate the balance status of interleukin 18 (IL-18) and interleukin 18 binding protein (IL-18BP) in circulation in patients with lupus nephritis (LN) and primary nephrotic syndrome (PNS), plasma levels as well as mRNA expression in peripheral blood mononuclear cells (PBMCs) of IL-18 and IL-18BP were measured by ELISA and RT-PCR respectively. The ratio of IL-18/IL-18BP was also calculated. Both plasma IL-18 and IL-18BP increased significantly in LN patients while only IL-18BP increased in PNS, which resulted in an elevated ratio of IL-18/IL-18BP in LN but not in PNS patients when compared with normal controls. In contrast, increased level of IL-18 mRNA was only detected in LN but not in PNS group, although IL-18BP mRNA expressions in PBMCs in both groups were higher than that in control. The imbalance of IL-18 and IL-18BP might be involved in the pathogenesis of LN, based on which a therapeutic approach is valuable to be developed for LN. Cellular & Molecular Immunology. 2006;3(4):303-306.

  6. The dynamic response of carbon fiber-filled polymer composites

    OpenAIRE

    Patterson B.; Orler E.B.; Furmanski J.; Rigg P.A.; Scharff R.J.; Stahl D.B.; Sheffield S.A.; Gustavsen R.L.; Dattelbaum D.M.; Coe J.D.

    2012-01-01

    The dynamic (shock) responses of two carbon fiber-filled polymer composites have been quantified using gas gun-driven plate impact experimentation. The first composite is a filament-wound, highly unidirectional carbon fiber-filled epoxy with a high degree of porosity. The second composite is a chopped carbon fiber- and graphite-filled phenolic resin with little-to-no porosity. Hugoniot data are presented for the carbon fiber-epoxy (CE) composite to 18.6 GPa in the through-thickness direction,...

  7. Structural basis for antagonism of human interleukin 18 by poxvirus interleukin 18-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Krumm, Brian; Meng, Xiangzhi; Li, Yongchao; Xiang, Yan; Deng, Junpeng (Texas-HSC); (OKLU)

    2009-07-10

    Human interleukin-18 (hIL-18) is a cytokine that plays an important role in inflammation and host defense against microbes. Its activity is regulated in vivo by a naturally occurring antagonist, the human IL-18-binding protein (IL-18BP). Functional homologs of human IL-18BP are encoded by all orthopoxviruses, including variola virus, the causative agent of smallpox. They contribute to virulence by suppressing IL-18-mediated immune responses. Here, we describe the 2.0-{angstrom} resolution crystal structure of an orthopoxvirus IL-18BP, ectromelia virus IL-18BP (ectvIL-18BP), in complex with hIL-18. The hIL-18 structure in the complex shows significant conformational change at the binding interface compared with the structure of ligand-free hIL-18, indicating that the binding is mediated by an induced-fit mechanism. EctvIL-18BP adopts a canonical Ig fold and interacts via one edge of its {beta}-sandwich with 3 cavities on the hIL-18 surface through extensive hydrophobic and hydrogen bonding interactions. Most of the ectvIL-18BP residues that participate in these interactions are conserved in both human and viral homologs, explaining their functional equivalence despite limited sequence homology. EctvIL-18BP blocks a putative receptor-binding site on IL-18, thus preventing IL-18 from engaging its receptor. Our structure provides insights into how IL-18BPs modulate hIL-18 activity. The revealed binding interface provides the basis for rational design of inhibitors against orthopoxvirus IL-18BP (for treating orthopoxvirus infection) or hIL-18 (for treating certain inflammatory and autoimmune diseases).

  8. Global deforestation: contribution to atmospheric carbon dioxide.

    Science.gov (United States)

    Woodwell, G M; Hobbie, J E; Houghton, R A; Melillo, J M; Moore, B; Peterson, B J; Shaver, G R

    1983-12-01

    A study of effects of terrestrial biota on the amount of carbon dioxide in the atmosphere suggests that the global net release of carbon due to forest clearing between 1860 and 1980 was between 135 x 10(15) and 228 x 10(15) grams. Between 1.8 x 10(15) and 4.7 x 10(15) grams of carbon were released in 1980, of which nearly 80 percent was due to deforestation, principally in the tropics. The annual release of carbon from the biota and soils exceeded the release from fossil fuels until about 1960. Because the biotic release has been and remains much larger than is commonly assumed, the airborne fraction, usually considered to be about 50 percent of the release from fossil fuels, was probably between 22 and 43 percent of the total carbon released in 1980. The increase in carbon dioxide in the atmosphere is thought by some to be increasing the storage of carbon in the earth's remaining forests sufficiently to offset the release from deforestation. The interpretation of the evidence presented here suggests no such effect; deforestation appears to be the dominant biotic effect on atmospheric carbon dioxide. If deforestation increases in proportion to population, the biotic release of carbon will reach 9 x 10(15) grams per year before forests are exhausted early in the next century. The possibilities for limiting the accumulation of carbon dioxide in the atmosphere through reduction in use of fossil fuels and through management of forests may be greater than is commonly assumed. PMID:17747369

  9. V18P9C2. A complex phosphide carbide

    International Nuclear Information System (INIS)

    V18P9C2 crystallizes in the orthorhombic space group Pmma with the lattice parameters a = 17.044(3), b = 3.2219(7), and c = 13.030(2) Aa, Z = 2. The crystal structure is composed of 19 symmetry-independent atoms. The crystal structure is considered as a network formed by the transition metal atoms exhibiting cubic, trigonal prismatic, and octahedral voids centered by V, P, and C atoms, respectively. Vice versa, the V and P atoms form a three-dimensional network. The two CV6 octahedra are edge- and corner-connected to chains running parallel to [010]. The five unique P atoms are trigonal prismatically coordinated by V atoms with one to three faces capped again by a V atom. The V atoms have mainly cubic environments formed solely by V or by V and P atoms. V18P9C2 exhibits some structural relations to other compounds of the ternary system V-P-C as well as to other intermetallic phases. Despite the low carbon content, V18P9C2 is considered as a ternary compound rather than an interstitially stabilized (binary) phosphide in view of its special structural features.

  10. Digital Mapping of Soil Organic Carbon Contents and Stocks in Denmark

    OpenAIRE

    Kabindra Adhikari; Hartemink, Alfred E.; Budiman Minasny; Rania Bou Kheir; Mette B Greve; Greve, Mogens H.

    2014-01-01

    Estimation of carbon contents and stocks are important for carbon sequestration, greenhouse gas emissions and national carbon balance inventories. For Denmark, we modeled the vertical distribution of soil organic carbon (SOC) and bulk density, and mapped its spatial distribution at five standard soil depth intervals (0-5, 5-15, 15-30, 30-60 and 60-100 cm) using 18 environmental variables as predictors. SOC distribution was influenced by precipitation, land use, soil type, wetland, elevation, ...

  11. Mutagenicity of carbon nanomaterials

    DEFF Research Database (Denmark)

    Wallin, Håkan; Jacobsen, Nicklas Raun; White, Paul A;

    2011-01-01

    Carbon nanomaterials such carbon nanotubes, graphene and fullerenes are some the most promising nanomaterials. Although carbon nanomaterials have been reported to possess genotoxic potential, it is imperitive to analyse the data on the genotoxicity of carbon nanomaterials in vivo and in vitro and...

  12. Carbon compound used in hydrogen storage; Compuesto de carbon utilizado en almacenamiento de hidrogeno

    Energy Technology Data Exchange (ETDEWEB)

    Iturbe G, J.L.; Lopez M, B.E. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2004-07-01

    In the present work it is studied the activated carbon of mineral origin for the sorption of hydrogen. The carbon decreased of particle size by means of the one alloyed mechanical. The time of mill was of 10 hours. The characterization one carries out by scanning electron microscopy and X-ray diffraction. The hydrogen sipped in the carbon material it was determined using the Thermal gravimetric method (TGA). The conditions of hydrogenation went at 10 atm of pressure and ambient temperature during 18 hours. They were also carried out absorption/desorption cycles of hydrogen in the same one system of thermal gravimetric analysis. The results showed percentages of sorption of 2% approximately in the cycles carried out in the system TGA and of 4.5% in weight of hydrogen at pressure of 10 atmospheres and ambient temperature during 18 hours. (Author)

  13. Electroanalysis with carbon paste electrodes

    CERN Document Server

    Svancara, Ivan; Walcarius, Alain; Vytras, Karel

    2011-01-01

    Introduction to Electrochemistry and Electroanalysis with Carbon Paste-Based ElectrodesHistorical Survey and GlossaryField in Publication Activities and LiteratureCarbon Pastes and Carbon Paste ElectrodesCarbon Paste as the Binary MixtureClassification of Carbon Pastes and Carbon Paste ElectrodesConstruction of Carbon Paste HoldersCarbon Paste as the Electrode MaterialPhysicochemical Properties of Carbon PastesElectrochemical Characteristics of Carbon PastesTesting of Unmodified CPEsIntera

  14. IL-18 and IL-18 binding protein levels in patients with dengue virus infection

    Institute of Scientific and Technical Information of China (English)

    Chintana Chirathaworn; Yong Poovorawan; Viboonsak Vuthitanachot

    2010-01-01

    Objective:To determine the levels ofIL-18 andIL-18binding protein(BP) in patients with dengue virus infection.Methods: Acute and convalescent sera were collected from each patient. Control group was sera from blood donors. The levels of both IL-18 andIL-18BP were measured byELISA assays.Results: It was shown thatIL-18 andIL-18BPlevels were significantly higher in patients when compared with controls. In addition, the level ofIL-18BP was lower in convalescent than in acute sera.Conclusions: These data suggest that bothIL-18 andIL-18BP production was induced following dengue virus infection. Investigating the regulation of IL-18 by its natural regulator could lead to further understanding of the immune response or immunopathogenesis following dengue virus infection.

  15. Pyrolyzed thin film carbon

    Science.gov (United States)

    Tai, Yu-Chong (Inventor); Liger, Matthieu (Inventor); Harder, Theodore (Inventor); Konishi, Satoshi (Inventor); Miserendino, Scott (Inventor)

    2010-01-01

    A method of making carbon thin films comprises depositing a catalyst on a substrate, depositing a hydrocarbon in contact with the catalyst and pyrolyzing the hydrocarbon. A method of controlling a carbon thin film density comprises etching a cavity into a substrate, depositing a hydrocarbon into the cavity, and pyrolyzing the hydrocarbon while in the cavity to form a carbon thin film. Controlling a carbon thin film density is achieved by changing the volume of the cavity. Methods of making carbon containing patterned structures are also provided. Carbon thin films and carbon containing patterned structures can be used in NEMS, MEMS, liquid chromatography, and sensor devices.

  16. Reef coral δ18O thermometer in Hainan island waters, south China sea

    International Nuclear Information System (INIS)

    An 18-year-long (1981-1998) study was conducted in Hainan Island waters (22 degree 22'N, 110 degree 39'E) to determine the relationship between δ18O in skeletal aragonite carbonate and sea surface temperature (SST) in porites lutea of reef-building corals. δ18O values in skeletal aragonite carbonate were measured by means of mass spectrometry. Coral samples grew at 5 m depth at Longwan Bay. Monthly measurements of the SST from 1960 to 1998 were taken at Qinglan Bay adjacent to the place of the collected samples. The thermometer shows that SST = -4.16 δ18OPDB + 4.9 (r = 0.80) and dδ18O/dT = -0.24 per mil/degree C. The δ18O thermometer is strongly influenced by the rainfall and runoff. Using the thermometer, the SST in the past hundred years with monthly resolution will be reconstructed and the climatic change in the northern area of South China Sea will be hind cast

  17. Carbon isotope fluctuations in Precambrian carbonate sequences of several localities in Brazil

    Directory of Open Access Journals (Sweden)

    SIAL ALCIDES N.

    2000-01-01

    Full Text Available Carbon isotope fluctuations in Precambrian sedimentary carbonates between 2.8 Ga and 0.60 Ga in Brazil are examined in this study. The carbonate facies of the BIF of the 2.8 Ga-old Carajás Formation, state of Pará in northern Brazil, has rather homogeneous delta13C (-5 o/ooPDB, compatible with carbonatization of a silicate protolith by a CO2-rich fluid from mantle degassing. The Paleoproterozoic Gandarela Formation, state of Minas Gerais, displays a narrow delta13C variation (-1.5 to +0.5 o/oo compatible with carbon isotope signatures of carbonates deposited around 2.4 Ga worldwide. The Fecho do Funil Formation has probably recorded the Lomagundi delta13C positive anomaly (+6.4 to +7.1 o/ooPDB. The magnesite-bearing carbonates of the Orós mobile belt, state of Ceará, exhibit carbon isotope fluctuation within the range for carbonates deposited at 1.8 Ga. The C-isotope record of the Frecheirinha Formation, northwestern state of Ceará, shows negative delta13C values in its lower portion (-2 o/oo and positive values up section (+1 to +3 o/oo, which suggests this sequence is a cap carbonate deposited after a glacial event around 0.95 Ga. The Jacoca and Acauã sedimentary carbonate Formations, state of Sergipe, NE Brazil, show carbon isotope fluctuations very similar to each other (average around -5 o/oo, compatible with a deposition around 0.76 Ga. The younger Olho D'Água carbonate Formation, however, also in the state of Sergipe, displays negative delta13C values at the lower portion of the Formation, changing dramatically up section to positive values as high as +10 o/oo, a characteristic compatible with a Sturtian cap carbonate deposited around 0.69 Ga. On the light of the C isotope data discussed in this study, it seems that delta13C fluctuations in Paleoproterozoic carbonates in Brazil are within the range found globally for metasedimentary carbonates of this age. Carbon isotope data proved to be very useful in establishing relative

  18. Noise Making Genes in the Oxygen-18 Climate Signal of Tree-Ring Cellulose

    Science.gov (United States)

    Sternberg, L.; Ellsworth, P.

    2008-12-01

    Previous studies showed that the δ18O values of the oxygen attached to the second carbon of the cellulose glucose moieties (δ18OC-2) adds biochemical noise to the 18O climate signal of cellulose. We expanded the above study to include tree ring sequences to see if this noise persists across time within an individual. The δ18OC-2 noise persists and the δ18O value of the cellulose derivative not having this "noisy" oxygen δ18OP-G is a superior predictor of plant water and relative humidity. We previously proposed that the isotopic noise may be generated by synthesis of polyols (sugar alcohols), since the isotopic noise was particularly strong in areas of plant water or temperature stress. It is well known that plants generate polyols, such as mannitol or inositol to protect membrane structure and build up osmotic pressure under stressful conditions. A survey of previously published leaf cellulose δ18O values shows that, indeed, polyol producing plants tend to have lower oxygen isotope ratios. A working hypothesis based on the reactions of the oxygen attached to the second carbon of the glucose moieties was developed and tested with genetically modified Arabidopsis thaliana var. Columbia. A A. thaliana line genetically modified by the insertion of a mannitol synthesis gene (Mannose 6-Phosphate Reductase) and another mutant line which cannot synthesize starch (lacking plastid Phosphoglucose Mutase) showed significantly lower δ18O values of stem cellulose compared to the wild type. The primary cause of this lower isotopic value of the whole cellulose molecule was lower δ18OC-2 values. These results are consistent with our working hypothesis.

  19. Wood - a carbon depot

    OpenAIRE

    Lipušček, Igor; Tišler, Vesna

    2003-01-01

    The article examines the global movement of carbon dioxide, the most important greenhouse gas due to its large quantities. We studied the carbon cycle with possibilities of its extension, and analysed the mechanisms that remove carbon dioxide from the atmosphere and bind it into solid substances for a longer period of time. The focus was on carbon dioxide sink into biomass and carbon deposit in wood. On the basis of wood component data and chemical analysis of the components, we calculated th...

  20. IAS 18 Revenue - A Closer Look

    OpenAIRE

    Muthupandian, K S

    2009-01-01

    The International Accounting Standards Committee issued the the International Accounting Standard 18, Revenue. The objective of IAS 18 The objective of IAS 18 is to prescribe the accounting treatment of revenue arising from certain types of transactions and events, namely the sale of goods, the rendering of services yielding fees and the use by others of entity assets yielding interest or rental income. The primary issue in accounting for revenue is determining when to recognise revenue. Reve...

  1. G18.95-1.1

    International Nuclear Information System (INIS)

    New radio continuum and spectral line observations of the Galactic radio source G18.95-1.1 are reported. The distance to G18.95-1.1 is 2 kpc as derived from HI-21 cm spectral line observations. These data also indicate an interaction with the interstellar medium. The radio continuum observations classify G18.95-1.1 as a composite supernova remnant

  2. Stable Carbon and Oxygen Isotopes of Pedogenic Carbonates in Ustic Vertisols: Implications for Paleoenvironmental Change

    Institute of Scientific and Technical Information of China (English)

    HUANG Cheng-Min; WANG Cheng-Shan; TANG Ya

    2005-01-01

    Pedogenic carbonates, found extensively in arid and semiarid regions, are important in revealing regional climatic and environmental changes as well as the carbon cycle. In addition, stable carbon and oxygen isotopic compositions of pedogenic carbonates have been used to rebuild paleoecology (biomass and vegetation) and to estimate paleotemperature and paleoprecipitation during past geological time. By utilizing the stable carbon and oxygen isotopic compositions (δ13C and δ18O) of secondary nodules in Ustic Vertisols, this study looked into the climatic and environmental changes in the dry valleys of the Yuanmou Basin, Yunnan Province, in southwestern China. The results showed that during the early Holocene, a warm-humid or hot-humid climate existed in the Yuanmou Basin, but since then fluctuations in climate have occurred, with a dry climate prevailing. A highly significant correlation (r = 0.92, n= 9) between δ13C and δ18O values of carbonates illustrated that there had been a continual shifting between cold-humid and warm-dry climates in southwestern China including the Yuanmou Basin since the early Holocene.

  3. Preparation of carbon/carbon composite by pyrolysis of ethanol and methane

    International Nuclear Information System (INIS)

    Highlights: • The mixture of ethanol and methane was used as the precursor of pyrolytic carbon. • C/C composites with high textured pyrolytic carbon and high density were obtained. • At the same condition, the high textured carbon cannot be obtained using methane. • The mixture precursor is a promising candidate for C/C composites in CVI. - Abstract: A high textured carbon/carbon (C/C) composite was prepared using the mixture gas of ethanol and methane as the precursor by isothermal chemical vapor infiltration. The preform was infiltrated at 1180 °C with the gas pressure from 2 to 10 kPa. For 85 h infiltration, the average bulk density is up to 1.8 ± 0.02 g cm−3. The texture of the infiltrated carbon was studied by polarized-light microscopy and characterized with the aid of the extinction angle. Texture and fracture morphology of the pyrolytic carbon matrix were observed using scanning electronic microscope. C/C composites with high textured pyrolytic carbon matrix and high density were obtained by pyrolysis of ethanol and methane. This indicates the mixture of ethanol and methane is a promising candidate of the precursors for the preparation of C/C composites

  4. Trisomy 18 with unilateral atypical ectrodactyly

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, R.C. [Greenwood Genetic Center, SC (United States)

    1994-01-01

    Becerra et al. recently reported on an infant with multiple congenital anomalies who had trisomy 18. This preterm infant presented with bilateral ectrodactyly of feet, small cleft palate, esophageal atresia with associated tracheoesophageal fistula, congenital heart disease and other anomalies. The authors referenced article by Castle and Bernstein, in which they reported a male with trisomy 18 and cleft foot as well as a review of the literature which showed 2 other infants with trisomy 18 and ectrodactyly of the feet. An additional case of trisomy 18 associated with multiple congenital anomalies, including unilaterial, atypical ectrodactyly of the left foot.

  5. 7 CFR 3431.18 - Service agreement.

    Science.gov (United States)

    2010-01-01

    ..., AND EXTENSION SERVICE, DEPARTMENT OF AGRICULTURE VETERINARY MEDICINE LOAN REPAYMENT PROGRAM Administration of the Veterinary Medicine Loan Repayment Program § 3431.18 Service agreement. (a) The...

  6. 21 CFR 26.18 - Regulatory collaboration.

    Science.gov (United States)

    2010-04-01

    ... RECOGNITION OF PHARMACEUTICAL GOOD MANUFACTURING PRACTICE REPORTS, MEDICAL DEVICE QUALITY SYSTEM AUDIT REPORTS... Specific Sector Provisions for Pharmaceutical Good Manufacturing Practices § 26.18 Regulatory...

  7. The Australian terrestrial carbon budget

    Directory of Open Access Journals (Sweden)

    V. Haverd

    2013-02-01

    Full Text Available This paper reports a study of the full carbon (C-CO2 budget of the Australian continent, focussing on 1990–2011 in the context of estimates over two centuries. The work is a contribution to the RECCAP (REgional Carbon Cycle Assessment and Processes project, as one of numerous regional studies. In constructing the budget, we estimate the following component carbon fluxes: net primary production (NPP; net ecosystem production (NEP; fire; land use change (LUC; riverine export; dust export; harvest (wood, crop and livestock and fossil fuel emissions (both territorial and non-territorial. Major biospheric fluxes were derived using BIOS2 (Haverd et al., 2012, a fine-spatial-resolution (0.05° offline modelling environment in which predictions of CABLE (Wang et al., 2011, a sophisticated land surface model with carbon cycle, are constrained by multiple observation types. The mean NEP reveals that climate variability and rising CO2 contributed 12 ± 24 (1σ error on mean and 68 ± 15 TgC yr−1, respectively. However these gains were partially offset by fire and LUC (along with other minor fluxes, which caused net losses of 26 ± 4 TgC yr−1 and 18 ± 7 TgC yr−1, respectively. The resultant net biome production (NBP is 36 ± 29 TgC yr−1, in which the largest contributions to uncertainty are NEP, fire and LUC. This NBP offset fossil fuel emissions (95 ± 6 TgC yr−1 by 38 ± 30%. The interannual variability (IAV in the Australian carbon budget exceeds Australia's total carbon emissions by fossil fuel combustion and is dominated by IAV in NEP. Territorial fossil fuel emissions are significantly smaller than the rapidly growing fossil fuel exports: in 2009–2010, Australia exported 2.5 times more carbon in fossil fuels than it emitted by burning fossil fuels.

  8. Carbon and nitrogen balances for six shrublands across Europe

    DEFF Research Database (Denmark)

    Beier, Claus; Emmett, Bridget A.; Tietema, Albert;

    2009-01-01

    developing and testing ecosystem models. As climate change progresses, the potential feedback from terrestrial ecosystems to the atmosphere through changes in carbon stocks, carbon sequestration, and general knowledge on biogeochemical cycles becomes increasingly important. Here we present carbon and...... nitrogen balances of six shrublands along a climatic gradient across the European continent. The aim of the study was to provide a basis for assessing the range and variability in carbon storage in European shrublands. Across the sites the net carbon storage in the systems ranged from 1,163 g C m−2 to 18...... allocation was more than 5 times aboveground litterfall carbon which is significantly greater than the factor of 2 reported in a global analysis of forest data. Nitrogen storage was also dominated by the soil pools generally showing small losses except when atmospheric N input was high. The study shows that...

  9. Accelerating Mineral Carbonation Using Carbonic Anhydrase.

    Science.gov (United States)

    Power, Ian M; Harrison, Anna L; Dipple, Gregory M

    2016-03-01

    Carbonic anhydrase (CA) enzymes have gained considerable attention for their potential use in carbon dioxide (CO2) capture technologies because they are able to catalyze rapidly the interconversion of aqueous CO2 and bicarbonate. However, there are challenges for widespread implementation including the need to develop mineralization process routes for permanent carbon storage. Mineral carbonation of highly reactive feedstocks may be limited by the supply rate of CO2. This rate limitation can be directly addressed by incorporating enzyme-catalyzed CO2 hydration. This study examined the effects of bovine carbonic anhydrase (BCA) and CO2-rich gas streams on the carbonation rate of brucite [Mg(OH)2], a highly reactive mineral. Alkaline brucite slurries were amended with BCA and supplied with 10% CO2 gas while aqueous chemistry and solids were monitored throughout the experiments (hours to days). In comparison to controls, brucite carbonation using BCA was accelerated by up to 240%. Nesquehonite [MgCO3·3H2O] precipitation limited the accumulation of hydrated CO2 species, apparently preventing BCA from catalyzing the dehydration reaction. Geochemical models reproduce observed reaction progress in all experiments, revealing a linear correlation between CO2 uptake and carbonation rate. Data demonstrates that carbonation in BCA-amended reactors remained limited by CO2 supply, implying further acceleration is possible. PMID:26829491

  10. Carbon fuel cells with carbon corrosion suppression

    Science.gov (United States)

    Cooper, John F.

    2012-04-10

    An electrochemical cell apparatus that can operate as either a fuel cell or a battery includes a cathode compartment, an anode compartment operatively connected to the cathode compartment, and a carbon fuel cell section connected to the anode compartment and the cathode compartment. An effusion plate is operatively positioned adjacent the anode compartment or the cathode compartment. The effusion plate allows passage of carbon dioxide. Carbon dioxide exhaust channels are operatively positioned in the electrochemical cell to direct the carbon dioxide from the electrochemical cell.

  11. Methodology for tritium recovery as a by-product in the fluorine 18 production

    International Nuclear Information System (INIS)

    In this paper previous studies for the recuperation of waste tritium proceeding from the process used to produce F-18 using natural and 95% enriched lithium carbonate in lithium-6 are presented; the nuclear reaction took place in the Triga Mark III Nuclear reactor of the Nuclear Centre of Mexico. Previous studies proved the importance of the quantity of remanent tritium in the solutions where F-18 was produced in oxygenated compounds of natural lithium. The recuperation methodology consisted in production of F-18 in the established manner, purification by chromatography in an alumina and ion exchange resins column and of waste solutions; these were put together and distilled at normal pressure until dry. The distilled products were concentrated using an electrochemical method, and a final treatment system of the sample based on one reported in the literature but adapted to concentrate smaller volumes (approximately 15 ml.). The samples coming from the enriched lithium carbonate contained 3 to 6 times more tritium than those of natural lithium carbonate. Approximately 30% of the initial considered quantity of lithium was recuperated. A modification to the proposed methodology will allow the recuperation of tritium in waste solutions of F-18 in a percentage higher than 80%. (Author)

  12. Drought sensitivity of Amazonian carbon balance revealed by atmospheric measurements.

    Science.gov (United States)

    Gatti, L V; Gloor, M; Miller, J B; Doughty, C E; Malhi, Y; Domingues, L G; Basso, L S; Martinewski, A; Correia, C S C; Borges, V F; Freitas, S; Braz, R; Anderson, L O; Rocha, H; Grace, J; Phillips, O L; Lloyd, J

    2014-02-01

    Feedbacks between land carbon pools and climate provide one of the largest sources of uncertainty in our predictions of global climate. Estimates of the sensitivity of the terrestrial carbon budget to climate anomalies in the tropics and the identification of the mechanisms responsible for feedback effects remain uncertain. The Amazon basin stores a vast amount of carbon, and has experienced increasingly higher temperatures and more frequent floods and droughts over the past two decades. Here we report seasonal and annual carbon balances across the Amazon basin, based on carbon dioxide and carbon monoxide measurements for the anomalously dry and wet years 2010 and 2011, respectively. We find that the Amazon basin lost 0.48 ± 0.18 petagrams of carbon per year (Pg C yr(-1)) during the dry year but was carbon neutral (0.06 ± 0.1 Pg C yr(-1)) during the wet year. Taking into account carbon losses from fire by using carbon monoxide measurements, we derived the basin net biome exchange (that is, the carbon flux between the non-burned forest and the atmosphere) revealing that during the dry year, vegetation was carbon neutral. During the wet year, vegetation was a net carbon sink of 0.25 ± 0.14 Pg C yr(-1), which is roughly consistent with the mean long-term intact-forest biomass sink of 0.39 ± 0.10 Pg C yr(-1) previously estimated from forest censuses. Observations from Amazonian forest plots suggest the suppression of photosynthesis during drought as the primary cause for the 2010 sink neutralization. Overall, our results suggest that moisture has an important role in determining the Amazonian carbon balance. If the recent trend of increasing precipitation extremes persists, the Amazon may become an increasing carbon source as a result of both emissions from fires and the suppression of net biome exchange by drought. PMID:24499918

  13. Comparison of 18F-FET and 18F-FDG PET in brain tumors

    International Nuclear Information System (INIS)

    The purpose of this study was to compare the diagnostic value of positron emission tomography (PET) using [18F]-fluorodeoxyglucose (18F-FDG) and O-(2-[18F]fluoroethyl)-L-tyrosine (18F-FET) in patients with brain lesions suspicious of cerebral gliomas. Methods: Fifty-two patients with suspicion of cerebral glioma were included in this study. From 30 to 50 min after injection of 180 MBq 18F-FET, a first PET scan (18F-FET scan) was performed. Thereafter, 240 MBq 18F-FDG was injected and a second PET scan was acquired from 30 to 60 min after the second injection (18F-FET/18F-FDG scan). The cerebral accumulation of 18F-FDG was calculated by decay corrected subtraction of the 18F-FET scan from the 18F-FET/18F-FDG scan. Tracer uptake was evaluated by visual scoring and by lesion-to-background (L/B) ratios. The imaging results were compared with the histological results and prognosis. Results: Histology revealed 24 low-grade gliomas (LGG) of World Health Organization (WHO) Grade II and 19 high-grade gliomas (HGG) of WHO Grade III or IV, as well as nine others, mainly benign histologies. The gliomas showed increased 18F-FET uptake (>normal brain) in 86% and increased 18F-FDG uptake (>white matter) in 35%. 18F-FET PET provided diagnostically useful delineation of tumor extent while this was impractical with 18F-FDG due to high tracer uptake in the gray matter. A local maximum in the tumor area for biopsy guidance could be identified with 18F-FET in 76% and with 18F-FDG in 28%. The L/B ratios showed significant differences between LGG and HGG for both tracers but considerable overlap so that reliable preoperative grading was not possible. A significant correlation of tracer uptake with overall survival was found with 18F-FDG only. In some benign lesions like abscesses, increased uptake was observed for both tracers indicating a limited specificity of both techniques. Conclusions: 18F-FET PET is superior to 18F-FDG for biopsy guidance and treatment planning of cerebral gliomas

  14. Trisomy 18 syndrome with cleft foot.

    OpenAIRE

    Castle, D; Bernstein, R.

    1988-01-01

    Ectrodactyly of the feet has been reported only twice in association with trisomy 18 syndrome. A severe form of this anomaly, the first with published illustrative x rays, is described in a male infant with trisomy 18 syndrome. It is suggested that this may represent an extreme expression of the foot anomalies more commonly associated with this syndrome.

  15. 46 CFR 58.16-18 - Installation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Installation. 58.16-18 Section 58.16-18 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND... ventilation consisting of a fresh air inlet pipe and an exhaust pipe both entering through the top of...

  16. 18 CFR 1308.53 - Service.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Service. 1308.53... Subpoenas § 1308.53 Service. A subpoena may be served at any place, and may be served by any individual not a party who is at least 18 years of age, or as otherwise provided by law. Service may be made by...

  17. 18 CFR 35.30 - General provisions.

    Science.gov (United States)

    2010-04-01

    ...) of that utility's resources (electric power generation by the utility) pursuant to section 5(c) of... determined by BPA in accordance with 18 CFR part 301. (b) Effectiveness of rates. (1) During the period... schedules, material necessary to comply with 18 CFR 35.13(c), and any other material requested by...

  18. Main: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE1PVGRP18 S000288 10-Feb-2000 (last modified) seki SE1 (Stem element 1) found in the bean (P.v.) grp1...ecifically; See S000289, S000101 (SE2); SE1; grp1.8; vascular; stem; shoot; bean (Phaseolus vulgaris) ATAATGGGCCACACTGTGGGGCAT ...

  19. 49 CFR 18.32 - Equipment.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Equipment. 18.32 Section 18.32 Transportation... Equipment. (a) Title. Subject to the obligations and conditions set forth in this section, title to equipment acquired under a grant or subgrant will vest upon acquisition in the grantee or...

  20. 40 CFR 265.18 - Location standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Location standards. 265.18 Section 265...) INTERIM STATUS STANDARDS FOR OWNERS AND OPERATORS OF HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES General Facility Standards § 265.18 Location standards. The placement of any hazardous waste in...

  1. 40 CFR 264.18 - Location standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Location standards. 264.18 Section 264...) STANDARDS FOR OWNERS AND OPERATORS OF HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES General Facility Standards § 264.18 Location standards. (a) Seismic considerations. (1) Portions of new...

  2. 30 CFR 779.18 - Climatological information.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Climatological information. 779.18 Section 779... PROGRAMS SURFACE MINING PERMIT APPLICATIONS-MINIMUM REQUIREMENTS FOR INFORMATION ON ENVIRONMENTAL RESOURCES § 779.18 Climatological information. (a) When requested by the regulatory authority, the...

  3. 30 CFR 783.18 - Climatological information.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Climatological information. 783.18 Section 783... PROGRAMS UNDERGROUND MINING PERMIT APPLICATIONS-MINIMUM REQUIREMENTS FOR INFORMATION ON ENVIRONMENTAL RESOURCES § 783.18 Climatological information. (a) When requested by the regulatory authority,...

  4. 24 CFR 26.18 - Discovery.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Discovery. 26.18 Section 26.18 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HEARING... will not compel the disclosure of privileged information, unduly delay the hearing, or result...

  5. 44 CFR 9.18 - Responsibilities.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Responsibilities. 9.18... HOMELAND SECURITY GENERAL FLOODPLAIN MANAGEMENT AND PROTECTION OF WETLANDS § 9.18 Responsibilities. (a) Regional Administrators' responsibilities. Regional Administrators shall, for all actions falling...

  6. 44 CFR 1.8 - Regulations review.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Regulations review. 1.8 Section 1.8 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF... the rule from the public; (3) The complexity of the rule, including need for review of language...

  7. 49 CFR 18.21 - Payment.

    Science.gov (United States)

    2010-10-01

    ... CFR part 205. (c) Advances. Grantees and subgrantees shall be paid in advance, provided they maintain... reimburse the grantee for its actual cash disbursements. The working capital advance method of payment shall... 49 Transportation 1 2010-10-01 2010-10-01 false Payment. 18.21 Section 18.21 Transportation...

  8. 38 CFR 18.543 - Mediation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Mediation. 18.543 Section... Enforcement Procedures § 18.543 Mediation. (a) Referral of complaints for mediation. VA will refer to the Federal Mediation and Conciliation Service all complaints that: (1) Fall within the jurisdiction of...

  9. 48 CFR 18.201 - Contingency operation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contingency operation. 18... METHODS AND CONTRACT TYPES EMERGENCY ACQUISITIONS Emergency Acquisition Flexibilities 18.201 Contingency operation. (a) Contingency operation is defined in 2.101. (b) Micro-purchase threshold. The...

  10. 7 CFR 1781.18 - Feasibility.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Feasibility. 1781.18 Section 1781.18 Agriculture... Feasibility. (a) Before WS loan, WS advance, or RCD loan is approved, a determination of feasibility will be... NRCS personnel. The feasibility determination must have the concurrence of the NRCS...

  11. 15 CFR 2301.18 - Selection process.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Selection process. 2301.18 Section... PROGRAM Evaluation and Selection Process § 2301.18 Selection process. (a) The PTFP Director will consider... OTIA Associate Administrator's review and approval will take into account the following...

  12. 21 CFR 610.18 - Cultures.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Cultures. 610.18 Section 610.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS GENERAL... contamination and deterioration. (b) Identity and verification. Each culture shall be clearly identified as...

  13. 15 CFR 719.18 - Decisions.

    Science.gov (United States)

    2010-01-01

    ..., with or without conditions, in accordance with 22 CFR 103.8. ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Decisions. 719.18 Section 719.18... Decisions. (a) Initial decision. After considering the entire record in the case, the ALJ will issue...

  14. Reference: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available lled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928 ... ...SE1PVGRP18 Keller B, Heierli D Vascular expression of the grp1.8 promoter is contro

  15. 38 CFR 18.439 - Private education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Private education. 18.439... Adult Education § 18.439 Private education. (a) A recipient that provides private elementary or secondary education may not on the basis of handicap, exclude a qualified handicapped person if the...

  16. 41 CFR 50-203.18 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Evidence. 50-203.18...-Healey Public Contracts Act § 50-203.18 Evidence. (a) Witnesses appearing at the hearing need not be... shall be tendered in quadruplicate. When evidence is embraced in a document containing matter...

  17. 15 CFR 18.20 - Further proceedings.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Further proceedings. 18.20 Section 18.20 Commerce and Foreign Trade Office of the Secretary of Commerce ATTORNEY'S FEES AND OTHER EXPENSES..., such as an informal conference, oral argument, additional written submissions or, as to issues...

  18. Oxygen isotopic constraints on the genesis of carbonates from Martian meteorite ALH84001

    Science.gov (United States)

    Leshin, Laurie A.; McKeegan, Kevin D.; Harvey, Ralph P.

    1997-03-01

    With a crystallization age of 4.5 Ga, ALH84001 is unique among the Martian meteorites. It is also the only Martian meteorite that contains an appreciable amount of carbonate, and significantly, this carbonate occurs without associated secondary hydrated minerals. Moreover, McKay et al. (1996) have suggested that ALH84001 contains evidence of past Martian life in the form of nanofossils, biogenic minerals, and polycyclic aromatic hydrocarbons. The presence of carbonate in ALH84001 is especially significant. The early Martian environment is thought to have been more hospitable to life than todays cold, dry climate. In order to better assess the true delta-O-18 values, as well as the isotopic diversity and complexity of the ALH84001 carbonates, direct measurements of the oxygen and carbon isotopic compositions of individual carbonate phases are needed. Here we report in situ analyses of delta-O-18 values in carbonates from two polished thin sections of ALH84001.

  19. Carbon dioxide effects research and assessment program

    International Nuclear Information System (INIS)

    Information about the past and present concentrations of CO2 in the atmosphere and variations in climate can be obtained from measurements of stable isotopes in tree rings; specifically carbon-13, oxygen-18 and deuterium. The analysis of these stable isotopes in tree rings is a relatively new and rapidly developing field. This proceedings volume contains most of the papers presented at the meeting. The first paper gives an overview of the status of carbon-13 research. Papers relating to carbon-13 are in section I and grouped separately from the contributions on carbon-14. Although the meeting was primarily concerned with stable isotopes, all carbon isotopic analysis may be helpful in understanding the carbon-13 record in tree rings. The papers on hydrogen and oxygen isotope studies are in sections II and III respectively. The remaining sections contain papers that consider more than one isotope at a time, general topics related to isotopes, atmospheric changes and tree growth, and methods of isotopic analysis

  20. Dynamic response of porous calcium carbonate minerals

    International Nuclear Information System (INIS)

    A theoretical study of the shock-loaded response of calcium carbonate materials is presented in which both dry and water-saturated samples with porosities up to 50 percent are considered. Data are presented for the unloading response from 15.0 and 18.5 GPa, and calculations from a mixture model using a Mie-Grueneisen equation of state with volume-dependent parameters are compared to both the Hugoniot and the isentropic unloading response

  1. Welding of high manganese- and carbon steels

    International Nuclear Information System (INIS)

    Technology and conditions of welding of high manganese and carbon steel by a resistance welding technique using an intermediate part are developed. Austenitic chromium-nickel 12Kh18N10T steel is chosen as a material of the intermediate part. The recommended welding conditions insure a high quality of the weld joint in terms of metal structure and its mechanical properties. It is the basic metal of the joint that fractures under mechanical testing

  2. 18-Substituted steroids: synthesis of 18-hydroxycortisol (11 beta,17 alpha,18,21-tetrahydroxy-4-pregnene-3,20-dione) and 18-hydroxycortisone (17 alpha,18,21-trihydroxy-4-pregnene-3,11,20-trione).

    Science.gov (United States)

    Gomez-Sanchez, C E; Kirk, D N; Farrant, R D; Milewich, L

    1985-01-01

    The isolation of 18-hydroxycortisol from the urine of patients with primary aldosteronism was recently described and no synthetic procedure was available for its preparation. The C-13 angular methyl group of prednisolone-17 alpha,21-acetonide-11 beta-nitrite was functionalized by photolysis in the presence of oxygen to give the product 18-hydroxy-prednisolone-17 alpha,21-acetonide-18-nitrate. The 18-nitrate was reduced with zinc and ammonium acetate to the corresponding 18-hydroxy compound, 18-hydroxy-prednisolone-17 alpha,21-acetonide. Homogeneous hydrogenation with Tris(triphenyl-phosphine)rhodium (I) chloride as catalyst resulted in the formation of 18-hydroxy-cortisol-17 alpha,21-acetonide. Acid hydrolysis of the latter compound gave 18-hydroxycortisol. Oxidation of 18-hydroxycortisol-17 alpha,21-acetonide with pyridinium dichromate followed by acid hydrolysis gave 18-hydroxycortisone. The 18-hydroxylated steroids exist as the 18,21-hemiacetals. Catalytic reduction with tritium gas with Tris(triphenyl-phosphine)rhodium (I) chloride of 18-hydroxyprednisolone-17 alpha,21-acetonide and acid hydrolysis gave [1,2(3)H]18-hydroxycortisol. PMID:3974224

  3. Carbon nanotube cathode with capping carbon nanosheet

    Science.gov (United States)

    Li, Xin; Zhao, Dengchao; Pang, Kaige; Pang, Junchao; Liu, Weihua; Liu, Hongzhong; Wang, Xiaoli

    2013-10-01

    Here, we report a vertically aligned carbon nanotube (VACNT) film capped with a few layer of carbon nanosheet (FLCN) synthesized by chemical vapor deposition using a carbon source from iron phthalocyanine pyrolysis. The square resistance of the VACNT film is significantly reduced from 1500 Ω/□ to 300 Ω/□ when it is capped with carbon nanosheet. The VACNT capped with carbon nanosheet was transferred to an ITO glass substrate in an inverted configuration so that the carbon nanosheet served as a flexible transparent electrode at the bottom and the VACNT roots served as emission tips. Because all of the VACNTs start growing from a flat silicon substrate, the VACNT roots are very neat and uniform in height. A field emission test of the carbon nanosheet-capped VACNT film proved that the CNT roots show better uniformity in field emission and the carbon nanosheet cap could also potentially serve as a flexible transparent electrode, which is highly desired in photo-assisted field emission.

  4. THE C2 OXIDATIVE PHOTOSYNTHETIC CARBON CYCLE.

    Science.gov (United States)

    Tolbert, N. E.

    1997-06-01

    The C2 oxidative photosynthetic carbon cycle plus the C3 reductive photosynthetic carbon cycle coexist. Both are initiated by Rubisco, use about equal amounts of energy, must regenerate RuBP, and result in exchanges of CO2 and O2 to establish rates of net photosynthesis, CO2 and O2 compensation points, and the ratio of CO2 and O2 in the atmosphere. These concepts evolved from research on O2 inhibition, glycolate metabolism, leaf peroxisomes, photorespiration, 18O2/16O2 exchange, CO2 concentrating processes, and a requirement for the oxygenase activity of Rubisco. Nearly 80 years of research on these topics are unified under the one process of photosynthetic carbon metabolism and its self-regulation. PMID:15012254

  5. SOUTHWEST REGIONAL PARTNERSHIP ON CARBON SEQUESTRATION

    Energy Technology Data Exchange (ETDEWEB)

    Brian McPherson; Rick Allis; Barry Biediger; Joel Brown; Jim Cappa; George Guthrie; Richard Hughes; Eugene Kim; Robert Lee; Dennis Leppin; Charles Mankin; Orman Paananen; Rajesh Pawar; Tarla Peterson; Steve Rauzi; Jerry Stuth; Genevieve Young

    2004-11-01

    The Southwest Partnership Region includes six whole states, including Arizona, Colorado, Kansas, New Mexico, Oklahoma, and Utah, roughly one-third of Texas, and significant portions of adjacent states. The Partnership comprises a large, diverse group of expert organizations and individuals specializing in carbon sequestration science and engineering, as well as public policy and outreach. The main objective of the Southwest Partnership project is to achieve an 18% reduction in carbon intensity by 2012. The Partnership made great progress in this first year. Action plans for possible Phase II carbon sequestration pilot tests in the region are almost finished, including both technical and non-technical aspects necessary for developing and carrying out these pilot tests. All partners in the Partnership are taking an active role in evaluating and ranking optimum sites and technologies for capture and storage of CO{sub 2} in the Southwest Region. We are identifying potential gaps in all aspects of potential sequestration deployment issues.

  6. Intercontinental correlation of organic carbon and carbonate stable isotope records: evidence of climate and sea-level change during the Turonian (Cretaceous)

    NARCIS (Netherlands)

    Jarvis, I.; Trabucho-Alexandre, João; Gröcke, D.R.; Uličný, D.; Laurin, J.

    2015-01-01

    Carbon (d13Corg, d13Ccarb) and oxygen (d18Ocarb) isotope records are presented for an expanded Upper Cretaceous (Turonian–Coniacian) hemipelagic succession cored in the central Bohemian Cretaceous Basin, Czech Republic. Geophysical logs, biostratigraphy and stable carbon isotope chemostratigraphy pr

  7. Trading forest carbon - OSU

    Science.gov (United States)

    Issues associate with trading carbon sequestered in forests are discussed. Scientific uncertainties associated with carbon measurement are discussed with respect to proposed accounting procedures. Major issues include: (1) Establishing baselines. (2) Determining additivity from f...

  8. Potassium carbonate poisoning

    Science.gov (United States)

    Potassium carbonate is a white powder used to make soap, glass, and other items. This article discusses poisoning from swallowing or breathing in potassium carbonate. This article is for information only. Do ...

  9. Sodium carbonate poisoning

    Science.gov (United States)

    Sodium carbonate (known as washing soda or soda ash) is a chemical found in many household and ... products. This article focuses on poisoning due to sodium carbonate. This article is for information only. Do ...

  10. Biomass Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Biomass carbon includes carbon stored in above- and below-ground live plant components (such as leaf, branch, stem and root) as well as in standing and down dead...

  11. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Home / Safety Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known as CO, is called the "Invisible ...

  12. Carbon Monoxide Safety

    Science.gov (United States)

    ... with the Media Fire Protection Technology Carbon monoxide safety outreach materials Help inform residents in your community ... KB | Spanish PDF 645 KB Handout: carbon monoxide safety Download this handout and add your organization's logo ...

  13. Soil Organic Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Soil organic carbon (SOC) is the carbon held within soil organic constituents (i.e., products produced as dead plants and animals decompose and the soil microbial...

  14. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known ... Install one and check its batteries regularly. View Information About CO Alarms Other CO Topics Safety Tips ...

  15. Calcium carbonate overdose

    Science.gov (United States)

    Tums overdose; Calcium overdose ... Calcium carbonate can be dangerous in large amounts. ... Some products that contain calcium carbonate are certain: ... and mineral supplements Other products may also contain calcium ...

  16. Carbon nanotube nanoelectrode arrays

    Science.gov (United States)

    Ren, Zhifeng; Lin, Yuehe; Yantasee, Wassana; Liu, Guodong; Lu, Fang; Tu, Yi

    2008-11-18

    The present invention relates to microelectode arrays (MEAs), and more particularly to carbon nanotube nanoelectrode arrays (CNT-NEAs) for chemical and biological sensing, and methods of use. A nanoelectrode array includes a carbon nanotube material comprising an array of substantially linear carbon nanotubes each having a proximal end and a distal end, the proximal end of the carbon nanotubes are attached to a catalyst substrate material so as to form the array with a pre-determined site density, wherein the carbon nanotubes are aligned with respect to one another within the array; an electrically insulating layer on the surface of the carbon nanotube material, whereby the distal end of the carbon nanotubes extend beyond the electrically insulating layer; a second adhesive electrically insulating layer on the surface of the electrically insulating layer, whereby the distal end of the carbon nanotubes extend beyond the second adhesive electrically insulating layer; and a metal wire attached to the catalyst substrate material.

  17. Tracking the migration of the Indian continent using the carbonate clumped isotope technique on Phanerozoic soil carbonates

    Science.gov (United States)

    Ghosh, Prosenjit; Vasiliev, Mikhail V.; Ghosh, Parthasarathi; Sarkar, Soumen; Ghosh, Sampa; Yamada, Keita; Ueno, Yuichiro; Yoshida, Naohiro; Poulsen, Christopher J.

    2016-03-01

    Approximately 140 million years ago, the Indian plate separated from Gondwana and migrated by almost 90° latitude to its current location, forming the Himalayan-Tibetan system. Large discrepancies exist in the rate of migration of Indian plate during Phanerozoic. Here we describe a new approach to paleo-latitudinal reconstruction based on simultaneous determination of carbonate formation temperature and δ18O of soil carbonates, constrained by the abundances of 13C-18O bonds in palaeosol carbonates. Assuming that the palaeosol carbonates have a strong relationship with the composition of the meteoric water, δ18O carbonate of palaeosol can constrain paleo-latitudinal position. Weighted mean annual rainfall δ18O water values measured at several stations across the southern latitudes are used to derive a polynomial equation: δ18Ow = -0.006 × (LAT)2 - 0.294 × (LAT) - 5.29 which is used for latitudinal reconstruction. We use this approach to show the northward migration of the Indian plate from 46.8 ± 5.8°S during the Permian (269 M.y.) to 30 ± 11°S during the Triassic (248 M.y.), 14.7 ± 8.7°S during the early Cretaceous (135 M.y.), and 28 ± 8.8°S during the late Cretaceous (68 M.y.). Soil carbonate δ18O provides an alternative method for tracing the latitudinal position of Indian plate in the past and the estimates are consistent with the paleo-magnetic records which document the position of Indian plate prior to 135 ± 3 M.y.

  18. CEACAM18 as candidate for the Holstein calving QTL on BTA18

    DEFF Research Database (Denmark)

    Mao, Xiaowei; Kadri, Naveen Kumar; de Koning, DirkJan;

    A genome-wide association study of Nordic Holstein cattle SNP chip genotypes and imputed next generation sequencing (NGS) variants identified carcinoembryonic antigen-related cell adhesion molecule 18 (CEACAm 18) on BTa 18 as the gene most highly significantly associated with direct calving traits...

  19. CHARACTERIZATION OF THE TANK 18F SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Oji, L.; Click, D.; Diprete, D.

    2009-12-17

    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 18F closure samples. Tank 18F slurry samples analyzed included the liquid and solid fractions derived from the 'as-received' slurry materials along with the floor scrape bottom Tank 18F wet solids. These samples were taken from Tank 18F in March 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 18F samples, the samples from the north quadrants of the tank were combined into one North Tank 18F Hemisphere sample and similarly the south quadrant samples were combined into one South Tank 18F Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 18F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were 1E-04 {micro}Ci/g for most radionuclides and customer desired detection values of 1E-05 {micro}Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the minimum detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 18F, some were not met due to spectral interferences. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  20. Characterization Of The Tank 18F Samples

    International Nuclear Information System (INIS)

    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 18F closure samples. Tank 18F slurry samples analyzed included the liquid and solid fractions derived from the 'as-received' slurry materials along with the floor scrape bottom Tank 18F wet solids. These samples were taken from Tank 18F in March 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 18F samples, the samples from the north quadrants of the tank were combined into one North Tank 18F Hemisphere sample and similarly the south quadrant samples were combined into one South Tank 18F Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 18F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were 1E-04 (micro)Ci/g for most radionuclides and customer desired detection values of 1E-05 (micro)Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the minimum detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 18F, some were not met due to spectral interferences. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  1. Metal filled porous carbon

    Science.gov (United States)

    Gross, Adam F.; Vajo, John J.; Cumberland, Robert W.; Liu, Ping; Salguero, Tina T.

    2011-03-22

    A porous carbon scaffold with a surface and pores, the porous carbon scaffold containing a primary metal and a secondary metal, where the primary metal is a metal that does not wet the surface of the pores of the carbon scaffold but wets the surface of the secondary metal, and the secondary metal is interspersed between the surface of the pores of the carbon scaffold and the primary metal.

  2. High yield, facile aqueous synthesis and characterization of C18 functionalized iron oxide nanoparticles

    Science.gov (United States)

    Nair, Kishore Kumar; Kaur, Ranjeet; Iqbal, Nusrat; Hasan, Abshar; Alam, Samsul; Raza, S. K.

    2015-04-01

    The present study shows the synthesis of magnetite nanoparticles by co-precipitation method in three steps. The steps involve the precipitation of Fe3O4 nanoparticles followed by layer by layer functionalization with silica and tetraethoxy(octadyl)silane (C18). The prepared magnetite nanoparticles were investigated by SEM, TEM, XRD, FTIR and VSM. It was suggested that the intermediate iron oxide nanoparticles were formed by the competing processes of oxidation and crystal growth after decomposition of ferrous and ferric salts. The first step synthesized nanoparticles were of around 16 ± 4 nm, second step silica coating of 18 ± 3 nm and the final step C18 were of 56 ± 6 nm. The tetraethylorthosilicate hydrolyzed to form silicic acid which further polymerizes and thereby forms a layer of silica over magnetite nanoparticles. FTIR peaks at 2854 and 2921 cm-1 confirm the layering of C18 on silica encapsulated nanoparticles which corresponds to ˜CH2 and ˜(CH2)17CH3 carbon chain symmetric extension. The thickness of silica coating and C18 are 1.9 ± 0.3 nm and 38.6 ± 2.5 nm as confirmed from TEM size distribution curve. The saturation magnetism of magnetite, silica coated and C18 nanoparticles are 77.46, 74.53 and 68.76 emu g-1 respectively. Thus, Fe3O4, silica and C18 encapsulated magnetite nanoparticles were superparamagnetic.

  3. Non-disjunction of chromosome 18

    DEFF Research Database (Denmark)

    Bugge, M; Collins, A; Petersen, M B;

    1998-01-01

    A sample of 100 trisomy 18 conceptuses analysed separately and together with a published sample of 61 conceptuses confirms that an error in maternal meiosis II (MII) is the most frequent cause of non-disjunction for chromosome 18. This is unlike all other human trisomies that have been studied......, which show a higher frequency in maternal meiosis I (MI). Maternal MI trisomy 18 shows a low frequency of recombination in proximal p and medial q, but not the reduction in proximal q observed in chromosome 21 MI non-disjunction. Maternal MII non-disjunction does not fit the entanglement model that...

  4. Population III Stars in I Zw 18

    CERN Document Server

    Heap, Sally; Hubeny, Ivan

    2015-01-01

    Ultraviolet and 21-cm observations suggest that the extremely low-metallicity galaxy, I Zw 18, is a stream-fed galaxy containing a "pocket" of pristine stars responsible for producing nebular He II recombination emission observed in I Zw18-NW. Far-UV spectra by Hubble/COS and the Far Ultraviolet Spectroscopic Explorer (FUSE) make this suggestion conclusive by demonstrating that the spectrum of I Zw 18-NW shows no metal lines like O VI 1032, 1038 of comparable ionization as the He II recombination emission.

  5. Carbon Activation Diagnostic for Tertiary Neutron Measurements

    Energy Technology Data Exchange (ETDEWEB)

    Glebov, V.Yu.; Stoeckl, C.; Sangster, T.C.; Meyerhofer, D.D.; Radha, P.B.; Padalino, S.; Baumgart, L.; Fuschino, J.

    2003-03-28

    OAK B202 The yield of tertiary neutrons with energies greater than 20 MeV has been proposed to determine the high rho R of inertial confinement fusion targets. The activation of carbon is a valuable measurement technique because of its high reaction threshold, the availability of high-purity samples, and relatively low cost. The 12C(n,2n)11C reaction has a Q value of 18.7 MeV, well above the 14.1 MeV primary DT neutron energy. The isotope 11C decays with a half-life of 20.3 min and emits a positron, resulting in the production of two back-to-back, 511 keV gamma rays upon annihilation. The positron decay of 11C is nearly identical to the copper decay used in the activation measurements of 14.1 MeV primary DT yields; therefore, the present copper activation gamma-detection system can be used to detect the tertiary-produced carbon activation. Because the tertiary neutron yield is more than six orders of magnitude lower than primary neutron yield, the carbon activation diagnostic requires ultrapure carbon samples, free from any positron-emitting contamination. In recent years we have developed carbon purification, packaging, and handling procedures that minimize the contamination signal to a level low enough to use carbon activation for tertiary neutron measurements in direct-drive implosion experiments with DT cryogenic targets on OMEGA. Experimental results of contamination measurements in carbon samples performed on high-neutron-yield shots on OMEGA in 2001-2002 will be presented. A concept for implementing a carbon activation system on the National Ignition Facility (NIF)will be discussed.

  6. Protolytic carbon film technology

    Energy Technology Data Exchange (ETDEWEB)

    Renschler, C.L.; White, C.A.

    1996-04-01

    This paper presents a technique for the deposition of polyacrylonitrile (PAN) on virtually any surface allowing carbon film formation with only the caveat that the substrate must withstand carbonization temperatures of at least 600 degrees centigrade. The influence of processing conditions upon the structure and properties of the carbonized film is discussed. Electrical conductivity, microstructure, and morphology control are also described.

  7. Carbon Goes To…

    Science.gov (United States)

    Savasci, Funda

    2014-01-01

    The purposes of this activity are to help middle school students understand the carbon cycle and realize how human activities affect the carbon cycle. This activity consists of two parts. The first part of the activity focuses on the carbon cycle, especially before the Industrial Revolution, while the second part of the activity focuses on how…

  8. Carbon/Carbon Pistons for Internal Combustion Engines

    Science.gov (United States)

    Taylor, A. H.

    1986-01-01

    Carbon/carbon piston performs same function as aluminum pistons in reciprocating internal combustion engines while reducing weight and increasing mechanical and thermal efficiencies of engine. Carbon/carbon piston concept features low piston-to-cylinder wall clearance - so low piston rings and skirts unnecessary. Advantages possible by negligible coefficient of thermal expansion of carbon/carbon.

  9. Heavy duty piezoresistivity induced strain sensing natural rubber/carbon black nanocomposites reinforced with different carbon nanofillers

    Science.gov (United States)

    He, Qingliang; Yuan, Tingting; Zhang, Xi; Guo, Shimei; Liu, Jingjing; Liu, Jiurong; Liu, Xinyu; Sun, Luyi; Wei, Suying; Guo, Zhanhu

    2014-09-01

    Durable piezoresistive effects of natural rubber nanocomposites have been demonstrated, i.e., with stable and reversible electrical resistance change within the tested 3000 cycles upon applying a small compressive strain (˜16.7%) under a relatively high frequency (0.5 Hz, 2 s/cycle). This unique function was achieved for the first time by combining carbon nanotubes and carbon nanofibers with natural rubber composites pretreated with carbon black. Even though the combination of different carbon nanomaterials, such as graphene nanosheets and carbon nanotubes, can improve the dispersion quality of both the nanostructures in solution or in polymer matrices, this type of synergistic effect between carbon nanotubes and carbon nanofibers in producing stable and reversible piezoresistive effect has been rarely reported. Besides, the strong reinforcement (compressive stress at a maximum strain of 16.7% was increased from 12.6 for untreated to 18.5 MPa for the natural rubber/carbon black composites treated with a combination of 1.0 wt% carbon nanotubes and 1.0 wt% carbon nanofibers) makes the as-prepared composites promising for heavy duty pressure sensors, i.e., healthy motion monitoring of industrial machinery vibrations.

  10. Carbon isotopes in tree rings of Norway spruce (Bohemian Forest, Central Europe) exposed to atmospheric pollution

    Czech Academy of Sciences Publication Activity Database

    Šantrůčková, H.; Šantrůček, Jiří; Svoboda, M.

    Brno : ISBE CAS, 2006. s. 22. [15 Years of EU Supported Ecophysiological Research in the Czech Republic. 18.09.2006-21.09.2006, Olomouc] Keywords : Carbon isotopes * Norway spruce Subject RIV: ED - Physiology

  11. Carbon and Oxygen Isotopic Composition of Surface-Sediment Carbonate in Bosten Lake (Xinjiang, China) and its Controlling Factors

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chengjun; Steffen MISCHKE; ZHENG Mianping; Alexander PROKOPENKO; GUO Fangqin; FENG Zhaodong

    2009-01-01

    Bosten Lake is a mid-latitude lake with water mainly supplied by melting ice and snow in the Tianshan Mountains. The depositional environment of the lake is spatially not uniform due to the proximity of the major inlet and the single outlet in the western part of the lake. The analytical results show that the carbon and oxygen isotopic composition of recent lake sediments is related to this specific lacustrine depositional environment and to the resulting carbonate mineralogy. In the southwestern lake region between the Kaidu River inlet and the Kongqi River outlet, carbon isotope composition (δ13C) values of the carbonate sediment (-1‰ to -2‰) have no relation to the oxygen isotope composition of the carbonate18O) values (-7‰ to -8‰), with both isotopes showing a low variability. The carbonate content is low (<20%). Carbonate minerals analyzed by X-ray diffraction are mainly composed of calcite, while aragonite was not recorded. The salinity of the lake water is low in the estuary region as a result of the Kaidu River inflow. In comparison, the carbon and oxygen isotope values are higher in the middle and eastern parts of the lake, with δ13C values between approximately +0.5‰ and +3‰, and δ18O values between -1‰ and -5‰. There is a moderate correlation between the stable oxygen and carbon isotopes, with a coefficient of correlation r of approximately 0.63. This implies that the lake water has a relatively short residence time. Carbonate minerals constitute calcite and aragonite in the middle and eastern region of the lake. Aragonite and Mg-calcite are formed at higher lake water salinity and temperatures, and larger evaporation effects. More saline lake water in the middle and eastern region of the lake and the enhanced isotopic equilibrium between water and atmospheric CO2 cause the correlating carbon and oxygen isotope values determined for aragonite and Mg-calcite. Evaporation and biological processes are the main reasons for the salinity

  12. Hurricane Isabel Poster (September 18, 2003)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Isabel poster. Multi-spectral image from NOAA-17 shows Hurricane Isabel making landfall on the North Carolina Outer Banks on September 18, 2003. Poster...

  13. African Studies Abstracts Online: number 18, 2007

    OpenAIRE

    African Studies Centre

    2007-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 18 (2007). African Studies Centre, Leiden.

  14. 40 CFR 227.18 - Factors considered.

    Science.gov (United States)

    2010-07-01

    ... Esthetic, Recreational and Economic Values § 227.18 Factors considered. The assessment of the potential for impacts on esthetic, recreational and economic values will be based on an evaluation of the...

  15. Genetics Home Reference: 18q deletion syndrome

    Science.gov (United States)

    ... to severe, but some affected individuals have normal intelligence and development. Seizures, hyperactivity, aggression, and autistic behaviors ... into two types : individuals with deletions near the end of the long arm of chromosome 18 are ...

  16. 18 CFR 382.104 - Enforcement.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Enforcement. 382.104 Section 382.104 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... action permitted by law....

  17. Carbonate and carbon fluctuations in the Eastern Arabian Sea over 140 ka: Implications on productivity changes?

    Digital Repository Service at National Institute of Oceanography (India)

    Guptha, M.V.S.; Naidu, P.D.; Haake, B.G.; Schiebel, R.

    -driven upwelling (Murray and Prell, 1992). A reliable organic carbon-based index of productivity must 0.0 -1.0 -2.0 -3.0 δ 18 O( ‰ ) 0 20 40 60 Age 20 Fig.4. Oxygenisotopestratigraphy,downcorevariationofcalcium coreSK129-CR05 (afterPattanetal.2003).LSR... andsummerinsolationmaximaintheprecessional frequencyband,itissuggestedthattheTOCsignal reflects either preservation changes due to en- hancedsedimentationratesortotheproductionof organic carbon and is not directly linked to monsoonal upwelling (Murray and Prell, 1992). In contrast, variation...

  18. Licensing of Centromeric Chromatin Assembly through the Mis18α-Mis18β Heterotetramer.

    Science.gov (United States)

    Nardi, Isaac K; Zasadzińska, Ewelina; Stellfox, Madison E; Knippler, Christina M; Foltz, Daniel R

    2016-03-01

    Centromeres are specialized chromatin domains specified by the centromere-specific CENP-A nucleosome. The stable inheritance of vertebrate centromeres is an epigenetic process requiring deposition of new CENP-A nucleosomes by HJURP. We show HJURP is recruited to centromeres through a direct interaction between the HJURP centromere targeting domain and the Mis18α-β C-terminal coiled-coil domains. We demonstrate Mis18α and Mis18β form a heterotetramer through their C-terminal coiled-coil domains. Mis18α-β heterotetramer formation is required for Mis18BP1 binding and centromere recognition. S. pombe contains a single Mis18 isoform that forms a homotetramer, showing tetrameric Mis18 is conserved from fission yeast to humans. HJURP binding disrupts the Mis18α-β heterotetramer and removes Mis18α from centromeres. We propose stable binding of Mis18 to centromeres in telophase licenses them for CENP-A deposition. Binding of HJURP deposits CENP-A at centromeres and facilitates the removal of Mis18, restricting CENP-A deposition to a single event per cell cycle. PMID:26942680

  19. Adipose tissue interleukin-18 mRNA and plasma interleukin-18: effect of obesity and exercise

    DEFF Research Database (Denmark)

    Leick, Lotte; Lindegaard, Birgitte; Stensvold, Dorthe;

    2007-01-01

    OBJECTIVES: Obesity and a physically inactive lifestyle are associated with increased risk of developing insulin resistance. The hypothesis that obesity is associated with increased adipose tissue (AT) interleukin (IL)-18 mRNA expression and that AT IL-18 mRNA expression is related to insulin......: AT IL-18 mRNA content and plasma IL-18 concentration were higher (p < 0.05) in the obese group than in the non-obese group. AT IL-18 mRNA content and plasma IL-18 concentration was positively correlated (p < 0.05) with insulin resistance. While acute exercise did not affect IL-18 mRNA expression at...... the studied time-points, exercise training reduced AT IL-18 mRNA content by 20% in both sexes. DISCUSSION: Because obesity and insulin resistance were associated with elevated AT IL-18 mRNA and plasma IL-18 levels, the training-induced lowering of AT IL-18 mRNA content may contribute to the beneficial...

  20. Molecular cloning and functional analysis of duck ubiquitin-specific protease 18 (USP18) gene.

    Science.gov (United States)

    Qian, Wei; Wei, Xiaoqin; Zhou, Hongbo; Jin, Meilin

    2016-09-01

    In mammals, ubiquitin-specific protease 18 (USP18) is an interferon (IFN)-inducible gene and is a negative regulator of Toll-like receptor-mediated nuclear factor kappa B (NF-κB) activation. The role of USP18 in ducks (duUSP18) remains poorly understood. In the present study, we cloned and characterized the full-length coding sequence of duUSP18 from duck embryo fibroblasts (DEFs). In healthy ducks, duUSP18 transcripts were broadly expressed in different tissues, with higher expression levels in the spleen, lung and kidney. Quantitative real-time PCR (qRT-PCR) analysis revealed that duUSP18 could be induced by treatment with Poly(I:C) or LPS. Overexpression of duUSP18 inhibited NF-κB and IFN-β expression. Furthermore, deletion mutant analysis revealed that the duUSP18 region between aa 75 and 304 was essential for inhibiting NF-κB. In addition, overexpression of duUSP18 also suppressed the secretion of NF-κB-dependent proinflammatory cytokines. Taken together, these results suggest that duUSP18 regulates duck innate immune responses. PMID:27133094

  1. Fluorine-18 chemistry in micro-reactors

    OpenAIRE

    Lu, Shuiyu; Chun, Joong-Hyun; Pike, Victor W.

    2010-01-01

    Recent applications of micro-reactor (microfluidics) technology to radiofluorination chemistry within our laboratory are presented, based on use of either a simple T-shaped glass micro-reactor or a more advanced microfluidics instrument. The topics include reaction optimization and radioligand production, in particular the study of the radiofluorination of diaryliodonium salts, [18F]fluoride ion exchange with xenon difluoride, esterification with [18F]2-fluoroethyl tosylate, and the syntheses...

  2. Main: VSF1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available VSF1PVGRP18 S000249 19-August-2004 (last modified) kehi VSF-1 binding site in French bean (P.v.) grp1... in 28 bp vs-1 element; This sequence controls vascular gene expression in transgenic tobacco; VS-1 found in bean grp1...h NRE; Confers xylem-specific expression; VSF-1; vascular; grp1.8; VS-1; bZIP; Xylem; French bean (Phaseolus

  3. Normalization of stable isotope data for carbonate minerals: Implementation of IUPAC guidelines

    Science.gov (United States)

    Kim, Sang-Tae; Coplen, Tyler B.; Horita, Juske

    2015-06-01

    Carbonate minerals provide a rich source of geochemical information because their δ13C and δ18O values provide information about surface and subsurface Earth processes. However, a significant problem is that the same δ18O value is not reported for the identical carbonate sample when analyzed in different isotope laboratories in spite of the fact that the International Union of Pure and Applied Chemistry (IUPAC) has provided reporting guidelines for two decades. This issue arises because (1) the δ18O measurements are performed on CO2 evolved by reaction of carbonates with phosphoric acid, (2) the acid-liberated CO2 is isotopically fractionated (enriched in 18O) because it contains only two-thirds of the oxygen from the solid carbonate, (3) this oxygen isotopic fractionation factor is a function of mineralogy, temperature, concentration of the phosphoric acid, and δ18O value of water in the phosphoric acid, (4) researchers may use any one of an assortment of oxygen isotopic fractionation factors that have been published for various minerals at various reaction temperatures, and (5) it sometimes is not clear how one should calculate δ18OVPDB values on a scale normalized such that the δ18O value of SLAP reference water is -55.5 ‰ relative to VSMOW reference water. To enable researchers worldwide to publish the same δ18O value (within experimental uncertainty) for the same carbonate sample, we have re-evaluated reported acid fractionation factors for calcite at 25, 50, and 75 °C and propose a revised relation for the temperature dependence of oxygen isotopic acid fractionation factor, αCO2(ACID)-calcite , of where T is temperature in kelvin. At 25 °C, αCO2(ACID)-calcite = 1.01025 , the most commonly accepted value for this quantity. We propose a normalization protocol in which (1) the internationally distributed carbonate isotopic reference materials NBS 18 and NBS 19 are interspersed among carbonate samples analyzed by treatment with phosphoric acid, (2

  4. Activated carbons and gold

    International Nuclear Information System (INIS)

    The literature on activated carbon is reviewed so as to provide a general background with respect to the effect of source material and activation procedure on carbon properties, the structure and chemical nature of the surface of the activated carbon, and the nature of absorption processes on carbon. The various theories on the absorption of gold and silver from cyanide solutions are then reviewed, followed by a discussion of processes for the recovery of gold and silver from cyanide solutions using activated carbon, including a comparison with zinc precipitation

  5. Recoil 18F-chemistry in fluoroalkanes

    International Nuclear Information System (INIS)

    This thesis describes the study of the chemical reactions of recoil 18F-atoms in gaseous fluoromethanes and fluoroethanes. A brief survey of the organic hot atom chemistry is given in Chapter I. Chapter II deals with the experimental procedures used in this investigation. The irradiation facilities, the vapour phase radio-chromatography and the identification, including the synthesis of some fluorocarbons, are described in detail. Chapter III consists of a study on the applicability of perfluoropropene, C3F6, as scavenger for thermal 18F-atoms and radicals. Chapters IV, V, VI and VII deal with 18F-recoil chemistry in gaseous fluoroethanes, using H2S as scavenger. Chapter VIII is a short discussion on the hot 18F-atom based production of 18F-labeled organic compounds via decay of the intermediate 18Ne. A target system is proposed for production of this isotope in high energy and ultra high flux particle beams, which possibly would become available in fast breeders and fusion reactors. (Auth.)

  6. Change of glassy carbon structure and characteristics under neutron irradiation

    International Nuclear Information System (INIS)

    Results of the investigation into samples of glassy carbon SU-1300, SU-2000 after irradiation in the BOR-60 reactor at 360 - 400 Deg C are presented. It is established that the effect of significant radiation compression of the glassy carbon under irradiation retains till neutron fluence 3.6 x 1026 m-2 (E > 0.18 MeV). It is shown that radiation shrinkage is produced by shrinkage of graphite-like beds and decrease of molecular porosity. Increasing temperature of glassy carbon preparation from 1300 to 2000 Deg C tends to decrease of graphitization of the material under irradiation

  7. RESTORING SUSTAINABLE FORESTS ON APPALACHIAN MINED LANDS FOR WOOD PRODUCTS, RENEWABLE ENERGY, CARBON SEQUESTRATION, AND OTHER ECOSYSTEM SERVICES

    Energy Technology Data Exchange (ETDEWEB)

    J. Burger; J. Galbraith; T. Fox; G. Amacher; J. Sullivan; C. Zipper

    2003-12-18

    The overall purpose of this project is to evaluate the biological and economic feasibility of restoring high-quality forests on mined land, and to measure carbon sequestration and wood production benefits that would be achieved from forest restoration procedures. In this quarterly report, we present a preliminary comparison of the carbon sequestration benefits for two forest types used to convert abandoned grasslands for carbon sequestration. Annual mixed hardwood benefits, based on total stand carbon volume present at the end of a given year, range from a minimum of $0/ton of carbon to a maximum of $5.26/ton of carbon (low prices). White pine benefits based on carbon volume range from a minimum of $0/ton of carbon to a maximum of $18.61/ton of carbon (high prices). The higher maximum white pine carbon payment can primarily be attributed to the fact that the shorter rotation means that payments for white pine carbon are being made on far less cumulative carbon tonnage than for that of the long-rotation hardwoods. Therefore, the payment per ton of white pine carbon needs to be higher than that of the hardwoods in order to render the conversion to white pine profitable by the end of a rotation. These carbon payments may seem appealingly low to the incentive provider. However, payments (not discounted) made over a full rotation may add up to approximately $17,493/ha for white pine (30-year rotation), and $18,820/ha for mixed hardwoods (60-year rotation). The literature suggests a range of carbon sequestration costs, from $0/ton of carbon to $120/ton of carbon, although the majority of studies suggest a cost below $50/ ton of carbon, with van Kooten et al. (2000) suggesting a cutoff cost of $20/ton of carbon sequestered. Thus, the ranges of carbon payments estimated for this study fall well within the ranges of carbon sequestration costs estimated in previous studies.

  8. The enhancement in wear resistance of W18Cr4V steel by ion implantation

    International Nuclear Information System (INIS)

    Two new methods of ion implantation were adopted in comparison with nitrogen implantation: carbon monoxide was implanted directly into W18Cr4V steel, and nitrogen was implanted into a deposited titanium film about 1000 A thick. It is shown that higher surface hardness and wear resistance have been achieved. The composition and phase structure of the implanted layer was determined in detail. The wear mechanisms were discussed

  9. Carbon-14 waste management

    International Nuclear Information System (INIS)

    Carbon-14 occurs in nature, but is also formed in nuclear reactors. Because of its long half-life and the biological significance of carbon, releases from nuclear facilities could have a significant radiological impact. Waste management strategies for carbon-14 are therefore of current concern. Carbon-14 is present in a variety of waste streams both at reactors and at reprocessing plants. A reliable picture of the production and release of carbon-14 from various reactor systems has been built up for the purposes of this study. A possible management strategy for carbon-14 might be the reduction of nitrogen impurity levels in core materials, since the activation of 14N is usually the dominant source of carbon-14. The key problem in carbon-14 management is its retention of off-gas streams, particularly in the dissolver off-gas stream at reprocessing plants. Three alternative trapping processes that convert carbon dioxide into insoluble carbonates have been suggested. The results show that none of the options considered need be rejected on the grounds of potential radiation doses to individuals. All exposures should be as low as reasonably achievable, economic and social factors being taken into account. If, on these grounds, retention and disposal of carbon-14 is found to be beneficial, then, subject to the limitations noted, appropriate retention, immobilization and disposal technologies have been identified

  10. The paper of the forests like retainers of carbon, an experience in the south of Mexico

    International Nuclear Information System (INIS)

    The forests play an important paper in the global cycle of the carbon. At the moment, the deforestation is responsible for approximately 1.8GtC (gigatons of carbon), 20% of the global annual emissions of carbonic gas caused by the human activity. However, it is calculated that the reforestation could retain from 50 to 150 GtC along next 50 years. Concepts related with the retention of carbon are discussed. The necessity is commented of carrying out the regulation of an international market in retention of carbon with the purpose of being able to maintain acceptable norms in the reforestation projects that are executed under this program

  11. Strong ionisation in carbon nanowires

    Science.gov (United States)

    Kaymak, V.; Pukhov, A.; Shlyaptsev, V. N.; Rocca, J. J.

    2016-04-01

    Surfaces covered with nanostructures, such as nanowire arrays, are shown to facilitate a significantly higher absorption of laser energy as compared to flat surfaces. Due to the efficient coupling of the laser energy, highly energetic electrons are produced, which in turn can emit intense ultrafast X-ray pulses. Full three dimensional PIC simulations are used to analyse the behaviour of arrays of carbon nanowires 400 nm in diameter, irradiated by a 400-nm laser pulse of 60-fs duration at FWHM and a vector potential of α0 = 18. We analyse the ionisation dynamics of the nanowires. The difference of the ionisation strength and structure between linearly and circularly polarised laser beam is investigated. The nanowires are found to be fully ionised after about 30 laser cycles. Circularly polarised light reveals a slightly stronger ionisation effect.

  12. Strong Ionization in carbon Nanowires

    CERN Document Server

    Kaymak, Vural; Shlyaptsev, Vyacheslav N; Rocca, Jorge J

    2015-01-01

    Surfaces covered with nanostructures, such as nanowire arrays, have shown to facilitate a significantly higher absorption of laser energy as compared to flat surfaces. Due to the efficient coupling of the laser energy, highly energetic electrons are produced, which in turn can emit intense ultrafast X-ray pulses. In the present work we use full three dimensional PIC simulations to analyze the behavior of arrays of carbon nanowires $400 nm$ in diameter, irradiated by a $\\lambda_0 = 400 nm$ laser pulse of $60 fs$ duration at FWHM and a vector potential of $a_0 = 18$. We analyze the ionization dynamics of the nanowires. We investigate the difference of the ionization strength and structure between linearly and circularly polarized laser beam. The nanowires are found to be fully ionized after about 30 laser cycles. Circularly polarized light reveals a slightly stronger ionization effect.

  13. Regional carbon dynamics in monsoon Asia and its implications for the global carbon cycle

    Science.gov (United States)

    Tian, H.; Melillo, J.M.; Kicklighter, D.W.; Pan, S.; Liu, J.; McGuire, A.D.; Moore, B., III

    2003-01-01

    Data on three major determinants of the carbon storage in terrestrial ecosystems are used with the process-based Terrestrial Ecosystem Model (TEM) to simulate the combined effect of climate variability, increasing atmospheric CO2 concentration, and cropland establishment and abandonment on the exchange of CO2 between the atmosphere and monsoon Asian ecosystems. During 1860-1990, modeled results suggest that monsoon Asia as a whole released 29.0 Pg C, which represents 50% of the global carbon release for this period. Carbon release varied across three subregions: East Asia (4.3 Pg C), South Asia (6.6 Pg C), and Southeast Asia (18.1 Pg C). For the entire region, the simulations indicate that land-use change alone has led to a loss of 42.6 Pg C. However, increasing CO2 and climate variability have added carbon to terrestrial ecosystems to compensate for 23% and 8% of the losses due to land-use change, respectively. During 1980-1989, monsoon Asia as a whole acted as a source of carbon to the atmosphere, releasing an average of 0.158 Pg C per year. Two of the subregions acted as net carbon source and one acted as a net carbon sink. Southeast Asia and South Asia were sources of 0.288 and 0.02 Pg C per year, respectively, while East Asia was a sink of 0.149 Pg C per year. Substantial interannual and decadal variations occur in the annual net carbon storage estimated by TEM due to comparable variations in summer precipitation and its effect on net primary production (NPP). At longer time scales, land-use change appears to be the important control on carbon dynamics in this region. ?? 2003 Elsevier Science B.V. All rights reserved.

  14. Carbon and Oxygen Isotope Measurements of Ordinary Chondrite (OC) Meteorites from Antarctica Indicate Distinct Terrestrial Carbonate Species using a Stepped Acid Extraction Procedure Impacting Mars Carbonate Research

    Science.gov (United States)

    Evans, M. E.; Niles, P. B.; Locke, D.

    2015-12-01

    The purpose of this study is to characterize the stable isotope values of terrestrial, secondary carbonate minerals from five OC meteorites collected in Antarctica. These samples were selected for analysis based upon their size and collection proximity to known Martian meteorites. They were also selected based on petrologic type (3+) such that they were likely to be carbonate-free before falling to Earth. This study has two main tasks: 1) characterize the isotopic composition of terrestrial, secondary carbonate minerals formed on meteorites in Antarctica, and 2) study the mechanisms of carbonate formation in cold and arid environments with Antarctica as an analog for Mars. Two samples from each meteorite, each ~0.5g, was crushed and dissolved in pure phosphoric acid for 3 sequential reactions: a) Rx0 for 1 hour at 30°C, b) Rx1 for 18 hours at 30°C, and c) Rx2 for 3 hours at 150°C. CO2 was distilled by freezing with liquid nitrogen from each sample tube, then separated from organics and sulfides with a TRACE GC using a Restek HayeSep Q 80/100 6' 2mm stainless column, and then analyzed on a Thermo MAT 253 IRMS in Dual Inlet mode. This system was built at NASA/JSC over the past 3 years and proof tested with known carbonate standards to develop procedures, assess yield, and quantify expected uncertainties. Two distinct species of carbonates are found based on the stepped extraction technique: 1) Ca-rich carbonate released at low temperatures, and 2) Mg, or Fe-rich carbonate released at high temperatures. Preliminary results indicate that most of the carbonates present in the ordinary chondrites analyzed have δ13C=+5‰, which is consistent with formation from atmospheric CO2 δ13C=-7‰ at -20°C. The oxygen isotopic compositions of the carbonates vary between +4‰ and +34‰ with the Mg-rich and/or Fe-rich carbonates possessing the lowest δ18O values. This suggests that the carbonates formed under a wide range of temperatures. However, the carbonate oxygen

  15. Photosynthetic isotope fractionation: oxygen and carbon

    International Nuclear Information System (INIS)

    Isotopic carbon analyses of plant tissue and carbon dioxide from air samples and plant and soil respiration were made. Soil respiratory CO2 is about 150/00 lighter than atmospheric CO2. Plant isotopic ratios were found to be influenced by (1) plant photosynthetic efficiency, (2) source CO2, (3) airflow, and (4) CO2 concentrations. Etiolated bean plants have nearly the same delta13C value as seed carbon and seed dark respiratory CO2. Mature leaves from greenhouse grown beans, however, are some 5 0/00 lighter than seed carbon. This is a result of CO2 source, i.e., plant or soil respiratory CO2. Leaves which are generally lighter than other plant organs becomes still lighter during the growing season. As a consequence of increasingly light leaf carbon, photorespired CO2 also becomes lighter during the growing season. Oxygen isotopic values were measured for (1) photorespiratory CO2, which reflects equilibration with leaf water, and (2) photosynthetic O2, which is enriched in 18O, perhaps due to respiratory or photorespiratory 16O preference

  16. Fluorine 18 in tritium generator ceramic materials

    International Nuclear Information System (INIS)

    At present time, the ceramic materials generators of tritium are very interesting mainly by the necessity of to found an adequate product for its application as fusion reactor shielding. The important element that must contain the ceramic material is the lithium and especially the isotope with mass=6. The tritium in these materials is generated by neutron irradiation, however, when the ceramic material contains oxygen, then is generated too fluorine 18 by the action of energetic atoms of tritium in recoil on the 16 O, as it is showed in the next reactions: 1) 6 Li (n, α) 3 H ; 2) 16 O(3 H, n) 18 F . In the present work was studied the LiAlO2 and the Li2O. The first was prepared in the laboratory and the second was used such as it is commercially expended. In particular the interest of this work is to study the chemical behavior of fluorine-18, since if it would be mixed with tritium it could be contaminate the fusion reactor fuel. The ceramic materials were irradiated with neutrons and also the chemical form of fluorine-18 produced was studied. It was determined the amount of fluorine-18 liberated by the irradiated materials when they were submitted to extraction with helium currents and argon-hydrogen mixtures and also it was investigated the possibility about the fluorine-18 was volatilized then it was mixed so with the tritium. Finally it was founded that the liberated amount of fluorine-18 depends widely of the experimental conditions, such as the temperature and the hydrogen amount in the mixture of dragging gas. (Author)

  17. Mechanical properties and corrosion behaviour of 18Cr-11Ni-2,5Mo cast steel

    Directory of Open Access Journals (Sweden)

    M. Starowicz

    2009-10-01

    Full Text Available The study discusses the effect of variable carbon concentration (0,02; 0,07 and 0,14% on the mechanical properties and corrosion resistance in 3,0% NaCl solution of 18Cr-11Ni-2,5Mo austenitic cast steel. It has been proved that at the concentration of 0,07%C, products made of the examined cast steel reveal on their surface some symptoms of local corrosion. Carbon concentration raised to 0,14%C results in advanced intercrystalline corrosion and the onset of local corrosion. Carbon concentration increased from 0,02 to 0,14% also results in the tensile strength UTS raised from 487MPa to 579MPa (a nearly 20% increase with elongation El reduced from 55,3% to 49,6%, and reduction of area RA from 69,3% to 53,4%.

  18. Carbon isotopes in mollusk shell carbonates

    Science.gov (United States)

    McConnaughey, Ted A.; Gillikin, David Paul

    2008-10-01

    Mollusk shells contain many isotopic clues about calcification physiology and environmental conditions at the time of shell formation. In this review, we use both published and unpublished data to discuss carbon isotopes in both bivalve and gastropod shell carbonates. Land snails construct their shells mainly from respired CO2, and shell δ13C reflects the local mix of C3 and C4 plants consumed. Shell δ13C is typically >10‰ heavier than diet, probably because respiratory gas exchange discards CO2, and retains the isotopically heavier HCO3 -. Respired CO2 contributes less to the shells of aquatic mollusks, because CO2/O2 ratios are usually higher in water than in air, leading to more replacement of respired CO2 by environmental CO2. Fluid exchange with the environment also brings additional dissolved inorganic carbon (DIC) into the calcification site. Shell δ13C is typically a few ‰ lower than ambient DIC, and often decreases with age. Shell δ13C retains clues about processes such as ecosystem metabolism and estuarine mixing. Ca2+ ATPase-based models of calcification physiology developed for corals and algae likely apply to mollusks, too, but lower pH and carbonic anhydrase at the calcification site probably suppress kinetic isotope effects. Carbon isotopes in biogenic carbonates are clearly complex, but cautious interpretation can provide a wealth of information, especially after vital effects are better understood.

  19. Estimation of soil organic carbon reservoir in China

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The paper respectively adopted physio-chemical properties of every soil stratum from 2473 soil profiles of the second national soil survey. The corresponding carbon content of soils is estimated by utilizing conversion coefficient 0.58. In the second soil survey, the total amount of soil organic carbon is about 924.18×108t and carbon density is about 10.53 kgC/m2 in China according to the area of 877.63×106 hm2 surveyed throughout the country. The spatial distribution characteristics of soil organic carbon in China is that the carbon storage increases when latitude increases in eastern China and the carbon storage decreases when longitude reduces in northern China. A transitional zone with great variation in carbon storage exists. Moreover, there is an increasing tendency of carbon density with decrease of latitude in western China. Soil circle is of great significance to global change, but with substantial difference in soil spatial distribution throughout the country. Because the structure of soil is inhomogeneous, it could bring some mistakes in estimating soil carbon reservoirs. It is necessary to farther resolve soil respiration and organic matter conversion and other questions by developing uniform and normal methods of measurement and sampling.

  20. Laser interaction with low-density carbon foam

    Indian Academy of Sciences (India)

    S Chaurasia; S Tripathi; D S Munda; G Mishra; C G Murali; N K Gupta; L J Dhareshwar; A K Rossall; G J Tallents; Rashmi Singh; D K Kohli; R K Khardekar

    2010-12-01

    Experiments were performed with a 15 J/500 ps Nd:glass laser ( = 1064 nm) focussed to an intensity > 1014 W/cm2 . X-ray emissions from carbon foam and 5 % Pt-doped carbon foam of density 150–300 mg/cc were compared with that of the solid carbon targets. The thickness of the carbon foam was 15 m on a graphite substrate. X-ray emission was measured using semiconductor X-ray diodes covered with various filters having transmissions in different X-ray spectral ranges. It covered X-ray spectrum of 0.8–8.5 keV range. The X-ray emission in the soft X-ray region was observed to increase to about 1.8 times and 2.3 times in carbon foam and Pt-doped foam, respectively with respect to solid carbon. In hard X-rays, there was no measurable difference amongst the carbon foam, Pt-doped carbon foam and solid carbon. Scanning electron microscope (SEM) analysis demonstrates that foam targets smoothens the crater formed by the laser irradiation.

  1. Microwave absorption properties of helical carbon nanofibers-coated carbon fibers

    Directory of Open Access Journals (Sweden)

    Lei Liu

    2013-08-01

    Full Text Available Helical carbon nanofibers (HCNFs coated-carbon fibers (CFs were fabricated by catalytic chemical vapor deposition method. TEM and Raman spectroscopy characterizations indicate that the graphitic layers of the HCNFs changed from disorder to order after high temperature annealing. The electromagnetic parameters and microwave absorption properties were measured at 2–18 GHz. The maximum reflection loss is 32 dB at 9 GHz and the widest bandwidth under −10 dB is 9.8 GHz from 8.2 to 18 GHz for the unannealed HCNFs coated-CFs composite with 2.5 mm in thickness, suggesting that HCNFs coated-CFs should have potential applications in high performance microwave absorption materials.

  2. Carbon accumulation by macrophytes of aqatic and wetland habitats with standing water

    Czech Academy of Sciences Publication Activity Database

    Květ, Jan; Pokorný, Jan; Čížková, Hana

    2008-01-01

    Roč. 78, - (2008), s. 91-98. ISSN 0369-8211 R&D Projects: GA MŽP(CZ) SM/640/18/03 Institutional research plan: CEZ:AV0Z60870520 Keywords : Climate change * plant biomass * net primary production * decomposition * organic carbon * carbonate encrustations Subject RIV: ED - Physiology

  3. Study on the Microwave Permittivity of Single-Walled Carbon Nanotube

    Science.gov (United States)

    Liu, Xiaolai; Zhao, Donglin

    2009-01-01

    In this article, we studied the microwave permittivity of the complex of the single-walled carbon nanotube and paraffin in 2-18GHz. In the range, the dielectric loss of single-walled carbon nanotube is higher, and the real part and the imaginary part of the dielectric constant decrease with the increase of frequency, and the dielectric constant…

  4. Analysis of Terrestrial Carbon Stocks in a Small Catchment of Northeastern Siberia

    Science.gov (United States)

    Heard, K.; Natali, S.; Bunn, A. G.; Loranty, M. M.; Kholodov, A. L.; Schade, J. D.; Berner, L. T.; Spektor, V.; Zimov, N.; Alexander, H. D.

    2015-12-01

    As arctic terrestrial ecosystems comprise about one-third of the global terrestrial ecosystem carbon total, understanding arctic carbon cycling and the feedback of terrestrial carbon pools to accelerated warming is an issue of global concern. For this research, we examined above- and belowground carbon stocks in a larch-dominated catchment underlain by yedoma and located within the Kolyma River watershed in northeastern Siberia. We quantified carbon stocks in vegetation, active layer, and permafrost, and we assessed the correlation between plant and active layer carbon pools and four environmental correlates — slope, solar insolation, canopy density, and leaf area index ­— at 20 sites. Carbon in the active layer was approximately four times greater than aboveground carbon pools (972 g C m-2), and belowground carbon to 1 m depth was approximately 18 times greater than aboveground carbon pools. Canopy density and slope had a robust positive association with aboveground carbon pools, and soil moisture was positively related to %C in organic, thawed mineral and permafrost soil. Thaw depth was negatively correlated with moss cover and larch biomass, highlighting the importance of vegetation and surface characteristics on permafrost carbon vulnerability. These data suggest that landscape and ecosystem characteristics affect carbon accumulation and storage, but they also play an important role in stabilizing permafrost carbon pools.

  5. Diet control on carbon isotopic composition of land snail shell carbonate

    Institute of Scientific and Technical Information of China (English)

    LIU ZongXiu; GU ZhaoYan; WU NaiQin; XU Bing

    2007-01-01

    Carbon isotope compositions for both the carbonate shells and soft bodies (organic tissue) of living land snails collected mostly from the Loess Plateau, China have been measured. The result shows that δ13C values range from -13.1‰ to -4.3‰ for the aragonite shell samples and from -26.8‰ to -18.0‰ for the soft body samples. Although the shells are enriched in 13C relative to the bodies averagely by 14.2(±0.8)‰, the shell δ13Ca values are closely correlated to the body δ13Corg values, expressed as δ13Ca = 1.021 δ13Corg + 14.38 (R = 0.965; N = 31). This relationship indicates that δ13Ca is primarily a function of the isotopic composition of the snail diets since previous studies have proved that the snail body is the same as their food in carbon isotope composition. In other words, carbon isotope compo-sition of the carbonate shell can be used as a proxy to estimate the dietary 13C abundance of the land snails. The data also support that the 13C enrichment of the carbonate shells results mainly from the equilibrium fractionations between the metabolic CO2, HCO3- in the hemolymph and shell aragonite, and partially from kinetic fractionations when snail shells form during their activity.

  6. 18F-FDG and 18F-FET uptake in experimental soft tissue infection

    International Nuclear Information System (INIS)

    The aim of this study was to compare the uptake of 18F-fluoroethyl-L-tyrosine (18F-FET) with that of 18F-fluorodeoxyglucose (18F-FDG) in activated inflammatory white blood cells. Unilateral thigh muscle abscesses were induced in 11 rats by intramuscular inoculation of 0.1 ml of a bacterial suspension (S. aureus, 1.2 x 109 CFU/ml). Four animals were intraperitoneally injected with 130-180 MBq 18F-FDG, four with 140-170 MBq 18F-FET and three with a mixture of 140-170 MBq 18F-FET and 1.8 MBq 14C-deoxyglucose. Autoradiography (10 μm slice thickness) of the abscess and the contralateral muscle was performed and detailed spatial correlation of autoradiography and histopathology (haematoxylin-eosin staining) was obtained. Regions of interest were placed on the abscess wall and the grey values (digitised image intensities) measured were converted to kBq/cc per kBq injected activity per gram (SUV). Areas with increased 18F-FDG uptake corresponded to cellular inflammatory infiltrates mainly consisting of granulocytes. The SUV was calculated to be 4.08±0.65 (mean±SD). The uptake of 18F-FET in activated white blood cells was not increased: the SUV of the abscess wall, at 0.74±0.14, was even below that of contralateral muscle. The low uptake of 18F-FET in non-neoplastic inflammatory cells promises a higher specificity for the detection of tumour cells than is achieved with 18F-FDG, since the immunological host response will not be labelled and inflammation can be excluded. (orig.)

  7. Synthesis and evaluation of [[sup 18]F]fluoroprogestins and [[sup 18]F]fluorometoprolol

    Energy Technology Data Exchange (ETDEWEB)

    De Groot, T.J.

    1993-05-01

    The author investigated if specific radioactively labelled compounds could be applied to gain insight into particular psychic diseases, f.e. Parkinson's disease and schizophrenia, by means of Positron Emission Tomography (PET). No appropriate compounds were found. In this thesis the syntheses of fluorine-18 labelled progestins and [beta][sub 1]-adrenergic ligands are described. Three approaches towards [[sup 18]F]fluorination are investigated. The first method concerns direct S[sub N]2-substitution, the second approach is the opening of an epoxide, and the third approach is [[sup 18]F]fluoroalkylation. The positron emitting radionuclide fluorine-18 was used because of its relatively long decay time and the possibility to produce it in high yields and with high specific activity. The target systems which were applied for the production of fluorine-18 are described in chapter two. Important chemical and physical aspects of [[sup 18]F]fluoride are reviewed in the same chapter. In chapter three the synthesis of 21-[[sup 18]F]fluorinated progestins is discussed. The synthesis of four 21-[[sup 18]F]fluoroprogesterone derivatives is described and the results of an in vivo evaluation of two of these ligands are discussed. Possible routes leading to 6[alpha]-[[sup 18]F]fluoroprogestins are presented in chapter four. The radiochemical approaches towards the synthesis of these ligands are discussed. In chapter five the proposed routes to the fluorine-18 labelled [beta][sub 1]-adrenergic ligands are described and evaluated in the synthesis of two model compounds. 1-[[sup 18]F]fluorometoprolol, the [[sup 18]F]fluorinated analogue of a potent beta-blocker, is prepared using one of the investigated methods. The biological effect of fluorine substitution of a [beta][sub 1]-adrenergic ligand is discussed on the basis of an in vitro and in vivo evaluation. 21 figs., 28 schemes, 19 tabs., 182 refs.

  8. Synthesis and evaluation of [18F]fluoroprogestins and [18F]fluorometoprolol

    International Nuclear Information System (INIS)

    The author investigated if specific radioactively labelled compounds could be applied to gain insight into particular psychic diseases, f.e. Parkinson's disease and schizophrenia, by means of Positron Emission Tomography (PET). No appropriate compounds were found. In this thesis the syntheses of fluorine-18 labelled progestins and β1-adrenergic ligands are described. Three approaches towards [18F]fluorination are investigated. The first method concerns direct SN2-substitution, the second approach is the opening of an epoxide, and the third approach is [18F]fluoroalkylation. The positron emitting radionuclide fluorine-18 was used because of its relatively long decay time and the possibility to produce it in high yields and with high specific activity. The target systems which were applied for the production of fluorine-18 are described in chapter two. Important chemical and physical aspects of [18F]fluoride are reviewed in the same chapter. In chapter three the synthesis of 21-[18F]fluorinated progestins is discussed. The synthesis of four 21-[18F]fluoroprogesterone derivatives is described and the results of an in vivo evaluation of two of these ligands are discussed. Possible routes leading to 6α-[18F]fluoroprogestins are presented in chapter four. The radiochemical approaches towards the synthesis of these ligands are discussed. In chapter five the proposed routes to the fluorine-18 labelled β1-adrenergic ligands are described and evaluated in the synthesis of two model compounds. 1-[18F]fluorometoprolol, the [18F]fluorinated analogue of a potent beta-blocker, is prepared using one of the investigated methods. The biological effect of fluorine substitution of a β1-adrenergic ligand is discussed on the basis of an in vitro and in vivo evaluation. 21 figs., 28 schemes, 19 tabs., 182 refs

  9. Calibration of speleothem δ18O records against hydroclimate instrumental records in Central Brazil

    Science.gov (United States)

    Moquet, J. S.; Cruz, F. W.; Novello, V. F.; Stríkis, N. M.; Deininger, M.; Karmann, I.; Santos, R. Ventura; Millo, C.; Apaestegui, J.; Guyot, J.-L.; Siffedine, A.; Vuille, M.; Cheng, H.; Edwards, R. L.; Santini, W.

    2016-04-01

    δ18O in speleothems is a powerful proxy for reconstruction of precipitation patterns in tropical and sub-tropical regions. The aim of this study is to calibrate the δ18O record of speleothems against historical precipitation and river discharge data in central Brazil, a region directly influenced by the Southern Atlantic Convergence Zone (SACZ), a major feature of the South American Monsoon System (SAMS). The present work is based on a sub-annual resolution speleothem record covering the last 141 years (the period between the years 1870 and 2011) from a cave in central Brazil. The comparison of this record with instrumental hydroclimate records since 1921 allows defining a strong relationship between precipitation variability and stable oxygen isotope ratios from speleothems. The results from a monitoring program of climatic parameters and isotopic composition of rainfall and cave seepage waters performed in the same cave, show that the rain δ18O variability is dominated by the amount effect in this region, while δ18O drip water remains almost constant over the monitored period (1.5 years). The δ18O of modern calcite, on the other hand, shows clear seasonal variations, with more negative values observed during the rainy season, which implies that other factors also influence the isotopic composition of carbonate. However, the relationship between δ18O of carbonate deposits and rainwater is supported by the results from the comparison between speleothem δ18O records and historical hydroclimate records. A significant correlation between speleothem δ18O and monsoon rainfall variability is observed on sub-decadal time scales, especially for the monsoon period (DJFM and NDJFM), once the rainfall record have been smoothed with a 7-9 years running mean. This study confirms that speleothem δ18O is directly associated with monsoon rainfall variability in central Brazil. The relationship between speleothem δ18O records and hydroclimatic historical records allows

  10. Separating Long-Lived Metal Ions from 18F During H2 18O Recovery

    International Nuclear Information System (INIS)

    Cyclotron targets for the production of [18F]fluoride usually use a thin metal window to contain the 18O enriched water during irradiation. This window is activated by the proton beam, and undesired radioisotopes can enter the target water. A pre-packaged strong anion exchange resin is commonly used for [18O]-water recovery. A two-column method has been developed which delivers >95% of the [18F]fluoride for radiosynthesis while rejecting >99.9% of the contaminants. (author)

  11. High Current Beam Transport to SIS18

    CERN Document Server

    Richter, S; Dahl, L; Glatz, J; Groening, L; Yaramishev, S

    2004-01-01

    The optimized transversal and longitudinal matching of space charged dominated ion beams to SIS18 is essential for a loss free injection. This paper focuses on the beam dynamics in the transfer line (TK) from the post-stripper accelerator to the SIS18. Transverse beam emittance measurements at different positions along the TK were done. Especially, the different foil stripping modes were investigated. A longitudinal emittance measurement set-up was commissioned at the entry to the TK. It is used extensively to tune all the rebunchers along the UNILAC. An addition, a test bench is in use for measurements of longitudinal bunch profiles, which enables to monitor for the final debunching to SIS18. Multi particle simulations by means of PARMILA allow a detailed analysis of experimental results for different ion currents.

  12. Plumbing carbon nanotubes

    Science.gov (United States)

    Jin, Chuanhong; Suenaga, Kazu; Iijima, Sumio

    2008-01-01

    Since their discovery, the possibility of connecting carbon nanotubes together like water pipes has been an intriguing prospect for these hollow nanostructures. The serial joining of carbon nanotubes in a controlled manner offers a promising approach for the bottom-up engineering of nanotube structures-from simply increasing their aspect ratio to making integrated carbon nanotube devices. To date, however, there have been few reports of the joining of two different carbon nanotubes. Here we demonstrate that a Joule heating process, and associated electro-migration effects, can be used to connect two carbon nanotubes that have the same (or similar) diameters. More generally, with the assistance of a tungsten metal particle, this technique can be used to seamlessly join any two carbon nanotubes-regardless of their diameters-to form new nanotube structures.

  13. Carbon-negative biofuels

    International Nuclear Information System (INIS)

    Current Kyoto-based approaches to reducing the earth's greenhouse gas problem involve looking for ways to reduce emissions. But these are palliative at best, and at worst will allow the problem to get out of hand. It is only through sequestration of atmospheric carbon that the problem can be solved. Carbon-negative biofuels represent the first potentially huge assault on the problem, in ways that are already technically feasible and practicable. The key to carbon negativity is to see it not as technically determined but as an issue of strategic choice, whereby farmers and fuel producers can decide how much carbon to return to the soil. Biochar amendment to the soil not only sequesters carbon but also enhances the fertility and vitality of the soil. The time is approaching when biofuels will be carbon negative by definition, and, as such, they will sweep away existing debates over their contribution to the solution of global warming. (author)

  14. Synthesis of F-18 labeled raloxifene derivative

    International Nuclear Information System (INIS)

    Raloxifene, [6-hydroxy-2-(4-hydroxy-phenyl) benzo [b] thiophen-3-yl]-[4-(2-piperidin-1-yl-ethoxy)phenyl] methanone, a tissue-selective estrogen mixed agonist/antagonist, classified as a selective estrogen receptor modulator (SERM), is currently under clinical evaluation for the prevention and treatment of postmenopausal osteoporosis, breast cancer, uterine dysfunction, and other disorders of the female reproductive system. Based on SAR studies of substituted raloxifenes, we synthesized 3 kinds of fluoroalkylated raloxifene derivatives. These compounds show high relative binding affinities (RBA) to the estrogen receptor in vitro (RBA of estradiol = 100%). The RBA values for compounds 1, 2 and 3 are 89, 60, and 45%, respectively, which are all higher than that of raloxifene itself (34%). Among these compounds, we selected to take the best RBA value one and F-18 labeled. Using 2 kinds of labeling method ; 1) Radiolabeling using [18F]KF was carried out in anhydrous acetonitrile for 10 min at 120 .deg. C. 2) Radiolabeling using [18F]KF was carried out in anhydrous acetonitrile for 15 min at 120 .deg. C in ionic liquid, [bmim][OTf]. Deprotection step added 1N HCl and reacted for 3 min at 120 .deg. C. [18F]Fluoroethyl raloxifene derivative obtained 5-23% decay corrected labeling yield by HPLC system (C18 xterra, 10 i, 34% Acetonitrile/0.1 M formate buffer, flow rate: 4 mL/1 min, collection time : 28-29 min) and total time was around 70 min. Fluoroethyl raloxifene derivative has the best RBA value among the other synthesized derivatives and chose it for radiolabeling. [18F]Fluoroethyl raloxifene derivative prepared 5-23% decay corrected labeling yield. This preparation is on going for labeling optimizing and preparing of in vitro and in vivo test

  15. Synthesis of F-18 labeled raloxifene derivative

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K. C.; Moon, B. S.; Jun, K. S. [KIRAMS, Seoul (Korea, Republic of); Lee, J. H.; Ji, D. Y. [Inha University, Incheon (Korea, Republic of)

    2005-07-01

    Raloxifene, [6-hydroxy-2-(4-hydroxy-phenyl) benzo [b] thiophen-3-yl]-[4-(2-piperidin-1-yl-ethoxy)phenyl] methanone, a tissue-selective estrogen mixed agonist/antagonist, classified as a selective estrogen receptor modulator (SERM), is currently under clinical evaluation for the prevention and treatment of postmenopausal osteoporosis, breast cancer, uterine dysfunction, and other disorders of the female reproductive system. Based on SAR studies of substituted raloxifenes, we synthesized 3 kinds of fluoroalkylated raloxifene derivatives. These compounds show high relative binding affinities (RBA) to the estrogen receptor in vitro (RBA of estradiol = 100%). The RBA values for compounds 1, 2 and 3 are 89, 60, and 45%, respectively, which are all higher than that of raloxifene itself (34%). Among these compounds, we selected to take the best RBA value one and F-18 labeled. Using 2 kinds of labeling method ; 1) Radiolabeling using [{sup 18}F]KF was carried out in anhydrous acetonitrile for 10 min at 120 .deg. C. 2) Radiolabeling using [{sup 18}F]KF was carried out in anhydrous acetonitrile for 15 min at 120 .deg. C in ionic liquid, [bmim][OTf]. Deprotection step added 1N HCl and reacted for 3 min at 120 .deg. C. [{sup 18}F]Fluoroethyl raloxifene derivative obtained 5-23% decay corrected labeling yield by HPLC system (C18 xterra, 10 i, 34% Acetonitrile/0.1 M formate buffer, flow rate: 4 mL/1 min, collection time : 28-29 min) and total time was around 70 min. Fluoroethyl raloxifene derivative has the best RBA value among the other synthesized derivatives and chose it for radiolabeling. [{sup 18}F]Fluoroethyl raloxifene derivative prepared 5-23% decay corrected labeling yield. This preparation is on going for labeling optimizing and preparing of in vitro and in vivo test.

  16. The effect of soil fauna on carbon sequestration in soil

    Czech Academy of Sciences Publication Activity Database

    Frouz, Jan; Pižl, Václav; Kaneda, Satoshi; Šimek, Miloslav

    2008-01-01

    Roč. 10, - (2008). ISSN 1029-7006. [EGU General Assembly 2008. 13.04.2008-18.04.2008, Vienna] Institutional research plan: CEZ:AV0Z60660521 Keywords : soil fauna * carbon sequestration * soil Subject RIV: EH - Ecology, Behaviour

  17. Novel carborane based inhibitors of carbonic anhydrase IX

    Czech Academy of Sciences Publication Activity Database

    Štěpánková, J.; Řezáčová, Pavlína; Brynda, Jiří; Harvanová, M.; Mašek, V.; Nová, A.; Siller, M.; Das, V.; Doležal, D.; Grüner, Bohumír; Šícha, Václav; Konečný, P.; Znojek, P.; Džubák, P.; Hajdúch, M.

    2015-01-01

    Roč. 75, 15 Suppl (2015), s. 4492. ISSN 0008-5472. [Annual Meeting of the American Association for Cancer Research (AACR) /106./. 18.04.2015-22.04.2015, Philadelphia] Institutional support: RVO:61388963 ; RVO:61388980 Keywords : carbonic anhydrase * carborane based inhibitors Subject RIV: CE - Biochemistry

  18. Carbon monoxide poisoning

    OpenAIRE

    Dolan, Michael C.

    1985-01-01

    Carbon monoxide poisoning is a significant cause of illness and death. Its protean symptoms probably lead to a gross underestimation of its true incidence. Low levels of carbon monoxide aggravate chronic cardiopulmonary problems, and high levels are associated with cardiac arrhythmias and cerebral edema. Patients who survive acute poisoning are at risk of delayed neurologic sequelae. The measurement of carboxyhemoglobin levels does not reveal the tissue levels of carbon monoxide but is useful...

  19. The carbon dioxide cycle

    Science.gov (United States)

    James, P.B.; Hansen, G.B.; Titus, T.N.

    2005-01-01

    The seasonal CO2 cycle on Mars refers to the exchange of carbon dioxide between dry ice in the seasonal polar caps and gaseous carbon dioxide in the atmosphere. This review focuses on breakthroughs in understanding the process involving seasonal carbon dioxide phase changes that have occurred as a result of observations by Mars Global Surveyor. ?? 2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

  20. Carbon monoxide poisoning (acute)

    OpenAIRE

    Olson, Kent; Smollin, Craig

    2010-01-01

    The main symptoms of carbon monoxide poisoning are non-specific in nature and relate to effects on the brain and heart. The symptoms correlate poorly with serum carboxyhaemoglobin levels. People with comorbidity, elderly or very young people, and pregnant women are most susceptible.Carbon monoxide is produced by the incomplete combustion of carbon fuels, including inadequately ventilated heaters and car exhausts, or from chemicals such as methylene chloride paint stripper.Poisoning is cons...

  1. Carbon nanotubes decorating methods

    OpenAIRE

    A.D. Dobrzańska-Danikiewicz; D. Łukowiec; D. Cichock; W. Wolany

    2013-01-01

    Purpose: The work is to present and characterise various methods of depositing carbon nanotubes with nanoparticles of precious metals, and also to present the results of own works concerning carbon nanotubes coated with platinum nanoparticles.Design/methodology/approach: Electron transmission and scanning microscopy has been used for imaging the structure and morphology of the nanocomposites obtained and the distribution of nanoparticles on the surface of carbon nanotubes.Findings: The studie...

  2. Functionalization of Carbon Nanotubes

    OpenAIRE

    Abraham, Jürgen

    2005-01-01

    Carbon nanotubes have an enormous potential due to their outstanding electronic, optical, and mechanical properties. However, any technological application is still hindered due to problems regarding the processibility of the pristine carbon nanotubes. In the past few years, it has been shown that the chemical modification of the carbon nanotubes is an inevitable step prior to their application. The first part of this work (chapter 3.1) was focused on the purification of pristine laser ablati...

  3. Abundances in red giant stars - Carbon and oxygen isotopes in carbon-rich molecular envelopes

    Science.gov (United States)

    Wannier, P. G.; Sahai, R.

    1987-01-01

    Millimeter-wave observations have been made of isotopically substituted CO toward the envelopes of 11 carbon-rich stars. In every case, C-13O was detected and model calculations were used to estimate the C-12/C-13 abundance ratio. C-17O was detected toward three, and possibly four, envelopes, with sensitive upper limits for two others. The CO-18 variant was detected in two envelopes. New results include determinations of oxygen isotopic ratios in the two carbon-rich protoplanetary nebulae CRL 26688 and CRL 618. As with other classes of red giant stars, the carbon-rich giants seem to be significantly, though variably, enriched in O-17. These results, in combination with observations in interstellar molecular clouds, indicate that current knowledge of stellar production of the CNO nuclides is far from satisfactory.

  4. Physics of carbon nanostructures

    International Nuclear Information System (INIS)

    Carbon is a prominent element that appears in various structures with new promising technological applications. The physics of carbon nanostructures is one of the hot topics in modern condensed matter theory. I plan to present a brief introduction into the theory of variously shaped carbon nanostructures paying special attention to generic field-theory models. The preliminary plan is the following: (1) a brief historical excursus, (2) the most interesting experimental observations, (3) generic models for the description of electronic states in carbon nanoparticles (Dirac-type equations, defects, geometry, etc.), (4) open problems. (author)

  5. Carbon Trading. Literature Overview

    International Nuclear Information System (INIS)

    From Pigou and Coase to the Kyoto Protocol, carbon trading has resulted in pricing of the negative externalities emanating from pollution. This report highlights leading literature and empirical findings on carbon trading, amongst others addressing the relevant carbon and related markets, the (lack of) success of carbon trading so far and room for improvement as well as its impact on investments in emission reduction. This report is part of a set of SEO-reports on finance and sustainability. The other reports deal with: Financing the Transition to Sustainable Energy; Innovations in financing environmental and social sustainability; and Sustainable investment.

  6. Nanoindentation of Carbon Nanostructures.

    Science.gov (United States)

    Kumar, Dinesh; Singh, Karamjit; Verma, Veena; Bhatti, H S

    2016-06-01

    In the present research paper carbon nanostructures viz. single walled carbon nanotubes, multi-walled carbon nanotubes, single walled carbon nanohorns and graphene nanoplatelets have been synthesized by CVD technique, hydrothermal method, DC arc discharge method in liquid nitrogen and microwave technique respectively. After synthesis 5 mm thick pallets of given nanomaterial are prepared by making a paste in isopropyl alcohol and using polyvinylidene difluoride as a binder and then these pallets were used for nanoindentation measurements. Hardness, reduced modulus, stiffness, contact height and contact area have been measured using nanoindenter. PMID:27427726

  7. Carbon Monoxide Toxicity

    Science.gov (United States)

    Aniol, Michael J.

    1992-01-01

    Of all fatal poisonings in the United States, an estimated half are due to carbon monoxide. The number of non-lethal poisonings due to carbon monoxide is difficult to estimate because signs and symptoms of carbon monoxide poisoning cover a wide spectrum and mimic other disorders. Misdiagnosis is serious, as the patient often returns to the contaminated environment. Those not receiving proper treatment are at significant risk, as high as 10% to 12%, of developing late neurological sequelae. The diagnosis of carbon monoxide poisoning depends upon precise history taking, careful physical examination, and a high index of suspicion. ImagesFigure 2 PMID:21221282

  8. Changing global carbon cycle

    International Nuclear Information System (INIS)

    Full text: The increase in atmospheric carbon dioxide (C02) is the single largest human perturbation on the earth's radiative balance contributing to climate change. Its rate of change reflects the balance between anthropogenic carbon emissions and the dynamics of a number of terrestrial and ocean processes that remove or emit C02. It is the long term evolution of this balance that will determine to large extent the speed and magnitude of the human induced climate change and the mitigation requirements to stabilise atmospheric C02 concentrations at any given level. In this talk, we show new trends in global carbon sources and sinks, with particularly focus on major shifts occurring since 2000 when the growth rate of atmospheric C02 has reached its highest level on record. The acceleration in the C02 growth results from the combination of several changes in properties of the carbon cycle, including: acceleration of anthropogenic carbon emissions; increased carbon intensity of the global economy, and decreased efficiency of natural carbon sinks. We discuss in more detail some of the possible causes of the reduced efficiency of natural carbon sinks on land and oceans, such as the decreased net sink in the Southern Ocean and on terrestrial mid-latitudes due to world-wide occurrence of drought. All these changes reported here characterise a carbon cycle that is generating stronger than expected climate forcing, and sooner than expected

  9. Fluorine-18 radiopharmaceuticals beyond [{sup 18}F]FDG for use in oncology and neurosciences

    Energy Technology Data Exchange (ETDEWEB)

    Coenen, H.H. [Institut fuer Neurowissenschaften und Medizin, INM-5: Institut fuer Nuklearchemie, Forschungszentrum Juelich GmbH, D-52425 Juelich (Germany); Elsinga, P.H. [Nuclear Medicine and Molecular Imaging, University Medical Center Groningen, Hanzeplein 1, Groningen (Netherlands); Iwata, R. [Cyclotron and Radioisotope Center, Tohoku University, Aramaki, Aoba-ku, Sendai 980-8578 (Japan); Kilbourn, M.R. [Division of Nuclear Medicine, Department of Radiology, University of Michigan Medical School, 2276 Medical Science I Building, Ann Arbor, MI 48109 (United States); Pillai, M.R.A., E-mail: m.r.a.pillai@iaea.or [Department of Nuclear Sciences and Applications, International Atomic Energy Agency, Wagramer Strasse 5, A-1400 Vienna (Austria); Rajan, M.G.R. [Radiation Medicine Centre, Bhabha Atomic Research Centre, TMH Annexe, Parel, Mumbai 400012 (India); Wagner, H.N. [School of Hygiene and Public Health, The Johns Hopkins University, Baltimore, Maryland 21205-2179 (United States); Zaknun, J.J. [Department of Nuclear Sciences and Applications, International Atomic Energy Agency, Wagramer Strasse 5, A-1400 Vienna (Austria)

    2010-10-15

    Positron emission tomography (PET) is a rapidly expanding clinical modality worldwide thanks to the availability of compact medical cyclotrons and automated chemistry for the production of radiopharmaceuticals. There is an armamentarium of fluorine-18 ({sup 18}F) tracers that can be used for PET studies in the fields of oncology and neurosciences. However, most of the {sup 18}F-tracers other than 2-deoxy-2-[18F]fluoro-D-glucose (FDG) are in less than optimum human use and there is considerable scope to bring potentially useful {sup 18}F-tracers to clinical investigation stage. The International Atomic Energy Agency (IAEA) convened a consultants' group meeting to review the current status of {sup 18}F-based radiotracers and to suggest means for accelerating their use for diagnostic applications. The consultants reviewed the developments including the synthetic approaches for the preparation of {sup 18}F-tracers for oncology and neurosciences. A selection of three groups of {sup 18}F-tracers that are useful either in oncology or in neurosciences was done based on well-defined criteria such as application, lack of toxicity, availability of precursors and ease of synthesis. Based on the recommendations of the consultants' group meeting, IAEA started a coordinated research project on 'Development of {sup 18}F radiopharmaceuticals (beyond [{sup 18}F]FDG) for use in oncology and neurosciences' in which 14 countries are participating in a 3-year collaborative program. The outcomes of the coordinated research project are expected to catalyze the wider application of several more {sup 18}F-radiopharmaceuticals beyond FDG for diagnostic applications in oncology and neurosciences.

  10. Carbonic anhydrase inhibitors: Design, synthesis and structural characterization of new heteroaryl-N-carbonylbenzenesulfonamides targeting druggable human carbonic anhydrase isoforms

    Czech Academy of Sciences Publication Activity Database

    Buemi, M. R.; De Luca, L.; Ferro, S.; Bruno, E.; Ceruso, M.; Supuran, C. T.; Pospíšilová, K.; Brynda, Jiří; Řezáčová, Pavlína; Gitto, R.

    2015-01-01

    Roč. 102, Sep 18 (2015), s. 223-232. ISSN 0223-5234 Institutional support: RVO:61388963 Keywords : human carbonic anhydrase * isoquinoline * quinoline * X-ray * molecular docking Subject RIV: CE - Biochemistry Impact factor: 3.447, year: 2014

  11. Expression of IL-18, IL-18 Binding Protein, and IL-18 Receptor by Normal and Cancerous Human Ovarian Tissues: Possible Implication of IL-18 in the Pathogenesis of Ovarian Carcinoma

    Directory of Open Access Journals (Sweden)

    Liat Medina

    2014-01-01

    Full Text Available Proinflammatory cytokine IL-18 has been shown to be elevated in the sera of ovarian carcinoma patients. The aim of the study was to examine the levels and cellular origin of IL-18, IL-18 binding protein, and IL-18 receptor in normal and cancerous ovarian tissues. Ovarian tissue samples were examined by immunohistochemical staining for IL-18, IL-18BP, and IL-18R and mRNA of these cytokines was analyzed with semiquantitative PT-PCR. IL-18 levels were significantly higher in cancerous ovarian tissues (P=0.0007, IL-18BP levels were significantly higher in normal ovarian tissues (P=0.04, and the ratio of IL-18/IL-18BP was significantly higher in cancerous ovarian tissues (P=0.036. Cancerous ovarian tissues expressed significantly higher IL-18 mRNA levels (P=0.025, while there was no difference in the expression of IL-18BP mRNA and IL-18R mRNA between cancerous and normal ovarian tissues. IL-18 and IL-18BP were expressed dominantly in the epithelial cells of both cancerous and normal ovarian tissues, while IL-18R was expressed dominantly in the epithelial cells of cancerous ovarian tissues but expressed similarly in the epithelial and stromal cells of normal cancerous tissues. This study indicates a possible role of IL-18, IL-18BP, and IL-18R in the pathogenesis of epithelial ovarian carcinoma.

  12. Evaporation induced 18O and 13C enrichment in lake systems: A global perspective on hydrologic balance effects

    Science.gov (United States)

    Horton, Travis W.; Defliese, William F.; Tripati, Aradhna K.; Oze, Christopher

    2016-01-01

    Growing pressure on sustainable water resource allocation in the context of global development and rapid environmental change demands rigorous knowledge of how regional water cycles change through time. One of the most attractive and widely utilized approaches for gaining this knowledge is the analysis of lake carbonate stable isotopic compositions. However, endogenic carbonate archives are sensitive to a variety of natural processes and conditions leaving isotopic datasets largely underdetermined. As a consequence, isotopic researchers are often required to assume values for multiple parameters, including temperature of carbonate formation or lake water δ18O, in order to interpret changes in hydrologic conditions. Here, we review and analyze a global compilation of 57 lacustrine dual carbon and oxygen stable isotope records with a topical focus on the effects of shifting hydrologic balance on endogenic carbonate isotopic compositions. Through integration of multiple large datasets we show that lake carbonate δ18O values and the lake waters from which they are derived are often shifted by >+10‰ relative to source waters discharging into the lake. The global pattern of δ18O and δ13C covariation observed in >70% of the records studied and in several evaporation experiments demonstrates that isotopic fractionations associated with lake water evaporation cause the heavy carbon and oxygen isotope enrichments observed in most lakes and lake carbonate records. Modeled endogenic calcite compositions in isotopic equilibrium with lake source waters further demonstrate that evaporation effects can be extreme even in lake records where δ18O and δ13C covariation is absent. Aridisol pedogenic carbonates show similar isotopic responses to evaporation, and the relevance of evaporative modification to paleoclimatic and paleotopographic research using endogenic carbonate proxies are discussed. Recent advances in stable isotope research techniques present unprecedented

  13. Carbon and oxygen isotope study of carbonates from highly shocked clasts of the polymict breccia of the Haughton Crater (Canada)

    Science.gov (United States)

    Agrinier, P.; Martinez, I.; Javoy, M.; Schaerer, U.

    1992-01-01

    It is known that the release of volatiles on impact is an important controlling factor in cratering processes in carbonate terranes and in the mobility of chemical elements. In order to assess the nature and the role of carbon- and oxygen-bearing volatiles during impact-induced metamorphism of sedimentary rocks, the C-13/C-12 and O-18/O-16 ratios and carbonate contents were determined for 30 shocked clasts from the Haughton Crater polymict breccia as well as for some unshocked carbonates from the sedimentary cover adjacent to the crater. Shock-induced CO2 loss during decarbonation of calcite is known to be a function of peak pressure and ambient partial pressure of the volatile species. In our clast samples, shocked from 20 to 60 GPa, we expect about 20 to 100 percent CO2 loss and preferential depletion in C-13 and O-18 in the residual carbonate. Rayleigh model (progressive loss of CO2) and batch model (single-step loss of CO2) curves for this depletion are shown. The magnitudes of the C-13 and O-18 depletions increase with the increase of the CO2 loss. In addition, the isotopic depletions should be correlated with an enrichment in CaO and MgO in the residual solid.

  14. Investigating carbonate formation in urban soils as a method for capture and storage of atmospheric carbon.

    Science.gov (United States)

    Washbourne, C-L; Renforth, P; Manning, D A C

    2012-08-01

    This paper investigates the potential for engineered urban soils to capture and store atmospheric carbon (C). Calcium (Ca) and magnesium (Mg) bearing waste silicate minerals within the soil environment can capture and store atmospheric C through the process of weathering and secondary carbonate mineral precipitation. Anthropogenic soils, known to contain substantial quantities of Ca and Mg-rich minerals derived from demolition activity (particularly cement and concrete), were systematically sampled at the surface across a 10 ha brownfield site, Science Central, located in the urban centre of Newcastle upon Tyne, U.K. Subsequent analysis yielded average carbonate contents of 21.8±4.7% wt CaCO(3). Isotopic analysis demonstrated δ(18)O values between -9.4‰ and -13.3‰ and δ(13)C values between -7.4‰ and -13.6‰ (relative to Pee Dee Belemnite), suggesting that up to 39.4±8.8% of the carbonate C has been captured from the atmosphere through hydroxylation of dissolved CO(2) in high pH solutions. The remaining carbonate C is derived from lithogenic sources. 37.4 kg of atmospheric CO(2) has already been captured and stored as carbonate per Mg of soil across the site, representing a carbon dioxide (CO(2)) removal rate of 12.5 kg CO(2) Mg(-1) yr(-1). There is the potential for capture and storage of a further 27.3 kg CO(2) Mg(-1) in residual reactive materials, which may be exploited through increased residence time (additional in situ weathering). Overall, the Science Central site has the potential to capture and store a total of 64,800 Mg CO(2) as carbonate minerals. This study illustrates the potential for managing urban soils as tools of C capture and storage, an important ecosystem service, and demonstrates the importance of studying C storage in engineering urban anthropogenic soils. PMID:22683756

  15. 18 CFR 154.3 - Effective tariff.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Effective tariff. 154.3... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT RATE SCHEDULES AND TARIFFS General Provisions and Conditions § 154.3 Effective tariff. (a) The effective tariff of a natural gas company is the tariff...

  16. 18 CFR 341.6 - Adoption rule.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Adoption rule. 341.6... SUBJECT TO SECTION 6 OF THE INTERSTATE COMMERCE ACT § 341.6 Adoption rule. (a) Change in name of carrier... such occurrence. The filing of adoption notices and adoption supplements requires no notice period....

  17. 38 CFR 18.445 - Housing.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Housing. 18.445 Section....445 Housing. (a) Housing provided by a recipient. A recipient that provides housing to its nonhandicapped students shall provide comparable, convenient, and accessible housing to qualified...

  18. 18 CFR 1317.405 - Housing.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Housing. 1317.405... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 1317.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except...

  19. 18 CFR 420.43 - Exempt use.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Exempt use. 420.43... MANUAL BASIN REGULATIONS-WATER SUPPLY CHARGES Charges; Exemptions § 420.43 Exempt use. The following uses shall be exempt from charge: (a) Non-consumptive uses of less than 1,000 gallons during any day,...

  20. 18 CFR 420.45 - Historical use.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Historical use. 420.45... MANUAL BASIN REGULATIONS-WATER SUPPLY CHARGES Charges; Exemptions § 420.45 Historical use. A person who or which could not for any reason use, take, withdraw or divert waters of the basin from the place...

  1. 7 CFR 1230.18 - Porcine animal.

    Science.gov (United States)

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PORK PROMOTION, RESEARCH, AND CONSUMER INFORMATION Pork Promotion, Research, and Consumer Information Order Definitions § 1230.18 Porcine... purposes as seed stock and included in the breeding herd; and (c) a market hog, slaughtered by the...

  2. 18 CFR 420.44 - Cooling water.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Cooling water. 420.44 Section 420.44 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL BASIN REGULATIONS-WATER SUPPLY CHARGES Charges; Exemptions § 420.44 Cooling water. Water...

  3. 18 CFR 701.100 - Field Directors.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Field Directors. 701... ORGANIZATION Field Organization § 701.100 Field Directors. The Council may employ as professional staff Field Directors who shall be designated as chairmen of committees or groups established by the Council to...

  4. 18 CFR 801.0 - Introduction.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Introduction. 801.0... POLICIES § 801.0 Introduction. (a) The Governors of the States of New York, Pennsylvania, and Maryland, and...) The Commission shall employ a multiobjective approach recognizing national economy,...

  5. 18 CFR 801.10 - Recreation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Recreation. 801.10... POLICIES § 801.10 Recreation. (a) The use of surface water resources of the basin for recreation purposes... private agencies in the planning and development of water-related recreation and fish and...

  6. 18 CFR 157.202 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... facilities. (7) Project means a unit of improvement or construction that is used and useful upon completion... appurtenant facilities, such as heaters, minor gas conditioning, treatment, odorization, and similar equipment... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions....

  7. 18 CFR 39.11 - Reliability reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reliability reports. 39... RELIABILITY ORGANIZATION; AND PROCEDURES FOR THE ESTABLISHMENT, APPROVAL, AND ENFORCEMENT OF ELECTRIC RELIABILITY STANDARDS § 39.11 Reliability reports. (a) The Electric Reliability Organization shall...

  8. 18th informal meeting on reactor noise

    International Nuclear Information System (INIS)

    The proceedings contain the texts of 24 papers all of which fall under the INIS Subject Scope. The main purpose of the meeting of more than 90 scientists and specialists from 18 countries was for them to get acquainted with the current state and prospective development of noise diagnostics application in nuclear reactor operation. (Z.M.)

  9. 18 CFR 3b.223 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Fees. 3b.223 Section 3b... INFORMATION Rules for Disclosure of Records § 3b.223 Fees. (a) Fees will be charged for the direct cost of... the records. Any person may obtain a copy of the Commission's schedule of fees by telephone, by...

  10. 18 CFR 806.35 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 806.35 Section... APPROVAL OF PROJECTS Terms and Conditions of Approval § 806.35 Fees. Project sponsors shall have an affirmative duty to pay such fees as established by the Commission....

  11. 18 CFR 401.110 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 401.110 Section... MANUAL RULES OF PRACTICE AND PROCEDURE Public Access to Records and Information § 401.110 Fees. (a) Unless waived in accordance with the provisions of § 401.111, the following fees shall be imposed...

  12. 18 CFR 1301.21 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 1301.21 Section... § 1301.21 Fees. (a) Fees to be charged, if any, to any individual for making copies of his or her record exclude the cost of any search and review of the record. The following fees are applicable: (1)...

  13. 18 CFR 701.312 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 701.312 Section... Protection of Privacy § 701.312 Fees. (a) The Council will not charge an individual for the costs of making a... disclosing the record to the individual), the Council will charge a maximum fee of $0.25 per page...

  14. 18 CFR 401.113 - Segregable materials.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Segregable materials. 401.113 Section 401.113 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION... Segregable materials. Any reasonably segregable portion of a record shall be provided to any...

  15. 18 CFR 1304.203 - Vegetation management.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Vegetation management...-Owned Residential Access Shoreland § 1304.203 Vegetation management. No vegetation management shall be approved on TVA-owned Residential Access Shoreland until a Vegetation Management Plan meeting...

  16. 18 CFR 401.122 - Supplementary details.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Supplementary details. 401.122 Section 401.122 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE General Provisions § 401.122 Supplementary details....

  17. 18 CFR 807.1 - Requirement.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Requirement. 807.1... WITHDRAWAL REGISTRATION § 807.1 Requirement. In addition to any other requirements of Commission regulations, and subject to the consent of the affected member state to this requirement, any person withdrawing...

  18. 18 CFR 286.105 - Shortened procedure.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Shortened procedure. 286.105 Section 286.105 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... facts and applicable law that support the position or positions taken regarding the matters at...

  19. 18 CFR 1317.310 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Recruitment. 1317.310... Discrimination on the Basis of Sex in Admission and Recruitment Prohibited § 1317.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 1317.300 through 1317.310 apply shall not discriminate on...

  20. 18 CFR 1317.510 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Recruitment. 1317.510... Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees. Where a recipient has been found to be...

  1. 18 CFR 1300.104 - Sexual harassment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Sexual harassment. 1300... CONDUCT FOR EMPLOYEES OF TENNESSEE VALLEY AUTHORITY § 1300.104 Sexual harassment. It is TVA policy that all TVA employees are responsible for assuring that the workplace is free from sexual...

  2. 18 CFR 807.2 - Time limits.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Time limits. 807.2... WITHDRAWAL REGISTRATION § 807.2 Time limits. (a) Except for agricultural water use projects, all registration... limit the responsibility of a project sponsor to apply for and obtain an approval as may be...

  3. 38 CFR 18.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... III of Executive Order 11246 (3 CFR Chapter IV) or any Executive order which supersedes it. (2) In... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... THE CIVIL RIGHTS ACT OF 1964 General § 18.3 Discrimination prohibited. (a) General. No person in...

  4. 18 CFR 705.4 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Discrimination... Discrimination prohibited. (a) General. No person in the United States shall, on the grounds of race, color, or... discrimination under, any program to which this part applies. (b) Specific discriminatory actions prohibited....

  5. 18 CFR 8.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Discrimination prohibited. 8.3 Section 8.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... LICENSED PROJECTS § 8.3 Discrimination prohibited. Every licensee maintaining recreation facilities for...

  6. 18 CFR 801.7 - Water quality.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Water quality. 801.7... POLICIES § 801.7 Water quality. (a) The signatory States have the primary responsibility in the basin for water quality management and control. However, protection of the water resources of the basin...

  7. 38 CFR 18b.52 - Testimony.

    Science.gov (United States)

    2010-07-01

    ... testimony of any witness be prepared in writing and served on all parties in advance of the hearing. Such testimony may be adopted by the witness at the hearing, and filed as part of the record thereof. Unless... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Testimony. 18b.52...

  8. 7 CFR 29.2634 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.2634 Rule 18. Any lot of tobacco containing 20 percent or more of green leaves or any lot which is not crude but contains 20 percent or more of green and crude combined shall...

  9. 7 CFR 29.3619 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Rule 18. 29.3619 Section 29.3619 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... as “mixed” and designated by the color symbol “M” when it is not green but contains (a) over...

  10. 7 CFR 29.3121 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.3121 Rule 18. Any lot of tobacco containing 20 percent or more of green leaves, or any lot which is not crude but contains 20 percent or more of green and crude combined,...

  11. 7 CFR 29.2409 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.2409 Rule 18. Any lot of tobacco containing 20 percent or more of green leaves or any lot which is not crude but contains 20 percent or more of green and crude combined shall...

  12. 18 CFR 1304.408 - Variances.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Variances. 1304.408 Section 1304.408 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY APPROVAL OF... § 1304.408 Variances. The Vice President or the designee thereof is authorized, following...

  13. 18 CFR 154.106 - Map.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Map. 154.106 Section....106 Map. (a) The map must show the general geographic location of the company's principal pipeline... on a single map. In addition, a separate map should be provided for each zone. (b) (c) The map...

  14. 18 CFR 50.4 - Stakeholder participation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Stakeholder... ELECTRIC TRANSMISSION FACILITIES § 50.4 Stakeholder participation. A Project Participation Plan is required to ensure stakeholders have access to accurate and timely information on the proposed project...

  15. 18 CFR 367.81 - Maintenance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Maintenance. 367.81... Expense Instructions § 367.81 Maintenance. (a) The cost of maintenance chargeable to the various operating... maintenance work. A list of work operations applicable generally to service company property is included...

  16. 18 CFR 806.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... upon the drilling (spudding) of a gas well, or the initiation of construction of any water impoundment... drilling pad upon which one or more exploratory or production wells are undertaken, and all water-related... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Definitions....

  17. Project 18. (Student and Teacher Booklets.)

    Science.gov (United States)

    Lower Merion Township School District, Ardmore, PA.

    Three separate teacher and student books for the Project 18 course are included in this packet. The objective is to help students develop a positive attitude and to motivate them toward political participation. Teaching strategies for six sections, which run the gamut from simulation to lecture, focus on practical politics. The six sections are as…

  18. 18 CFR 367.57 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Equipment. 367.57... Property Instructions § 367.57 Equipment. (a) The cost of equipment chargeable to the service company property accounts, unless otherwise indicated in the text of an equipment account, includes the related...

  19. 18 CFR 801.1 - Standard definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Standard definitions... GENERAL POLICIES § 801.1 Standard definitions. (a) Many terms that will be used in official Commission... clarity of the meaning the Commission applies to frequently used terms standard definitions will...

  20. 18 CFR 801.11 - Public values.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Public values. 801.11... POLICIES § 801.11 Public values. (a) The basin has many points of archeological and historic interest, and... value of these areas cannot be measured simply in economic terms and will strive to preserve and...

  1. 18 CFR 4.10 - Valuation data.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Valuation data. 4.10 Section 4.10 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF... Valuation data. (a) Notification of Commission. In every case arising under section 23(a) of the...

  2. 38 CFR 18.421 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... Accessibility § 18.421 Discrimination prohibited. No qualified handicapped person shall, because a recipient's... from participation in, or otherwise be subjected to discrimination under any program or activity...

  3. 38 CFR 18.404 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... Provisions § 18.404 Discrimination prohibited. (a) General. No qualified handicapped person shall, on the... subjected to discrimination under any program or activity which receives Federal financial assistance....

  4. 38 CFR 18.411 - Discrimination prohibited.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discrimination prohibited... Practices § 18.411 Discrimination prohibited. (a) General. (1) No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity to...

  5. 18 CFR 1317.525 - Fringe benefits.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fringe benefits. 1317... benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital, accident, life insurance, or retirement benefit, service, policy or plan,...

  6. 18 CFR 301.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 CFR 141.1. Functionalization. The process of assigning a Utility's costs, debits, credits, and.... Commission. Federal Energy Regulatory Commission. Consumer-owned Utility. A public body or cooperative that is eligible to purchase preference power from Bonneville under section 5(b) of the Northwest...

  7. 18 CFR 801.9 - Watershed management.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Watershed management... GENERAL POLICIES § 801.9 Watershed management. (a) The character, extent, and quality of water resources... management including soil and water conservation measures, land restoration and rehabilitation,...

  8. 18 CFR 1317.430 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Financial assistance. 1317.430 Section 1317.430 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY... parental status. (b) Financial aid established by certain legal instruments. (1) A recipient may...

  9. 18 CFR 375.103 - Official seal.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Official seal. 375.103... OF ENERGY REVISED GENERAL RULES THE COMMISSION General Provisions § 375.103 Official seal. The Commission hereby prescribes as its official seal, judicial notice of which shall be taken pursuant...

  10. 18 CFR 725.5 - Council studies.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Council studies. 725.5 Section 725.5 Conservation of Power and Water Resources WATER RESOURCES COUNCIL IMPLEMENTATION OF... Council studies. All studies and appraisals performed by the Council pursuant to section 102 of Pub. L....

  11. 18 CFR 740.6 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Financial assistance. 740.6 Section 740.6 Conservation of Power and Water Resources WATER RESOURCES COUNCIL STATE WATER... assessed by the Council. In assessing need for water management, the Council shall utilize...

  12. 18 CFR 701.51 - The Council.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false The Council. 701.51 Section 701.51 Conservation of Power and Water Resources WATER RESOURCES COUNCIL COUNCIL ORGANIZATION Headquarters Organization § 701.51 The Council. Decisions of the Council are made as hereinafter described...

  13. Familial deletion 18p syndrome: case report

    Directory of Open Access Journals (Sweden)

    Lemyre Emmanuelle

    2006-07-01

    Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.

  14. 18 CFR 157.216 - Abandonment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Abandonment. 157.216 Section 157.216 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... firm contract; or (2) A facility that did or could now qualify for automatic authorization as...

  15. Diversity in Action Workshop | 18 September

    CERN Multimedia

    CERN Diversity Programme

    2014-01-01

    Get an insight into diversity, develop greater sensitivity to differences, acquire new tools to recognise and overcome unconscious biases.   Thursday 18 September 2014 8.30 a.m. to 12.30 p.m.  Business Center Technoparc - Saint-Genis-Pouilly Registration mandatory through http://www.cern.ch/diversity

  16. 18 CFR 154.305 - Tax normalization.

    Science.gov (United States)

    2010-04-01

    ... of, and addition to, Rate Base. (1) The rate base of an interstate pipeline using tax normalization... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Tax normalization. 154... Changes § 154.305 Tax normalization. (a) Applicability. An interstate pipeline must compute the income...

  17. 18 CFR 5.3 - Process selection.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Process selection. 5.3... ENERGY REGULATIONS UNDER THE FEDERAL POWER ACT INTEGRATED LICENSE APPLICATION PROCESS § 5.3 Process selection. (a)(1) Notwithstanding any other provision of this part or of parts 4 and 16 of this chapter,...

  18. 18 CFR 401.7 - Further action.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Further action. 401.7 Section 401.7 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE Comprehensive Plan § 401.7 Further action. The Commission...

  19. 18 CFR 706.103 - Remedial action.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Remedial action. 706... RESPONSIBILITIES AND CONDUCT General Provisions § 706.103 Remedial action. (a) A violation of this part by an employee or special Government employee may be cause for remedial action. Remedial action may include,...

  20. 18 CFR 1308.37 - Decisions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Decisions. 1308.37... Prehearing and Hearing Procedures § 1308.37 Decisions. (a) The Hearing Officer's decision shall be in writing. Except as provided by § 1308.35 or 1308.36, the decision shall contain complete findings of fact...

  1. 18 CFR 4.21 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 4.21 Section 4... Reports. Representatives of the Commission will inspect the project works, engineering reports, and other..., records, and accounts of the licensee relating to the property under license, and prepare a report...

  2. 18 CFR 4.11 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 4.11 Section 4... Reports. Representatives of the Commission will inspect the project works, engineering reports, and other... report of their findings with respect to the inventory, appraisal, original cost, accrued...

  3. 18 CFR 34.10 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 34.10 Section 34.10 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF... SECURITIES OR THE ASSUMPTION OF LIABILITIES § 34.10 Reports. The applicant must file reports under §...

  4. 18 CFR 154.502 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 154.502... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT RATE SCHEDULES AND TARIFFS Refunds and Reports § 154.502 Reports. (a) When the natural gas company is required, either by a Commission order or as a part of...

  5. 18 CFR 376.102 - Organization.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Organization. 376.102... OF ENERGY REVISED GENERAL RULES ORGANIZATION, MISSION, AND FUNCTIONS; OPERATIONS DURING EMERGENCY CONDITIONS Organization, Mission, and Functions § 376.102 Organization. The Commission is established as...

  6. 18 CFR 1307.6 - Accessibility.

    Science.gov (United States)

    2010-04-01

    ... conformance with Sections 3-8 of the Uniform Federal Accessibility Standards (UFAS) (41 CFR Subpart 101-19.6... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Accessibility. 1307.6... RESPECT TO HANDICAP § 1307.6 Accessibility. (a) General. No qualified handicapped person shall,...

  7. Clean Cities Now, Vol. 18, No. 2

    Energy Technology Data Exchange (ETDEWEB)

    None

    2015-01-19

    This is version 18.2 of Clean Cities Now, the official biannual newsletter of the Clean Cities program. Clean Cities is an initiative designed to reduce petroleum consumption in the transportation sector by advancing the use of alternative and renewable fuels, fuel economy improvements, idle-reduction measures, and new technologies, as they emerge.

  8. Disseminated candidiasis 18 years after renal transplantation

    OpenAIRE

    Bismay, K.; Mathew, A.; R. Rajesh; Kurian, G.; Unni, V. N.; Kavita, R. D.; Sreehari, S.

    2012-01-01

    Although mucocutaneous candidiasis is a common infection in renal transplant recipients, disseminated candidiasis is rare. Candida pnemonia causing miliary mottling on X-ray chest with the central nervous system involvement is still rarer. We report an unusual case with disseminated candidiasis that presented 18 years after renal transplantation and improved on conventional antifungal therapy; the relevant literature is reviewed.

  9. 18 CFR 367.26 - Departmental classification.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Departmental classification. 367.26 Section 367.26 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... ACT General Instructions § 367.26 Departmental classification. Salaries and wages and all other...

  10. Reference: VSF1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available bZIP transcriptional activator VSF-1 to a regulatory element that controls xylem-specific gene expression Plant J 9:283-296 (1996) PubMed: 8919907; ... ...VSF1PVGRP18 Torres-Schumann S, Ringli C, Heierli D, Amrhein N, Keller B. In vitro binding of the tomato

  11. 18 CFR 367.20 - Depreciation accounting.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Depreciation accounting. 367.20 Section 367.20 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.20 Depreciation accounting. (a) Method. Service companies must use a method of...

  12. 18 CFR 367.5 - Accounting period.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Accounting period. 367.5 Section 367.5 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.5 Accounting period. Each service company must keep its books on a monthly basis so that...

  13. 18 CFR 381.107 - Direct billing.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Direct billing. 381.107 Section 381.107 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... the fee to the applicant to less than full cost recovery due to the presence of intervenors,...

  14. 18 CFR 35.23 - General provisions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General provisions. 35.23 Section 35.23 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... rate schedule on file that expressly provides for the recovery of all incremental or...

  15. 18 CFR 1310.1 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Purpose. 1310.1 Section 1310.1 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY ADMINISTRATIVE COST RECOVERY § 1310.1 Purpose. The purpose of the regulations in this part is to establish a schedule of...

  16. 18 CFR 1310.2 - Application.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Application. 1310.2 Section 1310.2 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY ADMINISTRATIVE COST RECOVERY § 1310.2 Application. (a) General. TVA will undertake the following actions only upon...

  17. 18 CFR 1317.300 - Admission.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Admission. 1317.300 Section 1317.300 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY NONDISCRIMINATION ON... person on the basis of pregnancy, childbirth, termination of pregnancy, or recovery therefrom,...

  18. 18 CFR 46.2 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...: Boiler/Reactor plant equipment (Accounts 312 and 322); Engines and engine driven generators (313... plant equipment (316, 325, 335 and 346); Water wheels, turbines and generators (333); Fuel holders... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions....

  19. 18 CFR 401.84 - Hearing procedure.

    Science.gov (United States)

    2010-04-01

    ... ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE Administrative and Other Hearings § 401.84 Hearing procedure. (a) Participation in the hearing. In any hearing, the person requesting the hearing shall be... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Hearing procedure....

  20. 18 CFR 401.23 - Procedure.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Procedure. 401.23 Section 401.23 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE Water Resources Program § 401.23 Procedure. Each project...

  1. 18 CFR 401.33 - Administrative agreements.

    Science.gov (United States)

    2010-04-01

    ... ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE Project Review Under Section 3.8 of the Compact § 401.33 Administrative agreements. The Executive Director is authorized and directed to enter into cooperative... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false...

  2. 38 CFR 18.6 - Compliance information.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Compliance information... THE CIVIL RIGHTS ACT OF 1964 General § 18.6 Compliance information. (a) Cooperation and assistance... compliance reports at such times, and in such form and containing such information, as the responsible...

  3. 18 CFR 3b.227 - Mailing lists.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Mailing lists. 3b.227 Section 3b.227 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... specifically authorized by law. This provision shall not be construed to require the withholding of names...

  4. 18 CFR 376.105 - Chairman.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Chairman. 376.105 Section 376.105 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Law Judges in accordance with the provisions of Title 5, United States Code. (2) The...

  5. 18 CFR 50.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions. 50.1 Section 50.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF... under Federal law in order to site a transmission facility. National interest electric...

  6. 18 CFR 375.101 - The Commission.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false The Commission. 375.101 Section 375.101 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT..., of Title 5, United States Code relating to Administrative Law Judges....

  7. 18 CFR 11.21 - Penalties.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Penalties. 11.21 Section 11.21 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... satisfied in accordance with law. The Commission may, by order, waive any penalty imposed by this...

  8. 18 CFR 375.201 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Purpose. 375.201 Section 375.201 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... provisions set forth in this subpart to the extent authorized by law....

  9. 18 CFR 1b.19 - Submissions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Submissions. 1b.19 Section 1b.19 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT..., which may consist of a statement of fact, argument, and/or memorandum of law, with such...

  10. 18 CFR 1317.540 - Advertising.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Advertising. 1317.540 Section 1317.540 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL...

  11. Digging Movie from Phoenix's Sol 18

    Science.gov (United States)

    2008-01-01

    The Surface Stereo Imager on NASA's Phoenix Mars Lander recorded the images combined into this movie of the lander's Robotic Arm enlarging and combining the two trenches informally named 'Dodo' (left) and 'Goldilocks.' The 21 images in this sequence were taken over a period of about 2 hours during Phoenix's Sol 18 (June 13, 2008), or the 18th Martian day since landing. The main purpose of the Sol 18 dig was to dig deeper for learning the depth of a hard underlying layer. A bright layer, possibly ice, was increasingly exposed as the digging progressed. Further digging and scraping in the combined Dodo-Goldilocks trench was planned for subsequent sols. The combined trench is about 20 centimeters (about 8 inches) wide. The depth at the end of the Sol 18 digging is 5 to 6 centimeters (about 2 inches). The Goldilocks trench was the source of soil samples 'Baby Bear' and 'Mama Bear,' which were collected on earlier sols and delivered to instruments on the lander deck. The Dodo trench was originally dug for practice in collecting and depositing soil samples. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  12. 18 CFR 367.12 - Payroll distribution.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Payroll distribution. 367.12 Section 367.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.12 Payroll distribution. Underlying accounting data must be maintained so that...

  13. 18 CFR 157.37 - Project design.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Project design. 157.37... Seasons for Alaska Natural Gas Transportation Projects § 157.37 Project design. In reviewing any... proposed project has been designed to accommodate the needs of shippers who have made conforming...

  14. 50 CFR 18.3 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR (CONTINUED) TAKING... marine mammals taken by Alaskan Natives for food, clothing, shelter, heating, transportation, and other... (CONTINUED) MARINE MAMMALS Introduction § 18.3 Definitions. In addition to definitions contained in section...

  15. 21 CFR 1301.18 - Research protocols.

    Science.gov (United States)

    2010-04-01

    ..., DISTRIBUTORS, AND DISPENSERS OF CONTROLLED SUBSTANCES Registration § 1301.18 Research protocols. (a) A protocol... security provisions (as proscribed in paragraph (a)(2)(vi) of this section for a research protocol) to, and... be in lieu of a research protocol to the Administration as required in paragraph (a) of this...

  16. Midway Atoll Site P18 12/4/2002 17-18M

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Onemetersquare 1 meter x 1 meter benthic substrate at Midway Atoll, site P18 28.263 N, 177.337 W, between 17 and 18 meters along a permanent transect.

  17. Oxygen-18 and deuterium labeling studies of choline oxidation by spinach and sugar beet

    International Nuclear Information System (INIS)

    Chenopods synthesize betaine by a two-step oxidation of choline: choline --> betaine aldehyde --> betaine. The pathway is chloroplastic; the first step has been shown in isolated spinach (Spinacia oleracea L.) chloroplasts to be O2- and light-dependent, the role of light being to provide reducing power (P Weigel, EA Weretilnyk, AD Hanson 1988 Plant Physiol 86: 54-60). Here, we report use of in vivo18O- and 2H-labeling in conjunction with fast atom bombardment mass spectrometry to test for two hypothetical choline-oxidizing reactions that would explain the observed requirements for O2 and reductant: a desaturase or an oxygenase. Simple syntheses for 2H3-choline, 2H3, 18O-choline, and 2H3, 18O-betaine are given. A desaturase mechanism was sought by giving choline deuterated at the 2-carbon, or choline unlabeled at this position together with 2H2O and by analyzing newly synthesized betaine. About 15% of the 2H at C-2 was lost during oxidation of choline to betaine, and about 10% of the betaine made in the presence of 50% 2H2O was monodeuterated. These small effects are more consistent with chemical exchange than with a desaturase, because 10 to 15% losses of 2H from the C-2 position also occurred if choline was converted to betaine by a purified bacterial choline oxidase. To test for an oxygenase, the incorporation of 18O from 18O2 into newly synthesized betaine was compared with that from 18O-labeled choline, in light and darkness. Incorporation of 18O from 18O-choline was readily detectable and varied from about 15 to 50% of the theoretical maximum value; the 18O losses were attributable to exchange of the intermediate betaine aldehyde with water. In darkness, incorporation of 18O from 18O2 approached that from 18O-choline, but in the light was severalfold lower, presumably due to isotopic dilution by photosynthetic 16O2. These data indicate that the chloroplast choline-oxidizing enzyme is an oxygenase. (author)

  18. Novel carbon nanostructures

    International Nuclear Information System (INIS)

    The discovery of carbon nanotubes in 1991 opened up a challenging new area of research, because they are expected to be ideal building blocks for nanoscale applications due to their extraordinary mechanical and electronic properties. Various production methods have been developed, however precise control of nanotube morphology (e.g. length, diameter) has yet to be realised, a fact which has delayed industrial exploitation. Thus a comprehensive understanding of nanotube growth is essential, and this thesis is concerned with this important problem, i.e. the controlled production of novel carbon nanomaterials. Chapter 1 surveys production methods for fullerenes, carbon nanotubes and other carbon-based materials, such as fibres, particles etc. The sophisticated tools required for this work, e.g. high resolution transmission electron microscopy (HRTEM), high resolution electron energy loss spectroscopy (HREELS), etc. are reviewed in Chapter 2. Chapter 3 describes a novel approach to carbon nanotubes, using laser etching techniques, which generates aligned tubes of uniform diameter and length. The mode of catalyst preparation, as well as the nature of the precursor, play crucial roles in this process. The preparation of modified carbon nanotubes by the pyrolysis of metallocene, e.g. ferrocene in conjunction with various hydrocarbons, is discussed in Chapter 4. Superconducting interference device measurements (SQUID) show that Fe-filled carbon nanotubes exhibit enhanced coercivities in the 430-1070 Oe range, i.e. greater than those reported for Ni and Co nanowires. Carbon nanotubes can be also modified by replacing atoms of the carbon network with nitrogen, boron or both. The creation of large arrays of nitrogen-doped carbon nanotubes, for example CNx nanofibres, as well as the formation of BxCyNz onions is described in Chapter 5. Electron irradiation of these onions generates pure carbon onions. Finally (Chapter 6), the catalytic behaviour of metal particles in different

  19. Hydrogen adsorption in doped porous carbons

    International Nuclear Information System (INIS)

    properties of doped microporous carbons (SWNTs and activated carbons). The raw nano-structured carbon materials are microporous activated carbons (BET specific surface area: 1600 m2/g), electric-arc closed-end single-walled carbon nano-tubes (SWNTs), and HiPCO SWNTs. They have been doped in the vapor phase by K, and Li (in order to obtain KC7, KC10, LiC18 SWNTs and LiC6, LiC18, KC24 activated carbons). The hydrogen adsorption-desorption isotherms of the doped activated carbons were obtained at room temperature and at 77 K, up to 3 MPa, by a volumetric method. The adsorption of D2 was studied in situ on doped nano-tubes and filaments by neutron diffraction on DIB experiment (ILL), at λ = 2.52 Angstroms, as a function of temperature [300-20 K] and pressure. Simultaneously the adsorption isotherms were recorded in the range 0-0.1 MPa [13]. Doping of microporous carbon by Li or K leads to an increase in the energy of adsorption of H2 or D2 molecules. Thus, the room temperature sorption capacities (at P≤3 MPa) can be higher than that of the raw materials after slight doping. However, the maximum H2 (or D2) storage measured at T≤ 77 K is lower than the one of pristine materials as the sites of adsorption are occupied by alkali ions inserted in the micropores [14]. The microporous adsorption sites of doped single-walled carbon nano-tubes, identified by neutron diffraction, are both the interstitial voids (in electric-arc or HiPCO tubes) in between the tubes and the central canals of the tubes (only in HiPCO tubes) [15]. We have also prepared nano-structured porous doped carbons by ball-milling carbon host materials with some dopant, such as alkali or alkaline earth metal. The new nano-porous carbons obtained by this method have been characterised and tested for their hydrogen-adsorption properties. [1] A. Chambers et al, J. Phys. Chem. B, 102, 4253, 1998; [2] A. C. Dillon et al, Nature, 386, 377, 1997; [3] J. Conard, Ann. Chim. Sci. Mat 26, 107, 2001; [4] A. Zuttel et al, Int

  20. Hydrogen adsorption in doped porous carbons

    International Nuclear Information System (INIS)

    properties of doped microporous carbons (SWNTs and activated carbons). The raw nano-structured carbon materials are microporous activated carbons (BET specific surface area: 1600 m2/g), electric-arc closed-end single-walled carbon nano-tubes (SWNTs), and HiPCO SWNTs. They have been doped in the vapour phase by K, and Li (in order to obtain KC7, KC10, LiC18 SWNTs and LiC6, LiC18, KC24 activated carbons). The hydrogen adsorption-desorption isotherms of the doped activated carbons were obtained at room temperature and at 77 K, up to 3 MPa, by a volumetric method. The adsorption of D2 was studied in situ on doped nano-tubes and nano-filaments by neutron diffraction on D1B experiment (ILL), at λ=2.52 Angstroms, as a function of temperature [300 - 20 K] and pressure. Simultaneously the adsorption isotherms were recorded in the range 0 - 0.1 MPa [13]. Doping of microporous carbon by Li or K leads to an increase in the energy of adsorption of H2 or D2 Molecules. Thus, the room temperature sorption capacities (al P≤3 MPa) can be higher than that of the raw materials after slight doping. However, the maximum H2 (or D2) storage measured at T ≤ 77 K is lower than the one of pristine Materials as the sites of adsorption are occupied by alkali ions inserted in the micropores [14]. The microporous adsorption sites of doped single-walled carbon nano-tubes, identified by neutron diffraction, are both the interstitial voids (in electric-arc or HiPCO tubes) in between the tubes and the central canals of the tubes (only in HiPCO tubes) [15]. We have also prepared nano-structured porous doped carbons by ball-milling carbon host materials with some dopant, such as alkali or alkaline earth metal. The new nano-porous carbons obtained by this method have been characterised and tested for their hydrogen-adsorption properties. References: [1]A. Chambers et al, J. Phys. Chem. B, 102, 4253,1998. [2]A. C. Dillon et al, Nature, 386, 377,1997. [3]J. Conard, Ann. Chim. Sci. Mat 26, 107, 2001. [4]A

  1. Differential binding partners of the Mis18α/β YIPPEE domains regulates the Mis18 complex recruitment to centromeres

    OpenAIRE

    Madison E. Stellfox; Isaac K. Nardi; Christina M. Knippler; Daniel R. Foltz

    2016-01-01

    The Mis18 complex specifies the site of new CENP-A nucleosome assembly by recruiting the CENP-A-specific assembly factor HJURP (Holliday junction recognition protein). The human Mis18 complex consists of Mis18α, Mis18β, and Mis18 binding protein 1 (Mis18BP1/hsKNL2). Although Mis18α and Mis18β are highly homologous proteins, we find that their conserved YIPPEE domains mediate distinct interactions that are essential to link new CENP-A deposition to existing centromeres. We find that Mis18α dir...

  2. The origin of high δ18O zircons: marbles, megacrysts, and metamorphism

    Science.gov (United States)

    Cavosie, Aaron J.; Valley, John W.; Kita, Noriko T.; Spicuzza, Michael J.; Ushikubo, Takayuki; Wilde, Simon A.

    2011-11-01

    The oxygen isotope ratios (δ18O) of most igneous zircons range from 5 to 8‰, with 99% of published values from 1345 rocks below 10‰. Metamorphic zircons from quartzite, metapelite, metabasite, and eclogite record δ18O values from 5 to 17‰, with 99% below 15‰. However, zircons with anomalously high δ18O, up to 23‰, have been reported in detrital suites; source rocks for these unusual zircons have not been identified. We report data for zircons from Sri Lanka and Myanmar that constrain a metamorphic petrogenesis for anomalously high δ18O in zircon. A suite of 28 large detrital zircon megacrysts from Mogok (Myanmar) analyzed by laser fluorination yields δ18O from 9.4 to 25.5‰. The U-Pb standard, CZ3, a large detrital zircon megacryst from Sri Lanka, yields δ18O = 15.4 ± 0.1‰ (2 SE) by ion microprobe. A euhedral unzoned zircon in a thin section of Sri Lanka granulite facies calcite marble yields δ18O = 19.4‰ by ion microprobe and confirms a metamorphic petrogenesis of zircon in marble. Small oxygen isotope fractionations between zircon and most minerals require a high δ18O source for the high δ18O zircons. Predicted equilibrium values of Δ18O(calcite-zircon) = 2-3‰ from 800 to 600°C show that metamorphic zircon crystallizing in a high δ18O marble will have high δ18O. The high δ18O zircons (>15‰) from both Sri Lanka and Mogok overlap the values of primary marine carbonates, and marbles are known detrital gemstone sources in both localities. The high δ18O zircons are thus metamorphic; the 15-25‰ zircon values are consistent with a marble origin in a rock-dominated system (i.e., low fluid(external)/rock); the lower δ18O zircon values (9-15‰) are consistent with an origin in an external fluid-dominated system, such as skarn derived from marble, although many non-metasomatized marbles also fall in this range of δ18O. High δ18O (>15‰) and the absence of zoning can thus be used as a tracer to identify a marble source for high δ18O

  3. DUODENAL WEBS: AN EXPERIENCE WITH 18 PATIENTS

    Directory of Open Access Journals (Sweden)

    Yogesh Kumar Sarin

    2012-04-01

    Full Text Available Aim: To describe the management and outcome of patients with duodenal webs, managed over a period of 12 ½ years in our unit.Methods: It is a retrospective case series of 18 patients with congenital duodenal webs, managed in our unit, between 1999 and 2011. The medical record of these patients was retrieved and analyzed for demographic details, clinical presentation, associated anomalies, and outcome. Results: The median age of presentation was 8 days (range 1 day to 1.5 years. Antenatal diagnosis was made in only 2 (11.1% patients. The commonest presentation was bilious vomiting. Associated anomalies were present in 8/18 patients, common being malrotation of gut. Down’s syndrome was seen in 2 patients and congenital heart disease in 1 patient. One patient had double duodenal webs. There was a delay in presentation of more than 5 days of life in 11/18 (61% patients. Three patients who presented beyond neonatal age group had fenestrated duodenal membranes causing partial obstruction. In addition, the diagnosis was missed in patients operated for malrotation elsewhere (n=2, imperforate anus (n=2 and esophageal atresia with tracheo-esophageal fistula (n=1. A lateral duodenotomy with excision of the obstructive membrane was done in all patients. A trans-anastomotic tube (TAT for enteral feeding was used in 8 patients The mortality rate was 4/18 (22%; the main causes being sepsis, prematurity, very low birth weight and associated congenital anomalies. The mean hospital stay for the 14 survivors was 18 days. Total parental nutrition (TPN was not given to any patient.Conclusions: Congenital duodenal webs are different as the diagnosis is often missed especially in case of perforated webs. Outcome depends upon the time of presentation and associated anomalies. The use of TAT feeding for nutritional support is an easy alternative to TPN.

  4. Method for Making a Carbon-Carbon Cylinder Block

    Science.gov (United States)

    Ransone, Phillip O. (Inventor)

    1997-01-01

    A method for making a lightweight cylinder block composed of carbon-carbon is disclosed. The use of carbon-carbon over conventional materials. such as cast iron or aluminum, reduces the weight of the cylinder block and improves thermal efficiency of the internal combustion reciprocating engine. Due to the negligible coefficient of thermal expansion and unique strength at elevated temperatures of carbon-carbon, the piston-to-cylinder wall clearance can be small, especially when the carbon-carbon cylinder block is used in conjunction with a carbon-carbon piston. Use of the carbon-carbon cylinder block has the effect of reducing the weight of other reciprocating engine components allowing the piston to run at higher speeds and improving specific engine performance.

  5. Authigenic carbonate formation at hydrocarbon seeps in continental margin sediments: A comparative study

    Science.gov (United States)

    Naehr, T.H.; Eichhubl, P.; Orphan, V.J.; Hovland, M.; Paull, C.K.; Ussler, W., III; Lorenson, T.D.; Greene, H. Gary

    2007-01-01

    Authigenic carbonates from five continental margin locations, the Eel River Basin, Monterey Bay, Santa Barbara Basin, the Sea of Okhotsk, and the North Sea, exhibit a wide range of mineralogical and stable isotopic compositions. These precipitates include aragonite, low- and high-Mg calcite, and dolomite. The carbon isotopic composition of carbonates varies widely, ranging from -60??? to +26???, indicating complex carbon sources that include 13C-depleted microbial and thermogenic methane and residual, 13C-enriched, bicarbonate. A similarly large variability of ??18O values (-5.5??? to +8.9???) demonstrates the geochemical complexity of these sites, with some samples pointing toward an 18O-enriched oxygen source possibly related to advection of 18O-enriched formation water or to the decomposition of gas hydrate. Samples depleted in 18O are consistent with formation deeper in the sediment or mixing of pore fluids with meteoric water during carbonate precipitation. A wide range of isotopic and mineralogical variation in authigenic carbonate composition within individual study areas but common trends across multiple geographic areas suggest that these parameters alone are not indicative for certain tectonic or geochemical settings. Rather, the observed variations probably reflect local controls on the flux of carbon and other reduced ions, such as faults, fluid conduits, the presence or absence of gas hydrate in the sediment, and the temporal evolution of the local carbon reservoir. Areas with seafloor carbonates that indicate formation at greater depth below the sediment-water interface must have undergone uplift and erosion in the past or are still being uplifted. Consequently, the occurrence of carbonate slabs on the seafloor in areas of active hydrocarbon seepage is commonly an indicator of exhumation following carbonate precipitation in the shallow subsurface. Therefore, careful petrographic and geochemical analyses are critical components necessary for the

  6. Carbon Stock and Carbon Cycle of Wetland Ecosystem

    OpenAIRE

    Zeng, Zhangquan; Zhang, Canming; LI, JIAO; Yang, Nan; Li, Xiquan; Niu, Yandong; Wu, Zijian

    2014-01-01

    Wetland ecosystem is an essential ecosystem in the world. Its organic carbon stock and carbon cycle are important basis of global carbon cycle researches and also major contents of global climate change researches. Researches have shown that wetland protection and restoration can promote carbon accumulation and reduce emission of greenhouse gases. This paper discussed influence of carbon stock and carbon balance of wetland ecosystem and emission of greenhouse gases, as well as the relationshi...

  7. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Consumers Businesses Contact CPSC Website Design Feedback Consumers: Español Businesses: Español , 中文 , Tiếng Việt Connect with Us : Twitter YouTube ... Safely Home / Safety Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon ...

  8. Carbon dioxide recycling

    Science.gov (United States)

    The recycling of carbon dioxide to methanol and dimethyl ether is seen to offer a substantial route to renewable and environmentally carbon neutral fuels. One of the authors has championed the “Methanol Economy" in articles and a book. By recycling ambient CO2, the authors argue ...

  9. Carbon Capture and Storage

    NARCIS (Netherlands)

    Benson, S.M.; Bennaceur, K.; Cook, P.; Davison, J.; Coninck, H. de; Farhat, K.; Ramirez, C.A.; Simbeck, D.; Surles, T.; Verma, P.; Wright, I.

    2012-01-01

    Emissions of carbon dioxide, the most important long-lived anthropogenic greenhouse gas, can be reduced by Carbon Capture and Storage (CCS). CCS involves the integration of four elements: CO 2 capture, compression of the CO2 from a gas to a liquid or a denser gas, transportation of pressurized CO 2

  10. Carbon black recovery

    International Nuclear Information System (INIS)

    A process and apparatus for recovering carbon black from hot smoke which comprises passing the smoke through a cyclone separation zone following cooling, then through aggregate filter beds and regeneration of filter beds with clean off-gas which is recycled to the carbon black reaction zone as quench

  11. Seeing the Carbon Cycle

    Science.gov (United States)

    Drouin, Pamela; Welty, David J.; Repeta, Daniel; Engle-Belknap, Cheryl A.; Cramer, Catherine; Frashure, Kim; Chen, Robert

    2006-01-01

    In this article, the authors present a classroom experiment that was developed to introduce middle school learners to the carbon cycle. The experiment deals with transfer of CO[subscript 2] between liquid reservoirs and the effect CO[subscript 2] has on algae growth. It allows students to observe the influence of the carbon cycle on algae growth,…

  12. The carbon cycle revisited

    Science.gov (United States)

    Bolin, Bert; Fung, Inez

    1992-01-01

    Discussions during the Global Change Institute indicated a need to present, in some detail and as accurately as possible, our present knowledge about the carbon cycle, the uncertainties in this knowledge, and the reasons for these uncertainties. We discuss basic issues of internal consistency within the carbon cycle, and end by summarizing the key unknowns.

  13. Amorphous iron (II) carbonate

    DEFF Research Database (Denmark)

    Sel, Ozlem; Radha, A.V.; Dideriksen, Knud;

    2012-01-01

    Abstract The synthesis, characterization and crystallization energetics of amorphous iron (II) carbonate (AFC) are reported. AFC may form as a precursor for siderite (FeCO3). The enthalpy of crystallization (DHcrys) of AFC is similar to that of amorphous magnesium carbonate (AMC) and more...

  14. Fly ash carbon passivation

    Science.gov (United States)

    La Count, Robert B; Baltrus, John P; Kern, Douglas G

    2013-05-14

    A thermal method to passivate the carbon and/or other components in fly ash significantly decreases adsorption. The passivated carbon remains in the fly ash. Heating the fly ash to about 500 and 800 degrees C. under inert gas conditions sharply decreases the amount of surfactant adsorbed by the fly ash recovered after thermal treatment despite the fact that the carbon content remains in the fly ash. Using oxygen and inert gas mixtures, the present invention shows that a thermal treatment to about 500 degrees C. also sharply decreases the surfactant adsorption of the recovered fly ash even though most of the carbon remains intact. Also, thermal treatment to about 800 degrees C. under these same oxidative conditions shows a sharp decrease in surfactant adsorption of the recovered fly ash due to the fact that the carbon has been removed. This experiment simulates the various "carbon burnout" methods and is not a claim in this method. The present invention provides a thermal method of deactivating high carbon fly ash toward adsorption of AEAs while retaining the fly ash carbon. The fly ash can be used, for example, as a partial Portland cement replacement in air-entrained concrete, in conductive and other concretes, and for other applications.

  15. Carbon Monoxide Poisoning

    Science.gov (United States)

    ... natural gas, propane, oil, and methane) burn incompletely. ** Carbon Monoxide can have different effects on people based on its concentration in the air that people breathe, and the person’s health condition.**** Each year, carbon monoxide poisoning claims approximately 480 lives and sends another ...

  16. Carbon for sensing devices

    CERN Document Server

    Tagliaferro, Alberto

    2015-01-01

    This book reveals why carbon is playing such an increasingly prominent role as a sensing material. The various steps that transform a raw material in a sensing device are thoroughly presented and critically discussed.  The authors deal with all aspects of carbon-based sensors, starting from the various hybridization and allotropes of carbon, with specific focus on micro and nanosized carbons (e.g., carbon nanotubes, graphene) and their growth processes. The discussion then moves to the role of functionalization and the different routes to achieve it. Finally, a number of sensing applications in various fields are presented, highlighting the connection with the basic properties of the various carbon allotropes.  Readers will benefit from this book’s bottom-up approach, which starts from the local bonding in carbon solids and ends with sensing applications, linking the local hybridization of carbon atoms and its modification by functionalization to specific device performance. This book is a must-have in th...

  17. Carbon Dioxide Fountain

    Science.gov (United States)

    Kang, Seong-Joo; Ryu, Eun-Hee

    2007-01-01

    This article presents the development of a carbon dioxide fountain. The advantages of the carbon dioxide fountain are that it is odorless and uses consumer chemicals. This experiment also is a nice visual experiment that allows students to see evidence of a gaseous reagent being consumed when a pressure sensor is available. (Contains 3 figures.)…

  18. De-carbonizingChina

    Institute of Scientific and Technical Information of China (English)

    zhou; Xiaoyan

    2013-01-01

    Innovation in the energy sector will pave the way for the country’slow-carbon future Although its per-capita emission is roughly on par with the world’s average, China is the world’s largest carbon dioxide emitter,

  19. COMMITTED TO CARBON REDUCTION

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Chinese efforts to lower carbon emissions through environmentally friendly means begin gaining momentum Efforts to curb carbon emissions continue to take shape as China adheres to its pledge for a brighter, greener future. More importantly, as environmental measures take hold and develop

  20. Silicon-[18F]Fluorine Radiochemistry: Basics, Applications and Challenges

    OpenAIRE

    Carmen Wängler; Alexey Kostikov; Jun Zhu; Joshua Chin; Björn Wängler; Ralf Schirrmacher

    2012-01-01

    Silicon-[18F]Fluorine (Si-18F) radiochemistry has recently emerged alongside other unconventional approaches such as aluminum-F-18 and boron-F-18 based labeling strategies, reshaping the landscape of modern F-18-radiochemistry. All these novel methodologies are driven by the demand for more convenient F-18-labeling procedures to further disseminate one of the most sophisticated imaging technologies, Positron Emission Tomography (PET). The PET methodology requires special radionuclides such as...