WorldWideScience

Sample records for carbon 18

  1. Concomitant oxygen-18 enrichment in commercial carbon-13 labelled urea

    Energy Technology Data Exchange (ETDEWEB)

    Iida, Katsumi; Chiyoda, Takeshi; Kajiwara, Masahiro [Meiji College of Pharmacy, Tokyo (Japan). Dept. of Medicinal Chemistry

    1996-12-01

    By mass spectroscopy, 50-fold oxygen-18 enrichment over natural abundance was observed in commercial {sup 13}C-urea (99 atom % {sup 13}C) synthesized from {sup 13}C-carbon monoxide that had been {sup 13}C-enriched by cryogenic distillation. In contrast, {sup 13}C-urea synthesized from {sup 13}C-potassium cyanide (a {sup 13}C-labelled compound having no oxygen atom) showed the natural abundance level of oxygen-18. (author).

  2. A routine production system for F-18 from frozen oxygen-18 enriched carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Firoubakht, M.L.; Schlyer, D.J.; Wolf, A.P. [Brookhaven National Lab., Upton, NY (United States)

    1994-05-01

    We have previously presented the results from a cryogenic target using isotopically enriched carbon dioxide ice. A system has been designed and built which allows the routine use of this target system for the production of fluorine-18 fluoride ion which is used to synthesize [{sup 18}F]fluorodeoxyglucose ([{sup 18}F]FDG). The system consists of a vacuum line used to contain and transfer the carbon dioxide gas and a wash volume to rinse the target cone with water after irradiation and send this volume to the Chemistry Laboratory for processing. The system is completely remote and is controlled from a panel in the cyclotron control room. This system has been in operation for about two months and yields of 250 millicuries from a 30 minute bombardment at 20 pA enough to supply the complete daily requirements of FDG for our PET tomography have been delivered to the FDG synthesis unit for processing. Larger amounts of fluorine-18 can be produced if needed. The fluorine-18 (as fluoride ion) is rinsed from the target in a volume of 10 mL of water (80% of the available fluoride) and processed by trapping on an anion exchange resin which is then eluted with .01 M K{sub 2}CO{sub 3} solution. The system also has automated liquid nitrogen filling of both the storage dewars and the target cooling container. The system has been tested for a variety of failure modes including accidental pumping of the enriched carbon dioxide to the roughing pump, loss of liquid nitrogen in the cooling container and a leak in the entrance foil. In all cases the carbon dioxide was recovered with better than 98% efficiency. This system, in conjunction with the cryogenic [{sup 18}O]carbon dioxide target, provides a reliable, highly efficient means of producing [{sup 18}F]fluoride for the synthesis radiotracers.

  3. Isotopic composition of carbon-13 and oxygen-18 from authigenic carbonates, Black Sea region

    Science.gov (United States)

    Logvina, E.; Mazurenko, L.; Prasolov, E.

    2004-05-01

    Several types of authigenic carbonates related to the fluid discharge zones were sampled during the international expeditions onboard R/V "Professor Vodyanitskiy" (56th cruise) and R/V "Professor Logachev" (11th cruise of UNESCO-TTR) in the northwest part of the Black sea. These carbonates are represented as mounds, build-ups and chimney-like structures, cemented sediments, crusts and concretions. The isotope analyses of carbonates were conducted using mass-spectrometer MS-20 in the Laboratory of Isotope Geology (St.Petersburg State University). The obtained values of oxygen-18 varied from +0,6 to -1,9 per mille (up to C0.8 per mille on average). This value is corresponding to normal seawater oxygen-18 value (about 0 per mille); we suspect, that the source of oxygen for carbonate formation is the seawater. The carbonates are characterized by low carbon-13 (from -35,4 to -42,6 per mille) in comparison with normal marine carbonates (about 0 per mille). We have reason to suppose that carbonates associated with fluid venting were formed by light isotopic composition of carbon dioxide (carbon-13 -45 to -52 per mille), which forming under methane microbiologic oxidation with such isotopic composition. This is because of crossing fluid process of carbon dioxide to carbonate with 8~10 degrees temperature carbon became heaver to 10- 11 per mille. The isotopic composition study of carbonate build-ups is of interest because its association with the gas hydrate accumulations is quite often in the gas seeps. This work is financially supported by Russian Foundation for Basic Research, grant 02-05-64346.

  4. Elastic Scattering of CARBON-14 + CARBON-12, Carbon -14 + OXYGEN-16, and CARBON-14 + OXYGEN-18.

    Science.gov (United States)

    Sterbenz, Stephen Michael

    We have carried out highly detailed studies of the elastic scattering of ^{14} C from ^{12}C, ^{16}O, and ^ {18}O, in a search for resonant phenomena in heavy-ion systems of non-zero isospin and zero spin. Angular distributions from ^{14}C+ ^{12}C and ^ {14}C+^{16}O scattering were measured at ^{14} C bombarding energies ranging from 20 to 40.3 MeV in 0.35 MeV steps. ^{14}C+ ^{18}O angular distributions were measured at ^{14}C energies from 20 to 30 MeV in 0.40 MeV steps and from 22.5 to 32.5 MeV in 2.5 MeV steps. The great variety of behavior which characterizes heavy-ion scattering is clearly illustrated by our data. The ^{14}C+^ {12}C and ^{14} C+^{16}O systems both exhibit marked gross structure in their excitation functions and deep oscillatory structure with a large backward angle rise in their angular distributions. They are in sharp contrast with the ^{14} C+^{18}O system, where structure is not apparent, and cross-sections fall steeply at larger angles and higher energies. However, only in the ^{14}C+ ^{12}C system are the excitation functions strongly fragmented by intermediate width structure. The anomalous appearance of the ^{14} C+^{12}C angular distributions near 17.5 MeV (cm) does suggest the existence of a resonant state (tentatively identified as l = 10 by phase shift analysis). In our analysis, we point out that the remarkable qualitative differences among these systems may be related to open-channel systematics. We find that general characteristics of the ^{14}C+ ^{18}O data are reproduced with a strongly absorbing optical potential model, contrary to the situation in the other two systems, where a specific mechanism, such as elastic transfer, must be invoked to account for the backward rise. We have pursued analysis with a one-step DWBA elastic transfer model which was quite successful at low energies. Its underprediction of the backward rise at higher energies provides further evidence of the importance of multi-step processes in two

  5. Oxygen-18 and carbon-13 in the carbonates of the Salina formation of southwestern Ontario

    Energy Technology Data Exchange (ETDEWEB)

    O' Shea, K.J.; Miles, M.C.; Fritz, P.; Frape, S.K.; Lawson, D.E.

    1988-02-01

    The oxygen and carbon isotopic composition of the carbonates of the Upper Silurian Salina formation of the Michigan Basin was investigated to aid in interpretation of depositional environments. /sup 13/C results indicate that a change from generally anoxic bottom conditions to oxic conditions occurred during deposition of the salt and anhydrite evaporite unit. The lower organic-rich carbonate units were deposited in a shallow-water, evaporitic setting, most likely adjacent to a sabkha-type environment. A positive water balance maintained the anoxic conditions and buffered the carbon isotopes. Above the salt and anhydrite evaporite, the isotopic composition suggests that the development of a similar depositional environment, a sub-aerial prograding sabkha, occurred over wide areas of the basin. /sup 18/O results support the conclusion that Silurian oceans were depleted in /sup 18/O with respect to modern oceans by 5-6%. 56 refs., 13 figs., 4 tabs.

  6. Water, hydrogen, deuterium, carbon, carbon-13, and oxygen-18 content of selected lunar material

    Science.gov (United States)

    Friedman, I.; O'Neil, J.R.; Adami, L.H.; Gleason, J.D.; Hardcastle, K.

    1970-01-01

    The water content of the breccia is 150 to 455 ppm, with a ??D from -580 to -870 per mil. Hydrogen gas content is 40 to 53 ppm with a ??D of -830 to -970 per mil. The CO2 is 290 to 418 ppm with S 13C = + 2.3 to + 5.1 per mil and ??18O = 14.2 to 19.1 per mil. Non-CO2 carbon is 22 to 100 ppm, ??18C = -6.4 to -23.2 per mil. Lunar dust is 810 ppm H2O (D = 80 ppm) and 188 ppm total carbon (??13C = -17.6 per mil). The 18O analyses of whole rocks range from 5.8 to 6.2 per mil. The temperature of crystallization of type B rocks is 1100?? to 1300??C, based on the oxygen isotope fractionation between coexisting plagioclase and ilmenite.

  7. Groningen experience in production and application of fluorine-18 and carbon-11 labeled radiopharmaceuticals

    International Nuclear Information System (INIS)

    In this presentation the preparation of these tracers (fluorine-18 and carbon-11 labeled radiopharmaceuticals), as well as the present stage of development and evaluation, and the potential application in oncology will be discussed. (author)

  8. Oxygen-18 Carbon Dioxide Isotope Ratio in Mars Atmosphere

    Science.gov (United States)

    Kostiuk, T.; Livengood, T. A.; Hewagama, T.; Smith, R.; Fast, K. E.; Annen, J.; Sonnabend, G.; Sornig, M.

    2012-09-01

    The determination of isotopic ratios on Mars is important to the study of atmospheric evolution [1]. The relative abundance of isotopes of CO2 provides insight into the loss of Mars' primordial atmosphere. Isotopic ratios also provide markers in the study of geochemistry of Mars meteorites and future returned samples formed in equilibrium with ambient atmosphere, and are probes of biogenic and abiotic chemistry, which differ in isotope fractionation. Due to its lesser gravity and relatively thin residual atmosphere, Mars' atmosphere should be enriched in heavy isotopes [1]. However Viking [2] results indicated an Earth-like singly substituted oxygen-18 CO2 isotopic ratio, 18OCO/OCO, with δ18O = 0±50‰ relative to Vienna Standard Mean Ocean Water (VSMOW). By comparison, isotopic ratios in Earth atmospheric CO2 are not uniquely defined due to seasonal and biotic variability, but have a range 0-41‰ relative to VSMOW [3, 4]. Phoenix lander TEGA [3] measurements found a modest enrichment of δ18O = 31.0±5.7‰. Only the Viking and Phoenix landers have carried a mass spectrometer to Mars, so far, until the arrival of Mars Science Laboratory in August 2012. Using ground-based spectroscopic techniques Krasnopolsky et al. [5] also found modest enrichment δ18O = 18±18‰. We present results from fully resolved spectroscopic measurements near 10.6 μm of both the normal and singly substituted oxygen- 18 CO2 lines, taken with the Goddard Space Flight Center Heterodyne Instrument for Planetary Winds And Composition (HIPWAC) at the NASA Infrared Telescope Facility on Mauna Kea, Hawaii. Measurements with spectral resolving power λ/Δλ=107 were obtained in October 2007 with an instantaneous field-of-view on the planet of ~1 arcsec, at the locations shown in Fig. 1 as open squares. The solid and broken line tracks show Mars SPICAM measurements of ozone corresponding to ozone measurements also obtained with HIPWAC and shown as hatched and solid regions [6]. Figure 1

  9. Oxygen-18 Carbon Dioxide Isotope Ratio in Mars Atmosphere

    Science.gov (United States)

    Kostiuk, T.; Livengood, T. A.; Hewagama, T.; Smith, R.; Fast, K. E.; Annen, J.; Sonnabend, G.; Sornig, M.

    2012-09-01

    The determination of isotopic ratios on Mars is important to the study of atmospheric evolution [1]. The relative abundance of isotopes of CO2 provides insight into the loss of Mars' primordial atmosphere. Isotopic ratios also provide markers in the study of geochemistry of Mars meteorites and future returned samples formed in equilibrium with ambient atmosphere, and are probes of biogenic and abiotic chemistry, which differ in isotope fractionation. Due to its lesser gravity and relatively thin residual atmosphere, Mars' atmosphere should be enriched in heavy isotopes [1]. However Viking [2] results indicated an Earth-like singly substituted oxygen-18 CO2 isotopic ratio, 18OCO/OCO, with δ18O = 0±50‰ relative to Vienna Standard Mean Ocean Water (VSMOW). By comparison, isotopic ratios in Earth atmospheric CO2 are not uniquely defined due to seasonal and biotic variability, but have a range 0-41‰ relative to VSMOW [3, 4]. Phoenix lander TEGA [3] measurements found a modest enrichment of δ18O = 31.0±5.7‰. Only the Viking and Phoenix landers have carried a mass spectrometer to Mars, so far, until the arrival of Mars Science Laboratory in August 2012. Using ground-based spectroscopic techniques Krasnopolsky et al. [5] also found modest enrichment δ18O = 18±18‰. We present results from fully resolved spectroscopic measurements near 10.6 μm of both the normal and singly substituted oxygen- 18 CO2 lines, taken with the Goddard Space Flight Center Heterodyne Instrument for Planetary Winds And Composition (HIPWAC) at the NASA Infrared Telescope Facility on Mauna Kea, Hawaii. Measurements with spectral resolving power λ/Δλ=107 were obtained in October 2007 with an instantaneous field-of-view on the planet of ~1 arcsec, at the locations shown in Fig. 1 as open squares. The solid and broken line tracks show Mars SPICAM measurements of ozone corresponding to ozone measurements also obtained with HIPWAC and shown as hatched and solid regions [6]. Figure 1

  10. Enhancing the Accuracy of Carbonate δ18O and δ13C Measurements by SIMS

    Science.gov (United States)

    Orland, I. J.; Kozdon, R.; Linzmeier, B.; Wycech, J.; Sliwinski, M.; Kitajima, K.; Kita, N.; Valley, J. W.

    2015-12-01

    The precision and accuracy of carbonate δ18O & δ13C analysis by multicollector SIMS is well established if standards match samples in structure and major/minor element chemistry. However, low-T- and bio-carbonates used to construct paleoclimate archives can include complex internal structures and some samples analyzed at WiscSIMS (and other SIMS labs) have a consistent, sample-dependent offset between average SIMS δ18O measurements and bulk δ18O analyses by phosphoric-acid digestion. The offset is typically hydrogen peroxide), for which there is no agreed procedure in conventional bulk analyses. For SIMS analyses, pre-treatments had varied influence on the δ18O value, [16O1H], the concentration of "organic markers" like 12C14N and 31P, and mineralogy (of aragonite samples).

  11. Synthesis of carbon-11, fluorine-18, and nitrogen-13 labeled radiotracers for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, J.S.; Wolf, A.P.

    1981-01-01

    A number of reviews, many of them recent, have appeared on various aspects of /sup 11/C, /sup 18/F and /sup 13/N-labeled radiotracers. This monograph treats the topic principally from the standpoint of synthetic organic chemistry while keeping in perspective the necessity of integrating the organic chemistry with the design and ultimate application of the radiotracer. Where possible, recent examples from the literature of organic synthesis are introduced to suggest potentially new routes which may be applied to problems in labeling organic molecules with the short-lived positron emitters, carbon-11, fluorine-18, and nitrogen-13. The literature survey of carbon-11, fluorine-18 and nitrogen-13 labeled compounds presented are of particular value to scientists working in this field. Two appendices are also included to provide supplementary general references. A subject index concludes this volume.

  12. Synthesis of carbon-11, fluorine-18, and nitrogen-13 labeled radiotracers for biomedical applications

    International Nuclear Information System (INIS)

    A number of reviews, many of them recent, have appeared on various aspects of 11C, 18F and 13N-labeled radiotracers. This monograph treats the topic principally from the standpoint of synthetic organic chemistry while keeping in perspective the necessity of integrating the organic chemistry with the design and ultimate application of the radiotracer. Where possible, recent examples from the literature of organic synthesis are introduced to suggest potentially new routes which may be applied to problems in labeling organic molecules with the short-lived positron emitters, carbon-11, fluorine-18, and nitrogen-13. The literature survey of carbon-11, fluorine-18 and nitrogen-13 labeled compounds presented are of particular value to scientists working in this field. Two appendices are also included to provide supplementary general references. A subject index concludes this volume

  13. Inorganic-Organic Hybrid 18-Molybdodiphosphate Nanoparticles Bulk-modified Carbon Paste Electrode and Its Electrocatalysis

    Institute of Scientific and Technical Information of China (English)

    WANG,Xiu-Li(王秀丽); KANG,Zhen-Hui(康振辉); WANG,En-Bo(王恩波); HU,Chang-Wen(胡长文)

    2002-01-01

    A kind of inorganic- organic hybrid 18-molybdodiphosphate nanoparticles ([(C4H9)4N]6P2Mo18O62 @4H2O) was firstly used as a bulk-modifier to fabricate a three-dimensional chemically modified carbon paste electrode (CPE) by direct mixing. The electrochemical behavior of the solid nanoparticles dispersed in the CPE in acidic aqueous solution was characterized by cyclic and square-wave voltammetry. The hybrid 18-molybdodiphosphate nanoparticles bulk-modified CPE (MNP-CPE) displayed a high electrocatalytic activity towards the reduction of nitrite,bromate and hydrogen peroxide. The remarkable advantages of the MNP-CPE over the traditional polyoxometalates-modified electrodes are their excellent reproducibility of surface-renewal and high stability owing to the insolubility of the hybrid 18-molybdodiphosphate nanoparticles.

  14. Influence of Carbonic Anhydrase Activity in Terrestrial Vegetation on the 18O Content of Atmospheric CO2

    Science.gov (United States)

    Gillon, Jim; Yakir, Dan

    2001-03-01

    The oxygen-18 (18O) content of atmospheric carbon dioxide (CO2) is an important indicator of CO2 uptake on land. It has generally been assumed that during photosynthesis, oxygen in CO2 reaches isotopic equilibrium with oxygen in 18O-enriched water in leaves. We show, however, large differences in the activity of carbonic anhydrase (which catalyzes CO2 hydration and 18O exchange in leaves) among major plant groups that cause variations in the extent of 18O equilibrium (θeq). A clear distinction in θeq between C3 trees and shrubs, and C4 grasses makes atmospheric C18OO a potentially sensitive indicator to changes in C3 and C4 productivity. We estimate a global mean θeq value of ~0.8, which reasonably reconciles inconsistencies between 18O budgets of atmospheric O2 (Dole effect) and CO2.

  15. Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants. A new approach to estimating in vivo carbonic anhydrase activity.

    Science.gov (United States)

    Holtum, J A; Summons, R; Roeske, C A; Comins, H N; O'Leary, M H

    1984-06-10

    Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with 13C18O2 , then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the [13C] malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance (using the oxygen-18 effect on the carbon-13 chemical shift of the carboxyl carbon) or by mass spectrometry (comparing the ions at three and five units above the molecular weight with that one unit above). Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO-3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum , 40 for Kalancho ë daigremontiana , and 100 or greater for Bryophyllum tubiflorum , Kalancho ë serrata, and Kalancho ë tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. PMID:6427227

  16. Priming effects of leaves of Laurus nobilis L. and 1,8-cineole on carbon mineralization

    Directory of Open Access Journals (Sweden)

    Burak Kocak

    2016-03-01

    Full Text Available Plant secondary compounds can have stimulating effect on C cycling and change its rate in soils. We examined how leaves of bay laurel (Laurus nobilis L.; Lauraceae and 1,8-cineole (CIN, one of its constituents, affect soil C mineralization and its rate. Leaves and soil samples of bay laurel were taken from Cukurova University Campus (Adana, Turkey growing naturally under Mediterranean climate conditions. Leaves and CIN were considered as the two forms of organic C sources. After determining the level of 1,8-cineole in leaves by gas chromatography-mass spectrometry, soils were mixed with powdered leaves and 1,8-cineole based on their C contents at same and half doses of soil organic C level. Carbon mineralization of all soils was determined over 54 d (28 °C, 80% field capacity. While 1,8-cineole was found as a major constituent of leaves (65% of essential oil, all doses of leaves and CIN increased soil microbial activity. There were significant differences for C mineralization rate between control and all applications (P < 0.05. High C levels of all treatments decreased C mineralization rate compared to control soils. In summary, all treatments stimulated C mineralization and it is possible to conclude that soil microorganisms adapted to use CIN as an energy source.

  17. Oxygen-18 incorporation into malic acid during nocturnal carbon dioxide fixation in crassulacean acid metabolism plants: a new approach to estimating in vivo carbonic anhydrase activity

    Energy Technology Data Exchange (ETDEWEB)

    Holtum, J.A.M.; Summons, R.; Roeske, C.A.; Comins, H.N.; O' Leary, M.H.

    1984-01-01

    Crassulacean acid metabolism (CAM) plants fix carbon dioxide at night by the carboxylation of phosphoenolpyruvate. If CO2 fixation is conducted with TC YO2, then in the absence of carbonic anhydrase, the malate formed by dark CO2 fixation should also contain high levels of carbon-13 and oxygen-18. Conversely, if carbonic anhydrase is present and highly active, oxygen exchange between CO2 and cellular H2O will occur more rapidly than carboxylation, and the ( TC) malate formed will contain little or no oxygen-18 above the natural abundance level. The presence of oxygen-18 in these molecules can be detected either by nuclear magnetic resonance or by mass spectrometry. Studies of phosphoenolpyruvate carboxylase in the presence and absence of carbonic anhydrase in vitro confirm the validity of the method. When CAM plants are studied by this method, we find that most species show incorporation of a significant amount of oxygen-18. Comparison of these results with results of isotope fractionation and gas exchange studies permits calculation of the in vivo activity of carbonic anhydrase toward HCO3 compared with that of phosphoenolpyruvate carboxylase. The ratio (carbonic anhydrase activity/phosphoenolpyruvate carboxylase activity) is species dependent and varies from a low of about 7 for Ananas comosus to values near 20 for Hoya carnosa and Bryophyllum pinnatum, 40 for Kalanchoee daigremontiana, and 100 or greater for Bryophyllum tubiflorum, Kalanchoee serrata, and Kalanchoae tomentosa. Carbonic anhydrase activity increases relative to phosphoenolpyruvate carboxylase activity at higher temperature. 37 references, 2 figures, 8 tables.

  18. Analysis of oxygen sources and reaction pathways of carbon support corrosion at the cathode in PEMFC using oxygen-18 DEMS

    Energy Technology Data Exchange (ETDEWEB)

    Li Wei [Department of Chemical and Biological Engineering, University of Alabama, Box 870203, Tuscaloosa AL 35487-0203 (United States); Lane, Alan M., E-mail: alane@eng.ua.ed [Department of Chemical and Biological Engineering, University of Alabama, Box 870203, Tuscaloosa AL 35487-0203 (United States)

    2010-09-01

    Oxygen gas, water used to humidify the gases, and surface oxides originated from the carbon black and catalyst preparation are the three possible oxygen sources contributing to carbon support corrosion (CSC) at the cathode in proton exchange membrane fuel cells (PEMFC). To discriminate among them, oxygen was isotopically labeled by replacing regular water with oxygen-18 ({sup 18}O) enriched water (H{sub 2}{sup 18}O, 98%) in differential electrochemical mass spectrometry (DEMS). The DEMS spectra of the cathode exhaust gases O{sub 2}, O{sup 18}O, {sup 18}O{sub 2}, CO{sub 2}, CO{sup 18}O and C{sup 18}O{sub 2} (m/z equal to 32, 34, 36, 44, 46 and 48 correspondingly), sampled by a mass spectrometer during cyclic voltammetry (potential cycled for 100-1400 mV at the rate of 10 mV s{sup -1}) and chronoamperometry, were analyzed to identify the sources of oxygen, identify mechanistic pathways, and classify the surface oxides on carbon for CSC. It was found that water is the main direct oxygen source for CSC. Water reacts with carbon to produce at least three types of carbon surface oxides, which are then further oxidized with water to produce CO{sub 2} in different potential ranges.

  19. Terrestrial influence on atmospheric carbon dioxide, a mechanistic study using oxygen-18

    Science.gov (United States)

    Fessenden, Julianna Eileen

    The present carbon budget is unbalanced due to anthropogenic influences. Atmospheric warming might have resulted from rising atmospheric carbon dioxide levels. Sequestration of this CO2 is observed in oceans and land vegetation, though questions arise regarding the magnitude of the terrestrial biosphere sink. These questions can be addressed by measuring the abundance of the light stable isotopes of oxygen (16O, and 18O in CO2) in the biological and chemical processes which produce and consume CO2. This work applies known methods of CO2 isolation and mass spectrometric analysis to address questions regarding the mechanisms of isotopic fractionation during land-atmosphere exchange where global, regional, local, and point-spot studies are researched. Atmospheric CO2 exchange with land masses influences about 80% of the delta18O signature yielding exchange fluxes on the order of 200 GtC yr-1. Land biosphere controls the seasonal cycle of CO2 and the offsets observed in the seasonal swing of the isotopic ratios, 13C/12C and 18O/16O (4--6 month shifts). When we looked closer at magnitudes of land-atmosphere exchanges, we saw that the respiratory flux was 100 times greater than the photosynthetic flux during the summer on the day of measurement in a coniferous forest system (3612 mumol m-2 s-1). Therefore, this regional isotopic signature was thought to be dominated by the delta 18O of soil respired CO2. Further inspection of the controlling mechanisms of soil respired CO 2 was then addressed where offsets (20‰) from soil water were observed in moisture limited ridge-top soils. Also, kinetic fractionation due to molecular diffusion through the soil column (thought to be 8.8‰) was not observed within the moisture limited, unsaturated, or saturated conditions within a grassland or forest ecosystem. On a localized scale, we conducted experiments on isotopically tracing water movement in a rooting zone. The results showed increased production of trace gases leading to

  20. Rapid uplift of the Altiplano revealed through 13C-18O bonds in paleosol carbonates.

    Science.gov (United States)

    Ghosh, Prosenjit; Garzione, Carmala N; Eiler, John M

    2006-01-27

    The elevation of Earth's surface is among the most difficult environmental variables to reconstruct from the geological record. Here we describe an approach to paleoaltimetry based on independent and simultaneous determinations of soil temperatures and the oxygen isotope compositions of soil waters, constrained by measurements of abundances of 13C-18O bonds in soil carbonates. We use this approach to show that the Altiplano plateau in the Bolivian Andes rose at an average rate of 1.03 +/- 0.12 millimeters per year between approximately 10.3 and approximately 6.7 million years ago. This rate is consistent with the removal of dense lower crust and/or lithospheric mantle as the cause of elevation gain.

  1. Carbon-13 and oxygen-18 kinetic isotope effects on methanolysis of p-nitrostyrene oxide

    Energy Technology Data Exchange (ETDEWEB)

    Jacober, S.P.; Hanzlik, R.P.

    1986-04-02

    Kinetic isotope effects for the acid- and base-catalyzed methanolysis of (epoxide-/sup 18/O)- and (8-/sup 13/C)-p-nitrostyrene oxide have been measured at 30.0/sup 0/. In acid 94.7% of the reaction occurs at the benzylic carbon, while in base 83.5% occurs at the primary carbon (C(8)). In base the isotope effects kappa/sub 16//kappa/sub 1/( and kappa/sub 1/''/kappa /sub 1/number were 1.035 +/- 0.013 and 1.082 +/- 0.012, while in acid they were 1.012 +/- 0.011 and 0.995 +/- 0.012, respectively. These data complement previously determined deuterium isotope effects for the reaction in base. They suggest a late transition state in base with considerable ring opening via an S/sub N/2 mechanism. However, in acid, the data suggest a somewhat earlier transition state with less ring opening and weaker bonding to the nucleophile than in base.

  2. Preferential formation of 13C- 18O bonds in carbonate minerals, estimated using first-principles lattice dynamics

    Science.gov (United States)

    Schauble, Edwin A.; Ghosh, Prosenjit; Eiler, John M.

    2006-05-01

    Equilibrium constants for internal isotopic exchange reactions of the type: Ca12C18O16O2+Ca13C16O3↔Ca13C18O16O2+Ca12C16O3 for individual CO 32- groups in the carbonate minerals calcite (CaCO 3), aragonite (CaCO 3), dolomite (CaMg(CO 3) 2), magnesite (MgCO 3), witherite (BaCO 3), and nahcolite (NaHCO 3) are calculated using first-principles lattice dynamics. Calculations rely on density functional perturbation theory (DFPT) with norm-conserving planewave pseudopotentials to determine the vibrational frequencies of isotopically substituted crystals. Our results predict an ˜0.4‰ excess of 13C18O16O22- groups in all studied carbonate minerals at room-temperature equilibrium, relative to what would be expected in a stochastic mixture of carbonate isotopologues with the same bulk 13C/ 12C, 18O/ 16O, and 17O/ 16O ratios. The amount of excess 13C18O16O22- decreases with increasing temperature of equilibration, from 0.5‰ at 0 °C to <0.1‰ at 300 °C, suggesting that measurements of multiply substituted isotopologues of carbonate could be used to infer temperatures of ancient carbonate mineral precipitation and alteration events, even where the δ 18O of coexisting fluids is uncertain. The predicted temperature sensitivity of the equilibrium constant is ˜0.003‰/°C at 25 °C. Estimated equilibrium constants for the formation of 13C18O16O22- are remarkably uniform for the variety of minerals studied, suggesting that temperature calibrations will also be applicable to carbonate minerals not studied here without greatly compromising accuracy. A related equilibrium constant for the reaction: Ca12C18O16O2+Ca12C17O16O2↔Ca12C18O17O16O+Ca12C16O3 in calcite indicates formation of 0.1‰ excess 12C 18O 17O 16O 2- at 25 °C. In a conventional phosphoric acid reaction of carbonate to form CO 2 for mass-spectrometric analysis, molecules derived from 13C18O16O22- dominate (˜96%) the mass 47 signal, and 12C 18O 17O 16O 2- contributes most of the remainder (3%). This suggests

  3. Lake carbonate18 records from the Yukon Territory, Canada: Little Ice Age moisture variability and patterns

    Science.gov (United States)

    Anderson, Lesleigh; Finney, Bruce P.; Shapley, Mark D.

    2011-01-01

    A 1000-yr history of climate change in the central Yukon Territory, Canada, is inferred from sediment composition and isotope geochemistry from small, groundwater fed, Seven Mile Lake. Recent observations of lake-water δ18O, lake level, river discharge, and climate variations, suggest that changes in regional effective moisture (precipitation minus evaporation) are reflected by the lake’s hydrologic balance. The observations indicate that the lake is currently 18O-enriched by summer evaporation and that during years of increased precipitation, when groundwater inflow rates to the lake increase, lake-water δ18O values decrease. Past lake-water δ18O values are inferred from oxygen isotope ratios of fine-grained sedimentary endogenic carbonate. Variations in carbonate δ18O, supplemented by those in carbonate and organic δ13C, C/N ratios, and organic carbon, carbonate and biogenic silica accumulation rates, document changes in effective moisture at decadal time scales during the early Little Ice Age period to present. Results indicate that between ∼AD 1000 and 1600, effective moisture was higher than today. A shift to more arid climate conditions occurred after ∼AD 1650. The 19th and 20th centuries have been the driest of the past millennium. Temporal variations correspond with inferred shifts in summer evaporation from Marcella Lake δ18O, a similarly small, stratified, alkaline lake located ∼250 km to the southwest, suggesting that the combined reconstructions accurately document the regional paleoclimate of the east-central interior. Comparison with regional glacial activity suggests differing regional moisture patterns during early and late Little Ice Age advances.

  4. Effects of intraleaf variations in carbonic anhydrase activity and gas exchange on leaf C18OO isoflux in Zea mays.

    Science.gov (United States)

    Affek, Hagit P; Krisch, Maria J; Yakir, Dan

    2006-01-01

    Variation in the C18OO content of atmospheric CO2 (delta18Oa) can be used to distinguish photosynthesis from soil respiration, which is based on carbonic anhydrase (CA)-catalyzed 18O exchange between CO2 and 18O-enriched leaf water (delta18Ow). Here we tested the hypothesis that mean leaf delta18Ow and assimilation rates can be used to estimate whole-leaf C18OO flux (isoflux), ignoring intraleaf variations in CA activity and gas exchange parameters. We observed variations in CA activity along the leaf (> 30% decline from the leaf center toward the leaf ends), which were only partially correlated to those in delta18Ow (7 to 21 per thousand), delta18O and delta13C of leaf organic matter (25 to 30 per thousand and -12.8 to -13.2 per thousand, respectively), and substomatal CO2 concentrations (intercellular CO2 concentrations, c(i), at the leaf center were approximately 40% of those at the leaf tip). The combined effect of these variations produced a leaf-integrated isoflux that was different from that predicted based on bulk leaf values. However, because of canceling effects among the influencing parameters, isoflux overestimations were only approximately 10%. Conversely, use of measured parameters from a leaf segment could produce large errors in predicting leaf-integrated C18OO fluxes. PMID:16411935

  5. Utilization of activated carbon produced from fruit juice industry solid waste for the adsorption of Yellow 18 from aqueous solutions.

    Science.gov (United States)

    Angin, Dilek

    2014-09-01

    The use of activated carbon obtained from sour cherry (Prunus cerasus L.) stones for the removal of a basic textile dye, which is Yellow 18, from aqueous solutions at different contact times, pH values and solution temperatures was investigated. The surface area and micropore volume of chemically modified activated carbon were 1704 m(2) g(-1) and 0.984 cm(3) g(-1), respectively. The experimental data indicated that the adsorption isotherms were well described by the Langmuir equilibrium isotherm equation and the calculated adsorption capacity was 75.76 mg g(-1) at 318 K. The adsorption kinetic of Yellow 18 obeys the pseudo-second-order kinetic model. The thermodynamic parameters were calculated to estimate the nature of adsorption. The activation energy of the system was calculated as 0.71-2.36 kJ/mol. According to these results, prepared activated carbon could be used as a low-cost adsorbent to compare with the commercial activated carbon for the removal of Yellow 18 from wastewater. PMID:24656549

  6. The potential of carbon-11 and fluorine-18 chemistry: illustration through the development of positron emission tomography radioligands targeting the translocator protein 18 kDa

    International Nuclear Information System (INIS)

    The TSPO (translocator protein), also known as the peripheral benzodiazepine receptor, is up-regulated in the brain of subjects suffering from neuro-degenerative disorders such as Alzheimer's, Parkinson's and Huntington's disease. Moreover, this overexpression has been proved to be linked to micro-glia activation making thus the TSPO a marker of choice of neuro-inflammatory processes and therefore a potential target for the development of radioligands for positron emission tomography imaging. The discovery of selective TSPO ligands and their labelling with the short-lived positron-emitter isotopes carbon-11 and fluorine-18 emerged in the mid-1980's with the preparation of the 3-iso-quinolinecarboxamide [11C]PK11195. To date, an impressive number of promising compounds - [11C]PK11195-challengers - have been developed; some radioligands - for example, [11C]PBR28, [11C]DPA-713, [18F]FEDAA1106 and [18F]DPA-714 - are currently used in clinical trials. As illustrated in this review, the methodologies applied for the preparation of these compounds remain mainly [11C]methylations using [11C]MeI or [11C]MeOTf and SN2- type nucleophilic aliphatic [18F]fluorinations - two processes illustrating the state-of-the-art arsenal of reactions that involves these two short-lived radioisotopes - but alternative processes, such as [11C]carbonylations using [11C]CO and [11C]COCl2 as well as SNAr-type nucleophilic [18F]fluorinations, have also been reported and as such, reviewed herein. (authors)

  7. Quantitative and mechanistic studies using the oxygen-18 isotope shift in carbon-13 nuclear magnetic resonance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Mega, T.L.

    1989-01-01

    The {sup 18}O-isotope shift in {sup 13}C NMR spectroscopy was used to study the kinetics of oxygen exchange at the anomeric carbon atoms of several ketoses and aldoses. At 25-26{degree}C and over the pH range from 2 to 10, the relative rates of oxygen exchange for the aldoses studied increased in the following sequence: D-glucose, D-mannose, D-ribose, D-2-deoxyribose. The hydration rates for the open chain forms of the sugars were calculated and the results were analyzed in terms of steric and inductive effects by drawing analogies with the hydration kinetics of simple aldehydes and ketones. Effective molarities associated with ring closure reactions of common monosaccharides are calculated. The position of bond cleavage in the acid-catalyzed hydrolysis of sucrose was elucidated by hydrolyzing the sugar in {sup 18}O-water and assaying the incorporation of {sup 18}O into the several anomeric products using {sup 13}C NMR. Independents supporting experimental evidence was obtained using {sup 1}H NMR. A detailed investigation was made of the complex {sup 13}C NMR spectrum arising from the various {sup 18}O-isotopomers in a solution of {sup 18}O-labeled (1,4-{sup 13}C{sub 2}) succinic acid. The quantitative use of the {sup 18}O isotope shift in {sup 13}C NMR was assessed.

  8. Carbon-11 and fluorine-18 chemistry devoted to molecular probes for imaging the brain with positron emission tomography

    International Nuclear Information System (INIS)

    Exploration of the living human brain in real-time and in a noninvasive way was for centuries only a dream, made, however, possible today with the remarkable development during the four last decades of powerful molecular imaging techniques, and especially positron emission tomography (PET). Molecular PET imaging relies, from a chemical point of view, on the use and preparation of a positron-emitting radiolabelled probe or radiotracer, notably compounds incorporating one of two short-lived radionuclides fluorine-18 (T1/2: 109.8 min) and carbon-11 (T1/2: 20.38 min). The growing availability and interest for the radio-halogen fluorine-18 in radiopharmaceutical chemistry undoubtedly results from its convenient half-life and the successful use in clinical oncology of 2-[18F]fluoro-2-deoxy-D-glucose ([18F]FDG). The special interest of carbon-11 is not only that carbon is present in virtually all biomolecules and drugs allowing therefore for isotopic labelling of their chemical structures but also that a given molecule could be radiolabelled at different functions or sites, permitting to explore (or to take advantage of) in vivo metabolic pathways. PET chemistry includes production of these short-lived radioactive isotopes via nuclear transmutation reactions using a cyclotron, and is directed towards the development of rapid synthetic methods, at the trace level, for the introduction of these nuclides into a molecule, as well as the use of fast purification, analysis and formulation techniques. PET chemistry is the driving force in molecular PET imaging, and this special issue of the Journal of Labelled Compounds and Radiopharmaceuticals, which is strongly chemistry and radiochemistry-oriented, aims at illustrating, be it in part only, the state-of-the-art arsenal of reactions currently available and its potential for the research and development of specific molecular probes labelled with the positron emitters carbon-11 and fluorine-18,with optimal imaging properties for

  9. Oxygen-18 and carbon-13 records for the last 14,000 years from lacustrine carbonates of Siling-Co (lake) in the Qinghai-Tibetan Plateau

    Science.gov (United States)

    Morinaga, H.; Itota, C.; Isezaki, N.; Goto, H.; Yaskawa, K.; Kusakabe, M.; Liu, J.; Gu, Z.; Yuan, B.; Cong, S.

    1993-12-01

    To understand paleoenvironmental changes for the central Qinghai-Tibetan plateau, we analyzed stable isotopes of oxygen and carbon from calcium carbonates in a bottom sediment core collected from Siling-Co (lake). Five conventional and two Tandetron Acceleration Mass Spectrometry (TAMS) C-14 dates indicate that the core recovered sediments of the last 14,000 years. Calcium carbonates in the sediments seem to be primary carbonates precipitated chemically in the lake, and not clastic particles from limestones distributed around the lake, because of large variation of isotopic ratios, isotopic covariance since 6,000 yr BP and similarity between dates from total calcium carbonates and organic carbon. Their isotopic composition therefore reflects that of the lake water. We present the following paleoenvironmental history over the last 14,000 years in the central part of the plateau, from secular variations of delta O-18, delta C-13 and CaCO3 content throughout the core: (1) Desiccation was dominant during the latter part of the Last Glacial stage (14,000 to 11,000 yr BP). (2) The Last Glacial stage abruptly terminated at 11,000 yr BP. (3) A temperate and stable climate was dominant from 11,000 to 5,000 yr BP. (4) Climatic conditions fluctuated from 5,000 to the present, including two strong desiccation periods (5,000 to 4,000 yr BP and 3,000 to 2,000 yr BP) and an intermediate period of heavy rainfall (4,000 to 3,000 yr BP). This period is also characterized by a covariant O and C isotopic trend.

  10. The influence of temperature and seawater carbonate saturation state on 13C–18O bond ordering in bivalve mollusks

    Directory of Open Access Journals (Sweden)

    R. A. Eagle

    2013-07-01

    Full Text Available The shells of marine mollusks are widely used archives of past climate and ocean chemistry. Whilst the measurement of mollusk δ18O to develop records of past climate change is a commonly used approach, it has proven challenging to develop reliable independent paleothermometers that can be used to deconvolve the contributions of temperature and fluid composition on molluscan oxygen isotope compositions. Here we investigate the temperature dependence of 13C–18O bond abundance, denoted by the measured parameter Δ47, in shell carbonates of bivalve mollusks and assess its potential to be a useful paleothermometer. We report measurements on cultured specimens spanning a range in water temperatures of 5 to 25 °C, and field collected specimens spanning a range of −1 to 29 °C. In addition we investigate the potential influence of carbonate saturation state on bivalve stable isotope compositions by making measurements on both calcitic and aragonitic specimens that have been cultured in seawater that is either supersaturated or undersaturated with respect to aragonite. We find a robust relationship between Δ47 and growth temperature. We also find that the slope of a linear regression through all the Δ47 data for bivalves plotted against seawater temperature is significantly shallower than previously published inorganic and biogenic carbonate calibration studies produced in our laboratory and go on to discuss the possible sources of this difference. We find that changing seawater saturation state does not have significant effect on the Δ47 of bivalve shell carbonate in two taxa that we examined, and we do not observe significant differences between Δ47-temperature relationships between calcitic and aragonitic taxa.

  11. Preparation of carbon dioxide for oxygen-18 determination of water by use of a plastic syringe

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, N.; Mizutani, Y.

    1986-05-01

    The CO/sub 2/ equilibration method is used generally for the /sup 18/O determination of water, but it is tedious and time-consuming. Although several modifications have already been made to reduce the time and steps required for this conventional method, they demand expensive equipment. The present study is intended to simplify the conventional CO/sub 2/ equilibration method by use of a plastic syringe as an equilibration vessel without decreasing its precision. 7 references, 2 figures, 1 table.

  12. Inlfuence of carbon content on microstructure and mechanical properties of Mn13Cr2 and Mn18Cr2 cast steels

    Institute of Scientific and Technical Information of China (English)

    Lu Dingshan; Liu Zhongyi; Li Wei

    2014-01-01

    In this paper, a comparison study was carried out to investigate the inlfuence of carbon content on the microstructure, hardness, and impact toughness of water-quenched Mn13Cr2 and Mn18Cr2 cast steels. The study results indicate that both steels' water-quenched microstructures are composed of austenite and a smal amount of carbide. The study also found that, when the carbon contents are the same, there is less carbide in Mn18Cr2 steel than in Mn13Cr2 steel. Therefore, the hardness of Mn18Cr2 steel is lower than that of Mn13Cr2 steel but the impact toughness of Mn18Cr2 steel is higher than that of Mn13Cr2 steel. With increasing the carbon content, the hardness increases and the impact toughness decreases in these two kinds of steels, and the impact toughness of Mn18Cr2 steel substantialy exceeds that of Mn13Cr2 steel. Therefore, the water-quenched Mn18Cr2 steel with high carbon content could be applied to relatively high impact abrasive working conditions, while the as-cast Mn18Cr2 steel could be only used under working conditions of relatively low impact abrasive load due to lower impact toughness.

  13. An isotope mass balance model for the correlation of freshwater bivalve shell (Unio pictorum carbonate δ18O to climatic conditions and water δ18O in Lake Balaton (Hungary

    Directory of Open Access Journals (Sweden)

    Gabriella SCHÖLL-BARNA

    2011-08-01

    describes the isotope variability of shell carbonate. As a practical application of the isotope mass balance model was used to present the effect of precipitation and evaporation on δ18Oshell. The relationship between intra-shell δ18O-variability and precipitation amount (precipitation/evaporation ratio were determined, which allows the quantified prediction the impact of meteorological parameters affecting the oxygen isotope composition of shell carbonate.

  14. Linking water and carbon fluxes in a Mediterranean oak woodland using a combined flux and ?18O partitioning approach

    Science.gov (United States)

    Dubbert, M.; Piayda, A.; Costa e Silva, F.; Correia, A.; Pereira, J. S.; Cuntz, M.; Werner, C.

    2013-12-01

    Water is one of the key factors driving ecosystem productivity, especially in water-limited ecosystems, where global climate change is expected to intensify drought and alter precipitation patterns. One such ecosystem is the ';Montado', where two vegetation layers respond differently to drought: oak trees avoid drought due to their access to deeper soil layers and ground water while herbaceous plants, surviving the summer in the form of seeds. We aimed at 1) quantifying the impact of the understory herbaceous vegetation on ecosystem carbon and water fluxes throughout the year, 2) determining the driving environmental factors for evapotranspiration (ET) and net ecosystem exchange (NEE) and 3) disentangling how ET components of the ecosystem relate to carbon dioxide exchange. We present one year data set comparing modeled and measured stable oxygen isotope signatures (δ18O) of soil evaporation, confirming that the Craig and Gordon equation leads to good agreement with measured δ18O of evaporation (Dubbert et al. 2013). Partitioning ecosystem ET and NEE into its three sources revealed a strong contribution of soil evaporation (E) and herbaceous transpiration (T) to ecosystem ET during spring and fall. In contrast, soil respiration (R) and herbaceous net carbon gain contributed to a lesser amount to ecosystem NEE during spring and fall, leading to consistently smaller water use efficiencies (WUE) of the herbaceous understory compared to the cork-oaks. Here, we demonstrate that the ability to assess ET, NEE and WUE independent of soil evaporation dynamics enables the understanding of the mechanisms of the coupling between water and carbon fluxes and their responses to drought. Dubbert, M., Cuntz, M., Piayda, A., Maguas, C., Werner, C., 2013: Partitioning evapotranspiration - Testing the Craig and Gordon model with field measurements of oxygen isotope ratios of evaporative fluxes. J Hydrol. a) Oxygen isotope signatures of soil evaporation on bare soil plots calculated

  15. Investigation on laser brazing AA6056 Al alloy to XC18 low-carbon steel

    Institute of Scientific and Technical Information of China (English)

    Jianjun Ding; Feiqun Li; Feng Qu; Patrice Peyre; Remy Fabbro

    2005-01-01

    @@ Based on the studies of influence of YAG laser heating conditions for Al alloy melt and steel on wettability,the mechanics of the laser overlap braze welding of 6056 Al and XC18 steel sheet has been investigated.Under the temperature range which is above the melting point of the Al alloy and below the melting point of the steel, two dissimilar metals can be joined by means of laser braze welding. There is no crack observed in the joining area, i.e. Al-Fe intermetallic phase (Fe3Al/FeAl/FeAl3/Fe2Al5) layer formed by solution and diffusion between liquid-solid interface. The temperature range can be defined as the process temperatures of laser braze welding of Al-Fe materials. Selecting a higher laser heating temperature can improve the wettability of Al melt to steel surface, but the intermetallic phase layer is also thicker. When the laser heating temperature is so high that the joining surface of steel is melted, there is a crack trend in the joining area.

  16. Synthesis and biological evaluation of carbon-11 and fluorine-18 labeled tracers for in vivo visualization of PDE10A

    International Nuclear Information System (INIS)

    Introduction: In vivo visualization of PDE10A using PET provides a tool to evaluate the role of PDE10A in various neuropsychiatric diseases and can also be useful in the clinical evaluation of PDE10A inhibitor drug candidates. We evaluated several carbon-11 and fluorine-18 labeled PDE10A inhibitors as potential PDE10A PET radioligands. Materials and Methods: [11C]MP10, [11C]JNJ42071965 and four other tracers were developed. Their biodistribution was evaluated in rats. Rat plasma and brain radiometabolites were quantified. Baseline microPET imaging was performed in normal rats and PDE10A knockout (KO) and wild-type (WT) mice. Blocking and displacement studies were conducted. The selectivity of the tracer binding was further studied in an ex vivo autoradiography experiment in PDE10A KO and WT mice. Results: Biodistribution showed brain uptake for all tracers in the striatum and wash-out from the cerebellum. [11C]1 (11C-MP10) had the highest specific uptake index (striatum (S) vs. cerebellum (C) ratios (S/C)-1) at 60 min (7.4). [11C]5 ([11C]JNJ42071965) had a high index at the early time points (1.0 and 3.7 at 2 and 30 min p.i., respectively). The affinity of [11C]4, [18 F]3 and [18 F]6 was too low to visualize PDE10A using microPET. [11C] 2 showed a specific binding, while kinetics of [11C]1 were too slow. [11C]5 reached equilibrium after 10 min (uptake index = 1.2). Blocking and displacement experiments in rats and baseline imaging in PDE10A KO mice showed specific and reversible binding of [11C]5 to PDE10A. Conclusions: We successfully radiolabeled and evaluated six radiotracers for their potential to visualize PDE10A in vivo. While [11C]1 had the highest striatal specific uptake index, its slow kinetics likely compromise clinical use of this tracer. [11C]5 has a relatively high striatum-to-background ratio and fast kinetic profile, which makes it a valuable carbon-11 alternative

  17. Chemical weathering and the role of sulfuric and nitric acids in carbonate weathering: Isotopes (13C, 15N, 34S, and 18O) and chemical constraints

    Science.gov (United States)

    Li, Cai; Ji, Hongbing

    2016-05-01

    Multiple isotopes (13C-DIC, 34S and 18O-SO42-, 15N and 18O-NO3-) and water chemistry were used to evaluate weathering rates and associated CO2 consumption by carbonic acid and strong acids (H2SO4 and HNO3) in a typical karst watershed (Wujiang River, Southwest China). The dual sulfate isotopes indicate that sulfate is mainly derived from sulfide oxidation in coal stratum and sulfide-containing minerals, and dual nitrate isotopes indicate that nitrate is mainly derived from soil N and nitrification. The correlation between isotopic compositions and water chemistry suggests that sulfuric and nitric acids, in addition to carbonic acid, are involved in carbonate weathering. The silicate and carbonate weathering rates are 7.2 t km-2 yr-1 and 76 t km-2 yr-1, respectively. In comparison with carbonate weathering rates (43 t km-2 yr-1) by carbonic acid alone, the subsequent increase in rates indicates significant enhancement of weathering when combined with sulfuric and nitric acids. Therefore, the role of sulfuric and nitric acids in the rock weathering should be considered in the global carbon cycle.

  18. Oxygen-18 Exchange as a Measure of Accessibility of CO2 and HCO3− to Carbonic Anhydrase in Chlorella vulgaris (UTEX 263) 1

    Science.gov (United States)

    Tu, C. K.; Acevedo-Duncan, Mildred; Wynns, George C.; Silverman, David N.

    1986-01-01

    We have measured the exchange of 18O between CO2 and H2O in stirred suspensions of Chlorella vulgaris (UTEX 263) using a membrane inlet to a mass spectrometer. The depletion of 18O from CO2 in the fluid outside the cells provides a method to study CO2 and HCO3− kinetics in suspensions of algae that contain carbonic anhydrase since 18O loss to H2O is catalyzed inside the cells but not in the external fluid. Low-CO2 cells of Chlorella vulgaris (grown with air) were added to a solution containing 18O enriched CO2 and HCO3− with 2 to 15 millimolar total inorganic carbon. The observed depletion of 18O from CO2 was biphasic and the resulting 18C content of CO2 was much less than the 18O content of HCO3− in the external solution. Analysis of the slopes showed that the Fick's law rate constant for entry of HCO3− into the cell was experimentally indistinguishable from zero (bicarbonate impermeable) with an upper limit of 3 × 10−4 s−1 due to our experimental errors. The Fick's law rate constant for entry of CO2 to the sites of intracellular carbonic anhydrase was large, 0.013 per second, but not as great as calculated for no membrane barrier to CO2 flux (6 per second). The experimental value may be explained by a nonhomogeneous distribution of carbonic anhydrase in the cell (such as membrane-bound enzyme) or by a membrane barrier to CO2 entry into the cell or both. The CO2 hydration activity inside the cells was 160 times the uncatalyzed CO2 hydration rate. PMID:16664755

  19. Oxygen-18 Exchange as a Measure of Accessibility of CO(2) and HCO(3) to Carbonic Anhydrase in Chlorella vulgaris (UTEX 263).

    Science.gov (United States)

    Tu, C K; Acevedo-Duncan, M; Wynns, G C; Silverman, D N

    1986-04-01

    We have measured the exchange of (18)O between CO(2) and H(2)O in stirred suspensions of Chlorella vulgaris (UTEX 263) using a membrane inlet to a mass spectrometer. The depletion of (18)O from CO(2) in the fluid outside the cells provides a method to study CO(2) and HCO(3) (-) kinetics in suspensions of algae that contain carbonic anhydrase since (18)O loss to H(2)O is catalyzed inside the cells but not in the external fluid. Low-CO(2) cells of Chlorella vulgaris (grown with air) were added to a solution containing (18)O enriched CO(2) and HCO(3) (-) with 2 to 15 millimolar total inorganic carbon. The observed depletion of (18)O from CO(2) was biphasic and the resulting (18)C content of CO(2) was much less than the (18)O content of HCO(3) (-) in the external solution. Analysis of the slopes showed that the Fick's law rate constant for entry of HCO(3) (-) into the cell was experimentally indistinguishable from zero (bicarbonate impermeable) with an upper limit of 3 x 10(-4) s(-1) due to our experimental errors. The Fick's law rate constant for entry of CO(2) to the sites of intracellular carbonic anhydrase was large, 0.013 per second, but not as great as calculated for no membrane barrier to CO(2) flux (6 per second). The experimental value may be explained by a nonhomogeneous distribution of carbonic anhydrase in the cell (such as membrane-bound enzyme) or by a membrane barrier to CO(2) entry into the cell or both. The CO(2) hydration activity inside the cells was 160 times the uncatalyzed CO(2) hydration rate. PMID:16664755

  20. Oxygen-18 exchange as a measure of accessibility of CO2 and HCO3- to carbonic anhydrase in Chlorella vulgaris (UTEX 263)

    International Nuclear Information System (INIS)

    The exchange of 18O between CO2 and H2O in stirred suspensions of Chlorella vulgaris (UTEX 263) was measured using a membrane inlet to a mass spectrometer. The depletion of 18O from CO2 in the fluid outside the cells provides a method to study CO2 and HCO3- kinetics in suspensions of algae that contain carbonic anhydrase since 18O loss to H2O is catalyzed inside the cells but not in the external fluid. Low-CO2 cells of Chlorella vulgaris (grown with air) were added to a solution containing 18O enriched CO2 and HCO3- with 2 to 15 millimolar total inorganic carbon. The observed depletion of 18O from CO2 was biphasic and the resulting 18O content of CO2 was much less than the 18O content of HCO3- in the external solution. Analysis of the slopes showed that the Fick's law rate constant for entry of HCO3- into the cell was experimentally indistinguishable from zero (bicarbonate impermeable) with an upper limit of 3 x 10-4 s-1 due to experimental errors. The Fick's law rate constant for entry of CO2 to the sites of intracellular carbonic anhydrase was large, 0.013 per second, but not as great as calculated for no membrane barrier to CO2 flux (6 per second). The experimental value may be explained by a nonhomogeneous distribution of carbonic anhydrase in the cell (such as membrane-bound enzyme) or by a membrane barrier to CO2 entry into the cell or both. The CO2 hydration activity inside the cells was 160 times the uncatalyzed CO2 hydration rate

  1. Effect of temperature on the oxygen isotope composition of carbon dioxide (δ18O) prepared from carbonate minerals by reaction with polyphosphoric acid: An example of the rhombohedral CaCO 3-MgCO 3 group minerals

    Science.gov (United States)

    Crowley, Stephen F.

    2010-11-01

    Measurement of the ratio of 18O to 16O in CO 2(δ18O) produced from rhombohedral carbonate minerals in the compositional range CaCO 3-MgCO 3 by reaction with polyphosphoric acid (PPA), at temperatures of between 25 and 110 °C, shows that values of δ18O are linearly correlated ( r o > 0.99) with the reciprocal of absolute reaction temperature (K/ T). This observation is consistent with earlier studies documenting the effect of temperature on the kinetic fractionation of oxygen isotopes between parent carbonate and product CO 2 and H 2O during acid decomposition. However, analysis of the resultant data reveals: (1) a progressive increase in dδ18O/dT-1 with increasing Mg content, and (2) a significant variation in dδ18O/dT-1 between individual samples of carbonate of identical lattice symmetry and similar chemical composition. The overall increase in gradient with increasing Mg content is assumed to reflect cation radius dependent factors that control the bonding environment at the interface between the metal cation exposed at the surface of the reacting carbonate solid and a H 2CO 3 transitional species during disproportionation of H 2CO 3 to CO 2 and H 2O ("cluster model" of Guo et al., 2009). Phase-specific variations in dδ18O/dT-1 might result from differences in lattice structure variables (e.g., degree of lattice distortion, extent of positional disorder, and non-ideal mixing of substituent cations where carbonates depart from end-member compositions). Lattice structure variables may be dependent on geochemical conditions pertaining at the time of carbonate precipitation (e.g., biosynthetic versus inorganic precipitates) and suggests that dδ18O/dT-1 has the potential to vary, within limits, in response to both the chemical composition and structure of each carbonate sample. Because the oxygen isotope composition of carbonate minerals (δ18O) measured on the VPDB scale is defined by the oxygen isotope composition of CO 2 prepared from NBS19 (calcite) by

  2. Long-term biobarriers to plant and animal intrusions of uranium tailings. [24% trifluralin, 18% carbon black, and 58% polymer

    Energy Technology Data Exchange (ETDEWEB)

    Cline, J.F.; Burton, F.G.; Cataldo, D.A.; Skiens, W.E.; Gano, K.A.

    1982-09-01

    The objective of this project was to develop and evaluate the effectiveness of physical and chemical barriers designed to prevent plant and animal breachment of uranium mill tailings containment systems for an extended period of time. A polymeric carrier/biocide delivery system was developed and tested in the laboratory, greenhouse and field. A continuous flow technique was established to determine the release rates of the biocides from the PCD systems; polymeric carrier specifications were established. Studies were conducted to determine effective biocide concentrations required to produce a phytotoxic response and the relative rates of phytotoxin degradation resulting from chemical and biological breakdown in soils. The final PCD system developed was a pelletized system containing 24% trifluralin, 18% carbon black and 58% polymer. Pellets were placed in the soil at the Grand Junction U-tailings site at one in. and two in. intervals. Data obtained in the field determined that the pellets released enough herbicide to the soil layer to stop root elongation past the barrier. Physical barriers to subsurface movement of burrowing animals were investigated. Small crushed stone (1 to 1 1/2 in. diameter) placed over asphalt emulsion and multilayer soil seals proved effective as barriers to a small mammal (ground squirrels) but were not of sufficient size to stop a larger animal (the prairie dog). No penetrations were made through the asphalt emulsion or the clay layer of the multilayer soil seals by either of the two mammals tested. A literature survey was prepared and published on the burrowing habits of the animals that may be found at U-tailings sites.

  3. Oxygen-18 isotope of breath CO₂ linking to erythrocytes carbonic anhydrase activity: a biomarker for pre-diabetes and type 2 diabetes.

    Science.gov (United States)

    Ghosh, Chiranjit; Banik, Gourab D; Maity, Abhijit; Som, Suman; Chakraborty, Arpita; Selvan, Chitra; Ghosh, Shibendu; Chowdhury, Subhankar; Pradhan, Manik

    2015-01-01

    Carbonic anhydrase (CA), a well-characterized metalloenzyme, is associated with oxygen-18 ( (18)O)-isotopic fractionations of CO₂. To investigate how CA activity links the (18)O of breath CO₂ to pre-diabetes (PD) and type 2 diabetes (T2D) during metabolism, we studied pre- and post-dose CA activities in erythrocytes with simultaneous monitoring of (18)O/ (16)O-isotope ratios of breath CO₂ and thereafter elucidated potential metabolic pathways underlying CA alteration in the pathogenesis of T2D. Here we show that the post-dose CA activity in both T2D and PD was markedly enhanced, whereas the non-diabetic controls (NDC) exhibited a considerable reduction in post-dose CA activity when compared with their basal CA activities. However, T2D and PD exhibited isotopic enrichments of (18)O in breath CO₂, while a marked depletion of (18)O in CO₂ was manifested in NDC. Thus, the isotopic enrichments and depletions of (18)O in breath CO₂ were well correlated with the changes in CA activities for controls, PD and T2D. Our findings suggest the changes in CA activities in erythrocytes may contribute to the pathogenesis of T2D and the breath C (18)O (16)O regulated by the CA activity as a potential biomarker for non-invasive assessment of T2D, and thus may open a new method for treating T2D. PMID:25633556

  4. Oxygen-18 isotope of breath CO2 linking to erythrocytes carbonic anhydrase activity: a biomarker for pre-diabetes and type 2 diabetes

    Science.gov (United States)

    Ghosh, Chiranjit; Banik, Gourab D.; Maity, Abhijit; Som, Suman; Chakraborty, Arpita; Selvan, Chitra; Ghosh, Shibendu; Chowdhury, Subhankar; Pradhan, Manik

    2015-01-01

    Carbonic anhydrase (CA), a well-characterized metalloenzyme, is associated with oxygen-18 ( 18O)-isotopic fractionations of CO2. To investigate how CA activity links the 18O of breath CO2 to pre-diabetes (PD) and type 2 diabetes (T2D) during metabolism, we studied pre- and post-dose CA activities in erythrocytes with simultaneous monitoring of 18O/ 16O-isotope ratios of breath CO2 and thereafter elucidated potential metabolic pathways underlying CA alteration in the pathogenesis of T2D. Here we show that the post-dose CA activity in both T2D and PD was markedly enhanced, whereas the non-diabetic controls (NDC) exhibited a considerable reduction in post-dose CA activity when compared with their basal CA activities. However, T2D and PD exhibited isotopic enrichments of 18O in breath CO2, while a marked depletion of 18O in CO2 was manifested in NDC. Thus, the isotopic enrichments and depletions of 18O in breath CO2 were well correlated with the changes in CA activities for controls, PD and T2D. Our findings suggest the changes in CA activities in erythrocytes may contribute to the pathogenesis of T2D and the breath C 18O 16O regulated by the CA activity as a potential biomarker for non-invasive assessment of T2D, and thus may open a new method for treating T2D. PMID:25633556

  5. Carbonates in the Martian meteorite Allan Hills 84001 formed at 18 +/- 4 degrees C in a near-surface aqueous environment.

    Science.gov (United States)

    Halevy, Itay; Fischer, Woodward W; Eiler, John M

    2011-10-11

    Despite evidence for liquid water at the surface of Mars during the Noachian epoch, the temperature of early aqueous environments has been impossible to establish, raising questions of whether the surface of Mars was ever warmer than today. We address this problem by determining the precipitation temperature of secondary carbonate minerals preserved in the oldest known sample of Mars' crust--the approximately 4.1 billion-year-old meteorite Allan Hills 84001 (ALH84001). The formation environment of these carbonates, which are constrained to be slightly younger than the crystallization age of the rock (i.e., 3.9 to 4.0 billion years), has been poorly understood, hindering insight into the hydrologic and carbon cycles of earliest Mars. Using "clumped" isotope thermometry we find that the carbonates in ALH84001 precipitated at a temperature of approximately 18 °C, with water and carbon dioxide derived from the ancient Martian atmosphere. Furthermore, covarying carbonate carbon and oxygen isotope ratios are constrained to have formed at constant, low temperatures, pointing to deposition from a gradually evaporating, subsurface water body--likely a shallow aquifer (meters to tens of meters below the surface). Despite the mild temperatures, the apparently ephemeral nature of water in this environment leaves open the question of its habitability.

  6. Guanidine hydrochloride method for determination of water oxygen isotope ratios and the oxygen-18 fractionation between carbon dioxide and water at 25/sup 0/C

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, J.P. Jr.; Borthwick, J.; Harmon, R.S.; Gagnier, M.A.; Glahn, J.E.; Kinsel, E.P.; MacLeod, S.; Viglino, J.A.; Hess, J.W.

    1985-07-01

    A technique utilizing guanidine hydrochloride has been used to determine /sup 18/O//sup 16/O ratios in water. These O-isotope ratios have been considered in conjuction with /sup 18/O//sup 16/O ratios obtained from equilibration of CO/sub 2/ with surplus water to obtain a value for the carbon dioxide-water fractionation factor at 25/sup 0/C of 1.04143 +/- 0.00032 (99% confidence interval). This determination of ..cap alpha..CO/sub 2/-H/sub 2/O falls within the range of values cited in teh literature. 27 references, 3 tables.

  7. Kinetics and Equilibrium Studies on Adsorption of Acid Red 18 (Azo-Dye) Using Multiwall Carbon Nanotubes (MWCNTs) from Aqueous Solution

    OpenAIRE

    Shirmardi, Mohammad; Mesdaghinia, Alireza; MAHVI, Amir Hossein; Nasseri, Simin; Nabizadeh, Ramin

    2012-01-01

    Azo dyes are one of the synthetic dyes that are used in many textile industries. Adsorption is one of the most effective techniques for removal of dye-contaminated wastewater. In this work, efficiency of multiwalled carbon nanotubes (MWCNTs) as an adsorbent for removal of Acid Red 18 (azo-dye) from aqueous solution was determined. The parameters affecting the adsorption process such as contact time, pH, adsorbent dosage, and initial dye concentration were studied. Experimental results have sh...

  8. Oxygen-18 exchange as a measure of accessibility of CO/sub 2/ and HCO/sub 3//sup -/ to carbonic anhydrase in Chlorella vulgaris (UTEX 263)

    Energy Technology Data Exchange (ETDEWEB)

    Tu, C.K.; Acevedo-Duncan, M.; Wynns, G.C.; Silverman, D.N.

    1986-04-01

    The exchange of /sup 18/O between CO/sub 2/ and H/sub 2/O in stirred suspensions of Chlorella vulgaris (UTEX 263) was measured using a membrane inlet to a mass spectrometer. The depletion of /sup 18/O from CO/sub 2/ in the fluid outside the cells provides a method to study CO/sub 2/ and HCO/sub 3//sup -/ kinetics in suspensions of algae that contain carbonic anhydrase since /sup 18/O loss to H/sub 2/O is catalyzed inside the cells but not in the external fluid. Low-CO/sub 2/ cells of Chlorella vulgaris (grown with air) were added to a solution containing /sup 18/O enriched CO/sub 2/ and HCO/sub 3//sup -/ with 2 to 15 millimolar total inorganic carbon. The observed depletion of /sup 18/O from CO/sub 2/ was biphasic and the resulting /sup 18/O content of CO/sub 2/ was much less than the /sup 18/O content of HCO/sub 3//sup -/ in the external solution. Analysis of the slopes showed that the Fick's law rate constant for entry of HCO/sub 3//sup -/ into the cell was experimentally indistinguishable from zero (bicarbonate impermeable) with an upper limit of 3 x 10/sup -4/ s/sup -1/ due to experimental errors. The Fick's law rate constant for entry of CO/sub 2/ to the sites of intracellular carbonic anhydrase was large, 0.013 per second, but not as great as calculated for no membrane barrier to CO/sub 2/ flux (6 per second). The experimental value may be explained by a nonhomogeneous distribution of carbonic anhydrase in the cell (such as membrane-bound enzyme) or by a membrane barrier to CO/sub 2/ entry into the cell or both. The CO/sub 2/ hydration activity inside the cells was 160 times the uncatalyzed CO/sub 2/ hydration rate.

  9. Estimating groundwater mixing and origin in an overexploited aquifer in Guanajuato, Mexico, using stable isotopes (strontium-87, carbon-13, deuterium and oxygen-18).

    Science.gov (United States)

    Horst, Axel; Mahlknecht, Jürgen; Merkel, Broder J

    2007-12-01

    Stable Isotopes (strontium-87, deuterium and oxygen-18, carbon-13) have been used to reveal different sources of groundwater and mixing processes in the aquifer of the Silao-Romita Valley in the state of Guanajuato, Mexico. Calcite dissolution appeared to be the main process of strontium release leading to relatively equal (87)Sr/(86)Sr ratios of 0.7042-0.7062 throughout the study area which could be confirmed by samples of carbonate rocks having similar Sr ratios (0.7041-0.7073). delta(13)C values (-11.91- -6.87 per thousand VPDB) of groundwaters confirmed the solution of carbonates but indicated furthermore influences of soil-CO(2). Deuterium and (18)O contents showed a relatively narrow range of-80.1- -70.0 per thousand VSMOW and -10.2- -8.8 per thousand, VSMOW, respectively but are affected by evaporation and mixing processes. The use of delta(13)C together with (87)Sr/(86)Sr revealed three possible sources: (i) carbonate-controlled waters showing generally higher Sr-concentrations, (ii) fissure waters with low-strontium contents and (iii) infiltrating water which is characterized by low delta(13)C and (87)Sr/(86)Sr ratios. The third component is affected by evaporation processes taking place before and during infiltration which might be increased by extraction and reinfiltration (irrigation return flow). PMID:18041622

  10. Catalysis by cobalt(II)-substituted carbonic anhydrase II of the exchange of oxygen-18 between CO2 and H2O.

    Science.gov (United States)

    Tu, C K; Silverman, D N

    1985-10-01

    We have measured the catalysis by Co(II)-substituted bovine carbonic anhydrase II from red cells of the exchange of 18O between CO2 and H2O using membrane-inlet mass spectrometry. We chose Co(II)-substituted carbonic anhydrase II because the apparent equilibrium dissociation constant of HCO3- and enzyme at pH 7.4, KHCO3-eff approximately equal to 55 mM, was within a practicable range of substrate concentrations for the 18O method. For the native, zinc-containing enzyme KHCO3-eff is close to 500 mM at this pH. The rate constant for the release from the active site of water bearing substrate oxygen kH2O was dependent on the fraction of enzyme that was free, not bound by substrate HCO3- or anions. The pH dependence of kH2O in the pH range 6.0-9.0 can be explained entirely by a rate-limiting, intramolecular proton transfer between cobalt-bound hydroxide and a nearby group, probably His-64. The rate constant for this proton transfer was found to be 7 X 10(5) S-1 for the Co(II)-substituted enzyme and 2 X 10(6) S-1 for the native enzyme. These results are applied to models derived from proton-relaxation enhancement of water exchanging from the inner coordination shell of the cobalt in carbonic anhydrase. The anions iodide, cyanate, and thiocyanate inhibited catalysis of 18O exchange by Co(II)-substituted carbonic anhydrase II in a manner competitive with total substrate (CO2 and HCO3-) at chemical equilibrium and pH 7.4. These results are discussed in terms of observed steady-state inhibition patterns and suggest that there is no significant contribution of a ternary complex between substrate, inhibitor, and enzyme. PMID:3936538

  11. The impact of Carbonic Anhydrase on the partitioning of leaf and soil CO18O and COS gas exchange across scales

    Science.gov (United States)

    Wingate, L.; Wehr, R. A.; Commane, R.; Ogee, J.; Sauze, J.; Jones, S.; Launois, T.; Wohl, S.; Whelan, M.; Meredith, L. K.; Genty, B.; Gimeno, T.; Kesselmeier, J.; Bosc, A.; Cuntz, M.; Munger, J. W.; Nelson, D. D.; Saleska, S. R.; Wofsy, S. C.; Zahniser, M. S.

    2015-12-01

    Photosynthesis (GPP), the largest CO2 flux to the land surface, is currently estimated with considerable uncertainty at between 100-175 Pg C yr-1. More robust estimates of global GPP could be obtained from the atmospheric budgets of other valuable tracers, such as carbonyl sulfide (COS) or the oxygen isotopic composition (δ18O) of atmospheric CO2. However, quantifying GPP using these tracers hinges on a better understanding of how soil micro-organisms modify the atmospheric concentrations of CO18O and COS at large scales. In particular, understanding better the role and activity of the enzyme Carbonic Anhydrase (CA) in soil micro-organisms is critical. We present novel datasets and model simulations demonstrating the progress in the collection of multi-tracer field datasets and how a new generation of multi-tracer land surface models can provide valuable constraints on photosynthesis and respiration across scales.

  12. Oxygène-18, carbone-13, carbone-14 et diatomées dans les quatre carottes du lac Huynamarca (Bolivie) : premiers résultats

    OpenAIRE

    Wirrmann, Denis; Servant Vildary, Simone; Fontes, J.C.

    1982-01-01

    L'étude de géochimie isotopique des carbonates coquilliers de quatre carottes du lac Huynamarca (Bolivie), ainsi que les datations au carbone-14 de quelques échantillons montrent qu'au cours des dix derniers millénaires le bilan hydrologique du lac Titicaca a considérablement varié. Une phase sèche, située entre 3650 et 5325 ans B.P. se traduit par une baisse du niveau du lac d'au moins dix mètres par rapport à l'actuel, avec comme corrolaire l'augmentation de la teneur en sels dissous dans l...

  13. What drives the δ18O signal in European carbonates during LGM and Termination II - multi-archive approach revised

    Science.gov (United States)

    Kwiecien, Ola; Marwan, Norbert

    2016-04-01

    Due to their natural occurrence in a wide spectrum of environmental settings (marine, lacustrine, terrestrial) carbonates constitute one of the most widely used archives of (paleo)environmental information Although the thermodynamic laws controlling isotopic fractionation are universal, each of the different environments leaves its characteristic imprint on the carbonate chemistry. Consequently, individual carbonate-based records are a combination of regional-scale and archive- or site-specific factors. Environmental heterogeneity, even within a confined geographical area, remains a challenge in teasing out the regional or local nature of the recorded climatic signal. Similarly, interpretation of new data often pays tribute to outdated assumptions. Here we compare and contrast published oxygen isotope records from different archives (lake sediments and stalagmites) from central Europe and the Black Sea region covering the time span between 26 and 8 ka BP. This exercise aims at (1) identification of the regional-scale mechanisms responsible for common trends and (2) better understanding of archive- and site-specific factors accounting for differences in the records. Additionally, this approach allows for testing 'closed vs outflowing' scenarios for the glacial Black Sea basin. It appears that changes in isotopic composition of atmospheric precipitation are a common denominator for the analyzed records. Site-specific factors include moisture source (stalagmites) and volume of the basin (lakes). Both, comparison of available geochemical records and data-based theoretical calculations suggest that since the LGM and until reconnection with Mediterranean at ca. 8 ka BP the Black Sea was an open system.

  14. Stable isotope composition of inorganic carbonates from Lake Abiyata (Ethiopia): Attempt of reconstructing δ18O palaeohydrological changes during the Holocene

    International Nuclear Information System (INIS)

    Due to the sensitivity of its regional climate to the African monsoon seasonal shifting, Ethiopia has been designated as a key site for palaeoenvironmental reconstructions mainly within the IGBP-PAGES-PEPIII programme. Under the French-Ethiopian ERICA project, we focused on Lake Abiyata located in the Ziway-Shala basin (Central Ethiopia) which has experienced several lacustrine highstands during the Late Pleistocene and Holocene. At present, Lake Abiyata is a closed lake with a very flat catchment area, and corresponds to a half, deep graben infilled by 600-m of sedimentary deposits. In 1995, a 12.6-m-long sequence ABII was cored in Lake Abiyata. A reliable 14C-AMS chronology was defined on both organic matter and inorganic carbonates. Both the modern hydrologeological and geochemical balances of the 'groundwater-lake' system indicate that (i) carbonate cristallization mainly occurs at the water-sediment interface via the mixing of lake water and 14C-depleted groundwaters, and that (ii) modern algae form in equilibrium with the atmospheric reservoir. Phytoplankton is thus considered as an authigenic material, and Core ABII has registered 13,500 cal. yr B.P. of environmental history. The evidence of calcite precipitation at the water-sediment interface calls into question the direct palaeoclimatic reconstruction based on inorganic carbonates. Since the evolution of isotopic contents of carbonates might be linked to the variable proportion of the 'lake/groundwater' end-members in the mixing, calculations based on isotopic mass balance models may allow for the reconstruction of δ18O composition of the lake water. Two major changes can be highlighted: (i) the ∼12,000-5500 cal. yr B.P. period is associated to low 18O contents of lake water, and corresponds to an open hydrological system, with a high lacustrine phytoplanktonic productivity, and (ii) from ∼5500 cal. yr B.P. to Present, regressive conditions are suggested by the δ18O enrichment of the lake water

  15. Carbon Fixation and Oxygen Release of 18 Shrub Greening Trees%18种常见灌木绿化树种光合特性及固碳释氧能力分析

    Institute of Scientific and Technical Information of China (English)

    林欣; 林晨菲; 刘素青; 李林锋

    2014-01-01

    采用Li-6400便携式光合仪对广州市区18种常见园林绿化灌木树种的净光合速率日变化进行测定,估测其日净固碳释氧量;以日净固碳量为指标,运用离差平方和对不同灌木树种的固碳释氧能力进行聚类分析。结果表明:不同树种的光合特性有差异,光合速率日变化曲线呈单峰型和双峰型2种类型。大多数植物净光合速率的日最高值出现在上午10:00~12:00,少数植物出现在下午14:00~16:00。不同树种固碳释氧能力也有所差异,其中固碳释氧能力最强的4种灌木分别为马缨丹、假连翘、黄叶榕和红桑,最弱的为棕竹。依据日净固碳量将灌木树种聚为3类,日净固碳量高的如马缨丹、假连翘、黄叶榕、红桑[固碳量为7~10 g/(m2·d),释氧量为5~7 g/(m2·d)],日净固碳量中等的如叶子花、朱槿、九里香、米仔兰、鹅掌藤、含笑花、狗牙花[(固碳量为5~7 g/(m2·d),释氧量为3~5 g/(m2·d)],日净固碳量低的如朱蕉、变叶木、红背桂花、茉莉花、江边针葵、基及树、棕竹[(固碳量为2~5 g/(m2·d),释氧量为1~3 g/(m2·d)]。本研究将为碳汇林业指导下的园林绿化树种选择提供一定的参考价值。%The net photosynthetic rate of 18 shrub species in Guangzhou city were measured by using the Li-6400 portable photosynthetic system in order to evaluate their daily net carbon fixation and oxygen release of each species. The cluster analysis was also used to compare their net amount of carbon storage and oxygen release capacity of different shrub species. The results showed that the photosynthetic characteristics of shrub species are different, and the single-peak and double-peak curve of diurnal change of photosynthetic rate variation were observed. The peak values of photosynthetic rate for most plant appeared between 10 00 and 12 00. Only a few of plant's photosynthetic rate peak appeared between

  16. Dating Cactus: Annual and Sub-annual Variations of Oxygen-18, Carbon-13 and Radiocarbon in Spines of a Columnar Cactus, Carnegiea gigantea.

    Science.gov (United States)

    Dettman, D. L.; English, N. B.; Sandquist, D. R.; Williams, D. G.

    2006-12-01

    We measured δ18O, δ13C and F14C of spines from a long-lived columnar cactus, Carnegiea gigantea (saguaro), to resolve a record of plant physiological responses to annual and sub-annual climate variation in the eastern Sonoran Desert. Spines grow from the apex of the cactus and are arranged serially along the side of the cactus oldest at the base, youngest at the apex. To establish the age of the spine series, we measured F14C of spines collected at 8 different heights from the apex (3.77 m) to the base of a naturally occurring saguaro. These spines yielded fractions of modern carbon (F14C) from 0.9679 and 1.5537, indicating the presence of carbon in spine tissue derived from atmospheric nuclear testing. We used the F14C of spine tissue to calculate the year of spine emergence for each of the 11 spines, assuming minimal re-allocation of stored carbon to growing spines. At the same 8 heights, we interpolated the date of spine emergence from observed height measurements made between 1964 and 2002. A very strong positive correlation (linear regression, r2 = 0.99, P < 0.0001) between the F14C age of spines and ages determined from direct height measurements was observed, with a two year offset suggesting incorporation of carbon from fossil fuel combustion sources in the Tucson basin. Additionally, spine tips from 97 spines collected serially from the top half of the same saguaro (between 1.77 and 3.50 m) and representing ~15 years of growth, yielded δ18O variations in spine bulk organic material from 38° to 50° (VSMOW) and in δ13C from ° to 11.5° (VPDB). The δ18O and δ13C values were positively correlated over the entire record (linear regression, r2 = 0.22, P < 0.0001). These variations occurred at or near an annual frequency. The most negative δ18O and δ13C values in bulk spine organic material from the naturally occurring cactus were observed in spines grown shortly following the 1983 and 1993 strong El Niño winter precipitation events in Tucson

  17. Polyamine-Cladded 18-Ring-Channel Gallium Phosphites with High-Capacity Hydrogen Adsorption and Carbon Dioxide Capture.

    Science.gov (United States)

    Sie, Ming-Jhe; Lin, Chia-Her; Wang, Sue-Lein

    2016-06-01

    In this study, we synthesized a unique inorganic framework bearing the largest 18-membered-ring channels in gallium phosphites, denoted as NTHU-15, which displayed genuine porosity even though large organic templates were present. The idea of using the "template-cladded" strategy succeeded in releasing channel space of up to ∼24% of the unit-cell volume as highly positive-charged organic templates were manipulated to cling to the anionic inorganic walls. NTHU-15 showed both high H2 uptake of 3.8 mmol/g at 77 K and effective CO2 adsorption of ∼2.4 mmol/g at 298 K, which surpassed those of all other known extra-large-channel inorganic framework structures. NTHU-15 has been successful at overcoming the long-standing problem of organic-templated extra-large-channel structures as opposed to a "true open" framework. Moreover, it realized practical gas sorption functionality in innovated metal phosphites. In view of its high stability in hot water and high selectivity for CO2 adsorption, NTHU-15 may be the first novel inorganic framework material to be applied to the field of flue gas cleaning. PMID:27181272

  18. Carbon cycling in primary production bottle incubations: inferences from grazing experiments and photosynthetic studies using 14C and 18O in the Arabian Sea

    Science.gov (United States)

    Laws, Edward A.; Landry, Michael R.; Barber, Richard T.; Campbell, Lisa; Dickson, Mary-Lynn; Marra, John

    Estimates of photosynthesis based on the incorporation of 14C-labeled inorganic carbon into particulate carbon were compared to estimates of gross photosynthesis based on net O 2 production and the production of 18O2 from H218O during the US Joint Global Ocean Flux Study (US JGOFS) Arabian Sea process cruises. For samples incubated below the surface and at optical depthsMehler reaction, photorespiration, dark respiration, excretion, and grazing effects on the two estimates of photosynthesis. The 14C uptake : gross photosynthesis ratio was distinctly higher (0.62) for samples incubated at the surface. This result is likely due to UV light effects, since the O 2 and 14C incubations were done in quartz and polysulfone bottles, respectively. The 14C uptake : gross photosynthesis ratio was lower (0.31) for bottles incubated at optical depths>3. This result probably reflects an increase in the ratio of dark respiration to net photosynthesis in the vicinity of the compensation light level.

  19. Recharge areas and hydrochemistry of carbonate springs issuing from Semmering Massif, Austria, based on long-term oxygen-18 and hydrochemical data evidence

    Science.gov (United States)

    Yehdegho, Beyene; Reichl, Peter

    2002-10-01

    Résumé. Les teneurs en oxygène-18 et l'hydrochimie des sources émergeant du massif de Semmering ont été suivies de manière intensive dans le but de caractériser les zones de recharge et l'évolution hydrochimique. L'effet d'altitude sur le δ18O a été déterminé grâce aux données isotopiques et hydrogéologiques de petites sources de référence, principalement en terrains cristallins; cet effet est d'environ -0,27 et -0,21‰ par 100 m pour les versants respectivement nord et sud du massif. En appliquant ces valeurs, l'altitude moyenne de recharge des sources a été calculée. Pour les sources à fort débit issues des carbonates, elle est comprise entre 1,100 et 1,400 m, compatible avec le cadre topographique et hydrogéologique des calcaires et des dolomies de l'Austro-alpin inférieur alimentant ces sources. La composition chimique des sources des carbonates est dominée par les ions Ca2+, Mg2+, HCO3- et SO42-. Les sources sont presque toutes proches de la saturation par rapport à la calcite, mais sont sous-saturées en dolomite (sauf quelques sources proches de la saturation). Comme cela est habituel en ce qui concerne le dioxyde de carbone fourni par les sols en régions montagneuses, la pCO2 équilibrante moyenne est faible, comprise entre 10-3.0 et 10-2.5 atm (0,1 à 0,3% en volume). En ce qui concerne les variations à long terme, le pH, SIc, Sid et la pCO2 équilibrante sont soumis à des variations saisonnières, alors que les concentrations en Ca2+, Mg2+ et HCO3- ne varient pratiquement pas. En intégrant les résultats de δ18O et les données hydrochimiques, la variabilité altitudinale du chimisme des eaux souterraines des carbonates est démontrée. Reflétant les variations d'activité biologique et des conditions de recharge dans les zones d'alimentation, une covariation négative résulte de l'altitude de recharge et de la pCO2 et la concentration en HCO3- n'est pas modifiée par aucun des termes source ou puits, ce qui fait varier

  20. Recharge areas and hydrochemistry of carbonate springs issuing from Semmering Massif, Austria, based on long-term oxygen-18 and hydrochemical data evidence

    Science.gov (United States)

    Yehdegho, Beyene; Reichl, Peter

    2002-10-01

    Résumé. Les teneurs en oxygène-18 et l'hydrochimie des sources émergeant du massif de Semmering ont été suivies de manière intensive dans le but de caractériser les zones de recharge et l'évolution hydrochimique. L'effet d'altitude sur le δ18O a été déterminé grâce aux données isotopiques et hydrogéologiques de petites sources de référence, principalement en terrains cristallins; cet effet est d'environ -0,27 et -0,21‰ par 100 m pour les versants respectivement nord et sud du massif. En appliquant ces valeurs, l'altitude moyenne de recharge des sources a été calculée. Pour les sources à fort débit issues des carbonates, elle est comprise entre 1,100 et 1,400 m, compatible avec le cadre topographique et hydrogéologique des calcaires et des dolomies de l'Austro-alpin inférieur alimentant ces sources. La composition chimique des sources des carbonates est dominée par les ions Ca2+, Mg2+, HCO3- et SO42-. Les sources sont presque toutes proches de la saturation par rapport à la calcite, mais sont sous-saturées en dolomite (sauf quelques sources proches de la saturation). Comme cela est habituel en ce qui concerne le dioxyde de carbone fourni par les sols en régions montagneuses, la pCO2 équilibrante moyenne est faible, comprise entre 10-3.0 et 10-2.5 atm (0,1 à 0,3% en volume). En ce qui concerne les variations à long terme, le pH, SIc, Sid et la pCO2 équilibrante sont soumis à des variations saisonnières, alors que les concentrations en Ca2+, Mg2+ et HCO3- ne varient pratiquement pas. En intégrant les résultats de δ18O et les données hydrochimiques, la variabilité altitudinale du chimisme des eaux souterraines des carbonates est démontrée. Reflétant les variations d'activité biologique et des conditions de recharge dans les zones d'alimentation, une covariation négative résulte de l'altitude de recharge et de la pCO2 et la concentration en HCO3- n'est pas modifiée par aucun des termes source ou puits, ce qui fait varier

  1. Effects of carbon nanomaterials fullerene C60 and fullerol C60(OH)18–22 on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    International Nuclear Information System (INIS)

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C60), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C60(OH)18–22), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO·) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO· in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen (1O2) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p 1O2 generation; and (3) fullerol also decreased GCL activity and GSH formation (p 1O2 formation.

  2. Stable Isotope (delta OXYGEN-18, Delta Deuterium, Delta CARBON-13) Dendroclimatological Studies in the Waterloo Region of Southern Ontario, Canada, Between AD 1610 and 1990.

    Science.gov (United States)

    Buhay, William Mark

    Oxygen (delta^{18} O), hydrogen (delta^2H) and carbon (delta^{13}C) isotopes were measured in wood cellulose from elm, white pine and maple trees that grew in southwestern Ontario, Canada. The measured oxygen and hydrogen isotopic data were used for model-based reconstructions of delta^{18}{O}_{meteoric water}, mean annual temperature (MAT) and relative humidity for a period, AD 1610 to 1880, that precedes instrumental records of climate. The carbon isotope measurements were compared with the Cellulose Model inferred climate data to reveal additional environmental information. Modifications made to the Cellulose Model focused on the dynamics of oxygen and hydrogen isotopic fractionation in plants during evapotranspiration and photosynthetic assimilation. For instance, kinetic fractionation of ^{18}O was found to be predictable from theoretical considerations of leaf energy balance and boundary layer dynamics. Kinetic fractionation during evapotranspiration is sensitive to the nature of the boundary layer, which is controlled by leaf size and morphology. Generally, plants with small segmented leaves have a lower component of turbidity in the leaf boundary layer, which results in higher kinetic fractionation values, than do plants having large simple leaves and more turbulent boundary layers. Kinetic ^2H enrichment in plant leaf water can also be rationalized in terms of leaf size and morphology when an apparent temperature-dependent isotope effect, acting in opposition to evaporative enrichment, is taken into account. Accounting for this temperature -dependent isotope effect helps to: (1) reconcile hydrogen kinetic fractionation inconsistencies for different leaves; (2) explain a temperature effect previously attributed to variable biochemical fractionation during cellulose synthesis, and; (3) verify hydrogen biochemical effects in plants. This improved characterization of the oxygen and hydrogen isotopic effects in plants, using the modified Cellulose Model, helped

  3. Pathway focused protein profiling indicates differential function for IL-1B, -18 and VEGF during initiation and resolution of lung inflammation evoked by carbon nanoparticle exposure in mice

    Directory of Open Access Journals (Sweden)

    Hamelmann Eckard

    2009-12-01

    Full Text Available Abstract Background Carbonaceous nanoparticles possess an emerging source of human exposure due to the massive release of combustion products and the ongoing revolution in nanotechnology. Pulmonary inflammation caused by deposited nanoparticles is central for their adverse health effects. Epidemiological studies suggest that individuals with favourable lung physiology are at lower risk for particulate matter associated respiratory diseases probably due to efficient control of inflammation and repair process. Therefore we selected a mouse strain C3H/HeJ (C3 with robust lung physiology and exposed it to moderately toxic carbon nanoparticles (CNP to study the elicited pulmonary inflammation and its resolution. Methods 5 μg, 20 μg and 50 μg CNP were intratracheally (i.t. instilled in C3 mice to identify the optimal dose for subsequent time course studies. Pulmonary inflammation was assessed using histology, bronchoalveolar lavage (BAL analysis and by a panel of 62 protein markers. Results 1 day after instillation of CNP, C3 mice exhibited a typical dose response, with the lowest dose (5 μg representing the 'no effect level' as reflected by polymorphonuclear leucocyte (PMN, and BAL/lung concentrations of pro-inflammatory proteins. Histological analysis and BAL-protein concentration did not reveal any evidence of tissue injury in 20 μg CNP instilled animals. Accordingly time course assessment of the inflammatory response was performed after 3 and 7 days with this dose (20 μg. Compared to day 1, BAL PMN counts were significantly decreased at day 3 and completely returned to normal by day 7. We have identified protein markers related to the acute response and also to the time dependent response in lung and BAL. After complete resolution of PMN influx on day 7, we detected elevated concentrations of 20 markers that included IL1B, IL18, FGF2, EDN1, and VEGF in lung and/or BAL. Biological pathway analysis revealed these factors to be involved in a

  4. Partitioning Net Ecosystem Carbon Exchange Into net Assimilation and Respiration With Canopy-scale Isotopic Measurements: an Error Propagation Analysis With Both 13C and 18O Data

    Science.gov (United States)

    Peylin, P.; Ogee, J.; Cuntz, M.; Bariac, T.; Ciais, P.; Brunet, Y.

    2003-12-01

    Stable CO2 isotope measurements are increasingly used to partition the net CO2 exchange between terrestrial ecosystems and the atmosphere in terms of non-foliar respiration (FR) and gross photosynthesis (FA). However the accuracy of the partitioning strongly depends on the isotopic disequilibrium between these two gross fluxes and a rigorous estimation of the errors on FA and FR is needed. In this study we account and propagate uncertainties on all terms in the mass balance equations for total and "labeled" CO2 in order to get precise estimates of the errors on FA and FR. We applied our method to a maritime pine forest in the Southwest of France. Using the δ 13C-CO2 and CO2 measurements, we show that the resulting uncertainty associated to the gross fluxes can be as large as 4 æmol m-2 s-1. In addition, even if we could get more precise estimates of the isoflux and the isotopic signature of FA we show that this error would not be significantly reduced. This is because the isotopic disequilibrium between FA and FR is around 2-3‰ , i.e. the order of magnitude of the uncertainty on the isotopic signature of FR (δ R). With δ 18O-CO2 and CO2 measurements, the uncertainty associated to the gross fluxes lies also around 4 æmol m-2 s-1. On the other hand, it could be dramatically reduced if we were able to get more precise estimates of the CO18O isoflux and the associated discrimination during photosynthesis. This is because the isotopic disequilibrium between FA and FR is large, of the order of 10-15‰ , i.e. much larger than the uncertainty on δ R. The isotopic disequilibrium between FA and FR or the uncertainty on δ R vary among ecosystems and over the year. Our approach may help to choose the best strategy to study the carbon budget of a given ecosystem using stable isotopes.

  5. Combined δ11B, δ13C, and δ18O analyses of coccolithophore calcite constrains the response of coccolith vesicle carbonate chemistry to CO2-induced ocean acidification

    Science.gov (United States)

    Liu, Yi-Wei; Tripati, Robert; Aciego, Sarah; Gilmore, Rosaleen; Ries, Justin

    2016-04-01

    Coccolithophorid algae play a central role in the biological carbon pump, oceanic carbon sequestration, and in marine food webs. It is therefore important to understand the potential impacts of CO2-induced ocean acidification on these organisms. Differences in the regulation of carbonate chemistry, pH, and carbon sources of the intracellular compartments where coccolith formation occurs may underlie the diverse calcification and growth responses to acidified seawater observed in prior experiments. Here we measured stable isotopes of boron (δ11B), carbon (δ13C) and oxygen (δ18O) within coccolith calcite, and δ13C of algal tissue to constrain carbonate system parameters in two strains of Pleurochrysis carterae (P. carterae). The two strains were cultured under variable pCO2, with water temperature, salinity, dissolved inorganic carbon (DIC), and alkalinity monitored. Notably, PIC, POC, and PIC/POC ratio did not vary across treatments, indicating that P. carterae is able to calcify and photosynthesize at relatively constant rates irrespective of pCO2 treatment. The δ11B data indicate that mean pH at the site of coccolith formation did not vary significantly in response to elevated CO2. These results suggest that P. carterae regulates calcifying vesicle pH, even amidst changes in external seawater pH. Furthermore, δ13C and δ18O data suggest that P. carterae may utilize carbon from a single internal DIC pool for both calcification and photosynthesis, and that a greater proportion of dissolved CO2 relative to HCO3- enters the internal DIC pool under acidified conditions. These results suggest that P. carterae is able to calcifyand photosynthesize at relatively constant rates across pCO2 treatments by maintaining pH homeostasis at their site of calcification and utilizing a greater proportion of aqueous CO2.

  6. 纯牛奶中18碳TFA及9c,11 t-CLA含量的测定研究%Study on 18-carbon trans fatty acid and 9c,11t-conjugated linoleic acid contents in milk

    Institute of Scientific and Technical Information of China (English)

    章萍萍; 赵培城

    2010-01-01

    为了精确测量出纯牛奶中18碳TFA及9c,11t-CLA的含量,本实验通过毛细管气相色谱法,并采用内标法,对纯牛奶进行了检测,结果显示,纯牛奶中18碳脂肪酸的质量百分比约为35.43% ,18碳TFA的质量百分比约为2.27%,而其中C18:1-llt的质量百分比达到1.28%,占所有18碳TFA的一半以上,约为56.36%,同时,牛奶中C18:2 -9c,11t的质量百分比只为0.11%,其含量远少于TFA.

  7. Study of the mechanism of corrosion of some ferritic steels in high-pressure carbon dioxide with the aid of oxygen-18 as a tracer: Pt. 3. Fe-9% Cr-1% Mo-0. 26% Sr

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, L.F.R.; Calvert, J.M.; Gleave, C.; Lees, D.G.; Rowlands, P.C.

    1989-04-08

    The oxidation mechanism of a commercial Fe-9% Cr steel in high-pressure (4.1 MPa) carbon dioxide at 913 K have been investigated with the aid of charged-particle nuclear techniques and /sup 18/O as a tracer. Duplex and multilayered oxide-scales were examined. Both types of scale grew at the oxide-gas interface. Substantial growth occurred in the inner half of the inner layer on the specimen with the duplex scale; very little growth occurred within the inner layer of the multilayered scale. A possible oxidation sequence which could account for the /sup 18/O distributions is proposed.

  8. Constraints on the factors controlling 13C-18O bond abundances in biologically precipitated carbonates from measurements of marine calcifiers cultured at variable temperature, pH, and salinity

    Science.gov (United States)

    Conchas, T. E.; Eagle, R.; Eiler, J. M.; Ries, J. B.; Freitas, P. S.; Hiebenthal, C.; Wanamaker, A. D.; Tripati, A. K.

    2012-12-01

    Marine mollusks and corals are widely used as archives of past climate change; oxygen isotopic composition (δ18O value) of their carbonate minerals is perhaps the most commonly used proxy to reconstruct paleoclimate from these marine calcifiers. However, oxygen isotope paleothermometry of mollusks and corals is complicated by non-equilibrium "vital effects" and variations in seawater pH changes, both of which influence the net fractionation of oxygen isotopes between carbonate and water. Carbonate "clumped isotope" thermometry is an emerging approach that potentially addresses these ambiguities. Here we report measurements of abundance of 13C-18O bonds (described by the measured parameter Δ47) in a variety of marine calcifiers cultured under controlled conditions. Previous studies on biologically precipitated samples such as foraminifera, coccoliths, and corals have shown that Δ47 values are related to calcification temperature with a relationship that is generally similar to inorganic carbonate. However, the influence of effects other than temperature has not been extensively studied and little work has been done to explore the potential for small non-equilibrium effects in cultured specimens that were grown under controlled conditions. In this study, we report δ18O and Δ47 measurements of mollusk specimens that were cultured at several temperatures ranging from 5 to 25°C, as well as different pH and salinity values. We also report data for other marine calcifiers including the temperate coral species Oculina arbuscula and the coralline red algae Neogoniolithon sp., that were cultured at a single temperature but variable pH.

  9. Cocatalyzed oxidation of carbon monoxide and triphenylphosphine using complexes derived from hexarhodium hexadecacarbonyl as homogeneous catalyst. Characterization of rhodium carbonyl intermediates, oxygen-18 labeling to identify oxygen atom sources, and observation of catalyzed oxygen atom exchange between carbon dioxide and water

    Energy Technology Data Exchange (ETDEWEB)

    Dickson, M.K.; Dixit, N.S.; Roundhill, D.M.

    1983-10-01

    Hexarhodium hexadecacarbonyl, Rh/sub 6/(CO)/sub 16/, will cocatalyze a reaction with molecular oxygen involving the conversion both of carbon monoxide to carbon dioxide and of triphenylphosphine (PPh/sub 3/) to triphenylphosphine oxide (OPPh/sub 3/). Solution infrared spectroscopy in the carbonyl region in benzene solvent shows that the catalytic cycle passes through the red Rh/sub 2/(CO)/sub 2/-(PPh/sub 3/)/sub 4/(C/sub 6/H/sub 6/)/sub 2/, the yellow Rh/sub 2/(CO)/sub 6/(PPh/sub 3/)/sub 2/, and the red Rh/sub 4/(CO)/sub 10/(PPh/sub 3/)/sub 2/. Final return to Rh/sub 6/(CO)/sub 16/ does not occur under the ambient temperature and pressure conditions used but can be achieved by elevating these conditions. Addition of carbon dioxide to a mixture of Rh/sub 6/(CO)/sub 16/, CO, and PPh/sub 3/ in the presence of added /sup 18/OH/sub 2/ shows that the rhodium compounds will catalyze oxygen exchange between carbon dioxide and the oxygen atom of water. A pathway for equilibration of oxygen isotope in the catalyzed conversion of coordinated carbonyl to carbon dioxide via metallocarboxylate intermediates is proposed. The equilibration of oxygen isotope from water into carbon dioxide catalyzed by rhodium carbonyl clusters is suggested to proceed via hydroxyrhodium intermediates. 3 figures, 3 tables

  10. Laboratory measurement of the 2-centimeter, 2/11/-2/12/ transition of normal formaldehyde and its carbon-13 and oxygen-18 species.

    Science.gov (United States)

    Tucker, K. D.; Tomasevich, G. R.; Thaddeus, P.

    1972-01-01

    Beam-maser spectrometric measurements to an accuracy of about 100 Hz have been conducted of the 2(11)-2(12) transition for the isotopic species of greatest astronomical interest - i.e., H2CO, H2(13)CO, and H2C(18)O. The samples used were not isotopically enriched, monomeric formaldehyde vapors. For these species, all the coupling constants required to calculate the hyperfine structure of any rotational transition have been determined.

  11. Moss stable isotopes (carbon-13, oxygen-18) and testate amoebae reflect environmental inputs and microclimate along a latitudinal gradient on the Antarctic Peninsula.

    Science.gov (United States)

    Royles, Jessica; Amesbury, Matthew J; Roland, Thomas P; Jones, Glyn D; Convey, Peter; Griffiths, Howard; Hodgson, Dominic A; Charman, Dan J

    2016-07-01

    The stable isotope compositions of moss tissue water (δ(2)H and δ(18)O) and cellulose (δ(13)C and δ(18)O), and testate amoebae populations were sampled from 61 contemporary surface samples along a 600-km latitudinal gradient of the Antarctic Peninsula (AP) to provide a spatial record of environmental change. The isotopic composition of moss tissue water represented an annually integrated precipitation signal with the expected isotopic depletion with increasing latitude. There was a weak, but significant, relationship between cellulose δ(18)O and latitude, with predicted source water inputs isotopically enriched compared to measured precipitation. Cellulose δ(13)C values were dependent on moss species and water content, and may reflect site exposure to strong winds. Testate amoebae assemblages were characterised by low concentrations and taxonomic diversity, with Corythion dubium and Microcorycia radiata types the most cosmopolitan taxa. The similarity between the intra- and inter-site ranges measured in all proxies suggests that microclimate and micro-topographical conditions around the moss surface were important determinants of proxy values. Isotope and testate amoebae analyses have proven value as palaeoclimatic, temporal proxies of climate change, whereas this study demonstrates that variations in isotopic and amoeboid proxies between microsites can be beyond the bounds of the current spatial variability in AP climate. PMID:27003701

  12. Moss stable isotopes (carbon-13, oxygen-18) and testate amoebae reflect environmental inputs and microclimate along a latitudinal gradient on the Antarctic Peninsula.

    Science.gov (United States)

    Royles, Jessica; Amesbury, Matthew J; Roland, Thomas P; Jones, Glyn D; Convey, Peter; Griffiths, Howard; Hodgson, Dominic A; Charman, Dan J

    2016-07-01

    The stable isotope compositions of moss tissue water (δ(2)H and δ(18)O) and cellulose (δ(13)C and δ(18)O), and testate amoebae populations were sampled from 61 contemporary surface samples along a 600-km latitudinal gradient of the Antarctic Peninsula (AP) to provide a spatial record of environmental change. The isotopic composition of moss tissue water represented an annually integrated precipitation signal with the expected isotopic depletion with increasing latitude. There was a weak, but significant, relationship between cellulose δ(18)O and latitude, with predicted source water inputs isotopically enriched compared to measured precipitation. Cellulose δ(13)C values were dependent on moss species and water content, and may reflect site exposure to strong winds. Testate amoebae assemblages were characterised by low concentrations and taxonomic diversity, with Corythion dubium and Microcorycia radiata types the most cosmopolitan taxa. The similarity between the intra- and inter-site ranges measured in all proxies suggests that microclimate and micro-topographical conditions around the moss surface were important determinants of proxy values. Isotope and testate amoebae analyses have proven value as palaeoclimatic, temporal proxies of climate change, whereas this study demonstrates that variations in isotopic and amoeboid proxies between microsites can be beyond the bounds of the current spatial variability in AP climate.

  13. Paragraf 18

    DEFF Research Database (Denmark)

    Lundgaard Andersen, Linda; Neerup, Stine; Cauchi, Pernille

    Redegørelsen tegner et aktuelt billede af bredden og variationen af samarbejdet mellem de frivillige sociale foreninger og kommuner i fem udvalgte kommuner. Den giver et billede af hvilke opgaver der varetages inden for det frivillige sociale arbejde, støttet gennem § 18 midler i serviceloven og...

  14. WA18

    CERN Multimedia

    1977-01-01

    Front view. The target plates are cut from marble (3x3 m slabs surrounded by magnetized iron) and allow the use of the calorimeter as a muon polarimeter. WA18 was CHARM, the experiment of the CERN-Hamburg-Amsterdam-Rome(INFN)-Moskow(ITEP) Collaboration

  15. δ18O water isotope in the iLOVECLIM model (version 1.0 – Part 3: A paleoperspective based on present-day data-model comparison for oxygen stable isotopes in carbonates

    Directory of Open Access Journals (Sweden)

    T. Caley

    2013-03-01

    Full Text Available Oxygen stable isotopes (18O are among the most usual tools in paleoclimatology/paleoceanography. Simulation of oxygen stable isotopes allows testing how the past variability of these isotopes in water can be interpreted. By modelling the proxy directly in the model, the results can also be directly compared with the data. Water isotopes have been implemented in the global three-dimensional model of intermediate complexity iLOVECLIM allowing fully coupled atmosphere-ocean simulations. In this study, we present the validation of the model results for present day climate against global database for oxygen stable isotopes in carbonates. The limitation of the model together with the processes operating in the natural environment reveal the complexity of use the continental calcite 18O signal of speleothems for a data-model comparison exercise. On the contrary, the reconstructed surface ocean calcite δ18O signal in iLOVECLIM does show a very good agreement with late Holocene database (foraminifers at the global and regional scales. Our results indicate that temperature and the isotopic composition of the seawater are the main control on the fossil δ18O signal recorded in foraminifer shells and that depth habitat and seasonality play a role but have secondary importance. We argue that a data-model comparison for surface ocean calcite δ18O in past climate, such as the last glacial maximum (≈21 000 yr, could constitute an interesting tool for mapping the potential shifts of the frontal systems and circulation changes throughout time. Similarly, the potential changes in intermediate oceanic circulation systems in the past could be documented by a data (benthic foraminifers-model comparison exercise whereas future investigations are necessary in order to quantitatively compare the results with data for the deep ocean.

  16. δ18O water isotope in the iLOVECLIM model (version 1.0 – Part 3: A palaeo-perspective based on present-day data–model comparison for oxygen stable isotopes in carbonates

    Directory of Open Access Journals (Sweden)

    T. Caley

    2013-09-01

    Full Text Available Oxygen stable isotopes (δ18O are among the most useful tools in palaeoclimatology/palaeoceanography. Simulation of oxygen stable isotopes allows testing how the past variability of these isotopes in water can be interpreted. By modelling the proxy directly in the model, the results can also be directly compared with the data. Water isotopes have been implemented in the global three-dimensional model of intermediate complexity iLOVECLIM, allowing fully coupled atmosphere–ocean simulations. In this study, we present the validation of the model results for present-day climate against the global database for oxygen stable isotopes in carbonates. The limitation of the model together with the processes operating in the natural environment reveal the complexity of use the continental calcite-δ18O signal of speleothems for a global quantitative data–model comparison exercise. On the contrary, the reconstructed surface ocean calcite-δ18O signal in iLOVECLIM does show a very good agreement with the late Holocene database (foraminifers at the global and regional scales. Our results indicate that temperature and the isotopic composition of the seawater are the main control on the fossil-δ18O signal recorded in foraminifer shells when all species are grouped together. Depth habitat, seasonality and other ecological effects play a more significant role when individual species are considered. We argue that a data–model comparison for surface ocean calcite δ18O in past climates, such as the Last Glacial Maximum (≈ 21 000 yr, could constitute an interesting tool for mapping the potential shifts of the frontal systems and circulation changes throughout time. Similarly, the potential changes in intermediate oceanic circulation systems in the past could be documented by a data (benthic foraminifers-model comparison exercise whereas future investigations are necessary in order to quantitatively compare the results with data for the deep ocean.

  17. Improved oil recovery in Mississippian carbonate reservoirs of Kansas near term Class 2. Annual report, September 18, 1994--March 15, 1997

    Energy Technology Data Exchange (ETDEWEB)

    Carr, T.R.; Green, D.W.; Willhite, G.P.

    1998-04-01

    This annual report describes progress during the second year of the project entitled {open_quotes}Improved Oil Recovery in Mississippian Carbonate Reservoirs in Kansas{close_quotes}. This project funded under the Department of Energy`s Class 2 program targets improving the reservoir performance of mature oil fields located in shallow shelf carbonate reservoirs. The focus of this project is development and demonstration of cost-effective reservoir description and management technologies to extend the economic life of mature reservoirs in Kansas and the mid-continent. As part of the project, several tools and techniques for reservoir description and management were developed, modified and demonstrated. These include: (1) a new approach to subsurface visualization using electric logs ({open_quotes}Pseudoseismic{open_quotes}); (2) a low-cost easy-to-use spreadsheet log analysis software (PfEFFER); and (3) an extension of the BOAST-3 computer program for full field reservoir simulation. The world-wide-web was used to provide rapid and flexible dissemination of the project results through the Internet. Included in this report is a summary of significant project results at the demonstration site (Schaben Field, Ness County, Kansas). These results include an outline of the reservoir description based on available and newly acquired data and reservoir simulation results. Detailed information is available on-line through the Internet. Based on the reservoir simulation, three infill wells will be drilled to validate the reservoir description and demonstrate the effectiveness of the proposed reservoir management strategies. The demonstration phase of the project has just begun and will be presented in the next annual report.

  18. OXYGEN-18 + OXYGEN-18 Reactions.

    Science.gov (United States)

    Yuan, Ren-Feng

    Cross sections for the ^{18 }O + ^{18}O reactions (fusion, inelastic excitation and transfer reactions) have been determined in the range 6.73 <=q E_{c.m}<=q 13.24 MeV by measuring the low-lying gamma-ray transitions in the residual nuclei with a high resolution Ge detector. A statistical model calculation of the populations of the residual nuclear states was employed in deducing cross sections from the measured gamma -yields. gamma-ray angular distributions were determined at E_{lab} = 20.0 MeV. The total fusion cross sections were compared with an IWBC calculation employing a parameter set obtained from fitting elastic scattering data. The interaction barrier shape has been obtained by means of the BKN inversion procedure and compared with the barriers for other oxygen isotopes. The inelastic scattering cross section and the two-neutron transfer reaction cross section are reproduced well by the DWBA approach.

  19. Application of poly 1,8-diaminonaphthalene/multiwalled carbon nanotubes-COOH hybrid material as an efficient sorbent for trace determination of cadmium and lead ions in water samples.

    Science.gov (United States)

    Nabid, Mohammad Reza; Sedghi, Roya; Behbahani, Mohammad; Arvan, Behnoush; Heravi, Majid M; Oskooie, Hossein Abdi

    2014-07-01

    Poly 1,8-diaminonaphthalene/multiwalled carbon nanotubes-COOH hybrid material as an effective sorbents in solid phase extraction has been developed for the separation and preconcentration of Cd(II) and Pb(II) at trace levels in environmental water samples. The results indicate that the novel nanocomposite show a high affinity for these heavy metals due to the presence of several good extractive sites, which are introduced to the synthesized nanocomposite The maximum adsorption capacity of the synthesized sorbent for cadmium and lead ions was found to be 101.2 and 175.2 mg g(-1) , respectively. The detection limits of this method were 0.09 and 0.7 ng ml(-1) for Cd(II) and Pb(II), respectively.

  20. Carbon Tetrachloride Flow and Transport in the Subsurface of the 216-Z-18 Crib and 216-Z-1A Tile Field at the Hanford Site: Multifluid Flow Simulations and Conceptual Model Update

    Energy Technology Data Exchange (ETDEWEB)

    Oostrom, Mart; Rockhold, Mark L.; Thorne, Paul D.; Last, George V.; Truex, Michael J.

    2006-10-31

    Carbon tetrachloride (CT) was discharged to the 216-Z-9, Z-1A, and Z-18 waste sites that are included in the 200-PW-1 Operable Unit in Hanford 200 West Area. Fluor Hanford, Inc. is conducting a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) remedial investigation/feasibility study (RI/FS) for the 200-PW-1 Operable Unit. As part of this overall effort, Pacific Northwest National Laboratory (PNNL) was contracted to improve the conceptual model of how CT is distributed in the Hanford 200 West Area subsurface through use of numerical flow and transport modeling. This work supports the U.S. Department of Energy's (DOE's) efforts to characterize the nature and distribution of CT in the 200 West Area and subsequently select an appropriate final remedy.

  1. Monitoring bone and soft-tissue tumors after carbon-ion radiotherapy using 18F-FDG positron emission tomography: a retrospective cohort study

    International Nuclear Information System (INIS)

    The results of treatment for malignant bone and soft-tissue tumors arising from the deep trunk and pelvis are still not acceptable due to the relatively high recurrence and low overall survival rates. Recently, carbon ion radiotherapy (CIRT) was applied for several malignancies, including bone and soft-tissue sarcomas, and provided favorable results. However, it has been unclear what modalities should be used for evaluating the response and for the follow-up of these patients. Here, we analyzed the methods used to predict local recurrence and to find local failures or metastases. We analyzed 37 patients with bone and soft-tissue tumors who received CIRT at our institute. The patients were examined with FDG positron emission tomography (PET) and enhanced MRI before and three months after CIRT. The pre-treatment maximum standardized uptake value (SUVmax), and that three months after treatment, the difference between the pre- and post-CIRT SUVmax, the ratio of the post- to pre-SUVmax in FDG-PET and the size of the tumors were evaluated as predictors for local recurrence. FDG-PET and enhanced MRI were used to detect local recurrence. Local recurrence appeared in 10 cases after CIRT. Nine of the 10 lesions (90.0 %) were detected with FDG-PET, while enhanced MRI detected just 50.0 % of the recurrences. One case of local recurrence, in which the lesion was negative on FDG-PET, was detected using enhanced MRI. A receiver operating characteristic curve analysis showed that neither the SUVmax on FDG-PET nor the tumor size before or three months after CIRT could be used to predict local recurrence. The combination of FDG-PET and enhanced MRI is recommended to detect local recurrence for patients with sarcomas who have received CIRT; however, no parameters obtained during the examinations performed before and three months after CIRT accurately predicted the development of local recurrence

  2. 我国9省(市)3~18岁儿童青少年碳酸饮料消费现状分析%Analysis on status of carbonated beverage consumption among children and adolescents aged 3 -18 years in ;nine provinces of China

    Institute of Scientific and Technical Information of China (English)

    刘飒娜; 陶婉亭; 毛伟峰; 刘爱东; 刘兆平; 张兵

    2015-01-01

    Objective To learn status of carbonated beverage consumption among children and adolescents aged 3 -18 years in nine provinces of China and provide scientific evidence for instruction on soft drinks consumption of children and youth .Methods Multi-stage stratified random sampling method was used and 2585 children of youth aged 3 -18 years among 9 provinces were selected in 2013.Consumption data were collected by using consecutive 3 day 24h recalls and one month food frequency survey.Results Differences of consumption were found among 3 -18 years old children and youth regarding to both amout and frequency in nine provinces.Subjectives in urban areas have higher consumption ratio of 45.1%than those in rural area (χ2 =19.529,P <0.01).Children aged 7 -13 years have the highest consumption frequency of 1 -3 times per week in view of soda drinks,which is around 45.4%.Children and youth in urban area consumed higher amount of carbonated beverage than those in rural area (P < 0.05 ), which is 31.4mL/d and 15.1mL/d respectively.Meanwhile,male subjectives drank more carbonated beverage than female subjectives (P <0.05),which is 28.8 mL/d and 19.5 mL/d respectively.The average amount of consumption was highest in subjectives from families at mid-dle income level,followed by that of families at high and low income levels,which were 19.7 mL/d,28.5 mL/d and 19.2 mL/d respectively.Conclusion The consumption of carbonated beverage manifested an increasing trend among children and youth in China .Subsequently,effective intervention measures should be applied to instruct children and youth to select and consume carbonated beverage wisely.%目的:了解我国9省(市)3~18岁儿童青少年碳酸饮料消费现状,为指导我国儿童青少年饮料合理消费提供科学依据。方法采用多阶段分层随机整群抽样方法,2013年在我国9个省(市)选取了2585名3~18岁儿童青少年;消费量数据采用非连续3d 24h 回顾法和

  3. A comparative study of carbon-11 methionine PET and Fluorine-18 fluorodeoxyglucose PET for the differentiation of benign lesion and low grade glioma%11碳-蛋氨酸与18氟-脱氧葡萄糖在脑良性病变及低级别胶质瘤诊断中的比较

    Institute of Scientific and Technical Information of China (English)

    王欣璐; 韩立新; 尹吉林; 王成; 姜丽莎; 谭思婷; 王伟民

    2015-01-01

    界的显示均明显优于18 F-FDG FDG,11 C-MET 还可检测和随访低级别胶质瘤(即惰性肿瘤)的生长情况,可为临床提供更多诊断、预后及治疗信息,因此,11 C-MET 可常规应用于脑内占位病变的显示,且其效果优于18 F-FDG.%Aim:As the study of Carbon-11 methionine (MET)and fluorine-18 fluorodeoxyglucose (FDG)in differentiating brain benign and low grade glioma was seldom.The aim of this study was to de-termine the effect of these two tracers for distinguishing two groups of patients and evaluating the extent of lesions.Methods:Both carbon-11 MET and fluorine-18 FDG have been used to evaluate brain benign and low grade glioma (LGG).MET positron emission tomography (PET)and FDG PET were all per-formed in 22 patients (5 brain benign lesions,17 low grade glioma WHO grade I and II)within one week for a single patient,Both MET and FDG uptake of the lesions were evaluated by a semiquantitative analy-sis using the standardized uptake value.The Tumor/normal brain uptake ratio (T/N ratio)were calculat-ed in two groups of patients.Results:MET uptake was not significantly different among these two groups (benign:1.59 ±0.28 and LGG:1.52 ±0.48).Similarily,FDG uptake was not significantly different among the two groups (benign:0.91 ±0.48 and 0.77 ±0.65)also.No significantly correlation was ob-served between MET uptake and FDG uptake.19 /22 hypermetabolization of patients were found in MET PET and 17 /22 hypometabolization of patients were found in FDG PET.The extents of increased MET uptake in 17 cases were larger than that of the increased FDG uptake.Conclusion:It is found that both MET and FDG are not useful for distinguishing with benign and LGG.MET was found to be highly useful for detecting benign and LGG,and for evaluating the extent of these lesions which were blurred in FDG PET.MET was also useful for monitoring the growth of LGG.In a word,MET was considered as routine examination for brain lesions.

  4. Partitioning net ecosystem carbon exchange into net assimilation and respiration with canopy-scale isotopic measurements: An error propagation analysis with 13CO2 and CO18O data

    Science.gov (United States)

    OgéE, J.; Peylin, P.; Cuntz, M.; Bariac, T.; Brunet, Y.; Berbigier, P.; Richard, P.; Ciais, P.

    2004-06-01

    Stable CO2 isotope measurements are increasingly used to partition the net CO2 exchange between terrestrial ecosystems and the atmosphere in terms of nonfoliar respiration (FR) and net photosynthesis (FA) in order to better understand the variations of this exchange. However, the accuracy of the partitioning strongly depends on the isotopic disequilibrium between these two gross fluxes, and a rigorous estimation of the errors on FA and FR is needed. In this study, we account for and propagate uncertainties on all terms in the mass balance and isotopic mass balance equations for CO2 in order to get accurate estimates of the errors on FA and FR. We apply our method to a maritime pine forest in the southwest of France. Nighttime Keeling plots are used to estimate the 13C and 18O isotopic signature of FR (δR), and for both isotopes the a priori uncertainty associated with this term is estimated to be around 2‰ at our site. Using δ13C-CO2 and [CO2] measurements, we then show that the uncertainty on instantaneous values of FA and FR can be as large as 4 μmol m-2 s-1. Even if we could get more accurate estimates of the net CO2 flux, the isoflux, and the isotopic signatures of FA and FR, this uncertainty would not be significantly reduced because the isotopic disequilibrium between FA and FR is too small, around 2-3‰. With δ18O-CO2 and [CO2] measurements the uncertainty associated with the gross fluxes lies also around 4 μmol m-2 s-1 but could be dramatically reduced if we were able to get more accurate estimates of the CO18O isoflux and the associated discrimination during photosynthesis. This is because the isotopic disequilibrium between FA and FR is large, of the order of 12-17‰. The isotopic disequilibrium between FA and FR and the uncertainty on δR vary among ecosystems and over the year. Our approach should help to choose the best strategy to study the carbon budget of a given ecosystem using stable isotopes.

  5. [18F]Fluoride recovery via gaseous [18F]HF

    DEFF Research Database (Denmark)

    Mathiessen, Bente; Jensen, Mikael; Zhuravlev, Fedor

    2011-01-01

    Acidification of target water with H2SO4 in a specially constructed glassy carbon/polyethylene apparatus allowed for recovery of up to 82% of [18F]fluoride as [18F]HF gas. The [18F]HF distillate was found to be acid-free but moist; when passed through a solution of tBuPh2SiOTf, it yielded [18F...

  6. Etude de la migration des interstitiels dans des austenites Fe, Cr (18), Ni (14) pures et industrielles par irradiation dans un microscope a tres haute tension: Role du carbone et du titane

    Science.gov (United States)

    Housseau, N.; Pelissier, J.

    1983-12-01

    Nous avons étudié le rôle des impurtés (C ou Ti) dans la condensation et la migration des défauts interstitiels. Les échantillons étudiés sont des aciers austénitiques: (a) acier de synthèse de haute pureté (Cr 18, Ni 14, Fe) avec ou sans carbone; (b) acier industriel avec C (800 ppm) ou Ti (0,45%). Les échantillons ont été irradiés dans un microscope à très haute tension aux doses allant de 10 -4 jusqu'à 10 -1 dpa aux températures de 300°C à 400°C. Dans de telles conditions les défauts observés sont des boucles interstitielles. L'étude de la variation de l'épaisseur de la zone dénudée près du bord de la lame mince en fonction de la température nous a permis d'évaluer l'énergie de migration effective de l'interstitiel dans ces alliages. Dans l'austénite de synthèse carburée ou non sa valeur est de 0.8 eV. Dans l'acier industriel au titane carburé ou non on obtient 2.0 eV. Nous n'avons pas observé d'effet lié au carbone. L'examen de la densité de boucles à saturation dans les divers aciers suggère une forte énergie de liaison interstitiel-titane. Cette énergie de liaison, si l'ont admet que le titane est la seule impureté agissante du système, peut être estimée à 1.2 eV.

  7. Effects of carbon nanomaterials fullerene C{sub 60} and fullerol C{sub 60}(OH){sub 18-22} on gills of fish Cyprinus carpio (Cyprinidae) exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Socoowski Britto, Roberta; Longaray Garcia, Marcia; Martins da Rocha, Alessandra [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Artigas Flores, Juliana [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Pinheiro, Mauricio V. Brant [Departamento de Fisica, ICEx, Universidade Federal de Minas Gerais, MG (Brazil); Monserrat, Jose Maria [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil); Ribas Ferreira, Josencler L., E-mail: josenclerf@gmail.com [Universidade Federal do Rio Grande - FURG, Instituto de Ciencias Biologicas, Campus Carreiros, Av. Italia km 8 s/n, Rio Grande, RS (Brazil); Programa de Pos Graduacao em Fisiologia Animal Comparada - Fisiologia Animal Comparada, FURG (Brazil)

    2012-06-15

    In consequence of their growing use and demand, the inevitable environmental presence of nanomaterials (NMs) has raised concerns about their potential deleterious effects to aquatic environments. The carbon NM fullerene (C{sub 60}), which forms colloidal aggregates in water, and its water-soluble derivative fullerol (C{sub 60}(OH){sub 18-22}), which possesses antioxidant properties, are known to be photo-excited by ultraviolet (UV) or visible light. To investigate their potential hazards to aquatic organisms upon exposure to UV sunlight, this study analyzed (a) the in vitro behavior of fullerene and fullerol against peroxyl radicals (ROO{center_dot}) under UV-A radiation and (b) the effects of these photo-excited NMs on oxidative stress parameters in functional gills extracted from the fish Cyprinus carpio (Cyprinidae). The variables measured were the total antioxidant capacity, lipid peroxidation (TBARS), the activities of the antioxidant enzymes glutathione reductase (GR) and glutamate cysteine ligase (GCL), and the levels of the non-enzymatic antioxidant glutathione (GSH). The obtained results revealed the following: (1) both NMs behaved in vitro as antioxidants against ROO{center_dot} in the dark and as pro-oxidants in presence of UV-A, the latter effect being reversed by the addition of sodium azide, which is a singlet oxygen ({sup 1}O{sub 2}) quencher; (2) fullerene induced toxicity with or without UV-A incidence, with a significant (p < 0.05) increase in lipid peroxidation (with greater damage under illumination), a decrease in GCL activity, and the depletion of GSH stocks (under illumination), all of which were attributed to {sup 1}O{sub 2} generation; and (3) fullerol also decreased GCL activity and GSH formation (p < 0.05) but without lipid damage. The overall results show that fullerene can be toxic with or without light incidence, whereas UV radiation seems to play a key role in the environmental toxicity of carbon NMs through {sup 1}O{sub 2} formation.

  8. 40 CFR 86.316-79 - Carbon monoxide and carbon dioxide analyzer specifications.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Carbon monoxide and carbon dioxide... Test Procedures § 86.316-79 Carbon monoxide and carbon dioxide analyzer specifications. (a) Carbon monoxide and carbon dioxide measurements are to be made with nondispersive infrared (NDIR) an analyzers....

  9. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Atlantic Ocean from 2010-11-27 to 2013-02-18 (NODC Accession 0117059)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0117059 includes time series data collected from MOORINGS in the North Atlantic Ocean from 2010-11-27 to 2013-02-18 and retrieved during cruise...

  10. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 (NODC Accession 0084099)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0084099 includes time series data collected from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 and retrieved during cruise...

  11. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the Hokusei Maru in the North Pacific Ocean from 1998-07-18 to 1998-08-18 (NODC Accession 0112239)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112239 includes chemical, discrete sample, physical and profile data collected from Hokusei Maru in the North Pacific Ocean from 1998-07-18 to...

  12. IL–18 AND IMMUNITY

    Directory of Open Access Journals (Sweden)

    E. V. Yakushenko

    2005-01-01

    Full Text Available Abstract. Interleukin–18 is one of the main cytokines, inducing production of IFNg. It is the important factor of anti–infectious and anti–tumor immunity. The review represent molecular–genetic and biochemical characteristics of IL–18. The data about producers, the structure of the receptor and of IL–18 binding protein, as well as signal transduction in the cell are considered. Besides that, the main immune effects of IL–18 are discussed. (Med. Immunol., 2005, vol.7, № 4, pp 355–364

  13. Lake highstands on the Altiplano (Tropical Andes) contemporaneous with Heinrich 1 and the Younger Dryas : new insights from (14)C, U-Th dating and delta(18)O of carbonates

    OpenAIRE

    Blard, P.H.; Sylvestre, Florence; A. K. Tripati; Claude, C.; Causse, C.; Coudrain, Anne; Condom, Thomas; Seidel, J.L.; Vimeux, Françoise; Moreau, C; Dumoulin, J.P.; J. Lavé

    2011-01-01

    This study provides new geochronological and stable isotope constraints on Late Pleistocene fluctuations in lake level that occurred in the closed-watershed of the Central Altiplano between similar to 25 and similar to 12 ka. U-series isochrons and (14)C ages from carbonates are used to confirm and refine the previous chronology published (Placzek et al., 2006b). Our new data support three successive lake highstands during the Late Pleistocene: (i) the lake Sajsi cycle, from similar to 25 to ...

  14. Influence of organic carbon sources and isotope exchange processes between water and nitrate on the fractionation of the stable isotopes 15N/14N and 18O/16O in dissolved nitrate during microbial dentrification in groundwater

    International Nuclear Information System (INIS)

    Stable isotopes of nitrate are commonly used to determine sources and degradation of nitrate. In this study, nitrite oxidizing bacteria were found to promote an oxygen isotope exchange between water and nitrate under anoxic conditions. Also, different carbon sources were found to influence the enrichment of stable isotopes in nitrate during microbial denitrification. Both results refine the stable isotope model of nitrate in respect to nitrate source determination and microbial nitrate reduction.

  15. Selective determination of ascorbic acid with a novel hybrid material based 1-butyl-3-methylimidazolium tetrafluoroborate ionic liquid and the Dawson type ion [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} immobilized on glassy carbon

    Energy Technology Data Exchange (ETDEWEB)

    Ammam, Malika, E-mail: Malika.Ammam@uoit.c [Faculty of Science, University of Ontario Institute of Technology, 2000 Simcoe Street North, Oshawa, ON, L1H 7K4 (Canada); Easton, E. Bradley [Faculty of Science, University of Ontario Institute of Technology, 2000 Simcoe Street North, Oshawa, ON, L1H 7K4 (Canada)

    2011-02-28

    In this study, we synthesized a new hybrid material using well-Dawson K{sub 6}[P{sub 2}Mo{sub 18}O{sub 62}].nH{sub 2}O and a room temperature ionic liquid 1-butyl-3-methylimidazolium tetrafluoroborate ([BMIM][BF{sub 4}]). CHN elemental analysis showed that one mole of [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} reacts with 6 moles of [BMIM]{sup +} to form [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62}. FT-IR spectra showed the presence of both 1-butyl-3-methylimidazolium cation and the Dawson anion. TG analysis displayed a relative thermal stability of the hybrid material compared to the parent Dawson POM. The new hybrid material [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} was immobilized on glassy carbon (GC) electrode and the modified electrode was investigated by cyclic voltammetry and amperometry. Compared to the electrochemical behavior of dissolved [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-}, a slight shift in the redox peaks towards negative potentials is observed for the immobilized [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62}. The relationship between the peak currents of the deposited [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} film and scan rate is shown to be linear, which demonstrates a surface-confined electron transfer processes. [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified electrode showed high sensitivities towards pH and shown to be active even at neutral pH. [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified GC electrode was subjected to cyclic voltammetry and amperometry in the presence of ascorbic acid (AA) and found to exhibit a remarkable catalytic activity towards the oxidation of AA. The catalytic oxidation peak of AA at [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} modified GC electrode occurs at low potential of {approx}0 V vs Ag/AgCl at neutral pH and shifts to more positive potentials when pH decreases. Comparison between [BMIM]{sub 6}P{sub 2}Mo{sub 18}O{sub 62} and [P{sub 2}Mo{sub 18}O{sub 62}]{sup 6-} modified GC films towards the oxidation of AA suggests that

  16. Study of the mechanism of corrosion of some ferritic steels in high-pressure carbon dioxide with the aid of oxygen-18 as a tracer. 1. Low-silicon mild steel

    Energy Technology Data Exchange (ETDEWEB)

    Gleave, C.; Lees, D.G. (Manchester Univ. (UK). Dept. of Metallurgy); Calvert, J.M. (Manchester Univ. (UK). Dept. of Physics); Rowlands, P.C. (Central Electricity Research Labs., Leatherhead (UK))

    1982-02-08

    The oxidation of low-silicon mild steel (a rimming steel) has been studied in CO/sub 2/ at a pressure of 4.1 MPa and a temperature of 773 K. A range of oxidation times between 70 and 5400 h was used. Oxygen-18 was used as a tracer to elucidate the oxidation mechanism, the /sup 18/O being identified and located by using a nuclear technique. The exposure times provided samples showing protective, transitional and breakaway oxidation. The measurements show that, in the protective regime, oxide growth is predominantly at the oxide-gas interface with a limited amount of growth within the scale. In the transitional period before breakaway, oxide grows at the oxide-gas interface and to a substantial extent within the scale. In the breakaway regime, the evidence is that no substantial growth occurs at the oxide-gas interface.

  17. Main: RSEPVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available RSEPVGRP18 S000289 10-Feb-2000 (last modified) seki RSE (root-specific element) found in bean (P.V.) grp1...n in stem; See S000288, S000099; RSE; grp1.8; vascular; root; stem; shoot; bean (Phaseolus vulgaris) CATCCAACTTTCATATCCATGTGCTT ...

  18. Carbon Carbon Composites: An Overview .

    OpenAIRE

    G. Rohini Devi; K. Rama Rao

    1993-01-01

    Carbon carbon composites are a new class of engineering materials that are ceramic in nature but exhibit brittle to pseudoplastic behaviour. Carbon-carbon is a unique all-carbon composite with carbon fibre embeded in carbon matrix and is known as an inverse composite. Due to their excellent thermo-structural properties, carbon-carbon composites are used in specialised application like re-entry nose-tips, leading edges, rocket nozzles, and aircraft brake discs apart from several indust...

  19. Vapor-liquid equilibrium data for the carbon dioxide and nitrogen (CO2+N2) system at the temperatures 223, 270, 298 and 303 K and pressures up to 18 MPa

    OpenAIRE

    Westman, Snorre Foss; Stang, Hans Georg Jacob; Løvseth, Sigurd Weidemann; Austegard, Anders; Snustad, Ingrid; Størset, Sigmund Østtveit; Ertesvåg, Ivar Ståle

    2015-01-01

    A new setup for the measurement of vapor-liquid phase equilibria of CO2-rich mixtures relevant for carbon capture and storage (CCS) transport conditions is presented. An isothermal analytical method with a variable volume cell is used. The apparatus is capable of highly accurate measurements in terms of pressure, temperature and composition, also in the critical region. Vapor-liquid equilibrium (VLE) measurements for the binary system CO2+N2 are reported at 223, 270, 298 and 303 K, with estim...

  20. Carbon Carbon Composites: An Overview .

    Directory of Open Access Journals (Sweden)

    G. Rohini Devi

    1993-10-01

    Full Text Available Carbon carbon composites are a new class of engineering materials that are ceramic in nature but exhibit brittle to pseudoplastic behaviour. Carbon-carbon is a unique all-carbon composite with carbon fibre embeded in carbon matrix and is known as an inverse composite. Due to their excellent thermo-structural properties, carbon-carbon composites are used in specialised application like re-entry nose-tips, leading edges, rocket nozzles, and aircraft brake discs apart from several industrial and biomedical applications. The multidirectional carbon-carbon product technology is versatile and offers design flexibility. This paper describes the multidirectional preform and carbon-carbon process technology and research and development activities within the country. Carbon-carbon product experience at DRDL has also been discussed. Development of carbon-carbon brake discs process technology using the liquid impregnation process is described. Further the test results on material characterisation, thermal, mechanical and tribological properties are presented.

  1. Internal Dosimetry. Chapter 18

    International Nuclear Information System (INIS)

    The Committee on Medical Internal Radiation Dose (MIRD) is a committee within the Society of Nuclear Medicine. The MIRD Committee was formed in 1965 with the mission to standardize internal dosimetry calculations, improve the published emission data for radionuclides and enhance the data on pharmacokinetics for radiopharmaceuticals [18.1]. A unified approach to internal dosimetry was published by the MIRD Committee in 1968, MIRD Pamphlet No. 1 [18.2], which was updated several times thereafter. Currently, the most well known version is the MIRD Primer from 1991 [18.3]. The latest publication on the formalism was published in 2009 in MIRD Pamphlet No. 21 [18.4], which provides a notation meant to bridge the differences in the formalism used by the MIRD Committee and the International Commission on Radiological Protection (ICRP) [18.5]. The formalism presented in MIRD Pamphlet No. 21 [18.4] will be used here, although some references to the quantities and parameters used in the MIRD primer [18.3] will be made. All symbols, quantities and units are presented

  2. Automated radiosynthesis of [18F]ciprofloxacin

    International Nuclear Information System (INIS)

    We transferred the previously published manual synthesis of [18F]ciprofloxacin (decay-corrected RCY: 5.5±1.0%) to an automated synthesis module (TRACERlabTM FXFDG, GE Healthcare) and observed a strong decrease in RCY (0.4±0.4%). When replacing the standard 15-mL glassy carbon reactor of the synthesis module with a 3-mL V-shaped borosilicate glass reactor a considerable improvement in RCY was observed. [18F]Ciprofloxacin was obtained in a RCY of 2.7±1.4% (n=23) with a specific activity at EOS of 1.4±0.5 GBq/µmol in a synthesis time of 160 min. - Highlights: • Automated synthesis of [18F]ciprofloxacin in a TRACERlabTM FXFDG (GE Healthcare) synthesis module was developed. • Dependence of radiochemical yield on reactor type was observed. • 3-mL V-shaped borosilicate glass reactor gave higher radiochemical yield as compared with standard 15-mL glassy carbon reactor. • V-shaped borosilicate glass reactor might also give higher radiochemical yield for other [18F]radiotracers than [18F]ciprofloxacin

  3. Study of the mechanism of corrosion of some ferritic steels in high-pressure carbon dioxide with the aid of oxygen-18 as a tracer. 2. High-silicon mild steel

    Energy Technology Data Exchange (ETDEWEB)

    Gleave, C.; Lees, D.G. (Manchester Univ. (UK). Dept. of Metallurgy); Calvert, J.M. (Manchester Univ. (UK). Dept. of Physics); Rowlands, P.C. (Central Electricity Research Labs., Leatherhead (UK))

    1982-02-08

    The oxidation mechanisms of a high-silicon mild steel (a fully killed steel) in high pressure (4.1 MPa) CO/sub 2/ at 773 K have been investigated with the aid of /sup 18/O as a tracer. In the protective region of oxidation oxide formation occurred at the oxide-gas interface, within the scale and possibly also at the oxide-metal interface. The oxide growth within the scale is believed to occur in a relatively stress-free manner. The results for this steel are compared with those for a low-silicon mild steel, Fe-9% Cr alloys, and nickel.

  4. Monosomy 18p

    Directory of Open Access Journals (Sweden)

    Turleau Catherine

    2008-02-01

    Full Text Available Abstract Monosomy 18p refers to a chromosomal disorder resulting from the deletion of all or part of the short arm of chromosome 18. The incidence is estimated to be about 1:50,000 live-born infants. In the commonest form of the disorder, the dysmorphic syndrome is very moderate and non-specific. The main clinical features are short stature, round face with short philtrum, palpebral ptosis and large ears with detached pinnae. Intellectual deficiency is mild to moderate. A small subset of patients, about 10–15 percent of cases, present with severe brain/facial malformations evocative of holoprosencephaly spectrum disorders. In two-thirds of the cases, the 18p- syndrome is due to a mere terminal deletion occurring de novo, in one-third the following are possible: a de novo translocation with loss of 18p, malsegregation of a parental translocation or inversion, or a ring chr18. Parental transmission of the 18p- syndrome has been reported. Cytogenetic analysis is necessary to make a definite diagnosis. Recurrence risk for siblings is low in de novo deletions and translocations, but is significant if a parental rearrangement is present. Deletion 18p can be detected prenatally by amniocentesis or chorionic villus sampling and cytogenetic testing. Differential diagnosis may include a wide number of syndromes with short stature and mild intellectual deficiency. In young children, deletion 18p syndrome may be vaguely evocative of either Turner syndrome or trisomy 21. No specific treatment exists but speech therapy and early educational programs may help to improve the performances of the children. Except for the patients with severe brain malformations, the life expectancy does not seem significantly reduced.

  5. Catalytic carbon deposition on 3-dimensional carbon fibre supports

    OpenAIRE

    Thornton, Matthew James

    2005-01-01

    Catalytic carbon deposition reactions, using methane, ethane or synthetic natural gas (1.8 vol. % propane, 6.7 vol. % ethane and balance methane) as the carbon-containing gas feedstock with or without the addition of hydrogen, have been investigated over nickel, cobalt and iron catalysts supported on 3-dimensional carbon fibre supports, using both a horizontal tube furnace and an isothermal, isobaric induction furnace. The transition metal catalysts were prepared by impregnating 3-dimens...

  6. 纯化处理对碳纳米管2~18GHz复介电常数与复磁导率的影响%Effect of purification on 2 ~ 18GHz complex permittivity and complex permeability of carbon nanotubes

    Institute of Scientific and Technical Information of China (English)

    李聃; 李泉注; 隋刚; 徐化明; 肖旭; 梁吉

    2004-01-01

    研究了纯化处理对多壁碳纳米管2~18GHz复介电常数与复磁导率的影响.纯化处理在部分频段降低了复介电常数的实部与虚部,增强了复磁导率的实部,而对复磁导率的虚部几乎没有影响.通过拉曼光谱对不同纯化处理的样品进行了表征,研究发现碳纳米管的晶化程度越好,介电常数降低和磁导率实部增强的幅度越大.

  7. Trisomy 18 (Edwards Syndrome

    Directory of Open Access Journals (Sweden)

    Masoud Poureisa

    2009-01-01

    Full Text Available Description and Definition "n"n Synonym: Edward syndrome Characterized by malformations of multiple organ systems, trisomy 18 has an incidence of 3 in 10000 live births. Abnormalities detectable by ultrasound Common findings Agenesis of the corpus callosum Choroid plexus cysts Posterior fossa abnormalities Micrognathia Low-set ears Microphthalmous Hypertelorism Short radial ray Clenched hand with overlapping index finger Clubbed foot Rocker-bottom foot Renal anomalies hydronephrosis Omphalocele Diaphragmatic hernia Cryptorchidism Heart defects Single umbilical artery Intrauterine growth restriction Polyhydramnios Nuchal lucency Occasional findings Meningomyelocele Ventriculomegaly Cleft lip and plate Major differential diagnoses Freeman-Sheldon syndrome (clenched hands and intrauterine growth restriction Pena Shokeir syndrome (pseudo-trisomy 18 Smith-Lemli-Opitz syndrome (clenched hands and intrauterine grown restriction Triploidy (intrauterine growth restriction Trisomy 9 Other multiple malformation syndromes associated with intrauterine growth retardation, limb anomalies and/ or heart defects. Ultrasound diagnosis Prenatal; ultrasound diagnosis has been established in the first trimester, based on the finding of a nuchal lucency. Detectable features on the early second trimester include abnormal forearms, clenched hands, clubbed feet, omphalocele and a major heart defect. The features of trisomy 18 are detectable in 80% of affected fetuses in the second trimester. Sonography is often used to evaluate fetuses for the prsence of trisomy 18 when choroid plexus cysts are present, or when the triple screen results in a low level of maternal serum alpha- fetoprotein, estriol and human chorionic  gonadotropin combination. Although trisomy 18 occurs in 1 in 100 fetuses with choroid plexus cysts, if it is an isolated finding, the risk for trisomy 18 falls below 1 in 400. Documenting an open hand is very helpful as most fetuses with trisomy 18 are

  8. The trisomy 18 syndrome

    Directory of Open Access Journals (Sweden)

    Cereda Anna

    2012-10-01

    Full Text Available Abstract The trisomy 18 syndrome, also known as Edwards syndrome, is a common chromosomal disorder due to the presence of an extra chromosome 18, either full, mosaic trisomy, or partial trisomy 18q. The condition is the second most common autosomal trisomy syndrome after trisomy 21. The live born prevalence is estimated as 1/6,000-1/8,000, but the overall prevalence is higher (1/2500-1/2600 due to the high frequency of fetal loss and pregnancy termination after prenatal diagnosis. The prevalence of trisomy 18 rises with the increasing maternal age. The recurrence risk for a family with a child with full trisomy 18 is about 1%. Currently most cases of trisomy 18 are prenatally diagnosed, based on screening by maternal age, maternal serum marker screening, or detection of sonographic abnormalities (e.g., increased nuchal translucency thickness, growth retardation, choroid plexus cyst, overlapping of fingers, and congenital heart defects . The recognizable syndrome pattern consists of major and minor anomalies, prenatal and postnatal growth deficiency, an increased risk of neonatal and infant mortality, and marked psychomotor and cognitive disability. Typical minor anomalies include characteristic craniofacial features, clenched fist with overriding fingers, small fingernails, underdeveloped thumbs, and short sternum. The presence of major malformations is common, and the most frequent are heart and kidney anomalies. Feeding problems occur consistently and may require enteral nutrition. Despite the well known infant mortality, approximately 50% of babies with trisomy 18 live longer than 1 week and about 5-10% of children beyond the first year. The major causes of death include central apnea, cardiac failure due to cardiac malformations, respiratory insufficiency due to hypoventilation, aspiration, or upper airway obstruction and, likely, the combination of these and other factors (including decisions regarding aggressive care. Upper airway

  9. At WA18

    CERN Multimedia

    1978-01-01

    By July 1978 the CERN-Hamburg-Amsterdam-Rome-Moskow Collaboration (CHARM) has set up the experiment WA18, behind WA1 (on the right), in the neutrino wide-band (WBB) and narrow-band (NBB) beams, at the West Area Neutrino Facility (WANF)and started data taking data.

  10. EDITORIAL: Optical Fibre Sensors 18 (OFS-18)

    Science.gov (United States)

    Jones, Julian D. C.; Tatam, Ralph P.

    2007-10-01

    The International Conference on Optical Fibre Sensors (OFS-18) was held in October 2006 in Cancún, Mexico, under the general chairmanship of Dr Alexis Mendez (MCH Engineering LLC, USA) and Dr Fernando Mendoza (Centro de Investigaciones en Optica, Mexico). 'OFS', as it has become known, is firmly established as the leading international conference for the optical fibre sensor community. Since its inception, in London in 1983, and under the leadership of an international steering committee independent of any learned society or professional institution, it has been held approximately every eighteen months. The venue nominally rotates from Europe, to the Americas, and thence to Asia and the Pacific. OFS-18 demonstrated the continuing vigour of the community, with some 250 papers presented, plus two workshops, with attendance as international as ever. In recent years, it has become a tradition to publish a post-conference special issue in the journal Measurement Science and Technology, and these special issues offer a representative sample of the current status of the field. In the nearly 25 years since OFS began, many of the early ideas and laboratory-based proof-of-principle experiments have led to highly developed instrumentation systems, and to successful commercial products. Perhaps the most mature of all of these technologies is the optical fibre gyroscope, with the fibre hydrophone a close second—originally developed for defence applications for which it is now established, but with increasing relevance to the oil and gas industry; electromagnetic sensors based on the Faraday and electro-optic effects are of growing significance in the power generation and distribution industry; whilst in-fibre grating-based sensors occupy an expanding niche in structural monitoring, especially in civil engineering. It is therefore appropriate that the first day of OFS was devoted to workshops on structural health monitoring, and to commemorate the 30th anniversary of the

  11. Carbon and oxygen isotope microanalysis of carbonate.

    Science.gov (United States)

    Velivetskaya, Tatiana A; Ignatiev, Alexander V; Gorbarenko, Sergey A

    2009-08-30

    Technical modification of the conventional method for the delta(13)C and delta(18)O analysis of 10-30 microg carbonate samples is described. The CO(2) extraction is carried out in vacuum using 105% phosphoric acid at 95 degrees C, and the isotopic composition of CO(2) is measured in a helium flow by gas chromatography/isotope ratio mass spectrometry (GC/IRMS). The feed-motion of samples to the reaction vessel provides sequential dropping of only the samples (without the sample holder) into the acid, preventing the contamination of acid and allowing us to use the same acid to carry out very large numbers of analyses. The high accuracy and high reproducibility of the delta(13)C and delta(18)O analyses were demonstrated by measurements of international standards and comparison of results obtained by our method and by the conventional method. Our method allows us to analyze 10 microg of the carbonate with a standard deviation of +/-0.05 per thousand for delta(13)C and delta(18)O. The method has been used successfully for the analyses of the oxygen and carbon isotopic composition of the planktonic and benthic foraminifera in detailed palaeotemperature reconstructions of the Okhotsk Sea. PMID:19603476

  12. Carbon isotope anomalies in carbonates of the Karelian series

    Science.gov (United States)

    Iudovich, Ia. E.; Makarikhin, V. V.; Medvedev, P. V.; Sukhanov, N. V.

    1990-07-01

    Results are presented on carbon isotope distributions in carbonates of the Karelian complex. A highly anomalous isotopic composition was found in carbonate rocks aged from 2.6 to 1.9 b.y. In the stromatolitic carbonates of the Onega water table, delta-(C-13) reaches a value of +18 percent, while the shungite layer of the Zaonega horizon is characterized by a wide dispersion (from +7.9 to -11.8 percent). These data are in good agreement with the known geochemical boundary (about 2.2 b.y. ago) in the history of the earth.

  13. Photodisintegration of oxygen-18

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, J.G.

    1978-01-01

    All the major photonuclear cross-sections for /sup 18/O, including sigma(..gamma..,p), sigma((..gamma..,n) + (..gamma..,np)) and ..gamma..(..gamma..,2n), were measured as a function of photon energy from threshold to 42 MeV. The photon energy resolution was between 200 and 300 keV. The source of radiation was the mono-energetic photon beam obtained from the annihilation-in-flight of fast positrons. Integrated cross-sections were extracted from the data and compared with sum-rule predictions. The /sup 18/O differential cross-sections at 98/sup 0/ for photoneutron decay leaving the /sup 17/O daughter nucleus in its ground or first excited state were also measured in the pigmy resonance between 10 and 17.6 MeV excitation energy. A time-of-flight spectrometer was used for this part of the work. Considerable structure was observed in all the partial cross-sections and in all energy regions. Resonances in the pigmy resonance region exhibit substantial decay branching to negative-parity states in /sup 17/O. Significant differences in the branching of resonances in the giant resonance region to the various partial cross-section, together with the photoneutron-energy data, allow the assignment of definite isospin to all the resonances, and the consequence delineation of the isospin strength distribution for /sup 18/O. Evidence was found for two weak but broad resonances above the giant resonant region.

  14. Microbially mediated mineral carbonation

    Science.gov (United States)

    Power, I. M.; Wilson, S. A.; Dipple, G. M.; Southam, G.

    2010-12-01

    implemented and economically efficient alternative to other technologies currently under development for mineral sequestration. Dismukes GC, Carrieri D, Bennette N, Ananyev GM, Posewitz MC (2008) Aquatic phototrophs: efficient alternatives to land-based crops for biofuels. Current Opinion in Biotechnology, 19, 235-240. Ferris FG, Wiese RG, Fyfe WS (1994) Precipitation of carbonate minerals by microorganisms: Implications of silicate weathering and the global carbon dioxide budget. Geomicrobiology Journal, 12, 1-13. Lackner KS, Wendt CH, Butt DP, Joyce EL, Jr., Sharp DH (1995) Carbon dioxide disposal in carbonate minerals. Energy, 20, 1153-1170. Power IM, Wilson SA, Thom JM, Dipple GM, Gabites JE, Southam G (2009) The hydromagnesite playas of Atlin, British Columbia, Canada: A biogeochemical model for CO2 sequestration. Chemical Geology, 206, 302-316. Thompson JB, Ferris FG (1990) Cyanobacterial precipitation of gypsum, calcite, and magnesite from natural alkaline lake water. Geology, 18, 995-998.

  15. Carbone-14, carbone-13 et oxygène-18 dans les sédiments carbonatés du lac Titicaca: premières estimations des vitesses de sédimentation et essai de paléoclimatologie

    OpenAIRE

    Fontes, J.C.; Boulangé, Bruno; Rodrigo, L

    1981-01-01

    La précipitation des carbonates se produit et s'est produite dans des conditions voisines de l'équilibre avec l'eau du lac et le CO2 de l'atmosphère. La vitesse moyenne de sédimentation est de l'ordre de 0,5 mm.an-1 au cours du dernier millenaire qui a vu le bilan hydrologique du lac fluctuer assez largement. (Résumé d'auteur)

  16. Sindrom prstenastog kromosoma 18

    OpenAIRE

    Pereza, Nina; Buretić-Tomljanović, Alena; Vraneković, Jadranka; Ostojić, Saša; Kapović, Miljenko

    2010-01-01

    Cilj: Prstenasti ili ring kromosom rijetka je strukturna promjena kromosoma koja najčešće nastaje zbog terminalne delecije na oba kraka kromosoma te ponovnog spajanja preostalih dijelova kratkog i dugog kraka kromosoma u prstenastu strukturu. Sindromi prstenastih kromosoma iznimno su rijetki s incidencijom od 1 : 50.000 živorođene djece. U ovom radu prikazujemo prvi slučaj djevojčice sa sindromom prstenastog kromosoma 18 zabilježenog na Zavodu za biologiju i medicinsku genetiku (Medicin...

  17. EUROTHERM Seminar No. 18

    CERN Document Server

    Heggs, Peter; Butterworth, David

    1992-01-01

    The Eurotherm Committee was created in 1986 from member countries of the European Community. It has the purpose of organising and coordinating scientific events such as seminars and conferences in the thermal sciences. The series of Eurotherm Seminars established by the Committee has become a popular forum for high-level scientific and technical interchange of ideas in a wide range of specialist topics. While the presentation and publication of papers at the Seminars are encouraged, the primary aim is to stimulate discussion and liaison between specialist groups. The present Chairman of Eurotherm is Professor C.J. Hoogendoorn of the Technical University, Delft (Fax [NL] 15, 783251). Information on Mure Seminars is available from the Secretary, Keith Cornwell, Heriot-Watt University, Edinburgh (Fax [UK] 31, 451, 3129). This particular Seminar No. 18 on the Design and Operation of Heat Exchangers was the first one on this topic and was held at the Universitat der Bundeswehr Hamburg (University of the Federal Ar...

  18. 18 CFR 35.18 - Asset retirement obligations.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Asset retirement obligations. 35.18 Section 35.18 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... not seeking recovery of the asset retirement costs in rates, must remove all...

  19. A carbon sink pathway increases carbon productivity in cyanobacteria.

    Science.gov (United States)

    Oliver, John W K; Atsumi, Shota

    2015-05-01

    The burning of fossil reserves, and subsequent release of carbon into the atmosphere is depleting the supply of carbon-based molecules used for synthetic materials including plastics, oils, medicines, and glues. To provide for future society, innovations are needed for the conversion of waste carbon (CO2) into organic carbon useful for materials. Chemical production directly from photosynthesis is a nascent technology, with great promise for capture of CO2 using sunlight. To improve low yields, it has been proposed that photosynthetic capacity can be increased by a relaxation of bottlenecks inherent to growth. The limits of carbon partitioning away from growth within the cell and the effect of partitioning on carbon fixation are not well known. Here we show that expressing genes in a pathway between carbon fixation and pyruvate increases partitioning to 2,3-butanediol (23BD) and leads to a 1.8-fold increase in total carbon yield in the cyanobacterium Synechococcus elongatus PCC 7942. Specific 2,3-butanediol production increases 2.4-fold. As partitioning increases beyond 30%, it leads to a steep decline in total carbon yield. The data suggests a local maximum for carbon partitioning from the Calvin Benson cycle that is scalable with light intensity.

  20. Incorporation of oxygen-18 into secondary alcohols of grasshopper Melanoplus sanguinipes.

    Science.gov (United States)

    Blomquist, G J; Mccain, D C; Jackson, L L

    1975-05-01

    Incorporation of 18-O2 and H2-18-O into the secondary alcohol moiety of wax esters in the grasshopper Melanoplus sanguinipes was determined by mass spectrometry. Results of this study show that oxygen-18 from 18-O2 was incorporated into the secondary alcohol, whereas no incorporation of oxygen-18 from H2-18-O was detected. The data suggest that the reaction, which hydroxylates n-alkanes at or near the center of the carbon chain, involves a mixed function oxidase type enzyme. PMID:1128177

  1. A mechanistic model of H{sub 2}{sup 18}O and C{sup 18}OO fluxes between ecosystems and the atmosphere: Model description and sensitivity analyses

    Energy Technology Data Exchange (ETDEWEB)

    Riley, W.J.; Still, C.J.; Torn, M.S.; Berry, J.A.

    2002-01-01

    The concentration of 18O in atmospheric CO2 and H2O is a potentially powerful tracer of ecosystem carbon and water fluxes. In this paper we describe the development of an isotope model (ISOLSM) that simulates the 18O content of canopy water vapor, leaf water, and vertically resolved soil water; leaf photosynthetic 18OC16O (hereafter C18OO) fluxes; CO2 oxygen isotope exchanges with soil and leaf water; soil CO2 and C18OO diffusive fluxes (including abiotic soil exchange); and ecosystem exchange of H218O and C18OO with the atmosphere. The isotope model is integrated into the land surface model LSM, but coupling with other models should be straightforward. We describe ISOLSM and apply it to evaluate (a) simplified methods of predicting the C18OO soil-surface flux; (b) the impacts on the C18OO soil-surface flux of the soil-gas diffusion coefficient formulation, soil CO2 source distribution, and rooting distribution; (c) the impacts on the C18OO fluxes of carbonic anhydrase (CA) activity in soil and leaves; and (d) the sensitivity of model predictions to the d18O value of atmospheric water vapor and CO2. Previously published simplified models are unable to capture the seasonal and diurnal variations in the C18OO soil-surface fluxes simulated by ISOLSM. Differences in the assumed soil CO2 production and rooting depth profiles, carbonic anhydrase activity in soil and leaves, and the d18O value of atmospheric water vapor have substantial impacts on the ecosystem CO2 flux isotopic composition. We conclude that accurate prediction of C18OO ecosystem fluxes requires careful representation of H218O and C18OO exchanges and transport in soils and plants.

  2. 18 CFR 1b.18 - Right to submit statements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Right to submit... COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.18 Right to submit statements. Any person may, at any time during the course of an investigation, submit documents,...

  3. SM18 Visits and Access

    CERN Multimedia

    2012-01-01

      VISITS The rules and conditions to be followed for visits in the SM18 Hall are laid out in the EDMS 1205328 document. No visit is allowed without prior reservation.   ACCESS Special access right is needed ONLY from 7 p.m. to 7 a.m. and during week-ends. From 1 December, the current SM18 access database will be closed and a new one “SM18-OWH outside normal hours” started from scratch. Requests, via EDH SM18-OWH, will have to be duly justified.   For further information, please contact Evelyne Delucinge.

  4. What Controls the Global Value of Oxygen-18 in Atmospheric CO2?

    Science.gov (United States)

    Still, C. J.; Noone, D. C.; Buenning, N. H.; Randerson, J. T.; Welp, L. R.; White, J.; Vaughn, B.; Riley, W. J.

    2006-12-01

    While spatial and temporal variations in atmospheric CO2 and its carbon isotope composition have received considerable attention from the carbon cycle community, much less is known about the δ18O of atmospheric CO2 (δ18O-atm). Because δ18O-atm represents a fundamental coupling between the carbon and water cycles, there is great interest in using it to diagnose underlying variations in each cycle. While much progress has been made in global simulations of δ18O-atm, basic aspects of its behavior at a range of spatial and temporal scales remain poorly understood, ranging from the phase shift between the seasonal cycles of CO2 and δ18O-atm at high northern latitudes to the large interannual variability of δ18O-atm observed at a range of spatial scales. Also, the mean annual global δ18O-atm exhibits large, multi-year excursions that imply large isotope fluxes driven by carbon and/or water cycle variations. In this work, we identify and quantify new forcings on δ18O-atm as determined from site-level and global simulations. Among the new forcings is a previously unrecognized strong relationship between relative humidity and leaf-atmosphere oxygen-18 discrimination and isofluxes through relative humidity sensitivities in leaf water δ18O-atm and bi- directional leaf carbon fluxes. We show how this relationship varies with ecosystem type, and quantify the potential impact of relative humidity variations on global budgets of δ18O-atm. We identify key biomes that help determine the mean global δ18O-atm and its variations.

  5. Porous carbons

    Indian Academy of Sciences (India)

    Satish M Manocha

    2003-02-01

    Carbon in dense as well as porous solid form is used in a variety of applications. Activated porous carbons are made through pyrolysis and activation of carbonaceous natural as well as synthetic precursors. Pyrolysed woods replicate the structure of original wood but as such possess very low surface areas and poor adsorption capacities. On activation, these exhibit increased adsorption volumes of 0.5–0.8 cm3 /gm and surface areas of 700–1800 m2 /gm depending on activation conditions, whether physical or chemical. Former carbons possess mixed pore size distribution while chemically activated carbons predominantly possess micropores. Thus, these carbons can be used for adsorption of wide distributions of molecules from gas to liquid. The molecular adsorption within the pores is due to single layer or multilayer molecule deposition at the pore walls and hence results in different types of adsorption isotherm. On the other hand, activated carbon fibres with controlled microporous structure and surface area in the range of 2500 m2 /gm can be developed by controlled pyrolysis and physical activation of amorphous carbon fibres. Active carbon fibres with unmatchable pore structure and surface characteristics are present and futuristic porous materials for a number of applications from pollution control to energy storage.

  6. High performance carbon-carbon composites

    Indian Academy of Sciences (India)

    Lalit M Manocha

    2003-02-01

    Carbon-carbon composites rank first among ceramic composite materials with a spectrum of properties and applications in various sectors. These composites are made of fibres in various directions and carbonaceous polymers and hydrocarbons as matrix precursors. Their density and properties depend on the type and volume fraction of reinforcement, matrix precursor used and end heat treatment temperature. Composites made with thermosetting resins as matrix precursors possess low densities (1.55–1.75 g/cm3) and well-distributed microporosity whereas those made with pitch as the matrix precursor, after densification exhibit densities of 1.8–2.0 g/cm3 with some mesopores, and those made by the CVD technique with hydrocarbon gases, possess intermediate densities and matrices with close porosities. The former (resin-based) composites exhibit high flexural strength, low toughness and low thermal conductivity, whereas the latter (pitch- and CVD-based) can be made with very high thermal conductivity (400–700 W/MK) in the fibre direction. Carbon-carbon composites are used in a variety of sectors requiring high mechanical properties at elevated temperatures, good frictional properties for brake pads in high speed vehicles or high thermal conductivity for thermal management applications. However, for extended life applications, these composites need to be protected against oxidation either through matrix modification with Si, Zr, Hf etc. or by multilayer oxidation protection coatings consisting of SiC, silica, zircon etc.

  7. Carbon dioxide gasification of carbon black: isotope study of carbonate catalysis

    International Nuclear Information System (INIS)

    Temperature-programmed reaction was used with labeled isotopes (13C and 18O) to study interactions between carbon black and potassium carbonate in pure He and 10% CO2/90% He atmospheres. Catalytic gasification precursor complexes were observed. Carbon and oxygen-bearing carbon surface groups interacted with the carbonate above 500 K to form surface complexes. Between 500 and 950 K, and in the presence of gaseous CO2, the complexes participated in C and O exchange with the gas phase while oxygen atoms within the complexes also exchanged with those on the carbon surface. As the temperature rose, the complexes decomposed, with CO2 the initial product. Decomposition started around 500 K in pure He, and around 950 K in CO2/He. Catalytic gasification began only after decomposition of significant portions of the complexes. Elemental potassium formed, and the active catalyst appears to alternate between being potassium metal and a potassium-oxygen-carbon complex. Potassium carbonate is not part of the catalytic cycle. 20 references, 10 figures

  8. Health screening - men - ages 18 to 39

    Science.gov (United States)

    Health maintenance visit - men - ages 18 to 39; Physical exam - men - ages 18 to 39; Yearly exam - ... 39; Checkup - men - ages 18 to 39; Men's health - ages 18 to 39; Preventive care exam - men - ...

  9. Health screening - women - ages 18 to 39

    Science.gov (United States)

    Health maintenance visit - women - ages 18 to 39; Physical exam - women - ages 18 to 39; Yearly exam - ... 39; Checkup - women - ages 18 to 39; Women's health - ages 18 to 39; Preventive care - women - ages ...

  10. Four advances in carbon-carbon materials technology

    Science.gov (United States)

    Maahs, Howard G.; Vaughn, Wallace L.; Kowbel, Witold

    1994-01-01

    Carbon-carbon composites are a specialty class of materials having many unique properties making these composites attractive for a variety of demanding engineering applications. Chief among these properties are exceptional retention of mechanical properties at temperatures as high as 4000 F, excellent creep resistance, and low density (1.6 to 1.8 g/cu cm). Although carbon-carbon composites are currently in service in a variety of applications, much development work remains to be accomplished before these materials can be considered to be fully mature, realizing their full potential. Four recent technology advances holding particular promise for overcoming current barriers to the wide-spread commercialization of carbon-carbon composites are described. These advances are: markedly improved interlaminar strengths (more than doubled) of two dimensional composites achieved by whiskerization of the fabric reinforcing plies, simultaneously improved oxidation resistance and mechanical properties achieved by the incorporation of matrix-phase oxidation inhibitors based on carborane chemistry, improved oxidation resistance achieved by compositionally graded oxidation protective coatings, and markedly reduced processing times (hours as opposed to weeks or months) accomplished through a novel process of carbon infiltration and coatings deposition based on the use of liquid-phase precursor materials.

  11. Carbon and Carbon Isotope Cycling in the Western Canadian Arctic

    Science.gov (United States)

    Mol, Jacoba; Thomas, Helmuth

    2016-04-01

    Increasing carbon dioxide levels in the atmosphere are having drastic effects on the global oceans. The Arctic Ocean is particularly susceptible to change as warming, sea-ice loss and a weak buffering capacity all influence this complicated semi-enclosed sea. In order to investigate the inorganic carbon system in the Canadian Arctic, water samples were collected in the Beaufort Sea, on the Alaskan shelf, at the Mackenzie river delta, and in Amundsen Gulf during the summer of 2014 and were analyzed for dissolved inorganic carbon (DIC), total alkalinity (TA), DI13C and 18O isotopes. Carbon isotopes are used to investigate the role of biological production on the uptake and transfer of inorganic carbon to depth. A preferential uptake of the lighter 12C relative to the heavier 13C isotope during biological production leads to a fractionation of the 13C/12C isotopes in both the organic matter and the water column. This results in an enrichment of DI13C in the high productivity surface waters and a depletion of DI13C at depth. Physical processes including freshwater input, brine rejection, and water mass mixing are investigated through the measurement of oxygen isotopes. Differences in the carbon system across the study area due to both biological and physical processes are assessed using depth profiles of DI13C and related carbon system parameters.

  12. Calcium Carbonate

    Science.gov (United States)

    ... before being swallowed; do not swallow them whole. Drink a full glass of water after taking either the regular or chewable tablets or capsules. Some liquid forms of calcium carbonate must be shaken well before use.Do not ...

  13. Carbon Stars

    Indian Academy of Sciences (India)

    T. Lloyd Evans

    2010-12-01

    In this paper, the present state of knowledge of the carbon stars is discussed. Particular attention is given to issues of classification, evolution, variability, populations in our own and other galaxies, and circumstellar material.

  14. Carbon recycling in ophiolite-hosted carbonates, Oman-UAE

    Science.gov (United States)

    Stephen, A.; Jenkin, G. R.; Smith, D. J.; Styles, M. T.; Naden, J.; Boyce, A. J.; Bryant, C. L.

    2013-12-01

    Large-scale surface and subsurface freshwater carbonate deposits of probable Quaternary age have formed on the Oman-UAE ophiolite. Here, serpentinisation reactions in ultramafic rocks have produced calcite and magnesite. These carbonates are frequently cited as examples of natural atmospheric CO2 sequestration, but the possibility of carbon recycling has not been addressed. The aim of this study is to assess the degree of atmospheric CO2 being incorporated into carbonates versus that which has been recycled from alternative sources such as soil CO2, or limestones that underlie the ophiolite. This has been determined through δ13C/δ18O, 87Sr/86Sr and 14C analysis of all major carbonate lithofacies identified. Our analyses of modern carbonate crusts forming on the surface of stagnant hyperalkaline (pH >11) waters show highly depleted δ13C and δ18O values (-25.5‰ ×0.5 PDB and -16.8‰ ×0.5 PDB respectively). This depletion has been attributed to a kinetic isotope effect occurring during atmospheric CO2 exchange with Ca(OH)2 hyperalkaline waters [1]. By comparison, inactive travertine deposits show a large range in δ13C (-10.5 to -21.8‰ PDB) which lies on a trajectory from the composition of modern crusts towards bicarbonate fluids in equilibrium with soil CO2. We interpret this trend as being produced by the mixing of different carbon sources, either at the time of formation or during later alteration. Modern carbonates and inactive travertines also have 87Sr/86Sr ratios and Sr concentrations similar to Cretaceous and Tertiary limestones which surround the ophiolite, whilst subsurface veins also display 87Sr/86Sr ratios similar to these Cretaceous limestones. Carbon recycling can also be determined with 14C. Modern atmospheric CO2 has a global average of 105-106% modern 14C (pMC), therefore freshwater carbonates forming solely from atmospheric CO2 would be expected to contain >100 pMC. However, modern carbonates display varied results from 94.5-101.4 p

  15. Dentine oxygen isotopes (δ (18)O) as a proxy for odontocete distributions and movements.

    Science.gov (United States)

    Matthews, Cory J D; Longstaffe, Fred J; Ferguson, Steven H

    2016-07-01

    Spatial variation in marine oxygen isotope ratios (δ (18)O) resulting from differential evaporation rates and precipitation inputs is potentially useful for characterizing marine mammal distributions and tracking movements across δ (18)O gradients. Dentine hydroxyapatite contains carbonate and phosphate that precipitate in oxygen isotopic equilibrium with body water, which in odontocetes closely tracks the isotopic composition of ambient water. To test whether dentine oxygen isotope composition reliably records that of ambient water and can therefore serve as a proxy for odontocete distribution and movement patterns, we measured δ (18)O values of dentine structural carbonate (δ (18) OSC) and phosphate (δ (18) OP) of seven odontocete species (n = 55 individuals) from regional marine water bodies spanning a surface water δ (18)O range of several per mil. Mean dentine δ (18) OSC (range +21.2 to +25.5‰ VSMOW) and δ (18) OP (+16.7 to +20.3‰) values were strongly correlated with marine surface water δ (18)O values, with lower dentine δ (18) OSC and δ (18) OP values in high-latitude regions (Arctic and Eastern North Pacific) and higher values in the Gulf of California, Gulf of Mexico, and Mediterranean Sea. Correlations between dentine δ (18) OSC and δ (18) OP values with marine surface water δ (18)O values indicate that sequential δ (18)O measurements along dentine, which grows incrementally and archives intra- and interannual isotopic composition over the lifetime of the animal, would be useful for characterizing residency within and movements among water bodies with strong δ (18)O gradients, particularly between polar and lower latitudes, or between oceans and marginal basins.

  16. Carbonate Ion Effects on Coccolith Carbon and Oxygen Isotopes

    Science.gov (United States)

    Ziveri, P.; Probert, I.; Stoll, H. M.

    2006-12-01

    The stable oxygen and carbon isotopic composition of biogenic calcite constitutes one of the primary tools used in paleoceanographic reconstructions. The δ18O of shells of ocean floor microfossils and corals reflects the composition of the paleo-seawater as they use the oxygen to build up their calcite and aragonite shells. The δ13C is used to reconstruct variations in the carbon isotopic composition of dissolved inorganic carbon in the ocean, which is controlled by biological productivity through the removal of isotopically light carbon in organic matter. To be effective and sensitive tools for understanding photic zone processes it is first necessary to understand the various biological fractionations associated with carbonate precipitation. To date, isotopic fractionation models are mainly based on foraminifera and corals but not on coccoliths, tiny plates produced by coccolithophore algae, which are often the most dominant carbonate contributors to pelagic sediments. As photosynthetic organisms, their chemistry can provide a sensitive tool for understanding photic zone processes. Coccoliths may be the most important carbonate phase for geochemical analysis in sediments where foraminifera are less common and/or core material is limited, such as in subpolar regions and for Early Cenozoic and Mesozoic sediments. Here we report experimental results on a common living coccolithophore species showing that the 13C/12C and 18O/16O ratios decrease with the increase of HCO^{3-} (CO32-). The selected species are among the heaviest calcifying extant coccolithophores and are major contributors to present coccolith carbonate export production. Because coccolithophores are photosynthetic organisms that calcify intracellularly in specialized vesicles, the challenge lies in ascertaining how kinetic and thermodynamic processes of isotopic fractionation are linked to cellular carbon "transport" and carbonate precipitation. This is a daunting challenge since studies have not

  17. 18 CFR 367.18 - Criteria for classifying leases.

    Science.gov (United States)

    2010-04-01

    ... classification of the lease under the criteria in paragraph (a) of this section had the changed terms been in... the lessee) must not give rise to a new classification of a lease for accounting purposes. ... ACT General Instructions § 367.18 Criteria for classifying leases. (a) If, at its inception, a...

  18. 18th International Cryocooler Conference

    CERN Document Server

    Ross, Ronald G

    2014-01-01

    Cryocoolers 18 Cryocoolers 18 archives developments and performance measurements in the field of cryocoolers based on the contributions of leading international experts at the 18th International Cryocooler Conference that was held in Syracuse, New York, on June 9-12, 2014. The program of this conference lead to the 76 peer-reviewed papers that are published here. Over the years the International Cryocoolers Conference has become the preeminent worldwide conference for the presentation of the latest developments and test experiences with cryocoolers. The typical applications of this technology include cooling space and terrestrial infrared focal plane arrays, space x-ray detectors, medical applications, and a growing number of high-temperature superconductor applications.

  19. Thai 18-Week Course: Glossary.

    Science.gov (United States)

    Defense Language Inst., Washington, DC.

    This glossary is part of the Defense Language Institute's 18-week "Short Course in Thai." Other course materials include six 10-lesson volumes and accompanying tape recordings together with an "Introduction to Thai Script." The course is designed to train native-English speakers to level 1, elementary proficiency in speaking, understanding, and…

  20. Production and test of {sup 18}F samples in the SNICS ion source

    Energy Technology Data Exchange (ETDEWEB)

    Rehm, K.E.; Paul, M. [Hebrew Univ., Jerusalem (Israel); Roberts, A.; Nickels, J. [Univ. of Wisconsin, Madison, MO (United States)

    1995-08-01

    For experiments with {sup 18}F beams the output of the SNICS ion source for fluorine ions was investigated. {sup 18}F, which is a well-studied PET isotope, is generated at the medical cyclotron of the University of Wisconsin. Aqueous [{sup 18}F] fluoride ions are produced via the {sup 18}O(p,n){sup 18}F reaction using a 30-{mu}A, 11.4-MeV proton beam bombarding a 95% enriched [{sup 18}O] water target. In order to minimize the {sup 18}O component of the {sup 18}F material the [{sup 18}F] fluoride must be separated from the [{sup 18}O] water. For this purpose the aqueous [{sup 18}F] fluoride solution ({approximately} 0.5-1 ml) is removed from the production target and placed in a glassy carbon vessel. The vessel is heated to 115{degrees}C with He bubbling through the solution, evaporating the water while the {sup 18}F adheres to the vessel walls. When dry, the vessel is filled with 1 ml {sup 18}O-depleted 99.98% [{sup 16}O] water which is again evaporated. After this step is repeated once more the vessel is filled with 1.5 ml [{sup 16}O] water and 200-300 mole of natural KF as carrier material.

  1. Carbon fiber-reinforced carbon as a potential implant material.

    Science.gov (United States)

    Adams, D; Williams, D F; Hill, J

    1978-01-01

    A carbon fiber-reinforced carbon is being evaluated as a promising implant material. In a unidirectional composite, high strengths (1200 MN/m2 longitudinal flexural strength) and high modulus (140 GN/m2 flexural modulus) may be obtained with an interlaminar shear strength of 18 MN/m2. Alternatively, layers of fibers may be laid in two directions to give more isotopic properties. The compatibility of the material with bone has been studied by implanting specimens in holes drilled in rat femora. For a period of up to 8 weeks, a thin layer of fibrous tissue bridged the gap between bone and implant; but this tissue mineralizes and by 10 weeks, bone can be observed adjacent to the implant, giving firm fixation. Potential applications include endosseous dental implants where a greater strength in the neck than that provided by unreinforced carbon would be advantageous.

  2. Dissolved inorganic carbon, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the TANKAI-MARU in the North Pacific Ocean from 1998-04-18 to 1998-04-20 (NODC Accession 0112316)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112316 includes chemical, discrete sample, physical and profile data collected from TANKAI-MARU in the North Pacific Ocean from 1998-04-18 to...

  3. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the MIRAI in the North Pacific Ocean from 2006-05-26 to 2006-06-18 (NODC Accession 0112266)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112266 includes chemical, discrete sample, physical and profile data collected from MIRAI in the North Pacific Ocean from 2006-05-26 to 2006-06-18...

  4. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the JAN MAYEN in the Barents Sea from 2003-07-10 to 2003-07-18 (NODC Accession 0113565)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113565 includes chemical, discrete sample, physical and profile data collected from JAN MAYEN in the Barents Sea from 2003-07-10 to 2003-07-18 and...

  5. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the MIRAI in the North Pacific Ocean from 2001-06-04 to 2001-07-18 (NODC Accession 0112256)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112256 includes chemical, discrete sample, physical and profile data collected from MIRAI in the North Pacific Ocean from 2001-06-04 to 2001-07-18...

  6. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and HYDROSTATIC PRESSURE collected from discrete sample and profile observations using CTD, bottle and other instruments from the SEWARD JOHNSON in the North Atlantic Ocean from 2003-04-18 to 2003-05-22 (NODC Accession 0113596)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113596 includes chemical, discrete sample, physical and profile data collected from SEWARD JOHNSON in the North Atlantic Ocean from 2003-04-18 to...

  7. Temperature, salinity and other variables collected from Surface underway observations using CTD, Carbon dioxide (CO2) gas analyzer and other instruments from the AIRCRAFT in the Arctic Ocean from 2005-05-02 to 2009-05-18 (NODC Accession 0117695)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0117695 includes Surface underway, chemical and physical data collected from AIRCRAFT in the Arctic Ocean from 2005-05-02 to 2009-05-18 and retrieved...

  8. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from DISCOVERY in the North Atlantic Ocean from 2010-01-06 to 2010-02-18 (NODC Accession 0112761)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0112761 includes discrete sample and profile data collected from DISCOVERY in the North Atlantic Ocean from 2010-01-06 to 2010-02-18 and retrieved...

  9. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the MARION DUFRESNE in the Indian Ocean from 1998-08-18 to 1998-09-09 (NODC Accession 0113573)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113573 includes biological, chemical, discrete sample, physical and profile data collected from MARION DUFRESNE in the Indian Ocean from 1998-08-18...

  10. Bis(adamantan-1-aminium carbonate

    Directory of Open Access Journals (Sweden)

    Monika Nowakowska

    2012-04-01

    Full Text Available In the title compound, 2C10H18N+·CO32−, the adamantan-1-aminium cation forms three N—H...O hydrogen bonds to three carbonate ions, resulting in a layer parallel to (001 with the adamantane groups located on its surface so that adjacent layers form only C—H...H—C contacts. The carbonate anions occupy special positions of 32 symmetry, whereas the adamantan-1-aminium cations occupy special positions of 3 symmetry.

  11. Carbon and oxygen isotopic composition of the carbonates from the Jacupiranga and Catalao I carbonatite complexes, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Morikiyo, Toshiro (Shinshu Univ., Matsumoto, Nagano (Japan). Faculty of Science); Hirano, Hideo; Matsuhisa, Yukihiro

    1990-11-01

    Carbon and oxygen isotope compositions were measured for carbonates from the Jacupiranga and Catalao I carbonatite complexes in Brazil. The {delta}{sup 13}C values of the Jacupiranga carbonates are uniform, ranging from -6.4 to -5.6 per mille with the average of -6.07 per mille. Except for one sample, the {delta}{sup 18}O values of the carbonates are between 7.1 and 8.1 per mille, and the average value is 7.6 per mille. The isotopic compositions of the Jacupiranga carbonates represent the value of primary igneous carbonatite. The {delta}{sup 13}C values of dolomites are about 0.5 per mille higher than those of calcites. The {delta}{sup 13}C values of carbonates from the Catalao I complex range from -6.8 to -5.2 per mille with the average of -5.83 per mille. Those values are similar to the values of the Jacupiranga carbonates. However, oxygen isotopic compositions of the Catalao I carbonates show a wide range of 8.4 to 22.3 per mille. Carbonates with the lowest {delta}{sup 18}O values in the complex are considered to represent the igneous stage. Carbonates with extremely high {delta}{sup 18}O values of about 22 per mille are considered to have precipitated from low-temperature hydrothermal fluids. The group of intermediate {delta}{sup 18}O values indicates a variable degree of contamination by the {delta}{sup 18}O-rich hydrothermal carbonates. The contribution of secondary stage hydrothermal carbonates seems to be significant in the Catalao I complex as compared with the Jacupiranga complex. The development of a network structure in the Catalao I complex may have enhanced the circulation of the later stage hydrothermal fluids. (author).

  12. Texture recrystallization formation in 08Kh18T1

    International Nuclear Information System (INIS)

    Effect of heat treatment of semi-finished hot-rolled products before cold rolling and the strain degree on texture formation and the value of a plastic anisotropy coefficient in a cold-rolled sheet of the 08Kh18T1 steel after recrystallization has been investigated. The cold-rolled sheet of the ferritic stainless 08Kh18T1 steel after recrystallization at 950 deg C during 3 min is shown to have texture components like low-carbon steels: (111)(110), (111)(112), (112)(110), (100)(110) and axial component with axis (111). The quantative ratio of ideal oreientations in the steel depends on the degree of cold metal strain and to a larger extent on the structural state of semi-finished rolled products before cold rolling. Titanium addition in a stainless steel with 18% Cr affects formation, being favourable for texture sheet stamping with predominance of grain orientation with plane (111) only then, when titanium binds carbon and nitrogen in heat stable and disperse carbonitrides, which be in a cold-rolled sheet before recrystallization semi-finished hot-rolled products is to be subjected to stabilizing heat treatment before rolling. Increase in metal of orientations with plane (111) affects favourably increase of the plastic anisotropy coefficient of sheet rolling

  13. 50 CFR 14.18 - Marine mammals.

    Science.gov (United States)

    2010-10-01

    ... with the Marine Mammal Protection Act of 1972 and implementing regulations (50 CFR parts 18 and 216... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Marine mammals. 14.18 Section 14.18....18 Marine mammals. Any person subject to the jurisdiction of the United States who has lawfully...

  14. 18-FDG in diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Fares, Y. (Dept. of Biophysics, Faculty of Medicine, UAE Univ., Al Ain (United Arab Emirates)); Itoh, M. (Cyclotron and Radioisotope Centre, Tohoku Univ., Sendai (Japan)); Watabe, H. (Cyclotron and Radioisotope Centre, Tohoku Univ., Sendai (Japan)); Ghista, D.N. (Dept. of Biophysics, Faculty of Medicine, UAE Univ., Al Ain (United Arab Emirates))

    1993-06-01

    The intravenous glucose tolerance test, IVGTT, has been used to evaluate patients in whom abnormalities in carbohydrate metabolism and diabetes mellitus are suspected. IVGTT, if analyzed using 'minimal models', or discrete-time methods, provides information on the sensitivity of glucose disappearance to insulin and on pancreatic sensitivity to glucose, information that cannot be obtained from direct analysis of the dynamic response alone. In a preliminary study, data obtained by intravenously injecting 18-FDG in four subjects was analyzed using a discrete-time model. The experimental details, the results and their implications will be discussed. (orig.)

  15. Calibration of the polarimeter POMME with polarized deuterons at 1.8 GeV

    Energy Technology Data Exchange (ETDEWEB)

    Tomasi-Gustafsson, E. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Ladygin, V.P. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Boivin, M. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Boyard, J.L. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 -Gif-sur-Yvette (France); Jaeckle, V. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Morsch, P. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Kunne, R. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Plouin, F. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Wurzinger, R. [Laboratoire National Saturne, Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Bimbot, L. [CNRS/IN2P3 IPN, 91400 Orsay (France); Djalali, C. [CNRS/IN2P3 IPN, 91400 Orsay (France); Farhi, L. [CNRS/IN2P3 IPN, 91400 Orsay (France); Hennino, T. [CNRS/IN2P3 IPN, 91400 Orsay (France); Jourdain, J.C. [CNRS/IN2P3 IPN, 91400 Orsay (France); Morlet, M. [CNRS/IN2P3 IPN, 91400 Orsay (France); Ramstein, B. [CNRS/IN2P3 IPN, 91400 Orsay (France); Rosier, L.H. [CNRS/IN2P3 IPN, 91400 Orsay (France); Roy-Stephan, M. [CNRS/IN2P3 IPN, 91400 Orsay (France); Wiele, J. van de [CNRS/IN2P3 IPN, 91400 Orsay (France); Jones, M.K. [College of William and Mary, Williamsburg, VA (United States); Perdrisat, C.F. [College of William and Mary, Williamsburg, VA (United States); Punjabi, V. [Norfolk State Univ., VA (United States); Glashausser, C. [Rutgers - the State Univ., New Brunswick, NJ (United States); Piskunov, N.M. [Joint Inst. for Nuclear Research, Dubna (Russian Federation); Sitnik, I.M. [Joint Inst. for Nuclear Research, Dubna (Russian Federation); Strokovsky, E.A. [Joint Inst. for Nuclear Research, Dubna (Russian Federation)

    1995-11-21

    We report here the results of the calibration of the polarimeter POMME for vector polarized deuterons at an energy of 1.8 GeV. The results show that inclusive deuteron-carbon scattering has substantial vector analyzing power even at this high energy. The results obtained on two analyzers, carbon, which is generally used and a lighter material, paraffin, are found to be similar. (orig.).

  16. Beyond temperature: Clumped isotope signatures in dissolved inorganic carbon species and the influence of solution chemistry on carbonate mineral composition

    OpenAIRE

    Tripati, Aradhna K.; Hill, Pamela S.; Eagle, Robert A.; Mosenfelder, Jed L.; Tang, Jianwu; Schauble, Edwin A.; Eiler, John M.; Zeebe, Richard E.; Uchikawa, Joji; Coplen, Tyler B.; Ries, Justin B; Henry, Drew

    2015-01-01

    “Clumped-isotope” thermometry is an emerging tool to probe the temperature history of surface and subsurface environments based on measurements of the proportion of ^(13)C and ^(18)O isotopes bound to each other within carbonate minerals in ^(13)C^(18)O^(16)O_2^(2−) groups (heavy isotope “clumps”). Although most clumped isotope geothermometry implicitly presumes carbonate crystals have attained lattice equilibrium (i.e., thermodynamic equilibrium for a mineral, which is independent of solutio...

  17. Frontiers of graphene and carbon nanotubes devices and applications

    CERN Document Server

    2015-01-01

    This book focuses on carbon nanotubes and graphene as representatives of nano-carbon materials, and describes the growth of new technology and applications of new devices. As new devices and as new materials, nano-carbon materials are expected to be world pioneers that could not have been realized with conventional semiconductor materials, and as those that extend the limits of conventional semiconductor performance. This book introduces the latest achievements of nano-carbon devices, processes, and technology growth. It is anticipated that these studies will also be pioneers in the development of future research of nano-carbon devices and materials. This book consists of 18 chapters. Chapters 1 to 8 describe new device applications and new growth methods of graphene, and Chapters 9 to 18, those of carbon nanotubes. It is expected that by increasing the advantages and overcoming the weak points of nanocarbon materials, a new world that cannot be achieved with conventional materials will be greatly expanded. W...

  18. 40 CFR 86.222-94 - Carbon monoxide analyzer calibration.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Carbon monoxide analyzer calibration. 86.222-94 Section 86.222-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.222-94 Carbon...

  19. 40 CFR 86.224-94 - Carbon dioxide analyzer calibration.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Carbon dioxide analyzer calibration. 86.224-94 Section 86.224-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.224-94 Carbon...

  20. Carbon classified?

    DEFF Research Database (Denmark)

    Lippert, Ingmar

    2012-01-01

    . Using an actor- network theory (ANT) framework, the aim is to investigate the actors who bring together the elements needed to classify their carbon emission sources and unpack the heterogeneous relations drawn on. Based on an ethnographic study of corporate agents of ecological modernisation over...... a period of 13 months, this paper provides an exploration of three cases of enacting classification. Drawing on ANT, we problematise the silencing of a range of possible modalities of consumption facts and point to the ontological ethics involved in such performances. In a context of global warming...

  1. Jilin Chemical Fiber Group Launches Its Largest Carbon Fiber Preject

    Institute of Scientific and Technical Information of China (English)

    Flora

    2011-01-01

    China's carbon fiber precursor production line with 5,000 tons of annual output was put into operation in Jilin Chemical Fiber Group on November 18th this year, creating the maximum production capacity currently in China, for which Jilin Chemical Fiber Group become China's largest carbon fiber precursor production base, The smooth operation of the project has laid a solid foundation for promoting China's carbon fiber industry steady, rapid, and healthy development,

  2. Carbonic Acid Retreatment of Biomass

    Energy Technology Data Exchange (ETDEWEB)

    Baylor university

    2003-06-01

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  3. Carbonic Acid Pretreatment of Biomass

    Energy Technology Data Exchange (ETDEWEB)

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

    2003-05-31

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  4. Carbon Nanomembranes.

    Science.gov (United States)

    Turchanin, Andrey; Gölzhäuser, Armin

    2016-08-01

    Carbon nanomembranes (CNMs) are synthetic 2D carbon sheets with tailored physical or chemical properties. These depend on the structure, molecular composition, and surroundings on either side. Due to their molecular thickness, they can be regarded as "interfaces without bulk" separating regions of different gaseous, liquid, or solid components and controlling the materials exchange between them. Here, a universal scheme for the fabrication of 1 nm-thick, mechanically stable, functional CNMs is presented. CNMs can be further modified, for example perforated by ion bombardment or chemically functionalized by the binding of other molecules onto the surfaces. The underlying physical and chemical mechanisms are described, and examples are presented for the engineering of complex surface architectures, e.g., nanopatterns of proteins, fluorescent dyes, or polymer brushes. A simple transfer procedure allows CNMs to be placed on various support structures, which makes them available for diverse applications: supports for electron and X-ray microscopy, nanolithography, nanosieves, Janus nanomembranes, polymer carpets, complex layered structures, functionalization of graphene, novel nanoelectronic and nanomechanical devices. To close, the potential of CNMs in filtration and sensorics is discussed. Based on tests for the separation of gas molecules, it is argued that ballistic membranes may play a prominent role in future efforts of materials separation. PMID:27281234

  5. A molecular organic carbon isotope record of Miocene climate changes

    NARCIS (Netherlands)

    Schoell, M.; Schouten, S.; Sinninghe Damsté, J.S.; Leeuw, J.W. de; Summons, R.E.

    1994-01-01

    The difference in carbon-13 (13C) contents of hopane and sterane biomarkers in the Monterey formation (Naples Beach, California) parallels the Miocene inorganic record of the change in 18O (δ18O), reflecting the Miocene evolution from a well-mixed to a highly stratified photic zone (upper 100 meters

  6. Trading forest carbon

    Science.gov (United States)

    The nature of carbon in forests is discussed from the perspective of carbon trading. Carbon inventories, specifically in the area of land use and forestry are reviewed for the Pacific Northwest. Carbon turnover in forests is discussed as it relates to carbon sequestration. Scient...

  7. 48 CFR 53.301-18 - SF 18 (Rev. 6/95), Request for Quotations.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false SF 18 (Rev. 6/95), Request for Quotations. 53.301-18 Section 53.301-18 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Illustrations of Forms 53.301-18 SF 18 (Rev. 6/95),...

  8. Limits on the Natural Oxygen-18 Abundance of Cellulose: Intra-molecular Patterns

    Science.gov (United States)

    Sternberg, L.; Jahren, H.; Anderson, W.; Pinzon, M. C.

    2005-12-01

    The oxygen isotope composition of tree-ring cellulose is an often-invoked quantitative proxy for multiple environmental factors, including paleotemperature, paleohumidity and paleoprecipitation patterns. A broad survey of aerial and aquatic plants reveals an upper limit to the 18O enrichment of cellulose relative to water at the site of cellulose synthesis, which we explain via the comparison of individual oxygen atoms within the cellulose molecule. We collected stems from various geographical regions, extracted stem water and cellulose and determined the oxygen isotope ratios of these two components. The cellulose was hydrolyzed to its glucose moieties and derivatized to determine the oxygen isotope ratios of the oxygens attached to carbon 3, 4, 5, 6 of the glucose moieties, which allowed us to calculate the oxygen isotope ratios of the oxygen attached to the carbon 2 of the glucose moieties. A compilation of results from our collection and from previous publications shows that δ18O values of cellulose increase with δ18O values of stem water only for samples having stem water with δ18O values below -10‰ (SMOW). However, the δ18O values of stem cellulose levels off and remains constant for stems having water with δ18O values greater than -10‰. This pattern suggests a limit on the enrichment of stem (and by inference tree ring) cellulose. This limitation had previously been ascribed to environmental factors affecting leaf water (e.g., humidity, stomatal conductance, solute potential). A compilation of the δ18O values of cellulose from aquatic plants versus that of their ambient water, however, shows the same general pattern which has been previously explained on the basis of evaporation rates and heterogeneities of lake water. We disprove the previous explanations by demonstrating differential isotopic effects on the oxygen atoms of the cellulose molecule. Our observation on the δ18O values of oxygen attached to carbon 2 versus those attached to carbon 3

  9. 18-24 Months: Your Child's Development

    Science.gov (United States)

    ... Resources & Services Parenting Resource 18–24 Months: Your Child’s Development Download Files Feb 10, 2016 This is a ... home language in the same sentence. Downloads Your Child's Development: 18–24 Months PDF 464 KB Read more ...

  10. 29 CFR 18.1103 - Title.

    Science.gov (United States)

    2010-07-01

    ... ADMINISTRATIVE LAW JUDGES Rules of Evidence Applicability § 18.1103 Title. These rules may be known as the United States Department of Labor Rules of Evidence and cited as 29 CFR 18.__ (1989)....

  11. Carbon Farming as a Carbon Negative Technology

    Science.gov (United States)

    Anderson, C.; Laird, D.; Hayes, D. J.

    2015-12-01

    Carbon farms have a pivotal role in national and international efforts to mitigate and adapt to climate change. A carbon farm in its broadest sense is one that reduces greenhouse gas (GHG) emissions or captures and holds carbon in vegetation and soils. Their capacity to remove carbon from the air and store it safely and permanently, while providing additional human and ecosystem benefits, means they could contribute significantly to national efforts to stabilize or reduce GHGs. We examine carbon farms in the context of corn and soybean production agriculture. We illustrate, using Iowa data but with relevance across United States corn and soybean production, the potential for carbon farms to reduce human GHG emissions and sequester carbon permanently at a rate that has meaningful impact on global greenhouse gas concentration. Carbon has been viewed as a next generation cash crop in Iowa for over a decade. The carbon farm perspective, however, goes beyond carbon as cash crop to make carbon the center of an entire farm enterprise. The transformation is possible through slight adjustment crop practices mixed with advances in technology to sequester carbon through biochar. We examine carbon balance of Iowa agriculture given only the combination of slight reduction in fertilizer and sequestration by biochar. We find the following. Iowa carbon farms could turn Iowa agriculture into a carbon sink. The estimated range of GHG reduction by statewide implementation of carbon farms is 19.46 to 90.27 MMt CO2-equivalent (CO2-e), while the current agricultural CO2-e emission estimate is 35.38 MMt CO2-e. Iowa carbon farm GHG reduction would exceed Iowa GHG reduction by wind energy (8.7 MMt CO2-e) and could exceed combined reductions from wind energy and corn grain ethanol (10.7 MMt CO2-e; 19.4 MMt CO2-e combined). In fact, Iowa carbon farms alone could exceed GHG reduction from national corn grain ethanol production (39.6 MMt CO2-e). A carbon price accessible to agricultural

  12. Net Ecosystem Carbon Flux

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Net Ecosystem Carbon Flux is defined as the year-over-year change in Total Ecosystem Carbon Stock, or the net rate of carbon exchange between an ecosystem and the...

  13. Carbon Monoxide (CO)

    Science.gov (United States)

    ... IAQ) » Carbon Monoxide's Impact on Indoor Air Quality Carbon Monoxide's Impact on Indoor Air Quality On this ... length of exposure. Top of Page Sources of Carbon Monoxide Sources of CO include: unvented kerosene and ...

  14. Carbon Monoxide Poisoning

    Science.gov (United States)

    ... Recommend on Facebook Tweet Share Compartir What is Carbon Monoxide? Carbon monoxide, or “CO,” is an odorless, colorless gas that can kill you. Carbon monoxide detector Where is CO found? CO is ...

  15. 7 CFR 632.18 - Special projects.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Special projects. 632.18 Section 632.18 Agriculture... AGRICULTURE LONG TERM CONTRACTING RURAL ABANDONED MINE PROGRAM Qualifications § 632.18 Special projects. (a) The NRCS State conservationist may approve the following types of special projects subject to...

  16. 48 CFR 18.204 - Resources.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Resources. 18.204 Section 18.204 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES EMERGENCY ACQUISITIONS Emergency Acquisition Flexibilities 18.204 Resources. (a)...

  17. 7 CFR 946.18 - Container.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container. 946.18 Section 946.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Order Regulating Handling Definitions § 946.18 Container. Container means a sack, box, bag,...

  18. 25 CFR 75.18 - Adoption.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Adoption. 75.18 Section 75.18 Indians BUREAU OF INDIAN... OF CHEROKEE INDIANS, NORTH CAROLINA § 75.18 Adoption. The Tribal Council of the Eastern Band of Cherokee Indians shall be empowered to enact ordinances governing the adoption of new members....

  19. 38 CFR 18b.57 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Evidence. 18b.57 Section 18b.57 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) PRACTICE AND... § 18b.57 Evidence. Irrelevant, immaterial, unreliable, and unduly repetitious evidence will be excluded....

  20. 22 CFR 18.16 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Evidence. 18.16 Section 18.16 Foreign Relations... Enforcement Proceedings § 18.16 Evidence. The rules of evidence prevailing in courts of law and equity are not controlling in hearings under this part. However, the hearing examiner shall exclude evidence which...

  1. 28 CFR 542.18 - Response time.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Response time. 542.18 Section 542.18... REMEDY Administrative Remedy Program § 542.18 Response time. If accepted, a Request or Appeal is... later than the third calendar day after filing. If the time period for response to a Request or...

  2. 50 CFR 401.18 - Contracts.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Contracts. 401.18 Section 401.18 Wildlife..., DEVELOPMENT AND ENHANCEMENT § 401.18 Contracts. A Cooperator may use its own regulations or guidelines in obtaining services by contract or otherwise, provided that they adhere to applicable Federal...

  3. 31 CFR 92.18 - Judicial review.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Judicial review. 92.18 Section 92.18... States Mint § 92.18 Judicial review. A Final Notice of Assessment issued under the procedures in this subpart may be subject to judicial review pursuant to 5 U.S.C. 701 et seq....

  4. 29 CFR 525.18 - Review.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Review. 525.18 Section 525.18 Labor Regulations Relating to... DISABILITIES UNDER SPECIAL CERTIFICATES § 525.18 Review. Any person aggrieved by any action of the... allow, file with the Administrator a petition for review. Such review, if granted, shall be made by...

  5. 46 CFR Sec. 18 - Group classification.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Group classification. Sec. 18 Section 18 Shipping... Sec. 18 Group classification. In the preparation of specifications, Job Orders, Supplemental Job... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards...

  6. 21 CFR 26.18 - Regulatory collaboration.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Regulatory collaboration. 26.18 Section 26.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL... Specific Sector Provisions for Pharmaceutical Good Manufacturing Practices § 26.18 Regulatory...

  7. 33 CFR 273.18 - Clearinghouse coordination.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Clearinghouse coordination. 273.18 Section 273.18 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE AQUATIC PLANT CONTROL § 273.18 Clearinghouse coordination. Procedures prescribed...

  8. 22 CFR 308.18 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Fees. 308.18 Section 308.18 Foreign Relations PEACE CORPS IMPLEMENTATION OF THE PRIVACY ACT OF 1974 § 308.18 Fees. No fees shall be charged for search time or for any other time expended by the agency to produce a record. Copies of records may be...

  9. 1 CFR 18.8 - Seal.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Seal. 18.8 Section 18.8 General Provisions ADMINISTRATIVE COMMITTEE OF THE FEDERAL REGISTER PREPARATION, TRANSMITTAL, AND PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.8 Seal. Use of a seal on an original document...

  10. 29 CFR 1917.18 - Log handling.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Log handling. 1917.18 Section 1917.18 Labor Regulations...) MARINE TERMINALS Marine Terminal Operations § 1917.18 Log handling. (a) The employer shall ensure that structures (bunks) used to contain logs have rounded corners and rounded structural parts to avoid...

  11. 15 CFR 2301.18 - Selection process.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Selection process. 2301.18 Section 2301.18 Commerce and Foreign Trade Regulations Relating to Telecommunications and Information NATIONAL... PROGRAM Evaluation and Selection Process § 2301.18 Selection process. (a) The PTFP Director will...

  12. 39 CFR 952.18 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Evidence. 952.18 Section 952.18 Postal Service... AND LOTTERY ORDERS § 952.18 Evidence. (a) Except as otherwise provided in these rules, the Federal Rules of Evidence shall govern. However, such rules may be relaxed to the extent that the...

  13. 42 CFR 73.18 - Inspections.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inspections. 73.18 Section 73.18 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES QUARANTINE, INSPECTION, LICENSING SELECT AGENTS AND TOXINS § 73.18 Inspections. (a) Without prior notification, the HHS Secretary, shall...

  14. 29 CFR 30.18 - Nondiscrimination.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Nondiscrimination. 30.18 Section 30.18 Labor Office of the Secretary of Labor EQUAL EMPLOYMENT OPPORTUNITY IN APPRENTICESHIP AND TRAINING § 30.18 Nondiscrimination. The commitments contained in the sponsor's affirmative action program are not intended and shall not be used to discriminate against...

  15. 12 CFR 703.18 - Grandfathered investments.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Grandfathered investments. 703.18 Section 703.18 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS AFFECTING CREDIT UNIONS INVESTMENT AND DEPOSIT ACTIVITIES § 703.18 Grandfathered investments. (a) Subject to safety and...

  16. 12 CFR 1.8 - Nonconforming investments.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Nonconforming investments. 1.8 Section 1.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY INVESTMENT SECURITIES § 1.8 Nonconforming investments. (a) A national bank's investment in securities that no longer conform to this...

  17. 24 CFR 26.18 - Discovery.

    Science.gov (United States)

    2010-04-01

    ... knowledge of any discoverable matter. For good cause, the hearing officer may order discovery of any matter... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Discovery. 26.18 Section 26.18... PROCEDURES Hearings Before Hearing Officers Discovery § 26.18 Discovery. (a) General. The parties...

  18. 30 CFR 778.18 - Insurance.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Insurance. 778.18 Section 778.18 Mineral... APPLICATIONS-MINIMUM REQUIREMENTS FOR LEGAL, FINANCIAL, COMPLIANCE, AND RELATED INFORMATION § 778.18 Insurance. An application shall contain either a certificate of liability insurance or evidence of...

  19. 49 CFR 18.41 - Financial reporting.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Financial reporting. 18.41 Section 18.41... Enforcement § 18.41 Financial reporting. (a) General. (1) Except as provided in paragraphs (a) (2) and (5) of...) Submitting financial reports to Federal agencies, or (ii) Requesting advances or reimbursements when...

  20. 1 CFR 18.5 - Certified copies.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Certified copies. 18.5 Section 18.5 General... DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.5 Certified copies. The certified copies or duplicate originals of each document must be submitted with the original. Each copy or...

  1. 29 CFR 18.50 - Authenticity.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Authenticity. 18.50 Section 18.50 Labor Office of the Secretary of Labor RULES OF PRACTICE AND PROCEDURE FOR ADMINISTRATIVE HEARINGS BEFORE THE OFFICE OF ADMINISTRATIVE LAW JUDGES General § 18.50 Authenticity. The authenticity of all documents submitted as...

  2. 7 CFR 1218.18 - Research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Research. 1218.18 Section 1218.18 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH, AND INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.18...

  3. 7 CFR 1206.18 - Research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Research. 1206.18 Section 1206.18 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MANGO PROMOTION, RESEARCH, AND INFORMATION Mango Promotion, Research, and Information Order Definitions § 1206.18 Research. Research...

  4. 38 CFR 18b.2 - Reviewing authority.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Reviewing authority. 18b.2 Section 18b.2 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED... Rules § 18b.2 Reviewing authority. The term reviewing authority means the Secretary of Veterans...

  5. 30 CFR 18.45 - Cable reels.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Cable reels. 18.45 Section 18.45 Mineral... § 18.45 Cable reels. (a) A self-propelled machine, that receives electrical energy through a portable cable and is designed to travel at speeds exceeding 2.5 miles per hour, shall have a...

  6. 27 CFR 18.25 - Organizational documents.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Organizational documents. 18.25 Section 18.25 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... § 18.25 Organizational documents. The supporting information required by paragraph (d) of §...

  7. 31 CFR 1.8 - Scope.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Scope. 1.8 Section 1.8 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Other Disclosure Provisions § 1.8 Scope. The regulations in this subpart concern access to information and records other...

  8. 32 CFR 552.18 - Administration.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Administration. 552.18 Section 552.18 National... CEMETERIES REGULATIONS AFFECTING MILITARY RESERVATIONS Post Commander § 552.18 Administration. (a) Purpose... economical operation, administration, service, and supply of all individuals, units, and activities...

  9. 7 CFR 29.18 - Person.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Person. 29.18 Section 29.18 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Regulations Definitions § 29.18 Person. Individual, association, partnership, or corporation....

  10. 30 CFR 18.26 - Static electricity.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Static electricity. 18.26 Section 18.26 Mineral... § 18.26 Static electricity. Nonmetallic rotating parts, such as belts and fans, shall be provided with a means to prevent an accumulation of static electricity....

  11. 29 CFR 18.13 - Discovery methods.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Discovery methods. 18.13 Section 18.13 Labor Office of the... ADMINISTRATIVE LAW JUDGES General § 18.13 Discovery methods. Parties may obtain discovery by one or more of the following methods: Depositions upon oral examination or written questions; written...

  12. 38 CFR 18.438 - Adult education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Adult education. 18.438 Section 18.438 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED... Adult Education § 18.438 Adult education. A recipient that provides adult education may not, on...

  13. 7 CFR 247.18 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 247.18 Section 247.18 Agriculture... CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.18 Nutrition education. (a) What are the State agency's responsibilities in ensuring that nutrition education is provided? The State...

  14. 32 CFR 18.3 - Organization.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Organization. 18.3 Section 18.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE MILITARY COMMISSIONS APPOINTING AUTHORITY FOR MILITARY COMMISSIONS § 18.3 Organization. (a) The Appointing Authority for Military Commissions...

  15. 30 CFR 18.24 - Electrical clearances.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Electrical clearances. 18.24 Section 18.24... APPROVAL OF MINING PRODUCTS ELECTRIC MOTOR-DRIVEN MINE EQUIPMENT AND ACCESSORIES Construction and Design Requirements § 18.24 Electrical clearances. Minimum clearances between uninsulated electrical...

  16. 45 CFR 16.18 - Mediation.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Mediation. 16.18 Section 16.18 Public Welfare... BOARD § 16.18 Mediation. (a) In cases pending before the Board. If the Board decides that mediation... mediation techniques and will provide or assist in selecting a mediator. The mediator may take any...

  17. 27 CFR 18.19 - Security.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Security. 18.19 Section 18.19 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE... Provisions Document Requirements § 18.19 Security. The concentrate plant and equipment will be so...

  18. 10 CFR 605.18 - National security.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false National security. 605.18 Section 605.18 Energy DEPARTMENT... PROGRAM § 605.18 National security. Activities under ER's Financial Assistance Program shall not involve classified information (i.e., Restricted Data, formerly Restricted Data, National Security...

  19. 38 CFR 18b.93 - Expeditious treatment.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Expeditious treatment. 18b.93 Section 18b.93 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Judicial Standards of Practice § 18b.93 Expeditious treatment. Requests for expeditious treatment...

  20. 7 CFR 1709.18 - Civil rights.

    Science.gov (United States)

    2010-01-01

    ... benefits and on equal employment opportunity including 7 CFR parts 15 and 15b; and 45 CFR part 90, as... 7 Agriculture 11 2010-01-01 2010-01-01 false Civil rights. 1709.18 Section 1709.18 Agriculture... ASSISTANCE TO HIGH ENERGY COST COMMUNITIES General Requirements § 1709.18 Civil rights. This program will...

  1. 21 CFR 349.18 - Ophthalmic vasoconstrictors.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Ophthalmic vasoconstrictors. 349.18 Section 349.18... FOR HUMAN USE OPHTHALMIC DRUG PRODUCTS FOR OVER-THE-COUNTER HUMAN USE Active Ingredients § 349.18 Ophthalmic vasoconstrictors. The active ingredient of the product consists of one of the following,...

  2. 28 CFR 100.18 - Audit.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Audit. 100.18 Section 100.18 Judicial... ENFORCEMENT ACT OF 1994 § 100.18 Audit. (a) General. In order to evaluate the accuracy, completeness, and... examine and audit all of the carrier's supporting materials. (1) These materials include, but are...

  3. 7 CFR 966.18 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 966.18 Section 966.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 966.18 Export. Export means shipment of tomatoes beyond the boundaries of the...

  4. 7 CFR 959.18 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 959.18 Section 959.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 959.18 Export. Export means to ship onions to any destination which is not...

  5. Isotopes of deuterium and oxygen-18 in thermal groundwater in China

    Science.gov (United States)

    Xun, Zhou; Bin, Fang; Haiyan, Zhou; Juan, Li; Ying, Wang

    2009-06-01

    Compositions of deuterium and 18O isotopes of 90 representative samples indicate that thermal groundwater in most parts of China is meteoric in origin. Latitude, altitude, and continent effects have significant bearing on the values of δD and δ18O of the hot water samples. Oxygen-18 shift is not significant in most of the thermal groundwater, especially the hot water of low-to-moderate temperature. Slight oxygen-18 shift is only found in some hot springs of high temperature in Tibet and western Yunnan and in thermal groundwater of low-to-moderate temperature in the deep-seated carbonate aquifers in the northern North China Plain (including the Tianjin area). Near-surface boiling may causes the shift of the former and the latter may be attributed to exchange of oxygen-18 between water and carbonates in the geothermal systems of taphrogenic basin-type. Hot springs in Tibet and western Sichuan have very low contents of δD and δ18O, possibly due to recharge of precipitation and snow-melting water of extremely depleted δD and δ18O values at high latitudes of several thousands of meters.

  6. Oxygen-18 enrichment of planktonic foraminifera due to gametongenic calcification below the euphotic zone

    Energy Technology Data Exchange (ETDEWEB)

    Duplessy, J.C. (Commissariat a l' Energie Atomique, Gif-sur-Yvette, France); Blanc, P.L.; Be, A.W.H.

    1981-09-11

    Empty shells of spinose planktonic foraminifera on the seabed are significantly enriched in oxygen-18 as compared with the shells of their living counterparts in surface waters. This enrichment is due to gametogenic calcification, which extracts calcium carbonate from deeper and colder waters as the shell sinks below the euphotic zone.

  7. Oxygen-18 enrichment of planktonic foraminifera due to gametogenic calcification below the euphotic zone.

    Science.gov (United States)

    Blanc, P L; Bé, A W

    1981-09-11

    Empty shells of spinose planktonic foraminifera on the seabed are significantly enriched in oxygen-18 as compared with the shells of their living counterparts in surface waters. This enrichment is due to gametogenic calcification, which extracts calcium carbonate from deeper and colder waters as the shell sinks below the euphotic zone. JEAN-CLAUDE DUPLESSY. PMID:17744758

  8. Integral Ring Carbon-Carbon Piston

    Science.gov (United States)

    Northam, G. Burton (Inventor)

    1999-01-01

    An improved structure for a reciprocating internal combustion engine or compressor piston fabricate from carbon-carbon composite materials is disclosed. An integral ring carbon-carbon composite piston, disclosed herein, reduces the need for piston rings and for small clearances by providing a small flexible, integral component around the piston that allows for variation in clearance due to manufacturing tolerances, distortion due to pressure and thermal loads, and variations in thermal expansion differences between the piston and cylinder liner.

  9. Carbon dioxide sequestration by mineral carbonation

    OpenAIRE

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept behind mineral CO2 sequestration is the mimicking of natural weathering processes in which calcium or magnesium containing minerals react with gaseous CO2 and form solid calcium or magnesium carbonate...

  10. Carbon Residence Times in Pedogenic Carbonate Pools

    Science.gov (United States)

    Monger, H.; Feng, Y.; Karnjanapiboonwang, A.

    2013-12-01

    Soil carbonate is a huge pool of terrestrial carbon that contains at least 930 to 940 Pg C and has influx rates on the order of 1 to 12 g CaCO3/m2/yr. Such large mass to flux ratios yield long mean residence times for carbon (e.g., 85,000 years)--assuming steady state. Like other global carbon pools, the soil carbonate pool has smaller sub-pools with higher influx rates and shorter mean residence times. For example, pedogenic carbonate in coppice dunes known to have formed since 1858 and carbonate formed on lithic artifacts in soils at archaeology sites suggests mean residence times can be as short as 120 years--again assuming steady state. Harder to assess are efflux rates as CO2 emissions or bicarbonate leaching. Some Bowen-ratio studies have nevertheless found evidence for CO2 emissions resulting from carbonate dissolution, and other studies have found evidence for bicarbonate leaching based on dissolution pipes through calcic horizons using soil morphology studies. Since an understanding of mean residence times are prerequisite for a better understanding of soil carbonate in the global carbon cycle, especially in a scenario of an expanding Aridosphere, more influx and efflux measurements are needed to evaluate the possibility of carbon sequestration by soil carbonate in hyperarid, arid, semiarid, or subhumid soils.

  11. Carbon dioxide sequestration by mineral carbonation

    NARCIS (Netherlands)

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept beh

  12. Imbalance of Interleukin 18 and Interleukin 18 Binding Protein in Patients with Lupus Nephritis

    Institute of Scientific and Technical Information of China (English)

    Dong Liang; Wenfeng Ma; Cuiwei Yao; Huafeng Liu; Xiaowen Chen

    2006-01-01

    To evaluate the balance status of interleukin 18 (IL-18) and interleukin 18 binding protein (IL-18BP) in circulation in patients with lupus nephritis (LN) and primary nephrotic syndrome (PNS), plasma levels as well as mRNA expression in peripheral blood mononuclear cells (PBMCs) of IL-18 and IL-18BP were measured by ELISA and RT-PCR respectively. The ratio of IL-18/IL-18BP was also calculated. Both plasma IL-18 and IL-18BP increased significantly in LN patients while only IL-18BP increased in PNS, which resulted in an elevated ratio of IL-18/IL-18BP in LN but not in PNS patients when compared with normal controls. In contrast, increased level of IL-18 mRNA was only detected in LN but not in PNS group, although IL-18BP mRNA expressions in PBMCs in both groups were higher than that in control. The imbalance of IL-18 and IL-18BP might be involved in the pathogenesis of LN, based on which a therapeutic approach is valuable to be developed for LN. Cellular & Molecular Immunology. 2006;3(4):303-306.

  13. Characteristics and forming mechanism of precipitates in 18Mn18Cr high nitrogen steel%18Mn18Cr 高氮钢析出相特征及形成机制

    Institute of Scientific and Technical Information of China (English)

    房菲; 李静媛; 王一德

    2014-01-01

    The effects of carbon and nitrogen contents on the characteristics and forming mechanism of precipitates in as-cast and aged 18Mn18Cr high nitrogen steels were investigated by optical microscopy, scanning electron microscopy, electron probe micro-analy-sis, transmission electron microscopy and thermodynamics calculation (Thermo-Calc). It is found that with the decrease in mass ratio of C to N, the precipitate is Cr23 C6 phase, σ phase and Cr2 N phase in the as-cast steel in turn. The precipitation of Cr23 C6 and Cr2 N phase increases as the C or N content increases. C and N contents influence the solidification mode of the tested steel and the eutectoid decomposition of the unstable ferrite phase. The solidification mode of 18Mn18Cr0. 44N steel is an AF mode, and the eutectoid decom-position reactions corresponding to the C contents of 0. 025% and 0. 16% are δ→σ + γ2 (0. 025% C) and δ→γ2 + Cr23 (Cx Ny ) 6 (x/ y> 1) (0. 16% C), respectively. The solidification mode of 18Mn18Cr0. 72N steel is an A mode, and a little granular Cr2 N phases precipitate on grain boundaries. Only laminar Cr2 N0. 39 C0. 61 phase exits in the aged steel, and with the increase of C + N content, the volume fraction and lamellar spacing of the precipitates increase, but the incubation time decreases.%通过金相显微镜、扫描电镜、电子探针显微分析、透射电镜及热力学计算软件研究 C 和 N 含量对铸态及时效态18Mn18Cr 高氮钢析出相特征及形成机制的影响.研究发现在铸态,随 C/ N 质量比降低,析出相依次为 Cr23 C6相、σ相和 Cr2 N相.增加 C 或 N 含量可分别促进 Cr23 C6相和 Cr2 N 相析出. C 和 N 含量影响实验钢凝固模式及不稳定铁素体相共析分解产物.18Mn18Cr0.44N 钢凝固模式为 AF 模式,不稳定铁素体相共析分解反应为δ→σ+γ2(0.025% C)和δ→γ2+ Cr23(Cx Ny )6(x/ y >1)(0.16% C);18Mn18Cr0.72N 钢凝固模式为 A 模式,晶界处存在少量颗粒状 Cr2 N 相.

  14. From carbon nanotubes to carbon atomic chains

    Science.gov (United States)

    Casillas García, Gilberto; Zhang, Weijia; José-Yacamán, Miguel

    2010-10-01

    Carbyne is a linear allotrope of carbon. It is formed by a linear arrangement of carbon atoms with sp-hybridization. We present a reliable and reproducible experiment to obtain these carbon atomic chains using few-layer-graphene (FLG) sheets and a HRTEM. First the FLG sheets were synthesized from worm-like exfoliated graphite and then drop-casted on a lacey-carbon copper grid. Once in the TEM, two holes are opened near each other in a FLG sheet by focusing the electron beam into a small spot. Due to the radiation, the carbon atoms rearrange themselves between the two holes and form carbon fibers. The beam is concentrated on the carbon fibers in order excite the atoms and induce a tension until multi wall carbon nanotube (MWCNT) is formed. As the radiation continues the MWCNT breaks down until there is only a single wall carbon nanotube (SWCNT). Then, when the SWCNT breaks, an atomic carbon chain is formed, lasts for several seconds under the radiation and finally breaks. This demonstrates the stability of this carbon structure.

  15. The dynamic response of carbon fiber-filled polymer composites

    OpenAIRE

    Patterson B.; Orler E.B.; Furmanski J.; Rigg P.A.; Scharff R.J.; Stahl D.B.; Sheffield S.A.; Gustavsen R.L.; Dattelbaum D.M.; Coe J.D.

    2012-01-01

    The dynamic (shock) responses of two carbon fiber-filled polymer composites have been quantified using gas gun-driven plate impact experimentation. The first composite is a filament-wound, highly unidirectional carbon fiber-filled epoxy with a high degree of porosity. The second composite is a chopped carbon fiber- and graphite-filled phenolic resin with little-to-no porosity. Hugoniot data are presented for the carbon fiber-epoxy (CE) composite to 18.6 GPa in the through-thickness direction,...

  16. V18P9C2. A complex phosphide carbide

    International Nuclear Information System (INIS)

    V18P9C2 crystallizes in the orthorhombic space group Pmma with the lattice parameters a = 17.044(3), b = 3.2219(7), and c = 13.030(2) Aa, Z = 2. The crystal structure is composed of 19 symmetry-independent atoms. The crystal structure is considered as a network formed by the transition metal atoms exhibiting cubic, trigonal prismatic, and octahedral voids centered by V, P, and C atoms, respectively. Vice versa, the V and P atoms form a three-dimensional network. The two CV6 octahedra are edge- and corner-connected to chains running parallel to [010]. The five unique P atoms are trigonal prismatically coordinated by V atoms with one to three faces capped again by a V atom. The V atoms have mainly cubic environments formed solely by V or by V and P atoms. V18P9C2 exhibits some structural relations to other compounds of the ternary system V-P-C as well as to other intermetallic phases. Despite the low carbon content, V18P9C2 is considered as a ternary compound rather than an interstitially stabilized (binary) phosphide in view of its special structural features.

  17. Global deforestation: contribution to atmospheric carbon dioxide.

    Science.gov (United States)

    Woodwell, G M; Hobbie, J E; Houghton, R A; Melillo, J M; Moore, B; Peterson, B J; Shaver, G R

    1983-12-01

    A study of effects of terrestrial biota on the amount of carbon dioxide in the atmosphere suggests that the global net release of carbon due to forest clearing between 1860 and 1980 was between 135 x 10(15) and 228 x 10(15) grams. Between 1.8 x 10(15) and 4.7 x 10(15) grams of carbon were released in 1980, of which nearly 80 percent was due to deforestation, principally in the tropics. The annual release of carbon from the biota and soils exceeded the release from fossil fuels until about 1960. Because the biotic release has been and remains much larger than is commonly assumed, the airborne fraction, usually considered to be about 50 percent of the release from fossil fuels, was probably between 22 and 43 percent of the total carbon released in 1980. The increase in carbon dioxide in the atmosphere is thought by some to be increasing the storage of carbon in the earth's remaining forests sufficiently to offset the release from deforestation. The interpretation of the evidence presented here suggests no such effect; deforestation appears to be the dominant biotic effect on atmospheric carbon dioxide. If deforestation increases in proportion to population, the biotic release of carbon will reach 9 x 10(15) grams per year before forests are exhausted early in the next century. The possibilities for limiting the accumulation of carbon dioxide in the atmosphere through reduction in use of fossil fuels and through management of forests may be greater than is commonly assumed. PMID:17747369

  18. Structure-function study of mammalian Munc18-1 and C. elegans UNC-18 implicates domain 3b in the regulation of exocytosis.

    Directory of Open Access Journals (Sweden)

    Margaret E Graham

    Full Text Available Munc18-1 is an essential synaptic protein functioning during multiple stages of the exocytotic process including vesicle recruitment, docking and fusion. These functions require a number of distinct syntaxin-dependent interactions; however, Munc18-1 also regulates vesicle fusion via syntaxin-independent interactions with other exocytotic proteins. Although the structural regions of the Munc18-1 protein involved in closed-conformation syntaxin binding have been thoroughly examined, regions of the protein involved in other interactions are poorly characterised. To investigate this we performed a random transposon mutagenesis, identifying domain 3b of Munc18-1 as a functionally important region of the protein. Transposon insertion in an exposed loop within this domain specifically disrupted Mint1 binding despite leaving affinity for closed conformation syntaxin and binding to the SNARE complex unaffected. The insertion mutation significantly reduced total amounts of exocytosis as measured by carbon fiber amperometry in chromaffin cells. Introduction of the equivalent mutation in UNC-18 in Caenorhabditis elegans also reduced neurotransmitter release as assessed by aldicarb sensitivity. Correlation between the two experimental methods for recording changes in the number of exocytotic events was verified using a previously identified gain of function Munc18-1 mutation E466K (increased exocytosis in chromaffin cells and aldicarb hypersensitivity of C. elegans. These data implicate a novel role for an exposed loop in domain 3b of Munc18-1 in transducing regulation of vesicle fusion independent of closed-conformation syntaxin binding.

  19. Carbon nanotube composite materials

    Energy Technology Data Exchange (ETDEWEB)

    O' Bryan, Gregory; Skinner, Jack L; Vance, Andrew; Yang, Elaine Lai; Zifer, Thomas

    2015-03-24

    A material consisting essentially of a vinyl thermoplastic polymer, un-functionalized carbon nanotubes and hydroxylated carbon nanotubes dissolved in a solvent. Un-functionalized carbon nanotube concentrations up to 30 wt % and hydroxylated carbon nanotube concentrations up to 40 wt % can be used with even small concentrations of each (less than 2 wt %) useful in producing enhanced conductivity properties of formed thin films.

  20. Mutagenicity of carbon nanomaterials

    DEFF Research Database (Denmark)

    Wallin, Håkan; Jacobsen, Nicklas Raun; White, Paul A;

    2011-01-01

    Carbon nanomaterials such carbon nanotubes, graphene and fullerenes are some the most promising nanomaterials. Although carbon nanomaterials have been reported to possess genotoxic potential, it is imperitive to analyse the data on the genotoxicity of carbon nanomaterials in vivo and in vitro...

  1. IL-18 and IL-18 binding protein levels in patients with dengue virus infection

    Institute of Scientific and Technical Information of China (English)

    Chintana Chirathaworn; Yong Poovorawan; Viboonsak Vuthitanachot

    2010-01-01

    Objective:To determine the levels ofIL-18 andIL-18binding protein(BP) in patients with dengue virus infection.Methods: Acute and convalescent sera were collected from each patient. Control group was sera from blood donors. The levels of both IL-18 andIL-18BP were measured byELISA assays.Results: It was shown thatIL-18 andIL-18BPlevels were significantly higher in patients when compared with controls. In addition, the level ofIL-18BP was lower in convalescent than in acute sera.Conclusions: These data suggest that bothIL-18 andIL-18BP production was induced following dengue virus infection. Investigating the regulation of IL-18 by its natural regulator could lead to further understanding of the immune response or immunopathogenesis following dengue virus infection.

  2. Electroanalysis with carbon paste electrodes

    CERN Document Server

    Svancara, Ivan; Walcarius, Alain; Vytras, Karel

    2011-01-01

    Introduction to Electrochemistry and Electroanalysis with Carbon Paste-Based ElectrodesHistorical Survey and GlossaryField in Publication Activities and LiteratureCarbon Pastes and Carbon Paste ElectrodesCarbon Paste as the Binary MixtureClassification of Carbon Pastes and Carbon Paste ElectrodesConstruction of Carbon Paste HoldersCarbon Paste as the Electrode MaterialPhysicochemical Properties of Carbon PastesElectrochemical Characteristics of Carbon PastesTesting of Unmodified CPEsIntera

  3. Mesoporous carbon materials

    Science.gov (United States)

    Dai, Sheng; Fulvio, Pasquale Fernando; Mayes, Richard T.; Wang, Xiqing; Sun, Xiao-Guang; Guo, Bingkun

    2014-09-09

    A conductive mesoporous carbon composite comprising conductive carbon nanoparticles contained within a mesoporous carbon matrix, wherein the conductive mesoporous carbon composite possesses at least a portion of mesopores having a pore size of at least 10 nm and up to 50 nm, and wherein the mesopores are either within the mesoporous carbon matrix, or are spacings delineated by surfaces of said conductive carbon nanoparticles when said conductive carbon nanoparticles are fused with each other, or both. Methods for producing the above-described composite, devices incorporating them (e.g., lithium batteries), and methods of using them, are also described.

  4. Pyrolyzed thin film carbon

    Science.gov (United States)

    Tai, Yu-Chong (Inventor); Liger, Matthieu (Inventor); Harder, Theodore (Inventor); Konishi, Satoshi (Inventor); Miserendino, Scott (Inventor)

    2010-01-01

    A method of making carbon thin films comprises depositing a catalyst on a substrate, depositing a hydrocarbon in contact with the catalyst and pyrolyzing the hydrocarbon. A method of controlling a carbon thin film density comprises etching a cavity into a substrate, depositing a hydrocarbon into the cavity, and pyrolyzing the hydrocarbon while in the cavity to form a carbon thin film. Controlling a carbon thin film density is achieved by changing the volume of the cavity. Methods of making carbon containing patterned structures are also provided. Carbon thin films and carbon containing patterned structures can be used in NEMS, MEMS, liquid chromatography, and sensor devices.

  5. Digital Mapping of Soil Organic Carbon Contents and Stocks in Denmark

    OpenAIRE

    Kabindra Adhikari; Hartemink, Alfred E.; Budiman Minasny; Rania Bou Kheir; Mette B Greve; Greve, Mogens H.

    2014-01-01

    Estimation of carbon contents and stocks are important for carbon sequestration, greenhouse gas emissions and national carbon balance inventories. For Denmark, we modeled the vertical distribution of soil organic carbon (SOC) and bulk density, and mapped its spatial distribution at five standard soil depth intervals (0-5, 5-15, 15-30, 30-60 and 60-100 cm) using 18 environmental variables as predictors. SOC distribution was influenced by precipitation, land use, soil type, wetland, elevation, ...

  6. Carbon Footprint of Beef Cattle

    Directory of Open Access Journals (Sweden)

    Jim Dyer

    2012-12-01

    Full Text Available The carbon footprint of beef cattle is presented for Canada, The United States, The European Union, Australia and Brazil. The values ranged between 8 and 22 kg CO2e per kg of live weight (LW depending on the type of farming system, the location, the year, the type of management practices, the allocation, as well as the boundaries of the study. Substantial reductions have been observed for most of these countries in the last thirty years. For instance, in Canada the mean carbon footprint of beef cattle at the exit gate of the farm decreased from 18.2 kg CO2e per kg LW in 1981 to 9.5 kg CO2e per kg LW in 2006 mainly because of improved genetics, better diets, and more sustainable land management practices. Cattle production results in products other than meat, such as hides, offal and products for rendering plants; hence the environmental burden must be distributed between these useful products. In order to do this, the cattle carbon footprint needs to be reported in kg of CO2e per kg of product. For example, in Canada in 2006, on a mass basis, the carbon footprint of cattle by-products at the exit gate of the slaughterhouse was 12.9 kg CO2e per kg of product. Based on an economic allocation, the carbon footprints of meat (primal cuts, hide, offal and fat, bones and other products for rendering were 19.6, 12.3, 7 and 2 kg CO2e per kg of product, respectively.

  7. IAS 18 Revenue - A Closer Look

    OpenAIRE

    Muthupandian, K S

    2009-01-01

    The International Accounting Standards Committee issued the the International Accounting Standard 18, Revenue. The objective of IAS 18 The objective of IAS 18 is to prescribe the accounting treatment of revenue arising from certain types of transactions and events, namely the sale of goods, the rendering of services yielding fees and the use by others of entity assets yielding interest or rental income. The primary issue in accounting for revenue is determining when to recognise revenue. Reve...

  8. 43 CFR § 10010.18 - Content.

    Science.gov (United States)

    2015-10-01

    ... CFR 1508.9(b)). (b) In addition, an EA may be expanded to more fully describe the proposal and a... 43 Public Lands: Interior 2 2015-10-01 2015-10-01 false Content. § 10010.18 Section § 10010.18... Environmental Assessments § 10010.18 Content. (a) At a minimum, an EA will include brief discussions of the...

  9. G18.95-1.1

    International Nuclear Information System (INIS)

    New radio continuum and spectral line observations of the Galactic radio source G18.95-1.1 are reported. The distance to G18.95-1.1 is 2 kpc as derived from HI-21 cm spectral line observations. These data also indicate an interaction with the interstellar medium. The radio continuum observations classify G18.95-1.1 as a composite supernova remnant

  10. Identification of carbonate pedofeatures of different ages in modern chernozems

    Science.gov (United States)

    Kovda, I. V.; Morgun, E. G.; Lebedeva, M. P.; Oleinik, S. A.; Shishkov, V. A.

    2016-07-01

    Carbonate pedofeatures of three chernozemic soils developed from loesslike loams in the foreststeppe zone of Lipetsk oblast under fallow plot (Luvic Chernozem (Clayic, Pachic)) and under forest (Calcic Chernozem (Clayic, Pachic)) and in the steppe zone of Dnepropetrovsk oblast (Calcic Chernozem (Episiltic, Endoclayic, Pachic)) were studied in the field and laboratory with the use of a set of methods, including the radiocarbon method, mass spectrometry, and micro- and submicromorphology. The morphological diversity of carbonate pedofeatures in these soils was represented by carbonate veins, coatings, disperse carbonates (carbonate impregnations), soft masses (beloglazka), and concretions. In the forest-steppe soils, disperse carbonates and soft masses were absent. The radiocarbon age of carbonate pedofeatures in the forest-steppe soils varied within a relatively narrow range of 3-4.3 ka cal BP with a tendency for a younger age of carbonate concretions subjected to destruction (geodes). In the steppe chernozem, this range was larger, and the 14C ages of different forms of carbonate pedofeatures were different. Thus, soft masses (beloglazka) had the age of 5.5-6 ka cal BP; disperse carbonates, 17.5-18.5 ka cal BP; and hard carbonate concretions, 26-27 ka cal BP. Data on δ13C demonstrated that the isotopic composition of carbon in virtually all the "nonlabile" carbonate pedofeatures does not correspond to the isotopic composition of carbon of the modern soil organic matter. It was shown that the studied chernozemic soils are polygenetic formations containing carbonate pedofeatures of different ages: (a) recent (currently growing), (b) relict, and (c) inherited pedofeatures. The latter group represents complex pedofeatures that include ancient fragments integrated in younger pedofeatures, e.g., the Holocene soft carbonate nodules with inclusions of fragments of the ancient microcodium.

  11. Indicators of δ13C and δ18O of gas hydrate-associated sediments

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The analyses of δ13C and δ18O of gas hydrate-associated sediments from two cores on Hydrate Ridge in Cascadia convergent margin offshore Oregon, eastern North Pacific show the values of d 13C from -29.81‰ to -48.28‰ (PDB) and d 18O from 2.56‰ to 4.28‰ (PDB), which could be plotted into a group called typical carbonate minerals influenced by the methane in cold venting. Moreover, the values of d 13C and d 18O show a consistent trend in both cores from top to bottom with increasing of d 13C and decreasing of d 18O. This trend could be explained as an effect caused by the anaerobic oxidation of methane (AOM) in depth and the oxygen fraction during the formation of gas hydrate in depth together. These characteristics of d 13C and d 18O indicate that the gas hydrate-associated sediments are significantly different from the normal marine carbonates, and they are deeply influenced by the formation and evolution of gas hydrate. So, the distinct characteristics of d 13C and d 18O of gas hydrate-associated sediments could be undoubtedly believed as one of parameters to determine the presence of gas hydrates in other unknown marine sediment cores.

  12. Reef coral δ18O thermometer in Hainan island waters, south China sea

    International Nuclear Information System (INIS)

    An 18-year-long (1981-1998) study was conducted in Hainan Island waters (22 degree 22'N, 110 degree 39'E) to determine the relationship between δ18O in skeletal aragonite carbonate and sea surface temperature (SST) in porites lutea of reef-building corals. δ18O values in skeletal aragonite carbonate were measured by means of mass spectrometry. Coral samples grew at 5 m depth at Longwan Bay. Monthly measurements of the SST from 1960 to 1998 were taken at Qinglan Bay adjacent to the place of the collected samples. The thermometer shows that SST = -4.16 δ18OPDB + 4.9 (r = 0.80) and dδ18O/dT = -0.24 per mil/degree C. The δ18O thermometer is strongly influenced by the rainfall and runoff. Using the thermometer, the SST in the past hundred years with monthly resolution will be reconstructed and the climatic change in the northern area of South China Sea will be hind cast

  13. Carbon compound used in hydrogen storage; Compuesto de carbon utilizado en almacenamiento de hidrogeno

    Energy Technology Data Exchange (ETDEWEB)

    Iturbe G, J.L.; Lopez M, B.E. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2004-07-01

    In the present work it is studied the activated carbon of mineral origin for the sorption of hydrogen. The carbon decreased of particle size by means of the one alloyed mechanical. The time of mill was of 10 hours. The characterization one carries out by scanning electron microscopy and X-ray diffraction. The hydrogen sipped in the carbon material it was determined using the Thermal gravimetric method (TGA). The conditions of hydrogenation went at 10 atm of pressure and ambient temperature during 18 hours. They were also carried out absorption/desorption cycles of hydrogen in the same one system of thermal gravimetric analysis. The results showed percentages of sorption of 2% approximately in the cycles carried out in the system TGA and of 4.5% in weight of hydrogen at pressure of 10 atmospheres and ambient temperature during 18 hours. (Author)

  14. Carbon isotope fluctuations in Precambrian carbonate sequences of several localities in Brazil

    Directory of Open Access Journals (Sweden)

    SIAL ALCIDES N.

    2000-01-01

    Full Text Available Carbon isotope fluctuations in Precambrian sedimentary carbonates between 2.8 Ga and 0.60 Ga in Brazil are examined in this study. The carbonate facies of the BIF of the 2.8 Ga-old Carajás Formation, state of Pará in northern Brazil, has rather homogeneous delta13C (-5 o/ooPDB, compatible with carbonatization of a silicate protolith by a CO2-rich fluid from mantle degassing. The Paleoproterozoic Gandarela Formation, state of Minas Gerais, displays a narrow delta13C variation (-1.5 to +0.5 o/oo compatible with carbon isotope signatures of carbonates deposited around 2.4 Ga worldwide. The Fecho do Funil Formation has probably recorded the Lomagundi delta13C positive anomaly (+6.4 to +7.1 o/ooPDB. The magnesite-bearing carbonates of the Orós mobile belt, state of Ceará, exhibit carbon isotope fluctuation within the range for carbonates deposited at 1.8 Ga. The C-isotope record of the Frecheirinha Formation, northwestern state of Ceará, shows negative delta13C values in its lower portion (-2 o/oo and positive values up section (+1 to +3 o/oo, which suggests this sequence is a cap carbonate deposited after a glacial event around 0.95 Ga. The Jacoca and Acauã sedimentary carbonate Formations, state of Sergipe, NE Brazil, show carbon isotope fluctuations very similar to each other (average around -5 o/oo, compatible with a deposition around 0.76 Ga. The younger Olho D'Água carbonate Formation, however, also in the state of Sergipe, displays negative delta13C values at the lower portion of the Formation, changing dramatically up section to positive values as high as +10 o/oo, a characteristic compatible with a Sturtian cap carbonate deposited around 0.69 Ga. On the light of the C isotope data discussed in this study, it seems that delta13C fluctuations in Paleoproterozoic carbonates in Brazil are within the range found globally for metasedimentary carbonates of this age. Carbon isotope data proved to be very useful in establishing relative

  15. Trisomy 18 with unilateral atypical ectrodactyly

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, R.C. [Greenwood Genetic Center, SC (United States)

    1994-01-01

    Becerra et al. recently reported on an infant with multiple congenital anomalies who had trisomy 18. This preterm infant presented with bilateral ectrodactyly of feet, small cleft palate, esophageal atresia with associated tracheoesophageal fistula, congenital heart disease and other anomalies. The authors referenced article by Castle and Bernstein, in which they reported a male with trisomy 18 and cleft foot as well as a review of the literature which showed 2 other infants with trisomy 18 and ectrodactyly of the feet. An additional case of trisomy 18 associated with multiple congenital anomalies, including unilaterial, atypical ectrodactyly of the left foot.

  16. Noise Making Genes in the Oxygen-18 Climate Signal of Tree-Ring Cellulose

    Science.gov (United States)

    Sternberg, L.; Ellsworth, P.

    2008-12-01

    Previous studies showed that the δ18O values of the oxygen attached to the second carbon of the cellulose glucose moieties (δ18OC-2) adds biochemical noise to the 18O climate signal of cellulose. We expanded the above study to include tree ring sequences to see if this noise persists across time within an individual. The δ18OC-2 noise persists and the δ18O value of the cellulose derivative not having this "noisy" oxygen δ18OP-G is a superior predictor of plant water and relative humidity. We previously proposed that the isotopic noise may be generated by synthesis of polyols (sugar alcohols), since the isotopic noise was particularly strong in areas of plant water or temperature stress. It is well known that plants generate polyols, such as mannitol or inositol to protect membrane structure and build up osmotic pressure under stressful conditions. A survey of previously published leaf cellulose δ18O values shows that, indeed, polyol producing plants tend to have lower oxygen isotope ratios. A working hypothesis based on the reactions of the oxygen attached to the second carbon of the glucose moieties was developed and tested with genetically modified Arabidopsis thaliana var. Columbia. A A. thaliana line genetically modified by the insertion of a mannitol synthesis gene (Mannose 6-Phosphate Reductase) and another mutant line which cannot synthesize starch (lacking plastid Phosphoglucose Mutase) showed significantly lower δ18O values of stem cellulose compared to the wild type. The primary cause of this lower isotopic value of the whole cellulose molecule was lower δ18OC-2 values. These results are consistent with our working hypothesis.

  17. Stable Carbon and Oxygen Isotopes of Pedogenic Carbonates in Ustic Vertisols: Implications for Paleoenvironmental Change

    Institute of Scientific and Technical Information of China (English)

    HUANG Cheng-Min; WANG Cheng-Shan; TANG Ya

    2005-01-01

    Pedogenic carbonates, found extensively in arid and semiarid regions, are important in revealing regional climatic and environmental changes as well as the carbon cycle. In addition, stable carbon and oxygen isotopic compositions of pedogenic carbonates have been used to rebuild paleoecology (biomass and vegetation) and to estimate paleotemperature and paleoprecipitation during past geological time. By utilizing the stable carbon and oxygen isotopic compositions (δ13C and δ18O) of secondary nodules in Ustic Vertisols, this study looked into the climatic and environmental changes in the dry valleys of the Yuanmou Basin, Yunnan Province, in southwestern China. The results showed that during the early Holocene, a warm-humid or hot-humid climate existed in the Yuanmou Basin, but since then fluctuations in climate have occurred, with a dry climate prevailing. A highly significant correlation (r = 0.92, n= 9) between δ13C and δ18O values of carbonates illustrated that there had been a continual shifting between cold-humid and warm-dry climates in southwestern China including the Yuanmou Basin since the early Holocene.

  18. Adsorption of Carbon Dioxide on Activated Carbon

    Institute of Scientific and Technical Information of China (English)

    Bo Guo; Liping Chang; Kechang Xie

    2006-01-01

    The adsorption of CO2 on a raw activated carbon A and three modified activated carbon samples B, C, and D at temperatures ranging from 303 to 333 K and the thermodynamics of adsorption have been investigated using a vacuum adsorption apparatus in order to obtain more information about the effect of CO2 on removal of organic sulfur-containing compounds in industrial gases. The active ingredients impregnated in the carbon samples show significant influence on the adsorption for CO2 and its volumes adsorbed on modified carbon samples B, C, and D are all larger than that on the raw carbon sample A. On the other hand, the physical parameters such as surface area, pore volume, and micropore volume of carbon samples show no influence on the adsorbed amount of CO2. The Dubinin-Radushkevich (D-R) equation was the best model for fitting the adsorption data on carbon samples A and B, while the Freundlich equation was the best fit for the adsorption on carbon samples C and D. The isosteric heats of adsorption on carbon samples A, B, C, and D derived from the adsorption isotherms using the Clapeyron equation decreased slightly increasing surface loading. The heat of adsorption lay between 10.5 and 28.4 kJ/mol, with the carbon sample D having the highest value at all surface coverages that were studied. The observed entropy change associated with the adsorption for the carbon samples A, B, and C (above the surface coverage of 7 ml/g) was lower than the theoretical value for mobile adsorption. However, it was higher than the theoretical value for mobile adsorption but lower than the theoretical value for localized adsorption for carbon sample D.

  19. The Australian terrestrial carbon budget

    Directory of Open Access Journals (Sweden)

    V. Haverd

    2013-02-01

    Full Text Available This paper reports a study of the full carbon (C-CO2 budget of the Australian continent, focussing on 1990–2011 in the context of estimates over two centuries. The work is a contribution to the RECCAP (REgional Carbon Cycle Assessment and Processes project, as one of numerous regional studies. In constructing the budget, we estimate the following component carbon fluxes: net primary production (NPP; net ecosystem production (NEP; fire; land use change (LUC; riverine export; dust export; harvest (wood, crop and livestock and fossil fuel emissions (both territorial and non-territorial. Major biospheric fluxes were derived using BIOS2 (Haverd et al., 2012, a fine-spatial-resolution (0.05° offline modelling environment in which predictions of CABLE (Wang et al., 2011, a sophisticated land surface model with carbon cycle, are constrained by multiple observation types. The mean NEP reveals that climate variability and rising CO2 contributed 12 ± 24 (1σ error on mean and 68 ± 15 TgC yr−1, respectively. However these gains were partially offset by fire and LUC (along with other minor fluxes, which caused net losses of 26 ± 4 TgC yr−1 and 18 ± 7 TgC yr−1, respectively. The resultant net biome production (NBP is 36 ± 29 TgC yr−1, in which the largest contributions to uncertainty are NEP, fire and LUC. This NBP offset fossil fuel emissions (95 ± 6 TgC yr−1 by 38 ± 30%. The interannual variability (IAV in the Australian carbon budget exceeds Australia's total carbon emissions by fossil fuel combustion and is dominated by IAV in NEP. Territorial fossil fuel emissions are significantly smaller than the rapidly growing fossil fuel exports: in 2009–2010, Australia exported 2.5 times more carbon in fossil fuels than it emitted by burning fossil fuels.

  20. Adaptation of the Unterzaucher procedure for determination of oxygen-18 in organic substances

    Energy Technology Data Exchange (ETDEWEB)

    Santrock, J.; Hayes, J.M.

    1987-01-01

    A method for the preparation of carbon dioxide from complex organic material for oxygen isotopic analysis is described. A commercial elemental analyzer has been modified so that oxygen contained in the organic material is quantitatively converted to carbon dioxide by the Schuetze-Unterzaucher technique, chromatographically purified, and transferred to a sample container for subsequent analysis by isotope ratio mass spectrometry. The organic sample is pyrolyzed, and the products of pyrolysis are equilibrated with elemental carbon at 1060 /sup 0/C to produce CO, and the CO is oxidized to CO/sub 2/ by I/sub 2/O/sub 5/. The details of these processes are considered, and a quantitative model is developed to allow correction for contamination of the carbon dioxide oxygen pool by an oxygen blank, oxygen from previous samples (memory), an oxygen from iodine pentoxide. Procedures for determination of the parameters used in the mathematical correction and routine application of the model to isotopic analysis are outlined. At natural abundance, the standard deviation for determination of the fractional abundance of oxygen-18 in a sample of organic material is 2 x 10/sup -7/ (equivalent to 0.1%). The detection limit for /sup 18/O as a tracer in biological materials is better than 1 atom excess/10/sup 6/ atoms total O. Analyses of independently established standards show that results obtained by the mathematical correction procedure are accurate and allow determination of abundances of /sup 18/O in the sucrose standards prepared by Hardcastle and Friedman.

  1. Accelerating Mineral Carbonation Using Carbonic Anhydrase.

    Science.gov (United States)

    Power, Ian M; Harrison, Anna L; Dipple, Gregory M

    2016-03-01

    Carbonic anhydrase (CA) enzymes have gained considerable attention for their potential use in carbon dioxide (CO2) capture technologies because they are able to catalyze rapidly the interconversion of aqueous CO2 and bicarbonate. However, there are challenges for widespread implementation including the need to develop mineralization process routes for permanent carbon storage. Mineral carbonation of highly reactive feedstocks may be limited by the supply rate of CO2. This rate limitation can be directly addressed by incorporating enzyme-catalyzed CO2 hydration. This study examined the effects of bovine carbonic anhydrase (BCA) and CO2-rich gas streams on the carbonation rate of brucite [Mg(OH)2], a highly reactive mineral. Alkaline brucite slurries were amended with BCA and supplied with 10% CO2 gas while aqueous chemistry and solids were monitored throughout the experiments (hours to days). In comparison to controls, brucite carbonation using BCA was accelerated by up to 240%. Nesquehonite [MgCO3·3H2O] precipitation limited the accumulation of hydrated CO2 species, apparently preventing BCA from catalyzing the dehydration reaction. Geochemical models reproduce observed reaction progress in all experiments, revealing a linear correlation between CO2 uptake and carbonation rate. Data demonstrates that carbonation in BCA-amended reactors remained limited by CO2 supply, implying further acceleration is possible. PMID:26829491

  2. Carbon fuel cells with carbon corrosion suppression

    Science.gov (United States)

    Cooper, John F.

    2012-04-10

    An electrochemical cell apparatus that can operate as either a fuel cell or a battery includes a cathode compartment, an anode compartment operatively connected to the cathode compartment, and a carbon fuel cell section connected to the anode compartment and the cathode compartment. An effusion plate is operatively positioned adjacent the anode compartment or the cathode compartment. The effusion plate allows passage of carbon dioxide. Carbon dioxide exhaust channels are operatively positioned in the electrochemical cell to direct the carbon dioxide from the electrochemical cell.

  3. 36 CFR 292.18 - Mineral resources.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Mineral resources. 292.18... RECREATION AREAS Sawtooth National Recreation Area-Federal Lands § 292.18 Mineral resources. (a) Occupancy... exploration work which will not cause significant damage to surface resources and will not involve the...

  4. 41 CFR 50-203.18 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Evidence. 50-203.18...-Healey Public Contracts Act § 50-203.18 Evidence. (a) Witnesses appearing at the hearing need not be... shall be tendered in quadruplicate. When evidence is embraced in a document containing matter...

  5. Main: VSF1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available VSF1PVGRP18 S000249 19-August-2004 (last modified) kehi VSF-1 binding site in French...h NRE; Confers xylem-specific expression; VSF-1; vascular; grp1.8; VS-1; bZIP; Xylem; French bean (Phaseolus

  6. 49 CFR 18.32 - Equipment.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Equipment. 18.32 Section 18.32 Transportation... Equipment. (a) Title. Subject to the obligations and conditions set forth in this section, title to equipment acquired under a grant or subgrant will vest upon acquisition in the grantee or...

  7. 46 CFR 58.16-18 - Installation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Installation. 58.16-18 Section 58.16-18 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING MAIN AND AUXILIARY MACHINERY AND... ventilation consisting of a fresh air inlet pipe and an exhaust pipe both entering through the top of...

  8. 44 CFR 1.8 - Regulations review.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Regulations review. 1.8... HOMELAND SECURITY GENERAL RULEMAKING; POLICY AND PROCEDURES General § 1.8 Regulations review. (a) As part... and keep updated a plan for periodic review of existing rules at least within 10 years from date...

  9. 44 CFR 9.18 - Responsibilities.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Responsibilities. 9.18... HOMELAND SECURITY GENERAL FLOODPLAIN MANAGEMENT AND PROTECTION OF WETLANDS § 9.18 Responsibilities. (a) Regional Administrators' responsibilities. Regional Administrators shall, for all actions falling...

  10. 47 CFR 78.18 - Frequency assignments.

    Science.gov (United States)

    2010-10-01

    ... channel. Editorial Note: For Federal Register citations affecting § 78.18, see the List of CFR Sections....0625-13.0875 B16 1 13.0875-13.1125 B17 1 13.1125-13.1375 B18 1 2 13.1375-13.1625 B19 1 2...

  11. 49 CFR 18.25 - Program income.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Program income. 18.25 Section 18.25 Transportation... income. (a) General. Grantees are encouraged to earn income to defray program costs. Program income includes income from fees for services performed, from the use or rental of real or personal...

  12. 21 CFR 610.18 - Cultures.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Cultures. 610.18 Section 610.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS GENERAL... contamination and deterioration. (b) Identity and verification. Each culture shall be clearly identified as...

  13. Normal free interleukin-18 (IL-18) plasma levels in dengue virus infection and the need to measure both total IL-18 and IL-18 binding protein levels

    NARCIS (Netherlands)

    Michels, M.; Mast, Q. de; Netea, M.G.; Joosten, L.A.B.; Dinarello, C.A.; Rudiman, P.I.; Sinarta, S.; Wisaksana, R.; Alisjahbana, B.; Ven, A. van der

    2015-01-01

    Activated monocytes/macrophages and T lymphocytes that produce a cytokine storm are assumed to play a pivotal role in the pathogenesis of dengue. Interleukin-18 (IL-18) is a proinflammatory cytokine that is increased during dengue and known to induce gamma interferon (IFN-gamma), which is crucial fo

  14. 25 CFR 286.18 - Written notice.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Written notice. 286.18 Section 286.18 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ECONOMIC ENTERPRISES INDIAN BUSINESS DEVELOPMENT PROGRAM § 286... the reasons for disapproval and the right of appeal pursuant to 25 CFR 2. A copy of the letter will...

  15. 7 CFR 30.18 - Injury.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Injury. 30.18 Section 30.18 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... deformed leaves; or tobacco hurt by insects; or tobacco affected by wild-fire, black fire, rust,...

  16. Main: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE1PVGRP18 S000288 10-Feb-2000 (last modified) seki SE1 (Stem element 1) found in the bean (P.v.) grp1...ecifically; See S000289, S000101 (SE2); SE1; grp1.8; vascular; stem; shoot; bean (Phaseolus vulgaris) ATAATGGGCCACACTGTGGGGCAT ...

  17. 7 CFR 1230.18 - Porcine animal.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Porcine animal. 1230.18 Section 1230.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... animal. Porcine animal means a swine, that is raised as (a) a feeder pig, that is, a young pig sold...

  18. 49 CFR 18.34 - Copyrights.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Copyrights. 18.34 Section 18.34 Transportation... Copyrights. The Federal awarding agency reserves a royalty-free, nonexclusive, and irrevocable license to...) The copyright in any work developed under a grant, subgrant, or contract under a grant or...

  19. 40 CFR 264.18 - Location standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Location standards. 264.18 Section 264...) STANDARDS FOR OWNERS AND OPERATORS OF HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES General Facility Standards § 264.18 Location standards. (a) Seismic considerations. (1) Portions of new...

  20. 40 CFR 265.18 - Location standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Location standards. 265.18 Section 265...) INTERIM STATUS STANDARDS FOR OWNERS AND OPERATORS OF HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES General Facility Standards § 265.18 Location standards. The placement of any hazardous waste in...

  1. 44 CFR 18.105 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Definitions. 18.105 Section 18.105 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF... an individual, corporation, company, association, authority, firm, partnership, society, State,...

  2. 16 CFR 18.0 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Definitions. 18.0 Section 18.0 Commercial... Definitions. Industry products. As used in this part, the term industry products includes all types of trees... greenhouse plants solely for inside culture or use and annual vegetable plants. Industry members. Any...

  3. 18 CFR 1308.53 - Service.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Service. 1308.53... Subpoenas § 1308.53 Service. A subpoena may be served at any place, and may be served by any individual not a party who is at least 18 years of age, or as otherwise provided by law. Service may be made by...

  4. 38 CFR 18.439 - Private education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Private education. 18.439... Adult Education § 18.439 Private education. (a) A recipient that provides private elementary or secondary education may not on the basis of handicap, exclude a qualified handicapped person if the...

  5. 7 CFR 249.18 - Audits.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Audits. 249.18 Section 249.18 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SENIOR FARMERS' MARKET NUTRITION PROGRAM (SFMNP) Monitoring and Review of...

  6. 38 CFR 18.543 - Mediation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Mediation. 18.543 Section... Enforcement Procedures § 18.543 Mediation. (a) Referral of complaints for mediation. VA will refer to the Federal Mediation and Conciliation Service all complaints that: (1) Fall within the jurisdiction of...

  7. 49 CFR 18.21 - Payment.

    Science.gov (United States)

    2010-10-01

    ... CFR part 205. (c) Advances. Grantees and subgrantees shall be paid in advance, provided they maintain... reimburse the grantee for its actual cash disbursements. The working capital advance method of payment shall... 49 Transportation 1 2010-10-01 2010-10-01 false Payment. 18.21 Section 18.21 Transportation...

  8. 47 CFR 18.307 - Conduction limits.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Conduction limits. 18.307 Section 18.307 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL INDUSTRIAL, SCIENTIFIC, AND MEDICAL EQUIPMENT Technical... conducted limits shall preclude the need to show compliance with the field strength limits below 30...

  9. Trisomy 18 syndrome with cleft foot.

    OpenAIRE

    Castle, D; Bernstein, R.

    1988-01-01

    Ectrodactyly of the feet has been reported only twice in association with trisomy 18 syndrome. A severe form of this anomaly, the first with published illustrative x rays, is described in a male infant with trisomy 18 syndrome. It is suggested that this may represent an extreme expression of the foot anomalies more commonly associated with this syndrome.

  10. 21 CFR 810.18 - Public notice.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Public notice. 810.18 Section 810.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES... agency will make available to the public in the weekly FDA Enforcement Report a descriptive listing...

  11. 15 CFR 8b.18 - New construction.

    Science.gov (United States)

    2010-01-01

    ... Standards (UFAS) (Appendix A to 41 CFR subpart 101-19.6) shall be deemed to comply with the requirements of... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false New construction. 8b.18 Section 8b.18... construction. (a) Design and construction. Each facility or part of a facility constructed by, on behalf of,...

  12. Methodology for tritium recovery as a by-product in the fluorine 18 production

    International Nuclear Information System (INIS)

    In this paper previous studies for the recuperation of waste tritium proceeding from the process used to produce F-18 using natural and 95% enriched lithium carbonate in lithium-6 are presented; the nuclear reaction took place in the Triga Mark III Nuclear reactor of the Nuclear Centre of Mexico. Previous studies proved the importance of the quantity of remanent tritium in the solutions where F-18 was produced in oxygenated compounds of natural lithium. The recuperation methodology consisted in production of F-18 in the established manner, purification by chromatography in an alumina and ion exchange resins column and of waste solutions; these were put together and distilled at normal pressure until dry. The distilled products were concentrated using an electrochemical method, and a final treatment system of the sample based on one reported in the literature but adapted to concentrate smaller volumes (approximately 15 ml.). The samples coming from the enriched lithium carbonate contained 3 to 6 times more tritium than those of natural lithium carbonate. Approximately 30% of the initial considered quantity of lithium was recuperated. A modification to the proposed methodology will allow the recuperation of tritium in waste solutions of F-18 in a percentage higher than 80%. (Author)

  13. Latitudinal variation in oxygen-18 of atmospheric CO2

    Science.gov (United States)

    Francey, Roger J.; Tans, Pieter P.

    1987-06-01

    A potentially important new atmospheric tracer of large-scale behavior at the earth's surface, the oxygen isotope composition of CO2, is reported. Measurements on flask air collected from Alaska, Hawaii, Samoa, Tasmania, coastal Antarctica, and the South Pole are compared with recent measurements of delta O-18 in CO2 extracted in situ from marine air at Cape Grim, Tasmania. This comparison provides a measure of precision and demonstrates a marked improvement over previous measurements. While previous data suggested a north-south gradient, the flask data establish a strong, asymmetric meridional gradient. It is argued that this reflects the oxygen isotope ratio in ground water, via mechanisms involving gross catalyzed CO2 exchange with leaf (and possibly soil) water. Very large CO2 fluxes are involved, of the order of 200 Gt carbon/yr.

  14. 18-Substituted steroids: synthesis of 18-hydroxycortisol (11 beta,17 alpha,18,21-tetrahydroxy-4-pregnene-3,20-dione) and 18-hydroxycortisone (17 alpha,18,21-trihydroxy-4-pregnene-3,11,20-trione).

    Science.gov (United States)

    Gomez-Sanchez, C E; Kirk, D N; Farrant, R D; Milewich, L

    1985-01-01

    The isolation of 18-hydroxycortisol from the urine of patients with primary aldosteronism was recently described and no synthetic procedure was available for its preparation. The C-13 angular methyl group of prednisolone-17 alpha,21-acetonide-11 beta-nitrite was functionalized by photolysis in the presence of oxygen to give the product 18-hydroxy-prednisolone-17 alpha,21-acetonide-18-nitrate. The 18-nitrate was reduced with zinc and ammonium acetate to the corresponding 18-hydroxy compound, 18-hydroxy-prednisolone-17 alpha,21-acetonide. Homogeneous hydrogenation with Tris(triphenyl-phosphine)rhodium (I) chloride as catalyst resulted in the formation of 18-hydroxy-cortisol-17 alpha,21-acetonide. Acid hydrolysis of the latter compound gave 18-hydroxycortisol. Oxidation of 18-hydroxycortisol-17 alpha,21-acetonide with pyridinium dichromate followed by acid hydrolysis gave 18-hydroxycortisone. The 18-hydroxylated steroids exist as the 18,21-hemiacetals. Catalytic reduction with tritium gas with Tris(triphenyl-phosphine)rhodium (I) chloride of 18-hydroxyprednisolone-17 alpha,21-acetonide and acid hydrolysis gave [1,2(3)H]18-hydroxycortisol. PMID:3974224

  15. Carbon dioxide effects research and assessment program

    International Nuclear Information System (INIS)

    Information about the past and present concentrations of CO2 in the atmosphere and variations in climate can be obtained from measurements of stable isotopes in tree rings; specifically carbon-13, oxygen-18 and deuterium. The analysis of these stable isotopes in tree rings is a relatively new and rapidly developing field. This proceedings volume contains most of the papers presented at the meeting. The first paper gives an overview of the status of carbon-13 research. Papers relating to carbon-13 are in section I and grouped separately from the contributions on carbon-14. Although the meeting was primarily concerned with stable isotopes, all carbon isotopic analysis may be helpful in understanding the carbon-13 record in tree rings. The papers on hydrogen and oxygen isotope studies are in sections II and III respectively. The remaining sections contain papers that consider more than one isotope at a time, general topics related to isotopes, atmospheric changes and tree growth, and methods of isotopic analysis

  16. Oxygen isotopic constraints on the genesis of carbonates from Martian meteorite ALH84001

    Science.gov (United States)

    Leshin, Laurie A.; McKeegan, Kevin D.; Harvey, Ralph P.

    1997-03-01

    With a crystallization age of 4.5 Ga, ALH84001 is unique among the Martian meteorites. It is also the only Martian meteorite that contains an appreciable amount of carbonate, and significantly, this carbonate occurs without associated secondary hydrated minerals. Moreover, McKay et al. (1996) have suggested that ALH84001 contains evidence of past Martian life in the form of nanofossils, biogenic minerals, and polycyclic aromatic hydrocarbons. The presence of carbonate in ALH84001 is especially significant. The early Martian environment is thought to have been more hospitable to life than todays cold, dry climate. In order to better assess the true delta-O-18 values, as well as the isotopic diversity and complexity of the ALH84001 carbonates, direct measurements of the oxygen and carbon isotopic compositions of individual carbonate phases are needed. Here we report in situ analyses of delta-O-18 values in carbonates from two polished thin sections of ALH84001.

  17. CHARACTERIZATION OF THE TANK 18F SAMPLES

    Energy Technology Data Exchange (ETDEWEB)

    Oji, L.; Click, D.; Diprete, D.

    2009-12-17

    The Savannah River National Laboratory (SRNL) was asked by Liquid Waste Operations to characterize Tank 18F closure samples. Tank 18F slurry samples analyzed included the liquid and solid fractions derived from the 'as-received' slurry materials along with the floor scrape bottom Tank 18F wet solids. These samples were taken from Tank 18F in March 2009 and made available to SRNL in the same month. Because of limited amounts of solids observed in Tank 18F samples, the samples from the north quadrants of the tank were combined into one North Tank 18F Hemisphere sample and similarly the south quadrant samples were combined into one South Tank 18F Hemisphere sample. These samples were delivered to the SRNL shielded cell. The Tank 18F samples were analyzed for radiological, chemical and elemental components. Where analytical methods yielded additional contaminants other than those requested by the customer, these results were also reported. The target detection limits for isotopes analyzed were 1E-04 {micro}Ci/g for most radionuclides and customer desired detection values of 1E-05 {micro}Ci/g for I-129, Pa-231, Np-237, and Ra-226. While many of the minimum detection limits, as specified in the technical task request and task technical and quality assurance plans were met for the species characterized for Tank 18F, some were not met due to spectral interferences. In a number of cases, the relatively high levels of radioactive species of the same element or a chemically similar element precluded the ability to measure some isotopes to low levels. SRNL, in conjunction with the plant customer, reviewed all these cases and determined that the impacts were negligible.

  18. Oxygen isotope study of mid-ocean ridge hydrothermal fluids: Implication for the oxygen-18 budget of the oceans

    Science.gov (United States)

    Jean-Baptiste, P.; Charlou, J. L.; Stievenard, M.

    1997-07-01

    New data are reported for the 18O composition of hot hydrothermal fluids from various sites with different tectonic settings. The measured δ 18O, in the range 0.53-2.3‰ confirm earlier data suggesting that mid-ocean ridge hydrothermal vents are a major source of 18O to the ocean. In light of this new data, we attempt to re-evaluate the marine 18O budget from direct quantification of the main sources and sinks of oceanic oxygen-18. Within the uncertainty of the flux estimates, 18O inputs and outputs are found to balance each other, showing that oceanic 18O is presently at a steady-state. Using these present fluxes, we examine the past evolution of the 18O composition of the ocean and speculate that the initial 18O oceanic content may have evolved rapidly towards its present value. This suggests, as already pointed out in previous studies, that ocean water may have had a rather constant 18O composition over most of the Earth's history and that δ 18O measurements in ancient cherts and carbonates may primarily record the evolution of the ocean temperature.

  19. CEACAM18 as candidate for the Holstein calving QTL on BTA18

    DEFF Research Database (Denmark)

    Mao, Xiaowei; Kadri, Naveen Kumar; de Koning, DirkJan;

    A genome-wide association study of Nordic Holstein cattle SNP chip genotypes and imputed next generation sequencing (NGS) variants identified carcinoembryonic antigen-related cell adhesion molecule 18 (CEACAm 18) on BTa 18 as the gene most highly significantly associated with direct calving traits...

  20. Trading forest carbon - OSU

    Science.gov (United States)

    Issues associate with trading carbon sequestered in forests are discussed. Scientific uncertainties associated with carbon measurement are discussed with respect to proposed accounting procedures. Major issues include: (1) Establishing baselines. (2) Determining additivity from f...

  1. Soil Organic Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Soil organic carbon (SOC) is the carbon held within soil organic constituents (i.e., products produced as dead plants and animals decompose and the soil microbial...

  2. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known ... Install one and check its batteries regularly. View Information About CO Alarms Other CO Topics Safety Tips ...

  3. Biomass Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Biomass carbon includes carbon stored in above- and below-ground live plant components (such as leaf, branch, stem and root) as well as in standing and down dead...

  4. Carbon Monoxide Safety

    Science.gov (United States)

    ... with the Media Fire Protection Technology Carbon monoxide safety outreach materials Help inform residents in your community ... KB | Spanish PDF 645 KB Handout: carbon monoxide safety Download this handout and add your organization's logo ...

  5. Calcium carbonate overdose

    Science.gov (United States)

    Tums overdose; Calcium overdose ... Calcium carbonate can be dangerous in large amounts. ... Some products that contain calcium carbonate are certain: ... and mineral supplements Other products may also contain calcium ...

  6. Potassium carbonate poisoning

    Science.gov (United States)

    Potassium carbonate is a white powder used to make soap, glass, and other items. This article discusses poisoning from swallowing or breathing in potassium carbonate. This article is for information only. Do ...

  7. Carbon nanotube nanoelectrode arrays

    Science.gov (United States)

    Ren, Zhifeng; Lin, Yuehe; Yantasee, Wassana; Liu, Guodong; Lu, Fang; Tu, Yi

    2008-11-18

    The present invention relates to microelectode arrays (MEAs), and more particularly to carbon nanotube nanoelectrode arrays (CNT-NEAs) for chemical and biological sensing, and methods of use. A nanoelectrode array includes a carbon nanotube material comprising an array of substantially linear carbon nanotubes each having a proximal end and a distal end, the proximal end of the carbon nanotubes are attached to a catalyst substrate material so as to form the array with a pre-determined site density, wherein the carbon nanotubes are aligned with respect to one another within the array; an electrically insulating layer on the surface of the carbon nanotube material, whereby the distal end of the carbon nanotubes extend beyond the electrically insulating layer; a second adhesive electrically insulating layer on the surface of the electrically insulating layer, whereby the distal end of the carbon nanotubes extend beyond the second adhesive electrically insulating layer; and a metal wire attached to the catalyst substrate material.

  8. Population III Stars in I Zw 18

    CERN Document Server

    Heap, Sally; Hubeny, Ivan

    2015-01-01

    Ultraviolet and 21-cm observations suggest that the extremely low-metallicity galaxy, I Zw 18, is a stream-fed galaxy containing a "pocket" of pristine stars responsible for producing nebular He II recombination emission observed in I Zw18-NW. Far-UV spectra by Hubble/COS and the Far Ultraviolet Spectroscopic Explorer (FUSE) make this suggestion conclusive by demonstrating that the spectrum of I Zw 18-NW shows no metal lines like O VI 1032, 1038 of comparable ionization as the He II recombination emission.

  9. Metaphorical Language and Theophany in Psalm 18

    DEFF Research Database (Denmark)

    Nielsen, Kirsten

    2010-01-01

    This article focuses on metaphorical language and theophany in Ps 18 and the question of normativity. My results are the following: Point 1. Psalm 18 is placed in the mouth of King David as part of his “testament” and as such it becomes normative for speaking about Israel’s God, with regard...... not only to content but also to linguistic form. Psalm 18 contains a rich variety of imagery comprising both personal and non-personal metaphors, as well as metonymies, which together have a normative function. Point 2. The personal and non-personal metaphors are set in tension against one another, thereby...

  10. Metal filled porous carbon

    Science.gov (United States)

    Gross, Adam F.; Vajo, John J.; Cumberland, Robert W.; Liu, Ping; Salguero, Tina T.

    2011-03-22

    A porous carbon scaffold with a surface and pores, the porous carbon scaffold containing a primary metal and a secondary metal, where the primary metal is a metal that does not wet the surface of the pores of the carbon scaffold but wets the surface of the secondary metal, and the secondary metal is interspersed between the surface of the pores of the carbon scaffold and the primary metal.

  11. SOUTHWEST REGIONAL PARTNERSHIP ON CARBON SEQUESTRATION

    Energy Technology Data Exchange (ETDEWEB)

    Brian McPherson; Rick Allis; Barry Biediger; Joel Brown; Jim Cappa; George Guthrie; Richard Hughes; Eugene Kim; Robert Lee; Dennis Leppin; Charles Mankin; Orman Paananen; Rajesh Pawar; Tarla Peterson; Steve Rauzi; Jerry Stuth; Genevieve Young

    2004-11-01

    The Southwest Partnership Region includes six whole states, including Arizona, Colorado, Kansas, New Mexico, Oklahoma, and Utah, roughly one-third of Texas, and significant portions of adjacent states. The Partnership comprises a large, diverse group of expert organizations and individuals specializing in carbon sequestration science and engineering, as well as public policy and outreach. The main objective of the Southwest Partnership project is to achieve an 18% reduction in carbon intensity by 2012. The Partnership made great progress in this first year. Action plans for possible Phase II carbon sequestration pilot tests in the region are almost finished, including both technical and non-technical aspects necessary for developing and carrying out these pilot tests. All partners in the Partnership are taking an active role in evaluating and ranking optimum sites and technologies for capture and storage of CO{sub 2} in the Southwest Region. We are identifying potential gaps in all aspects of potential sequestration deployment issues.

  12. THE C2 OXIDATIVE PHOTOSYNTHETIC CARBON CYCLE.

    Science.gov (United States)

    Tolbert, N. E.

    1997-06-01

    The C2 oxidative photosynthetic carbon cycle plus the C3 reductive photosynthetic carbon cycle coexist. Both are initiated by Rubisco, use about equal amounts of energy, must regenerate RuBP, and result in exchanges of CO2 and O2 to establish rates of net photosynthesis, CO2 and O2 compensation points, and the ratio of CO2 and O2 in the atmosphere. These concepts evolved from research on O2 inhibition, glycolate metabolism, leaf peroxisomes, photorespiration, 18O2/16O2 exchange, CO2 concentrating processes, and a requirement for the oxygenase activity of Rubisco. Nearly 80 years of research on these topics are unified under the one process of photosynthetic carbon metabolism and its self-regulation. PMID:15012254

  13. Protolytic carbon film technology

    Energy Technology Data Exchange (ETDEWEB)

    Renschler, C.L.; White, C.A.

    1996-04-01

    This paper presents a technique for the deposition of polyacrylonitrile (PAN) on virtually any surface allowing carbon film formation with only the caveat that the substrate must withstand carbonization temperatures of at least 600 degrees centigrade. The influence of processing conditions upon the structure and properties of the carbonized film is discussed. Electrical conductivity, microstructure, and morphology control are also described.

  14. Carbon nanotube quantum dots

    NARCIS (Netherlands)

    Sapmaz, S.

    2006-01-01

    Low temperature electron transport measurements on individual single wall carbon nanotubes are described in this thesis. Carbon nanotubes are small hollow cylinders made entirely out of carbon atoms. At low temperatures (below ~10 K) finite length nanotubes form quantum dots. Because of its small si

  15. Carbon Goes To…

    Science.gov (United States)

    Savasci, Funda

    2014-01-01

    The purposes of this activity are to help middle school students understand the carbon cycle and realize how human activities affect the carbon cycle. This activity consists of two parts. The first part of the activity focuses on the carbon cycle, especially before the Industrial Revolution, while the second part of the activity focuses on how…

  16. Intercontinental correlation of organic carbon and carbonate stable isotope records: evidence of climate and sea-level change during the Turonian (Cretaceous)

    NARCIS (Netherlands)

    Jarvis, I.; Trabucho-Alexandre, João; Gröcke, D.R.; Uličný, D.; Laurin, J.

    2015-01-01

    Carbon (d13Corg, d13Ccarb) and oxygen (d18Ocarb) isotope records are presented for an expanded Upper Cretaceous (Turonian–Coniacian) hemipelagic succession cored in the central Bohemian Cretaceous Basin, Czech Republic. Geophysical logs, biostratigraphy and stable carbon isotope chemostratigraphy pr

  17. Carbon/Carbon Pistons for Internal Combustion Engines

    Science.gov (United States)

    Taylor, A. H.

    1986-01-01

    Carbon/carbon piston performs same function as aluminum pistons in reciprocating internal combustion engines while reducing weight and increasing mechanical and thermal efficiencies of engine. Carbon/carbon piston concept features low piston-to-cylinder wall clearance - so low piston rings and skirts unnecessary. Advantages possible by negligible coefficient of thermal expansion of carbon/carbon.

  18. 29 CFR 18.801 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... ADMINISTRATIVE LAW JUDGES Rules of Evidence Hearsay § 18.801 Definitions. (a) Statement. A statement is (1) an..., other than one made by the declarant while testifying at the hearing, offered in evidence to prove...

  19. 47 CFR 18.107 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... intended to be used by the general public in a residential environment, notwithstanding use in other areas... associated with each ISM frequency. See § 18.301. (i) Marketing. As used in this part, marketing...

  20. Hurricane Isabel Poster (September 18, 2003)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Isabel poster. Multi-spectral image from NOAA-17 shows Hurricane Isabel making landfall on the North Carolina Outer Banks on September 18, 2003. Poster...

  1. Non-disjunction of chromosome 18

    DEFF Research Database (Denmark)

    Bugge, M; Collins, A; Petersen, M B;

    1998-01-01

    A sample of 100 trisomy 18 conceptuses analysed separately and together with a published sample of 61 conceptuses confirms that an error in maternal meiosis II (MII) is the most frequent cause of non-disjunction for chromosome 18. This is unlike all other human trisomies that have been studied......, which show a higher frequency in maternal meiosis I (MI). Maternal MI trisomy 18 shows a low frequency of recombination in proximal p and medial q, but not the reduction in proximal q observed in chromosome 21 MI non-disjunction. Maternal MII non-disjunction does not fit the entanglement model...... that predicts increased recombination, especially near the centromere. Whereas recent data on MII trisomy 21 show the predicted increase in recombination proximally, maternal MII trisomy 18 has non-significantly reduced recombination. Therefore, chromosome-specific factors must complicate the simple model...

  2. Fluorine-18 chemistry in micro-reactors

    OpenAIRE

    Lu, Shuiyu; Chun, Joong-Hyun; Pike, Victor W.

    2010-01-01

    Recent applications of micro-reactor (microfluidics) technology to radiofluorination chemistry within our laboratory are presented, based on use of either a simple T-shaped glass micro-reactor or a more advanced microfluidics instrument. The topics include reaction optimization and radioligand production, in particular the study of the radiofluorination of diaryliodonium salts, [18F]fluoride ion exchange with xenon difluoride, esterification with [18F]2-fluoroethyl tosylate, and the syntheses...

  3. Echovirus 18 meningitis in southern Taiwan.

    Science.gov (United States)

    Wang, Shih-Min; Ho, Tzong-Shiann; Shen, Ching-Fen; Wang, Jen-Ren; Liu, Ching-Chuan

    2011-03-01

    Eighty cases of echovirus 18 infection among young children during an outbreak in 2006 in Taiwan were enrolled. Twenty percent of the patients had a comorbid condition. Twenty-five cases (31%) were complicated by aseptic meningitis. The most frequent diagnoses in children without meningitis were pharyngitis/tonsillitis (35%) and vesicular viral exanthem (33%). The case-fatality rate among the children with meningitis was 4%. Echovirus 18 was isolated from the cerebrospinal fluid of 68% of the children.

  4. Licensing of Centromeric Chromatin Assembly through the Mis18α-Mis18β Heterotetramer.

    Science.gov (United States)

    Nardi, Isaac K; Zasadzińska, Ewelina; Stellfox, Madison E; Knippler, Christina M; Foltz, Daniel R

    2016-03-01

    Centromeres are specialized chromatin domains specified by the centromere-specific CENP-A nucleosome. The stable inheritance of vertebrate centromeres is an epigenetic process requiring deposition of new CENP-A nucleosomes by HJURP. We show HJURP is recruited to centromeres through a direct interaction between the HJURP centromere targeting domain and the Mis18α-β C-terminal coiled-coil domains. We demonstrate Mis18α and Mis18β form a heterotetramer through their C-terminal coiled-coil domains. Mis18α-β heterotetramer formation is required for Mis18BP1 binding and centromere recognition. S. pombe contains a single Mis18 isoform that forms a homotetramer, showing tetrameric Mis18 is conserved from fission yeast to humans. HJURP binding disrupts the Mis18α-β heterotetramer and removes Mis18α from centromeres. We propose stable binding of Mis18 to centromeres in telophase licenses them for CENP-A deposition. Binding of HJURP deposits CENP-A at centromeres and facilitates the removal of Mis18, restricting CENP-A deposition to a single event per cell cycle. PMID:26942680

  5. Molecular cloning and functional analysis of duck ubiquitin-specific protease 18 (USP18) gene.

    Science.gov (United States)

    Qian, Wei; Wei, Xiaoqin; Zhou, Hongbo; Jin, Meilin

    2016-09-01

    In mammals, ubiquitin-specific protease 18 (USP18) is an interferon (IFN)-inducible gene and is a negative regulator of Toll-like receptor-mediated nuclear factor kappa B (NF-κB) activation. The role of USP18 in ducks (duUSP18) remains poorly understood. In the present study, we cloned and characterized the full-length coding sequence of duUSP18 from duck embryo fibroblasts (DEFs). In healthy ducks, duUSP18 transcripts were broadly expressed in different tissues, with higher expression levels in the spleen, lung and kidney. Quantitative real-time PCR (qRT-PCR) analysis revealed that duUSP18 could be induced by treatment with Poly(I:C) or LPS. Overexpression of duUSP18 inhibited NF-κB and IFN-β expression. Furthermore, deletion mutant analysis revealed that the duUSP18 region between aa 75 and 304 was essential for inhibiting NF-κB. In addition, overexpression of duUSP18 also suppressed the secretion of NF-κB-dependent proinflammatory cytokines. Taken together, these results suggest that duUSP18 regulates duck innate immune responses. PMID:27133094

  6. Recoil 18F-chemistry in fluoroalkanes

    International Nuclear Information System (INIS)

    This thesis describes the study of the chemical reactions of recoil 18F-atoms in gaseous fluoromethanes and fluoroethanes. A brief survey of the organic hot atom chemistry is given in Chapter I. Chapter II deals with the experimental procedures used in this investigation. The irradiation facilities, the vapour phase radio-chromatography and the identification, including the synthesis of some fluorocarbons, are described in detail. Chapter III consists of a study on the applicability of perfluoropropene, C3F6, as scavenger for thermal 18F-atoms and radicals. Chapters IV, V, VI and VII deal with 18F-recoil chemistry in gaseous fluoroethanes, using H2S as scavenger. Chapter VIII is a short discussion on the hot 18F-atom based production of 18F-labeled organic compounds via decay of the intermediate 18Ne. A target system is proposed for production of this isotope in high energy and ultra high flux particle beams, which possibly would become available in fast breeders and fusion reactors. (Auth.)

  7. Carbon and Oxygen Isotopic Composition of Surface-Sediment Carbonate in Bosten Lake (Xinjiang, China) and its Controlling Factors

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chengjun; Steffen MISCHKE; ZHENG Mianping; Alexander PROKOPENKO; GUO Fangqin; FENG Zhaodong

    2009-01-01

    Bosten Lake is a mid-latitude lake with water mainly supplied by melting ice and snow in the Tianshan Mountains. The depositional environment of the lake is spatially not uniform due to the proximity of the major inlet and the single outlet in the western part of the lake. The analytical results show that the carbon and oxygen isotopic composition of recent lake sediments is related to this specific lacustrine depositional environment and to the resulting carbonate mineralogy. In the southwestern lake region between the Kaidu River inlet and the Kongqi River outlet, carbon isotope composition (δ13C) values of the carbonate sediment (-1‰ to -2‰) have no relation to the oxygen isotope composition of the carbonate18O) values (-7‰ to -8‰), with both isotopes showing a low variability. The carbonate content is low (<20%). Carbonate minerals analyzed by X-ray diffraction are mainly composed of calcite, while aragonite was not recorded. The salinity of the lake water is low in the estuary region as a result of the Kaidu River inflow. In comparison, the carbon and oxygen isotope values are higher in the middle and eastern parts of the lake, with δ13C values between approximately +0.5‰ and +3‰, and δ18O values between -1‰ and -5‰. There is a moderate correlation between the stable oxygen and carbon isotopes, with a coefficient of correlation r of approximately 0.63. This implies that the lake water has a relatively short residence time. Carbonate minerals constitute calcite and aragonite in the middle and eastern region of the lake. Aragonite and Mg-calcite are formed at higher lake water salinity and temperatures, and larger evaporation effects. More saline lake water in the middle and eastern region of the lake and the enhanced isotopic equilibrium between water and atmospheric CO2 cause the correlating carbon and oxygen isotope values determined for aragonite and Mg-calcite. Evaporation and biological processes are the main reasons for the salinity

  8. Behaviour of Structural Carbonate Stable Carbon and Oxygen Isotope Compositions in Bioapatite During Burning of Bone

    Science.gov (United States)

    Munro, L. E.; Longstaffe, F. J.; White, C. D.

    2003-12-01

    isotopic compositions are largely preserved for both phosphate (+/-1‰ ) and carbonate (+/-2‰ ) oxygen at phosphate and carbonate oxygen in the bioapatite are systematically depleted of oxygen-18 relative to original values.

  9. Carbon-14 waste management

    International Nuclear Information System (INIS)

    Carbon-14 occurs in nature, but is also formed in nuclear reactors. Because of its long half-life and the biological significance of carbon, releases from nuclear facilities could have a significant radiological impact. Waste management strategies for carbon-14 are therefore of current concern. Carbon-14 is present in a variety of waste streams both at reactors and at reprocessing plants. A reliable picture of the production and release of carbon-14 from various reactor systems has been built up for the purposes of this study. A possible management strategy for carbon-14 might be the reduction of nitrogen impurity levels in core materials, since the activation of 14N is usually the dominant source of carbon-14. The key problem in carbon-14 management is its retention of off-gas streams, particularly in the dissolver off-gas stream at reprocessing plants. Three alternative trapping processes that convert carbon dioxide into insoluble carbonates have been suggested. The results show that none of the options considered need be rejected on the grounds of potential radiation doses to individuals. All exposures should be as low as reasonably achievable, economic and social factors being taken into account. If, on these grounds, retention and disposal of carbon-14 is found to be beneficial, then, subject to the limitations noted, appropriate retention, immobilization and disposal technologies have been identified

  10. LOCAL LASER ALLOYING OF STAINLESS STEEL 12H18N10T

    Directory of Open Access Journals (Sweden)

    Mr. Vladimir A. Kim

    2016-06-01

    Full Text Available The article presents the research of local laser alloying of stainless steel 12X18H10T. The steel resists quenching, but it is widely used in food, chemical, oil-processing and other industries. The alloying was carried out by graphite that provided carbon increase in steel and improvement of surface capacity. The article shows details of the structural transformations leading to surfaces hardening, and micro hardness spreading inside the modified layer.

  11. Fluorine 18 in tritium generator ceramic materials

    International Nuclear Information System (INIS)

    At present time, the ceramic materials generators of tritium are very interesting mainly by the necessity of to found an adequate product for its application as fusion reactor shielding. The important element that must contain the ceramic material is the lithium and especially the isotope with mass=6. The tritium in these materials is generated by neutron irradiation, however, when the ceramic material contains oxygen, then is generated too fluorine 18 by the action of energetic atoms of tritium in recoil on the 16 O, as it is showed in the next reactions: 1) 6 Li (n, α) 3 H ; 2) 16 O(3 H, n) 18 F . In the present work was studied the LiAlO2 and the Li2O. The first was prepared in the laboratory and the second was used such as it is commercially expended. In particular the interest of this work is to study the chemical behavior of fluorine-18, since if it would be mixed with tritium it could be contaminate the fusion reactor fuel. The ceramic materials were irradiated with neutrons and also the chemical form of fluorine-18 produced was studied. It was determined the amount of fluorine-18 liberated by the irradiated materials when they were submitted to extraction with helium currents and argon-hydrogen mixtures and also it was investigated the possibility about the fluorine-18 was volatilized then it was mixed so with the tritium. Finally it was founded that the liberated amount of fluorine-18 depends widely of the experimental conditions, such as the temperature and the hydrogen amount in the mixture of dragging gas. (Author)

  12. RESTORING SUSTAINABLE FORESTS ON APPALACHIAN MINED LANDS FOR WOOD PRODUCTS, RENEWABLE ENERGY, CARBON SEQUESTRATION, AND OTHER ECOSYSTEM SERVICES

    Energy Technology Data Exchange (ETDEWEB)

    J. Burger; J. Galbraith; T. Fox; G. Amacher; J. Sullivan; C. Zipper

    2003-12-18

    The overall purpose of this project is to evaluate the biological and economic feasibility of restoring high-quality forests on mined land, and to measure carbon sequestration and wood production benefits that would be achieved from forest restoration procedures. In this quarterly report, we present a preliminary comparison of the carbon sequestration benefits for two forest types used to convert abandoned grasslands for carbon sequestration. Annual mixed hardwood benefits, based on total stand carbon volume present at the end of a given year, range from a minimum of $0/ton of carbon to a maximum of $5.26/ton of carbon (low prices). White pine benefits based on carbon volume range from a minimum of $0/ton of carbon to a maximum of $18.61/ton of carbon (high prices). The higher maximum white pine carbon payment can primarily be attributed to the fact that the shorter rotation means that payments for white pine carbon are being made on far less cumulative carbon tonnage than for that of the long-rotation hardwoods. Therefore, the payment per ton of white pine carbon needs to be higher than that of the hardwoods in order to render the conversion to white pine profitable by the end of a rotation. These carbon payments may seem appealingly low to the incentive provider. However, payments (not discounted) made over a full rotation may add up to approximately $17,493/ha for white pine (30-year rotation), and $18,820/ha for mixed hardwoods (60-year rotation). The literature suggests a range of carbon sequestration costs, from $0/ton of carbon to $120/ton of carbon, although the majority of studies suggest a cost below $50/ ton of carbon, with van Kooten et al. (2000) suggesting a cutoff cost of $20/ton of carbon sequestered. Thus, the ranges of carbon payments estimated for this study fall well within the ranges of carbon sequestration costs estimated in previous studies.

  13. Elevated levels of circulating IL-18BP and perturbed regulation of IL-18 in schizophrenia

    Directory of Open Access Journals (Sweden)

    Palladino Ilaria

    2012-08-01

    Full Text Available Abstract Background The pleiotropic pro-inflammatory cytokine Interleukin (IL-18 has been proposed to play a role in schizophrenia, since elevated circulating levels of its protein and altered frequencies of genetic variants in its molecular system are reported in schizophrenic patients. Methods We analyzed 77 patients with schizophrenia diagnosis (SCZ and 77 healthy control subjects (HC for serum concentration of both IL-18 and its natural inhibitor, the IL-18 binding protein (IL-18BP. Results We confirmed that serum levels of total IL-18 are significantly increased in SCZ, as compared to HC. However, due to a highly significant increase in levels of circulating IL-18BP in SCZ, as compared to HC, the levels of free, bioactive IL-18 are not significantly different between the two groups. In addition, the relationships between the levels of IL-18 and its inhibitor, as well as between the two molecules and age appear dissimilar for SCZ and HC. In particular, the elevated levels of IL-18BP, likely a consequence of the body’s attempt to counteract the early prominent inflammation which characterizes schizophrenia, are maintained in earlier and later stages of the disease. However, the IL-18BP elevation appears ineffective to balance the IL-18 system in younger SCZ patients, while in older patients the levels of circulating bioactive IL-18 are comparable to those of HC, if not lower. Conclusions In conclusion, these findings indicate that the IL-18 system is perturbed in schizophrenia, supporting the idea that this pro-inflammatory cytokine might be part of a pathway of genetic and environmental components for vulnerability to the disease.

  14. Strong Ionization in carbon Nanowires

    CERN Document Server

    Kaymak, Vural; Shlyaptsev, Vyacheslav N; Rocca, Jorge J

    2015-01-01

    Surfaces covered with nanostructures, such as nanowire arrays, have shown to facilitate a significantly higher absorption of laser energy as compared to flat surfaces. Due to the efficient coupling of the laser energy, highly energetic electrons are produced, which in turn can emit intense ultrafast X-ray pulses. In the present work we use full three dimensional PIC simulations to analyze the behavior of arrays of carbon nanowires $400 nm$ in diameter, irradiated by a $\\lambda_0 = 400 nm$ laser pulse of $60 fs$ duration at FWHM and a vector potential of $a_0 = 18$. We analyze the ionization dynamics of the nanowires. We investigate the difference of the ionization strength and structure between linearly and circularly polarized laser beam. The nanowires are found to be fully ionized after about 30 laser cycles. Circularly polarized light reveals a slightly stronger ionization effect.

  15. The paper of the forests like retainers of carbon, an experience in the south of Mexico

    International Nuclear Information System (INIS)

    The forests play an important paper in the global cycle of the carbon. At the moment, the deforestation is responsible for approximately 1.8GtC (gigatons of carbon), 20% of the global annual emissions of carbonic gas caused by the human activity. However, it is calculated that the reforestation could retain from 50 to 150 GtC along next 50 years. Concepts related with the retention of carbon are discussed. The necessity is commented of carrying out the regulation of an international market in retention of carbon with the purpose of being able to maintain acceptable norms in the reforestation projects that are executed under this program

  16. Carbon isotopes in mollusk shell carbonates

    Science.gov (United States)

    McConnaughey, Ted A.; Gillikin, David Paul

    2008-10-01

    Mollusk shells contain many isotopic clues about calcification physiology and environmental conditions at the time of shell formation. In this review, we use both published and unpublished data to discuss carbon isotopes in both bivalve and gastropod shell carbonates. Land snails construct their shells mainly from respired CO2, and shell δ13C reflects the local mix of C3 and C4 plants consumed. Shell δ13C is typically >10‰ heavier than diet, probably because respiratory gas exchange discards CO2, and retains the isotopically heavier HCO3 -. Respired CO2 contributes less to the shells of aquatic mollusks, because CO2/O2 ratios are usually higher in water than in air, leading to more replacement of respired CO2 by environmental CO2. Fluid exchange with the environment also brings additional dissolved inorganic carbon (DIC) into the calcification site. Shell δ13C is typically a few ‰ lower than ambient DIC, and often decreases with age. Shell δ13C retains clues about processes such as ecosystem metabolism and estuarine mixing. Ca2+ ATPase-based models of calcification physiology developed for corals and algae likely apply to mollusks, too, but lower pH and carbonic anhydrase at the calcification site probably suppress kinetic isotope effects. Carbon isotopes in biogenic carbonates are clearly complex, but cautious interpretation can provide a wealth of information, especially after vital effects are better understood.

  17. Carbon and Oxygen Isotope Measurements of Ordinary Chondrite (OC) Meteorites from Antarctica Indicate Distinct Terrestrial Carbonate Species using a Stepped Acid Extraction Procedure Impacting Mars Carbonate Research

    Science.gov (United States)

    Evans, M. E.; Niles, P. B.; Locke, D.

    2015-12-01

    The purpose of this study is to characterize the stable isotope values of terrestrial, secondary carbonate minerals from five OC meteorites collected in Antarctica. These samples were selected for analysis based upon their size and collection proximity to known Martian meteorites. They were also selected based on petrologic type (3+) such that they were likely to be carbonate-free before falling to Earth. This study has two main tasks: 1) characterize the isotopic composition of terrestrial, secondary carbonate minerals formed on meteorites in Antarctica, and 2) study the mechanisms of carbonate formation in cold and arid environments with Antarctica as an analog for Mars. Two samples from each meteorite, each ~0.5g, was crushed and dissolved in pure phosphoric acid for 3 sequential reactions: a) Rx0 for 1 hour at 30°C, b) Rx1 for 18 hours at 30°C, and c) Rx2 for 3 hours at 150°C. CO2 was distilled by freezing with liquid nitrogen from each sample tube, then separated from organics and sulfides with a TRACE GC using a Restek HayeSep Q 80/100 6' 2mm stainless column, and then analyzed on a Thermo MAT 253 IRMS in Dual Inlet mode. This system was built at NASA/JSC over the past 3 years and proof tested with known carbonate standards to develop procedures, assess yield, and quantify expected uncertainties. Two distinct species of carbonates are found based on the stepped extraction technique: 1) Ca-rich carbonate released at low temperatures, and 2) Mg, or Fe-rich carbonate released at high temperatures. Preliminary results indicate that most of the carbonates present in the ordinary chondrites analyzed have δ13C=+5‰, which is consistent with formation from atmospheric CO2 δ13C=-7‰ at -20°C. The oxygen isotopic compositions of the carbonates vary between +4‰ and +34‰ with the Mg-rich and/or Fe-rich carbonates possessing the lowest δ18O values. This suggests that the carbonates formed under a wide range of temperatures. However, the carbonate oxygen

  18. Carbon dioxide sensor

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, Prabir K. (Worthington, OH); Lee, Inhee (Columbus, OH); Akbar, Sheikh A. (Hilliard, OH)

    2011-11-15

    The present invention generally relates to carbon dioxide (CO.sub.2) sensors. In one embodiment, the present invention relates to a carbon dioxide (CO.sub.2) sensor that incorporates lithium phosphate (Li.sub.3PO.sub.4) as an electrolyte and sensing electrode comprising a combination of lithium carbonate (Li.sub.2CO.sub.3) and barium carbonate (BaCO.sub.3). In another embodiment, the present invention relates to a carbon dioxide (CO.sub.2) sensor has a reduced sensitivity to humidity due to a sensing electrode with a layered structure of lithium carbonate and barium carbonate. In still another embodiment, the present invention relates to a method of producing carbon dioxide (CO.sub.2) sensors having lithium phosphate (Li.sub.3PO.sub.4) as an electrolyte and sensing electrode comprising a combination of lithium carbonate (Li.sub.2CO.sub.3) and barium carbonate (BaCO.sub.3).

  19. Estimation of soil organic carbon reservoir in China

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The paper respectively adopted physio-chemical properties of every soil stratum from 2473 soil profiles of the second national soil survey. The corresponding carbon content of soils is estimated by utilizing conversion coefficient 0.58. In the second soil survey, the total amount of soil organic carbon is about 924.18×108t and carbon density is about 10.53 kgC/m2 in China according to the area of 877.63×106 hm2 surveyed throughout the country. The spatial distribution characteristics of soil organic carbon in China is that the carbon storage increases when latitude increases in eastern China and the carbon storage decreases when longitude reduces in northern China. A transitional zone with great variation in carbon storage exists. Moreover, there is an increasing tendency of carbon density with decrease of latitude in western China. Soil circle is of great significance to global change, but with substantial difference in soil spatial distribution throughout the country. Because the structure of soil is inhomogeneous, it could bring some mistakes in estimating soil carbon reservoirs. It is necessary to farther resolve soil respiration and organic matter conversion and other questions by developing uniform and normal methods of measurement and sampling.

  20. Laser interaction with low-density carbon foam

    Indian Academy of Sciences (India)

    S Chaurasia; S Tripathi; D S Munda; G Mishra; C G Murali; N K Gupta; L J Dhareshwar; A K Rossall; G J Tallents; Rashmi Singh; D K Kohli; R K Khardekar

    2010-12-01

    Experiments were performed with a 15 J/500 ps Nd:glass laser ( = 1064 nm) focussed to an intensity > 1014 W/cm2 . X-ray emissions from carbon foam and 5 % Pt-doped carbon foam of density 150–300 mg/cc were compared with that of the solid carbon targets. The thickness of the carbon foam was 15 m on a graphite substrate. X-ray emission was measured using semiconductor X-ray diodes covered with various filters having transmissions in different X-ray spectral ranges. It covered X-ray spectrum of 0.8–8.5 keV range. The X-ray emission in the soft X-ray region was observed to increase to about 1.8 times and 2.3 times in carbon foam and Pt-doped foam, respectively with respect to solid carbon. In hard X-rays, there was no measurable difference amongst the carbon foam, Pt-doped carbon foam and solid carbon. Scanning electron microscope (SEM) analysis demonstrates that foam targets smoothens the crater formed by the laser irradiation.

  1. Synthesis and evaluation of [[sup 18]F]fluoroprogestins and [[sup 18]F]fluorometoprolol

    Energy Technology Data Exchange (ETDEWEB)

    De Groot, T.J.

    1993-05-01

    The author investigated if specific radioactively labelled compounds could be applied to gain insight into particular psychic diseases, f.e. Parkinson's disease and schizophrenia, by means of Positron Emission Tomography (PET). No appropriate compounds were found. In this thesis the syntheses of fluorine-18 labelled progestins and [beta][sub 1]-adrenergic ligands are described. Three approaches towards [[sup 18]F]fluorination are investigated. The first method concerns direct S[sub N]2-substitution, the second approach is the opening of an epoxide, and the third approach is [[sup 18]F]fluoroalkylation. The positron emitting radionuclide fluorine-18 was used because of its relatively long decay time and the possibility to produce it in high yields and with high specific activity. The target systems which were applied for the production of fluorine-18 are described in chapter two. Important chemical and physical aspects of [[sup 18]F]fluoride are reviewed in the same chapter. In chapter three the synthesis of 21-[[sup 18]F]fluorinated progestins is discussed. The synthesis of four 21-[[sup 18]F]fluoroprogesterone derivatives is described and the results of an in vivo evaluation of two of these ligands are discussed. Possible routes leading to 6[alpha]-[[sup 18]F]fluoroprogestins are presented in chapter four. The radiochemical approaches towards the synthesis of these ligands are discussed. In chapter five the proposed routes to the fluorine-18 labelled [beta][sub 1]-adrenergic ligands are described and evaluated in the synthesis of two model compounds. 1-[[sup 18]F]fluorometoprolol, the [[sup 18]F]fluorinated analogue of a potent beta-blocker, is prepared using one of the investigated methods. The biological effect of fluorine substitution of a [beta][sub 1]-adrenergic ligand is discussed on the basis of an in vitro and in vivo evaluation. 21 figs., 28 schemes, 19 tabs., 182 refs.

  2. Microwave absorption properties of helical carbon nanofibers-coated carbon fibers

    Directory of Open Access Journals (Sweden)

    Lei Liu

    2013-08-01

    Full Text Available Helical carbon nanofibers (HCNFs coated-carbon fibers (CFs were fabricated by catalytic chemical vapor deposition method. TEM and Raman spectroscopy characterizations indicate that the graphitic layers of the HCNFs changed from disorder to order after high temperature annealing. The electromagnetic parameters and microwave absorption properties were measured at 2–18 GHz. The maximum reflection loss is 32 dB at 9 GHz and the widest bandwidth under −10 dB is 9.8 GHz from 8.2 to 18 GHz for the unannealed HCNFs coated-CFs composite with 2.5 mm in thickness, suggesting that HCNFs coated-CFs should have potential applications in high performance microwave absorption materials.

  3. An automated system for oxygen-18 water recovery and fluorine-18 delivery

    Energy Technology Data Exchange (ETDEWEB)

    Schueller, Michael J. [Chemistry Department, 57 Cornell Street, Building 901, Brookhaven National Laboratory, Upton, NY 11973 (United States)]. E-mail: mschueller@bnl.gov; Ferrieri, Richard A. [Chemistry Department, 57 Cornell Street, Building 901, Brookhaven National Laboratory, Upton, NY 11973 (United States); Schlyer, David J. [Chemistry Department, 57 Cornell Street, Building 901, Brookhaven National Laboratory, Upton, NY 11973 (United States)

    2005-12-15

    BNL has recently purchased an EBCO TR-19 cyclotron for routine isotope production. A system has been built to recover oxygen-18 enriched water from the fluorine-18 target, and then transport the F-18 a distance of 50 m to a shielded dose splitter. The remotized system provides the operator with feedback on flow rates and radiation levels during processing. Recovery of the 2.6 mL of enriched water and transport of the F-18 to the radiochemistry labs takes under 10 min, with more than 80% of the activity arriving in the chemistry lab.

  4. An automated system for oxygen-18 water recovery and fluorine-18 delivery

    Science.gov (United States)

    Schueller, Michael J.; Ferrieri, Richard A.; Schlyer, David J.

    2005-12-01

    BNL has recently purchased an EBCO TR-19 cyclotron for routine isotope production. A system has been built to recover oxygen-18 enriched water from the fluorine-18 target, and then transport the F-18 a distance of 50 m to a shielded dose splitter. The remotized system provides the operator with feedback on flow rates and radiation levels during processing. Recovery of the 2.6 mL of enriched water and transport of the F-18 to the radiochemistry labs takes under 10 min, with more than 80% of the activity arriving in the chemistry lab.

  5. Separating Long-Lived Metal Ions from 18F During H2 18O Recovery

    International Nuclear Information System (INIS)

    Cyclotron targets for the production of [18F]fluoride usually use a thin metal window to contain the 18O enriched water during irradiation. This window is activated by the proton beam, and undesired radioisotopes can enter the target water. A pre-packaged strong anion exchange resin is commonly used for [18O]-water recovery. A two-column method has been developed which delivers >95% of the [18F]fluoride for radiosynthesis while rejecting >99.9% of the contaminants. (author)

  6. CHARACTERIZATION OF THE PARTIALLY PURIFIED PLANTARCIN SR18 PRODUCED BY LACTOBACILLUS PLANTARUM SR18

    Directory of Open Access Journals (Sweden)

    Wagih El-Shouny

    2013-04-01

    Full Text Available The bacteriocin bound to the cells and that secreted into the culture filtrate of Lactobacillus plantarum SR18 were precipitated by 75% ammomium sulphate, dialysed and further purified by Gel filtration on Sephadex G-100. Bacteriocins were purified from proteins bound to the cell of L. plantarum SR18 (plantarcin SR18 a and culture filtrate proteins (plantarcin SR18 b, respectively. The SDS-PAGE of partially purified Plantarcin SR18a showed a molecular weight of 3.5 KDa. While, plantarcin SR18 b had a molecular weight of 10.3 KDa. The antibacterial activity of the tested plantarcin SR18 preparations suffered no measurable loss after 45 min at 80ºC. Whereas, At 100ºC, significant decrease in the activity of bacteriocin preparations (60- 80 % took place by the end of 45 min. At pH ranged from 5-8, the activity of the plantarcin SR18 preparations suffered no measurable loss. Dissociating agents significantly affected the bacteriocin activity. Thus, tween 80 and mercaptoethanol increased the activity of bacteriocin preparations to 1.2-1.4 fold. Sodium dodecyl sulphate (SDS increased the activity of the tested bacteriocin preparations by about 20%.The lowest residual activity (60% was recorded after treatment with Triton X100 for 45 min. Protease completely inhibited the activities of all forms of plantarcin SR18 after 45 min at 37ºC.

  7. Synthesis of F-18 labeled raloxifene derivative

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K. C.; Moon, B. S.; Jun, K. S. [KIRAMS, Seoul (Korea, Republic of); Lee, J. H.; Ji, D. Y. [Inha University, Incheon (Korea, Republic of)

    2005-07-01

    Raloxifene, [6-hydroxy-2-(4-hydroxy-phenyl) benzo [b] thiophen-3-yl]-[4-(2-piperidin-1-yl-ethoxy)phenyl] methanone, a tissue-selective estrogen mixed agonist/antagonist, classified as a selective estrogen receptor modulator (SERM), is currently under clinical evaluation for the prevention and treatment of postmenopausal osteoporosis, breast cancer, uterine dysfunction, and other disorders of the female reproductive system. Based on SAR studies of substituted raloxifenes, we synthesized 3 kinds of fluoroalkylated raloxifene derivatives. These compounds show high relative binding affinities (RBA) to the estrogen receptor in vitro (RBA of estradiol = 100%). The RBA values for compounds 1, 2 and 3 are 89, 60, and 45%, respectively, which are all higher than that of raloxifene itself (34%). Among these compounds, we selected to take the best RBA value one and F-18 labeled. Using 2 kinds of labeling method ; 1) Radiolabeling using [{sup 18}F]KF was carried out in anhydrous acetonitrile for 10 min at 120 .deg. C. 2) Radiolabeling using [{sup 18}F]KF was carried out in anhydrous acetonitrile for 15 min at 120 .deg. C in ionic liquid, [bmim][OTf]. Deprotection step added 1N HCl and reacted for 3 min at 120 .deg. C. [{sup 18}F]Fluoroethyl raloxifene derivative obtained 5-23% decay corrected labeling yield by HPLC system (C18 xterra, 10 i, 34% Acetonitrile/0.1 M formate buffer, flow rate: 4 mL/1 min, collection time : 28-29 min) and total time was around 70 min. Fluoroethyl raloxifene derivative has the best RBA value among the other synthesized derivatives and chose it for radiolabeling. [{sup 18}F]Fluoroethyl raloxifene derivative prepared 5-23% decay corrected labeling yield. This preparation is on going for labeling optimizing and preparing of in vitro and in vivo test.

  8. Oxygen-18 study of high-temperature air oxidation of SO/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Holt, B.D.; Kumar, R.

    1984-01-01

    The oxygen-18 enrichment in sulfates formed at high temperatures (475-500/sup 0/C) by platinum-catalyzed air oxidation of SO/sub 2/ to SO/sub 3/ in humidified air, was found to be several parts per thousand higher than in the air oxygen, SO/sub 2/, or water vapor from which the sulfates were formed. Variation of the delta/sup 18/O in the sulfates showed little dependence on variation of the delta/sup 18/O in the water vapor. The mechanism of sulfate formation involved isotopic exchange between the air oxygen and water vapor, isotopic exchange between the water vapor and SO/sub 2/, and formation of the hydrate, H/sub 2/SO/sub 4/ x 3H/sub 2/O. When Fe/sub 2/O/sub 3/ or V/sub 2/O/sub 5/ was heated in mixtures of air, water vapor, and SO/sub 2/, some of the SO/sub 2/ was catalytically oxidized (via SO/sub 3/ formation) to sulfate of relatively high delta/sup 18/O and the remainder to chemisorbed sulfate of relatively low delta/sup 18/O. Charcoal and fly ash (containing unburned carbon and basic oxides) reacted with the SO/sub 2/ to yield chemisorbed sulfates of relatively low delta/sup 18/O. 12 references.

  9. Study on the Microwave Permittivity of Single-Walled Carbon Nanotube

    Science.gov (United States)

    Liu, Xiaolai; Zhao, Donglin

    2009-01-01

    In this article, we studied the microwave permittivity of the complex of the single-walled carbon nanotube and paraffin in 2-18GHz. In the range, the dielectric loss of single-walled carbon nanotube is higher, and the real part and the imaginary part of the dielectric constant decrease with the increase of frequency, and the dielectric constant…

  10. Diet control on carbon isotopic composition of land snail shell carbonate

    Institute of Scientific and Technical Information of China (English)

    LIU ZongXiu; GU ZhaoYan; WU NaiQin; XU Bing

    2007-01-01

    Carbon isotope compositions for both the carbonate shells and soft bodies (organic tissue) of living land snails collected mostly from the Loess Plateau, China have been measured. The result shows that δ13C values range from -13.1‰ to -4.3‰ for the aragonite shell samples and from -26.8‰ to -18.0‰ for the soft body samples. Although the shells are enriched in 13C relative to the bodies averagely by 14.2(±0.8)‰, the shell δ13Ca values are closely correlated to the body δ13Corg values, expressed as δ13Ca = 1.021 δ13Corg + 14.38 (R = 0.965; N = 31). This relationship indicates that δ13Ca is primarily a function of the isotopic composition of the snail diets since previous studies have proved that the snail body is the same as their food in carbon isotope composition. In other words, carbon isotope compo-sition of the carbonate shell can be used as a proxy to estimate the dietary 13C abundance of the land snails. The data also support that the 13C enrichment of the carbonate shells results mainly from the equilibrium fractionations between the metabolic CO2, HCO3- in the hemolymph and shell aragonite, and partially from kinetic fractionations when snail shells form during their activity.

  11. Analysis of Terrestrial Carbon Stocks in a Small Catchment of Northeastern Siberia

    Science.gov (United States)

    Heard, K.; Natali, S.; Bunn, A. G.; Loranty, M. M.; Kholodov, A. L.; Schade, J. D.; Berner, L. T.; Spektor, V.; Zimov, N.; Alexander, H. D.

    2015-12-01

    As arctic terrestrial ecosystems comprise about one-third of the global terrestrial ecosystem carbon total, understanding arctic carbon cycling and the feedback of terrestrial carbon pools to accelerated warming is an issue of global concern. For this research, we examined above- and belowground carbon stocks in a larch-dominated catchment underlain by yedoma and located within the Kolyma River watershed in northeastern Siberia. We quantified carbon stocks in vegetation, active layer, and permafrost, and we assessed the correlation between plant and active layer carbon pools and four environmental correlates — slope, solar insolation, canopy density, and leaf area index ­— at 20 sites. Carbon in the active layer was approximately four times greater than aboveground carbon pools (972 g C m-2), and belowground carbon to 1 m depth was approximately 18 times greater than aboveground carbon pools. Canopy density and slope had a robust positive association with aboveground carbon pools, and soil moisture was positively related to %C in organic, thawed mineral and permafrost soil. Thaw depth was negatively correlated with moss cover and larch biomass, highlighting the importance of vegetation and surface characteristics on permafrost carbon vulnerability. These data suggest that landscape and ecosystem characteristics affect carbon accumulation and storage, but they also play an important role in stabilizing permafrost carbon pools.

  12. Calibration of speleothem δ18O records against hydroclimate instrumental records in Central Brazil

    Science.gov (United States)

    Moquet, J. S.; Cruz, F. W.; Novello, V. F.; Stríkis, N. M.; Deininger, M.; Karmann, I.; Santos, R. Ventura; Millo, C.; Apaestegui, J.; Guyot, J.-L.; Siffedine, A.; Vuille, M.; Cheng, H.; Edwards, R. L.; Santini, W.

    2016-04-01

    δ18O in speleothems is a powerful proxy for reconstruction of precipitation patterns in tropical and sub-tropical regions. The aim of this study is to calibrate the δ18O record of speleothems against historical precipitation and river discharge data in central Brazil, a region directly influenced by the Southern Atlantic Convergence Zone (SACZ), a major feature of the South American Monsoon System (SAMS). The present work is based on a sub-annual resolution speleothem record covering the last 141 years (the period between the years 1870 and 2011) from a cave in central Brazil. The comparison of this record with instrumental hydroclimate records since 1921 allows defining a strong relationship between precipitation variability and stable oxygen isotope ratios from speleothems. The results from a monitoring program of climatic parameters and isotopic composition of rainfall and cave seepage waters performed in the same cave, show that the rain δ18O variability is dominated by the amount effect in this region, while δ18O drip water remains almost constant over the monitored period (1.5 years). The δ18O of modern calcite, on the other hand, shows clear seasonal variations, with more negative values observed during the rainy season, which implies that other factors also influence the isotopic composition of carbonate. However, the relationship between δ18O of carbonate deposits and rainwater is supported by the results from the comparison between speleothem δ18O records and historical hydroclimate records. A significant correlation between speleothem δ18O and monsoon rainfall variability is observed on sub-decadal time scales, especially for the monsoon period (DJFM and NDJFM), once the rainfall record have been smoothed with a 7-9 years running mean. This study confirms that speleothem δ18O is directly associated with monsoon rainfall variability in central Brazil. The relationship between speleothem δ18O records and hydroclimatic historical records allows

  13. Plumbing carbon nanotubes

    Science.gov (United States)

    Jin, Chuanhong; Suenaga, Kazu; Iijima, Sumio

    2008-01-01

    Since their discovery, the possibility of connecting carbon nanotubes together like water pipes has been an intriguing prospect for these hollow nanostructures. The serial joining of carbon nanotubes in a controlled manner offers a promising approach for the bottom-up engineering of nanotube structures-from simply increasing their aspect ratio to making integrated carbon nanotube devices. To date, however, there have been few reports of the joining of two different carbon nanotubes. Here we demonstrate that a Joule heating process, and associated electro-migration effects, can be used to connect two carbon nanotubes that have the same (or similar) diameters. More generally, with the assistance of a tungsten metal particle, this technique can be used to seamlessly join any two carbon nanotubes-regardless of their diameters-to form new nanotube structures.

  14. High Resolution Carbon and Oxygen Isotope Measurements of Laminations in Pedogenic Carbonate

    Science.gov (United States)

    Breecker, D.; Sharp, Z.

    2005-12-01

    Stable carbon and oxygen isotope ratios in pedogenic carbonate from buried soils provide a proxy for low-resolution Quaternary climate and environmental conditions. Samples of carbonate are taken from clast rinds, nodules or filaments in calcic soils. Most clast rinds exhibit micro-laminations that may preserve isotopic ratios of formation. The techniques typically utilized to sample pedogenic carbonate, however, are too coarse to sample individual laminations and likely result in time averages and therefore limit temporal resolution. We investigated the heterogeneity of both carbon and oxygen isotopes ratios in clast rinds at a 100 μm scale using a rapid CO2 laser extraction technique (Sharp and Cerling, 1996). A single 20 msec burst at low power releases CO2 from polished carbonate slabs and the CO2 is then analyzed using continuous flow GC-IRMS. Analyses take less than 5 minutes with a reproducibility of better than ±0.3‰ (δ13C) and ±0.4‰ (δ18O). We have made a two dimensional map of a thick carbonate rind on a limestone clast from a stage V soil to explore the potential for preservation of isotopic ratios in well developed soils and plan to analyze additional rinds from less well developed calcic horizons for comparison. The isotopic map reveals heterogeneities in δ13C of up to 4‰ at a sub-millimeter scale, possibly corresponding to 30% changes in the fraction of C4 plants. Also imaged are abrupt changes in δ13C of approximately 2‰ across sub-100 μm scale boundaries. One well-defined carbon isotope boundary is sub parallel to, but crosses, the lamination boundaries. Oxygen isotope compositions do not change systematically across the same boundary and generally appear more random. These observations are most easily explained by alteration of initial isotopic compositions. Alteration may preferentially affect oxygen isotope ratios leaving carbon isotope distributions relatively intact. It is also possible that both carbon and oxygen isotopes

  15. Nanographene reinforced carbon/carbon composites

    Science.gov (United States)

    Bansal, Dhruv

    Carbon/Carbon Composites (CCC) are made of carbon reinforcement in carbon matrix and have high thermal stability and fatigue resistance. CCC are used in nose cones, heat shields and disc brakes of aircrafts due to their exceptional mechanical properties at high temperature. The manufacturing process of CCC involves a carbonization stage in which unwanted elements, except carbon, are eliminated from the polymer precursor. Carbonization results in the formation of voids and cracks due to the thermal mismatch between the reinforcement and the matrix and expulsion of volatiles from the polymer matrix. Thermal cracks and voids decrease the density and mechanical properties of the manufactured CCC. In this work, Nanographene Platelets (NGP) were explored as nanofillers to fill the voids/cracks and reduce thermal shrinkage in CCC. They were first compared with Vapor Grown Carbon Nanofibers (VGCNF) by dispersion of different concentrations (0.5wt%, 1.5wt%, 3wt%) in resole-type phenolic resin and were characterized to explore their effect on rheology, heat of reaction and wetting behavior. The dispersions were then cured to form nanocomposites and were characterized for morphology, flexure and thermal properties. Finally, NGP were introduced into the carbon/carboncomposites in two stages, first by spraying in different concentrations (0.5wt%, 1.5wt%, 3wt%, 5wt %) during the prepreg formation and later during densification by directly mixing in the corresponding densification mix. The manufactured NGP reinforced CCC were characterized for microstructure, porosity, bulk density and mechanical properties (Flexure and ILSS) which were further cross-checked by non-destructive techniques (vibration and ultrasonic). In this study, it was further found that at low concentration (≤ 1.5 wt%) NGP were more effective in increasing the heat of reaction and in decreasing the viscosity of the phenolic resin. The decrease in viscosity led to better wetting properties of NGP / phenolic

  16. Physics of carbon nanostructures

    International Nuclear Information System (INIS)

    Carbon is a prominent element that appears in various structures with new promising technological applications. The physics of carbon nanostructures is one of the hot topics in modern condensed matter theory. I plan to present a brief introduction into the theory of variously shaped carbon nanostructures paying special attention to generic field-theory models. The preliminary plan is the following: (1) a brief historical excursus, (2) the most interesting experimental observations, (3) generic models for the description of electronic states in carbon nanoparticles (Dirac-type equations, defects, geometry, etc.), (4) open problems. (author)

  17. Carbon Monoxide Toxicity

    Science.gov (United States)

    Aniol, Michael J.

    1992-01-01

    Of all fatal poisonings in the United States, an estimated half are due to carbon monoxide. The number of non-lethal poisonings due to carbon monoxide is difficult to estimate because signs and symptoms of carbon monoxide poisoning cover a wide spectrum and mimic other disorders. Misdiagnosis is serious, as the patient often returns to the contaminated environment. Those not receiving proper treatment are at significant risk, as high as 10% to 12%, of developing late neurological sequelae. The diagnosis of carbon monoxide poisoning depends upon precise history taking, careful physical examination, and a high index of suspicion. ImagesFigure 2 PMID:21221282

  18. Nanoindentation of Carbon Nanostructures.

    Science.gov (United States)

    Kumar, Dinesh; Singh, Karamjit; Verma, Veena; Bhatti, H S

    2016-06-01

    In the present research paper carbon nanostructures viz. single walled carbon nanotubes, multi-walled carbon nanotubes, single walled carbon nanohorns and graphene nanoplatelets have been synthesized by CVD technique, hydrothermal method, DC arc discharge method in liquid nitrogen and microwave technique respectively. After synthesis 5 mm thick pallets of given nanomaterial are prepared by making a paste in isopropyl alcohol and using polyvinylidene difluoride as a binder and then these pallets were used for nanoindentation measurements. Hardness, reduced modulus, stiffness, contact height and contact area have been measured using nanoindenter. PMID:27427726

  19. Carbon dioxide released from subduction zones by fluid-mediated reactions

    Science.gov (United States)

    Ague, Jay J.; Nicolescu, Stefan

    2014-05-01

    The balance between the subduction of carbonate mineral-bearing rocks into Earth's mantle and the return of CO2 to the atmosphere by volcanic and metamorphic degassing is critical to the carbon cycle. Carbon is thought to be released from subducted rocks mostly by simple devolatilization reactions. However, these reactions will also retain large amounts of carbon within the subducting slab and have difficulty in accounting for the mass of CO2 emitted from volcanic arcs. Carbon release may therefore occur via fluid-induced dissolution of calcium carbonate. Here we use carbonate δ18O and δ13C systematics, combined with analyses of rock and fluid inclusion mineralogy and geochemistry, to investigate the alteration of the exhumed Eocene Cycladic subduction complex on the Syros and Tinos islands, Greece. We find that in marble rocks adjacent to two fluid conduits that were active during subduction, the abundance of calcium carbonate drastically decreases approaching the conduits, whereas silicate minerals increase. Up to 60-90% of the CO2 was released from the rocks--far greater than expected via simple devolatilization reactions. The δ18O of the carbonate minerals is 5-10 lighter than is typical for metamorphosed carbonate rocks, implying that isotopically light oxygen was transported by fluid infiltration from the surroundings. We suggest that fluid-mediated carbonate mineral removal, accompanied by silicate mineral precipitation, provides a mechanism for the release of enormous amounts of CO2 from subduction zones.

  20. 18 CFR 367.12 - Payroll distribution.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Payroll distribution. 367.12 Section 367.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.12 Payroll distribution. Underlying accounting data must be maintained so that...

  1. 18 CFR 225.2 - General instructions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General instructions. 225.2 Section 225.2 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... betterments thereto must be retained until the Commission has determined the actual legitimate original...

  2. 18 CFR 341.6 - Adoption rule.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Adoption rule. 341.6... SUBJECT TO SECTION 6 OF THE INTERSTATE COMMERCE ACT § 341.6 Adoption rule. (a) Change in name of carrier... such occurrence. The filing of adoption notices and adoption supplements requires no notice period....

  3. 18 CFR 367.57 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Equipment. 367.57... Property Instructions § 367.57 Equipment. (a) The cost of equipment chargeable to the service company property accounts, unless otherwise indicated in the text of an equipment account, includes the related...

  4. 38 CFR 18.445 - Housing.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Housing. 18.445 Section....445 Housing. (a) Housing provided by a recipient. A recipient that provides housing to its nonhandicapped students shall provide comparable, convenient, and accessible housing to qualified...

  5. 18 CFR 1317.405 - Housing.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Housing. 1317.405... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 1317.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except...

  6. 18 CFR 367.26 - Departmental classification.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Departmental classification. 367.26 Section 367.26 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... ACT General Instructions § 367.26 Departmental classification. Salaries and wages and all other...

  7. 40 CFR 227.18 - Factors considered.

    Science.gov (United States)

    2010-07-01

    ....18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING CRITERIA FOR... biochemical degradation during movement of the materials from a disposal site to an area of significant... organisms which may cause a public health hazard either directly or through contamination of fisheries...

  8. 18 CFR 3b.223 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Fees. 3b.223 Section 3b... INFORMATION Rules for Disclosure of Records § 3b.223 Fees. (a) Fees will be charged for the direct cost of... the records. Any person may obtain a copy of the Commission's schedule of fees by telephone, by...

  9. 18 CFR 806.35 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 806.35 Section... APPROVAL OF PROJECTS Terms and Conditions of Approval § 806.35 Fees. Project sponsors shall have an affirmative duty to pay such fees as established by the Commission....

  10. 18 CFR 401.110 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 401.110 Section... MANUAL RULES OF PRACTICE AND PROCEDURE Public Access to Records and Information § 401.110 Fees. (a) Unless waived in accordance with the provisions of § 401.111, the following fees shall be imposed...

  11. 18 CFR 1301.21 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 1301.21 Section... § 1301.21 Fees. (a) Fees to be charged, if any, to any individual for making copies of his or her record exclude the cost of any search and review of the record. The following fees are applicable: (1)...

  12. 18 CFR 701.312 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 701.312 Section... Protection of Privacy § 701.312 Fees. (a) The Council will not charge an individual for the costs of making a... disclosing the record to the individual), the Council will charge a maximum fee of $0.25 per page...

  13. 18 CFR 1317.310 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Recruitment. 1317.310... Discrimination on the Basis of Sex in Admission and Recruitment Prohibited § 1317.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 1317.300 through 1317.310 apply shall not discriminate on...

  14. 18 CFR 1317.510 - Recruitment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Recruitment. 1317.510... Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees. Where a recipient has been found to be...

  15. 18 CFR 367.81 - Maintenance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Maintenance. 367.81... Expense Instructions § 367.81 Maintenance. (a) The cost of maintenance chargeable to the various operating... maintenance work. A list of work operations applicable generally to service company property is included...

  16. 18 CFR 1304.203 - Vegetation management.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Vegetation management...-Owned Residential Access Shoreland § 1304.203 Vegetation management. No vegetation management shall be approved on TVA-owned Residential Access Shoreland until a Vegetation Management Plan meeting...

  17. 18 CFR 801.9 - Watershed management.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Watershed management... GENERAL POLICIES § 801.9 Watershed management. (a) The character, extent, and quality of water resources... management including soil and water conservation measures, land restoration and rehabilitation,...

  18. 18 CFR 1317.540 - Advertising.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Advertising. 1317.540 Section 1317.540 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY NONDISCRIMINATION ON... Advertising. A recipient shall not in any advertising related to employment indicate preference,...

  19. 18 CFR 375.103 - Official seal.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Official seal. 375.103... OF ENERGY REVISED GENERAL RULES THE COMMISSION General Provisions § 375.103 Official seal. The Commission hereby prescribes as its official seal, judicial notice of which shall be taken pursuant...

  20. 18 CFR 1300.104 - Sexual harassment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Sexual harassment. 1300... CONDUCT FOR EMPLOYEES OF TENNESSEE VALLEY AUTHORITY § 1300.104 Sexual harassment. It is TVA policy that all TVA employees are responsible for assuring that the workplace is free from sexual...

  1. 38 CFR 18.6 - Compliance information.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Compliance information... THE CIVIL RIGHTS ACT OF 1964 General § 18.6 Compliance information. (a) Cooperation and assistance... compliance reports at such times, and in such form and containing such information, as the responsible...

  2. 18th informal meeting on reactor noise

    International Nuclear Information System (INIS)

    The proceedings contain the texts of 24 papers all of which fall under the INIS Subject Scope. The main purpose of the meeting of more than 90 scientists and specialists from 18 countries was for them to get acquainted with the current state and prospective development of noise diagnostics application in nuclear reactor operation. (Z.M.)

  3. 29 CFR 18.411 - Liability insurance.

    Science.gov (United States)

    2010-07-01

    ... OF ADMINISTRATIVE LAW JUDGES Rules of Evidence Relevancy and Its Limits § 18.411 Liability insurance. Evidence that a person was or was not insured against liability is not admissible upon the issue whether... evidence of insurance against liability when offered for another purpose, such as proof of...

  4. 29 CFR 18.101 - Scope.

    Science.gov (United States)

    2010-07-01

    ... ADMINISTRATIVE LAW JUDGES Rules of Evidence § 18.101 Scope. These rules govern formal adversarial adjudications... rules as the judge, means an Administrative Law Judge, an agency head, or other officer who presides at the reception of evidence at a hearing in such an adjudication....

  5. 29 CFR 18.104 - Preliminary questions.

    Science.gov (United States)

    2010-07-01

    ... OF ADMINISTRATIVE LAW JUDGES Rules of Evidence § 18.104 Preliminary questions. (a) Questions of... existence of a privilege, or the admissibility of evidence shall be determined by the judge, subject to the... of evidence except those with respect to privileges. (b) Relevance conditioned on fact. When...

  6. Familial deletion 18p syndrome: case report

    Directory of Open Access Journals (Sweden)

    Lemyre Emmanuelle

    2006-07-01

    Full Text Available Abstract Background Deletion 18p is a frequent deletion syndrome characterized by dysmorphic features, growth deficiencies, and mental retardation with a poorer verbal performance. Until now, five families have been described with limited clinical description. We report transmission of deletion 18p from a mother to her two daughters and review the previous cases. Case presentation The proband is 12 years old and has short stature, dysmorphic features and moderate mental retardation. Her sister is 9 years old and also has short stature and similar dysmorphic features. Her cognitive performance is within the borderline to mild mental retardation range. The mother also presents short stature. Psychological evaluation showed moderate mental retardation. Chromosome analysis from the sisters and their mother revealed the same chromosomal deletion: 46, XX, del(18(p11.2. Previous familial cases were consistent regarding the transmission of mental retardation. Our family differs in this regard with variable cognitive impairment and does not display poorer verbal than non-verbal abilities. An exclusive maternal transmission is observed throughout those families. Women with del(18p are fertile and seem to have a normal miscarriage rate. Conclusion Genetic counseling for these patients should take into account a greater range of cognitive outcome than previously reported.

  7. 18 CFR 801.5 - Comprehensive plan.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Comprehensive plan. 801... POLICIES § 801.5 Comprehensive plan. (a) The Compact requires that the Commission formulate and adopt a comprehensive plan for the immediate and long-range development and use of the water resources of the basin....

  8. Digging Movie from Phoenix's Sol 18

    Science.gov (United States)

    2008-01-01

    The Surface Stereo Imager on NASA's Phoenix Mars Lander recorded the images combined into this movie of the lander's Robotic Arm enlarging and combining the two trenches informally named 'Dodo' (left) and 'Goldilocks.' The 21 images in this sequence were taken over a period of about 2 hours during Phoenix's Sol 18 (June 13, 2008), or the 18th Martian day since landing. The main purpose of the Sol 18 dig was to dig deeper for learning the depth of a hard underlying layer. A bright layer, possibly ice, was increasingly exposed as the digging progressed. Further digging and scraping in the combined Dodo-Goldilocks trench was planned for subsequent sols. The combined trench is about 20 centimeters (about 8 inches) wide. The depth at the end of the Sol 18 digging is 5 to 6 centimeters (about 2 inches). The Goldilocks trench was the source of soil samples 'Baby Bear' and 'Mama Bear,' which were collected on earlier sols and delivered to instruments on the lander deck. The Dodo trench was originally dug for practice in collecting and depositing soil samples. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  9. 18 CFR 1317.430 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Financial assistance. 1317.430 Section 1317.430 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY... parental status. (b) Financial aid established by certain legal instruments. (1) A recipient may...

  10. 18 CFR 1304.408 - Variances.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Variances. 1304.408 Section 1304.408 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY APPROVAL OF... § 1304.408 Variances. The Vice President or the designee thereof is authorized, following...

  11. 18 CFR 157.37 - Project design.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Project design. 157.37... Seasons for Alaska Natural Gas Transportation Projects § 157.37 Project design. In reviewing any... proposed project has been designed to accommodate the needs of shippers who have made conforming...

  12. 5 CFR 1315.18 - Inquiries.

    Science.gov (United States)

    2010-01-01

    ... Administrative Personnel OFFICE OF MANAGEMENT AND BUDGET OMB DIRECTIVES PROMPT PAYMENT § 1315.18 Inquiries. (a..., Financial Management Service (FMS), Cash Management Policy and Planning Division, 401 14th Street, SW... published by the Fiscal Service, Department of the Treasury, semiannually in the Federal Register on...

  13. 18 CFR 801.1 - Standard definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Standard definitions... GENERAL POLICIES § 801.1 Standard definitions. (a) Many terms that will be used in official Commission... clarity of the meaning the Commission applies to frequently used terms standard definitions will...

  14. 18 CFR 50.4 - Stakeholder participation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Stakeholder... ELECTRIC TRANSMISSION FACILITIES § 50.4 Stakeholder participation. A Project Participation Plan is required to ensure stakeholders have access to accurate and timely information on the proposed project...

  15. 18 CFR 801.11 - Public values.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Public values. 801.11... POLICIES § 801.11 Public values. (a) The basin has many points of archeological and historic interest, and... value of these areas cannot be measured simply in economic terms and will strive to preserve and...

  16. 18 CFR 270.101 - General definitions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General definitions..., DEPARTMENT OF ENERGY PROCEDURES GOVERNING DETERMINATIONS FOR TAX CREDIT PURPOSES DETERMINATION PROCEDURES General Definitions § 270.101 General definitions. (a) NGPA definitions. Terms defined in the Natural...

  17. 18 CFR 286.105 - Shortened procedure.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Shortened procedure. 286.105 Section 286.105 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... facts and applicable law that support the position or positions taken regarding the matters at...

  18. 18 CFR 807.1 - Requirement.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Requirement. 807.1... WITHDRAWAL REGISTRATION § 807.1 Requirement. In addition to any other requirements of Commission regulations, and subject to the consent of the affected member state to this requirement, any person withdrawing...

  19. 18 CFR 5.3 - Process selection.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Process selection. 5.3... the pre-filing consultation process, including the Commission staff, may communicate with each other... ENERGY REGULATIONS UNDER THE FEDERAL POWER ACT INTEGRATED LICENSE APPLICATION PROCESS § 5.3...

  20. 18 CFR 154.305 - Tax normalization.

    Science.gov (United States)

    2010-04-01

    ... of, and addition to, Rate Base. (1) The rate base of an interstate pipeline using tax normalization... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Tax normalization. 154... Changes § 154.305 Tax normalization. (a) Applicability. An interstate pipeline must compute the income...

  1. 18 CFR 367.83 - Training costs.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Training costs. 367.83... Expense Instructions § 367.83 Training costs. When it is necessary that employees be trained to specifically operate or maintain facilities that are being constructed, the related costs must be accounted...

  2. 18 CFR 401.7 - Further action.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Further action. 401.7 Section 401.7 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE Comprehensive Plan § 401.7 Further action. The Commission...

  3. 18 CFR 706.103 - Remedial action.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Remedial action. 706... RESPONSIBILITIES AND CONDUCT General Provisions § 706.103 Remedial action. (a) A violation of this part by an employee or special Government employee may be cause for remedial action. Remedial action may include,...

  4. Diversity in Action Workshop | 18 September

    CERN Multimedia

    CERN Diversity Programme

    2014-01-01

    Get an insight into diversity, develop greater sensitivity to differences, acquire new tools to recognise and overcome unconscious biases.   Thursday 18 September 2014 8.30 a.m. to 12.30 p.m.  Business Center Technoparc - Saint-Genis-Pouilly Registration mandatory through http://www.cern.ch/diversity

  5. 38 CFR 18b.52 - Testimony.

    Science.gov (United States)

    2010-07-01

    ... testimony of any witness be prepared in writing and served on all parties in advance of the hearing. Such testimony may be adopted by the witness at the hearing, and filed as part of the record thereof. Unless... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Testimony. 18b.52...

  6. 50 CFR 18.23 - Native exemptions.

    Science.gov (United States)

    2010-10-01

    ...) It is an edible portion and it is sold in an Alaskan Native village or town. (2) “Except for a... (iv) It is an edible portion and it is sold (A) in an Alaskan Native village or town or (B) to an..., tagging, and reporting. (1) In addition to definitions contained in the Act, 50 CFR 18.3, and 50 CFR...

  7. 7 CFR 29.3619 - Rule 18.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Rule 18. 29.3619 Section 29.3619 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... as “mixed” and designated by the color symbol “M” when it is not green but contains (a) over...

  8. 18 CFR 801.7 - Water quality.

    Science.gov (United States)

    2010-04-01

    ... waste utilization and treatment technology. (3) Promote and encourage State and local governments and industry to plan for regional waste water treatment and management. (4) In cooperation with appropriate... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Water quality....

  9. 18 CFR 1308.5 - Interest.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Interest. 1308.5... General Matters § 1308.5 Interest. TVA shall pay a Contractor interest on the amount found to be due on a... the date from which interest runs pursuant to paragraph (a) of this section....

  10. 18 CFR 292.306 - Interconnection costs.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Interconnection costs... § 292.306 Interconnection costs. (a) Obligation to pay. Each qualifying facility shall be obligated to pay any interconnection costs which the State regulatory authority (with respect to any...

  11. 18 CFR 701.100 - Field Directors.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Field Directors. 701... ORGANIZATION Field Organization § 701.100 Field Directors. The Council may employ as professional staff Field Directors who shall be designated as chairmen of committees or groups established by the Council to...

  12. 18 CFR 801.0 - Introduction.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Introduction. 801.0... POLICIES § 801.0 Introduction. (a) The Governors of the States of New York, Pennsylvania, and Maryland, and...) The Commission shall employ a multiobjective approach recognizing national economy,...

  13. 18 CFR 1317.525 - Fringe benefits.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fringe benefits. 1317... benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital, accident, life insurance, or retirement benefit, service, policy or plan,...

  14. 18 CFR 801.10 - Recreation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Recreation. 801.10... POLICIES § 801.10 Recreation. (a) The use of surface water resources of the basin for recreation purposes... private agencies in the planning and development of water-related recreation and fish and...

  15. 18 CFR 157.202 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... facilities. (7) Project means a unit of improvement or construction that is used and useful upon completion... appurtenant facilities, such as heaters, minor gas conditioning, treatment, odorization, and similar equipment... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Definitions....

  16. 38 CFR 18.403 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Definitions. 18.403... Definitions. As used in this part, the term: (a) The Act means the Rehabilitation Act of 1973, Pub. L. 93-112... conditions as orthopedic, visual, speech and hearing impairments, cerebral palsy, epilepsy,...

  17. 7 CFR 1434.18 - Loan repayments.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS NONRECOURSE MARKETING ASSISTANCE LOAN AND LDP REGULATIONS FOR HONEY § 1434.18 Loan repayments. (a) A honey producer may repay a nonrecourse marketing assistance loan during the loan period at a rate that is the lesser of: (1) The principal, plus interest; or...

  18. 18 CFR 1317.515 - Compensation.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Compensation. 1317.515... Compensation. A recipient shall not make or enforce any policy or practice that, on the basis of sex: (a) Makes distinctions in rates of pay or other compensation; (b) Results in the payment of wages to employees of one...

  19. Clean Cities Now, Vol. 18, No. 2

    Energy Technology Data Exchange (ETDEWEB)

    None

    2015-01-19

    This is version 18.2 of Clean Cities Now, the official biannual newsletter of the Clean Cities program. Clean Cities is an initiative designed to reduce petroleum consumption in the transportation sector by advancing the use of alternative and renewable fuels, fuel economy improvements, idle-reduction measures, and new technologies, as they emerge.

  20. 18 CFR 270.401 - Jurisdictional agency.

    Science.gov (United States)

    2010-04-01

    ... 36800, Billings, MT 59107. (13) Nebraska—Chief, Branch of Resources, Planning & Protection, Bureau of..., PO Box 36800, Billings, MT 59107. (18) Ohio—Chief, Branch of Resources, Planning & Protection, Bureau... Land Management, Division of Mineral Resources, PO Box 36800 Billings, MT 59107. (23)...

  1. 18 CFR 376.102 - Organization.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Organization. 376.102... OF ENERGY REVISED GENERAL RULES ORGANIZATION, MISSION, AND FUNCTIONS; OPERATIONS DURING EMERGENCY CONDITIONS Organization, Mission, and Functions § 376.102 Organization. The Commission is established as...

  2. Disseminated candidiasis 18 years after renal transplantation

    OpenAIRE

    Bismay, K.; Mathew, A.; R. Rajesh; Kurian, G.; Unni, V. N.; Kavita, R. D.; Sreehari, S.

    2012-01-01

    Although mucocutaneous candidiasis is a common infection in renal transplant recipients, disseminated candidiasis is rare. Candida pnemonia causing miliary mottling on X-ray chest with the central nervous system involvement is still rarer. We report an unusual case with disseminated candidiasis that presented 18 years after renal transplantation and improved on conventional antifungal therapy; the relevant literature is reviewed.

  3. 18 CFR 381.107 - Direct billing.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Direct billing. 381.107 Section 381.107 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... the fee to the applicant to less than full cost recovery due to the presence of intervenors,...

  4. 18 CFR 35.23 - General provisions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false General provisions. 35.23 Section 35.23 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... rate schedule on file that expressly provides for the recovery of all incremental or...

  5. 18 CFR 1310.1 - Purpose.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Purpose. 1310.1 Section 1310.1 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY ADMINISTRATIVE COST RECOVERY § 1310.1 Purpose. The purpose of the regulations in this part is to establish a schedule of...

  6. 18 CFR 1310.2 - Application.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Application. 1310.2 Section 1310.2 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY ADMINISTRATIVE COST RECOVERY § 1310.2 Application. (a) General. TVA will undertake the following actions only upon...

  7. 18 CFR 430.15 - Conservation requirements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Conservation requirements. 430.15 Section 430.15 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION SPECIAL REGULATIONS GROUND WATER PROTECTION AREA: PENNSYLVANIA § 430.15 Conservation requirements....

  8. 18 CFR 401.113 - Segregable materials.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Segregable materials. 401.113 Section 401.113 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION... Segregable materials. Any reasonably segregable portion of a record shall be provided to any...

  9. 18 CFR 725.5 - Council studies.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Council studies. 725.5 Section 725.5 Conservation of Power and Water Resources WATER RESOURCES COUNCIL IMPLEMENTATION OF... Council studies. All studies and appraisals performed by the Council pursuant to section 102 of Pub. L....

  10. 18 CFR 740.6 - Financial assistance.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Financial assistance. 740.6 Section 740.6 Conservation of Power and Water Resources WATER RESOURCES COUNCIL STATE WATER... assessed by the Council. In assessing need for water management, the Council shall utilize...

  11. 18 CFR 701.51 - The Council.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false The Council. 701.51 Section 701.51 Conservation of Power and Water Resources WATER RESOURCES COUNCIL COUNCIL ORGANIZATION Headquarters Organization § 701.51 The Council. Decisions of the Council are made as hereinafter described...

  12. 18 CFR 157.216 - Abandonment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Abandonment. 157.216 Section 157.216 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... firm contract; or (2) A facility that did or could now qualify for automatic authorization as...

  13. 30 CFR 18.37 - Lead entrances.

    Science.gov (United States)

    2010-07-01

    ... against loosening. (d) Compressed packing material shall be in contact with the cable jacket for a length... cable jacket and the nominal inside diameter of the packing material shall not exceed 1/32-inch, based... § 18.37 Lead entrances. (a) Insulated cable(s), which must extend through an outside wall of...

  14. 18 CFR 801.6 - Water supply.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Water supply. 801.6... POLICIES § 801.6 Water supply. (a) The Susquehanna River Basin is rich in water resources. With proper... forth in the comprehensive plan. (c) The Commission shall study the basin's water supply needs,...

  15. 18 CFR 367.20 - Depreciation accounting.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Depreciation accounting. 367.20 Section 367.20 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.20 Depreciation accounting. (a) Method. Service companies must use a method of...

  16. 18 CFR 367.5 - Accounting period.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Accounting period. 367.5 Section 367.5 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Instructions § 367.5 Accounting period. Each service company must keep its books on a monthly basis so that...

  17. 18 CFR 420.44 - Cooling water.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Cooling water. 420.44 Section 420.44 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL BASIN REGULATIONS-WATER SUPPLY CHARGES Charges; Exemptions § 420.44 Cooling water. Water...

  18. 18 CFR 4.10 - Valuation data.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Valuation data. 4.10 Section 4.10 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF... Valuation data. (a) Notification of Commission. In every case arising under section 23(a) of the...

  19. 18 CFR 401.124 - Construction.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Construction. 401.124 Section 401.124 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE General Provisions § 401.124 Construction. This part...

  20. 38 CFR 18.423 - New construction.

    Science.gov (United States)

    2010-07-01

    ... sections 3-8 of the Uniform Federal Accessibility Standards (USAF) (appendix A to 41 CFR subpart 101-19.6... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false New construction. 18.423... construction. (a) Design and construction. Each facility or part of a facility constructed by, on behalf of,...

  1. Expression of IL-18, IL-18 Binding Protein, and IL-18 Receptor by Normal and Cancerous Human Ovarian Tissues: Possible Implication of IL-18 in the Pathogenesis of Ovarian Carcinoma

    Directory of Open Access Journals (Sweden)

    Liat Medina

    2014-01-01

    Full Text Available Proinflammatory cytokine IL-18 has been shown to be elevated in the sera of ovarian carcinoma patients. The aim of the study was to examine the levels and cellular origin of IL-18, IL-18 binding protein, and IL-18 receptor in normal and cancerous ovarian tissues. Ovarian tissue samples were examined by immunohistochemical staining for IL-18, IL-18BP, and IL-18R and mRNA of these cytokines was analyzed with semiquantitative PT-PCR. IL-18 levels were significantly higher in cancerous ovarian tissues (P=0.0007, IL-18BP levels were significantly higher in normal ovarian tissues (P=0.04, and the ratio of IL-18/IL-18BP was significantly higher in cancerous ovarian tissues (P=0.036. Cancerous ovarian tissues expressed significantly higher IL-18 mRNA levels (P=0.025, while there was no difference in the expression of IL-18BP mRNA and IL-18R mRNA between cancerous and normal ovarian tissues. IL-18 and IL-18BP were expressed dominantly in the epithelial cells of both cancerous and normal ovarian tissues, while IL-18R was expressed dominantly in the epithelial cells of cancerous ovarian tissues but expressed similarly in the epithelial and stromal cells of normal cancerous tissues. This study indicates a possible role of IL-18, IL-18BP, and IL-18R in the pathogenesis of epithelial ovarian carcinoma.

  2. Determination of the oxygen-18/oxygen-16 isotope ratios of sugar, citric acid and water from single strength orange juice.

    Science.gov (United States)

    Houerou, G; Kelly, S D; Dennis, M J

    1999-01-01

    The ratio of the stable isotopes of oxygen (18O/16O) has been measured in the sugar, citric acid and water from authentic single strength orange juices, originating from a number of different countries. The sugars and citric acid were recovered from the juices and their 18O/16O ratios were determined by pyrolysis/continuous flow-isotope ratio mass spectrometry (Py/CF-IRMS). The 18O/16O ratio of the fruit juice water was determined by the carbon dioxide/water equilibration method. The delta 18O/1000 values of 45 different sugars ranged from +29.1 to +38.8/1000 and 15 citric acids ranged from +18.9 to +25.4/1000. The delta 18O/1000 value of the water present in the same samples ranged from -2.1 to +7.8/1000. A correlation was evident between the delta 18O/1000 values of the sugar, citric acid and water from the juices. This information can be used to improve the assessment of the authenticity of commercial 'freshly squeezed' orange juices. The detection of the presence of reconstituted orange juice concentrate in 'freshly squeezed' orange juices was improved by 37% using regression analysis of the combined water and sugar delta 18O/1000 ratios when compared to the use of delta 18O/1000 ratios of fruit juice water alone. PMID:10407308

  3. Holocene record of precipitation seasonality from lake calcite δ18O in the central Rocky Mountains, United States

    Science.gov (United States)

    Anderson, Lesleigh

    2011-01-01

    A context for recent hydroclimatic extremes and variability is provided by a ~10 k.y. sediment carbonate oxygen isotope (??18O) record at 5-100 yr resolution from Bison Lake, 3255 m above sea level, in northwestern Colorado (United States). Winter precipitation is the primary water source for the alpine headwater lake in the Upper Colorado River Basin and lake water ??18O measurements reflect seasonal variations in precipitation ??18O. Holocene lake water ??18O variations are inferred from endogenic sedimentary calcite ??18O based on comparisons with historic watershed discharge records and tree-ring reconstructions. Drought periods (i.e., drier winters and/or a more rain-dominated seasonal precipitation balance) generally correspond with higher calcite ??18O values, and vice-versa. Early to middle Holocene ??18O values are higher, implying a rain-dominated seasonal precipitation balance. Lower, more variable ??18O values after ca. 3500 yr ago indicate a snow-dominated but more seasonally variable precipitation balance. The middle to late Holocene ??18O record corresponds with records of El Ni??o Southern Oscillation intensification that supports a teleconnection between Rocky Mountain climate and North Pacific sea-surface temperatures at decade to century time scales. ?? 2011 Geological Society of America.

  4. Abundances in red giant stars - Carbon and oxygen isotopes in carbon-rich molecular envelopes

    Science.gov (United States)

    Wannier, P. G.; Sahai, R.

    1987-01-01

    Millimeter-wave observations have been made of isotopically substituted CO toward the envelopes of 11 carbon-rich stars. In every case, C-13O was detected and model calculations were used to estimate the C-12/C-13 abundance ratio. C-17O was detected toward three, and possibly four, envelopes, with sensitive upper limits for two others. The CO-18 variant was detected in two envelopes. New results include determinations of oxygen isotopic ratios in the two carbon-rich protoplanetary nebulae CRL 26688 and CRL 618. As with other classes of red giant stars, the carbon-rich giants seem to be significantly, though variably, enriched in O-17. These results, in combination with observations in interstellar molecular clouds, indicate that current knowledge of stellar production of the CNO nuclides is far from satisfactory.

  5. Synthesis of oxygen-18 enriched phenol and naphthol from /sup 18/O/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Walker, T.E.; Goldblatt, M.

    1984-01-01

    Phenols enriched with oxygen-18 can be synthesized using an acid exchange reaction in H/sub 2//sup 18/O at elevated temperature, however, to obtain highly enriched products very large quantities of water must be used and recycled. Grignard reagents will react readily with oxygen gas with almost no isotopic dilution to produce the /sup 18/O enriched alcohol or phenol. Aromatic Grignards do not produce as high a yield as the aliphatic Grignards, however, both provide convenient routes to labeled products. The yield of naphthol from an aryl halide can be improved by the addition of an aliphatic halide (which produces the alcohol as a by product), however, the yield of naphthol from /sup 18/O/sub 2/ gas is not improved by this approach. Either 1-bromonaphthalene or bromobenzene was converted into the Grignard reagent and reacted with oxygen-18 enriched gas at 0/sup 0/ in a sealed reaction system. The reaction was worked up in the conventional manner and the yields from /sup 18/O/sub 2/ were 34% for (/sup 18/O) phenol and 23% for 1-(/sup 18/O)naphthol. 15 references, 1 figure, 1 table.

  6. The detection of the (J,K)=(18,18) line of NH3

    CERN Document Server

    Wilson, T L; Hüttemeister, S

    2006-01-01

    The first astronomical detection of the metastable ($J,K$) = (18,18) line of NH3 is reported. With 3130 K above the ground state, this is the NH3 line with by far the highest energy detected in interstellar space. It is observed in absorption toward the galactic center star forming region Sgr B2. There is a clear detection toward Sgr B2(M) and a likely one toward SgrB2(N). An upper limit for emission is determined for Orion-KL. If we combine the (18,18) line results from Sgr B2(M) with the previously measured (12,12) absorption line, we find a rotation temperature of >1300 K for the absorbing cloud. This is at least a factor of two higher than previously derived values from less highly excited ammonia lines, giving a lower limit to the kinetic temperature. There is a hot low density gas component in the envelope of SgrB2. It is possible that the (18,18) line arises in this region. The radial velocity of the low density, hot envelope is the same as that of the dense hot cores, so the (18,18) line could also ar...

  7. Adipose tissue interleukin-18 mRNA and plasma interleukin-18: effect of obesity and exercise

    DEFF Research Database (Denmark)

    Leick, Lotte; Lindegaard, Birgitte; Stensvold, Dorthe;

    2007-01-01

    OBJECTIVES: Obesity and a physically inactive lifestyle are associated with increased risk of developing insulin resistance. The hypothesis that obesity is associated with increased adipose tissue (AT) interleukin (IL)-18 mRNA expression and that AT IL-18 mRNA expression is related to insulin...

  8. Midway Atoll Site P18 12/4/2002 17-18M

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Onemetersquare 1 meter x 1 meter benthic substrate at Midway Atoll, site P18 28.263 N, 177.337 W, between 17 and 18 meters along a permanent transect.

  9. Fluorine-18 radiopharmaceuticals beyond [F-18]FDG for use in oncology and neurosciences

    NARCIS (Netherlands)

    Coenen, H. H.; Elsinga, P. H.; Iwata, R.; Kilbourn, M. R.; Pillai, M. R. A.; Rajan, M. G. R.; Wagner, H. N.; Zaknun, J. J.

    2010-01-01

    Positron emission tomography (PET) is a rapidly expanding clinical modality worldwide thanks to the availability of compact medical cyclotrons and automated chemistry for the production of radiopharmaceuticals. There is an armamentarium of fluorine-18 (F-18) tracers that can be used for PET studies

  10. Evaporation induced 18O and 13C enrichment in lake systems: A global perspective on hydrologic balance effects

    Science.gov (United States)

    Horton, Travis W.; Defliese, William F.; Tripati, Aradhna K.; Oze, Christopher

    2016-01-01

    Growing pressure on sustainable water resource allocation in the context of global development and rapid environmental change demands rigorous knowledge of how regional water cycles change through time. One of the most attractive and widely utilized approaches for gaining this knowledge is the analysis of lake carbonate stable isotopic compositions. However, endogenic carbonate archives are sensitive to a variety of natural processes and conditions leaving isotopic datasets largely underdetermined. As a consequence, isotopic researchers are often required to assume values for multiple parameters, including temperature of carbonate formation or lake water δ18O, in order to interpret changes in hydrologic conditions. Here, we review and analyze a global compilation of 57 lacustrine dual carbon and oxygen stable isotope records with a topical focus on the effects of shifting hydrologic balance on endogenic carbonate isotopic compositions. Through integration of multiple large datasets we show that lake carbonate δ18O values and the lake waters from which they are derived are often shifted by >+10‰ relative to source waters discharging into the lake. The global pattern of δ18O and δ13C covariation observed in >70% of the records studied and in several evaporation experiments demonstrates that isotopic fractionations associated with lake water evaporation cause the heavy carbon and oxygen isotope enrichments observed in most lakes and lake carbonate records. Modeled endogenic calcite compositions in isotopic equilibrium with lake source waters further demonstrate that evaporation effects can be extreme even in lake records where δ18O and δ13C covariation is absent. Aridisol pedogenic carbonates show similar isotopic responses to evaporation, and the relevance of evaporative modification to paleoclimatic and paleotopographic research using endogenic carbonate proxies are discussed. Recent advances in stable isotope research techniques present unprecedented

  11. DUODENAL WEBS: AN EXPERIENCE WITH 18 PATIENTS

    Directory of Open Access Journals (Sweden)

    Yogesh Kumar Sarin

    2012-04-01

    Full Text Available Aim: To describe the management and outcome of patients with duodenal webs, managed over a period of 12 ½ years in our unit.Methods: It is a retrospective case series of 18 patients with congenital duodenal webs, managed in our unit, between 1999 and 2011. The medical record of these patients was retrieved and analyzed for demographic details, clinical presentation, associated anomalies, and outcome. Results: The median age of presentation was 8 days (range 1 day to 1.5 years. Antenatal diagnosis was made in only 2 (11.1% patients. The commonest presentation was bilious vomiting. Associated anomalies were present in 8/18 patients, common being malrotation of gut. Down’s syndrome was seen in 2 patients and congenital heart disease in 1 patient. One patient had double duodenal webs. There was a delay in presentation of more than 5 days of life in 11/18 (61% patients. Three patients who presented beyond neonatal age group had fenestrated duodenal membranes causing partial obstruction. In addition, the diagnosis was missed in patients operated for malrotation elsewhere (n=2, imperforate anus (n=2 and esophageal atresia with tracheo-esophageal fistula (n=1. A lateral duodenotomy with excision of the obstructive membrane was done in all patients. A trans-anastomotic tube (TAT for enteral feeding was used in 8 patients The mortality rate was 4/18 (22%; the main causes being sepsis, prematurity, very low birth weight and associated congenital anomalies. The mean hospital stay for the 14 survivors was 18 days. Total parental nutrition (TPN was not given to any patient.Conclusions: Congenital duodenal webs are different as the diagnosis is often missed especially in case of perforated webs. Outcome depends upon the time of presentation and associated anomalies. The use of TAT feeding for nutritional support is an easy alternative to TPN.

  12. Novel carbon nanostructures

    International Nuclear Information System (INIS)

    The discovery of carbon nanotubes in 1991 opened up a challenging new area of research, because they are expected to be ideal building blocks for nanoscale applications due to their extraordinary mechanical and electronic properties. Various production methods have been developed, however precise control of nanotube morphology (e.g. length, diameter) has yet to be realised, a fact which has delayed industrial exploitation. Thus a comprehensive understanding of nanotube growth is essential, and this thesis is concerned with this important problem, i.e. the controlled production of novel carbon nanomaterials. Chapter 1 surveys production methods for fullerenes, carbon nanotubes and other carbon-based materials, such as fibres, particles etc. The sophisticated tools required for this work, e.g. high resolution transmission electron microscopy (HRTEM), high resolution electron energy loss spectroscopy (HREELS), etc. are reviewed in Chapter 2. Chapter 3 describes a novel approach to carbon nanotubes, using laser etching techniques, which generates aligned tubes of uniform diameter and length. The mode of catalyst preparation, as well as the nature of the precursor, play crucial roles in this process. The preparation of modified carbon nanotubes by the pyrolysis of metallocene, e.g. ferrocene in conjunction with various hydrocarbons, is discussed in Chapter 4. Superconducting interference device measurements (SQUID) show that Fe-filled carbon nanotubes exhibit enhanced coercivities in the 430-1070 Oe range, i.e. greater than those reported for Ni and Co nanowires. Carbon nanotubes can be also modified by replacing atoms of the carbon network with nitrogen, boron or both. The creation of large arrays of nitrogen-doped carbon nanotubes, for example CNx nanofibres, as well as the formation of BxCyNz onions is described in Chapter 5. Electron irradiation of these onions generates pure carbon onions. Finally (Chapter 6), the catalytic behaviour of metal particles in different

  13. Investigating carbonate formation in urban soils as a method for capture and storage of atmospheric carbon.

    Science.gov (United States)

    Washbourne, C-L; Renforth, P; Manning, D A C

    2012-08-01

    This paper investigates the potential for engineered urban soils to capture and store atmospheric carbon (C). Calcium (Ca) and magnesium (Mg) bearing waste silicate minerals within the soil environment can capture and store atmospheric C through the process of weathering and secondary carbonate mineral precipitation. Anthropogenic soils, known to contain substantial quantities of Ca and Mg-rich minerals derived from demolition activity (particularly cement and concrete), were systematically sampled at the surface across a 10 ha brownfield site, Science Central, located in the urban centre of Newcastle upon Tyne, U.K. Subsequent analysis yielded average carbonate contents of 21.8±4.7% wt CaCO(3). Isotopic analysis demonstrated δ(18)O values between -9.4‰ and -13.3‰ and δ(13)C values between -7.4‰ and -13.6‰ (relative to Pee Dee Belemnite), suggesting that up to 39.4±8.8% of the carbonate C has been captured from the atmosphere through hydroxylation of dissolved CO(2) in high pH solutions. The remaining carbonate C is derived from lithogenic sources. 37.4 kg of atmospheric CO(2) has already been captured and stored as carbonate per Mg of soil across the site, representing a carbon dioxide (CO(2)) removal rate of 12.5 kg CO(2) Mg(-1) yr(-1). There is the potential for capture and storage of a further 27.3 kg CO(2) Mg(-1) in residual reactive materials, which may be exploited through increased residence time (additional in situ weathering). Overall, the Science Central site has the potential to capture and store a total of 64,800 Mg CO(2) as carbonate minerals. This study illustrates the potential for managing urban soils as tools of C capture and storage, an important ecosystem service, and demonstrates the importance of studying C storage in engineering urban anthropogenic soils. PMID:22683756

  14. A modified procedure for measuring oxygen-18 content of nitrate

    Science.gov (United States)

    Ahmed, M. A.; Aly, A. I. M.; Abdel Monem, N.; Hanafy, M.; Gomaa, H. E.

    2012-11-01

    SummaryMass spectrometric analysis of O-isotopic composition of nitrate has many potential applications in studies of environmental processes. Through this work, rapid, reliable, precise, broadly applicable, catalyst-free, low-priced and less labor intensive procedure for measuring δ18O of nitrate using Isotope Ratio Mass Spectrometer has been developed and implemented. The conditions necessary to effect complete nitrate recovery and complete removal of other oxygen containing anions and dissolved organic carbon (DOC) without scarifying the isotopic signature of nitrate were investigated. The developed procedure consists of two main parts: (1) wet chemistry train for extraction and purification of nitrate from the liquid matrix; (2) off-line pyrolysis of extracted nitrate salt with activated graphite at 550 °C for 30 min. The conditions necessary to effect complete nitrate recovery and complete removal of other oxygen containing compounds were investigated. Dramatic reduction in processing times needed for analysis of δ18O of nitrate at natural abundance level was achieved. Preservation experiments revealed that chloroform (99.8%) is an effective preservative. Isotopic contents of some selected nitrate salts were measured using the modified procedure and some other well established methods at two laboratories in Egypt and Germany. Performance assessment of the whole developed analytical train was made using internationally distributed nitrate isotopes reference materials and real world sample of initial zero-nitrate content. The uncertainty budget was evaluated using the graphical nested hierarchal approach. The obtained results proved the suitability for handling samples of complicated matrices. Reduction of consumables cost by about 80% was achieved.

  15. Pulmonary NO and C18O2 uptake during pressure-induced lung expansion in rabbits.

    Science.gov (United States)

    Heller, Hartmut; Schuster, Klaus-Dieter

    2007-01-01

    In artificially ventilated animals we investigated the dependence of the pulmonary diffusing capacities of nitric oxide (NO) and doubly 18O-labeled carbon dioxide (DLNO, DLC18O2) on lung expansion with respect to ventilator-driven increases in intrapulmonary pressure. For this purpose we applied computerized single-breath experiments to 11 anesthetized paralyzed rabbits (weight 2.8-3.8 kg) at various alveolar volumes (45-72 ml) by studying the almost entire inspiratory limb of the respective pressure/volume curves (intrapulmonary pressure: 6-27 cmH2O). The animals were ventilated with room air, employing a computerized ventilatory servo-system that we designed to maintain mechanical ventilation and to execute the particular lung function tests automatically. Each single-breath maneuver was started from residual volume (13.5+/-2 ml, mean+/-SD) by inflating the rabbit lungs with 35-55 ml indicator gas mixture containing 0.05% NO in N2 or 0.9% C18O2 in N2. Alveolar partial pressures of NO and C18O2 were measured by respiratory mass spectrometry. Values of DLNO and DLC18O2 ranged between 1.55 and 2.49 ml/(mmHg min) and 11.7 and 16.6 ml/(mmHg min), respectively. Linear regression analyses yielded a significant increase in DLNO with simultaneous increase in alveolar volume (P<0.005) and intrapulmonary pressure (P<0.023) whereas DLC18O2 was not improved. Our results suggest that the ventilator-driven lung expansion impaired the C18O2 blood uptake conductance, finally compensating for the beneficial effect of the increase in alveolar volume on DLC18O2 values.

  16. Carbon and oxygen isotope study of carbonates from highly shocked clasts of the polymict breccia of the Haughton Crater (Canada)

    Science.gov (United States)

    Agrinier, P.; Martinez, I.; Javoy, M.; Schaerer, U.

    1992-01-01

    It is known that the release of volatiles on impact is an important controlling factor in cratering processes in carbonate terranes and in the mobility of chemical elements. In order to assess the nature and the role of carbon- and oxygen-bearing volatiles during impact-induced metamorphism of sedimentary rocks, the C-13/C-12 and O-18/O-16 ratios and carbonate contents were determined for 30 shocked clasts from the Haughton Crater polymict breccia as well as for some unshocked carbonates from the sedimentary cover adjacent to the crater. Shock-induced CO2 loss during decarbonation of calcite is known to be a function of peak pressure and ambient partial pressure of the volatile species. In our clast samples, shocked from 20 to 60 GPa, we expect about 20 to 100 percent CO2 loss and preferential depletion in C-13 and O-18 in the residual carbonate. Rayleigh model (progressive loss of CO2) and batch model (single-step loss of CO2) curves for this depletion are shown. The magnitudes of the C-13 and O-18 depletions increase with the increase of the CO2 loss. In addition, the isotopic depletions should be correlated with an enrichment in CaO and MgO in the residual solid.

  17. Differential binding partners of the Mis18α/β YIPPEE domains regulates the Mis18 complex recruitment to centromeres

    OpenAIRE

    Madison E. Stellfox; Isaac K. Nardi; Christina M. Knippler; Daniel R. Foltz

    2016-01-01

    The Mis18 complex specifies the site of new CENP-A nucleosome assembly by recruiting the CENP-A-specific assembly factor HJURP (Holliday junction recognition protein). The human Mis18 complex consists of Mis18α, Mis18β, and Mis18 binding protein 1 (Mis18BP1/hsKNL2). Although Mis18α and Mis18β are highly homologous proteins, we find that their conserved YIPPEE domains mediate distinct interactions that are essential to link new CENP-A deposition to existing centromeres. We find that Mis18α dir...

  18. Method for Making a Carbon-Carbon Cylinder Block

    Science.gov (United States)

    Ransone, Phillip O. (Inventor)

    1997-01-01

    A method for making a lightweight cylinder block composed of carbon-carbon is disclosed. The use of carbon-carbon over conventional materials. such as cast iron or aluminum, reduces the weight of the cylinder block and improves thermal efficiency of the internal combustion reciprocating engine. Due to the negligible coefficient of thermal expansion and unique strength at elevated temperatures of carbon-carbon, the piston-to-cylinder wall clearance can be small, especially when the carbon-carbon cylinder block is used in conjunction with a carbon-carbon piston. Use of the carbon-carbon cylinder block has the effect of reducing the weight of other reciprocating engine components allowing the piston to run at higher speeds and improving specific engine performance.

  19. Oxygen-18 and deuterium labeling studies of choline oxidation by spinach and sugar beet.

    Science.gov (United States)

    Lerma, C; Hanson, A D; Rhodes, D

    1988-11-01

    Chenopods synthesize betaine by a two-step oxidation of choline: choline --> betaine aldehyde --> betaine. The pathway is chloroplastic; the first step has been shown in isolated spinach (Spinacia oleracea L.) chloroplasts to be O(2)- and light-dependent, the role of light being to provide reducing power (P Weigel, EA Weretilnyk, AD Hanson 1988 Plant Physiol 86: 54-60). Here, we report use of in vivo(18)O- and (2)H-labeling in conjunction with fast atom bombardment mass spectrometry to test for two hypothetical choline-oxidizing reactions that would explain the observed requirements for O(2) and reductant: a desaturase or an oxygenase. Simple syntheses for (2)H(3)-choline, (2)H(3), (18)O-choline, and (2)H(3), (18)O-betaine are given. A desaturase mechanism was sought by giving choline deuterated at the 2-carbon, or choline unlabeled at this position together with (2)H(2)O and by analyzing newly synthesized betaine. About 15% of the (2)H at C-2 was lost during oxidation of choline to betaine, and about 10% of the betaine made in the presence of 50% (2)H(2)O was monodeuterated. These small effects are more consistent with chemical exchange than with a desaturase, because 10 to 15% losses of (2)H from the C-2 position also occurred if choline was converted to betaine by a purified bacterial choline oxidase. To test for an oxygenase, the incorporation of (18)O from (18)O(2) into newly synthesized betaine was compared with that from (18)O-labeled choline, in light and darkness. Incorporation of (18)O from (18)O-choline was readily detectable and varied from about 15 to 50% of the theoretical maximum value; the (18)O losses were attributable to exchange of the intermediate betaine aldehyde with water. In darkness, incorporation of (18)O from (18)O(2) approached that from (18)O-choline, but in the light was severalfold lower, presumably due to isotopic dilution by photosynthetic (16)O(2). These data indicate that the chloroplast choline-oxidizing enzyme is an oxygenase

  20. Oxygen-18 and Deuterium Labeling Studies of Choline Oxidation by Spinach and Sugar Beet 1

    Science.gov (United States)

    Lerma, Claudia; Hanson, Andrew D.; Rhodes, David

    1988-01-01

    Chenopods synthesize betaine by a two-step oxidation of choline: choline → betaine aldehyde → betaine. The pathway is chloroplastic; the first step has been shown in isolated spinach (Spinacia oleracea L.) chloroplasts to be O2- and light-dependent, the role of light being to provide reducing power (P Weigel, EA Weretilnyk, AD Hanson 1988 Plant Physiol 86: 54-60). Here, we report use of in vivo18O- and 2H-labeling in conjunction with fast atom bombardment mass spectrometry to test for two hypothetical choline-oxidizing reactions that would explain the observed requirements for O2 and reductant: a desaturase or an oxygenase. Simple syntheses for 2H3-choline, 2H3, 18O-choline, and 2H3, 18O-betaine are given. A desaturase mechanism was sought by giving choline deuterated at the 2-carbon, or choline unlabeled at this position together with 2H2O and by analyzing newly synthesized betaine. About 15% of the 2H at C-2 was lost during oxidation of choline to betaine, and about 10% of the betaine made in the presence of 50% 2H2O was monodeuterated. These small effects are more consistent with chemical exchange than with a desaturase, because 10 to 15% losses of 2H from the C-2 position also occurred if choline was converted to betaine by a purified bacterial choline oxidase. To test for an oxygenase, the incorporation of 18O from 18O2 into newly synthesized betaine was compared with that from 18O-labeled choline, in light and darkness. Incorporation of 18O from 18O-choline was readily detectable and varied from about 15 to 50% of the theoretical maximum value; the 18O losses were attributable to exchange of the intermediate betaine aldehyde with water. In darkness, incorporation of 18O from 18O2 approached that from 18O-choline, but in the light was severalfold lower, presumably due to isotopic dilution by photosynthetic 16O2. These data indicate that the chloroplast choline-oxidizing enzyme is an oxygenase. PMID:16666370

  1. Production and application of synthetic precursors labeled with carbon-11 and fluorine-18

    Energy Technology Data Exchange (ETDEWEB)

    Ferrieri, R.A.

    2001-04-02

    It is evident from this chapter that there is enormous flexibility both in the selection of the nature of the radioisotope and ways to generate it, as well as in the selection of the labeling precursor to appropriately attach that radioisotope to some larger biomolecule of interest. The arsenal of radiolabeling precursors now available to the chemist is quite extensive, and without a doubt will continue to grow as chemists develop new ones. However, the upcoming years will perhaps reflect a greater effort in refining existing methods for preparing some of those precursors that are already available to us. For example, the use of solid-phase reactions to accomplish in a single step what would normally take several using conventional solvent-based reactions has already been shown to work in many occasions. The obvious advantage here is that processes become more amenable to system automation thus affording greater reliability in day-to-day operations. There are perhaps other technologies in science that have yet to be realized by the chemist in the PET laboratory that could provide a similar or even a greater benefit. One only needs to be open to new ideas, and imaginative enough to apply them to the problems at hand.

  2. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Consumers Businesses Contact CPSC Website Design Feedback Consumers: Español Businesses: Español , 中文 , Tiếng Việt Connect with Us : Twitter YouTube ... Safely Home / Safety Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon ...

  3. Carbon black recovery

    International Nuclear Information System (INIS)

    A process and apparatus for recovering carbon black from hot smoke which comprises passing the smoke through a cyclone separation zone following cooling, then through aggregate filter beds and regeneration of filter beds with clean off-gas which is recycled to the carbon black reaction zone as quench

  4. Carbon for sensing devices

    CERN Document Server

    Tagliaferro, Alberto

    2015-01-01

    This book reveals why carbon is playing such an increasingly prominent role as a sensing material. The various steps that transform a raw material in a sensing device are thoroughly presented and critically discussed.  The authors deal with all aspects of carbon-based sensors, starting from the various hybridization and allotropes of carbon, with specific focus on micro and nanosized carbons (e.g., carbon nanotubes, graphene) and their growth processes. The discussion then moves to the role of functionalization and the different routes to achieve it. Finally, a number of sensing applications in various fields are presented, highlighting the connection with the basic properties of the various carbon allotropes.  Readers will benefit from this book’s bottom-up approach, which starts from the local bonding in carbon solids and ends with sensing applications, linking the local hybridization of carbon atoms and its modification by functionalization to specific device performance. This book is a must-have in th...

  5. Fly ash carbon passivation

    Science.gov (United States)

    La Count, Robert B; Baltrus, John P; Kern, Douglas G

    2013-05-14

    A thermal method to passivate the carbon and/or other components in fly ash significantly decreases adsorption. The passivated carbon remains in the fly ash. Heating the fly ash to about 500 and 800 degrees C. under inert gas conditions sharply decreases the amount of surfactant adsorbed by the fly ash recovered after thermal treatment despite the fact that the carbon content remains in the fly ash. Using oxygen and inert gas mixtures, the present invention shows that a thermal treatment to about 500 degrees C. also sharply decreases the surfactant adsorption of the recovered fly ash even though most of the carbon remains intact. Also, thermal treatment to about 800 degrees C. under these same oxidative conditions shows a sharp decrease in surfactant adsorption of the recovered fly ash due to the fact that the carbon has been removed. This experiment simulates the various "carbon burnout" methods and is not a claim in this method. The present invention provides a thermal method of deactivating high carbon fly ash toward adsorption of AEAs while retaining the fly ash carbon. The fly ash can be used, for example, as a partial Portland cement replacement in air-entrained concrete, in conductive and other concretes, and for other applications.

  6. Carbon Capture and Storage

    NARCIS (Netherlands)

    Benson, S.M.; Bennaceur, K.; Cook, P.; Davison, J.; Coninck, H. de; Farhat, K.; Ramirez, C.A.; Simbeck, D.; Surles, T.; Verma, P.; Wright, I.

    2012-01-01

    Emissions of carbon dioxide, the most important long-lived anthropogenic greenhouse gas, can be reduced by Carbon Capture and Storage (CCS). CCS involves the integration of four elements: CO 2 capture, compression of the CO2 from a gas to a liquid or a denser gas, transportation of pressurized CO 2

  7. COMMITTED TO CARBON REDUCTION

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Chinese efforts to lower carbon emissions through environmentally friendly means begin gaining momentum Efforts to curb carbon emissions continue to take shape as China adheres to its pledge for a brighter, greener future. More importantly, as environmental measures take hold and develop

  8. Amorphous iron (II) carbonate

    DEFF Research Database (Denmark)

    Sel, Ozlem; Radha, A.V.; Dideriksen, Knud;

    2012-01-01

    Abstract The synthesis, characterization and crystallization energetics of amorphous iron (II) carbonate (AFC) are reported. AFC may form as a precursor for siderite (FeCO3). The enthalpy of crystallization (DHcrys) of AFC is similar to that of amorphous magnesium carbonate (AMC) and more...

  9. Carbon Dioxide Fountain

    Science.gov (United States)

    Kang, Seong-Joo; Ryu, Eun-Hee

    2007-01-01

    This article presents the development of a carbon dioxide fountain. The advantages of the carbon dioxide fountain are that it is odorless and uses consumer chemicals. This experiment also is a nice visual experiment that allows students to see evidence of a gaseous reagent being consumed when a pressure sensor is available. (Contains 3 figures.)…

  10. Carbon dioxide recycling

    Science.gov (United States)

    The recycling of carbon dioxide to methanol and dimethyl ether is seen to offer a substantial route to renewable and environmentally carbon neutral fuels. One of the authors has championed the “Methanol Economy" in articles and a book. By recycling ambient CO2, the authors argue ...

  11. De-carbonizingChina

    Institute of Scientific and Technical Information of China (English)

    zhou; Xiaoyan

    2013-01-01

    Innovation in the energy sector will pave the way for the country’slow-carbon future Although its per-capita emission is roughly on par with the world’s average, China is the world’s largest carbon dioxide emitter,

  12. Trisomy 18 mosaicism in a woman with normal intelligence, pigmentary dysplasia, and an 18 trisomic daughter

    Energy Technology Data Exchange (ETDEWEB)

    Ukita, Masahiko; Hasegawa, Masaaki; Nakahori, Takashi [Kurashiki Central Hospital (Japan)

    1997-01-20

    Survival beyond the age of 10 years is rare among 18-trisomic individuals. Most of these long-term survivors, when more than one tissue is studied, are normal/trisomy mosaics. They are usually mentally severely retarded with a variety of anomalies. There is another group of mosaic individuals: 7 women and a 13-year-old girl, with a low frequency of 18-trisomic cells, normal or mildly retarded intelligence, and minor anomalies. Two of them were diagnosed after delivering malformed stillborn infants. One of them was the mother of a trisomy 18 patient who was coincidentally found to have trisomy 18 mosaicism. Pigmentary dysplasia, previously called hypomelanosis of Ito, is a disorder with linear, swirly, or patchy, hypo- or hyperpigmented areas of skin, resulting from migration and interaction of melanoblasts of different pigmentary potential. The disorder is often accompanied by mosaic chromosomal abnormalities, including mosaic trisomy 18. Here we report a 26-year-old woman with low frequency trisomy 18 mosaicism, normal intelligence, and pigmentary dysplasia, who gave birth to an 18-trisomic girl. 12 refs., 1 fig.

  13. Oxygen-18 variations in the Baltic Sea

    Energy Technology Data Exchange (ETDEWEB)

    Punning, J.-M.; Vaikmaee, R.; Maeekivi, S. (AN Ehstonskoj SSR, Tallin (USSR))

    1991-01-01

    Studies of the distribution of stable isotopes in the Baltic Sea have been carried out for more than 20 years. Studies performed by the authors of the present paper provided, during 1983-1989, additional experimental material which makes it possible to identify new aspects of the distribution regularities of {delta}{sup 18}O and the conditions which determine its distribution. The samples were taken in different seasons during the cruises of r/v ''Arnold Veimer'' in the Baltic Sea. Bathometers were used for sampling; hydrological parameters (salinity, temperature, density) were registered by the Neil Brown Mark (U.S.A.) probe. The isotopic composition of the samples was determined at the Institute of Geology, Estonian Academy of Sciences, using the Finnigan MAT mass-spectrometer Delta-E, with precision {+-}0.1 per mille.{delta}{sup 18} O values are presented relative to the international V-SMOW standard. (author).

  14. PET designated flouride-18 production and chemistry.

    Science.gov (United States)

    Jacobson, Orit; Chen, Xiaoyuan

    2010-01-01

    Positron emission tomography (PET) is a nuclear medicine imaging technology which allows for four-dimensional, quantitative determination of the distribution of labeled biological compounds within the human body. PET is becoming an increasingly important tool for the measurement of physiological, biochemical and pharmacological functions at the molecular level in healthy and pathological conditions. This review will focus on Flouride-18, one of the common isotopes used for PET imaging, which has a half life of 109.8 minutes. This isotope can be produced with an efficient yield in a cyclotron as a nucleophile or as an electrophile. Flouride-18 can be thereafter introduced into small molecules or biomolecules using various chemical synthetic routes, to give the desired imaging agent.

  15. Boot Loader para Microcontroladores PIC serie 18

    Directory of Open Access Journals (Sweden)

    Francisco Javier Villalobos Piña

    2006-01-01

    Full Text Available El presente trabajo expone el diseño de un boot loader, programa que permanece residente en un microcontrolador PIC18F452. Dicho programa permite grabar cualquier aplicación en el PIC sin el uso de un programador. Esta ventaja, no solo facilita el diseño de aplicaciones de control digital mediante la familia 18 de Microchip, sino que evita que el procesador se monte y desmonte continuamente, debido a lo cual, disminuyen los daños que por mal manejo pudiera sufrir el procesador. Se reporta igualmente el programa en visual Delphi, que permite leer, grabar y ejecutar los archivos hexadecimales del procesador, y probar la integridad del dispositivo

  16. Analysis of low-carbon industrial symbiosis technology for carbon mitigation in a Chinese iron/steel industrial park: A case study with carbon flow analysis

    International Nuclear Information System (INIS)

    CO2 mitigation strategies in industrial parks are a significant component of the Chinese climate change mitigation policy, and industrial symbiosis can provide specific CO2 mitigation opportunity. Technology is important to support symbiosis, but few studies in China have focused on this topic at the industrial park level. This research presented a case study in a national iron and steel industrial park in China. Focus was given onto carbon mitigation through industrial symbiosis technology using substance flow analysis (SFA). Three typical iron and steel industry technologies, including coke dry quenching (CDQ), combined cycle power plant (CCPP), and CO2 capture by slag carbonization (CCSC) were evaluated with SFA. Technology assessment was further conducted in terms of carbon mitigation potential and unit reduction cost. Compared with the Business as usual (BAU) scenario, application with CDQ, CCPP, and CCSC reduced the net carbon emissions by 56.18, 134.43, and 222.89 kg CO2 per ton crude steel inside the industrial parks, respectively, including both direct and indirect emissions. Economic assessment revealed that the unit costs for the three technologies were also high, thereby necessitating national financial support. Finally, relevant policy suggestions and future concerns were proposed and discussed. - Highlights: • A typical carbon mitigation case study on China iron/steel industrial park. • Using carbon SFA to investigate mitigation effects of industrial symbiosis technology. • CCPP greatly reduced the indirect carbon emission embodied in power purchase. • CCSC reduced the carbon emission by distributing fixed carbon into by-product. • Specific low carbon-tech promotion policies fit to China was discussed and proposed

  17. Global Uncertainty Accounting for Forest Carbon

    Science.gov (United States)

    Cooke, R. M.; Saatchi, S. S.; Hagen, S. C.

    2015-12-01

    Uncertainty in Global Forest Carbon There are 11.3 E9 global hectares of biologically productive surface, of which approximately 4E9 are forested. The terrestrial biosphere reservoir contains carbon in organic compounds in vegetation living biomass (450 to 650 PgC, IPCC AR5 ). Houghton et al (2009) give 385 - 650 GtC, of which 70 ~90% is forest. Using 80%, that gives a range of 360 ~ 520 (IPCC) or 308 ~ 520 (Houghton) GtC in Earth's forests. The IPCC values give a forest carbon global density range of 90 ~ 130 tC/ha. Assuming that 360 and 520 GtC are two independent samples from our uncertainty on the global forest carbon pool, we may ballpark this uncertainty as STD(global forest carbon pool) ~ [½(160)2 [GtC]2]½= 113 E9 [tC].If Xi,…XN have average variance s2 and average covariance c then VAR(SXi) = s2N + N(N-1)c, and: 1) 28.3 = s(2.5E-10 + r)½. where s is the root of the average variance of forest carbon in [t/ha], and r = c/s2 is the "global correlation". r is equal to the average correlation over all pairs of hectares if the variances per hectare are constant, but r £ 1 holds in any case. Uncertainty accounting.If r = 0, then (1) entails that s = 1.8 E6 tC, which is not defensible. Suppose an uncertainty requirement for carbon monitoring systems stipulates that the standard deviation per hectare should not exceed 10% of the mean. With a mean of 110 tC/ha, s = 11, and substitution in (1) would give r½ = 2.6, which is impossible. If r = 1, then s = 28.3 which is 26% of the mean. In this case it can be shown that the error in the estimate in any hectare is perfectly correlated with errors in every other hectare: removing the uncertainty in ONE hectare on the Earth would remove uncertainty in ALL hectares. Neither r = 0, r = 1 are reasonable. Uncertainty accounting requires consistent estimates of global forest carbon uncertainty, uncertainty in hectare-wise estimates and global correlation. Consistent estimates do not exist at present. This research charts

  18. ({sup 18}O,{sup 18}Ne) double charge-exchange with MAGNEX

    Energy Technology Data Exchange (ETDEWEB)

    Bondí, M.; Cappuzzello, F.; Nicolosi, D.; Tropea, S. [Dipartimento di Fisica e Astrofisica, Universitá degli studi di Catania, Catania, 95100, Italy and Istituto di Fisica Nucleare - Laboratori Nazionali del Sud, Catania, 95100 (Italy); Agodi, C.; Carbone, D.; Cavallaro, M.; Cunsolo, A. [Istituto di Fisica Nucleare - Laboratori Nazionali del Sud, Catania, 95100 (Italy); De Napoli, M.; Foti, A. [Istituto di Fisica Nucleare - Sezione di Catania, Catania, 95100 (Italy)

    2014-05-09

    An experimental study concerning Double Gamow-Teller (DGT) modes in ({sup 18}O,{sup 18}Ne) Double Charge-Exchange reactions has been very recently performed at INFN-LNS laboratory in Catania. The experiment was performed using a {sup 40}Ca solid target and a {sup 18}O Cyclotron beam at 270 MeV incident energy. Charged ejectiles produced in the reaction were momentum analyzed and identified by MAGNEX spectrometer at very forward angles. Preliminary results are presented in the present paper.

  19. Major carbon industries in India

    Energy Technology Data Exchange (ETDEWEB)

    Jain, P.K.

    1982-01-01

    The history of the major carbon industries in India, their growth, present status, problems and future prospects are described. Chapters cover: raw petroleum coke, calcined petroleum coke, graphite electrodes and anodes, carbon electrode paste, calcined anthracite coal, low-ash metallurgical coke, carbon black industry, activated carbon, midget electrodes, cinema arc carbons, carbon blocks and brushes for electrical machinery, and the growth of the aluminium industry and its impact on the calcined petroleum coke industry.

  20. Synthesis of hydrated lutetium carbonate

    Energy Technology Data Exchange (ETDEWEB)

    Song Liu [South China Univ. of Technology, Dept. of Applied Chemistry, Guangdong (China); Rong-jun Ma [Changsha Research Institute of Minig and Metallurgy, Hunan (China)

    1997-09-01

    Crystalline lutetium carbonate was synthesized for the corresponding chloride using ammonium bicarbonate as precipitant. The chemical analyses suggest that the synthesized lutetium carbonate is a hydrated basic carbonate or oxycarbonate. The X-ray powder diffraction data are presented. The IR data for the compound show the presence of two different carbonate groups. There is no stable intermediate carbonate in the process of thermal decomposition of the lutetium carbonate. (au) 15 refs.

  1. Low-carbon infrastructure strategies for cities

    Science.gov (United States)

    Kennedy, C. A.; Ibrahim, N.; Hoornweg, D.

    2014-05-01

    Reducing greenhouse gas emissions to avert potentially disastrous global climate change requires substantial redevelopment of infrastructure systems. Cities are recognized as key actors for leading such climate change mitigation efforts. We have studied the greenhouse gas inventories and underlying characteristics of 22 global cities. These cities differ in terms of their climates, income, levels of industrial activity, urban form and existing carbon intensity of electricity supply. Here we show how these differences in city characteristics lead to wide variations in the type of strategies that can be used for reducing emissions. Cities experiencing greater than ~1,500 heating degree days (below an 18 °C base), for example, will review building construction and retrofitting for cold climates. Electrification of infrastructure technologies is effective for cities where the carbon intensity of the grid is lower than ~600 tCO2e GWh-1 whereas transportation strategies will differ between low urban density (~6,000 persons km-2) cities. As nation states negotiate targets and develop policies for reducing greenhouse gas emissions, attention to the specific characteristics of their cities will broaden and improve their suite of options. Beyond carbon pricing, markets and taxation, governments may develop policies and target spending towards low-carbon urban infrastructure.

  2. Multifunctional Stiff Carbon Foam Derived from Bread.

    Science.gov (United States)

    Yuan, Ye; Ding, Yujie; Wang, Chunhui; Xu, Fan; Lin, Zaishan; Qin, Yuyang; Li, Ying; Yang, Minglong; He, Xiaodong; Peng, Qingyu; Li, Yibin

    2016-07-01

    The creation of stiff yet multifunctional three-dimensional porous carbon architecture at very low cost is still challenging. In this work, lightweight and stiff carbon foam (CF) with adjustable pore structure was prepared by using flour as the basic element via a simple fermentation and carbonization process. The compressive strength of CF exhibits a high value of 3.6 MPa whereas its density is 0.29 g/cm(3) (compressive modulus can be 121 MPa). The electromagnetic interference (EMI) shielding effectiveness measurements (specific EMI shielding effectiveness can be 78.18 dB·cm(3)·g(-1)) indicate that CF can be used as lightweight, effective shielding material. Unlike ordinary foam structure materials, the low thermal conductivity (lowest is 0.06 W/m·K) with high resistance to fire makes CF a good candidate for commercial thermal insulation material. These results demonstrate a promising method to fabricate an economical, robust carbon material for applications in industry as well as topics regarding environmental protection and improvement of energy efficiency. PMID:27295106

  3. Bacterial carbon cycling in a subarctic fjord

    DEFF Research Database (Denmark)

    Middelboe, Mathias; Glud, Ronnie Nøhr; Sejr, M.K.

    2012-01-01

    and BGE were positively correlated with BDOC concentration, suggesting that organic carbon availability was limiting bacterial activity and carbon conversion efficiency. Viral production was low (0.8–1.8 × 104 viruses mL−1 h−1) as compared to low-latitude environments, suggesting a relatively small effect......In this seasonal study, we examined the environmental controls and quantitative importance of bacterial carbon consumption in the water column and the sediment in the subarctic Kobbefjord, Greenland. Depth-integrated bacterial production in the photic zone varied from 5.0 ± 2.7 mg C m−2 d−1...... in February to 42 ± 28 mg C m−2 d−1 in May and 34 ± 7 mg C m−2 d−1 in September, corresponding to a bacterial production to primary production ratio of 0.34 ± 0.14, 0.07 ± 0.04, and 0.08 ± 0.06, respectively. Based on measured bacterial growth efficiencies (BGEs) of 0.09–0.10, pelagic bacterial carbon...

  4. Investigating carbonate formation in urban soils as a method for capture and storage of atmospheric carbon

    International Nuclear Information System (INIS)

    This paper investigates the potential for engineered urban soils to capture and store atmospheric carbon (C). Calcium (Ca) and magnesium (Mg) bearing waste silicate minerals within the soil environment can capture and store atmospheric C through the process of weathering and secondary carbonate mineral precipitation. Anthropogenic soils, known to contain substantial quantities of Ca and Mg-rich minerals derived from demolition activity (particularly cement and concrete), were systematically sampled at the surface across a 10 ha brownfield site, Science Central, located in the urban centre of Newcastle upon Tyne, U.K. Subsequent analysis yielded average carbonate contents of 21.8 ± 4.7% wt CaCO3. Isotopic analysis demonstrated δ18O values between − 9.4‰ and − 13.3‰ and δ13C values between − 7.4‰ and − 13.6‰ (relative to Pee Dee Belemnite), suggesting that up to 39.4 ± 8.8% of the carbonate C has been captured from the atmosphere through hydroxylation of dissolved CO2 in high pH solutions. The remaining carbonate C is derived from lithogenic sources. 37.4 kg of atmospheric CO2 has already been captured and stored as carbonate per Mg of soil across the site, representing a carbon dioxide (CO2) removal rate of 12.5 kgCO2 Mg−1 yr−1. There is the potential for capture and storage of a further 27.3 kgCO2 Mg−1 in residual reactive materials, which may be exploited through increased residence time (additional in situ weathering). Overall, the Science Central site has the potential to capture and store a total of 64,800 Mg CO2 as carbonate minerals. This study illustrates the potential for managing urban soils as tools of C capture and storage, an important ecosystem service, and demonstrates the importance of studying C storage in engineering urban anthropogenic soils. Highlights: ► Urban soils potentially capture 12.5 kgCO2 Mg−1 yr−1 (value £51,843–£77,765 ha−1). ► Formation of carbonate may be significant and exploitable storage

  5. Potential reduction of carbon emissions from Crude Palm Oil production based on energy and carbon balances

    International Nuclear Information System (INIS)

    Highlights: ► We evaluate energy and carbon equivalence from CPO production based on a CBM. ► Energy spent and produced via carbon movement from palm oil mill was determined. ► Scenarios were formulated to evaluate the potential reduction of carbon emission. ► Utilization of biomass from palm oil mill shows the high potential of C-reduction. -- Abstract: This study aimed to evaluate energy and carbon equivalences (CE) associated with palm oil milling and to evaluate sustainability alternatives for energy consumption. Appropriate ways to reduce carbon emissions were also evaluated. A field survey was carried out to quantify the input and output of energy and materials following the conceptual framework of a carbon-balanced model (CBM), which exclude other non-CO2 greenhouse gases. Survey results indicate that the electrical energy consumption for daily mill start-up averaged 18.7 ± 5.4 kWh/ton Fresh Fruit Bunches (FFBs). This energy is equivalent to 114.4 ± 33.2 kWh/ton Crude Palm Oil (CPO) which was found to be offset by that generated in the mills using palm fiber as a solid fuel. Currently, organic residues contained in the wastewater are anaerobically converted to methane. The methane is used as fuel to generate electricity and sold to an outside grid network at a generation rate of 8.1 ± 2.1 kWh/ton FFB. Based on the CBM approach, carbon emissions observed from the use of fossil energy in palm oil milling were very small; however, total carbon emission from oil palm plantation and palm oil milling were found to be 12.3 kg CE/ton FFB, resulting in the net carbon reduction in CPO production of 2.8 kg CE/ton FFB or 53.7 kg CE/ha-y. Overall, the sum of C-reduction was found 1.2 times greater than that of C-emission. This figure can be increased up to 5.5, if all biomass by-products are used as fuel to generate electricity only. The full potential for carbon reduction from palm oil milling is estimated at 0.94 kW of electric power for every hectare of

  6. Late Holocene hydroclimate change inferred from δ18O of lake sediments, Lost River Range, Idaho

    Science.gov (United States)

    Krueger, C. R.; Finney, B. P.; Shapley, M.

    2012-12-01

    High-resolution paleohydrological records are needed to assess the frequency and magnitude of past droughts in Idaho and the northern Rocky Mountain region, but are scarce in this semi-arid region. Sediments from Lost Keys Pond (LKP) can be used to reconstruct hydroclimate. LKP is closed to surface outflow and is therefore sensitive to precipitation minus evaporation; surface water is enriched in δ18O compared to the local meteoric waters. In summer 2011 several sediment cores were collected from LKP using a square rod piston corer; the focus of this analysis is an 82-cm Bolivia core. This core contains thinly banded to laminated, authigenic carbonate mud, a recorder of lake δ18O at the time of deposition. This core was sampled for δ18O and /δ13C at 0.5 cm intervals, and the <20 um fraction was isolated to avoid any detrital carbonate. Based on the current age model, sampling at this interval records sub-decadal (5-10 year) hydroclimate variability. The δ18O signal recovered has 5‰ variability over the length of the record, including several major fluctuations in last 1,000 years. During this period, several major dry and wet periods have been recorded occurring over multidecadal timescales, with a trend toward increasing aridity. The δ18O and δ13C records in the lowest decimeter are divergent and mirror each other, above this interval isotopic records have strong covariance. This pattern may be indicative of a change from surface outflow to no surface outflow conditions. The age model is being refined to better assess how this record correlates with other regional records, and ultimately improve our understanding of past atmospheric circulation.

  7. 13C-18O bonding (Δ47) in deep-sea corals: a calibration study

    Science.gov (United States)

    Kimball, J. B.; Tripati, A.; Dunbar, R. B.; Eagle, R.

    2013-12-01

    Deep-sea corals are a potentially valuable archive of temperature in intermediate and deep waters, regions for which a paucity of temperature data exists. These archives could give valuable insight into the natural variability of areas of the ocean that play an active role in large-scale climate dynamics. Due to significant 'vital effects' (i.e., non-equilibrium mineral compositions) in δ18O, however, deep-sea coral have been challenging to develop as a paleotemperature proxy. Clumped-isotope paleothermometry is a new method that may circumvent some of the known complications with δ18O paleotemperature analysis in deep-sea coral. This geothermometer is based on the ordering of heavy 13C-18O ';clumps' in carbonate minerals. Initial calibration studies have shown that the method is independent from the solution chemistry of the precipitating fluids as well as 'vital effects' in deep-sea corals and other types of carbonates. Some kinetic effects have been observed in tropical corals and speleothems. Here we report new data in order to further develop clumped isotopes as a paleothermometer in deep-sea corals as well as to investigate taxon-specific effects. 13C-18O bond ordering was analyzed in live-collected scleractinian (Enallopsammia sp.) and gorgonian (Isididae and Coralliidae) deep-sea corals. We determined mass 47 anomalies in samples (Δ47), which refers to the parts per thousand excess of 13C-18O-16O in CO2 produced on acid digestion of a sample, relative to the amount predicted to be present if isotopes were randomly distributed amongst all CO2 isotopologues. Measured Δ47 values were compared to in situ temperatures and the relationship between Δ47 and temperature was determined for each group to investigate taxon-specific effects.

  8. Carbon Budget of Bastard Halibut Paralichthys Oliva-eus in Relation to Body Weight and Temperature

    Institute of Scientific and Technical Information of China (English)

    线薇薇; 刘瑞玉; 朱鑫华

    2003-01-01

    The effects of body weight and temperature on the carbon budget of the juvenile bastard halibut, Paralichthys olivaceus , were studied at temperature 13.5, 18, 21.5 and 24 ℃, respectively. The carbon intake, faecal and growth carbon were measured, and the carbon respiration was calculated using the carbon budget equation(CC=GC+FC+RC). The combined relationship between different components of the carbon budget, body weight and temperature could be described by regression equations: CC =1.0206 W 0.8126 e 0.1483 T; G=0.0042 W 1.4096 (-5.11 T 3+285.90 T2-5173.72 T +30314.03); FC =0.0485 W0.7711e 0.1624 T ; UC = 1.4333 W 0.6715e 0.1487 T. Body weight had no significant ffect on the carbon absorption efficiency and the conversion efficiency.

  9. Conducting carbonized polyaniline nanotubes

    Science.gov (United States)

    Mentus, Slavko; Ćirić-Marjanović, Gordana; Trchová, Miroslava; Stejskal, Jaroslav

    2009-06-01

    Conducting nitrogen-containing carbon nanotubes were synthesized by the carbonization of self-assembled polyaniline nanotubes protonated with sulfuric acid. Carbonization was carried out in a nitrogen atmosphere at a heating rate of 10 °C min-1 up to a maximum temperature of 800 °C. The carbonized polyaniline nanotubes which have a typical outer diameter of 100-260 nm, with an inner diameter of 20-170 nm and a length extending from 0.5 to 0.8 µm, accompanied with very thin nanotubes with outer diameters of 8-14 nm, inner diameters 3.0-4.5 nm and length extending from 0.3 to 1.0 µm, were observed by scanning and transmission electron microscopies. Elemental analysis showed 9 wt% of nitrogen in the carbonized product. Conductivity of the nanotubular PANI precursor, amounting to 0.04 S cm-1, increased to 0.7 S cm-1 upon carbonization. Molecular structure of carbonized polyaniline nanotubes has been analyzed by FTIR and Raman spectroscopies, and their paramagnetic characteristics were compared with the starting PANI nanotubes by EPR spectroscopy.

  10. Conducting carbonized polyaniline nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Mentus, Slavko; Ciric-Marjanovic, Gordana [Faculty of Physical Chemistry, University of Belgrade, Studentski trg 12-16, 11158 Belgrade (Serbia); Trchova, Miroslava; Stejskal, Jaroslav [Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovsky Square 2, 162 06 Prague 6 (Czech Republic)], E-mail: gordana@ffh.bg.ac.rs

    2009-06-17

    Conducting nitrogen-containing carbon nanotubes were synthesized by the carbonization of self-assembled polyaniline nanotubes protonated with sulfuric acid. Carbonization was carried out in a nitrogen atmosphere at a heating rate of 10 deg. C min{sup -1} up to a maximum temperature of 800 deg. C. The carbonized polyaniline nanotubes which have a typical outer diameter of 100-260 nm, with an inner diameter of 20-170 nm and a length extending from 0.5 to 0.8 {mu}m, accompanied with very thin nanotubes with outer diameters of 8-14 nm, inner diameters 3.0-4.5 nm and length extending from 0.3 to 1.0 {mu}m, were observed by scanning and transmission electron microscopies. Elemental analysis showed 9 wt% of nitrogen in the carbonized product. Conductivity of the nanotubular PANI precursor, amounting to 0.04 S cm{sup -1}, increased to 0.7 S cm{sup -1} upon carbonization. Molecular structure of carbonized polyaniline nanotubes has been analyzed by FTIR and Raman spectroscopies, and their paramagnetic characteristics were compared with the starting PANI nanotubes by EPR spectroscopy.

  11. Automated Synthesis of 18F Analogue of Paclitaxel (PAC): [18F]Paclitaxel (FPAC)

    OpenAIRE

    Kalen, Joseph D.; Hirsch, Jerry I.; Kurdziel, Karen A.; Eckelman, William C; Kiesewetter, Dale O.

    2006-01-01

    A positron-emitting paclitaxel (PAC) derivative could allow in-vivo measurement of multidrug resistance in tumors and, therefore, predict a potential chemotherapeutic benefit to patients. [18F]Paclitaxel was produced using a 2-reaction vessel automated synthesizer followed by HPLC purification. Optimized reaction conditions resulted in radiochemical yields of 21.2 ± 9.6% at end of bombardment, radiochemical purity > 99%, and specific activity of 159 ± 43 GBq/μmol. [18F]Paclitaxel activities o...

  12. Prenatal Exposure to Carbon Black (Printex 90)

    DEFF Research Database (Denmark)

    Jackson, Petra; Vogel, Ulla; Wallin, Håkan;

    2011-01-01

    Maternal pulmonary exposure to ultrafine particles during pregnancy may affect the health of the child. Developmental toxicity of carbon black (Printex 90) nanoparticles was evaluated in a mouse model. Time-mated mice were intratracheally instilled with Printex 90 dispersed in Millipore water on ...... on gestation days (GD) 7, 10, 15 and 18, with total doses of 11, 54 and 268 mu g Printex 90/animal. The female offspring prenatally exposed to 268 mu g Printex 90/animal displayed altered habituation pattern during the Open field test....

  13. Small diameter carbon nanopipettes

    Science.gov (United States)

    Singhal, Riju; Bhattacharyya, Sayan; Orynbayeva, Zulfiya; Vitol, Elina; Friedman, Gary; Gogotsi, Yury

    2010-01-01

    Nanoscale multifunctional carbon probes facilitate cellular studies due to their small size, which makes it possible to interrogate organelles within living cells in a minimally invasive fashion. However, connecting nanotubes to macroscopic devices and constructing an integrated system for the purpose of fluid and electrical signal transfer is challenging, as is often the case with nanoscale components. We describe a non-catalytic chemical vapor deposition based method for batch fabrication of integrated multifunctional carbon nanopipettes (CNPs) with tip diameters much smaller (10-30 nm) than previously reported (200 nm and above) and approaching those observed for multiwalled carbon nanotubes. This eliminates the need for complicated attachment/assembly of nanotubes into nanofluidic devices. Variable tip geometries and structures were obtained by controlled deposition of carbon inside and outside quartz pipettes. We have shown that the capillary length and gas flow rate have a marked effect on the carbon deposition. This gives us a flexible protocol, useful for growing carbon layers of different thicknesses at selective locations on a glass pipette to yield a large variety of cellular probes in bulk quantities. The CNPs possess an open channel for fluid transfer with the carbon deposited inside at 875 °C behaving like an amorphous semiconductor. Vacuum annealing of the CNP tips at temperatures up to 2000 °C yields graphitic carbon structures with an increase in conductivity of two orders of magnitude. Penetration of the integrated carbon nanoprobes into cells was shown to produce minimal Ca2+ signals, fast recovery of basal Ca2+ levels and no adverse activation of the cellular metabolism during interrogation times as long as 0.5-1 h.

  14. Small diameter carbon nanopipettes

    International Nuclear Information System (INIS)

    Nanoscale multifunctional carbon probes facilitate cellular studies due to their small size, which makes it possible to interrogate organelles within living cells in a minimally invasive fashion. However, connecting nanotubes to macroscopic devices and constructing an integrated system for the purpose of fluid and electrical signal transfer is challenging, as is often the case with nanoscale components. We describe a non-catalytic chemical vapor deposition based method for batch fabrication of integrated multifunctional carbon nanopipettes (CNPs) with tip diameters much smaller (10-30 nm) than previously reported (200 nm and above) and approaching those observed for multiwalled carbon nanotubes. This eliminates the need for complicated attachment/assembly of nanotubes into nanofluidic devices. Variable tip geometries and structures were obtained by controlled deposition of carbon inside and outside quartz pipettes. We have shown that the capillary length and gas flow rate have a marked effect on the carbon deposition. This gives us a flexible protocol, useful for growing carbon layers of different thicknesses at selective locations on a glass pipette to yield a large variety of cellular probes in bulk quantities. The CNPs possess an open channel for fluid transfer with the carbon deposited inside at 875 deg. C behaving like an amorphous semiconductor. Vacuum annealing of the CNP tips at temperatures up to 2000 deg. C yields graphitic carbon structures with an increase in conductivity of two orders of magnitude. Penetration of the integrated carbon nanoprobes into cells was shown to produce minimal Ca2+ signals, fast recovery of basal Ca2+ levels and no adverse activation of the cellular metabolism during interrogation times as long as 0.5-1 h.

  15. Development of fluorine 18 labelled MPPF, radiopharmaceutical tracer for serotoninergic system exploration

    International Nuclear Information System (INIS)

    Full text: Positron Emission Tomography (PET) is a non-invasive method for exploration, in man and animals, of metabolism with radiopharmaceutical tracers labelled with positron emitters such as carbon 11 and fluorine 18 obtained with a cyclotron. Among the ever increasing number of tracers focussed at the CNS neurotransmission, the discovery of a new family of serotoninergic 5HT1A antagonists (WAY 100635) has led to the first in vivo imaging of 5HT1A receptors in man, located in cerebral structures such as cortex and hippocampus. Exploration of serotonine parthway is particulaly interesting in normal or diseased state, as this neurotransmitter is involved in the control of mood, sleep and is probably altered in psychiatric disorders. CERMEP, in collaboration with other PET centres has developped a new 5HT1A antagonist, MPPF, labelled with fluorine 18. [18F]MPPF has the advantadge of fluorine 18 labelling, with a longer half-life (110 min vs 20 min for carbon 11) and easier radiosynthesis automation. Moreover, MPPF affinity for 5HT1A is close to serotonin itself, thus enabling displacement of MPPF by endogenous serotonin during pharmacological challenges. Automated radiosynthesis of MPPF is achieved via a classical [18F]F - fluoro for nitro displacement, activated by a catalyst, on a nitro precursor prepared in four steps. A final HPLC purification ensures the production of [18F]MPPF with a high purity and a high specific activity. Ex vivo autoradiographies and PET studies in animals (rat, cat) have shown the excellent specificity of MPPF for the 5HT1A receptor. Experiments with intracerebral β probe have evidenced the displacement of [18F]MPPF by endogenous serotonin after fenfluramine injection. [18F]MPPF is now used in man for non-invasive PET studies of serotoninergic system. Normal volunteers matched for age and sex have been screened as a database and to compute a mathematical model of the tracer kinetic describing 5HT1A receptor affinity and availability

  16. Carbon Ion Therapy

    DEFF Research Database (Denmark)

    Bassler, Niels; Hansen, David Christoffer; Herrmann, Rochus;

    On the importance of choice of target size for selective boosting of hypoxic tumor subvolumina in carbon ion therapy Purpose: Functional imaging methods in radiotherapy are maturing and can to some extent uncover radio resistant structures found within a tumour entity. Selective boost of identified...... effect. All cell lines investigated here did not reach an OER of 1, even for the smaller structures, which may indicate that the achievable dose average LET of carbon ions is too low, and heavier ions than carbon may be considered for functional LET-painting....

  17. The "Flood of the Century" as Isotopic Fingerprint in Canopy d18O Signatures

    Science.gov (United States)

    Seibt, U.; Wingate, L.; Berry, J. A.

    2006-12-01

    The d18O composition of water and CO2 exchange at smaller scales (leaf and ecosystem) can be affected by changes in environmental conditions at larger (regional) scales. During a sampling campaign in a beech forest in Germany in August 2002, we encountered such a large scale change when dry sunny weather was followed by a large storm system with heavy rains leading to floods across Europe. During the first, sunny period, bulk leaf water d18O was -1 permil at night and 7 permil at mid-day. Foliage CO2 exchange had positive values of 18O discrimination during photosynthesis (10-30 permil) and nocturnal respiration (11 permil). The second period had frequent rains and mostly diffuse light, with reduced foliage water fluxes but similar carbon fluxes. Canopy vapour d18O decreased at least 2 permil, and leaf water then reflected isotopic exchange with this depleted vapour due to the high humidity. Hence, bulk leaf water was substantially more depleted at night (-8 permil) and showed virtually no evaporative enrichment during the day (-5 permil). Values of 18O discrimination during CO2 exchange were small or even negative for photosynthesis (-2 to 6 permil) but larger for nocturnal respiration (23-39 permil). Model simulations indicated that the small positive foliage isoflux during the day was offset by the negative isoflux at night. As a consequence, the d18O of CO2 in canopy air decreased from -0.3 permil during the sunny period to -3 permil during the wet period. The d18O signatures of canopy water and CO2 thus reflected the transition from local water to the regional regime of depleted water deposited across the area by the storm.

  18. Twelve year interannual and seasonal variability of stream carbon export from a boreal peatland catchment

    Science.gov (United States)

    Leach, J. A.; Larsson, A.; Wallin, M. B.; Nilsson, M. B.; Laudon, H.

    2016-07-01

    Understanding stream carbon export dynamics is needed to accurately predict how the carbon balance of peatland catchments will respond to climatic and environmental change. We used a 12 year record (2003-2014) of continuous streamflow and manual spot measurements of total organic carbon (TOC), dissolved inorganic carbon (DIC), methane (CH4), and organic carbon quality (carbon-specific ultraviolet absorbance at 254 nm per dissolved organic carbon) to assess interannual and seasonal variability in stream carbon export for a peatland catchment (70% mire and 30% forest cover) in northern Sweden. Mean annual total carbon export for the 12 year period was 12.2 gCm-2 yr-1, but individual years ranged between 6 and 18 gCm-2 yr-1. TOC, which was primarily composed of dissolved organic carbon (>99%), was the dominant form of carbon being exported, comprising 63% to 79% of total annual exports, and DIC contributed between 19% and 33%. CH4 made up less than 5% of total export. When compared to previously published annual net ecosystem exchange (NEE) for the studied peatland system, stream carbon export typically accounted for 12 to 50% of NEE for most years. However, in 2006 stream carbon export accounted for 63 to 90% (estimated uncertainty range) of NEE due to a dry summer which suppressed NEE, followed by a wet autumn that resulted in considerable stream export. Runoff exerted a primary control on stream carbon export from this catchment; however, our findings suggest that seasonal variations in biologic and hydrologic processes responsible for production and transport of carbon within the peatland were secondary influences on stream carbon export. Consideration of these seasonal dynamics is needed when predicting stream carbon export response to environmental change.

  19. Investigating the Formation of Pedogenic Carbonate Using Stable Isotopes

    Science.gov (United States)

    Breecker, D. O.; Sharp, Z. D.; McFadden, L.

    2006-12-01

    18O values of soil CO2 collected in May span a 16‰ range with the highest values and steepest gradient just below the surface. In August, the lowest δ18O values measured were just below the surface and there was little change with depth below 35 cm. These results can also be explained by August rainfall which likely lowers the δ18O value of near surface soil water and also near surface soil CO2 via oxygen exchange. Neither the May nor August CO2 values are in equilibrium with the pedogenic carbonate at measured temperatures, but the shape of the δ18O CO2 profiles from May more closely approximate the carbonate δ18O profile. Our results to date suggest that the majority of pedogenic carbonate in this soil forms when the soil is relatively dry. It is possible that the magnitude of soil water evaporation during the period between daily thunderstorms is insufficient to drive carbonate precipitation. Sufficient evaporation may primarily occur during seasonal drying in the autumn. We will test this hypothesis by continuing to sample soil CO2 at this site.

  20. 46 CFR 151.50-41 - Carbon disulfide (carbon bisulfide).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Carbon disulfide (carbon bisulfide). 151.50-41 Section... CARGOES BARGES CARRYING BULK LIQUID HAZARDOUS MATERIAL CARGOES Special Requirements § 151.50-41 Carbon disulfide (carbon bisulfide). (a) All openings shall be in the top of the tank. (b) Loading lines...