WorldWideScience

Sample records for carbon 17

  1. Weight Percentage of Calcium Carbonate for 17 Equatorial Pacific Cores from Brown University

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Weight percentages of calcium carbonate in this file were compiled by J. Farrell and W. L. Prell of Brown University for 17 equatorial Pacific Ocean sediment cores....

  2. Carbon Dioxide Emissions: 17 Years and Still Talking

    International Nuclear Information System (INIS)

    This paper, written in French and in English, examines how the figures have changed from Kyoto base year 1990 up to 2007, before looking at certain countries' proposals for the future of their carbon dioxide emissions. Statistics are given concerning the emissions changes in various countries (or groups of countries) but also their developments in regards to the economy and energy use. Changes in CO2 emissions, changes in the gross domestic product of a country, its CO2 emissions per capita, its energy intensity (the ratio of energy use to the monetary value of GDP) and its carbon intensity of energy use as well as population change, are presented. The main countries considered are: United States, European Union, China, Japan, India, Brazil, South Africa and Russia

  3. MD investigation of the collective carbon atom behavior of a (17, 0) zigzag single wall carbon nanotube under axial tensile strain

    International Nuclear Information System (INIS)

    The collective dynamic behavior of carbon atoms of a (17, 0) zigzag single wall carbon nanotube is investigated under tensile strains by molecular dynamics (MD) simulations. The 'slip vector' parameter is used to study the collective motion of a group of atoms and the deformation behavior in three different directions (axial, radial, and tangential) of a (17, 0) carbon nanotube. The variations of radial slip vectors indicate almost all carbon atoms of the (17, 0) carbon nanotube will stay on the cylindrical surface before the yielding of the single wall carbon nanotube (SWNT). Furthermore, the tangential vectors show kinking deformation for the (17, 0) zigzag tube only rarely appears when the crack occurs. Non-symmetrical deformation around a carbon atom along the axial direction also can be found. The variations in the slip vector values of each atom display a symmetrical crack along the horizontal direction and normal to the tube axis. Chain-like structures with 3-4 atoms can be observed, with the number of chain-like structures decreasing before the breakage of the SWNT. The mechanical properties and dynamic behavior of a (17, 0) zigzag SWNT under tensile strain are also compared with that of a (10, 10) armchair tube in our previous study (Weng et al. 2009).

  4. Demonstration of a 17 cm robust carbon fiber deformable mirror for adaptive optics

    Energy Technology Data Exchange (ETDEWEB)

    Ammons, S M; Hart, M; Coughenour, B; Romeo, R; Martin, R; Rademacher, M

    2011-09-12

    Carbon-fiber reinforced polymer (CFRP) composite is an attractive material for fabrication of optics due to its high stiffness-to-weight ratio, robustness, zero coefficient of thermal expansion (CTE), and the ability to replicate multiple optics from the same mandrel. We use 8 and 17 cm prototype CFRP thin-shell deformable mirrors to show that residual CTE variation may be addressed with mounted actuators for a variety of mirror sizes. We present measurements of surface quality at a range of temperatures characteristic of mountaintop observatories. For the 8 cm piece, the figure error of the Al-coated reflective surface under best actuator correction is {approx}43 nm RMS. The 8 cm mirror has a low surface error internal to the outer ring of actuators (17 nm RMS at 20 C and 33 nm RMS at -5 C). Surface roughness is low (< 3 nm P-V) at a variety of temperatures. We present new figure quality measurements of the larger 17 cm mirror, showing that the intra-actuator figure error internal to the outer ring of actuators (38 nm RMS surface with one-third the actuator density of the 8 cm mirror) does not scale sharply with mirror diameter.

  5. Hyperspectral Microscopy of Near-Infrared Fluorescence Enables 17-Chirality Carbon Nanotube Imaging.

    Science.gov (United States)

    Roxbury, Daniel; Jena, Prakrit V; Williams, Ryan M; Enyedi, Balázs; Niethammer, Philipp; Marcet, Stéphane; Verhaegen, Marc; Blais-Ouellette, Sébastien; Heller, Daniel A

    2015-01-01

    The intrinsic near-infrared photoluminescence (fluorescence) of single-walled carbon nanotubes exhibits unique photostability, narrow bandwidth, penetration through biological media, environmental sensitivity, and both chromatic variety and range. Biomedical applications exploiting this large family of fluorophores will require the spectral and spatial resolution of individual (n,m) nanotube species' fluorescence and its modulation within live cells and tissues, which is not possible with current microscopy methods. We present a wide-field hyperspectral approach to spatially delineate and spectroscopically measure single nanotube fluorescence in living systems. This approach resolved up to 17 distinct (n,m) species (chiralities) with single nanotube spatial resolution in live mammalian cells, murine tissues ex vivo, and zebrafish endothelium in vivo. We anticipate that this approach will facilitate multiplexed nanotube imaging in biomedical applications while enabling deep-tissue optical penetration, and single-molecule resolution in vivo. PMID:26387482

  6. Removal of an endocrine disrupting chemical (17 alpha-ethinyloestradiol) from wastewater effluent by activated carbon adsorption: Effects of activated carbon type and competitive adsorption

    Energy Technology Data Exchange (ETDEWEB)

    Ifelebuegu, A.O.; Lester, J.N.; Churchley, J.; Cartmell, E. [Cranfield University, Cranfield (United Kingdom). School of Water Science

    2006-12-15

    Granular activated carbon has been extensively used for the adsorption of organic micropollutants for potable water production. In this study the removal of an endocrine disrupting chemical from wastewater final effluent by three types of granular activated carbon (wood, coconut and coal based) has been investigated in batch adsorption experiments and correlated with the removal of chemical oxygen demand (COD), total organic carbon (TOC) and ultraviolet absorbance (UV). The results obtained demonstrated 17 alpha-ethinyloestradiol (EE2) removals of 98.6%, 99.3%, and 96.4% were achieved by the coal based (ACo), coconut based (ACn) and wood based (AWd) carbons respectively at the lowest dose of carbon (0.1 gl{sup -1}). The other adsorbates investigated all exhibited good removal. At an equilibrium concentration of 7 mgl{sup -1} the COD adsorption capacities were 3.16 mg g{sup -1}, 4.8 mg g{sup -1} and 7.1 mg g{sup -1} for the wood, coconut and coal based carbons respectively. Overall, the order of removal efficiency of EE2 and the other adsorbates for the three activated carbons was ACn {gt} ACo {gt} AWd. The adsorption capacities of the carbons were found to be reduced by the effects of other competing adsorbates in the wastewater effluent.

  7. Synergistic effect of heat shock protein 90 inhibitor, 17-allylamino-17-demethoxygeldanamycin and X-rays, but not carbon-ion beams, on lethality in human oral squamous cell carcinoma cells

    International Nuclear Information System (INIS)

    The purpose of this study is to clarify the effect of a heat shock protein 90 inhibitor, 17-allylamino-17-demethoxygeldanamycin (17-AAG), in combination with X-rays or carbon-ion beams on cell killing in human oral squamous cell carcinoma LMF4 cells. Cell survival was measured by colony formation assay. Cell-cycle distribution was analyzed by flow cytometry. Expression of DNA repair-related proteins was investigated by western blotting. The results showed 17-AAG to have synergistic effects on cell lethality with X-rays, but not with carbon-ion beams. The 17-AAG decreased G2/M arrest induced by X-rays, but not by carbon-ion beams. Both X-ray and carbon-ion irradiation up-regulated expression of non-homologous end-joining-associated proteins, Ku70 and Ku80, but 17-AAG inhibited only X-ray-induced up-regulation of these proteins. These results show that 17-AAG with X-rays releases G2/M phase arrest; cells carrying misrepaired DNA damage then move on to the G1 phase. We demonstrate, for the first time, that the radiosensitization effect of 17-AAG is not seen with carbon-ion beams because 17-AAG does not affect these changes. (author)

  8. High sensitivity Cavity Ring Down spectroscopy of 18O enriched carbon dioxide between 5850 and 7000 cm-1: Part III-Analysis and theoretical modeling of the 12C17O2, 16O12C17O, 17O12C18O, 16O13C17O and 17O13C18O spectra

    CERN Document Server

    Karlovets, E V; Mondelain, D; Kassi, S; Tashkun, S A; Perevalov, V I

    2014-01-01

    More than 19,700 transitions belonging to 11 isotopologues of carbon dioxide have been assigned in the room temperature absorption spectrum of highly 18O enriched carbon dioxide recorded by very high sensitivity CW-Cavity Ring Down spectroscopy between 5851 and 6990 cm-1 (1.71-1.43 \\mum). This third and last report is devoted to the analysis of the bands of five 17O containing isotopologues present at very low concentration in the studied spectra: 16O12C17O, 17O12C18O, 16O13C17O, 17O13C18O and 12C17O2 (627, 728, 637, 738 and 727 in short hand notation). On the basis of the predictions of effective Hamiltonian models, a total of 1759, 1786, 335, 273 and 551 transitions belonging to 24, 24, 5, 4 and 7 bands were rovibrationally assigned for 627, 728, 637, 738 and 727, respectively. For comparison, only five bands were previously measured in the region for the 728 species. All the identified bands belong to the \\deltaP=8 and 9 series of transitions, where P=2V1+V2+3V3 is the polyad number (Vi are vibrational qua...

  9. Effects of oxygen and carbon on the magnetic properties and microstructure of Sm2Co17 permanent magnets

    Institute of Scientific and Technical Information of China (English)

    TIAN Jianjun; ZHANG Shengen; QU Xuanhui

    2007-01-01

    The research on the sintered Sm2Co17 permanent magnets prepared by metal injection molding is still at the exploratory stage. Carbon and oxygen are two key factors that influence the magnetic properties. In this article, the effects of oxygen and carbon on the properties and microstructure of the magnets have been studied. The results indicate that oxygen consumes the effective Sm content of the magnets and forms Sm2O3-the non-magnetism phase, which result in the deterioration of the magnetic properties. Besides, the magnetic properties decrease in evidence with increasing carbon content. The main factor that affects the magnetic properties is the deterioration of the microstructure of the magnets. The Sm(Co, Cu)5 phase decreases, whereas the cell size increases with the increase of the carbon content. When the carbon content is above 0.43 wt.%, the Sm(Co, Cu)5 phase is not enough to form a uniform cellular microstructure. Thus the magnetic properties disappear. ZrC is detected in the magnets by XRD when the carbon content is above 0.21 wt.%. ZrC also reduces the properties of the magnets.

  10. 2012 CHEMISTRY & PHYSICS OF GRAPHITIC CARBON MATERIALS GORDON RESEARCH CONFERENCE, JUNE 17-22, 2012

    Energy Technology Data Exchange (ETDEWEB)

    Fertig, Herbert

    2012-06-22

    This conference will highlight the urgency for research on graphitic carbon materials and gather scientists in physics, chemistry, and engineering to tackle the challenges in this field. The conference will focus on scalable synthesis, characterization, novel physical and electronic properties, structure-properties relationship studies, and new applications of the carbon materials. Contributors

  11. Effect of inorganic nanoparticles on 17β-estradiol and 17α-ethynylestradiol adsorption by multi-walled carbon nanotubes

    International Nuclear Information System (INIS)

    With extensive application of diverse engineered nanoparticles (NPs), multiple NPs would inevitably be released into the environment. However, much emphasis in most previous studies on the interactions of pollutants with NPs has been placed on only one type of NPs at a time. This study investigated the impact of inorganic NPs (I-NPs) on the adsorption of 17β-estradiol (E2) and 17α-ethynylestradiol (EE2) by multi-walled carbon nanotubes (CNTs). The presence of I-NPs inhibited the adsorption and increased the equilibrium time of E2 and EE2 by CNTs. Moreover, the effect of Al2O3 was stronger than that of SiO2, because electrostatic attraction enhanced the interaction between oppositely charged Al2O3 and CNTs. The addition sequence of I-NPs and pollutant also influences adsorption. This is among the first studies investigating the effect of I-NPs on pollutants adsorption by CNTs, which is useful for understanding the transport and fate of CNTs and contaminants in natural aquatic systems. - Highlights: • The impact of I-NPs on the E2 and EE2 adsorption by CNTs were investigated. • The presence of I-NPs inhibited the adsorption of E2 and EE2 by CNTs. • The inhibition effect of Al2O3 NPs was stronger than that of SiO2 NPs. • The preload of I-NPs to CNTs led to a further decrease in E2 and EE2 adsorption. - I-NPs inhibited E2/EE2 adsorption by CNTs, and Al2O3 had greater inhibition effect because electrostatic attraction enhanced interaction of oppositely charged Al2O3 and CNTs

  12. Infrared spectroscopy of 17O- and 18O-enriched carbon dioxide: Line positions and intensities in the 4681-5337 cm-1 region

    Science.gov (United States)

    Borkov, Yu. G.; Jacquemart, D.; Lyulin, O. M.; Tashkun, S. A.; Perevalov, V. I.

    2015-07-01

    The line positions and intensities of carbon dioxide isotopologues have been retrieved in the 4681-5337 cm-1 spectral range from Fourier transform spectra of carbon dioxide recorded in LADIR (Paris, France) with the Bruker IFS 125-HR [Jacquemart D, et al., J Quant Spectrosc Radiat Transf 2012;113:961-975]. In total 6386 line positions and intensities of 89 bands of 12 isotopologues 16O12C16O, 16O13C16O, 16O12C18O, 16O12C17O, 16O13C18O, 16O13C17O, 18O12C18O, 17O12C18O, 17O12C17O, 18O13C18O, 17O13C18O, and 17O13C17O have been retrieved. 23 bands were newly assigned. All studied bands belong to the ΔP=7 series of transitions, where P = 2V1 +V2 + 3V3 is the polyad number (Vi are vibrational quantum numbers). The accuracy of the line position measurement is about 0.3×10-3 cm-1 for the unblended and not very weak lines. The accuracy of the line intensities varies from 4% to 15% depending on the isotopologue, on the intensity of the line and on the extent of the line overlapping. The observed intensities were used to fit the effective dipole moment parameters for the ΔP=7 series of transitions in 16O12C18O, 16O12C17O, 12C17O2, 17O12C18O, 16O13C17O, 13C17O2 and 17O13C18O isotopologues of carbon dioxide.

  13. Quantifying early 17th century changes in Chesapeake Bay estuarine carbon dynamics from James River, VA oyster geochemistry

    Science.gov (United States)

    Grimm, B. L.; Spero, H. J.; Harding, J. M.

    2012-12-01

    same shells provide seasonal signals and also show an offset from modern that is consistent with drought conditions during the early 17th century. These high fidelity records allow for a direct, high-resolution comparison of the residence time of carbon in the environment immediately prior to European colonization and during the first century of land use change in mid-Atlantic North America.

  14. ICC resistance of thin-walled tubes of super low carbon steel Kh17N14M3, alloyed with nitrogen

    International Nuclear Information System (INIS)

    The tendency to intercrystallite corrosion (ICC) in the range of 400-750 deg CV and 1-1000 h of thin-walled (0.3 mm) tubes of steel Kh17N14M3 was studied. Electrochemical investigations confirmed high ICC resistance of the tubes from particularly low-carbon experimental steels

  15. Removal of bisphenol A and 17α-ethinyl estradiol from landfill leachate using single-walled carbon nanotubes.

    Science.gov (United States)

    Joseph, Lesley; Zaib, Qammer; Khan, Iftheker A; Berge, Nicole D; Park, Yong-Gyun; Saleh, Navid B; Yoon, Yeomin

    2011-07-01

    In this study, the adsorption of bisphenol A (BPA) and 17α-ethinyl estradiol (EE2) from landfill leachate onto single-walled carbon nanotubes (SWCNTs) was investigated. Different leachate solutions were prepared by altering the pH, ionic strength, and dissolved organic carbon (DOC) in the solutions to mimic the varying water conditions that occur in leachate during the various stages of waste decomposition. The youngest and oldest leachate solutions contained varying DOC and background chemistry and were represented by leachate Type A (pH = 5.0; DOC = 2500 mg/L; conductivity = 12,500 μS/cm; [Ca(2+)] = 1200 mg/L; [Mg(2+)] = 470 mg/L) and Type E (pH = 7.5; DOC = 250 mg/L; conductivity = 3250 μS/cm; [Ca(2+)] = 60 mg/L; [Mg(2+)] = 180 mg/L). These solutions were subsequently combined in different ratios to produce intermediate solutions, labeled B-D, to replicate time-dependent changes in leachate composition. Overall, a larger fraction of EE2 was removed as compared to BPA, consistent with its higher log K(OW) value. The total removal of BPA and EE2 decreased in older leachate solutions, with the adsorptive capacity of SWCNTs decreasing in the order of leachate Type A > Type B > Type C > Type D > Type E. An increase in the pH from 3.5 to 11 decreased the adsorption of BPA by 22% in young leachate and by 10% in old leachate. The changes in pH did not affect the adsorption of EE2 in the young leachate, but did reduce adsorption by 32% in the old leachate. Adjusting the ionic strength using Na(+) did not significantly impact adsorption, while increasing the concentration of Ca(2+) resulted in a 12% increase in the adsorption of BPA and a 19% increase in the adsorption of EE2. DOC was revealed to be the most influential parameter in this study. In the presence of hydrophilic DOC, represented by glucose in this study, adsorption of the endocrine disrupting compounds (EDCs) onto the SWCNTs was not affected. In the absence of SWCNTs, hydrophobic DOC (i.e., humic acid

  16. Acyl-Carbon Bond Cleaving Cytochrome P450 Enzymes: CYP17A1, CYP19A1 and CYP51A1.

    Science.gov (United States)

    Akhtar, Muhammad; Wright, J Neville

    2015-01-01

    Cytochrome P450 (P450 or CYP) enzymes in their resting state contain the heme-iron in a high-spin FeIII state. Binding of a substrate to a P450 enzyme allows transfer of the first electron, producing a Fe(II) species that reacts with oxygen to generate a low-spin iron superoxide intermediate (FeIII-O-O•) ready to accept the second electron to produce an iron peroxy anion intermediate (a, FeIII-O-O-). In classical monooxygenation reactions, the peroxy anion upon protonation fragments to form the reactive Compound I intermediate (Por•+FeIV=O), or its ferryl radical resonance form (FeIV-O•). However, when the substrate projects a carbonyl functionality, of the type b, at the active site as is the case for reactions catalyzed by CYP17A1, CYP19A1 and CYP51A1, the peroxy anion (FeIII-O-O-) is trapped, yielding a tetrahedral intermediate (c) that fragments to an acyl-carbon cleavage product (d plus an acid). Analogous acyl-carbon cleavage reactions are also catalyzed by certain hepatic P450s and CYP125A1 from Mycobacterium tuberculosis. A further improvisation on the theme is provided by aldehyde deformylases that convert long-chain aliphatic aldehydes to hydrocarbons. CYP17A1 is involved in the biosynthesis of corticoids as well as androgens. The flux toward these two classes of hormones seems to be regulated by cytochrome b 5, at the level of the acyl-carbon cleavage reaction. It is this regulation of CYP17A1 that provides a safety mechanism, ensuring that during corticoid biosynthesis, which requires 17α-hydroxylation by CYP17A1, androgen formation is avoided (Fig. 4.1). PMID:26002733

  17. Carbon dioxide, hydrographic, and chemical data obtained in the South Pacific Ocean (WOCE Sections P16A/P17A, P17E/P19S, and P19C, R/V Knorr, October 1992--April 1993)

    Energy Technology Data Exchange (ETDEWEB)

    Rubin, S.; Goddard, J.G.; Chipman, D.W.; Takahashi, Taro; Sutherland, S.C. [Columbia Univ., Palisades, NY (United States). Lamont-Doherty Earth Observatory; Reid, J.L.; Swift, J.H.; Talley, L.D. [Univ. of California, San Diego, La Jolla, CA (United States). Scripps Institution of Oceanography

    1998-06-01

    This data documentation discusses the procedures and methods used to measure total carbon dioxide concentration (TCO{sub 2}) and partial pressure of CO{sub 2} (pCO{sub 2}) in discrete water samples collected during three expeditions of the Research Vessel (R/V) Knorr in the South Pacific Ocean. Conducted as part of the World Ocean Circulation Experiment (WOCE), the first cruise (WOCE Section P16A/P17A) began in Papeete, Tahiti, French Polynesia, on October 6, 1992, and returned to Papeete on November 25, 1992. The second cruise (WOCE Section P17E/P19S) began in Papeete on December 4, 1992, and finished in Punta Arenas, Chile, on January 22, 1993. The third expedition (WOCE Section P19C) started in Punta Arenas, on February 22 and finished in Panama City, Panama, on April 13, 1993. During the three expeditions, 422 hydrographic stations were occupied. Hydrographic and chemical measurements made along WOCE Sections P16A/P17A, P17E/P19S, and P19C included pressure, temperature, salinity, and oxygen [measured by conductivity, temperature, and depth (CTD) sensor], as well as discrete measurements of salinity, oxygen, phosphate, nitrate, nitrite, silicate, chlorofluorocarbons (CFC-11, CFC-12), TCO{sub 2}, and pCO{sub 2} measured at 4 and 20 C. In addition, potential temperatures were calculated from the measured variables.

  18. Carbon dioxide, hydrographic, and chemical data obtained during the R/V Thomas Washington TUNES-1 in the equatorial Pacific Ocean (WOCE Section P17C)

    Energy Technology Data Exchange (ETDEWEB)

    Goyet, C. [Woods Hole Oceanographic Institution, MA (United States); Key, R.M. [Princeton Univ., NJ (United States); Sullivan, K.F. [Univ. of Miami, FL (United States). Rosensteil School of Marine and Atmospheric Sciences; Tsuchiya, M. [Univ. of California, San Diego, CA (United States). Scripps Institution of Oceanography; Kozyr, A. [Oak Ridge National Lab., TN (United States). Carbon Dioxide Information Analysis Center]|[Univ. of Tennessee, Knoxville, TN (United States). Energy, Environment, and Resources Center

    1997-06-01

    This report discusses the procedures and methods used to obtain measurements of total carbon dioxide (TCO{sub 2}), total alkalinity (TALK), and radiocarbon ({Delta} {sup 14}C), as well as hydrographic and chemical data, during the Research Vessel Thomas Washington Expedition TUNES-1 in the Equatorial Pacific Ocean (Section P17C). Conducted as part of the World Ocean Circulation Experiment (WOCE), the cruise began in San Diego, California, on May 31, 1991, and ended in Papeete, Tahiti, on July 11, 1991. WOCE Meridional Section P17C, along 135{degree}W and between {approximately}5{degree}S and 36{degree}N, was completed during the 42-day expedition. All 123 hydrographic stations (including 9 large-volume stations) were completed to the full water-column depth. Spacing between stations was 30 nautical miles, except between 3{degree}N and 3{degree}S, where it was 10 nautical miles. At 30 stations, CO{sub 2} measurements were provided for the US Department of Energy`s Carbon Dioxide Program. Hydrographic and chemical measurements made along WOCE Section P17C included pressure, temperature, salinity, and oxygen (measured by conductivity, temperature, and depth sensor), as well as bottle measurements of salinity, oxygen, phosphate, nitrate, nitrite, silicate, chlorofluorocarbon (CFC)-11, CFC-12, {Delta} {sup 14}C, TCO{sub 2}, and TALK. In addition, potential temperatures were calculated from the measured variables.

  19. A calcium oxide sorbent process for bulk separation of carbon dioxide. Quarterly progress report 17, July--September 1993

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, D.P.

    1993-10-01

    Phase II research involves a scale-up from microgram to gram quantities of sorbent and a switch from the electrobalance reactor to a fixed-bed reactor with capability for feed and product gas analysis. Parameters being studied in Phase II are essentially the same as in Phase I. The reactor response is being studied as a function of calcination and carbonation temperature and pressure, composition of the calcination and carbonation feed gas, and space velocity during the carbonation cycle. Multicycle tests are also being conducted to extend the information on sorbent durability. During the current quarter, reactor modifications to permit easier addition and removal of sorbent to and from the reactor were accomplished. It is now possible to remove sorbent after a run in discrete axial sections which will permit characterization of the sorbent as a function of axial position. Tracer response tests in which the chromatograph response to step function injections of hydrogen to flowing nitrogen under non-reactive conditions were carried out to evaluate the lag time between feeding reactive gases to the reactor and their appearance in the product gas sample. Fourteen additional calcination/carbonation reaction tests were completed this quarter, and the effects of carbonation background gas composition, sorbent particle size, calcination temperature, calcination gas flow rate, and calcination gas composition were studied. In addition, the first multicycle test involving complete calcination/carbonation cycles was carried out.

  20. Application of stable carbon isotope analysis to the detection of 17beta-estradiol administration to cattle.

    Science.gov (United States)

    Buisson, C; Hebestreit, M; Weigert, A Preiss; Heinrich, K; Fry, H; Flenker, U; Banneke, S; Prevost, S; Andre, F; Schaenzer, W; Houghton, E; Le Bizec, B

    2005-11-01

    The use of anabolic agents in food producing animals is prohibited within the EU since 1988 (96/22/EC directive). The control of the illegal use of natural steroid hormones in cattle is still an exciting analytical challenge as far as no definitive method and non-ambiguous analytical criteria are available. The ability of gas chromatography/combustion/isotope ratio mass spectrometry (GC/C/IRMS) to demonstrate the administration of 17beta-estradiol to bovine has been investigated in this paper. By comparison of 13C/12C isotopic ratio of main urinary estradiol metabolite, i.e. 17alpha-estradiol, with two endogenous reference compounds (ERCs), i.e. dehydroepiandrosterone (DHEA) and 5-androstene-3beta,17alpha-diol, the differentiation of estradiol metabolite origin, either endogenous or exogenous, has been proved to be achievable. After treatment, the delta(13)C(VPDB)-values of 17alpha-estradiol reached -27 per thousand to -29 per thousand, whereas delta13CVPDB-values of DHEA remained between -13 per thousand and -20 per thousand depending on the diet, maize and grass, respectively. A significant difference of delta13CVPDB between ERCs and 17alpha-estradiol was measurable over a period of 2 weeks after estradiol ester administration to the animal. PMID:16233872

  1. Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the R/V Maurice Ewing Cruise in the Atlantic Ocean (WOCE Section A17, 4 January - 21 March 1994)

    Energy Technology Data Exchange (ETDEWEB)

    Kozyr, Alex [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Carbon Dioxide Information Analysis Center

    2005-06-30

    This documentation discusses the procedures and methods used to measure total carbon dioxide (TCO2), total alkalinity (TALK), and pH at hydrographic stations during the R/V Maurice Ewing cruise in the South Atlantic Ocean on the A17 WOCE section. Conducted as part of the World Ocean Circulation Experiment (WOCE), this cruise was also a part of the French WOCE program consisting of three expeditions (CITHER 1, 2, and 3) focused on the South Atlantic Ocean. The A17 section was occupied during the CITHER 2 expedition, which began in Montevideo, Uruguay, on January 4, 1994 and finished in Cayenne, French Guyana, on March 21, 1994. During this period the ship stopped in Salvador de Bahia and Recife, Brazil, to take on supplies and exchange personnel. Upon completion of the cruise the ship transited to Fort de France, Martinique. Instructions for accessing the data are provided.

  2. 13C and 17O NMR binding constant studies of uranyl carbonate complexes in near-neutral aqueous solution. Yucca Mountain Project Milestone Report 3351

    International Nuclear Information System (INIS)

    Valuable structural information, much of it unavailable by other methods, can be obtained about complexes in solution through NMR spectroscopy. From chemical shift and intensity measurements of complexed species, NMR can serve as a species-specific structural probe for molecules in solution and can be used to validate thermodynamic constants used in geochemical modeling. Fourier-transform nuclear magnetic resonance (FT-NMR) spectroscopy has been employed to study the speciation of uranium(VI) ions in aqueous carbonate solutions as a function of pH, ionic strength, carbonate concentration, uranium concentration, and temperature. Carbon-13 and oxygen-17 NMR spectroscopy were used to monitor the fractions, and hence thermodynamic binding constants of two different uranyl species U02(CO3)34- and (UO2)3(CO3)66- in aqueous solution. Synthetic buffer solutions were prepared under the ionic strength conditions used in the NMR studies in order to obtain an accurate measure of the hydrogen ion concentration, and a discussion of pH = -log(aH+) versus p[H] = -log[H+] is provided. It is shown that for quantitative studies, the quantity p[H] needs to be used. Fourteen uranium(VI) binding constants recommended by the OECD NEA literature review were corrected to the ionic strengths employed in the NMR study using specific ion interaction theory (SIT), and the predicted species distributions were compared with the actual species observed by multinuclear NMR. Agreement between observed and predicted stability fields is excellent. This establishes the utility of multinuclear NMR as a species-specific tool for the study of the actinide carbonate complexation constants, and serves as a means for validating the recommendations provided by the OECD NEA

  3. A Comparison of Household Carbon Emission Patterns of Urban and Rural China over the 17 Year Period (1995–2011

    Directory of Open Access Journals (Sweden)

    Jiansheng Qu

    2015-09-01

    Full Text Available The household sector consumes a large amount of goods and services and is therefore a major source of global carbon emissions. This study aims to analyze per person household carbon emission (HCEs patterns of urban and rural China over the period from 1995 to 2011. Annual macroeconomic data for the study were obtained from authentic Chinese government sources. Direct HCE estimates for each fossil fuel were obtained using the IPCC’s reference approach, and indirect HCEs were calculated by input-output analysis. In 1995, per person HCEs from direct sources for urban and rural China were 0.50 tCO2 and 0.22 tCO2, respectively; by 2011, these values had increased to 0.60 tCO2 and 0.61 tCO2, an increase of 20% and 177.27%, respectively. Similarly, in 1995, per person HCEs from indirect sources for urban and rural China were 0.43 tCO2 and 0.16 tCO2, respectively; by 2011, these values had increased to 1.77 tCO2 and 0.53 tCO2, respectively, an increase of 306% and 235%. The reasons for these differences and the sets of policies required to rectify increasing emissions are discussed. If current trends and practices continue, with a RMB1000 increase in per capita income from 2011 levels, per person HCEs in urban and rural China will increase by 0.119 tCO2 and 0.197 tCO2, respectively. This result indicates that the sector of society which is most vulnerable will contribute most to China’s increasing HCEs. Therefore, while developing energy consumption and emissions reduction policies and programs, principles of fairness and equity need to be followed.

  4. Global air-sea surface carbon dioxide transfer velocity and flux estimated using 17 a altimeter data and a new algorithm

    Institute of Scientific and Technical Information of China (English)

    YU Tan; HE Yijun; YAN Xiaohai

    2013-01-01

    The global distributions of the air-sea CO2 transfer velocity and flux are retrieved from TOPEX/Poseidon and Jason altimeter data from October 1992 to December 2009 using a combined algorithm. The 17 a average global, area-weighted, Schmidt number-corrected mean gas transfer velocity is 21.26 cm/h, and the full exploration of the uncertainty of this estimate awaits further data. The average total CO2 flux (calculated by carbon) from atmosphere to ocean during the 17 a was 2.58 Pg/a. The highest transfer velocity is in the circumpolar current area, because of constant high wind speeds and currents there. This results in strong CO2 fluxes. CO2 fluxes are strong but opposite direction in the equatorial east Pacific Ocean, because the air-sea CO2 partial pressure difference is the largest in the global oceans. The results differ from the previous studies calculated using the wind speed. It is demonstrated that the air-sea transfer velocity is very important for estimating air-sea CO2 flux. It is critical to have an accurate estimation for improving calculation of CO2 flux within climate change studies.

  5. Fine particles and carbon monoxide from wood burning in 17th-19th century Danish kitchens: Measurements at two reconstructed farm houses at the Lejre Historical-Archaeological Experimental Center

    DEFF Research Database (Denmark)

    Ryhl-Svendsen, Morten; Clausen, Geo; Chowdhury, Z.;

    2010-01-01

    Carbon monoxide (CO) and particulate matter (PM2.5) were measured in two reconstructed Danish farmhouses (17-19th century) during two weeks of summer. During the first week intensive measurements were performed while test cooking fires were burned, during the second week the houses were monitored...

  6. Aptamer-based electrochemical assay of 17β-estradiol using a glassy carbon electrode modified with copper sulfide nanosheets and gold nanoparticles, and applying enzyme-based signal amplification

    International Nuclear Information System (INIS)

    We have developed an electrochemical method for the determination of 17β-estradiol. A glassy carbon electrode was modified with a composite made from copper sulfide nanosheets, gold nanoparticles, and glucose oxidase. The copper sulfide nanosheet was prepared by a single-step hydrothermal process, and its properties were characterized by X-ray powder diffraction, X-ray photoelectron spectroscopy, scanning electron microscopy and transmission electron microscopy. Finally, an estradiol-specific aptamer was assembled on the electrode. The copper sulfide nanosheet on the electrode surface acts as a relatively good electrical conductor. Glucose oxidase acts as an indicator, and the dual modification of glucose oxidase and gold nanoparticles for signal amplification. The determination of 17β-estradiol was performed by differential pulse voltammetry of glucose oxidase because the signal measured at typically −0.43 V depends on the concentration of 17β-estradiol because addition of 17β-estradiol at electrode hinders electron transfer. A linear relationship exists between the peak current and the logarithm of concentration of 17β-estradiol in the 0.5 pM to 5 nM range, with a 60 f. detection limit (at 3σ/S). The method displays good selectivity over bisphenol A, 1-aminoanthraquinone and naphthalene even if present in 100-fold concentrations. (author)

  7. 47 CFR 17.17 - Existing structures.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Existing structures. 17.17 Section 17.17... STRUCTURES Federal Aviation Administration Notification Criteria § 17.17 Existing structures. (a) The requirements found in § 17.23 relating to painting and lighting of antenna structures shall not apply to...

  8. Carbonates-based noble metal-free lean NOx trap catalysts MOx-K2CO3/K2Ti8O17 (M = Ce, Fe, Cu, Co) with superior catalytic performance

    Science.gov (United States)

    Zhang, Yuxia; You, Rui; Liu, Dongsheng; Liu, Cheng; Li, Xingang; Tian, Ye; Jiang, Zheng; Zhang, Shuo; Huang, Yuying; Zha, Yuqing; Meng, Ming

    2015-12-01

    A series of base metal-based lean NOx trap (LNT) catalysts MOx-K2CO3/K2Ti8O17 (M = Ce, Fe, Cu, Co) were synthesized by successive impregnations and employed for the storage and reduction of NOx in the emissions of lean-burn engines at 350 °C. The XRD and XANES/EXAFS results reveal that the active phases in the corresponding catalysts exist as CeO2, Fe2O3, CuO and Co3O4, respectively. Among all the catalysts, CoOx-K2CO3/K2Ti8O17 exhibits the best performance, which cannot only trap the NOx quickly and completely at lean condition, giving the highest storage capacity (3.32 mmol/g) reported so far, but also reduce the NOx at rich condition, showing a NOx reduction percentage as high as 99.0%. Meanwhile, this catalyst displays an ultralow NOx to N2O selectivity (0.3%) during NOx reduction. The excellent performance of CoOx-K2CO3/K2Ti8O17 results from its largest amount of surface active oxygen species as revealed by XPS, O2-TPD and NO-TPD. HRTEM, FT-IR and CO2-TPD results illustrate that several kinds of K species such as sbnd OK groups, K2O, surface carbonates and bulk or bulk-like carbonates coexist in the catalysts. Based upon the in situ DRIFTS results, the participation of K2CO3 in NOx storage is confirmed, and the predominant NOx storage species is revealed as bidentate nitrites formed via multiple kinetic pathways. The low cost and high catalytic performance of the CoOx-based LNT catalyst make it most promising for the substitution of noble metal-based LNT catalysts.

  9. β-alumina-14H and β-alumina-21R: Two chromic Na2-δ(Al,Mg,Cr)17O25 polysomes observed in slags from the production of low-carbon ferrochromium

    Science.gov (United States)

    Hejny, Clivia; Kahlenberg, Volker; Schmidmair, Daniela; Tribus, Martina; deVilliers, Johan

    2016-09-01

    The crystal structures of unknown phases found in slags from the production of low-carbon ferrochromium were studied by powder and single-crystal X-ray diffraction. Two phases of Na2-δ(Al, Mg, Cr)17O25 composition were found to be composed of an alternating stacking of a spinel-type and a Na-hosting block. Similar structures are known for β-alumina and β"-alumina, NaAl11O17. However, the spinel-type block in Na2-δ(Al, Mg, Cr)17O25 is composed of five cation layers in contrast to three cation layers in the β-alumina spinel-block. The two new phases, β-alumina-14H, P63/mmc, a=5.6467(2), c=31.9111(12) Å, and β-alumina-21R, R 3 ̅m, a=5.6515(3), c=48.068(3) Å have a 14-layer and 21-layer stacking with a 2 × (cccccch) and a 3 × (ccccccc) repeat sequence of oxygen layers in cubic and hexagonal close packing, respectively.

  10. Big deformation in 17C

    International Nuclear Information System (INIS)

    Reaction and interaction cross sections of 17C on a carbon target have been re-analyzed using the modified Glauber model. The analysis with a deformed Woods-Saxon density/potential suggests a big deformation structure for 17C. The existence of a tail in the density distribution supports the possibility of it being a one-neutron halo structure. Under a deformed core plus a single-particle assumption, analysis shows a dominant d-wave of the valence neutron in 17C. (authors)

  11. Irradiation effects on 17-7 PH stainless steel, A-201 carbon steel, and titanium-6-percent-aluminum-4-percent-vanadium alloy

    Science.gov (United States)

    Hasse, R. A.; Hartley, C. B.

    1972-01-01

    Irradiation effects on three materials from the NASA Plum Brook Reactor Surveillance Program were determined. An increase of 105 K in the nil-ductility temperature for A-201 steel was observed at a fluence of approximately 3.1 x 10 to the 18th power neutrons/sq cm (neutron energy E sub n greater than 1.0 MeV). Only minor changes in the mechanical properties of 17-7 PH stainless steel were observed up to a fluence of 2 x 10 to the 21st power neutrons/sq cm (E sub n greater than 1.0 MeV). The titanium-6-percent-aluminum-4-percent-vanadium alloy maintained its notch toughness up to a fluence of 1 x 10 to the 21st power neutrons/sq cm (E sub n greater than 1.0 MeV).

  12. Enhancement of superconducting Tc (33 K) by entrapment of FeSe in carbon coated Au-Pd17Se15 nanoparticles.

    Science.gov (United States)

    Mishra, Sukhada; Song, Kai; Ghosh, Kartik C; Nath, Manashi

    2014-03-25

    FeSe has been an interesting member of the Fe-based superconductor family ever since the discovery of superconductivity in this simple binary chalcogenide. Simplicity of composition and ease of synthesis has made FeSe, in particular, very lucrative as a test system to understand the unconventional nature of superconductivity, especially in low-dimensional models. In this article we report the synthesis of composite nanoparticles containing FeSe nanoislands entrapped within an ent-FeSe-Pd16Se15-Au nanoparticle and sharing an interface with Pd17Se15. This assembly exhibits a significant enhancement in the superconducting Tc (onset at 33 K) accompanied by a noticeable lattice compression of FeSe along the and directions. The Tc in FeSe is very sensitive to application of pressure and it has been shown that with increasing external pressure Tc can be increased almost 4-fold. In these composite nanoparticles reported here, immobilization of FeSe on the Pd17Se15 surface contributes to increasing the effect of interfacial pressure, thereby enhancing the Tc. The effect of interfacial pressure is also manifested in the contraction of the FeSe lattice (up to 3.8% in direction) as observed through extensive high-resolution TEM imaging. The confined FeSe in these nanoparticles occupied a region of approximately 15-25 nm, where lattice compression was uniform over the entire FeSe region, thereby maximizing its effect in enhancing the Tc. The nanoparticles have been synthesized by a simple catalyst-aided vapor transport reaction at 800 °C where iron acetylacetonate and Se were used as precursors. Morphology and composition of these nanoparticles have been studied in details through extensive electron microscopy. PMID:24494773

  13. Carbon dioxide, hydrographic, and chemical data obtained in the Central South Pacific Ocean (WOCE sections P17S and P16S) during the tunes-2-expedition of the R/V Thomas Washington, July--August 1991

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-12-31

    This data documentation discusses the procedures and methods used to measure total carbon dioxide (TCO{sub 2}), discrete partial pressure of TCO{sub 2} (pCO{sub 2}), and total alkalinity (TALK), during the Research Vessel (R/V) Thomas Washington TUNES Leg 2 Expedition in the central South Pacific Ocean. Conducted as part of the World Ocean Circulation Experiment (WOCE), the cruise began in Papeete, Tahiti, French Polynesia, on July 16, 1991, and returned to Papeete on August 25, 1991. WOCE Meridional Sections P17S along 135{degrees} W and P16S along 150{degrees} W were completed during the 40-day expedition. A total of 97 hydrographic stations were occupied. Hydrographic and chemical measurements made along WOCE Sections P17S and P16S included pressure, temperature, salinity, and oxygen measured by conductivity, temperature and depth sensor; bottle salinity; oxygen; phosphate; nitrate; nitrite; silicate; CFC-12; CFC- 11; TCO{sub 2}; TALK; and pCO{sub 2} measured at 20{degrees}C. The TCO{sub 2} concentration in 1000 seawater samples was determined with a coulometric analysis system, the pCO{sub 2} in 940 water samples was determined with an equilibrator/gas chromatograph system, while the TALK concentration in 139 samples was determined on shore at the laboratory of C. Goyet of Woods Hole Oceanographic Institution with an alkalinity titration system. In addition, 156 coulometric measurements for the Certified Reference Material (Batch {number_sign}6) were made and yielded a mean value of 2303.2 {plus_minus} 1.5 {mu}mol/kg. This mean value agrees within a standard deviation of the 2304.6 {plus_minus} 1.6 {mu}mol/kg (N=9) value determined with the manometer of C. D. Keeling at Scripps Institution of Oceanography (SIO). Replicate samples from 11 Niskin bottles at 4 stations were also collected for later shore-based reference analyses of TCO{sub 2} and TALK by vacuum extraction and manometry in the laboratory of C. D. Keeling of SIO.

  14. Cyclostratigraphy and eccentricity tuning of the early Oligocene through early Miocene (30.1-17.1 Ma): Cibicides mundulus stable oxygen and carbon isotope records from Walvis Ridge Site 1264

    Science.gov (United States)

    Liebrand, Diederik; Beddow, Helen M.; Lourens, Lucas J.; Pälike, Heiko; Raffi, Isabella; Bohaty, Steven M.; Hilgen, Frederik J.; Saes, Mischa J. M.; Wilson, Paul A.; van Dijk, Arnold E.; Hodell, David A.; Kroon, Dick; Huck, Claire E.; Batenburg, Sietske J.

    2016-09-01

    Few astronomically calibrated high-resolution (≤5 kyr) climate records exist that span the Oligocene-Miocene time interval. Notably, available proxy records show responses varying in amplitude at frequencies related to astronomical forcing, and the main pacemakers of global change on astronomical time-scales remain debated. Here we present newly generated X-ray fluorescence core scanning and benthic foraminiferal stable oxygen and carbon isotope records from Ocean Drilling Program Site 1264 (Walvis Ridge, southeastern Atlantic Ocean). Complemented by data from nearby Site 1265, the Site 1264 benthic stable isotope records span a continuous ∼13-Myr interval of the Oligo-Miocene (30.1-17.1 Ma) at high resolution (∼3.0 kyr). Spectral analyses in the stratigraphic depth domain indicate that the largest amplitude variability of all proxy records is associated with periods of ∼ 3.4 m and ∼ 0.9 m, which correspond to 405- and ∼110-kyr eccentricity, using a magnetobiostratigraphic age model. Maxima in CaCO3 content, δ18O and δ13C are interpreted to coincide with ∼110 kyr eccentricity minima. The strong expression of these cycles in combination with the weakness of the precession- and obliquity-related signals allow construction of an astronomical age model that is solely based on tuning the CaCO3 content to the nominal (La2011_ecc3L) eccentricity solution. Very long-period eccentricity maxima (∼2.4-Myr) are marked by recurrent episodes of high-amplitude ∼110-kyr δ18O cycles at Walvis Ridge, indicating greater sensitivity of the climate/cryosphere system to short eccentricity modulation of climatic precession. In contrast, the responses of the global (high-latitude) climate system, cryosphere, and carbon cycle to the 405-kyr cycle, as expressed in benthic δ18O and especially δ13C signals, are more pronounced during ∼2.4-Myr minima. The relationship between the recurrent episodes of high-amplitude ∼110-kyr δ18O cycles and the ∼1.2-Myr amplitude

  15. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 (NODC Accession 0084099)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0084099 includes time series data collected from MOORINGS in the North Pacific Ocean from 2010-01-17 to 2013-03-18 and retrieved during cruise...

  16. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from Surface underway observations using Carbon dioxide (CO2) gas analyzer, Shower head chamber equilibrator for autonomous carbon dioxide (CO2) measurement and other instruments from ATLANTIS in the Caribbean Sea and North Atlantic Ocean from 2012-03-24 to 2012-04-17 (NCEI Accession 0144247)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0144247 includes Surface underway data collected from ATLANTIS in the Caribbean Sea and North Atlantic Ocean from 2012-03-24 to 2012-04-17. These...

  17. Reference: GRAZMRAB17 [PLACE

    Lifescience Database Archive (English)

    Full Text Available GRAZMRAB17 Busk PK, Jensen AB, Pages M Regulatory elements in vivo in the promoter ...of the abscisic acid responsive gene rab17 from maize. Plant J 11:1258-1295 (1997) PubMed: 9225468; ...

  18. Chemical and biological data collected as part of the CArbon Retention In A Colored Ocean (CARIACO) program in the Cariaco Basin off the coast of Venezuela, January 17, 2005 - January 16, 2006 (NODC Accession 0013170)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and biological data were collected using bottle casts on the continental shelf of Venezuela from the HERMANO GINES from January 17, 2005 to January 16,...

  19. Dissolved Inorganic Carbon, Alkalinity, pH, temperature, salinity, and other variables collected from profile observations using CTD, discrete bottles, and other instruments from February 12, 1985 to June 17, 2009, as synthesized in the Pacific Ocean Interior Carbon (PACIFICA) Database (NODC Accession 0110865)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — PACIFICA Data Synthesis Project PACIFICA (PACIFic ocean Interior CArbon) was an international collaborative project for the data synthesis of ocean interior carbon...

  20. Contribution to analysis of fatigue crack propagation at room temperature in low carbon austenitic steels type 18-10(304L) and Mo 17-12(316L). Relation between macroscopic and microscopic phenomena

    International Nuclear Information System (INIS)

    Low cycle fatigue phenomenon on the structural components of reactors is one of the most important problem. In this paper were carried out some fatigue tests on stainless steels type Z2CN18-10 (AISI 304L) and Z2CND17-12 (AISI 316L) at room temperature in air and in a corrosive medium (NaCl solution at different pH values). Length of cracks and crack propagation under stresses were determined. Z2CND17-12 has a better behavior than Z2CN18-10 because of a better structural stability both in air and in a corrosive environment. Structure was examined by transmission electron microscopy and microhardness was measured in the perturbed zones

  1. Investigation of carbon dioxide in the central South Pacific Ocean (WOCE Sections P-16C and P-17C) during the TUNES/2 expedition of the R/V Thomas Washington, July--August, 1991. Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, T.; Goddard, J.G.; Rubin, S.; Chipman, D.W.; Sutherland, S.C.

    1993-12-01

    This report summarizes the results of carbon dioxide and associated hydrographic measurements made during the oceanographic expedition, TUNES/2, aboard the R/V Thomas Washington in the central South Pacific Ocean. During the 40 day expedition, the total carbon dioxide concentration in 1000 seawater samples were determined using a coulometer system and the pCO(sub 2) in 940 seawater samples were determined using an equilibrator/gas chromatograph system. The alkalinity values in 900 water samples were computed using these measurements. In addition, 156 coulometric measurements were made for the Certified Reference Solutions (Batch No. 6) and yielded a mean value of 2303.2 +or- 1.5umol/kg. The chemical characteristics for the major water masses have been determined.

  2. Reflectometry on D17

    Energy Technology Data Exchange (ETDEWEB)

    Cubitt, R. [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France)

    1997-04-01

    As part of the package of instrument upgrades planned over the next few years, D17 is based on a straightened cold neutron-guide and converted into a dedicated and versatile reflectometer. In the meantime, in order for ILL to become as fully involved as possible in this growing area of activity, the current D17 has been optimised for reflectometry. Results of this project are presented. (author).

  3. Triple-ionised carbon associated with the low-density neutral hydrogen gas at 1.7 < z < 3.3: the integrated N(HI)-N(CIV) relation

    OpenAIRE

    Kim, Tae-Sun; Carswell, R. F.; Mongardi, C.; Partl, A. M.; Muecket, J. P.; P. Barai; Criatiani, S.

    2016-01-01

    From the Voigt profile fitting analysis of 183 intervening CIV systems at 1.7 < z < 3.3 in 23 high-quality UVES/VLT and HIRES/Keck QSO spectra, we find that a majority of CIV systems (~75%) display a well-characterised scaling relation between integrated column densities of HI and CIV with a negligible redshift evolution, when column densities of all the HI and CIV components are integrated within a given (-150, +150) km/sec range centred at the CIV flux minimum. The integrated CIV column den...

  4. Triple-ionised carbon associated with the low-density neutral hydrogen gas at 1.7 < z < 3.3: the integrated N(HI)-N(CIV) relation

    CERN Document Server

    Kim, Tae-Sun; Mongardi, C; Partl, A M; Muecket, J P; Barai, P; Criatiani, S

    2016-01-01

    From the Voigt profile fitting analysis of 183 intervening CIV systems at 1.7 16, with a large scatter: at log N(HI, sys) = 14--22, log N(CIV, sys) = C1 / (log(NHI, sys) + C2) + C3, with C1 = -1.90+0.55, C2 = -14.11+0.19 and C3 = 14.76+0.17, respectively. The steep (flat) part is dominated by SiIV-free (SiIV-enriched) CIV systems. Extrapolating the N(HI, sys)-N(CIV, sys) relation implies that most absorbers with log N(HI) < 14 are virtually CIV-free. The N(HI, sys)-N(CIV, sys) relation does not hold for individual components, clumps or the integration velocity range less than +-100 km/sec. It is expected if the line-of-sight extent of CIV is smaller than HI and N(CIV, sys) decreases more rapidly than N(HI, sys) at the larger impact parameter, regardless of the location of the HI+CIV gas in the IGM filaments or in the intervening galactic halos.

  5. Measurements of the nucleon structure function in the range 0.002 < x < 0.17 and 00.2 < Q2 < 8 GeV2 in deuterium, carbon and calcium

    Science.gov (United States)

    European Muon Collaboration; Arneodo, M.; Arvidson, A.; Aubert, J. J.; Badelek, B.; Beaufays, J.; Bee, C. P.; Benchouk, C.; Berghoff, G.; Bird, I. G.; Blum, D.; Böhm, E.; de Bouard, X.; Brasse, F. W.; Braun, H.; Broll, C.; Brown, S. C.; Brück, H.; Calén, H.; Chima, J. S.; Ciborowski, J.; Clifft, R.; Coignet, G.; Combley, F.; Coughlan, J.; d'Agostini, G.; Dahlgren, S.; Derado, I.; Dreyer, T.; Drees, J.; Düren, M.; Eckardt, V.; Edwards, A.; Edwards, M.; Ernst, T.; Eszes, G.; Favier, J.; Ferrero, M. I.; Figiel, J.; Flauger, W.; Foster, J.; Gabathuler, E.; Gajewski, J.; Gamet, R.; Geddes, N.; Grafström, P.; Gustafsson, L.; Haas, J.; Hagberg, E.; Hasert, F. J.; Hayman, P.; Heusse, P.; Jaffre, M.; Jacholkowska, A.; Janata, F.; Jancso, G.; Johnson, A. S.; Kabuss, E. M.; Kellner, G.; Krüger, A.; Krüger, J.; Kullander, S.; Landgraf, U.; Lanske, D.; Loken, J.; Long, K.; Maire, M.; Malecki, P.; Manz, A.; Maselli, S.; Mohr, W.; Montanet, F.; Montgomery, H. E.; Nagy, E.; Nassalski, J.; Norton, P. R.; Oakham, F. G.; Osborne, A. M.; Pascaud, C.; Pawlik, B.; Payre, P.; Peroni, C.; Peschel, H.; Pessard, H.; Pettingale, J.; Pietrzyk, B.; Poensgen, B.; Pötsch, M.; Renton, P.; Ribarics, P.; Rith, K.; Rondio, E.; Sandacz, A.; Scheer, M.; Schlagböhmer, A.; Schiemann, H.; Schmitz, N.; Schneegans, M.; Scholz, M.; Schouten, M.; Schröder, T.; Schultze, K.; Sloan, T.; Stier, H. E.; Studt, M.; Taylor, G. N.; Thenard, J. M.; Thompson, J. C.; de la Torre, A.; Toth, J.; Urban, L.; Urban, L.; Wallucks, W.; Whalley, M.; Wheeler, S.; Williams, W. S. C.; Wimpenny, S. J.; Windmolders, R.; Wolf, G.

    1990-03-01

    Small angle scattering of 280 GeV positive muons by deuterium, carbon and calcium has been measured at scattering angles down to 2 mrad. The nucleon structure function F2 extracted from deuterium does not show a significant x dependence in the measured range of Q2 and its Q2 dependence is linear in logQ2. For calcium, a depletion of F2 is observed at low x by 30% as compared with the values at x = 0.1 where F2(Ca) and F2 (D) are not significantly different. This depletion is attributed to shadowing. The carbon structure function exhibits a similar, but less pronounced, x dependence. Such behaviour is observed to be independent of Q2. The data are consistent with those obtained from other charged lepton experiments both at similar and higher values of x and Q2 and considerably extend the range of the measurements down to the low values of x to be measured in forthcoming experiments at HERA.

  6. Carbon Carbon Composites: An Overview .

    OpenAIRE

    G. Rohini Devi; K. Rama Rao

    1993-01-01

    Carbon carbon composites are a new class of engineering materials that are ceramic in nature but exhibit brittle to pseudoplastic behaviour. Carbon-carbon is a unique all-carbon composite with carbon fibre embeded in carbon matrix and is known as an inverse composite. Due to their excellent thermo-structural properties, carbon-carbon composites are used in specialised application like re-entry nose-tips, leading edges, rocket nozzles, and aircraft brake discs apart from several indust...

  7. Triple-ionized carbon associated with the low-density neutral hydrogen gas at 1.7 < z < 3.3: the integrated N H I-N C IV relation

    Science.gov (United States)

    Kim, T.-S.; Carswell, R. F.; Mongardi, C.; Partl, A. M.; Mücket, J. P.; Barai, P.; Cristiani, S.

    2016-04-01

    From the Voigt profile fitting analysis of 183 intervening {C IV} systems at 1.7 components are integrated within a given ±150 km s-1 range centred at the {C IV} flux minimum. The integrated {C IV} column density N_{C IV,sys} increases with N_{H I,sys} at log N_{H I,sys} in [14, {{16}}] and log N_{C IV,sys} in [11.8, 14.0], then becomes almost independent of N_{H I,sys} at log N_{H I,sys} ≥ {{16}}, with a large scatter: at log N_{H I,sys} in [14, 22], log {N_{C IV,sys}} = [C1/log {N_{H I,sys}} + C2} ] + C3, with C1 = -1.90 ± 0.55, C2 = -14.11 ± 0.19 and C3 = 14.76 ± 0.17, respectively. The steep (flat) part is dominated by {Si IV}-free ({Si IV}-enriched) {C IV} systems. Extrapolating the N_{H I,sys}-N_{C IV,sys} relation implies that most absorbers with log N_{H I} ≤ 14 are virtually {C IV}-free. The N_{H I,sys}-N_{C IV,sys} relation does not hold for individual components, clumps or the integrated velocity range less than ±100 km s-1. This is expected if the line-of-sight extent of {C IV} is smaller than {H I} and N_{C IV,sys} decreases more rapidly than N_{H I,sys} at the larger impact parameter, regardless of the location of the {H I}+{C IV} gas in intergalactic medium filaments or in intervening galactic haloes.

  8. Main: GRAZMRAB17 [PLACE

    Lifescience Database Archive (English)

    Full Text Available GRAZMRAB17 S000150 29-Sep-1999 (last modified) kehi GRA; GC-rich rab activator; Found in the pro ... from maize (Z.m.); Important for transcription in leaves ... but not in embryos; See S000200, S000401 and S0004 ...

  9. 17 CFR 240.17g-5 - Conflicts of interest.

    Science.gov (United States)

    2010-04-01

    ... money market instruments for which it accesses information pursuant to 17 CFR 240.17g-5(a)(3)(iii), if... market instruments; or (B) Has not accessed information pursuant to 17 CFR 240.17g-5(a)(3) 10 or more... section relating to issuing or maintaining a credit rating for a security or money market...

  10. 14 CFR 17.17 - Initial protest procedures.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Initial protest procedures. 17.17 Section... RULES PROCEDURES FOR PROTESTS AND CONTRACTS DISPUTES Protests § 17.17 Initial protest procedures. (a) If, as part of a protest, the protester requests a suspension or delay of procurement, in whole or...

  11. Pengaruh Sumber Karbon dan Nitrogen Terhadap Pertumbuhan dan Pembentukan Spora Bacillus sp. Bk17

    OpenAIRE

    Rachmi

    2014-01-01

    Study of the effect of carbon and nitrogen sources on the growth and sporulation of Bacillus sp. BK17 has been conducted. Bacillus sp. BK17 was cultured in broth medium containing different carbon and nitrogen sources, and incubated for 6 days. The highest growth of Bacillus sp. BK17 was obtained on molasses-tryptone medium incubated during 3 days and the lowest growth obtained on whey-sodium nitrate. The highest spore formation was also obtained from molasses-tryptone mediu...

  12. 17. aprill : rahvusvaheline tuutorprojekt

    Index Scriptorium Estoniae

    2001-01-01

    17. apr. 2001 toimus esimene rahvusvaheline workshop "International Tutoring", eesmärk : koostöö arendamine välisülikoolidega tuutoritegevuse edendamisel ning kogemuste vahetamisel. Osalesid Eesti ülikoolide üliõpilased ja 45 Vantaa-Espoo polütehnikumi üliõpilast Soomest. Eestvedajateks TPÜ üliõpilasesinduse liikmed Katriina Vasarik, Kadri Kiigema ja Sulev Senkel

  13. Chernobyl, 17 after

    International Nuclear Information System (INIS)

    This information document takes stock on the Chernobyl accident effects, 17 years after the reactor accident. The domains concerned are: the Chernobyl power plant, the sanitary consequences of the accident in the most exposed countries, the Chernobyl environment and the polluted regions management, the Chernobyl accident consequences in France; Some data and technical sheets on the RBMK reactors and the international cooperation are also provided. (A.L.B.)

  14. Interleukin-17 in human inflammatory diseases

    OpenAIRE

    Shabgah, Arezoo Gowhari; Fattahi, Ebrahim; Shahneh, Fatemeh Zare

    2014-01-01

    Human Th17 pro-inflammatory cells are currently defined as cells that produce IL-17A and F, tumor necrosis factor (TNF)-α, IL-6, IL-21, IL-22 and IL-23. Recently discovered related molecules are forming a family of cytokines, the IL-17 family, IL-17A, IL-17B, IL-17C, IL-17D, IL-17E and IL-17F. The associated receptors for the IL-17 family identified are IL-17R, IL-17RH1, IL-17RL (receptor like), IL-17RD and IL-17RE. This review introduces the roles of IL-17 and Th17 cells in human autoimmune ...

  15. Coulomb and nuclear excitations of narrow resonances in 17Ne

    OpenAIRE

    Marganiec, J.; Wamers, F.; Aksouh, F.; Yu. Aksyutina; Álvarez-Pol, H.; Aumann, T.; Beceiro-Novo, S.; Bertulani, C. A.; Boretzky, K.; Borge, M. J. G.; Chartier, M.; Chatillon, A.; Chulkov, L. V.; Cortina-Gil, D.; Emling, H.

    2016-01-01

    New experimental data for dissociation of relativistic 17Ne projectiles incident on targets of lead, carbon, and polyethylene targets at GSI are presented. Special attention is paid to the excitation and decay of narrow resonant states in 17Ne. Distributions of internal energy in the O15+p+p three-body system have been determined together with angular and partial-energy correlations between the decay products in different energy regions. The analysis was done using existing experimental data ...

  16. 17 CFR 240.17Ad-3 - Limitations on expansion.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Limitations on expansion. 240.17Ad-3 Section 240.17Ad-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... expansion. (a) Any registered transfer agent which is required to file any notice pursuant to §...

  17. IL-17 promotes murine lupus.

    Science.gov (United States)

    Amarilyo, Gil; Lourenço, Elaine V; Shi, Fu-Dong; La Cava, Antonio

    2014-07-15

    The proinflammatory activity of IL-17-producing Th17 cells has been associated with the pathogenesis of several autoimmune diseases. In this article, we provide direct evidence for a role of IL-17 in the pathogenesis of systemic lupus erythematosus (SLE). The induction of SLE by pristane in IL-17-sufficient wild-type mice did not occur in IL-17-deficient mice, which were protected from development of lupus autoantibodies and glomerulonephritis. The protection from SLE in IL-17-deficient mice was associated with a reduced frequency of CD3(+)CD4(-)CD8(-) double-negative T cells and an expansion of CD4(+) regulatory T cells, and did not depend on Stat-1 signaling. These data affirm the key role of IL-17 in the pathogenesis of SLE and strengthen the support for IL-17 blockade in the therapy of SLE. PMID:24920843

  18. Coulomb and nuclear excitations of narrow resonances in 17Ne

    Directory of Open Access Journals (Sweden)

    J. Marganiec

    2016-08-01

    Full Text Available New experimental data for dissociation of relativistic 17Ne projectiles incident on targets of lead, carbon, and polyethylene targets at GSI are presented. Special attention is paid to the excitation and decay of narrow resonant states in 17Ne. Distributions of internal energy in the O15+p+p three-body system have been determined together with angular and partial-energy correlations between the decay products in different energy regions. The analysis was done using existing experimental data on 17Ne and its mirror nucleus 17N. The isobaric multiplet mass equation is used for assignment of observed resonances and their spins and parities. A combination of data from the heavy and light targets yielded cross sections and transition probabilities for the Coulomb excitations of the narrow resonant states. The resulting transition probabilities provide information relevant for a better understanding of the 17Ne structure.

  19. Coulomb and nuclear excitations of narrow resonances in 17Ne

    Science.gov (United States)

    Marganiec, J.; Wamers, F.; Aksouh, F.; Aksyutina, Yu.; Álvarez-Pol, H.; Aumann, T.; Beceiro-Novo, S.; Bertulani, C. A.; Boretzky, K.; Borge, M. J. G.; Chartier, M.; Chatillon, A.; Chulkov, L. V.; Cortina-Gil, D.; Emling, H.; Ershova, O.; Fraile, L. M.; Fynbo, H. O. U.; Galaviz, D.; Geissel, H.; Heil, M.; Hoffmann, D. H. H.; Hoffmann, J.; Johansson, H. T.; Jonson, B.; Karagiannis, C.; Kiselev, O. A.; Kratz, J. V.; Kulessa, R.; Kurz, N.; Langer, C.; Lantz, M.; Le Bleis, T.; Lemmon, R.; Litvinov, Yu. A.; Mahata, K.; Müntz, C.; Nilsson, T.; Nociforo, C.; Nyman, G.; Ott, W.; Panin, V.; Paschalis, S.; Perea, A.; Plag, R.; Reifarth, R.; Richter, A.; Rodriguez-Tajes, C.; Rossi, D.; Riisager, K.; Savran, D.; Schrieder, G.; Simon, H.; Stroth, J.; Sümmerer, K.; Tengblad, O.; Typel, S.; Weick, H.; Wiescher, M.; Wimmer, C.

    2016-08-01

    New experimental data for dissociation of relativistic 17Ne projectiles incident on targets of lead, carbon, and polyethylene targets at GSI are presented. Special attention is paid to the excitation and decay of narrow resonant states in 17Ne. Distributions of internal energy in the 15O + p + p three-body system have been determined together with angular and partial-energy correlations between the decay products in different energy regions. The analysis was done using existing experimental data on 17Ne and its mirror nucleus 17N. The isobaric multiplet mass equation is used for assignment of observed resonances and their spins and parities. A combination of data from the heavy and light targets yielded cross sections and transition probabilities for the Coulomb excitations of the narrow resonant states. The resulting transition probabilities provide information relevant for a better understanding of the 17Ne structure.

  20. EUROTHERM Seminar No. 17

    CERN Document Server

    Lockwood, F; Taine, J

    1991-01-01

    This volume contains the selected papers presented at the EUROTHERM SEMINAR No. 17 - Heat Transfer in Radiating and Combusting Systems held at Cascais from October 8th- 10th, 1990. The EUROTHERM COMMITTEE was created by representatives of the member countries of the European Communities for the organization and coordination of European Scientific events in the field of thermal sciences and their applications. The book is focused on the integration of the heat transfer and combustion. These two subjects have traditionally been considered separate disciplines. In reality, the two are closely interwoven. The central purpose of the book is to generate an effective cross fertilisation of the two at both the fundamental and applied levels. The book reports on: mathematical simulations of heat transfer in reacting systems, new measurements of and measurement techniques for the radiation properties of the intervening medium, and data and theoretical analyses which clarify the physical nature of the complex interactio...

  1. Renewable and metal-free carbon nanofibre catalysts for carbon dioxide reduction

    Science.gov (United States)

    Kumar, Bijandra; Asadi, Mohammad; Pisasale, Davide; Sinha-Ray, Suman; Rosen, Brian A.; Haasch, Richard; Abiade, Jeremiah; Yarin, Alexander L.; Salehi-Khojin, Amin

    2013-12-01

    The development of an efficient catalyst system for the electrochemical reduction of carbon dioxide into energy-rich products is a major research topic. Here we report the catalytic ability of polyacrylonitrile-based heteroatomic carbon nanofibres for carbon dioxide reduction into carbon monoxide, via a metal-free, renewable and cost-effective route. The carbon nanofibre catalyst exhibits negligible overpotential (0.17 V) for carbon dioxide reduction and more than an order of magnitude higher current density compared with the silver catalyst under similar experimental conditions. The carbon dioxide reduction ability of carbon nanofibres is attributed to the reduced carbons rather than to electronegative nitrogen atoms. The superior performance is credited to the nanofibrillar structure and high binding energy of key intermediates to the carbon nanofibre surfaces. The finding may lead to a new generation of metal-free and non-precious catalysts with much greater efficiency than the existing noble metal catalysts.

  2. 48 CFR 6101.17 - Exhibits [Rule 17].

    Science.gov (United States)

    2010-10-01

    ... 6101.17 Federal Acquisition Regulations System CIVILIAN BOARD OF CONTRACT APPEALS, GENERAL SERVICES ADMINISTRATION CONTRACT DISPUTE CASES 6101.17 Exhibits . (a) Marking of exhibits. (1) Documents and other... electronically stored information or printed versions of electronically stored information to be included in...

  3. 17 CFR 240.14a-17 - Electronic shareholder forums.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Electronic shareholder forums... Securities Exchange Act of 1934 Regulation 14a: Solicitation of Proxies § 240.14a-17 Electronic shareholder forums. (a) A shareholder, registrant, or third party acting on behalf of a shareholder or registrant...

  4. ISS Expedition 17 Press Kit

    Data.gov (United States)

    National Aeronautics and Space Administration — Press kit for ISS mission Expedition 17 from 04/2008-10/2008. Press kits contain information about each mission overview, crew, mission timeline, benefits, and...

  5. Manufacturing of Nanocomposite Carbon Fibers and Composite Cylinders

    Science.gov (United States)

    Tan, Seng; Zhou, Jian-guo

    2013-01-01

    Pitch-based nanocomposite carbon fibers were prepared with various percentages of carbon nanofibers (CNFs), and the fibers were used for manufacturing composite structures. Experimental results show that these nanocomposite carbon fibers exhibit improved structural and electrical conductivity properties as compared to unreinforced carbon fibers. Composite panels fabricated from these nanocomposite carbon fibers and an epoxy system also show the same properties transformed from the fibers. Single-fiber testing per ASTM C1557 standard indicates that the nanocomposite carbon fiber has a tensile modulus of 110% higher, and a tensile strength 17.7% times higher, than the conventional carbon fiber manufactured from pitch. Also, the electrical resistance of the carbon fiber carbonized at 900 C was reduced from 4.8 to 2.2 ohm/cm. The manufacturing of the nanocomposite carbon fiber was based on an extrusion, non-solvent process. The precursor fibers were then carbonized and graphitized. The resultant fibers are continuous.

  6. Biodegradation of pyrazosulfuron-ethyl by Acinetobacter sp. CW17.

    Science.gov (United States)

    Wang, Yanhui; Du, Liangwei; Chen, Yingxi; Liu, Xiaoliang; Zhou, Xiaomao; Tan, Huihua; Bai, Lianyang; Zeng, Dongqiang

    2012-03-01

    The pyrazosulfuron-ethyl-degrading bacterium, designated as CW17, was isolated from contaminated soil near the warehouse of the factory producing pyrazosulfuron-ethyl in Changsha city, China. The strain CW17 was identified as Acinetobacter sp. based on analyses of 94 carbon source utilization or chemical sensitivity in Biolog microplates, conventional phenotypic characteristics, and 16S rRNA gene sequencing. When pyrazosulfuron-ethyl was provided as the sole carbon source, the effects of pyrazosulfuron-ethyl concentration, pH, and temperature on biodegradation were examined. The degradation rates of pyrazosulfuron-ethyl at initial concentrations of 5.0, 20.0, and 50.0 mg/L were 48.0%, 77.0%, and 32.6%, respectively, after inoculation for 7 days. The growth of the strain was inhibited at low pH buffers. The chemical degradation occurs much faster at low pH than at neutral and basic pH conditions. The degradation rate of pyrazosulfuron-ethyl at 30°C was faster than those at 20 and 37°C by CW17 strains. Two metabolites of degradation were analyzed by liquid chromatography-mass spectroscopy (LC/MS). Based on the identified products, strain CW17 seemed to be able to degrade pyrazosulfuron-ethyl by cleavage of the sulfonylurea bridge. PMID:22388979

  7. Electron scattering from 17O

    International Nuclear Information System (INIS)

    Cross sections for elastic and inelastic scattering of electrons from 17O have been measured for momentum transfers up to 1.2 fm-1. The elastic cross section indicates that the rms charge radii of 17O and 16O are equal to within a few parts in a thousand: 217>sup(1/2)/216>sub(1/2)=1.0015+-0.0025. Reduced transition probabilities and ground-state radiative widths are deduced for 17O excited states below 9 MeV. Various aspects of the inelastic spectrum are discussed, with emphasis on the 'single-particle' levels at 0.871 (1/2+) and 5.083 (3/2+) MeV, the levels at 7.569 (7/2-) and 7.378 (5/2+) MeV, and the spectrum of electric octupole excitations. (Auth.)

  8. Identification of genes involved in the sensitivity to antitumour drug 17-allylamino,17-demethoxygeldanamycin (17AAG).

    Science.gov (United States)

    Barresi, Vincenza; Fortuna, Cosimo G; Garozzo, Roberta; Musumarra, Giuseppe; Scirè, Salvatore; Condorelli, Daniele F

    2006-05-01

    In the present study we analysed the gene expression database provided by the National Cancer Institute in an attempt to correlate activity profiles of geldanamycin, 17AAG and 11 other analogues in 60 human tumor cell lines with their gene expression profiles determined by the cDNA microarray technique. On the basis of the activity profiles two classes of geldanamycin analogues could be distinguished, having geldanamycin and 17AAG, respectively, as prototype compounds (denominated as gelda-like and 17AAG-like classes). Application of the "soft" statistical methodology of PLS (partial least squares modelling in latent variables or projections to latent structures) allowed us to evaluate the influence of each gene expression target in determining the therapeutical responses. The transcript encoding the translocating chain-associated membrane protein (TRAM) showed a significant statistical correlation with activity profiles of 17AAG. In order to validate the role of TRAM in determining sensitivity to 17AAG we induced a selective knocking-down of this transcript by the RNA interference methodology in H226 non-small cell lung carcinoma cell line. The efficiency of double-stranded RNA oligonucleotides (short-interfering RNAs, siRNAs) was determined by measuring TRAM mRNA levels by quantitative real-time RT-PCR at different times (24-72 hours) after siRNA lipotransfection. A significant increase in chemosensitivity to 17AAG was observed in siRNA-silenced cells. Although a number of factors may affect tumour sensitivity to 17AAG the present methodology allowed us to dissect out a single parameter which may be partly responsible for its activity. PMID:16880941

  9. Porous carbons

    Indian Academy of Sciences (India)

    Satish M Manocha

    2003-02-01

    Carbon in dense as well as porous solid form is used in a variety of applications. Activated porous carbons are made through pyrolysis and activation of carbonaceous natural as well as synthetic precursors. Pyrolysed woods replicate the structure of original wood but as such possess very low surface areas and poor adsorption capacities. On activation, these exhibit increased adsorption volumes of 0.5–0.8 cm3 /gm and surface areas of 700–1800 m2 /gm depending on activation conditions, whether physical or chemical. Former carbons possess mixed pore size distribution while chemically activated carbons predominantly possess micropores. Thus, these carbons can be used for adsorption of wide distributions of molecules from gas to liquid. The molecular adsorption within the pores is due to single layer or multilayer molecule deposition at the pore walls and hence results in different types of adsorption isotherm. On the other hand, activated carbon fibres with controlled microporous structure and surface area in the range of 2500 m2 /gm can be developed by controlled pyrolysis and physical activation of amorphous carbon fibres. Active carbon fibres with unmatchable pore structure and surface characteristics are present and futuristic porous materials for a number of applications from pollution control to energy storage.

  10. 17DD yellow fever vaccine

    OpenAIRE

    Martins, Reinaldo M.; Maia, Maria de Lourdes S.; Farias, Roberto Henrique G.; Camacho, Luiz Antonio B.; Marcos S Freire; Galler, Ricardo; Yamamura, Anna Maya Yoshida; Almeida, Luiz Fernando C.; Lima, Sheila Maria B.; Rita Maria R. Nogueira; Sá, Gloria Regina S.; Hokama, Darcy A.; Carvalho, Ricardo; Freire, Ricardo Aguiar V.; Filho, Edson Pereira

    2013-01-01

    Objective: To verify if the Bio-Manguinhos 17DD yellow fever vaccine (17DD-YFV) used in lower doses is as immunogenic and safe as the current formulation. Results : Doses from 27,476 IU to 587 IU induced similar seroconversion rates and neutralizing antibodies geometric mean titers (GMTs). Immunity of those who seroconverted to YF was maintained for 10 mo. Reactogenicity was low for all groups. Methods : Young and healthy adult males (n = 900) were recruited and randomized into 6 groups, to r...

  11. Effects of Alloying Elements on Martensitic Transformation Behavior and Damping Capacity in Fe-17Mn Alloy

    OpenAIRE

    Baik, S.; Kim, J; Jee, K.; Jang, W.; Shin, M.

    1997-01-01

    Effect of carbon and Ti on γ ←→ εmartensitic transformation behavior and damping capacity has been investigated in an Fe-17Mn alloy. The suppressive force of carbon against γ ←→ ε transformation increases linearly with an increase in carbon content, lowering Ms temperature and volume fraction of ε martensite. Carbon deteriorates damping capacity by reducing the area of γ/ε interfaces and by decreasing the mobility of the interfaces operated as damping source. The reduction in the mobility of ...

  12. 49 CFR 229.17 - Accident reports.

    Science.gov (United States)

    2010-10-01

    ... CFR part 225. ... 49 Transportation 4 2010-10-01 2010-10-01 false Accident reports. 229.17 Section 229.17..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS General § 229.17 Accident reports. (a)...

  13. Kinetic Solvent Isotope Effect in Human P450 CYP17A1 Mediated Androgen Formation: Evidence for a Reactive Peroxoanion Intermediate

    OpenAIRE

    Gregory, Michael C.; Denisov, Ilia G.; Grinkova, Yelena V.; Khatri, Yogan; Sligar, Stephen G.

    2013-01-01

    Human steroid hormone biosynthesis is the result of a complex series of chemical transformations operating on cholesterol, with key steps mediated by members of the Cytochrome P450 superfamily. In the formation of the male hormone dehydroepiandrosterone, pregnenolone is first hydroxylated by P450 CYP17A1 at the 17-carbon followed a second round of catalysis by the same enzyme that cleaves C17–C20 carbon-carbon bond releasing acetic acid and the 17-keto product. In order to explore the mechani...

  14. New developments of carbon materials

    International Nuclear Information System (INIS)

    The 117th Committee on Carbon Materials in the Japan Society for the Promotion of Science (JSPS) started in March 1948. The committee will have 60th anniversary in March 2008. As memorial of this, the title publication was published for informing about new developments of carbon materials to many people. The publication is divided into 3 chapters. A theme of the 1st chapter is 'Synthesis' which includes 17 papers, a theme of the 2nd chapter is 'Analysis' which includes 11 papers, a theme of the 3rd chapter is Application' which includes 15 papers. The publication also includes historical review of the committee. (J.P.N.)

  15. Effect of 17 X 17 fuel assembly geometry on DNB

    International Nuclear Information System (INIS)

    A series of tests was run in which the DNB heat flux was determined in axially uniform heated rod bundles of both 17 x 17 (.374'' rod) and 14 x 14 (.422'' rod) reactor fuel assembly geometry. The purposes of this test series were (1) to assess the DNB performance of .374'' fuel rod assembly design, (2) to verify the present design DNB methods for .374'' rod geometry and (3) to obtain a body of data which will later be used to develop a new correlation. The comparison of the uniform to previously reported non-uniform axial heat flux DNB test results using the .422'' rod geometry showed that use of the non-uniform heat flux F-factor used with existing correlations brings the two sets into agreement. 10 references

  16. 21 CFR 862.1385 - 17-Hydroxycorticosteroids (17-ketogenic steroids) test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false 17-Hydroxycorticosteroids (17-ketogenic steroids... Clinical Chemistry Test Systems § 862.1385 17-Hydroxycorticosteroids (17-ketogenic steroids) test system. (a) Identification. A 17-hydroxycorticosteroids (17-ketogenic steroids) test system is a...

  17. Calcium Carbonate

    Science.gov (United States)

    ... before being swallowed; do not swallow them whole. Drink a full glass of water after taking either the regular or chewable tablets or capsules. Some liquid forms of calcium carbonate must be shaken well before use.Do not ...

  18. Carbon Stars

    Indian Academy of Sciences (India)

    T. Lloyd Evans

    2010-12-01

    In this paper, the present state of knowledge of the carbon stars is discussed. Particular attention is given to issues of classification, evolution, variability, populations in our own and other galaxies, and circumstellar material.

  19. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using Alkalinity titrator, CTD and other instruments from ATLANTIS in the Caribbean Sea and North Atlantic Ocean from 2012-03-24 to 2012-04-17 (NODC Accession 0109915)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0109915 includes discrete sample and profile data collected from ATLANTIS in the Caribbean Sea and North Atlantic Ocean from 2012-03-24 to 2012-04-17...

  20. Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the METEOR in the North Atlantic Ocean from 2001-07-17 to 2001-08-07 (NODC Accession 0113587)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113587 includes biological, chemical, discrete sample, physical and profile data collected from METEOR in the North Atlantic Ocean from 2001-07-17...

  1. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the TYRO in the North Atlantic Ocean from 1990-04-17 to 1990-05-31 (NODC Accession 0113605)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113605 includes chemical, discrete sample, physical and profile data collected from TYRO in the North Atlantic Ocean from 1990-04-17 to 1990-05-31...

  2. Dissolved inorganic carbon, total alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Niskin bottle, and other instruments from R/V Bell M. Shimada in the West Coast of the United States from 2012-09-04 to 2012-09-17 (NODC Accession 0123468)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This cruise represents the second dedicated West Coast Ocean Acidification cruise (WCOA2012), which took place September 4-17, 2012 aboard the NOAA Ship Bell M....

  3. Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the MARION DUFRESNE in the Indian Ocean from 2000-01-17 to 2000-01-27 (NODC Accession 0113575)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113575 includes biological, chemical, discrete sample, physical and profile data collected from MARION DUFRESNE in the Indian Ocean from 2000-01-17...

  4. Dissolved inorganic carbon, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the TANGAROA in the Indian Ocean from 2003-02-17 to 2003-03-12 (NODC Accession 0113599)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113599 includes biological, chemical, discrete sample, physical and profile data collected from TANGAROA in the Indian Ocean from 2003-02-17 to...

  5. Removal mechanisms of 17β-estradiol and 17α-ethinylestradiol in membrane bioreactors.

    Science.gov (United States)

    Yang, W; Zhou, H; Cicek, N

    2012-01-01

    The fate and behavior of natural and synthetic estrogens in wastewater treatment processes is currently of increasing concern all over the world. In this study, the removal mechanisms of a natural estrogen, 17β-estradiol (E2), and a synthetic estrogen, 17α-ethinylestradiol (EE2) were investigated in membrane bioreactors (MBRs) with and without powdered activated carbon (PAC) addition. The experimental results showed that the average removal rates of E2 and EE2 by the MBR without PAC addition were 89.0 and 70.9%; PAC addition in the MBR increased the removal rate of E2 and EE2 by 3.4 and 15.8%, respectively. The greater impact of PAC dosing on EE2 removal was due to its greater hydrophobic property. Adsorption played a more important role in the removal mechanisms of EE2 than E2. Biodegradation was the dominant mechanism for the removal of E2 and EE2 in MBRs. Unlike their adsorption behavior, the biodegradation rates of both E2 and EE2 were not significantly different between the MBRs with and without PAC addition. PMID:22828304

  6. Dissolved inorganic carbon, total alkalinity, pH, and other variables collected from profile and discrete observations using CTD, Niskin bottle, and other instruments from R/V Okeanos Explorer, off the east coast of Florida, United States from 2014-05-10 to 2014-05-17 (NCEI Accession 0131424)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archival package contains carbon and nutrient related data that were collected from CTD profile measurements off the east coast of Florida, United States...

  7. IL-17 Contributes to Autoimmune Hepatitis

    Institute of Scientific and Technical Information of China (English)

    余海静; 黄加权; 刘阳; 艾国; 严伟明; 王晓晶; 宁琴

    2010-01-01

    The role of interleukin-17 (IL-17) in autoimmune hepatitis (AIH) was investigated. A mouse model of experimental autoimmune hepatitis was established, and the syngeneic S-100 antigen emulsified in complete Freud's adjuvant was injected intraperitoneally into adult male C57BL/6 mice. The IL-17 expression in serum and the livers of the mice models was detected by using ELISA and immunohistochemistry, respectively. IL-17 neutralizing antibody was used to study the biological effect of IL-17 in the experimental...

  8. Interleukin-17 inhibits Adult Hippocampal Neurogenesis

    OpenAIRE

    Qiang LIU; Xin, Wei; He, Ping; Turner, Dharshaun; Yin, Junxiang; Gan, Yan; Shi, Fu-Dong; Wu, Jie

    2014-01-01

    Interleukin 17(A) (IL-17) is a potent pro-inflammatory cytokine that acts as a central regulator of inflammatory response within the brain, but its physiological roles under non-inflammatory conditions remain elusive. Here we report that endogenous IL-17 ablates neurogenesis in the adult dentate gyrus (DG) of hippocampus. Genetic deletion of IL-17 increased the number of adult-born neurons in the DG. Further, we found that IL-17 deletion altered cytokine network, facilitated basal excitatory ...

  9. Triple oxygen isotopes in biogenic and sedimentary carbonates

    Science.gov (United States)

    Passey, Benjamin H.; Hu, Huanting; Ji, Haoyuan; Montanari, Shaena; Li, Shuning; Henkes, Gregory A.; Levin, Naomi E.

    2014-09-01

    The 17O anomaly (Δ17O) of natural waters has been shown to be sensitive to evaporation in a way analogous to deuterium excess, with evaporated bodies of water (e.g., leaf waters, lake waters, animal body waters) tending to have lower Δ17O than primary meteoric waters. In animal body water, Δ17O relates to the intake of evaporated waters, evaporative effluxes of water, and the Δ17O value of atmospheric O2, which itself carries signatures of global carbon cycling and photochemical reactions in the stratosphere. Carbonates have the potential to record the triple oxygen isotope compositions of parent waters, allowing reconstruction of past water compositions, but such investigations have awaited development of methods for high-precision measurement of Δ17O of carbonate. We describe optimized methods based on a sequential acid digestion/reduction/fluorination approach that yield Δ17O data with the high precision (∼0.010‰, 1σ) needed to resolve subtle environmental signals. We report the first high-precision Δ17O dataset for terrestrial carbonates, focusing on vertebrate biogenic carbonates and soil carbonates, but also including marine invertebrates and high-temperature carbonates. We determine apparent three-isotope fractionation factors between the O2 analyte derived from carbonate and the parent waters of the carbonate. These in combination with appropriate temperature estimates (from clumped isotope thermometry, or known or estimated body temperatures) are used to calculate the δ18O and Δ17O of parent waters. The clearest pattern to emerge is the strong 17O-depletion in avian, dinosaurian, and mammalian body water (from analyses of eggshell and tooth enamel) relative to meteoric waters, following expected influences of evaporated water (e.g., leaf water) and atmospheric O2 on vertebrate body water. Parent waters of the soil carbonates studied here have Δ17O values that are similar to or slightly lower than global precipitation. Our results suggest

  10. Carbon particles

    Science.gov (United States)

    Hunt, Arlon J.

    1984-01-01

    A method and apparatus whereby small carbon particles are made by pyrolysis of a mixture of acetylene carried in argon. The mixture is injected through a nozzle into a heated tube. A small amount of air is added to the mixture. In order to prevent carbon build-up at the nozzle, the nozzle tip is externally cooled. The tube is also elongated sufficiently to assure efficient pyrolysis at the desired flow rates. A key feature of the method is that the acetylene and argon, for example, are premixed in a dilute ratio, and such mixture is injected while cool to minimize the agglomeration of the particles, which produces carbon particles with desired optical properties for use as a solar radiant heat absorber.

  11. 48 CFR 53.302-17 - Optional Form 17, Offer Label.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Optional Form 17, Offer Label. 53.302-17 Section 53.302-17 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Illustrations of Forms 53.302-17 Optional Form 17, Offer Label....

  12. Carbon classified?

    DEFF Research Database (Denmark)

    Lippert, Ingmar

    2012-01-01

    . Using an actor- network theory (ANT) framework, the aim is to investigate the actors who bring together the elements needed to classify their carbon emission sources and unpack the heterogeneous relations drawn on. Based on an ethnographic study of corporate agents of ecological modernisation over a...... corporations construing themselves as able and suitable to manage their emissions, and, additionally, given that the construction of carbon emissions has performative consequences, the underlying practices need to be declassified, i.e. opened for public scrutiny. Hence the paper concludes by arguing for a...

  13. MH17: the Malaysian experience.

    Science.gov (United States)

    Khoo, L S; Hasmi, A H; Abdul Ghani Aziz, S A; Ibrahim, M A; Mahmood, M S

    2016-04-01

    A disaster is a natural or man-made (or technological) hazard resulting in an event of substantial extent causing significant physical damage or destruction, loss of life, or drastic change to the environment. It is a phenomenon that can cause damage to life and property and destroy the economic, social and cultural life of the people; and overwhelms the capacity of the community to cope with the event. The recent tragic aviation accidents in 2014 involving Malaysia Airlines flights MH370 and MH17 shocked the world in an unprecedented manner. This paper focuses on the Malaysian experience in the MH17 mission in Ukraine as well as the first ever international Disaster Victim Identification (DVI) operation for the Malaysian DVI team. The DVI operations in Hilversum, the Netherlands were well described in stages. The Netherlands' Landelijk Team Forensische Opsporing as the lead DVI team in Hilversum operated systematically, ensuring the success of the whole mission. This paper discusses the lessons learned by the Malaysian team on proper DVI structure, inter- and intra-agency cooperation, facilities planning and set up, logistics and health and safety aspects, as well as effective communication and collaboration with other international delegates. Several issues and challenges faced by the Malaysian team were also documented. In addition, the authors shared views, opinions and recommendations for a more comprehensive DVI operation in the future. PMID:27126658

  14. The TOPSIS Evaluation on Carbon Emission Economic Efficiency

    Institute of Scientific and Technical Information of China (English)

    Sheng; XU; Chao; ZHANG; Juan; YANG

    2013-01-01

    Based on carbon emission data of 17 cities in Shandong Province in 2005-2009,this paper analyzes carbon emission economic efficiency. It conducts weight distribution by the Ordered Weighted Averaging ( OWA) method,and takes systematic evaluation on carbon emission economic efficiency using TOPSIS method. In eastern coastal regions,including Dongying,Yantai,Weihai and Qingdao,the carbon emission economic efficiency is generally higher than inland regions of Shandong Province. The conclusion reached after correction of time weight is basically consistent with traditional TOPSIS overall evaluation,further proves validity of the evaluation. Finally,it gives recommendations for improving carbon emission economic efficiency in Shandong Province.

  15. New carbon stars at a galactic longitude of 82 deg

    International Nuclear Information System (INIS)

    Objective prism infrared plates taken with the Schmidt telescope of the Radioastrophysical Observatory in a 4deg.5 wide and 25 deg long zero perpendicular to the galactic equator and centered on the galactic longitude l=82 deg were used for carbon stars search. 16 new carbon stars were found and one earlier suspected carbon star confirmed. Positions of the new carbon stars BC 256-BC 272 were measured on direct plates and their equatorial and galactic coordinates determined. 17 carbon stars are identified on finding charts

  16. Explorations of soil microbial processes driven by dissolved organic carbon

    NARCIS (Netherlands)

    Straathof, A.L.

    2015-01-01

    Explorations of soil microbial processes driven by dissolved organic carbon Angela L. Straathof June 17, 2015, Wageningen UR ISBN 978-94-6257-327-7 Abstract Dissolved organic carbon (DOC) is a complex, heterogeneous mixture of C compounds which, as

  17. Contributions for the seventeenth biennial conference on carbon

    International Nuclear Information System (INIS)

    This report is the compilation of the papers prepared by KFA Juelich GmbH for the 17th Biennial Conference on Carbon. In the contributions, results are presented which were obtained from the application of carbon in the High Temperature Gas-Cooled Reactor and for the Spallation Neutron Source planned in the Federal Republic of Germany. (orig.)

  18. 75 FR 60814 - Carbon Steel Butt-Weld Pipe Fittings From Brazil, China, Japan, Taiwan, and Thailand

    Science.gov (United States)

    2010-10-01

    ... Investigation No. F.R. cite 12/17/86 Carbon steel butt- 731-TA-308 51 FR 45152. weld pipe fittings/ Brazil. 12/17/86 Carbon steel butt- 731-TA-310 51 FR 45152. weld pipe fittings/ Taiwan. 2/10/87 Carbon steel butt- 731-TA-309 52 FR 4167. weld pipe fittings/ Japan. 7/6/92 Carbon steel butt- 731-TA-520 57...

  19. Silicate production and availability for mineral carbonation.

    Science.gov (United States)

    Renforth, P; Washbourne, C-L; Taylder, J; Manning, D A C

    2011-03-15

    Atmospheric carbon dioxide sequestered as carbonates through the accelerated weathering of silicate minerals is proposed as a climate change mitigation technology with the potential to capture billions of tonnes of carbon per year. Although these materials can be mined expressly for carbonation, they are also produced by human activities (cement, iron and steel making, coal combustion, etc.). Despite their potential, there is poor global accounting of silicates produced in this way. This paper presents production estimates (by proxy) of various silicate materials including aggregate and mine waste, cement kiln dust, construction and demolition waste, iron and steel slag, and fuel ash. Approximately 7-17 billion tonnes are produced globally each year with an approximate annual sequestration potential of 190-332 million tonnes C. These estimates provide justification for additional research to accurately quantify the contemporary production of silicate minerals and to determine the location and carbon capture potential of historic material accumulations. PMID:21332128

  20. 17 fake arguments against nuclear

    International Nuclear Information System (INIS)

    The author discusses or criticizes 17 statements usually made against nuclear energy: with its 75 per cent of electricity produced by nuclear stations, France is an exception (and is thus supposed to be wrong); nuclear is not democratic; nuclear can be replaced by renewable energies and energy savings; nuclear produces wastes nobody knows what to do with; wastes are active during hundreds thousands years; nuclear waste reprocessing is a nonsense which costs a lot; according to private criteria, nuclear cannot survive and can only survive with subsidies; nuclear is a very dangerous activity; Chernobyl is said to have killed thousands of people and has contaminated the environment for centuries; nuclear poisons populations with radiations; with nuclear reactors, the bomb is not far; electric heating is mismanagement; nuclear only allows the production of electricity; nuclear depends on a limited resource, uranium; nuclear is expensive; dismantling will cost a fortune

  1. The prevalence and distribution of Th17 and Tc17 cells in patients with thyroid tumor.

    Science.gov (United States)

    Jiang, Guoqin; Ma, Shoubao; Wei, Yan; Wu, Yan; Yu, Xiao; Liu, Haiyan

    2014-11-01

    Both Th17 and Tc17 cells have been found in various tumors and may play important roles in regulating anti-tumor immune responses. However, the prevalence and distribution of Th17 and Tc17 cells in thyroid tumors are still unclear. In the current study, we examined the percentages of Th17 and Tc17 cells in the peripheral blood of 31 thyroid adenoma and 11 thyroid carcinoma patients. The serum IL-17 levels were also examined and their associations with Th17 and Tc17 cells were evaluated. Moreover, the presence of Th17 cells was detected in both thyroid adenoma and carcinoma patients. Our results showed that compared with healthy individuals, patients with thyroid tumors had a higher proportion of Th17 and lower proportion of Tc17 cells in peripheral blood. The serum concentration of IL-17 was significantly increased in patients with thyroid tumors and it was correlated with the percent of Th17 cells. Furthermore, the number of Th17 cells was significantly increased in the tumors of the patients. Th17 and Tc17 cells were negatively correlated with the tumor size. There was no significant difference between thyroid adenoma and carcinoma patients. These results indicate that Th17 cells may contribute to thyroid tumor pathogenesis. PMID:25068436

  2. Chemical separation of carbon -14 in radwastes

    International Nuclear Information System (INIS)

    Carbon-14 has a long half-life of 5730 years and decays by beta emission of 156KeV to the stable nuclide, Nitrogen-14. Carbon-14 is produced mostly by the neutron activation of naturally occurring oxygen-17 in water molecules of the reactor coolant and Nitrogen-14 from nitrogen gas dissolved in the reactor coolant. Most of these carbon-14 are known to be discharged as gaseous wastes. The chemical forms of the gaseous emissions of carbon-14 from PWR stations range from 10∼26% as 14CO2 and 74∼90% as 14CH4 and other hydrocarbons, compared to about 95% as 14CO2 and 5% as 14CH4 and other hydrocarbons in BWR station gaseous emissions. Knowles reported that although the exact nature of these organic compounds was not identified, most of the carbon-14 was present as forms of organic species in a PWR primary coolant. Praudic measured the contents of the total organic and inorganic carbon-14 in waste trench leachates of New York commercial LLW disposal site and found that 74 ∼ 98% of carbon-14 was organic. In 1991, Dayal and Kirby reported that carbon-14 identified in LLW trench leachates from the Maxi Fiats site were carbonate and bicarbonate as inorganic carbon-14 and citric acid and palmitic acid as organic carbon-14. Thus concentrated Boric acid waste solutions(CB) which has generated from domestic NPP were classified into organic and inorganic carbon-14 with wet oxidation method in order to grasping a existing ratio of organic carbon-14 from total one due to affecting an environment

  3. Standardisation of gas mixtures for estimating carbon monoxide transfer factor.

    OpenAIRE

    Kendrick, A. H.; Laszlo, G.

    1993-01-01

    BACKGROUND--The American Thoracic Society recommends that the inspired concentration used for the estimation of carbon monoxide transfer factor (TLCO) mixture should be 0.25-0.35% carbon monoxide, 10-14% helium, 17-21% oxygen, balance nitrogen. Inspired oxygen influences alveolar oxygen and hence carbon monoxide uptake, such that transfer factor increases by 0.35% per mm Hg decrease in alveolar oxygen. To aid in the standardisation of TLCO either a known inspired oxygen concentration should b...

  4. 6 CFR 17.405 - Housing.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Housing. 17.405 Section 17.405 Domestic Security... Education Programs or Activities Prohibited § 17.405 Housing. (a) General. A recipient shall not, on the... different services or benefits related to housing, except as provided in this section (including...

  5. 7 CFR 982.17 - Marketing year.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Marketing year. 982.17 Section 982.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... WASHINGTON Order Regulating Handling Definitions § 982.17 Marketing year. Marketing year means the 12...

  6. 48 CFR 17.204 - Contracts.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contracts. 17.204 Section 17.204 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES SPECIAL CONTRACTING METHODS Options 17.204 Contracts. (a) The contract shall specify...

  7. 6 CFR 17.500 - Employment.

    Science.gov (United States)

    2010-01-01

    ... in Employment in Education Programs or Activities Prohibited § 17.500 Employment. (a) General. (1) No... Federal financial assistance. (2) A recipient shall make all employment decisions in any education program... 6 Domestic Security 1 2010-01-01 2010-01-01 false Employment. 17.500 Section 17.500...

  8. 43 CFR 10.17 - Dispute resolution.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Dispute resolution. 10.17 Section 10.17... REPATRIATION REGULATIONS General § 10.17 Dispute resolution. (a) Formal and informal resolutions. Any person... a fair resolution of the matter. The Review Committee may aid in this regard as described below....

  9. 9 CFR 352.17 - Transportation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Transportation. 352.17 Section 352.17 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY... CERTIFICATION EXOTIC ANIMALS AND HORSES; VOLUNTARY INSPECTION Exotic Animals § 352.17 Transportation. This...

  10. 36 CFR 261.17 - Recreation fees.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Recreation fees. 261.17 Section 261.17 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE PROHIBITIONS General Prohibitions § 261.17 Recreation fees. Failure to pay any recreation fee is...

  11. 43 CFR 17.270 - Recreation.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Recreation. 17.270 Section 17.270 Public... OF THE DEPARTMENT OF THE INTERIOR Nondiscrimination on the Basis of Handicap § 17.270 Recreation... operation of programs or activities involving recreation. (a) Accessibility in existing...

  12. 30 CFR 281.17 - Leasing notice.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Leasing notice. 281.17 Section 281.17 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE LEASING OF MINERALS OTHER THAN OIL, GAS, AND SULPHUR IN THE OUTER CONTINENTAL SHELF Leasing Procedures § 281.17 Leasing notice....

  13. 4 CFR 83.17 - Fees.

    Science.gov (United States)

    2010-01-01

    ... 4 Accounts 1 2010-01-01 2010-01-01 false Fees. 83.17 Section 83.17 Accounts GOVERNMENT ACCOUNTABILITY OFFICE RECORDS PRIVACY PROCEDURES FOR PERSONNEL RECORDS § 83.17 Fees. (a) Generally, GAO's policy... discretion may charge a fee when the cost for copying the record (at a rate of 20 cents per page) would be...

  14. 14 CFR 47.17 - Fees.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fees. 47.17 Section 47.17 Aeronautics and... General § 47.17 Fees. (a) The fees for applications under this part are as follows: (1) Certificate of... Certificate of Registration 2.00 (b) Each application must be accompanied by the proper fee, that may be...

  15. 24 CFR 320.17 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Fees. 320.17 Section 320.17 Housing... SECURITIES Pass-Through Type Securities § 320.17 Fees. The Association may impose application fees, guaranty fees, securities transfer fees and other fees....

  16. 7 CFR 905.17 - Production area.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Production area. 905.17 Section 905.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... TANGELOS GROWN IN FLORIDA Order Regulating Handling Definitions § 905.17 Production area. Production...

  17. 38 CFR 17.504 - Disclosure methods.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Disclosure methods. 17.504 Section 17.504 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Confidentiality of Healthcare Quality Assurance Review Records § 17.504 Disclosure methods. (a) Disclosure...

  18. 48 CFR 17.205 - Documentation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Documentation. 17.205 Section 17.205 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES SPECIAL CONTRACTING METHODS Options 17.205 Documentation. (a) The...

  19. 7 CFR 160.17 - Laboratory analysis.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Laboratory analysis. 160.17 Section 160.17 Agriculture... STANDARDS FOR NAVAL STORES Methods of Analysis, Inspection, Sampling and Grading § 160.17 Laboratory analysis. The analysis and laboratory testing of naval stores shall be conducted, so far as is...

  20. 7 CFR 947.17 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 947.17 Section 947.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Definitions § 947.17 Export. Export means shipment of potatoes beyond the boundaries of continental...

  1. 22 CFR 120.17 - Export.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Export. 120.17 Section 120.17 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS § 120.17 Export. (a) Export means: (1) Sending or taking a defense article out of the United States in any manner, except...

  2. 7 CFR 948.17 - Export.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Export. 948.17 Section 948.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Regulating Handling Definitions § 948.17 Export. Export means the shipment of potatoes to any...

  3. 6 CFR 17.310 - Recruitment.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Recruitment. 17.310 Section 17.310 Domestic... in Admission and Recruitment Prohibited § 17.310 Recruitment. (a) Nondiscriminatory recruitment. A... recruitment and admission of students. A recipient may be required to undertake additional recruitment...

  4. 6 CFR 17.510 - Recruitment.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Recruitment. 17.510 Section 17.510 Domestic... in Employment in Education Programs or Activities Prohibited § 17.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the...

  5. 43 CFR 17.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Discrimination prohibited. 17.3 Section 17... National Origin § 17.3 Discrimination prohibited. (a) General. No person in the United States shall, on the..., or be otherwise subjected to discrimination under any program to which this part applies....

  6. 7 CFR 15b.17 - Discrimination prohibited.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Discrimination prohibited. 15b.17 Section 15b.17... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Accessibility § 15b.17 Discrimination prohibited. No... to discrimination under any program or activity receiving assistance from this Department....

  7. 50 CFR 17.107 - Facilitating enforcement.

    Science.gov (United States)

    2010-10-01

    ... Protection Areas § 17.107 Facilitating enforcement. Water vehicles operating in manatee sanctuary or refuge... 50 Wildlife and Fisheries 5 2010-10-01 2010-10-01 true Facilitating enforcement. 17.107 Section 17.107 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE...

  8. 50 CFR 80.17 - Maintenance.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Maintenance. 80.17 Section 80.17 Wildlife... WILDLIFE RESTORATION AND DINGELL-JOHNSON SPORT FISH RESTORATION ACTS § 80.17 Maintenance. The State is responsible for maintenance of all capital improvements acquired or constructed with Wildlife and Sport...

  9. CHARACTERIZATION OF THERMALLY DAMAGED LX-17

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, P C

    2007-07-11

    Thermal damage was applied to LX-17 at 190 C for several hours. The damaged LX-17 samples, after cooled down to room temperature, were characterized for their material properties (density, porosity, permeability, moduli), safety, and performance. Weight losses upon thermal exposure were insignificant (< 0.1% wt.). The damaged LX-17 samples expanded, resulting in a bulk density reduction of 4.3%. Subsequent detonation measurements (cylinder tests) were conducted on the thermally-damaged LX-17 samples. The results showed that the fractions of damaged LX-17 reacted were slightly lower than those of pristine LX-17. The thermally damaged LX-17 had a detonation velocity of 7.315 mm/{micro}s, lower than that (7.638 mm/{micro}s) of pristine LX-17. Detonation energy density for the damaged LX-17 was 5.08 kJ/cm{sup 3}, about 9.0% lower than the detonation energy density of 5.50 kJ/cm{sup 3} for the pristine LX-17. The break-out curves showed reaction zone lengths for pristine LX-17 and damaged LX-17 were similar but the damaged samples had ragged detonation fronts.

  10. 50 CFR 82.17 - Procurement.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Procurement. 82.17 Section 82.17 Wildlife... (MARINE MAMMAL PROTECTION ACT OF 1972) Administration § 82.17 Procurement. Grantees may use their own procurement regulations which reflect applicable State and local laws, rules, and regulations, provided...

  11. 6 CFR 17.525 - Fringe benefits.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Fringe benefits. 17.525 Section 17.525 Domestic... in Employment in Education Programs or Activities Prohibited § 17.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, the term fringe benefits means any...

  12. 43 CFR 17.560 - Communications.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Communications. 17.560 Section 17.560... Programs or Activities Conducted by the Department of the Interior § 17.560 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants, participants,...

  13. 43 CFR 17.332 - Mediation.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Mediation. 17.332 Section 17.332 Public..., and Enforcement Procedures § 17.332 Mediation. (a) Referral of complaints for mediation. DOI will... participate in the mediation process to the extent necessary to reach an agreement or make an...

  14. 38 CFR 17.1004 - Filing claims.

    Science.gov (United States)

    2010-07-01

    ... services under 38 CFR 17.1002 (except for paragraph (e)) and 17.1003. I am aware that 38 U.S.C. 6102(b... internet at http://www.va.gov/health/elig. (c) Notwithstanding the provisions of paragraph (b) of this... Reimbursement for Emergency Services for Nonservice-Connected Conditions in Non-Va Facilities § 17.1004...

  15. 36 CFR 327.17 - Advertisment.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Advertisment. 327.17 Section 327.17 Parks, Forests, and Public Property CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY RULES AND... § 327.17 Advertisment. (a) Advertising and the distribution of printed matter is allowed within...

  16. 46 CFR 78.17-25 - Sanitation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 3 2010-10-01 2010-10-01 false Sanitation. 78.17-25 Section 78.17-25 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PASSENGER VESSELS OPERATIONS Tests, Drills, and Inspections § 78.17-25 Sanitation. (a) It shall be the duty of the master and chief engineer to see that...

  17. 7 CFR 250.17 - Reports.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Reports. 250.17 Section 250.17 Agriculture Regulations... TERRITORIES AND POSSESSIONS AND AREAS UNDER ITS JURISDICTION General Operating Provisions § 250.17 Reports. (a) Inventory reports and receipt of donated foods. Distributing agencies shall complete and submit to the...

  18. 10 CFR 470.17 - General requirements.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false General requirements. 470.17 Section 470.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION APPROPRIATE TECHNOLOGY SMALL GRANTS PROGRAM § 470.17 General... expenses, accounting practices, publication and publicity, copyrights, patents, discrimination, conflict...

  19. 10 CFR 1045.17 - Classification levels.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Classification levels. 1045.17 Section 1045.17 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) NUCLEAR CLASSIFICATION AND DECLASSIFICATION Identification of Restricted Data and Formerly Restricted Data Information § 1045.17 Classification levels. (a) Restricted...

  20. December 17, 2014 CDC Ebola Response Update

    Centers for Disease Control (CDC) Podcasts

    2014-12-17

    This podcast provides an update on the Ebola response, as of December 17, 2014. It briefly describes CDC's "Operation Care Package.".  Created: 12/17/2014 by CDC’s Office of the Associate Director for Communication.   Date Released: 12/17/2014.

  1. 7 CFR 922.17 - Container.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container. 922.17 Section 922.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... IN WASHINGTON Order Regulating Handling Definitions § 922.17 Container. Container means a box,...

  2. 7 CFR 923.17 - Container.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container. 923.17 Section 923.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... COUNTIES IN WASHINGTON Order Regulating Handling Definitions § 923.17 Container. Container means a box,...

  3. 32 CFR 637.17 - Police Intelligence.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Police Intelligence. 637.17 Section 637.17... CRIMINAL INVESTIGATIONS MILITARY POLICE INVESTIGATION Investigations § 637.17 Police Intelligence. (a) The purpose of gathering police intelligence is to identify individuals or groups of individuals in an...

  4. 36 CFR 17.7 - Preference rights.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Preference rights. 17.7 Section 17.7 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR CONVEYANCE OF FREEHOLD AND LEASEHOLD INTERESTS ON LANDS OF THE NATIONAL PARK SYSTEM § 17.7 Preference...

  5. 7 CFR 215.17 - Program information.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Program information. 215.17 Section 215.17 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL MILK PROGRAM FOR CHILDREN § 215.17 Program information. School Food Authorities and...

  6. 7 CFR 277.17 - Audit requirements.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Audit requirements. 277.17 Section 277.17 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM PAYMENTS OF CERTAIN ADMINISTRATIVE COSTS OF STATE AGENCIES § 277.17 Audit requirements. (a) General. This section sets forth the audit requirements for...

  7. 7 CFR 550.17 - Peer review.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Peer review. 550.17 Section 550.17 Agriculture... § 550.17 Peer review. Upon request of the REE Agency, cooperators may be requested to provide documentation in support of peer review activities and cooperator personnel may be requested to participate...

  8. 28 CFR 51.17 - Special elections.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Special elections. 51.17 Section 51.17... THE VOTING RIGHTS ACT OF 1965, AS AMENDED General Provisions § 51.17 Special elections. (a) The conduct of a special election (e.g., an election to fill a vacancy; an initiative, referendum, or...

  9. 42 CFR 1005.17 - Evidence.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Evidence. 1005.17 Section 1005.17 Public Health... OF EXCLUSIONS, CIVIL MONEY PENALTIES AND ASSESSMENTS § 1005.17 Evidence. (a) The ALJ will determine the admissibility of evidence. (b) Except as provided in this part, the ALJ will not be bound by...

  10. 21 CFR 17.39 - Evidence.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Evidence. 17.39 Section 17.39 Food and Drugs FOOD... HEARINGS § 17.39 Evidence. (a) The presiding officer shall determine the admissibility of evidence. (b... Evidence.” However, the presiding officer may apply the “Federal Rules of Evidence” when appropriate,...

  11. 39 CFR 959.17 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Evidence. 959.17 Section 959.17 Postal Service... STATUTES § 959.17 Evidence. (a) Except as otherwise provided in these rules, the rules of evidence... repetitious evidence. (b) Testimony shall be under oath or affirmation and witnesses shall be subject to...

  12. 46 CFR 9.17 - Protests.

    Science.gov (United States)

    2010-10-01

    ... § 9.17 Protests. Protests against the exaction of extra compensation shall be forwarded to the Commandant of the Coast Guard. 46 CFR Ch. I (10-1-10 Edition) Coast Guard, DHS ... 46 Shipping 1 2010-10-01 2010-10-01 false Protests. 9.17 Section 9.17 Shipping COAST...

  13. 40 CFR 1508.17 - Legislation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Legislation. 1508.17 Section 1508.17 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY TERMINOLOGY AND INDEX § 1508.17 Legislation. Legislation includes a bill or legislative proposal to Congress developed by or with the...

  14. Innovation with carbon materials---A report on the annual world conference on carbon, Carbon 2015%炭材料的革新--记Carbon 2015国际炭会议

    Institute of Scientific and Technical Information of China (English)

    张强

    2015-01-01

    The annual world conference on carbon, Carbon 2015, was held in Dresden, Germany, and was hosted by the German Carbon Group and German Ceramic Society, during July 12~17, 2015. About 582 attendees from 40 countries participated in the conference, and 540 papers were accepted for discussion, including 4 plenary lectures, 256 oral presentations, and 280 posters in-volved in 12 topics, namely, activated carbon, biomass derived carbon, carbon black, carbon fiber and composites, granular/nucle-ar carbon, natural graphite, nanoforms, industrial, conversion process, physical &chemical properties, environmental &medical, and energy storage. Carbon fiber, graphite, carbon black, and carbon alloy were the subjects of the plenary lectures. The innovation of the traditional carbon materials and new nanocarbon, the critical role of carbon in energy, environment, and healthcare applica-tion, as well as the new insights on the relationship of structure and properties at the molecular scale were strongly considered in this event. Carbon materials required continuous innovation to meet the rising requirement of sustainable society.

  15. Sorption and degradation of 17ß-estradiol-17-sulfate in sterilized soil-water systems

    Science.gov (United States)

    To identify abiotic processes that govern the fate of a sulfate conjugated estrogen, 17ß-estradiol-17-sulfate (E2-17S), soil batch experiments were conducted to investigate the dissipation, sorption, and degradation of radiolabeled E2-17S under sterilized conditions. The aqueous dissipation half-liv...

  16. 17 CFR 240.17a-10 - Report on revenue and expenses.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Report on revenue and expenses. 240.17a-10 Section 240.17a-10 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION....17a-10 Report on revenue and expenses. (a)(1) Every broker or dealer exempted from the...

  17. 17 CFR 240.17Ad-21T - Operational capability in a Year 2000 environment.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Operational capability in a Year 2000 environment. 240.17Ad-21T Section 240.17Ad-21T Commodity and Securities Exchanges SECURITIES... Company Rules § 240.17Ad-21T Operational capability in a Year 2000 environment. (a) This section...

  18. Interleukin 17A controls Interleukin 17F production and maintains blood neutrophil counts in mice

    OpenAIRE

    von Vietinghoff, Sibylle; Ley, Klaus

    2009-01-01

    Granulocyte colony-stimulating factor (G-CSF), its receptor and interleukin-17 receptor A (IL-17RA) are all required to maintain baseline neutrophil counts in mice. Here, we tested whether IL-17F could compensate and maintain baseline neutrophil counts in the absence of IL-17A. Unlike the reduced neutrophil counts found in IL-17RA deficient mice, neutrophil counts were mildly increased in IL-17A deficient (Il17a-/-) animals. There was no evidence for infection or altered neutrophil function. ...

  19. The Kinase PKCα Selectively Upregulates Interleukin-17A during Th17 Cell Immune Responses

    OpenAIRE

    Meisel, Marlies; Hermann-Kleiter, Natascha; Hinterleitner, Reinhard; Gruber, Thomas; Wachowicz, Katarzyna; Pfeifhofer-Obermair, Christa; Fresser, Friedrich; Leitges, Michael; Soldani, Cristiana; Viola, Antonella; Kaminski, Sandra; Baier, Gottfried

    2013-01-01

    Summary Transforming growth-factor β (TGFβ) has been implicated in T helper 17 (Th17) cell biology and in triggering expression of interleukin-17A (IL-17A), which is a key Th17 cell cytokine. Deregulated TGFβ receptor (TGFβR) signaling has been implicated in Th17-cell-mediated autoimmune pathogenesis. Nevertheless, the full molecular mechanisms involved in the activation of the TGFβR pathway in driving IL-17A expression remain unknown. Here, we identified protein kinase C α (PKCα) as a signal...

  20. Model-based estimation of the global carbon budget and its uncertainty from carbon dioxide and carbon isotope records

    International Nuclear Information System (INIS)

    A global carbon cycle model is used to reconstruct the carbon budget, balancing emissions from fossil fuel and land use with carbon uptake by the oceans, and the terrestrial biosphere. We apply Bayesian statistics to estimate uncertainty of carbon uptake by the oceans and the terrestrial biosphere based on carbon dioxide and carbon isotope records, and prior information on model parameter probability distributions. This results in a quantitative reconstruction of past carbon budget and its uncertainty derived from an explicit choice of model, data-based constraints, and prior distribution of parameters. Our estimated ocean sink for the 1980s is 17±7 Gt C (90% confidence interval) and is comparable to the estimate of 20±8 Gt C given in the recent Intergovernmental Panel on Climate Change assessment [Schimel et al., 1996]. Constraint choice is tested to determine which records have the most influence over estimates of the past carbon budget; records individually (e.g., bomb-radiocarbon inventory) have little effect since there are other records which form similar constraints. (c) 1999 American Geophysical Union

  1. The aryl hydrocarbon receptor: differential contribution to T helper 17 and T cytotoxic 17 cell development.

    Directory of Open Access Journals (Sweden)

    Mark D Hayes

    Full Text Available The aryl hydrocarbon receptor (AhR has been shown to be required for optimal Thelper (Th 17 cell activation. Th17 cells provide immunity against extracellular pathogens and are implicated in autoimmune diseases. Herein, the role of the AhR in cytokine production by Th17, and by the analogous population of T cytotoxic (Tc17 cells, has been examined. Lymph node Tc (CD8(+ and Th (CD4(+ cells were isolated by negative selection from naive AhR(+/- and AhR(-/- mice and polarised to Tc1/Th1 or Tc17/Th17 phenotypes with appropriate cytokines. Cell differentiation was assessed as a function of mRNA and protein (ELISA and flow cytometry expression for interferon (IFN-γ and for key Th17 cytokines. In AhR(+/- mice, Th17 cells displayed an exclusive IL-17 profile, which was markedly inhibited by a selective AhR antagonist to levels observed in AhR knockout mice. Addition of the natural AhR agonist 6-formylindolo[3,2-b]carbazole (FICZ markedly enhanced Th17 cell activity in the heterozygotes. In contrast, Tc17 cells polarised into 3 distinct subsets: producing either IL-17 or IFN-γ alone, or both cytokines. Blocking AhR was also detrimental to Tc17 development, with reduced responses recorded in AhR(-/- mice and antagonist-mediated reduction of IL-17 expression in the heterozygotes. However, Tc17 cells were largely refractory to exogenous FICZ, presumably because Tc17 cells express baseline AhR mRNA, but unlike Th17 cells, there is no marked up-regulation during polarisation. Thus, Th17 cell development is more dependent upon AhR activation than is Tc17 cell development, suggesting that endogenous AhR ligands play a much greater role in driving Th17 cell responses.

  2. The aryl hydrocarbon receptor: differential contribution to T helper 17 and T cytotoxic 17 cell development.

    Science.gov (United States)

    Hayes, Mark D; Ovcinnikovs, Vitalijs; Smith, Andrew G; Kimber, Ian; Dearman, Rebecca J

    2014-01-01

    The aryl hydrocarbon receptor (AhR) has been shown to be required for optimal Thelper (Th) 17 cell activation. Th17 cells provide immunity against extracellular pathogens and are implicated in autoimmune diseases. Herein, the role of the AhR in cytokine production by Th17, and by the analogous population of T cytotoxic (Tc)17 cells, has been examined. Lymph node Tc (CD8(+)) and Th (CD4(+)) cells were isolated by negative selection from naive AhR(+/-) and AhR(-/-) mice and polarised to Tc1/Th1 or Tc17/Th17 phenotypes with appropriate cytokines. Cell differentiation was assessed as a function of mRNA and protein (ELISA and flow cytometry) expression for interferon (IFN)-γ and for key Th17 cytokines. In AhR(+/-) mice, Th17 cells displayed an exclusive IL-17 profile, which was markedly inhibited by a selective AhR antagonist to levels observed in AhR knockout mice. Addition of the natural AhR agonist 6-formylindolo[3,2-b]carbazole (FICZ) markedly enhanced Th17 cell activity in the heterozygotes. In contrast, Tc17 cells polarised into 3 distinct subsets: producing either IL-17 or IFN-γ alone, or both cytokines. Blocking AhR was also detrimental to Tc17 development, with reduced responses recorded in AhR(-/-) mice and antagonist-mediated reduction of IL-17 expression in the heterozygotes. However, Tc17 cells were largely refractory to exogenous FICZ, presumably because Tc17 cells express baseline AhR mRNA, but unlike Th17 cells, there is no marked up-regulation during polarisation. Thus, Th17 cell development is more dependent upon AhR activation than is Tc17 cell development, suggesting that endogenous AhR ligands play a much greater role in driving Th17 cell responses. PMID:25203682

  3. Carbon Footprints

    OpenAIRE

    Rahel Aichele; Gabriel Felbermayr

    2011-01-01

    Lässt sich der Beitrag eines Landes zum weltweiten Klimaschutz an der Veränderung seines CO2-Ausstoßes messen, wie es im Kyoto-Abkommen implizit unterstellt wird? Oder ist aufgrund der Bedeutung des internationalen Güterhandels der Carbon Footprint – der alle CO2-Emissionen erfasst, die durch die Absorption (d.h. Konsum und Investitionen) eines Landes entstehen – das bessere Maß? Die Autoren erstellen eine Datenbank mit den Footprints von 40 Ländern für den Zeitraum 1995–2007. Die deskriptive...

  4. Anti-interleukin-17 treatment of psoriasis.

    Science.gov (United States)

    Jinna, Sphoorthi; Strober, Bruce

    2016-08-01

    Psoriasis is a chronic, immune-mediated, inflammatory dermatosis, affecting 2-3% of the US population. While first-generation cytokine antagonists targeting tumor necrosis factor alpha (TNF-α)-dependent pathways have produced favorable responses in the treatment of psoriasis, higher levels of efficacy in a greater proportion of patients have been shown in trials with antibodies targeting interleukin (IL)-17A and the IL-17 receptor subunit. This examines the role of IL-17 inhibitors in the treatment of plaque psoriasis. The efficacy and safety results from the phase-3 trials with monoclonal antibodies targeting IL-17RA (brodalumab) and IL-17A (ixekizumab and secukinumab) validate IL-17 as a highly effective therapeutic target for the treatment of plaque psoriasis. PMID:26943806

  5. Cardiovascular actions of angiotensin-(1-7

    Directory of Open Access Journals (Sweden)

    Ferreira A.J.

    2005-01-01

    Full Text Available Angiotensin-(1-7 (Ang-(1-7 is now considered to be a biologically active member of the renin-angiotensin system. The functions of Ang-(1-7 are often opposite to those attributed to the main effector component of the renin-angiotensin system, Ang II. Chronic administration of angiotensin-converting enzyme inhibitors (ACEI increases 10- to 25-fold the plasma levels of this peptide, suggesting that part of the beneficial effects of ACEI could be mediated by Ang-(1-7. Ang-(1-7 can be formed from Ang II or directly from Ang I. Other enzymatic pathways for Ang-(1-7 generation have been recently described involving the novel ACE homologue ACE2. This enzyme can form Ang-(1-7 from Ang II or less efficiently by the hydrolysis of Ang I to Ang-(1-9 with subsequent Ang-(1-7 formation. The biological relevance of Ang-(1-7 has been recently reinforced by the identification of its receptor, the G-protein-coupled receptor Mas. Heart and blood vessels are important targets for the formation and actions of Ang-(1-7. In this review we will discuss recent findings concerning the biological role of Ang-(1-7 in the heart and blood vessels, taking into account aspects related to its formation and effects on these tissues. In addition, we will discuss the potential of Ang-(1-7 and its receptor as a target for the development of new cardiovascular drugs.

  6. Radiation polymerization of vinylene carbonate

    International Nuclear Information System (INIS)

    The radiation-induced polymerization of vinylene carbonate of 99,97% purity has been investigated. The relationship between conversion and irradiation time is strictly linear, even at the lowest conversions, thus proving that the normal induction period observed for the polymerization of lower-purity vinylene carbonate indeed results from the presence of an inhibitor. Although the identity of the inhibitor has not been established, it has been shown that it is not dichlorovinylene carbonate. An activation energy of 15,1 kJ/mole was calculated for the homopolymerization process. The radiation-induced copolymerization of vinylene carbonate (M1) with isobutyl vinyl ether (M2) has been investigated over the temperature range of 40-80 degrees Celcius. The monomer reactivity ratios r1 and r2 were determined to be 0,118 and 0,148 respectively, and an activation energy of 31,8kJ/mole was calculated for the copolymerization process. The radiation-induced telomerization of vinylene carbonate with carbon tetrachloride has been investigated over a telogen to monomer concentration ratio range of 4 to 20. The rate of formation of the n=1 adduct was found to be independent of monomer concentration, directly proportional to the telogen concentration, and exhibiting a 0,38 order power dependence on the radiation intensity, in general agreement with the derived rate equations. The rate of formation of the n=2 telomer was found to be independent of both monomer and telogen concentrations and radiation intensity, which is not in agreement with the derived rate equations. The first and second chain-transfer coefficients C1 and C2 were determined to be 0,116 and 0,34 respectively, and the activation energies for the formation of the n=1 adduct and n=2 telomer were calculated to be 17,6 and 64,9 kJ/mole respectively

  7. Carbon Nanomembranes.

    Science.gov (United States)

    Turchanin, Andrey; Gölzhäuser, Armin

    2016-08-01

    Carbon nanomembranes (CNMs) are synthetic 2D carbon sheets with tailored physical or chemical properties. These depend on the structure, molecular composition, and surroundings on either side. Due to their molecular thickness, they can be regarded as "interfaces without bulk" separating regions of different gaseous, liquid, or solid components and controlling the materials exchange between them. Here, a universal scheme for the fabrication of 1 nm-thick, mechanically stable, functional CNMs is presented. CNMs can be further modified, for example perforated by ion bombardment or chemically functionalized by the binding of other molecules onto the surfaces. The underlying physical and chemical mechanisms are described, and examples are presented for the engineering of complex surface architectures, e.g., nanopatterns of proteins, fluorescent dyes, or polymer brushes. A simple transfer procedure allows CNMs to be placed on various support structures, which makes them available for diverse applications: supports for electron and X-ray microscopy, nanolithography, nanosieves, Janus nanomembranes, polymer carpets, complex layered structures, functionalization of graphene, novel nanoelectronic and nanomechanical devices. To close, the potential of CNMs in filtration and sensorics is discussed. Based on tests for the separation of gas molecules, it is argued that ballistic membranes may play a prominent role in future efforts of materials separation. PMID:27281234

  8. Active site proton delivery and the lyase activity of human CYP17A1

    Energy Technology Data Exchange (ETDEWEB)

    Khatri, Yogan; Gregory, Michael C.; Grinkova, Yelena V.; Denisov, Ilia G.; Sligar, Stephen G., E-mail: s-sligar@illinois.edu

    2014-01-03

    Highlights: •The disruption of PREG/PROG hydroxylation activity by T306A showed the participation of Cpd I. •T306A supports the involvement of a nucleophilic peroxo-anion during lyase activity. •The presence of cytochrome b{sub 5} augments C–C lyase activity. •Δ5-Steroids are preferred substrates for CYP17 catalysis. -- Abstract: Cytochrome P450 CYP17A1 catalyzes a series of reactions that lie at the intersection of corticoid and androgen biosynthesis and thus occupies an essential role in steroid hormone metabolism. This multifunctional enzyme catalyzes the 17α-hydroxylation of Δ4- and Δ5-steroids progesterone and pregnenolone to form the corresponding 17α-hydroxy products through its hydroxylase activity, and a subsequent 17,20-carbon–carbon scission of pregnene-side chain produce the androgens androstenedione (AD) and dehydroepiandrosterone (DHEA). While the former hydroxylation reaction is believed to proceed through a conventional “Compound I” rebound mechanism, it has been suggested that the latter carbon cleavage is initiated by an iron-peroxy intermediate. We report on the role of Thr306 in CYP17 catalysis. Thr306 is a member of the conserved acid/alcohol pair thought to be essential for the efficient delivery of protons required for hydroperoxoanion heterolysis and formation of Compound I in the cytochromes P450. Wild type and T306A CYP17A1 self-assembled in Nanodiscs were used to quantitate turnover and coupling efficiencies of CYP17’s physiological Δ4- and Δ5-substrates. We observed that T306A co-incorporated in Nanodiscs with its redox partner cytochrome P450 oxidoreductase, coupled NADPH only by 0.9% and 0.7% compared to the wild type (97% and 22%) during the conversion of pregnenolone and progesterone, respectively, to the corresponding 17-OH products. Despite increased oxidation of pyridine nucleotide, hydroxylase activity was drastically diminished in the T306A mutant, suggesting a high degree of uncoupling in which reducing

  9. Active site proton delivery and the lyase activity of human CYP17A1

    International Nuclear Information System (INIS)

    Highlights: •The disruption of PREG/PROG hydroxylation activity by T306A showed the participation of Cpd I. •T306A supports the involvement of a nucleophilic peroxo-anion during lyase activity. •The presence of cytochrome b5 augments C–C lyase activity. •Δ5-Steroids are preferred substrates for CYP17 catalysis. -- Abstract: Cytochrome P450 CYP17A1 catalyzes a series of reactions that lie at the intersection of corticoid and androgen biosynthesis and thus occupies an essential role in steroid hormone metabolism. This multifunctional enzyme catalyzes the 17α-hydroxylation of Δ4- and Δ5-steroids progesterone and pregnenolone to form the corresponding 17α-hydroxy products through its hydroxylase activity, and a subsequent 17,20-carbon–carbon scission of pregnene-side chain produce the androgens androstenedione (AD) and dehydroepiandrosterone (DHEA). While the former hydroxylation reaction is believed to proceed through a conventional “Compound I” rebound mechanism, it has been suggested that the latter carbon cleavage is initiated by an iron-peroxy intermediate. We report on the role of Thr306 in CYP17 catalysis. Thr306 is a member of the conserved acid/alcohol pair thought to be essential for the efficient delivery of protons required for hydroperoxoanion heterolysis and formation of Compound I in the cytochromes P450. Wild type and T306A CYP17A1 self-assembled in Nanodiscs were used to quantitate turnover and coupling efficiencies of CYP17’s physiological Δ4- and Δ5-substrates. We observed that T306A co-incorporated in Nanodiscs with its redox partner cytochrome P450 oxidoreductase, coupled NADPH only by 0.9% and 0.7% compared to the wild type (97% and 22%) during the conversion of pregnenolone and progesterone, respectively, to the corresponding 17-OH products. Despite increased oxidation of pyridine nucleotide, hydroxylase activity was drastically diminished in the T306A mutant, suggesting a high degree of uncoupling in which reducing

  10. 7 CFR 1219.17 - Order.

    Science.gov (United States)

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH, AND INFORMATION Hass Avocado Promotion, Research, and Information Order Definitions § 1219.17...

  11. The presence, function and regulation of IL-17 and Th17 cells in periodontitis.

    Science.gov (United States)

    Cheng, Wan-Chien; Hughes, Francis J; Taams, Leonie S

    2014-06-01

    Periodontitis (PD) is a chronic inflammatory disease characterised by tissue inflammation and destruction of the associated alveolar bone. It is caused by the colonisation of the bacterial plaque biofilm and the resultant host immune responses in the surrounding periodontal tissues. The pro-inflammatory cytokine IL-17, and IL-17 producing CD4+ T cells (also called Th17 cells) have been shown to play an important role in many inflammatory diseases. There is increasing evidence of the presence of IL-17 and Th17 cells in human PD lesions and this may be associated with disease severity. Moreover, several animal studies indicate the potential role of IL-17 and Th17 cells in gingival inflammation and the resultant bone destruction in PD. Here we review recent findings regarding the presence, function and regulation of IL-17 and Th17 cells in PD, and we highlight potential areas of future research interest. PMID:24735470

  12. Increased number of Tc17 and correlation with Th17 cells in patients with immune thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Yu Hu

    Full Text Available BACKGROUND: IL-17-secreting CD8+ T cells (Tc17 subset have recently been defined as a subpopulation of effector T cells implicated in the pathogenesis of autoimmune diseases. The role of Tc17 and correlation with Th17 cells in the pathophysiology of immune thrombocytopenia (ITP remain unsettled. DESIGN AND METHODS: We studied 47 ITP patients (20 newly-diagnosed and 27 with complete response and 34 healthy controls. IL-17-producing CD3+CD8+ cells (Tc17 and IL-17-producing CD3+CD8- cells (Th17 were evaluated by flow cytometry and expressed as a percentage of the total number of CD3+ cells. Specific anti-platelet glycoprotein (GP GPIIb/IIIa and/or GPIb/IX autoantibodies were measured by modified monoclonal antibody specific immobilization of platelet antigens. Peripheral blood mononuclear cells of ITP patients were isolated, incubated in the presence of 0, 0.25, 0.5, or 1 µmol/L of dexamethasone for 72 h, and collected to detect Tc17 and Th17 cells by flow cytometric analysis. RESULTS: IL-17 was expressed on CD3+CD8- and CD3+CD8+ T cells. The percentages of Tc17 and Th17 cells in newly-diagnosed patients were significantly elevated compared to controls, and Tc17 was decreased after clinical treatment. The Th17∶Tc17 ratio was significantly lower in newly-diagnosed patients compared with controls, and was increased in patients who had complete response. There was a significantly positive correlation between Tc17 and Th17 cells in the control group, but not in the ITP patients. A positive correlation existed between Tc17 and the CD8∶CD4 ratio, as well as CD8+ cells in patients with ITP. The frequencies of Tc17 were marginally higher in autoantibody-negative patients than autoantibody-positive patients. Moreover, both Tc17 and Th17 cell percentages decreased as the concentration of dexamethasone in the culture media increased in ITP patients. CONCLUSIONS: Tc17 and the Th17 subset are involved in the immunopathology of ITP. Blocking the abnormally

  13. Th17/IL-17A might play a protective role in chronic lymphocytic leukemia immunity.

    Directory of Open Access Journals (Sweden)

    Iwona Hus

    Full Text Available Th17 cells, a recently discovered subset of T helper cells that secrete IL-17A, can affect the inflammation process autoimmune and cancer diseases development. The purpose of this study was to evaluate the role of Th17 cells and IL17A in biology of CLL. The study group included 294 untreated CLL patients in different clinical stages. Here, we show that higher Th17 and IL-17A values were associated with less advanced clinical stage of CLL. Th17 cells' percentages in PB were lower in patients who died due to CLL during follow-up due to CLL (as compared to surviving patients and in patients responding to first-line therapy with fludarabine-based regimens (as compared to non-responders. IL-17A inversely correlated with the time from CLL diagnosis to the start of therapy and was lower in patients who required treatment during follow-up. Th-17 and IL-17A values were lower in patients with adverse prognostic factors (17p and 11q deletion, CD38 and ZAP-70 expression. CLL patients with detectable IL-17A mRNA in T cells were in Rai Stage 0 and negative for both ZAP-70 and CD38 expression. Th17 percentages positively correlated with iNKT and adversely with Treg cells. The results of this study suggest that Th17 may play a beneficial role in CLL immunity.

  14. TH17 Cell Induction and Effects of IL-17A and IL-17F Blockade in Experimental Colitis

    DEFF Research Database (Denmark)

    Wedebye Schmidt, Esben Gjerløff; Larsen, Hjalte List; Kristensen, Nanna Ny;

    2013-01-01

    T helper (TH) 17 cells are believed to play a pivotal role in development of inflammatory bowel disease, and their contribution to intestinal inflammation has been studied in various models of colitis. TH17 cells produce a range of cytokines, some of which are potential targets for immunotherapy...

  15. Trading forest carbon

    Science.gov (United States)

    The nature of carbon in forests is discussed from the perspective of carbon trading. Carbon inventories, specifically in the area of land use and forestry are reviewed for the Pacific Northwest. Carbon turnover in forests is discussed as it relates to carbon sequestration. Scient...

  16. IL-17/IL-17 receptor system in autoimmune disease: mechanisms and therapeutic potential.

    Science.gov (United States)

    Zhu, Shu; Qian, Youcun

    2012-06-01

    IL-17 (interleukin-17), a hallmark cytokine of Th17 (T-helper 17) cells, plays critical roles in host defence against bacterial and fungal infections, as well as in the pathogenesis of autoimmune diseases. The present review focuses on current knowledge of the regulation, functional mechanisms and targeting strategies of IL-17 in the context of inflammatory autoimmune diseases. Evidence shows that IL-17 is highly up-regulated at sites of inflammatory tissues of autoimmune diseases and amplifies the inflammation through synergy with other cytokines, such as TNF (tumour necrosis factor) α. Although IL-17 was originally thought to be produced mainly by Th17 cells, a newly defined T-cell subset with a specific differentiation programme and tight regulation, several other cell types (especially innate immune cells) are also found as important sources for IL-17 production. Although IL-17 activates common downstream signalling, including NF-κB (nuclear factor κB), MAPKs (mitogen-activated protein kinases), C/EBPs (CCAAT/enhancer-binding proteins) and mRNA stability, the immediate receptor signalling has been shown to be quite unique and tightly regulated. Mouse genetic studies have demonstrated a critical role for IL-17 in the pathogenesis of variety of inflammatory autoimmune diseases, such as RA (rheumatoid arthritis) and MS (multiple sclerosis). Importantly, promising results have been shown in initial clinical trials of monoclonal antibodies against IL-17 or its receptor (IL-17R) to block IL-17-mediated function in treating autoimmune patients with psoriasis, RA and MS. Therefore targeting IL-17/IL-17R, IL-17-producing pathways or IL-17-mediated signalling pathways can be considered for future therapy in autoimmune diseases. PMID:22324470

  17. Changes in plasma potassium concentration during carbon dioxide pneumoperitoneum

    DEFF Research Database (Denmark)

    Perner, A; Bugge, K; Lyng, K M;

    1999-01-01

    Hyperkalaemia with ECG changes had been noted during prolonged carbon dioxide pneumoperitoneum in pigs. We have compared plasma potassium concentrations during surgery in 11 patients allocated randomly to undergo either laparoscopic or open appendectomy and in another 17 patients allocated randomly...... to either carbon dioxide pneumoperitoneum or abdominal wall lifting for laparoscopic colectomy. Despite an increasing metabolic acidosis, prolonged carbon dioxide pneumoperitoneum resulted in only a slight increase in plasma potassium concentrations, which was both statistically and clinically...... insignificant. Thus hyperkalaemia is unlikely to develop in patients with normal renal function undergoing carbon dioxide pneumoperitoneum for laparoscopic surgery....

  18. The role of Interleukin-17A and Interleukin-17E in multiple myeloma patients

    OpenAIRE

    Lemancewicz, Dorota; Bolkun, Lukasz; Jablonska, Ewa; Czeczuga-Semeniuk, Ewa; Kostur, Agnieszka; Kloczko, Janusz; Dzieciol, Janusz

    2012-01-01

    Summary Background Tumor growth in multiple myeloma (MM) is regulated by the cytokine networks which are produced by myeloma cells and the microenvironment of the bone marrow. Interleukin-17 (IL-17) is implicated in the increased angiogenesis in the bone marrow of MM. Recent studies reported elevated levels of interleukin 17A (IL-17A) in the sera of patients with advanced stages according to Durie-Salmon classification. Material/Methods We compared the concentration of IL-17A and IL-17E in th...

  19. IL-17A secretion by CD8+ T cells supports Th17-mediated autoimmune encephalomyelitis

    OpenAIRE

    Huber, Magdalena; Heink, Sylvia; Pagenstecher, Axel; Reinhard, Katharina; Ritter, Josephine; Visekruna, Alexander; Guralnik, Anna; Bollig, Nadine; Jeltsch, Katharina; Heinemann, Christina; Wittmann, Eva; Buch, Thorsten; da Costa, Olivia Prazeres; Brüstle, Anne; Brenner, Dirk

    2012-01-01

    IL-17–producing CD8+ T (Tc17) cells are detectible in multiple sclerosis (MS) lesions; however, their contribution to the disease is unknown. To identify functions of Tc17 cells, we induced EAE, a murine model of MS, in mice lacking IFN regulatory factor 4 (IRF4). IRF4-deficient mice failed to generate Tc17 and Th17 cells and were resistant to EAE. After adoptive transfer of WT CD8+ T cells and subsequent immunization for EAE induction in these mice, the CD8+ T cells developed a Tc17 phenotyp...

  20. Carbon Farming as a Carbon Negative Technology

    Science.gov (United States)

    Anderson, C.; Laird, D.; Hayes, D. J.

    2015-12-01

    Carbon farms have a pivotal role in national and international efforts to mitigate and adapt to climate change. A carbon farm in its broadest sense is one that reduces greenhouse gas (GHG) emissions or captures and holds carbon in vegetation and soils. Their capacity to remove carbon from the air and store it safely and permanently, while providing additional human and ecosystem benefits, means they could contribute significantly to national efforts to stabilize or reduce GHGs. We examine carbon farms in the context of corn and soybean production agriculture. We illustrate, using Iowa data but with relevance across United States corn and soybean production, the potential for carbon farms to reduce human GHG emissions and sequester carbon permanently at a rate that has meaningful impact on global greenhouse gas concentration. Carbon has been viewed as a next generation cash crop in Iowa for over a decade. The carbon farm perspective, however, goes beyond carbon as cash crop to make carbon the center of an entire farm enterprise. The transformation is possible through slight adjustment crop practices mixed with advances in technology to sequester carbon through biochar. We examine carbon balance of Iowa agriculture given only the combination of slight reduction in fertilizer and sequestration by biochar. We find the following. Iowa carbon farms could turn Iowa agriculture into a carbon sink. The estimated range of GHG reduction by statewide implementation of carbon farms is 19.46 to 90.27 MMt CO2-equivalent (CO2-e), while the current agricultural CO2-e emission estimate is 35.38 MMt CO2-e. Iowa carbon farm GHG reduction would exceed Iowa GHG reduction by wind energy (8.7 MMt CO2-e) and could exceed combined reductions from wind energy and corn grain ethanol (10.7 MMt CO2-e; 19.4 MMt CO2-e combined). In fact, Iowa carbon farms alone could exceed GHG reduction from national corn grain ethanol production (39.6 MMt CO2-e). A carbon price accessible to agricultural

  1. Treg17 cells are programmed by Stat3 to suppress Th17 responses in systemic lupus.

    Science.gov (United States)

    Kluger, Malte A; Melderis, Simon; Nosko, Anna; Goerke, Boeren; Luig, Michael; Meyer, Matthias C; Turner, Jan-Eric; Meyer-Schwesinger, Catherine; Wegscheid, Claudia; Tiegs, Gisa; Stahl, Rolf A K; Panzer, Ulf; Steinmetz, Oliver M

    2016-01-01

    Systemic lupus erythematosus (SLE) is a complex and potentially fatal autoimmune disorder. Although Th17 cells are thought to be central mediators of SLE, mechanisms underlying their counter regulation remain largely unknown. To help define this, we studied the function of the newly defined Stat3-dependent Th17-specific regulatory T cells (Treg17). Treg-specific deletion of Stat3 was achieved by generating Foxp3(Cre) × Stat3(fl/fl) mice and SLE was induced by intraperitoneal injection of pristane. Lack of Treg17 cells in these mice caused selectively enhanced peritoneal Th17 inflammation. Importantly, Treg17 deficiency also resulted in aggravated pulmonary vasculitis with increased percentages of Th17 cells and significantly higher mortality. Similarly, 4 and 9 months after pristane injection, analysis of renal and systemic immunity showed overshooting Th17 responses in the absence of Treg17 cells, associated with the aggravation of lupus nephritis. Expression of the Th17 characteristic trafficking receptor CCR6 was strikingly reduced on Tregs of Foxp3(Cre) × Stat3(fl/fl) mice, resulting in impaired renal Treg infiltration. Thus, Stat3-induced Treg17 cells are novel antiinflammatory mediators of SLE. One mechanism enabling Treg17 cells to target pathogenic Th17 responses is shared expression of the chemokine receptor CCR6. PMID:26466322

  2. 48 CFR 17.206 - Evaluation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Evaluation. 17.206 Section... CONTRACT TYPES SPECIAL CONTRACTING METHODS Options 17.206 Evaluation. (a) In awarding the basic contract... officer need not evaluate offers for any option quantities when it is determined that evaluation would...

  3. 17 CFR 201.57 - Commission review.

    Science.gov (United States)

    2010-04-01

    ... Regulations Pertaining to the Equal Access to Justice Act § 201.57 Commission review. In accordance with the procedures set forth in 17 CFR 201.410 and 201.411, either the applicant or counsel for the Office or... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Commission review....

  4. 6 CFR 17.505 - Employment criteria.

    Science.gov (United States)

    2010-01-01

    ... OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 17.505 Employment... 6 Domestic Security 1 2010-01-01 2010-01-01 false Employment criteria. 17.505 Section...

  5. 21 CFR 17.21 - Prehearing conferences.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Prehearing conferences. 17.21 Section 17.21 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL CIVIL MONEY...; (3) Stipulations and admissions of fact as to the contents and authenticity of documents; (4)...

  6. 38 CFR 17.1003 - Emergency transportation.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Emergency transportation... Facilities § 17.1003 Emergency transportation. Notwithstanding the provisions of § 17.1002, payment or... the emergency transportation; (c) The veteran has no coverage under a health-plan contract...

  7. 6 CFR 17.430 - Financial assistance.

    Science.gov (United States)

    2010-01-01

    ... or assist in the administration of scholarships, fellowships, or other forms of financial assistance... 6 Domestic Security 1 2010-01-01 2010-01-01 false Financial assistance. 17.430 Section 17.430... OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination...

  8. 27 CFR 17.164 - Production record.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Production record. 17.164... PRODUCTS Records § 17.164 Production record. (a) General. Each manufacturer shall keep a production record for each batch of intermediate product and for each batch of nonbeverage product. The...

  9. 27 CFR 17.167 - Inventories.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Inventories. 17.167... PRODUCTS Records § 17.167 Inventories. (a) Distilled spirits. The “on hand” figures reported in Part II of TTB Form 5154.2 shall be verified by physical inventories taken as of the end of each quarter in...

  10. 20 CFR 632.17 - Planning process.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Planning process. 632.17 Section 632.17... process. (a) Each Native American grantee shall establish a planning process for the development of its Master Plan and Comprehensive Annual Plan. This planning process shall involve consideration of the...

  11. 31 CFR 92.17 - Final action.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Final action. 92.17 Section 92.17 Money and Finance: Treasury Regulations Relating to Money and Finance UNITED STATES MINT OPERATIONS AND... assessing official shall take into consideration the entire report prepared by the examining...

  12. 36 CFR 331.17 - Minerals.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Minerals. 331.17 Section 331..., KENTUCKY AND INDIANA § 331.17 Minerals. All activities in connection with prospecting, exploration, development, mining or other removal or the processing of mineral resources and all uses reasonably...

  13. 32 CFR 17.3 - Commission personnel.

    Science.gov (United States)

    2010-07-01

    ... with 32 CFR part 9, the Appointing Authority shall appoint at least three but no more than seven... questioning in any manner he deems appropriate. Consistent with 32 CFR part 9, any such questioning shall be... 32 National Defense 1 2010-07-01 2010-07-01 false Commission personnel. 17.3 Section 17.3...

  14. 40 CFR 61.17 - State authority.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false State authority. 61.17 Section 61.17 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL... shall not be construed to preclude any State or political subdivision thereof from— (1) Adopting...

  15. 28 CFR 17.30 - Classification challenges.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Classification challenges. 17.30 Section 17.30 Judicial Administration DEPARTMENT OF JUSTICE CLASSIFIED NATIONAL SECURITY INFORMATION AND... DRC shall redact the identity of an individual challenging a classification under paragraph (a)...

  16. 7 CFR 1215.17 - Research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Research. 1215.17 Section 1215.17 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE POPCORN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Popcorn Promotion, Research, and Consumer Information Order Definitions §...

  17. 8 CFR 245a.17 - Citizenship skills.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Citizenship skills. 245a.17 Section 245a.17... Citizenship skills. (a) Requirements. Applicants for adjustment under LIFE Legalization must meet the... permanent residence and may be based solely on the failure to pass the basic citizenship skills...

  18. 7 CFR 29.3618 - Rule 17.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Rule 17. 29.3618 Section 29.3618 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Rules § 29.3618 Rule 17. Any lot of tobacco which is not green but contains over...

  19. Syntax and Semantics of Babel-17

    CERN Document Server

    Obua, Steven

    2010-01-01

    We present Babel-17, the first programming language for purely functional structured programming (PFSP). Earlier work illustrated PFSP in the framework of a toy research language. Babel-17 takes this earlier work to a new level by showing how PFSP can be combined with pattern matching, object oriented programming, and features like concurrency, lazy evaluation and memoization.

  20. Syntax and Semantics of Babel-17

    OpenAIRE

    Obua, Steven

    2010-01-01

    We present Babel-17, the first programming language for purely functionalstructured programming (PFSP). Earlier work illustrated PFSP in the frameworkof a toy research language. Babel-17 takes this earlier work to a new level byshowing how PFSP can be combined with pattern matching, object orientedprogramming, and features like concurrency, lazy evaluation, memoization andsupport for lenses.

  1. More stories on Th17 cells

    Institute of Scientific and Technical Information of China (English)

    Alexandra S Basso; Hilde Cheroutre; Daniel Mucida

    2009-01-01

    For more than two decades, immunologists have been using the so-called Th1/Th2 paradigm to explain most of the phenomena related to adaptive immunity. The Th1/Th2 paradigm implied the existence of two different, mutually regulated, CD4+ T helper subsets: Th1 cells, driving cell-mediated immune responses involved in tissue damage and fighting infection against intracellular parasites; and Th2 cells that mediate IgE production and are particularly involved in eosinophilic inflammation, allergy and clearance of helminthic infections. A third member of the T helper set, IL-17-producing CD4+ T cells, now called Th17 cells, was recently described as a distinct lineage that does not share developmental pathways with either Thl or Th2 cells. The Th17 subset has been linked to autoimmune disorders, being able to produce IL-17, IL-17F and IL-21 among other inflammatory cytokines. Interestingly, it has been reported that there is not only a cross-regulation among Thl, Th2 and Th17 effector cells but there is also a dichotomy in the generation of Thl7 and T regulatory cells. Therefore, Treg and Th17 effector cells arise in a mutually exclusive fashion, depending on whether they are activated in the presence of TGF-β or TGF-β plus inflammatory cytokines such as IL-6. This review will address the discovery of the Th17 cells, and recent progress on their development and regulation.

  2. 31 CFR 223.17 - Revocation.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Revocation. 223.17 Section 223.17 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE SURETY COMPANIES DOING BUSINESS WITH THE...

  3. 43 CFR 17.232 - Postsecondary education.

    Science.gov (United States)

    2010-10-01

    ... promulgated by the Department of Education at 34 CFR part 104, subpart E. ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Postsecondary education. 17.232 Section 17... Postsecondary education. This section applies to postsecondary education and activities, including...

  4. 22 CFR 142.17 - New construction.

    Science.gov (United States)

    2010-04-01

    ... Uniform Federal Accessibility Standards (USAF) (appendix A to 41 CFR subpart 101-19.6) shall be deemed to... 22 Foreign Relations 1 2010-04-01 2010-04-01 false New construction. 142.17 Section 142.17 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS...

  5. 21 CFR 17.1 - Scope.

    Science.gov (United States)

    2010-04-01

    ... act that relate to prescription drug marketing practices. (b) Section 303(f)(1) of the act authorizing... mitigation strategies for drugs. (d) Section 303(g)(1) of the act authorizing civil money penalties for... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Scope. 17.1 Section 17.1 Food and Drugs FOOD...

  6. 38 CFR 17.902 - Preauthorization.

    Science.gov (United States)

    2010-07-01

    ... services; mental health services; training; substance abuse treatment; dental services; and travel (other..., (3) Name of veteran, (4) Veteran's Social Security number, (5) Type of service requested, (6) Medical... the following services or benefits under §§ 17.900 through 17.905: rental or purchase of...

  7. Main: DRE1COREZMRAB17 [PLACE

    Lifescience Database Archive (English)

    Full Text Available DRE1COREZMRAB17 S000401 27-Aug-2002 (last modified) uchi DRE1 core found in maize (Z.M.) rab17 g ... ting, by a protein in embryos specifically, but in leaves , was protected when was treated with ABA and droug ...

  8. 7 CFR 1218.17 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1218.17 Section 1218.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BLUEBERRY PROMOTION, RESEARCH,...

  9. 7 CFR 1209.17 - Promotion.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1209.17 Section 1209.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE MUSHROOM PROMOTION, RESEARCH,...

  10. 14 CFR 17.21 - Protest remedies.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Protest remedies. 17.21 Section 17.21 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES... are allowable to the extent permitted by the Equal Access to Justice Act, 5 U.S.C. 504(a)(1)(EAJA)....

  11. 31 CFR 17.160 - Communications.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Communications. 17.160 Section 17.160 Money and Finance: Treasury Office of the Secretary of the Treasury ENFORCEMENT OF NONDISCRIMINATION ON... Communications. (a) The agency shall take appropriate steps to effectively communicate with...

  12. 21 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...) Defective, for the purposes of interpreting 21 U.S.C. 333(g)(1)(B)(iii), includes any defect in performance... or respondent includes an individual, partnership, corporation, association, scientific or academic... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Definitions. 17.3 Section 17.3 Food and Drugs...

  13. 32 CFR 651.17 - Environmental justice.

    Science.gov (United States)

    2010-07-01

    ... § 651.17 Environmental justice. Executive Order 12898 (Federal Actions to Address Environmental Justice in Minority and Low-Income Populations, 11 February 1994, 3 CFR, 1994 Comp., p. 859) requires the... 32 National Defense 4 2010-07-01 2010-07-01 true Environmental justice. 651.17 Section...

  14. Antihypertensive effects of angiotensin-(1-7

    Directory of Open Access Journals (Sweden)

    M.C. Chappell

    1998-09-01

    Full Text Available Accumulating evidence suggests that angiotensin-(1-7 (Ang-(1-7 is an important component of the renin-angiotensin system and that the actions of the peptide may either contribute to or oppose those of Ang II. Ang-(1-7 can be converted directly from Ang I bypassing prerequisite formation of Ang II. Formation of Ang-(1-7 is under the control of at least three endopeptidases depending on the tissue compartment and include neprilysin, thimet oligopeptidase and prolyl oligopeptidase. Both neprilysin and thimet oligopeptidase are also involved in the metabolism of bradykinin and the atrial natriuretic peptide. Moreover, recent studies suggest that in addition to Ang I and bradykinin, Ang-(1-7 is an endogenous substrate for angiotensin converting enzyme. These enzymatic pathways may contribute to a complex relationship between the hypertensive actions of Ang II and various vasodepressor peptides from either the renin-angiotensin system or other peptide systems. Ang-(1-7 is devoid of the vasoconstrictor, central pressor, or thirst-stimulating actions associated with Ang II. In fact, new findings reveal depressor, vasodilator, and antihypertensive actions that may be more apparent in hypertensive animals or humans. Thus, Ang-(1-7 may oppose the actions of Ang II directly or as a result of increasing prostaglandins or nitric oxide. In this review, we examine the mechanisms by which Ang-(1-7 may contribute to cardiovascular regulation.

  15. 43 CFR 17.216 - Accessibility.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Accessibility. 17.216 Section 17.216 Public Lands: Interior Office of the Secretary of the Interior NONDISCRIMINATION IN FEDERALLY ASSISTED... Accessibility. No handicapped person shall, because a recipient's facilities are inaccessible to or unusable...

  16. 7 CFR 220.17 - Prohibitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Prohibitions. 220.17 Section 220.17 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... State and local sources for the maintenance of food programs for children shall not be diminished as...

  17. 28 CFR 17.26 - Derivative classification.

    Science.gov (United States)

    2010-07-01

    ..., the ISOO implementing directives in 32 CFR 2001.22, and internal Department directions provided by the... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Derivative classification. 17.26 Section... ACCESS TO CLASSIFIED INFORMATION Classified Information § 17.26 Derivative classification. (a)...

  18. Reference: DRE1COREZMRAB17 [PLACE

    Lifescience Database Archive (English)

    Full Text Available DRE1COREZMRAB17 Busk PK, Jensen AB, Pages M Regulatory elements in vivo in the prom...oter of the abscisic acid responsive gene rab17 from maize Plant J. 11: 1285-1295 (1997) PubMed: 9225468; ...

  19. Reference: DRE2COREZMRAB17 [PLACE

    Lifescience Database Archive (English)

    Full Text Available DRE2COREZMRAB17 Busk PK, Jensen AB, Pages M Regulatory elements in vivo in the prom...oter of the abscisic acid responsive gene rab17 from maize Plant J. 11: 1285-1295 (1997) PubMed: 9225468; ...

  20. 24 CFR 17.69 - Accounting control.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Accounting control. 17.69 Section... § 17.69 Accounting control. Each office and the Department Claims Officer shall process all claims collections through the appropriate accounting office and report the collection, compromise, suspension...

  1. 7 CFR 924.17 - Container.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container. 924.17 Section 924.17 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Container. Container means a box, bag, crate, lug, basket, carton, package, or any other type of...

  2. 7 CFR 1738.17 - Civil rights.

    Science.gov (United States)

    2010-01-01

    ... 20-15:320-15, “Equal Employment Opportunity in Construction Financed with RUS Loans”; 7 CFR parts 15 and 15b and 45 CFR part 90. ... 7 Agriculture 11 2010-01-01 2010-01-01 false Civil rights. 1738.17 Section 1738.17...

  3. 6 CFR 17.540 - Advertising.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Advertising. 17.540 Section 17.540 Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of...

  4. 20 CFR 655.17 - Advertising requirements.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Advertising requirements. 655.17 Section 655.17 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR TEMPORARY EMPLOYMENT OF FOREIGN WORKERS IN THE UNITED STATES Labor Certification Process and Enforcement...

  5. Carbon Monoxide Poisoning

    Science.gov (United States)

    ... Recommend on Facebook Tweet Share Compartir What is Carbon Monoxide? Carbon monoxide, or “CO,” is an odorless, colorless gas that can kill you. Carbon monoxide detector Where is CO found? CO is ...

  6. Net Ecosystem Carbon Flux

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Net Ecosystem Carbon Flux is defined as the year-over-year change in Total Ecosystem Carbon Stock, or the net rate of carbon exchange between an ecosystem and the...

  7. Carbon Monoxide (CO)

    Science.gov (United States)

    ... IAQ) » Carbon Monoxide's Impact on Indoor Air Quality Carbon Monoxide's Impact on Indoor Air Quality On this ... length of exposure. Top of Page Sources of Carbon Monoxide Sources of CO include: unvented kerosene and ...

  8. Abundances in red giant stars - Carbon and oxygen isotopes in carbon-rich molecular envelopes

    Science.gov (United States)

    Wannier, P. G.; Sahai, R.

    1987-01-01

    Millimeter-wave observations have been made of isotopically substituted CO toward the envelopes of 11 carbon-rich stars. In every case, C-13O was detected and model calculations were used to estimate the C-12/C-13 abundance ratio. C-17O was detected toward three, and possibly four, envelopes, with sensitive upper limits for two others. The CO-18 variant was detected in two envelopes. New results include determinations of oxygen isotopic ratios in the two carbon-rich protoplanetary nebulae CRL 26688 and CRL 618. As with other classes of red giant stars, the carbon-rich giants seem to be significantly, though variably, enriched in O-17. These results, in combination with observations in interstellar molecular clouds, indicate that current knowledge of stellar production of the CNO nuclides is far from satisfactory.

  9. Photoproton cross section for 17O

    International Nuclear Information System (INIS)

    The measurement of the 17O(γ,p)16N reaction from threshold to an excitation energy of 44 MeV is presented. These results have been summed with the previously measured total photoneutron cross section to provide an approximation to the total photoabsorption cross section of 17O. The magnitude of the 17O photoabsorption cross section at the peak of the Giant Dipole Resonance is considerably less than the equivalent value for the photoabsorption cross sections of 16O and 18O. In addition, the integrated total photoabsorption cross section for 17O (up to 40 MeV) exhausts only about 58% of the sum rule; the values for the cases of 16O and 18O are significantly larger than this. The present data along with results from other reaction channels of this nucleus, were used to make spin, parity, and isospin assignments for several states in 17O. 48 refs., 4 tabs., 7 figs

  10. Integral Ring Carbon-Carbon Piston

    Science.gov (United States)

    Northam, G. Burton (Inventor)

    1999-01-01

    An improved structure for a reciprocating internal combustion engine or compressor piston fabricate from carbon-carbon composite materials is disclosed. An integral ring carbon-carbon composite piston, disclosed herein, reduces the need for piston rings and for small clearances by providing a small flexible, integral component around the piston that allows for variation in clearance due to manufacturing tolerances, distortion due to pressure and thermal loads, and variations in thermal expansion differences between the piston and cylinder liner.

  11. Carbon dioxide sequestration by mineral carbonation

    OpenAIRE

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept behind mineral CO2 sequestration is the mimicking of natural weathering processes in which calcium or magnesium containing minerals react with gaseous CO2 and form solid calcium or magnesium carbonate...

  12. Formation of [b(n) + 17 + Ag]+ product ions from Ag+ cationized native and acetylated peptides.

    Science.gov (United States)

    Anbalagan, V; Perera, B A; Silva, A T M; Gallardo, A L; Barber, M; Barr, J M; Terkarli, S M; Talaty, E R; Van Stipdonk, M J

    2002-09-01

    We compared the tandem mass spectra of a range of native and acetylated Ag(+) cationized peptides to determine the influence of the derivatization step on the abundance of the [b(n) + 17 + Ag](+) product ions. Using tripeptides, the smallest for which the mechanisms to generate [b(2) - 1 + Ag](+) and [b(2) + 17 + Ag](+) products are both operative, we found that in most cases acetylation causes an increase in the abundance of the C-terminal rearrangement ion, [b(2) + 17 + Ag](+), relative to the rival N-terminal rearrangement ion, [b(2) - 1 + Ag](+). The presence of a free amino group to bind to the metal ion significantly influences the relative abundances of the product ions. We propose a mechanism for the formation of the [b(n) + 17 + Ag](+) that is based on the formation of a five-membered oxazolidin-5-one and tetrahedral carbon intermediate that may collapse to a peptide upon release of CO and an imine, aided by the fact that the ring formed during C-terminal rearrangement is both a hemiacylal and hemiaminal. We also identified an influence of amino acid sequence on the relative abundances of the [b(n) + 17 + Ag](+) and [b(n) - 1 + Ag](+) product ions, whereby bulky substituents located on the alpha-carbon of the amino acid to the C-terminal side of the cleavage site apparently promote the formation of the [b(n) + 17 + Ag](+) product over [b(n) - 1 + Ag](+) when the amino acid to the N-terminal side of the cleavage site is glycine. The latter ion is the favored product, however, when the bulky group is positioned on the alpha-carbon of the amino acid to the N-terminal side of the cleavage site. PMID:12271434

  13. 17alpha- and 17beta-boldenone 17-glucuronides: synthesis and complete characterization by 1H and 13C NMR.

    Science.gov (United States)

    Casati, Silvana; Ottria, Roberta; Ciuffreda, Pierangela

    2009-02-01

    Boldenone is an androgenic anabolic steroid intensively used for growth promoting purposes in animals destined for meat production and as a performance enhancer in athletics. Therefore its use is officially banned either in animals intended for consumption or in humans. Because most anabolic steroids are completely metabolized and usually no parent steroid is excreted, metabolite identification is crucial to detect the illegal use of anabolic steroids either in humans or in livestock. 17alpha- and 17beta-boldenone 17-glucuronides were synthesized, purified and characterized in order to provide suitable standards for the identification and quantification of these metabolites. PMID:19071152

  14. Are there carbon stars in the Bulge ?

    OpenAIRE

    Ng, Y. K.

    1998-01-01

    The bulge carbon stars have been a mystery since their discovery, because they are about 2.5mag too faint to be regarded as genuine AGB stars, if located inside the metal-rich bulge (m-M=14.5mag). Part of the mystery can be solved if these carbon stars are related to the Sagittarius dwarf galaxy (SDG; m-M=17.0mag). They are in that case not old and metal-rich, but young, ~0.1 Gyr, with SMC-like metallicity. The sigma_RV=113+/-14 km/s radial velocity dispersion of the stars appears to be consi...

  15. Carbon dioxide sequestration by mineral carbonation

    NARCIS (Netherlands)

    Huijgen, W.J.J.

    2007-01-01

    The increasing atmospheric carbon dioxide (CO2) concentration, mainly caused by fossil fuel combustion, has lead to concerns about global warming. A possible technology that can contribute to the reduction of carbon dioxide emissions is CO2 sequestration by mineral carbonation. The basic concept beh

  16. 17 CFR 240.17Ad-13 - Annual study and evaluation of internal accounting control.

    Science.gov (United States)

    2010-04-01

    ... internal accounting control. 240.17Ad-13 Section 240.17Ad-13 Commodity and Securities Exchanges SECURITIES... Company Rules § 240.17Ad-13 Annual study and evaluation of internal accounting control. (a) Accountant's... accountant concerning the transfer agent's system of internal accounting control and related procedures...

  17. 17 CFR 240.17f-2 - Fingerprinting of securities industry personnel.

    Science.gov (United States)

    2010-04-01

    ... interests in limited partnerships, unit investment trusts or real estate investment trusts; Provided, That... industry personnel. 240.17f-2 Section 240.17f-2 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... Activities § 240.17f-2 Fingerprinting of securities industry personnel. (a) Exemptions for the...

  18. 17 CFR 170.10 - Proficiency examinations (sections 4p and 17(p) of the Act).

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Proficiency examinations (sections 4p and 17(p) of the Act). 170.10 Section 170.10 Commodity and Securities Exchanges COMMODITY... examinations (sections 4p and 17(p) of the Act). A futures association may prescribe different...

  19. Synthesis and evaluation of novel 17-indazole androstene derivatives designed as CYP17 inhibitors.

    Science.gov (United States)

    Moreira, Vânia M A; Vasaitis, Tadas S; Njar, Vincent C O; Salvador, Jorge A R

    2007-12-01

    A series of novel 1H- and 2H-indazole derivatives of the commercially available dehydroepiandrosterone acetate have been synthesized and tested for inhibition of human cytochrome 17alpha-hydroxylase-C(17,20)-lyase (CYP17), androgen receptor (AR) binding affinity, and cytotoxic potential against three prostate cancer (PC) cell lines. PMID:17884122

  20. Composite carbon foam electrode

    Science.gov (United States)

    Mayer, S.T.; Pekala, R.W.; Kaschmitter, J.L.

    1997-05-06

    Carbon aerogels used as a binder for granulated materials, including other forms of carbon and metal additives, are cast onto carbon or metal fiber substrates to form composite carbon thin film sheets. The thin film sheets are utilized in electrochemical energy storage applications, such as electrochemical double layer capacitors (aerocapacitors), lithium based battery insertion electrodes, fuel cell electrodes, and electrocapacitive deionization electrodes. The composite carbon foam may be formed by prior known processes, but with the solid particles being added during the liquid phase of the process, i.e. prior to gelation. The other forms of carbon may include carbon microspheres, carbon powder, carbon aerogel powder or particles, graphite carbons. Metal and/or carbon fibers may be added for increased conductivity. The choice of materials and fibers will depend on the electrolyte used and the relative trade off of system resistivity and power to system energy. 1 fig.

  1. The Aryl Hydrocarbon Receptor: Differential Contribution to T Helper 17 and T Cytotoxic 17 Cell Development

    OpenAIRE

    Hayes, Mark D.; Ovcinnikovs, Vitalijs; Smith, Andrew G.; Kimber, Ian; Dearman, Rebecca J

    2014-01-01

    The aryl hydrocarbon receptor (AhR) has been shown to be required for optimal Thelper (Th) 17 cell activation. Th17 cells provide immunity against extracellular pathogens and are implicated in autoimmune diseases. Herein, the role of the AhR in cytokine production by Th17, and by the analogous population of T cytotoxic (Tc)17 cells, has been examined. Lymph node Tc (CD8+) and Th (CD4+) cells were isolated by negative selection from naive AhR+/− and AhR−/− mice and polarised to Tc1/Th1 or Tc17...

  2. Role of Th17 cells and IL-17 in lung transplant rejection

    Science.gov (United States)

    Wilkes, David S.

    2013-01-01

    In the past decade, advances in immunology have led to the recognition that T cell differentiation is not simply Th1 or Th2 but involves differentiation to other subsets, such as T regulatory cells, T follicular helper cells, and Th17 cells. Th17 cells, characterized by production of IL-17, IL-22, and IL-21, have been implicated in the pathogenesis of autoimmune diseases, like rheumatoid arthritis and multiple sclerosis, but also play an important role in host defense and mucosal immunity. IL-17, with its pleiotropic effects on stromal cells, as well as hematopoietic cells, has long been recognized as a possible mediator of rejection after lung transplantation. Recent data have implicated IL-17 and Th17 cells in the development of autoimmunity and chronic rejection after lung transplantation in both animal models and humans. In this review, we will discuss the current data on Th17 and the prospects for the future for lung transplantation. PMID:21279808

  3. African Studies Abstracts Online: number 17, 2007

    OpenAIRE

    African Studies Centre

    2007-01-01

    ASA Online provides a quarterly overview of journal articles and edited works on Africa in the field of the social sciences and the humanities available in the ASC library. Issue 17 (2007). African Studies Centre, Leiden.

  4. Papua New Guinea Tsunami, July 17, 1998

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — On the evening of Friday July 17, 1998, a magnitude Ms 7.1 earthquake occurred near the northwest coast Papua New Guinea 850 km (510 miles ) northwest of Port...

  5. 48 CFR 17.504 - Ordering procedures.

    Science.gov (United States)

    2010-10-01

    ... METHODS AND CONTRACT TYPES SPECIAL CONTRACTING METHODS Interagency Acquisitions Under the Economy Act 17.504 Ordering procedures. (a) Before placing an Economy Act order for supplies or services with...

  6. 48 CFR 17.505 - Payment.

    Science.gov (United States)

    2010-10-01

    ... CONTRACT TYPES SPECIAL CONTRACTING METHODS Interagency Acquisitions Under the Economy Act 17.505 Payment... of payment. (d) If the Economy Act order requires use of a contract by the servicing agency, then...

  7. Mutagenicity of carbon nanomaterials

    DEFF Research Database (Denmark)

    Wallin, Håkan; Jacobsen, Nicklas Raun; White, Paul A;

    2011-01-01

    Carbon nanomaterials such carbon nanotubes, graphene and fullerenes are some the most promising nanomaterials. Although carbon nanomaterials have been reported to possess genotoxic potential, it is imperitive to analyse the data on the genotoxicity of carbon nanomaterials in vivo and in vitro and...

  8. Expression of interleukin-17RC protein in normal human tissues

    OpenAIRE

    2008-01-01

    Background Interleukin-17 (IL-17) cytokines and receptors play an important role in many autoimmune and inflammatory diseases. IL-17 receptors IL-17RA and IL-17RC have been found to form a heterodimer for mediating the signals of IL-17A and IL-17F cytokines. While the function and signaling pathway of IL-17RA has been revealed, IL-17RC has not been well characterized. The function and signaling pathway of IL-17RC remain largely unknown. The purpose of the present study was to systematically e...

  9. Sensorineural Hearing Loss following Carbon Monoxide Poisoning

    OpenAIRE

    Pillion, Joseph P.

    2012-01-01

    A case study is presented of a 17-year-old male who sustained an anoxic brain injury and sensorineural hearing loss secondary to carbon monoxide poisoning. Audiological data is presented showing a slightly asymmetrical hearing loss of sensorineural origin and mild-to-severe degree for both ears. Word recognition performance was fair to poor bilaterally for speech presented at normal conversational levels in quiet. Management considerations of the hearing loss are discussed.

  10. Relativistic Electron Transport Through Carbon Foils

    Science.gov (United States)

    Seliger, M.; Takasi, K.; Reinhold, C. O.; Takabayashi, Y.; Ito, T.; Komaki, K.; Azuma, T.; Yamazaki, Y.; Yamazaki, Y.

    We present a theoretical study of convoy electron emission resulting from transmission of relativistic 390 MeV/amu Ar17+ ions through carbon foils of various thicknesses. Our approach is based on a Langevin equation describing the random walk of the electron initially bound to the argon nucleus and later in the continuum. The calculated spectra of ejected electrons in the forward direction exhibit clear signatures of multiple scattering and are found to be in good agreement with recent experimental data.

  11. Electroanalysis with carbon paste electrodes

    CERN Document Server

    Svancara, Ivan; Walcarius, Alain; Vytras, Karel

    2011-01-01

    Introduction to Electrochemistry and Electroanalysis with Carbon Paste-Based ElectrodesHistorical Survey and GlossaryField in Publication Activities and LiteratureCarbon Pastes and Carbon Paste ElectrodesCarbon Paste as the Binary MixtureClassification of Carbon Pastes and Carbon Paste ElectrodesConstruction of Carbon Paste HoldersCarbon Paste as the Electrode MaterialPhysicochemical Properties of Carbon PastesElectrochemical Characteristics of Carbon PastesTesting of Unmodified CPEsIntera

  12. Compartmentalized Production of CCL17 In Vivo

    OpenAIRE

    Alferink, Judith; Lieberam, Ivo; Reindl, Wolfgang; Behrens, Andrea; Weiß, Susanne; Hüser, Norbert; Gerauer, Klaus; Ross, Ralf; Reske-Kunz, Angelika B.; Ahmad-Nejad, Parviz; Wagner, Hermann; Förster, Irmgard

    2003-01-01

    Dendritic cells (DCs)* fulfill an important regulatory function at the interface of the innate and adaptive immune system. The thymus and activation-regulated chemokine (TARC/CCL17) is produced by DCs and facilitates the attraction of activated T cells. Using a fluorescence-based in vivo reporter system, we show that CCL17 expression in mice is found in activated Langerhans cells and mature DCs located in various lymphoid and nonlymphoid organs, and is up-regulated after stimulation with Toll...

  13. Pyrolyzed thin film carbon

    Science.gov (United States)

    Tai, Yu-Chong (Inventor); Liger, Matthieu (Inventor); Harder, Theodore (Inventor); Konishi, Satoshi (Inventor); Miserendino, Scott (Inventor)

    2010-01-01

    A method of making carbon thin films comprises depositing a catalyst on a substrate, depositing a hydrocarbon in contact with the catalyst and pyrolyzing the hydrocarbon. A method of controlling a carbon thin film density comprises etching a cavity into a substrate, depositing a hydrocarbon into the cavity, and pyrolyzing the hydrocarbon while in the cavity to form a carbon thin film. Controlling a carbon thin film density is achieved by changing the volume of the cavity. Methods of making carbon containing patterned structures are also provided. Carbon thin films and carbon containing patterned structures can be used in NEMS, MEMS, liquid chromatography, and sensor devices.

  14. n-Nonane Nucleation in the Presence of Carbon Dioxide

    Czech Academy of Sciences Publication Activity Database

    Labetski, D.G.; Hrubý, Jan; Dongen, M. E. H.

    Vienna : Springer Netherlands , 2007, s. 78-82. ISBN 978-1-4020-6474-6. [Nucleation and Atmospheric Aerosols International Conference /17./. Galway (IE), 13.08.2007-17.08.2007] R&D Projects: GA ČR GA101/05/2214 Institutional research plan: CEZ:AV0Z20760514 Keywords : nucleation * natural gas * carbon dioxide Subject RIV: BJ - Thermodynamics http://www.springerlink.com/content/r278044g8244v561/

  15. Supercritical carbon dioxide (SC-CO2 as a clean technology for palm kernel oil extraction

    Directory of Open Access Journals (Sweden)

    Norhuda I

    2009-04-01

    Kyoto Protocol. Keywords: By-product, Solvent extraction, Kyoto protocol, Supercritical Carbon Dioxide, Palm Kernel Oil Received: 13 July 2008 / Received in revised form: 17 February 2009, Accepted: 28 February 2009, Published online: 12 March 2009

  16. Wood - a carbon depot

    OpenAIRE

    Lipušček, Igor; Tišler, Vesna

    2003-01-01

    The article examines the global movement of carbon dioxide, the most important greenhouse gas due to its large quantities. We studied the carbon cycle with possibilities of its extension, and analysed the mechanisms that remove carbon dioxide from the atmosphere and bind it into solid substances for a longer period of time. The focus was on carbon dioxide sink into biomass and carbon deposit in wood. On the basis of wood component data and chemical analysis of the components, we calculated th...

  17. Regulation of inflammatory responses by IL-17F

    OpenAIRE

    Yang, Xuexian O.; Chang, Seon Hee; Park, Heon; Nurieva, Roza; Shah, Bhavin; Acero, Luis; Wang, Yi-hong; Schluns, Kimberly S.; Broaddus, Russell R.; Zhu, Zhou; Dong, Chen

    2008-01-01

    Although interleukin (IL) 17 has been extensively characterized, the function of IL-17F, which has an expression pattern regulated similarly to IL-17, is poorly understood. We show that like IL-17, IL-17F regulates proinflammatory gene expression in vitro, and this requires IL-17 receptor A, tumor necrosis factor receptor–associated factor 6, and Act1. In vivo, overexpression of IL-17F in lung epithelium led to infiltration of lymphocytes and macrophages and mucus hyperplasia, similar to obse...

  18. Interleukin-17 is a negative regulator of established allergic asthma

    OpenAIRE

    Schnyder-Candrian, Silvia; Togbe, Dieudonnée; Couillin, Isabelle; Mercier, Isabelle; Brombacher, Frank; Quesniaux, Valérie,; Fossiez, Francois; Ryffel, Bernhard; Schnyder, Bruno

    2006-01-01

    T helper (Th)17 cells producing interleukin (IL)-17 play a role in autoimmune and allergic inflammation. Here, we show that IL-23 induces IL-17 in the lung and IL-17 is required during antigen sensitization to develop allergic asthma, as shown in IL-17R–deficient mice. Since IL-17 expression increased further upon antigen challenge, we addressed its function in the effector phase. Most strikingly, neutralization of IL-17 augmented the allergic response in sensitized mice. Conversely, exogenou...

  19. Synthesis of novel 21-trifluoropregnane steroids: inhibitors of 17 alpha-hydroxylase/17,20-lyase (17 alpha-lyase).

    Science.gov (United States)

    Njar, V C; Klus, G T; Johnson, H H; Brodie, A M

    1997-06-01

    Novel 21-trifluoropregnenolone (6), 21-trifluoroprogesterone (7) and related compounds 4a and 8 have been synthesized in high yields from 3 beta-acetoxyandrost-5-ene-17 beta-carbaldehyde (3). The key reaction was the conversion of 3 into the 21-trifluoromethyl-20-alcohol as a diastereomeric mixture (4) by trifluoromethyltrimethylsilane (TMS-CF3) in the presence of tetrabutylammonium fluoride (TBAF). All compounds, including 6 and 7, were unambiguously characterized by IR, 1H and 19F NMR, high-resolution mass spectrometry (HRMS), and elemental analysis. On this basis, we concluded that the only report of an earlier synthesis of 6 and 7 is erroneous. Enzyme inhibition studies showed that 20 xi-hydroxy-21-trifluoropregn-4-en-3-one (8) is a potent inhibitor (IC50 value = 0.6 microM) of rat 17 alpha-hydroxylase/17,20-lyase. PMID:9185294

  20. Carbon coated textiles for flexible energy storage

    Energy Technology Data Exchange (ETDEWEB)

    Jost, Kristy [Drexel Univ., Philadelphia, PA (United States). Fashion, Product, Design and Merchandising Dept., A. J. Drexel Nanotechnology Inst. and Dept. of Materials Science and Engineering; Perez, Carlos R. [Drexel Univ., Philadelphia, PA (United States). A. J. Drexel Nanotechnology Inst. and Dept. of Materials Science and Engineering; McDonough, John K. [Drexel Univ., Philadelphia, PA (United States). A. J. Drexel Nanotechnology Inst. and Dept. of Materials Science and Engineering; Presser, Volker [Drexel Univ., Philadelphia, PA (United States). A. J. Drexel Nanotechnology Inst. and Dept. of Materials Science and Engineering; Heon, Min [Drexel Univ., Philadelphia, PA (United States). A. J. Drexel Nanotechnology Inst. and Dept. of Materials Science and Engineering; Dion, Genevieve [Drexel Univ., Philadelphia, PA (United States). Fashion, Product, Design and Merchandising Dept.; Gogotsi, Yury [Drexel Univ., Philadelphia, PA (United States). A. J. Drexel Nanotechnology Inst. and Dept. of Materials Science and Engineering

    2011-10-20

    This paper describes a flexible and lightweight fabric supercapacitor electrode as a possible energy source in smart garments. We examined the electrochemical behavior of porous carbon materials impregnated into woven cotton and polyester fabrics using a traditional printmaking technique (screen printing). The porous structure of such fabrics makes them attractive for supercapacitor applications that need porous films for ion transfer between electrodes. We used cyclic voltammetry, galvanostatic cycling and electrochemical impedance spectroscopy to study the capacitive behaviour of carbon materials using nontoxic aqueous electrolytes including sodium sulfate and lithium sulfate. Electrodes coated with activated carbon (YP17) and tested at ~0.25 A·g⁻¹ achieved a high gravimetric and areal capacitance, an average of 85 F·g⁻¹ on cotton lawn and polyester microfiber, both corresponding to ~0.43 F·cm⁻².

  1. Divergent Gold(I)-Catalyzed Skeletal Rearrangements of 1,7-Enynes.

    Science.gov (United States)

    Meiß, Rebecca; Kumar, Kamal; Waldmann, Herbert

    2015-09-21

    The gold(I) complex catalyzed cycloisomerization and skeletal rearrangement of 1,n-enynes (n=5-7) is a powerful methodology for the efficient synthesis of complex molecular architectures. In contrast to 1,6-enynes, readily accessible homologous 1,7-enynes are largely unexplored in such transformations. Here, the divergent skeletal rearrangement of all-carbon 1,7-enynes by catalysis with a cationic gold(I) complex is reported. Depending on electronic and steric factors, differently substituted 1,7-enynes react via different carbocations formed from a common gold carbene intermediate to yield on the one hand novel exocyclic allenes and on the other hand tricyclic hexahydro-anthracenes through a novel dehydrogenative Diels-Alder reaction. PMID:26356499

  2. Accelerating Mineral Carbonation Using Carbonic Anhydrase.

    Science.gov (United States)

    Power, Ian M; Harrison, Anna L; Dipple, Gregory M

    2016-03-01

    Carbonic anhydrase (CA) enzymes have gained considerable attention for their potential use in carbon dioxide (CO2) capture technologies because they are able to catalyze rapidly the interconversion of aqueous CO2 and bicarbonate. However, there are challenges for widespread implementation including the need to develop mineralization process routes for permanent carbon storage. Mineral carbonation of highly reactive feedstocks may be limited by the supply rate of CO2. This rate limitation can be directly addressed by incorporating enzyme-catalyzed CO2 hydration. This study examined the effects of bovine carbonic anhydrase (BCA) and CO2-rich gas streams on the carbonation rate of brucite [Mg(OH)2], a highly reactive mineral. Alkaline brucite slurries were amended with BCA and supplied with 10% CO2 gas while aqueous chemistry and solids were monitored throughout the experiments (hours to days). In comparison to controls, brucite carbonation using BCA was accelerated by up to 240%. Nesquehonite [MgCO3·3H2O] precipitation limited the accumulation of hydrated CO2 species, apparently preventing BCA from catalyzing the dehydration reaction. Geochemical models reproduce observed reaction progress in all experiments, revealing a linear correlation between CO2 uptake and carbonation rate. Data demonstrates that carbonation in BCA-amended reactors remained limited by CO2 supply, implying further acceleration is possible. PMID:26829491

  3. Carbon fuel cells with carbon corrosion suppression

    Science.gov (United States)

    Cooper, John F.

    2012-04-10

    An electrochemical cell apparatus that can operate as either a fuel cell or a battery includes a cathode compartment, an anode compartment operatively connected to the cathode compartment, and a carbon fuel cell section connected to the anode compartment and the cathode compartment. An effusion plate is operatively positioned adjacent the anode compartment or the cathode compartment. The effusion plate allows passage of carbon dioxide. Carbon dioxide exhaust channels are operatively positioned in the electrochemical cell to direct the carbon dioxide from the electrochemical cell.

  4. Structural basis of receptor sharing by interleukin 17 cytokines

    Energy Technology Data Exchange (ETDEWEB)

    Ely, Lauren K.; Fischer, Suzanne; Garcia, K. Christopher; Stanford-MED

    2010-02-19

    Interleukin 17 (IL-17)-producing helper T cells (T{sub H}-17 cells), together with their effector cytokines, including members of the IL-17 family, are emerging as key mediators of chronic inflammatory and autoimmune disorders. Here we present the crystal structure of a complex of IL-17 receptor A (IL-17RA) bound to IL-17F in a 1:2 stoichiometry. The mechanism of complex formation was unique for cytokines and involved the engagement of IL-17 by two fibronectin-type domains of IL-17RA in a groove between the IL-17 homodimer interface. Binding of the first receptor to the IL-17 cytokines modulated the affinity and specificity of the second receptor-binding event, thereby promoting heterodimeric versus homodimeric complex formation. IL-17RA used a common recognition strategy to bind to several members of the IL-17 family, which allows it to potentially act as a shared receptor in multiple different signaling complexes.

  5. The Social Desirability Scale-17 (SDS-17): Convergent validity, discriminant validity, and relationship with age

    OpenAIRE

    Stöber, Joachim

    2001-01-01

    Four studies are presented investigating the convergent validity, discriminant validity, and relationship with age of the Social Desirability Scale-17 (SDS-17). As to convergent validity, SDS-17 scores showed correlations between .52 and .85 with other measures of social desirability (Eysenck Personality Questionnaire-Lie Scale, Sets of Four Scale, Marlowe-Crowne Scale). Moreover, scores were highly sensitive to social-desirability-provoking instructions (job-application instruction). Finally...

  6. Carbon cycling in Lake Superior

    Science.gov (United States)

    Urban, N. R.; Auer, M. T.; Green, S. A.; Lu, X.; Apul, D. S.; Powell, K. D.; Bub, L.

    2005-06-01

    Carbon (C) cycling in Lake Superior was studied within the Keweenaw Interdisciplinary Transport Experiment in Superior (KITES) project to assess (1) whether the lake is net heterotrophic, (2) sources, sinks and residence time for dissolved organic carbon (DOC), (3) importance of terrigenous organic C subsidies, and (4) factors limiting C flow through bacteria. During 3 years of fieldwork, measurements were made of spatial and temporal distributions of C pools and rates of photosynthesis, community respiration, and bacterial production. Measurements were made of the composition of dissolved organic matter (DOM), rates of DOM photolysis, lability of DOM toward microbial consumption, and river inputs of DOM. All measurements suggest the lake is net heterotrophic. The C:N ratios of DOM suggest that it is primarily of terrigenous origin, but other characteristics (size distribution, UV absorption) point to the presence of autochthonous DOM and to alteration of terrigenous material. The lake mass balance indicates that the residence time (˜8 years) of the DOC pool (17 Tg) is short relative to the hydrologic residence time (170 years). The known flux of terrigenous DOC (˜1 Tg/yr) is too low to support annual bacterial carbon demand (6-38 Tg/yr), but microbial respiration is the major sink for terrigenous DOC. A rapidly cycling, autochthonous DOC pool must exist. Microbial activity was correlated with temperature, phosphorus availability, and DOC concentration but not with photosynthesis rates. Measurements of respiration (˜40 Tg/yr), photosynthesis (2-7 Tg/yr), and bacterial production (0.5-2 Tg/yr) are not all mutually compatible and result in a discrepancy in the organic carbon budget.

  7. CYP17 inhibitors for prostate cancer therapy.

    Science.gov (United States)

    Vasaitis, Tadas S; Bruno, Robert D; Njar, Vincent C O

    2011-05-01

    Prostate cancer (PC) is now the second most prevalent cause of death in men in the USA and Europe. At present, the major treatment options include surgical or medical castration. These strategies cause ablation of the production of testosterone (T), dihydrotestosterone (DHT) and related androgens by the testes. However, because these procedures do not affect adrenal, prostate and other tissues' androgen production, they are often combined with androgen receptor antagonists to block their action. Indeed, recent studies have unequivocally established that in castration-resistant prostate cancer (CRPC) many androgen-regulated genes become re-expressed and tissue androgen levels increase despite low serum levels. Clearly, inhibition of the key enzyme which catalyzes the biosynthesis of androgens from pregnane precursors, 17α-hydroxy/17,20-lyase (hereafter referred to as CYP17) could prevent androgen production from all sources. Thus, total ablation of androgen production by potent CYP17 inhibitors may provide effective treatment of prostate cancer patients. This review highlights the role of androgen biosynthesis in the progression of prostate cancer and the impact of CYP17 inhibitors, such as ketoconazole, abiraterone acetate, VN/124-1 (TOK-001) and TAK-700 in the clinic and in clinical development. Article from the special issue on Targeted Inhibitors. PMID:21092758

  8. Radioimmunoassay for serum 11-deoxy-17-ketosteroids

    International Nuclear Information System (INIS)

    A simplified method for evaluating serum 11-deoxy-17-ketosteroids (11-deoxy-17-KS) equivalent to dehydroepiandrosterone sulfate (DHEAS) has been developed without solvolysis and chromatography. Blood serum or plasma (5 mu l) was added to 1 ml of ethanol, mixed, and centrifuged, and 10 or 20 mu l of the supernatant was evaporated to dryness and incubated with anti-11-deoxy-17-KS antiserum obtained by immunizing a rabbit with DHEA-3.O. CO-BSA which was prepared from DHEA-3.O.COCl and containing DHEAS-7α3H, pepsin-treated human immune serum globulin and bovine serum albumin. Ammonium sulfate was used to separate free from bound DHEAS-7α3H. The accuracy, precision and sensitivity were satisfactory. The blank values could not be differentiated from zero. As the antiserum reacted not only on DHEAS but also on androsterone sulfate and etiocholanolone sulfate, serum 11-deoxy-17KS obtained by the radioimmunoassay expressed nearly the sum of 100 percent of DHEAS, 45 percent of androsterone sulfate and 35 percent of etiocholanolone sulfate in the serum. A good correlation was found between serum 11-deoxy-17-KS and DHEAS obtained by the radioimmunoassay described in a previous paper. The present radioimmunoassay is the simplest method for the evaluation of the concentrations of C19 steroids in the serum. (auth)

  9. Inhibiting complex IL-17A and IL-17RA interactions with a linear peptide.

    Science.gov (United States)

    Liu, Shenping; Desharnais, Joel; Sahasrabudhe, Parag V; Jin, Ping; Li, Wei; Oates, Bryan D; Shanker, Suman; Banker, Mary Ellen; Chrunyk, Boris A; Song, Xi; Feng, Xidong; Griffor, Matt; Jimenez, Judith; Chen, Gang; Tumelty, David; Bhat, Abhijit; Bradshaw, Curt W; Woodnutt, Gary; Lappe, Rodney W; Thorarensen, Atli; Qiu, Xiayang; Withka, Jane M; Wood, Lauren D

    2016-01-01

    IL-17A is a pro-inflammatory cytokine that has been implicated in autoimmune and inflammatory diseases. Monoclonal antibodies inhibiting IL-17A signaling have demonstrated remarkable efficacy, but an oral therapy is still lacking. A high affinity IL-17A peptide antagonist (HAP) of 15 residues was identified through phage-display screening followed by saturation mutagenesis optimization and amino acid substitutions. HAP binds specifically to IL-17A and inhibits the interaction of the cytokine with its receptor, IL-17RA. Tested in primary human cells, HAP blocked the production of multiple inflammatory cytokines. Crystal structure studies revealed that two HAP molecules bind to one IL-17A dimer symmetrically. The N-terminal portions of HAP form a β-strand that inserts between two IL-17A monomers while the C-terminal section forms an α helix that directly blocks IL-17RA from binding to the same region of IL-17A. This mode of inhibition suggests opportunities for developing peptide antagonists against this challenging target. PMID:27184415

  10. The Aryl Hydrocarbon Receptor: Differential Contribution to T Helper 17 and T Cytotoxic 17 Cell Development

    OpenAIRE

    Mark D Hayes; Vitalijs Ovcinnikovs; Smith, Andrew G.; Ian Kimber; Dearman, Rebecca J.

    2014-01-01

    The aryl hydrocarbon receptor (AhR) has been shown to be required for optimal Thelper (Th) 17 cell activation. Th17 cells provide immunity against extracellular pathogens and are implicated in autoimmune diseases. Herein, the role of the AhR in cytokine production by Th17, and by the analogous population of T cytotoxic (Tc)17 cells, has been examined. Lymph node Tc (CD8(+)) and Th (CD4(+)) cells were isolated by negative selection from naive AhR(+/-) and AhR(-/-) mice and polarised to Tc1/Th1...

  11. 27 CFR 17.7 - Delegations of the Administrator.

    Science.gov (United States)

    2010-04-01

    ... in TTB Order 1135.17, Delegation of the Administrator's Authorities in 27 CFR Part 17, Drawback on... Administrator. 17.7 Section 17.7 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... PRODUCTS General Provisions § 17.7 Delegations of the Administrator. The regulatory authorities of...

  12. Molecular cloning and characterization of duck interleukin-17

    Science.gov (United States)

    Interleukin-17 (IL-17) belonging to the Th17 family is a proinflammatory cytokine produced by activated T cells. A 1034-bp cDNA encoding duck IL-17 (duIL-17) was cloned from ConA-activated splenic lymphocytes of ducks. The encoded protein, predicted to consisted of 169 amino acids, displayed a molec...

  13. 6 CFR 17.305 - Preference in admission.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Preference in admission. 17.305 Section 17.305... the Basis of Sex in Admission and Recruitment Prohibited § 17.305 Preference in admission. A recipient to which §§ 17.300 through 17.310 apply shall not give preference to applicants for admission, on...

  14. Interleukin-17A inhibits the expansion of IL-17A-producing T cells in mice through “short-loop” inhibition via IL-17 receptor.1

    OpenAIRE

    Smith, Emily; Stark, Matthew A.; Zarbock, Alexander; Burcin, Tracy L.; Bruce, Anthony C.; Vaswani, Devin; Foley, Patricia; Ley, Klaus

    2008-01-01

    Interleukin-23 (IL-23) and IL-17A regulate granulopoiesis through Granulocyte-Colony Stimulating Factor (G-CSF), the main granulopoietic cytokine. IL-23 is secreted by activated macrophages and dendritic cells and promotes the expansion of three subsets of IL-17A-expressing neutrophil-regulatory T (Tn) cells; CD4−CD8−αβlow, CD4+CD8−αβ+ (Th17) and γδ+ T cells. Here we investigate the effects of IL-17A on circulating neutrophil levels using IL-17 receptor (Il17ra−/−) deficient mice and Il17ra−/...

  15. An Evaluation of the MOD17 Gross Primary Production Algorithm in a Mangrove Forest

    Science.gov (United States)

    Wells, H.; Najjar, R.; Herrmann, M.; Fuentes, J. D.; Ruiz-Plancarte, J.

    2015-12-01

    Though coastal wetlands occupy a small fraction of the Earth's surface, they are extremely active ecosystems and play a significant role in the global carbon budget. However, coastal wetlands are still poorly understood, especially when compared to open-ocean and terrestrial ecosystems. This is partly due to the limited in situ observations in these areas. One of the ways around the limited in situ data is to use remote sensing products. Here we present the first evaluation of the MOD17 remote sensing algorithm of gross primary productivity (GPP) in a mangrove forest using data from a flux tower in the Florida Everglades. MOD17 utilizes remote sensing products from the Moderate Resolution Imaging Spectroradiometer and meteorological fields from the NCEP/DOE Reanalysis 2. MOD17 is found to capture the long-term mean and seasonal amplitude of GPP but has significant errors describing the interannual variability, intramonthly variability, and the phasing of the annual cycle in GPP. Regarding the latter, MOD17 overestimates GPP when salinity is high and underestimates it when it is low, consistent with the fact that MOD17 ignores salinity and salinity tends to decrease GPP. Including salinity in the algorithm would then most likely improve its accuracy. MOD17 also assumes that GPP is linear with respect to PAR (photosynthetically active radiation), which does not hold true in the mangroves. Finally, the estimated PAR and air temperature inputs to MOD17 were found to be significantly lower than observed. In summary, while MOD17 captures some aspects of GPP variability at this mangrove site, it appears to be doing so for the wrong reasons.

  16. Carbon Neutrality and Bioenergy: A Zero-Sum Game?

    OpenAIRE

    Sedjo, Roger A.

    2011-01-01

    Biomass, a renewable energy source, has been viewed as “carbon neutral”—that is, its use as energy is presumed not to release net carbon dioxide. However, this assumption of carbon neutrality has recently been challenged. In 2010 two letters were sent to the Congress by eminent scientists examining the merits—or demerits—of biomass for climate change mitigation. The first, from about 90 scientists (to Nancy Pelosi and Harry Reid, from W.H. Schlesinger et al. May 17, 2010), questioned the trea...

  17. Dense carbon monoliths for supercapacitors with outstanding volumetric capacitances

    OpenAIRE

    Kunowsky, Mirko; García Gómez, Alejandra; Barranco, V.; Rojo, José M.; Ibáñez Ulargui, Joaquín; Carruthers, James Donald; Linares Solano, Ángel

    2014-01-01

    A commercially available dense carbon monolith (CM) and four carbon monoliths obtained from it have been studied as electrochemical capacitor electrodes in a two-electrode cell. CM has: (i) very high density (1.17 g cm−3), (ii) high electrical conductivity (9.3 S cm−1), (iii) well-compacted and interconnected carbon spheres, (iv) homogeneous microporous structure and (v) apparent BET surface area of 957 m2g−1. It presents interesting electrochemical behaviors (e.g., excellent gravimetric capa...

  18. Spin Waves in Ho2Co17

    DEFF Research Database (Denmark)

    Clausen, Kurt Nørgaard; Lebech, Bente

    1980-01-01

    Spin wave excitations in a single crystal of Ho2Co17 have been studied at 4.8 and 78 K. The results are discussed in terms of a linear spin wave model. At 78 K both ground state and excited state spin waves are observed.......Spin wave excitations in a single crystal of Ho2Co17 have been studied at 4.8 and 78 K. The results are discussed in terms of a linear spin wave model. At 78 K both ground state and excited state spin waves are observed....

  19. Rapid Assessment of U.S. Forest and Soil Organic Carbon Storage and Forest Biomass Carbon-Sequestration Capacity

    Science.gov (United States)

    Sundquist, Eric T.; Ackerman, Katherine V.; Bliss, Norman B.; Kellndorfer, Josef M.; Reeves, Matt C.; Rollins, Matthew G.

    2009-01-01

    This report provides results of a rapid assessment of biological carbon stocks and forest biomass carbon sequestration capacity in the conterminous United States. Maps available from the U.S. Department of Agriculture are used to calculate estimates of current organic carbon storage in soils (73 petagrams of carbon, or PgC) and forest biomass (17 PgC). Of these totals, 3.5 PgC of soil organic carbon and 0.8 PgC of forest biomass carbon occur on lands managed by the U.S. Department of the Interior (DOI). Maps of potential vegetation are used to estimate hypothetical forest biomass carbon sequestration capacities that are 3-7 PgC higher than current forest biomass carbon storage in the conterminous United States. Most of the estimated hypothetical additional forest biomass carbon sequestration capacity is accrued in areas currently occupied by agriculture and development. Hypothetical forest biomass carbon sequestration capacities calculated for existing forests and woodlands are within +or- 1 PgC of estimated current forest biomass carbon storage. Hypothetical forest biomass sequestration capacities on lands managed by the DOI in the conterminous United States are 0-0.4 PgC higher than existing forest biomass carbon storage. Implications for forest and other land management practices are not considered in this report. Uncertainties in the values reported here are large and difficult to quantify, particularly for hypothetical carbon sequestration capacities. Nevertheless, this rapid assessment helps to frame policy and management discussion by providing estimates that can be compared to amounts necessary to reduce predicted future atmospheric carbon dioxide levels.

  20. Carbon nanotube cathode with capping carbon nanosheet

    Science.gov (United States)

    Li, Xin; Zhao, Dengchao; Pang, Kaige; Pang, Junchao; Liu, Weihua; Liu, Hongzhong; Wang, Xiaoli

    2013-10-01

    Here, we report a vertically aligned carbon nanotube (VACNT) film capped with a few layer of carbon nanosheet (FLCN) synthesized by chemical vapor deposition using a carbon source from iron phthalocyanine pyrolysis. The square resistance of the VACNT film is significantly reduced from 1500 Ω/□ to 300 Ω/□ when it is capped with carbon nanosheet. The VACNT capped with carbon nanosheet was transferred to an ITO glass substrate in an inverted configuration so that the carbon nanosheet served as a flexible transparent electrode at the bottom and the VACNT roots served as emission tips. Because all of the VACNTs start growing from a flat silicon substrate, the VACNT roots are very neat and uniform in height. A field emission test of the carbon nanosheet-capped VACNT film proved that the CNT roots show better uniformity in field emission and the carbon nanosheet cap could also potentially serve as a flexible transparent electrode, which is highly desired in photo-assisted field emission.

  1. Preparation of Pt–Ru bimetallic catalyst supported on carbon nanotubes

    Indian Academy of Sciences (India)

    B Rajesh; K Ravindranathan Thampi; J -M Bonard; B Viswanathan

    2000-10-01

    The template carbonization of polyphenyl acetylene yields hollow, uniform cylindrical carbon nanotubes with outer diameter almost equal to pore diameter of the template used. High resolution transmission electron microscopic investigation reveals that Pt–Ru nanoparticles are highly dispersed inside the tube with an average particle size of 1.7 nm.

  2. Midway Atoll Site P17 12/4/2002 16-17M

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Midway Atoll, site P17 (28.231 N, 177.318 W), between 16 and 17 meters along a permanent transect.

  3. Hsp90 inhibitor 17-allylamino-17-demethoxygeldanamycin inhibits the proliferation of ARPE-19 cells

    Directory of Open Access Journals (Sweden)

    Wang Lin

    2010-04-01

    Full Text Available Abstract Background The antiproliferative effect of the Hsp90 inhibitor 17-AAG (17-allylamino-17-demethoxygeldanamycin on human retinal pigment epithelial cells is investigated. Methods MTT and flow cytometry were used to study the antiproliferative effects of the 17-AAG treatment of ARPE-19 cells. 2D gel electrophoresis (2-DE and mass spectrometry were applied to detect the altered expression of proteins, which was verified by real-time PCR. Gene Ontology analysis and Ingenuity Pathway Analysis (IPA were utilized to analyze the signaling pathways, cellular location, function, and network connections of the identified proteins. And SOD assay was employed to confirm the analysis. Results 17-AAG suppressed the proliferation of ARPE-19 cells by inducing cell cycle arrest and apoptosis. Proteomic analysis revealed that the expression of 94 proteins was altered by a factor of more than 1.5 following exposure to 17-AAG. Of these 94, 87 proteins were identified. Real-time PCR results indicated that Hsp90 and Hsp70, which were not identified by proteomic analysis, were both upregulated upon 17-AAG treatment. IPA revealed that most of the proteins have functions that are related to oxidative stress, as verified by SOD assay, while canonical pathway analysis revealed glycolysis/gluconeogenesis. Conclusions 17-AAG suppressed the proliferation of ARPE-19 cells by inducing cell cycle arrest and apoptosis, and possibly by oxidative stress.

  4. 17 CFR 170.8 - Settlement of customer disputes (section 17(b)(10) of the Act).

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Settlement of customer... FUTURES TRADING COMMISSION REGISTERED FUTURES ASSOCIATIONS Standards Governing Commission Review of... customer disputes (section 17(b)(10) of the Act). A futures association must be able to demonstrate...

  5. 17 CFR 240.17g-4 - Prevention of misuse of material nonpublic information.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Prevention of misuse of... Organizations § 240.17g-4 Prevention of misuse of material nonpublic information. (a) The written policies and... prevent the misuse of material, nonpublic information pursuant to section 15E(g)(1) of the Act (15...

  6. 17 CFR 270.17f-5 - Custody of investment company assets outside the United States.

    Science.gov (United States)

    2010-04-01

    ...-owned direct or indirect subsidiary of a U.S. Bank or bank-holding company. (2) Foreign Assets means any....17f-5 Custody of investment company assets outside the United States. (a) Definitions. For purposes of... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Custody of investment...

  7. Trading forest carbon - OSU

    Science.gov (United States)

    Issues associate with trading carbon sequestered in forests are discussed. Scientific uncertainties associated with carbon measurement are discussed with respect to proposed accounting procedures. Major issues include: (1) Establishing baselines. (2) Determining additivity from f...

  8. Potassium carbonate poisoning

    Science.gov (United States)

    Potassium carbonate is a white powder used to make soap, glass, and other items. This article discusses poisoning from swallowing or breathing in potassium carbonate. This article is for information only. Do ...

  9. Sodium carbonate poisoning

    Science.gov (United States)

    Sodium carbonate (known as washing soda or soda ash) is a chemical found in many household and ... products. This article focuses on poisoning due to sodium carbonate. This article is for information only. Do ...

  10. Biomass Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Biomass carbon includes carbon stored in above- and below-ground live plant components (such as leaf, branch, stem and root) as well as in standing and down dead...

  11. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Home / Safety Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known as CO, is called the "Invisible ...

  12. Carbon Monoxide Safety

    Science.gov (United States)

    ... with the Media Fire Protection Technology Carbon monoxide safety outreach materials Help inform residents in your community ... KB | Spanish PDF 645 KB Handout: carbon monoxide safety Download this handout and add your organization's logo ...

  13. Soil Organic Carbon Stock

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Soil organic carbon (SOC) is the carbon held within soil organic constituents (i.e., products produced as dead plants and animals decompose and the soil microbial...

  14. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon monoxide, also known ... Install one and check its batteries regularly. View Information About CO Alarms Other CO Topics Safety Tips ...

  15. Calcium carbonate overdose

    Science.gov (United States)

    Tums overdose; Calcium overdose ... Calcium carbonate can be dangerous in large amounts. ... Some products that contain calcium carbonate are certain: ... and mineral supplements Other products may also contain calcium ...

  16. Carbon nanotube nanoelectrode arrays

    Science.gov (United States)

    Ren, Zhifeng; Lin, Yuehe; Yantasee, Wassana; Liu, Guodong; Lu, Fang; Tu, Yi

    2008-11-18

    The present invention relates to microelectode arrays (MEAs), and more particularly to carbon nanotube nanoelectrode arrays (CNT-NEAs) for chemical and biological sensing, and methods of use. A nanoelectrode array includes a carbon nanotube material comprising an array of substantially linear carbon nanotubes each having a proximal end and a distal end, the proximal end of the carbon nanotubes are attached to a catalyst substrate material so as to form the array with a pre-determined site density, wherein the carbon nanotubes are aligned with respect to one another within the array; an electrically insulating layer on the surface of the carbon nanotube material, whereby the distal end of the carbon nanotubes extend beyond the electrically insulating layer; a second adhesive electrically insulating layer on the surface of the electrically insulating layer, whereby the distal end of the carbon nanotubes extend beyond the second adhesive electrically insulating layer; and a metal wire attached to the catalyst substrate material.

  17. A ROLE FOR TH17 IN RESPIRATORY DISEASES

    OpenAIRE

    Acosta, P.

    2014-01-01

    T-helper 17 (Th17) cells are a new CD4+ helper subset mainly characterized by interleukin 17 (IL- 17A) production. The functions of Th17 cells in several infectious and autoimmune diseases have recently started to be clarified. Th17 immune response is important for the defense against many microorganisms but they can also contribute to immunopathology. This review presents the new advances in the field.

  18. Promotion of lung tumor growth by interleukin-17

    OpenAIRE

    Xu, Beibei; Guenther, James F.; Pociask, Derek A.; Wang, Yu; Kolls, Jay K.; You, Zongbing; Chandrasekar, Bysani; Shan, Bin; Sullivan, Deborah E.; Morris, Gilbert F.

    2014-01-01

    Recent findings demonstrate that inhaled cigarette smoke, the predominant lung carcinogen, elicits a T helper 17 (Th17) inflammatory phenotype. Interleukin-17A (IL-17), the hallmark cytokine of Th17 inflammation, displays pro- and antitumorigenic properties in a manner that varies according to tumor type and assay system. To investigate the role of IL-17 in lung tumor growth, we used an autochthonous tumor model (K-RasLA1 mice) with lung delivery of a recombinant adenovirus that expresses IL-...

  19. In vitro biosynthesis of radioactive estradiol-17 beta, 17-glucosiduronate by rhesus monkey liver

    International Nuclear Information System (INIS)

    A method for the preparation of radioactive estradiol-17 beta, 17-glucosiduronate by incubating 3H-estradiol with rhesus monkey liver microsomal preparation in the presence of uridine diphosphoglucuronic acid is described. Small but significant amounts of the conjugate were also obtained from the 150,000 pellet and cytosol fractions. The addition of NADPH to the incubation media increased the yield of radioactive-estradiol-17 beta, 17-glucosiduronate perhaps by preserving the integrity of the C-17-hydroxyl group. As expected, the effect of the reduced nucleotide was more pronounced in the fractions other than the microsome. The biosynthesized conjugate was isolated and purified by multiple column chromatography and the structure was confirmed by derivative formation, enzyme hydrolysis and crystallization of the aglycone

  20. Metal filled porous carbon

    Science.gov (United States)

    Gross, Adam F.; Vajo, John J.; Cumberland, Robert W.; Liu, Ping; Salguero, Tina T.

    2011-03-22

    A porous carbon scaffold with a surface and pores, the porous carbon scaffold containing a primary metal and a secondary metal, where the primary metal is a metal that does not wet the surface of the pores of the carbon scaffold but wets the surface of the secondary metal, and the secondary metal is interspersed between the surface of the pores of the carbon scaffold and the primary metal.

  1. 17 CFR 256.143 - Accounts receivable.

    Science.gov (United States)

    2010-04-01

    ... COMPANY ACT OF 1935 3. Current and Accrued Assets § 256.143 Accounts receivable. This account shall... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Accounts receivable. 256.143 Section 256.143 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED)...

  2. 17 CFR 290.2 - Periodic reports.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Periodic reports. 290.2 Section 290.2 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) Schedule A to Part 285 GENERAL RULES AND REGULATIONS PURSUANT TO SECTION 9(a) OF THE EUROPEAN BANK...

  3. 17 CFR 200.64 - Judicial review.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Judicial review. 200.64... AND ETHICS; AND INFORMATION AND REQUESTS Canons of Ethics § 200.64 Judicial review. The Congress has provided for review by the courts of the decisions and orders by this Commission. Members should...

  4. 17 CFR 204.6 - Agency review.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Agency review. 204.6 Section... COLLECTION Administrative Offset § 204.6 Agency review. (a) To the extent that a debt owed has not been... request to review a disputed debt must be submitted to the Commission official who provided...

  5. 17 CFR 201.58 - Judicial review.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Judicial review. 201.58 Section 201.58 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION RULES OF PRACTICE Regulations Pertaining to the Equal Access to Justice Act § 201.58 Judicial review. Judicial review of...

  6. 17 CFR 243.101 - Definitions.

    Science.gov (United States)

    2010-04-01

    ..., or agent of an issuer who discloses material nonpublic information in breach of a duty of trust or confidence to the issuer shall not be considered to be acting on behalf of the issuer. (d) Promptly... or filing with the Commission a Form 8-K (17 CFR 249.308) disclosing that information. (2) An...

  7. 17 CFR 200.54 - Constitutional obligations.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Constitutional obligations... ORGANIZATION; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Canons of Ethics § 200.54 Constitutional... against any infringement of the constitutional rights, privileges, or immunities of those who are...

  8. 17 CFR 201.104 - Business hours.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Business hours. 201.104 Section 201.104 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION RULES OF PRACTICE Rules of Practice General Rules § 201.104 Business hours. The Headquarters office of the Commission,...

  9. Abstract Invited Braumann 17th IWMS 2008

    OpenAIRE

    Braumann, Carlos A.

    2009-01-01

    Invited conference of the scientific meeting 17th International Workshop on Matrices and Statistics (Tomar, Portugal, July 2008). The conference involved several applications of stochastic differential equations in population growth, harvesting and animal individual growth, including the issues of extinction, existence of stationary densities and the use of Itô or Stratonovich calculus.

  10. 31 CFR 17.103 - Definitions.

    Science.gov (United States)

    2010-07-01

    ...; genitourinary; hemic and lymphatic; skin; and endocrine; or (ii) any mental or psychological disorder such as... handicapped person” is defined in 29 CFR 1613.702(f), which is made applicable to this part by § 17.140. (h... mental impairment includes: (i) Any physiological disorder or condition, cosmetic disfigurement,...

  11. 17 CFR 200.310 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Fees. 200.310 Section 200.310... Maintained by the Commission § 200.310 Fees. (a) A request by an individual for copies of a record pertaining... the copier and the Commission. (b) Waiver or reduction of fees. Whenever the Privacy Act...

  12. 17 CFR 200.552 - NEPA planning.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false NEPA planning. 200.552 Section 200.552 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION; CONDUCT... § 200.552 NEPA planning. Where it is reasonably foreseeable by the Commission that it may be required...

  13. NMR spectra of phosphorus 17O esters

    International Nuclear Information System (INIS)

    By the 17O NMR method the authors investigated methyl, ethyl, isopropyl, tert-butyl, and phenyl ethylene phosphites; methyl, ethyl, and isopropyl trimethylene phosphites; and methyl, ethyl, isopropyl, and tert-butyl o-phenylene phosphites. They also determined the 13C and 31P NMR spectra of these compounds

  14. 5 CFR 2502.17 - Exemptions.

    Science.gov (United States)

    2010-01-01

    ... Reproduction § 2502.17 Exemptions. (a) 5 U.S.C. 552 exempts from all of its publication and disclosure... Administration shall upon request, assist the White House office in performing its role of providing those... 1974 are exempt from disclosure to the public except as provided by 5 CFR part 2504....

  15. 17 CFR 14.5 - Criminal conviction.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Criminal conviction. 14.5 Section 14.5 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM APPEARANCE AND PRACTICE § 14.5 Criminal conviction. Any person who...

  16. 17 CFR 12.10 - Service.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Service. 12.10 Section 12.10... General Information and Preliminary Consideration of Pleadings § 12.10 Service. (a) General requirements—(1) When service is required; number of copies. One copy of all motions, petitions or...

  17. 17 CFR 204.75 - Collection services.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Collection services. 204.75... DEBT COLLECTION Miscellaneous: Credit Bureau Reporting, Collection Services § 204.75 Collection services. Section 13 of the Debt Collection Act (31 U.S.C. 3718) authorizes agencies to enter...

  18. 17 CFR 171.9 - Service.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Service. 171.9 Section 171.9... ACTIONS General Provisions § 171.9 Service. (a) General requirements. Unless otherwise provided, all... service. Service may be made by personal delivery (effective upon receipt), mail (effective upon...

  19. 17 CFR 3.50 - Service.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Service. 3.50 Section 3.50... Revocation of Registration § 3.50 Service. (a) For purposes of this subpart, service upon an applicant or... thereto, and will be complete upon mailing. Where a party effects service by mail, the time within...

  20. 17 CFR 150.2 - Position limits.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Position limits. 150.2 Section 150.2 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION LIMITS ON POSITIONS § 150.2 Position limits. No person may hold or control positions, separately or in combination, net...

  1. 43 CFR 17.203 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Discrimination prohibited. 17.203 Section... Discrimination prohibited. (a) General. No qualified handicapped person shall, on the basis of handicap, be excluded from participation in, be denied the benefits of, or otherwise be subjected to...

  2. 17th session of the Baltic Assembly

    Index Scriptorium Estoniae

    2000-01-01

    Balti Assamblee 17. istungjärgu dokumendid. Lõppdokument. Avaldus NATO-ga liitumise kohta. Pöördumine Balti Ministrite Nõukogu poole raudteetranspordi arendamise asjus. Resolutsioon noorte turismi arendamise kohta. Resolutsioon muuseumite pedagoogilise ja haridusliku rolli tõhustamisest. Balti Assamblee sekratariaadi korraldused. Otsus Balti Assamblee 2001. a. eelarve kohta. Pöördumine Vene Föderatsiooni poole

  3. 21 CFR 17.37 - Witnesses.

    Science.gov (United States)

    2010-04-01

    ... individual employed by a party engaged in assisting counsel for the party. (g) If a witness' testimony is... witness at its own expense, and failure to do so shall result in the striking of the witness' testimony. ... HEARINGS § 17.37 Witnesses. (a) Except as provided in paragraph (b) of this section, testimony at...

  4. 17 CFR 8.05 - Enforcement staff.

    Science.gov (United States)

    2010-04-01

    ... staff shall consist of employees of the exchange and/or persons hired on a contract basis. It may not... within its disciplinary jurisdiction, regardless of whether its enforcement staff consists of employees... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Enforcement staff....

  5. 38 CFR 17.903 - Payment.

    Science.gov (United States)

    2010-07-01

    ... the date the child was determined eligible for benefits under § 3.814 of this title. (ii) For covered birth defects, on or after December 1, 2001, and must have occurred on or after the date the child was... Benefits for Certain Children of Vietnam Veterans-Spina Bifida and Covered Birth Defects § 17.903...

  6. Sequence analysis of 17 NRXN1 deletions

    DEFF Research Database (Denmark)

    Hoeffding, Louise Kristine Enggaard; Hansen, Thomas; Ingason, Andrés;

    2014-01-01

    molecular mechanisms governing such genomic rearrangements may increase our understanding of disease pathology and evolutionary processes. Here we analyse 17 carriers of non-recurrent deletions in the NRXN1 gene, which have been associated with neurodevelopmental disorders, e.g. schizophrenia, autism and...

  7. 7 CFR 29.3120 - Rule 17.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Rule 17. 29.3120 Section 29.3120 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... leaves, or any lot which contains 20 percent of greenish and green leaves combined, shall be...

  8. 7 CFR 29.2633 - Rule 17.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Rule 17. 29.2633 Section 29.2633 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... leaves or any lot which contains 20 percent of greenish and green leaves combined shall be designated...

  9. 48 CFR 17.403 - Procedures.

    Science.gov (United States)

    2010-10-01

    ... contract to the follower for production of the items; or (3) Follower company, obligating it to subcontract... CONTRACT TYPES SPECIAL CONTRACTING METHODS Leader Company Contracting 17.403 Procedures. (a) The contracting officer may award a prime contract to a— (1) Leader company, obligating it to subcontract...

  10. 48 CFR 17.401 - General.

    Science.gov (United States)

    2010-10-01

    ... CONTRACT TYPES SPECIAL CONTRACTING METHODS Leader Company Contracting 17.401 General. Leader company... system is designated under this acquisition technique to be the leader company, and to furnish assistance... special equipment. (d) Achieve economies in production. (e) Ensure uniformity and reliability in...

  11. 48 CFR 17.402 - Limitations.

    Science.gov (United States)

    2010-10-01

    ... AND CONTRACT TYPES SPECIAL CONTRACTING METHODS Leader Company Contracting 17.402 Limitations. (a) Leader company contracting is to be used only when— (1) The leader company has the necessary production... the Government's requirements without the assistance of a leader company; (3) The assistance...

  12. 38 CFR 17.600 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... include nursing, physical therapy, occupational therapy, and other specified direct or indirect health... 17.600 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Va Health... requirements for the award of scholarships under the Department of Veterans Affairs Health...

  13. 17. IAEA fusion energy conference. Extended synopses

    International Nuclear Information System (INIS)

    Book of extended synopses of the papers, accepted by a international programme committee for presentation at the 17th IAEA Fusion Energy Conference in Yokohama, Japan. The subjects covered are magnetic confinement experiments, plasma heating and current drive, ITER EDA, inertial fusion energy, innovative concepts, fusion technology and theory

  14. 24 CFR 17.1 - Scope; definitions.

    Science.gov (United States)

    2010-04-01

    ... Tort Claims Act issued by the Attorney General (31 FR 16616; 28 CFR part 14). (c) The terms Department and Organizational unit are defined in 24 CFR part 5. Procedures ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Scope; definitions. 17.1 Section...

  15. 17 CFR 256.307 - Equipment.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Equipment. 256.307 Section 256... COMPANY ACT OF 1935 Service Company Property Accounts § 256.307 Equipment. This account shall include the cost of equipment owned by the service company and used in rendering services such as...

  16. 17 CFR 256.924 - Property insurance.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Property insurance. 256.924... COMPANY ACT OF 1935 2. Expense § 256.924 Property insurance. (a) This account shall include the cost of insurance premiums to protect the service company against losses and damages to owned or leased...

  17. 17 CFR 166.3 - Supervision.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Supervision. 166.3 Section 166.3 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION CUSTOMER PROTECTION RULES § 166.3 Supervision. Each Commission registrant, except an associated person who has no...

  18. 17 CFR 32.6 - Segregation.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Segregation. 32.6 Section 32.6 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION REGULATION OF COMMODITY OPTION TRANSACTIONS § 32.6 Segregation. (a) Any person which accepts money, securities, or property from an...

  19. 17 CFR 31.12 - Segregation.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Segregation. 31.12 Section 31....12 Segregation. (a) Any person that accepts leverage customer funds from a leverage customer to enter.... Notwithstanding the foregoing, a leverage transaction merchant may exclude from its segregation...

  20. New floristic records in the Balkans: 17

    DEFF Research Database (Denmark)

    2011-01-01

    , 107), Orobanchaceae (101), Phytolaccaceae (48), Plumbaginaceae (49), Poaceae (16, 17, 91–93, 118–123, 130), Polygalaceae (50), Potamogetonaceae (18), Ranunculaceae (51, 52), Rhamnaceae (10), Rosaceae (11, 12, 53–55, 84, 111, 115–117, 140), Rubiaceae (56, 57), Ruppiaceae (19), Salicaceae (58...

  1. 17 CFR 200.502 - Definition.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Definition. 200.502 Section 200.502 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION; CONDUCT... Information and Material § 200.502 Definition. As used in this part: Foreign government information...

  2. 32 CFR 199.17 - TRICARE program.

    Science.gov (United States)

    2010-07-01

    ... Defense (Health Affairs). In TRICARE, all care may be subject to review for medical necessity and... with guidelines issued by the Assistant Secretary of Defense for Health Affairs, certain travel... CIVILIAN HEALTH AND MEDICAL PROGRAM OF THE UNIFORMED SERVICES (CHAMPUS) § 199.17 TRICARE program....

  3. 48 CFR 17.502 - General.

    Science.gov (United States)

    2010-10-01

    ... CONTRACT TYPES SPECIAL CONTRACTING METHODS Interagency Acquisitions Under the Economy Act 17.502 General. (a) The Economy Act authorizes agencies to enter into mutual agreements to obtain supplies or services by interagency acquisition. (b) The Economy Act may not be used by an agency to...

  4. 17 CFR 200.401 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Definitions. 200.401 Section 200.401 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Regulations Pertaining to Public Observation of Commission Meetings § 200.401 Definitions. As used in...

  5. 17 CFR 200.302 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Definitions. 200.302 Section 200.302 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Regulations Pertaining to the Privacy of Individuals and Systems of Records Maintained by the Commission §...

  6. 38 CFR 17.802 - Application provisions.

    Science.gov (United States)

    2010-07-01

    ... Transitional Housing Loan Program § 17.802 Application provisions. (a) To obtain a loan under these Transitional Housing Loan Program regulations, an application must be submitted by the applicant in the form... occupants intended to live in the residence for which the loan assistance is requested, (C)...

  7. Transiting planetary system WASP-17 (Southworth+, 2012)

    DEFF Research Database (Denmark)

    Southworth, J.; Hinse, T. C.; Dominik, M.;

    2013-01-01

    A light curve of four transits of the extrasolar planetary system WASP-17 is presented. The data were obtained using the Danish 1.5m telescope and DFOSC camera at ESO La Silla in 2012, with substantial telescope defocussing in order to improve the photometric precision of the observations. A Cous...

  8. 17 CFR 200.660 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Communications. 200.660 Section 200.660 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION... Communications. (a) The agency shall take appropriate steps to ensure effective communication with...

  9. 17 CFR 149.160 - Communications.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Communications. 149.160... COMMISSION § 149.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants, participants, personnel of other Federal entities, and members of the public....

  10. 38 CFR 17.61 - Eligibility.

    Science.gov (United States)

    2010-07-01

    ... Section 17.61 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Community... for placement in a privately or publicly-owned community residential care facility if: (a) At the time... or VA medical center, domiciliary, or nursing home care; or (2) Such care or services were...

  11. Pärnusse tuleb 17-korruseline hoone

    Index Scriptorium Estoniae

    2007-01-01

    Pärnu linnavalitsus lubas Port Artur Grupil püstitada südalinna Lai t. 10 territooriumile 17-korruselise vabaaja- ja kaubanduskeskuse, mida nägi ette 2006. a. endise REV-i territooriumi hoonestamiseks korraldatud rahvusvahelise arhitektuurikonkursi võidutöö "Flood". Kommenteerib Mart Viisitamm

  12. 17 CFR 257.2 - Schedule.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Schedule. 257.2 Section 257.2... COMPANIES § 257.2 Schedule. Schedule of Records Retention Periods Description of records Retention period...) Schedules for recurring journal entries 6 years after settlement. Destroy when superseded if not a part of...

  13. 17 CFR 256.135 - Working funds.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Working funds. 256.135 Section... SYSTEM OF ACCOUNTS FOR MUTUAL SERVICE COMPANIES AND SUBSIDIARY SERVICE COMPANIES, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935 3. Current and Accrued Assets § 256.135 Working funds. This account shall include...

  14. 17 CFR 256.236 - Taxes accrued.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Taxes accrued. 256.236 Section... COMPANY ACT OF 1935 7. Current and Accrued Liabilities § 256.236 Taxes accrued. (a) This account shall be credited with the amount of taxes accrued during the accounting period, corresponding debits being made...

  15. 17 CFR 256.409 - Income taxes.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Income taxes. 256.409 Section... COMPANY ACT OF 1935 Income and Expense Accounts § 256.409 Income taxes. (a) This account shall include the amount of local, State and Federal taxes on income properly accruable during the period covered by...

  16. 17 CFR 256.301 - Organization.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Organization. 256.301 Section... COMPANY ACT OF 1935 Service Company Property Accounts § 256.301 Organization. This account shall include... incident to organizing a corporation or other form of organization and putting it into readiness to...

  17. 17 CFR 200.70 - Business promotions.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Business promotions. 200.70... AND ETHICS; AND INFORMATION AND REQUESTS Canons of Ethics § 200.70 Business promotions. A member must not engage in any other business, employment or vocation while in office, nor may he ever use...

  18. 17 CFR 200.506 - Derivative classification.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Derivative classification. 200...; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Classification and Declassification of National Security Information and Material § 200.506 Derivative classification. Any document that includes...

  19. 17 CFR 200.505 - Original classification.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Original classification. 200...; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Classification and Declassification of National Security Information and Material § 200.505 Original classification. (a) No Commission Member or employee has...

  20. 17 CFR 200.55 - Statutory obligations.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Statutory obligations. 200.55 Section 200.55 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION ORGANIZATION; CONDUCT AND ETHICS; AND INFORMATION AND REQUESTS Canons of Ethics § 200.55 Statutory obligations. In administering the law, members of this...

  1. 49 CFR 572.17 - Neck.

    Science.gov (United States)

    2010-10-01

    ... 30 21 2.2 60 36 4.3 Maximum 62 5.8 60 91 4.3 30 108 2.2 0 123 0 (c) Test procedure. (1) Mount the... OF TRANSPORTATION (CONTINUED) ANTHROPOMORPHIC TEST DEVICES 3-Year-Old Child § 572.17 Neck. (a)(1)...

  2. 17 CFR 42.1 - [Reserved

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false 42.1 Section 42.1 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION ANTI-MONEY LAUNDERING, TERRORIST FINANCING General Provisions § 42.1...

  3. 17 CFR 201.101 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... as duty officer pursuant to 17 CFR 200.43; (2) Counsel means any attorney representing a party or any... Public Company Accounting Oversight Board; or (vi) By the filing, pursuant to § 242.601 of this chapter...; and (12) Board means the Public Company Accounting Oversight Board. (b)...

  4. 37 CFR 202.17 - Renewals

    Science.gov (United States)

    2010-07-01

    ... CFR 202.20 and 202.21, the Copyright Office, at its discretion, may, upon receipt of an acceptable... existed in its original term of copyright was in compliance with the 1909 copyright law, 17 U.S.C. 1, et... regulations found at 37 CFR 201.2. (g) Application for renewal registration for a work registered in...

  5. 17 CFR 300.104 - Trust accounts.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Trust accounts. 300.104... A to Part 285 RULES OF THE SECURITIES INVESTOR PROTECTION CORPORATION Accounts of âseparateâ Customers of Sipc Members § 300.104 Trust accounts. (a) A trust account held with a member shall be deemed...

  6. 17 CFR 300.105 - Joint accounts.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Joint accounts. 300.105... A to Part 285 RULES OF THE SECURITIES INVESTOR PROTECTION CORPORATION Accounts of âseparateâ Customers of Sipc Members § 300.105 Joint accounts. (a) A joint account shall be deemed to be a...

  7. Protolytic carbon film technology

    Energy Technology Data Exchange (ETDEWEB)

    Renschler, C.L.; White, C.A.

    1996-04-01

    This paper presents a technique for the deposition of polyacrylonitrile (PAN) on virtually any surface allowing carbon film formation with only the caveat that the substrate must withstand carbonization temperatures of at least 600 degrees centigrade. The influence of processing conditions upon the structure and properties of the carbonized film is discussed. Electrical conductivity, microstructure, and morphology control are also described.

  8. Carbon Goes To…

    Science.gov (United States)

    Savasci, Funda

    2014-01-01

    The purposes of this activity are to help middle school students understand the carbon cycle and realize how human activities affect the carbon cycle. This activity consists of two parts. The first part of the activity focuses on the carbon cycle, especially before the Industrial Revolution, while the second part of the activity focuses on how…

  9. Influence of chicken manure and NPK (17-17-17 fertilizer on growth and yield of carrot

    Directory of Open Access Journals (Sweden)

    Sylvestre Habimana

    2014-10-01

    Full Text Available This study was conducted to determine the effect of chicken manure and NPK (17-17-17 fertilizer on growth and yield of carrot (Daucus carota L. in a volcanic soil of Musanze District in the Northern Province of Rwanda. This was geared upon by many unattended biotic and agronomic factors pertaining to low yields of carrot crop in this area. The treatments were: the control (T0, 10 t ha-1 of chicken manure (T1, 300 kg ha-1 of NPK (17-17-17 fertilizer (T2, and 5 t ha-1 chicken manure + 150 kg ha-1 of NPK fertilizer (T3 and each treatment was in three repetitions. The soil was tested for some of its physical and chemical properties and the soil reaction was moderately acid (pH 5.97 and the quantities of N, P, K were moderate. The growth and yield parameters were studied along with the effect of treatments and the economic contribution of the intervention was determined by Benefit-Cost-Ratio (BGR approach. Results revealed that the significantly (p < 0.05 highest plant height (45.59 cm and leaf length (45.29 cm were obtained in the combination of chicken manure and NPK fertilizer and the lowest were 34.12 and 34.69 cm, respectively, in the absolute control. The sole application of chicken manure and NPK fertilizer recorded plant heights of 43.70 and 39.89 cm and leaf lengths of 43.46 and 39.61 cm, respectively. Results also indicated that marketable root yield was statistically similar between control (5.6 t ha-1 and chicken manure alone (5.7 t ha-1 and between NPK fertilizer alone (8.55 t ha-1 and combination of chicken manure and NPK fertilizer (10.55 t ha-1. The best BCR was obtained in the combination of chicken manure and NPK fertilizer (2.09 compared with the absolute control (1.12, chicken manure alone (1.75 and NPK fertilizer alone (1.62.

  10. Carbon/Carbon Pistons for Internal Combustion Engines

    Science.gov (United States)

    Taylor, A. H.

    1986-01-01

    Carbon/carbon piston performs same function as aluminum pistons in reciprocating internal combustion engines while reducing weight and increasing mechanical and thermal efficiencies of engine. Carbon/carbon piston concept features low piston-to-cylinder wall clearance - so low piston rings and skirts unnecessary. Advantages possible by negligible coefficient of thermal expansion of carbon/carbon.

  11. Determinants of Chronic Carbon Dioxide Retention and Its Correction in Humans

    OpenAIRE

    Skatrud, James B.; Dempsey, Jerome A; Bhansali, Praful; Irvin, Charles

    1980-01-01

    17 patients with chronic ventilatory failure (including 14 with chronic obstructive pulmonary disease) were studied to determine the causes of carbon dioxide retention and the chronic effect of medroxyprogesterone acetate on ventilatory drive and acid-base status. Carbon dioxide retention in patients with high mechanical loads occurred concomitantly with a higher than normal inspiratory effort (mouth occlusion pressure) and normal minute ventilation to carbon dioxide production ratio (V̇e/V̇c...

  12. Nitrogen deposition: how important is it for global terrestrial carbon uptake?

    OpenAIRE

    Bala, G.; N. Devaraju; R. K. Chaturvedi; K. Caldeira; R. Nemani

    2013-01-01

    Global carbon budget studies indicate that the terrestrial ecosystems have remained a large sink for carbon despite widespread deforestation activities. CO2 fertilization, N deposition and re-growth of mid-latitude forests are believed to be key drivers for land carbon uptake. In this study, we assess the importance of N deposition by performing idealized near-equilibrium simulations using the Community Land Model 4.0 (CLM4). In our equilibrium simulations, only 12–17% of th...

  13. Climate policy and dependence on traded carbon

    Science.gov (United States)

    Andrew, Robbie M.; Davis, Steven J.; Peters, Glen P.

    2013-09-01

    A growing number of countries regulate carbon dioxide (CO2) emissions occurring within their borders, but due to rapid growth in international trade, the products consumed in many of the same countries increasingly rely on coal, oil and gas extracted and burned in other countries where CO2 is not regulated. As a consequence, existing national and regional climate policies may be growing less effective every year. Furthermore, countries that are dependent on imported products or fossil fuels are more exposed to energy and climate policies in other countries. We show that the combined international trade in carbon (as fossil fuels and also embodied in products) increased from 12.3 GtCO2 (55% of global emissions) in 1997 to 17.6 GtCO2 (60%) in 2007 (growing at 3.7% yr-1). Within this, trade in fossil fuels was larger (10.8 GtCO2 in 2007) than trade in embodied carbon (6.9 GtCO2), but the latter grew faster (4.6% yr-1 compared with 3.1% yr-1 for fuels). Most major economies demonstrate increased dependence on traded carbon, either as exports or as imports. Because energy is increasingly embodied in internationally traded products, both as fossil fuels and as products, energy and climate policies in other countries may weaken domestic climate policy via carbon leakage and mask energy security issues.

  14. Carbonate hosted gold deposit in Tasmania, Australia

    International Nuclear Information System (INIS)

    Full text: This study uses elemental and isotopic composition of carbonates associated with gold from Henty and Beaconsfield in Tasmania, Australia, to illustrate source of gold-bearing fluids, salinity, temperature and dissolution and reprecipitation of carbonate. The Beaconsfield and Henty gold mines are located in northern and western Tasmania respectively. Gold mineralisation in Beaconsfield occurs within the quartz-carbonate Tasmania Reef (Lower to Middle Palaeozoic sequence, Hills, 1998). The Henty gold mine is located at the base of the Cambrian Tyndall Group (volcano-sedimentary succession, White and McPhie, 1996) close to Henty Fault. Gold in carbonate samples from Henty ranges from 7.7 to 9360 ppm and in Beaconsfield ranges from 0.01 to 434 ppm. The amount of carbonate in samples from Henty and Beaconsfield gold mines varies from approximately 24 to 99.8%. Bivariate plot of Ca relative to total amounts of Mg, Fe and Mn illustrates that the major carbonate minerals at Beaconsfield and Henty gold mines are magnesian ankerite and calcite. The difference in carbonate mineralogy, at Henty and Beaconsfield gold mines, is attributed to the composition of fluids responsible for carbonate alteration. Gold and magnesium in Beaconsfield ankerite are derived from the leaching of Cambrian ultramafic rocks during the Devonian by the passage of meteoric fluids through tectonically affected Ordovician carbonates (Rao and Adabi, 1999). The total concentration of Fe and Mn are low (0.5 to 2%) in Henty and high (1 to 17.5%) in Beaconsfield ankerite, possibly due to oxidising conditions at Henty and reducing conditions at Beaconsfield gold mines during gold mineralisation. Variation of Sr values between Beaconsfield ankerite and Henty calcite is related to dissolution of limestone that increase Sr concentrations in gold mineralising fluids. Na values in both Beaconsfield (20 to 1100 ppm) and Henty carbonates (25 to 1650 ppm) suggest low salinity fluids responsible for gold

  15. CTLA-4 (CD152) enhances the Tc17 differentiation program.

    Science.gov (United States)

    Pick, Jonas; Arra, Aditya; Lingel, Holger; Hegel, J Kolja; Huber, Magdalena; Nishanth, Gopala; Jorch, Gerhard; Fischer, Klaus-Dieter; Schlüter, Dirk; Tedford, Kerry; Brunner-Weinzierl, Monika C

    2014-07-01

    Although CD8(+) T cells that produce IL-17 (Tc17 cells) have been linked to host defense, Tc17 cells show reduced cytotoxic activity, which is the characteristic function of CD8(+) T cells. Here, we show that CTLA-4 enhances the frequency of IL-17 in CD8(+) T cells, indicating that CTLA-4 (CD152) specifically promotes Tc17 differentiation. Simultaneous stimulation of CTLA-4(+/+) and CTLA-4(-/-) T cells in cocultures and agonistic CTLA-4 stimulation unambiguously revealed a cell-intrinsic mechanism for IL-17 control by CTLA-4. The quality of CTLA-4-induced Tc17 cells was tested in vivo, utilizing infection with the facultative intracellular bacterium Listeria monocytogenes (LM). Unlike CTLA-4(+/+) Tc17 cells, CTLA-4(-/-) were nearly as efficient as Tc1 CTLA-4(+/+) cells in LM clearance. Additionally, adoptively transferred CTLA-4(-/-) Tc17 cells expressed granzyme B after rechallenge, and produced Tc1 cytokines such as IFN-γ and TNF-α, which strongly correlate with bacterial clearance. CTLA-4(+/+) Tc17 cells demonstrated a high-quality Tc17 differentiation program ex vivo, which was also evident in isolated IL-17-secreting Tc17 cells, with CTLA-4-mediated enhanced upregulation of Tc17-related molecules such as IL-17A, RORγt, and IRF-4. Our results show that CTLA-4 promotes Tc17 differentiation that results in robust Tc17 responses. Its inactivation might therefore represent a central therapeutic target to enhance clearance of infection. PMID:24723371

  16. Activated carbons and gold

    International Nuclear Information System (INIS)

    The literature on activated carbon is reviewed so as to provide a general background with respect to the effect of source material and activation procedure on carbon properties, the structure and chemical nature of the surface of the activated carbon, and the nature of absorption processes on carbon. The various theories on the absorption of gold and silver from cyanide solutions are then reviewed, followed by a discussion of processes for the recovery of gold and silver from cyanide solutions using activated carbon, including a comparison with zinc precipitation

  17. Carbon footprint of electronic devices

    Science.gov (United States)

    Sloma, Marcin

    2013-07-01

    Paper assesses the greenhouse gas emissions related to the electronic sectors including information and communication technology and media sectors. While media often presents the carbon emission problem of other industries like petroleum industry, the airlines and automobile sectors, plastics and steel manufacturers, the electronics industry must include the increasing carbon footprints caused from their applications like media and entertainment, computers and cooling devices, complex telecommunications networks, cloud computing and powerful mobile phones. In that sense greenhouse gas emission of electronics should be studied in a life cycle perspective, including regular operational electricity use. Paper presents which product groups or processes are major contributors in emission. From available data and extrapolation of existing information we know that the information and communication technology sector produced 1.3% and media sector 1.7% of global gas emissions within production cycle, using the data from 2007.In the same time global electricity use of that sectors was 3.9% and 3.2% respectively. The results indicate that for both sectors operation leads to more gas emissions than manufacture, although impacts from the manufacture is significant, especially in the supply chain. Media electronics led to more emissions than PCs (manufacture and operation). Examining the role of electronics in climate change, including disposal of its waste, will enable the industry to take internal actions, leading to lowering the impact on the climate change within the sector itself.

  18. Signaling through IL-17C/IL-17RE is dispensable for immunity to systemic, oral and cutaneous candidiasis.

    Directory of Open Access Journals (Sweden)

    Heather R Conti

    Full Text Available Candida albicans is a commensal fungal microbe of the human orogastrointestinal tract and skin. C. albicans causes multiple forms of disease in immunocompromised patients, including oral, vaginal, dermal and disseminated candidiasis. The cytokine IL-17 (IL-17A and its receptor subunits, IL-17RA and IL-17RC, are required for protection to most forms of candidiasis. The importance of the IL-17R pathway has been observed not only in knockout mouse models, but also in humans with rare genetic mutations that impact generation of Th17 cells or the IL-17 signaling pathway, including Hyper-IgE Syndrome (STAT3 or TYK2 mutations or IL17RA or ACT1 gene deficiency. The IL-17 family of cytokines is a distinct subclass of cytokines with unique structural and signaling properties. IL-17A is the best-characterized member of the IL-17 family to date, but far less is known about other IL-17-related cytokines. In this study, we sought to determine the role of a related IL-17 cytokine, IL-17C, in protection against oral, dermal and disseminated forms of C. albicans infection. IL-17C signals through a heterodimeric receptor composed of the IL-17RA and IL-17RE subunits. We observed that IL-17C mRNA was induced following oral C. albicans infection. However, mice lacking IL-17C or IL-17RE cleared C. albicans infections in the oral mucosa, skin and bloodstream at rates similar to WT littermate controls. Moreover, these mice demonstrated similar gene transcription profiles and recovery kinetics as WT animals. These findings indicate that IL-17C and IL-17RE are dispensable for immunity to the forms of candidiasis evaluated, and illustrate a surprisingly limited specificity of the IL-17 family of cytokines with respect to systemic, oral and cutaneous Candida infections.

  19. Signaling through IL-17C/IL-17RE is dispensable for immunity to systemic, oral and cutaneous candidiasis.

    Science.gov (United States)

    Conti, Heather R; Whibley, Natasha; Coleman, Bianca M; Garg, Abhishek V; Jaycox, Jillian R; Gaffen, Sarah L

    2015-01-01

    Candida albicans is a commensal fungal microbe of the human orogastrointestinal tract and skin. C. albicans causes multiple forms of disease in immunocompromised patients, including oral, vaginal, dermal and disseminated candidiasis. The cytokine IL-17 (IL-17A) and its receptor subunits, IL-17RA and IL-17RC, are required for protection to most forms of candidiasis. The importance of the IL-17R pathway has been observed not only in knockout mouse models, but also in humans with rare genetic mutations that impact generation of Th17 cells or the IL-17 signaling pathway, including Hyper-IgE Syndrome (STAT3 or TYK2 mutations) or IL17RA or ACT1 gene deficiency. The IL-17 family of cytokines is a distinct subclass of cytokines with unique structural and signaling properties. IL-17A is the best-characterized member of the IL-17 family to date, but far less is known about other IL-17-related cytokines. In this study, we sought to determine the role of a related IL-17 cytokine, IL-17C, in protection against oral, dermal and disseminated forms of C. albicans infection. IL-17C signals through a heterodimeric receptor composed of the IL-17RA and IL-17RE subunits. We observed that IL-17C mRNA was induced following oral C. albicans infection. However, mice lacking IL-17C or IL-17RE cleared C. albicans infections in the oral mucosa, skin and bloodstream at rates similar to WT littermate controls. Moreover, these mice demonstrated similar gene transcription profiles and recovery kinetics as WT animals. These findings indicate that IL-17C and IL-17RE are dispensable for immunity to the forms of candidiasis evaluated, and illustrate a surprisingly limited specificity of the IL-17 family of cytokines with respect to systemic, oral and cutaneous Candida infections. PMID:25849644

  20. An irradiated jet in M 17

    Science.gov (United States)

    Comerón, F.; Pasquali, A.; Alves de Oliveira, C.

    2013-04-01

    Context. M 17 is one of the best studied giant HII regions in our galactic neighborhood. It should also provide a suitable environment for the class of fully ionized jets externally irradiated by the presence of nearby hot stars. However, no such jets have been observed thus far in M 17. Aims: We report on a visible imaging survey of the M 17 nebula with the goal of identifying likely shock-excited nebulosities. Methods: We imaged M 17 through narrow-band filters centered on the most intense visible lines of [OIII], Hα+[NII], [SII], and Hβ. We obtained follow-up spectroscopy of the only jet-like structure identified in the images. We also used published X-ray observations of M 17 obtained with the Chandra X-ray Observatory, as well as infrared data obtained with the Very Large Telescope and with the Spitzer Space Telescope, to look for evidence of a jet-driving source. Results: We have detected what appears to be the first jet identified in M 17 visible HII region. The jet is composed of a set of knots, two of which have significant radial velocities with respect to the HII region, and a distant arc-like bright nebulosity that may represent an early episode of intense mass loss by the jet-driving source. The follow-up spectra of the structures composing the jet, including the arc, support this interpretation by revealing intense forbidden lines of [NII] and [SII] due to enhanced collisional excitation in shocks. The presence of a X-ray source, most likely a young stellar object, at a position where the jet launching source should be expected to lie reinforces the interpretation. We identify a tentative near-infrared counterpart of the X-ray source, although it is offset by 1".9 from the nominal position of the X-ray source, which is almost three times the radius of its positional uncertainty. The very weak [OI] emission in the spectra of the jet knots and the arc suggests that they are nearly fully ionized, in agreement with the environment in which the jet is

  1. Carbon-14 waste management

    International Nuclear Information System (INIS)

    Carbon-14 occurs in nature, but is also formed in nuclear reactors. Because of its long half-life and the biological significance of carbon, releases from nuclear facilities could have a significant radiological impact. Waste management strategies for carbon-14 are therefore of current concern. Carbon-14 is present in a variety of waste streams both at reactors and at reprocessing plants. A reliable picture of the production and release of carbon-14 from various reactor systems has been built up for the purposes of this study. A possible management strategy for carbon-14 might be the reduction of nitrogen impurity levels in core materials, since the activation of 14N is usually the dominant source of carbon-14. The key problem in carbon-14 management is its retention of off-gas streams, particularly in the dissolver off-gas stream at reprocessing plants. Three alternative trapping processes that convert carbon dioxide into insoluble carbonates have been suggested. The results show that none of the options considered need be rejected on the grounds of potential radiation doses to individuals. All exposures should be as low as reasonably achievable, economic and social factors being taken into account. If, on these grounds, retention and disposal of carbon-14 is found to be beneficial, then, subject to the limitations noted, appropriate retention, immobilization and disposal technologies have been identified

  2. Role of Th17 cells and IL-17 in lung transplant rejection

    OpenAIRE

    Shilling, Rebecca A.; Wilkes, David S.

    2011-01-01

    In the past decade, advances in immunology have led to the recognition that T cell differentiation is not simply Th1 or Th2 but involves differentiation to other subsets, such as T regulatory cells, T follicular helper cells, and Th17 cells. Th17 cells, characterized by production of IL-17, IL-22, and IL-21, have been implicated in the pathogenesis of autoimmune diseases, like rheumatoid arthritis and multiple sclerosis, but also play an important role in host defense and mucosal immunity. IL...

  3. Proton Radii of B12-17 Define a Thick Neutron Surface in B17

    Science.gov (United States)

    Estradé, A.; Kanungo, R.; Horiuchi, W.; Ameil, F.; Atkinson, J.; Ayyad, Y.; Cortina-Gil, D.; Dillmann, I.; Evdokimov, A.; Farinon, F.; Geissel, H.; Guastalla, G.; Janik, R.; Kimura, M.; Knöbel, R.; Kurcewicz, J.; Litvinov, Yu. A.; Marta, M.; Mostazo, M.; Mukha, I.; Nociforo, C.; Ong, H. J.; Pietri, S.; Prochazka, A.; Scheidenberger, C.; Sitar, B.; Strmen, P.; Suzuki, Y.; Takechi, M.; Tanaka, J.; Tanihata, I.; Terashima, S.; Vargas, J.; Weick, H.; Winfield, J. S.

    2014-09-01

    The first determination of radii of point proton distribution (proton radii) of B12-17 from charge-changing cross sections (σCC) measurements at the FRS, GSI, Darmstadt is reported. The proton radii are deduced from a finite-range Glauber model analysis of the σCC. The radii show an increase from B13 to B17 and are consistent with predictions from the antisymmetrized molecular dynamics model for the neutron-rich nuclei. The measurements show the existence of a thick neutron surface with neutron-proton radius difference of 0.51(0.11) fm in B17.

  4. Inorganic arsenic represses interleukin-17A expression in human activated Th17 lymphocytes

    International Nuclear Information System (INIS)

    Trivalent inorganic arsenic [As(III)] is an efficient anticancer agent used to treat patients suffering from acute promyelocytic leukemia. Recently, experimental studies have clearly demonstrated that this metalloid can also cure lymphoproliferative and/or pro-inflammatory syndromes in different murine models of chronic immune-mediated diseases. T helper (Th) 1 and Th17 lymphocytes play a central role in development of these diseases, in mice and humans, especially by secreting the potent pro-inflammatory cytokine interferon-γ and IL-17A, respectively. As(III) impairs basic functions of human T cells but its ability to modulate secretion of pro-inflammatory cytokines by differentiated Th lymphocytes is unknown. In the present study, we demonstrate that As(III), used at concentrations clinically achievable in plasma of patients, has no effect on the secretion of interferon-γ from Th1 cells but almost totally blocks the expression and the release of IL-17A from human Th17 lymphocytes co-stimulated for five days with anti-CD3 and anti-CD28 antibodies, in the presence of differentiating cytokines. In addition, As(III) specifically reduces mRNA levels of the retinoic-related orphan receptor (ROR)C gene which encodes RORγt, a key transcription factor controlling optimal IL-17 expression in fully differentiated Th17 cells. The metalloid also blocks initial expression of IL-17 gene induced by the co-stimulation, probably in part by impairing activation of the JNK/c-Jun pathway. In conclusion, our results demonstrate that As(III) represses expression of the major pro-inflammatory cytokine IL-17A produced by human Th17 lymphocytes, thus strengthening the idea that As(III) may be useful to treat inflammatory immune-mediated diseases in humans. -- Highlights: ► Arsenic inhibits secretion of IL-17A from human naïve and memory Th17 lymphocytes. ► Arsenic represses early expression of IL-17A gene in human activated T lymphocytes. ► Arsenic interferes with activation of

  5. Inorganic arsenic represses interleukin-17A expression in human activated Th17 lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Morzadec, Claudie; Macoch, Mélinda; Robineau, Marc; Sparfel, Lydie [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Fardel, Olivier [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France); Pôle Biologie, Centre Hospitalier Universitaire (CHU) Rennes, 2 rue Henri Le Guilloux, 35033 Rennes (France); Vernhet, Laurent, E-mail: laurent.vernhet@univ-rennes1.fr [UMR INSERM U1085, Institut de Recherche sur la Santé, l' Environnement et le Travail (IRSET), Université de Rennes 1, 2 avenue du Professeur Léon Bernard, 35043 Rennes (France)

    2012-08-01

    Trivalent inorganic arsenic [As(III)] is an efficient anticancer agent used to treat patients suffering from acute promyelocytic leukemia. Recently, experimental studies have clearly demonstrated that this metalloid can also cure lymphoproliferative and/or pro-inflammatory syndromes in different murine models of chronic immune-mediated diseases. T helper (Th) 1 and Th17 lymphocytes play a central role in development of these diseases, in mice and humans, especially by secreting the potent pro-inflammatory cytokine interferon-γ and IL-17A, respectively. As(III) impairs basic functions of human T cells but its ability to modulate secretion of pro-inflammatory cytokines by differentiated Th lymphocytes is unknown. In the present study, we demonstrate that As(III), used at concentrations clinically achievable in plasma of patients, has no effect on the secretion of interferon-γ from Th1 cells but almost totally blocks the expression and the release of IL-17A from human Th17 lymphocytes co-stimulated for five days with anti-CD3 and anti-CD28 antibodies, in the presence of differentiating cytokines. In addition, As(III) specifically reduces mRNA levels of the retinoic-related orphan receptor (ROR)C gene which encodes RORγt, a key transcription factor controlling optimal IL-17 expression in fully differentiated Th17 cells. The metalloid also blocks initial expression of IL-17 gene induced by the co-stimulation, probably in part by impairing activation of the JNK/c-Jun pathway. In conclusion, our results demonstrate that As(III) represses expression of the major pro-inflammatory cytokine IL-17A produced by human Th17 lymphocytes, thus strengthening the idea that As(III) may be useful to treat inflammatory immune-mediated diseases in humans. -- Highlights: ► Arsenic inhibits secretion of IL-17A from human naïve and memory Th17 lymphocytes. ► Arsenic represses early expression of IL-17A gene in human activated T lymphocytes. ► Arsenic interferes with activation of

  6. 从炭材料到低碳社会——2012世界炭会议介绍%How will carbon material lead to a low carbon society——A review of Carbon 2012

    Institute of Scientific and Technical Information of China (English)

    刘旭光

    2012-01-01

    A review is given of the Annual World Conference on Carbon, which was held on June 17-22, 2012 in Krakow, Poland and organized by the Polish Carbon Society. In this conference, 5 plenary lectures, 30 keynote lectures, 220 oral presentations and 465 posters were divided into 10 topics, i. e. , carbons for energy storage ; carbons for health and environmental protection; precursors, processing and technology; carbon nanomate-rials; porous carbons; carbon-based composites; graphene; new methods for carbon characterization; computation and modeling; and industrial news. Besides traditional modification on surface area and porosity, doping with hetero atoms such as N, B and P or compositing with metals or metal oxides have been developed into effective means for modifying carbon materials for improved adsorption, catalysis and energy-storage performance. The applications of novel carbon structures like nanotubes are still limited by the controllable and scalable preparation, processability and reactivity. Research on the structure and properties of graphene is moving from curiosity-oriented to application-oriented. Mathematical formulation or modeling of pore structures has been promoted by the progress in characterization methods. The modification of the surface/interface in carbon materials, which plays important roles in determining their physical, chemical or mechanical properties is still a focus of research activity in carbon materials.

  7. Net carbon flux in organic and conventional olive production systems

    Science.gov (United States)

    Saeid Mohamad, Ramez; Verrastro, Vincenzo; Bitar, Lina Al; Roma, Rocco; Moretti, Michele; Chami, Ziad Al

    2014-05-01

    Agricultural systems are considered as one of the most relevant sources of atmospheric carbon. However, agriculture has the potentiality to mitigate carbon dioxide mainly through soil carbon sequestration. Some agricultural practices, particularly fertilization and soil management, can play a dual role in the agricultural systems regarding the carbon cycle contributing to the emissions and to the sequestration process in the soil. Good soil and input managements affect positively Soil Organic Carbon (SOC) changes and consequently the carbon cycle. The present study aimed at comparing the carbon footprint of organic and conventional olive systems and to link it to the efficiency of both systems on carbon sequestration by calculating the net carbon flux. Data were collected at farm level through a specific and detailed questionnaire based on one hectare as a functional unit and a system boundary limited to olive production. Using LCA databases particularly ecoinvent one, IPCC GWP 100a impact assessment method was used to calculate carbon emissions from agricultural practices of both systems. Soil organic carbon has been measured, at 0-30 cm depth, based on soil analyses done at the IAMB laboratory and based on reference value of SOC, the annual change of SOC has been calculated. Substracting sequestrated carbon in the soil from the emitted on resulted in net carbon flux calculation. Results showed higher environmental impact of the organic system on Global Warming Potential (1.07 t CO2 eq. yr-1) comparing to 0.76 t CO2 eq. yr-1 in the conventional system due to the higher GHG emissions caused by manure fertilizers compared to the use of synthetic foliar fertilizers in the conventional system. However, manure was the main reason behind the higher SOC content and sequestration in the organic system. As a resultant, the organic system showed higher net carbon flux (-1.7 t C ha-1 yr-1 than -0.52 t C ha-1 yr-1 in the conventional system reflecting higher efficiency as a

  8. Exon: CBRC-RNOR-17-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-RNOR-17-0003 AAGATAATGATGGTGGTGGTGATgggggagaaagagggagaacagaaggaggggaggaggaggaggaagagaaggaggaagagg...acagtaagaaggaaagaaaaaagaaagaaaaagaaaggaaggaagaaagaggaaggaagaaagaaaggaaggaaagaaggaaggaaggaaggaaggaaggagggagggagggg...ggagggagggagggaatgagggagggagggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaagCAGAAG ...

  9. Exon: CBRC-GACU-17-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CTGGTCTCTGCTGCAGGATTCGGGTCTGTCCTCGGTGGACTGGTCTCTGCTGGAGGATTCGGGTCTGTCCTCGGTGGACTGGTCTCTGCTGGAGGATGTGGGTCTGTC...CTCGGTGGACTGGTCTCTGCTGGAGGATTCGGGTCTGTCCTCGGTGGACTGGTCTCTGCTGGAGGATTCGGGTCTGTCCTCGGTGGACTGGTCTCTGCTGGAGGAT ... ...CBRC-GACU-17-0001 GTCCGAGAACTGCGGTGGAGCCCGGATGTGGGTCTGTCCCTCGGTGGACTGGTCTCTGCTGGAGGATGTGGGTCTTGTCCTCGGTGGA

  10. Return to youth with Sox17

    OpenAIRE

    Chhabra, Akanksha; Mikkola, Hanna K. A.

    2011-01-01

    Maturation of hematopoietic stem cells (HSCs) from fetal to adult state and differentiation to progenitors are thought to follow a one-way street. In this issue of Genes & Development, He and colleagues (pp. 1613–1627) show that overexpression of Sox17 can convert adult multipotential progenitors to self-renewing HSCs that possess fetal properties. These findings challenge the irreversibility of hematopoietic development, and open up new perspectives to understand the different forms of HSC s...

  11. Mosaic partial trisomy 17q2

    OpenAIRE

    King, P. A.; Ghosh, A; Tang, M

    1991-01-01

    Examination of an infant born after prenatal diagnosis of mosaic partial trisomy 17q2 showed the unique phenotypic features of this chromosomal abnormality, that is, frontal bossing, large mouth, brachyrhizomelia, and hexadactyly. Amniocentesis was performed because of polyhydramnios and ultrasound diagnosis of fetal craniofacial dysmorphology and rhizomelic shortening of the limbs. Chromosomal mosaicism was restricted to fetal tissue and amniotic fluid cells. The placental chromosomal comple...

  12. Snapping Supernovae at z>1.7

    OpenAIRE

    Aldering , Greg; Kim, Alex G.; Kowalski, Marek; Linder, Eric V.; Perlmutter, Saul

    2006-01-01

    We examine the utility of very high redshift Type Ia supernovae for cosmology and systematic uncertainty control. Next generation space surveys such as the Supernova/Acceleration Probe (SNAP) will obtain thousands of supernovae at z>1.7, beyond the design redshift for which the supernovae will be exquisitely characterized. We find that any z\\gtrsim2 standard candles' use for cosmological parameter estimation is quite modest and subject to pitfalls; we examine gravitational lensing, redshift c...

  13. Snapping Supernovae at z>1.7

    OpenAIRE

    Aldering , Greg

    2009-01-01

    We examine the utility of very high redshift Type Ia supernovae for cosmology and systematic uncertainty control. Next generation space surveys such as the Supernova/Acceleration Probe (SNAP) will obtain thousands of supernovae at z>1.7, beyond the design redshift for which the supernovae will be exquisitely characterized. We find that any z gtrsim 2 standard candles' use for cosmological parameter estimation is quite modest and subject to pitfalls; we examine gravitational lensing, redshift ...

  14. Molecular mapping of chromosomes 17 and X

    Energy Technology Data Exchange (ETDEWEB)

    Barker, D.F.

    1991-01-15

    Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition of new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping clones from a larger genome.

  15. Autoimmune diseases in the TH17 era

    Directory of Open Access Journals (Sweden)

    D. Mesquita Jr.

    2009-06-01

    Full Text Available A new subtype of CD4+ T lymphocytes characterized by the production of interleukin 17, i.e., TH17 cells, has been recently described. This novel T cell subset is distinct from type 1 and type 2 T helper cells. The major feature of this subpopulation is to generate significant amounts of pro-inflammatory cytokines, therefore appearing to be critically involved in protection against infection caused by extracellular microorganisms, and in the pathogenesis of autoimmune diseases and allergy. The dynamic balance among subsets of T cells is important for the modulation of several steps of the immune response. Disturbances in this balance may cause a shift from normal immunologic physiology to the development of immune-mediated disorders. In autoimmune diseases, the fine balance between the proportion and degree of activation of the various T lymphocyte subsets can contribute to persistent undesirable inflammatory responses and tissue replacement by fibrosis. This review highlights the importance of TH17 cells in this process by providing an update on the biology of these cells and focusing on their biology and differentiation processes in the context of immune-mediated chronic inflammatory diseases.

  16. Snapping Supernovae at z>1.7

    Energy Technology Data Exchange (ETDEWEB)

    Aldering, Greg; Kim, Alex G.; Kowalski, Marek; Linder, Eric V.; Perlmutter, Saul

    2006-07-03

    We examine the utility of very high redshift Type Ia supernovae for cosmology and systematic uncertainty control. Next generation space surveys such as the Supernova/Acceleration Probe (SNAP) will obtain thousands of supernovae at z>1.7, beyond the design redshift for which the supernovae will be exquisitely characterized. We find that any z gtrsim 2 standard candles' use for cosmological parameter estimation is quite modest and subject to pitfalls; we examine gravitational lensing, redshift calibration, and contamination effects in some detail. The very high redshift supernovae - both thermonuclear and core collapse - will provide copious interesting information on star formation, environment, and evolution. However, the new observational systematics that must be faced, as well as the limited expansion of SN-parameter space afforded, does not point to high value for 1.71.7. Synergy with observations from JWST and thirty meter class telescopes afford rich opportunities for advances throughout astrophysics.

  17. Carbon isotopes in mollusk shell carbonates

    Science.gov (United States)

    McConnaughey, Ted A.; Gillikin, David Paul

    2008-10-01

    Mollusk shells contain many isotopic clues about calcification physiology and environmental conditions at the time of shell formation. In this review, we use both published and unpublished data to discuss carbon isotopes in both bivalve and gastropod shell carbonates. Land snails construct their shells mainly from respired CO2, and shell δ13C reflects the local mix of C3 and C4 plants consumed. Shell δ13C is typically >10‰ heavier than diet, probably because respiratory gas exchange discards CO2, and retains the isotopically heavier HCO3 -. Respired CO2 contributes less to the shells of aquatic mollusks, because CO2/O2 ratios are usually higher in water than in air, leading to more replacement of respired CO2 by environmental CO2. Fluid exchange with the environment also brings additional dissolved inorganic carbon (DIC) into the calcification site. Shell δ13C is typically a few ‰ lower than ambient DIC, and often decreases with age. Shell δ13C retains clues about processes such as ecosystem metabolism and estuarine mixing. Ca2+ ATPase-based models of calcification physiology developed for corals and algae likely apply to mollusks, too, but lower pH and carbonic anhydrase at the calcification site probably suppress kinetic isotope effects. Carbon isotopes in biogenic carbonates are clearly complex, but cautious interpretation can provide a wealth of information, especially after vital effects are better understood.

  18. Curie temperature rising by fluorination for Sm2Fe17

    Directory of Open Access Journals (Sweden)

    Matahiro Komuro

    2013-02-01

    Full Text Available Fluorine atoms can be introduced to Sm2Fe17 using XeF2 below 423 K. The resulting fluorinated Sm2Fe17 powders have ferromagnetic phases containing Sm2Fe17FY1(017FY2 (117, and α-Fe. The unit cell for Sm2Fe17 is elongated by the fluorination. The largest unit cell volume among the rhombohedral Sm2Fe17 compounds is 83.8 nm3, which is 5.8% larger than Sm2Fe17. The rhombohedral Sm2Fe17 with the largest unit cell volume is dissociated above 873 K, and fluorination increases Curie temperature from 403 K for Sm2Fe17 to 675 K. This increase can be explained by the magneto-volume effect.

  19. Expression of interleukin-6 is downregulated by 17-(allylamino)-17-demethoxygeldanamycin in human prostatic carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    Ke-hung TSUI; Tsui-hsia FENG; Wen-chi HSIEH; Phei-lang CHANG; Horng-heng JUANG

    2008-01-01

    Aim: Interleukin-6 (IL-6) is a pleiotropic cytokine that is associated with tumor metastasis and prostate cancer. We evaluated the mechanism and effect of 17-(allylamino)-17-demethoxygeldanamycin (17AAG), a novel inhibitor of heat shock protein 90 (Hsp90), on the IL-6 gene expression in human prostatic carcinoma (PC-3) cells. Methods: Quantitative IL-6 and IL-6 receptor (IL-6R) expressions were assessed using RT-PCR. The deregulation of 17AAG and phor-bol 12-myristate 13-acetate (PMA) on the IL-6 gene was determined by ELISA and transient gene expression assays using an IL-6 reporter vector. Results: Although the IL-6R is ubiquitously expressed by prostatic epithelium cells, the IL-6 expression is only found in advanced prostatic carcinoma cells, such as PC-3 and DU145. Further studies using RT-PCR indicated that 17AAG downregulated the gene expression of IL-6. ELISA and the transient gene expression assay revealed that 17AAG blocked the stimulation of PMA of IL-6 gene expression in PC-3 cells. The PMA-induced IL-6 gene expression is dependent on the NF-κB response element. However, the effect of 17AAG appears to be mediated via a region located at -149 to +8 bp upstream of the transcriptional starting site of the IL-6 gene, and might not be through the NF-κB signaling pathway. Conclusion: The present study reveals that IL-6 is transcriptionally downregulated in human prostatic carcinoma cells in response to 17AAG. This result suggests the presence of a novel Hsp90 mediation pathway that is involved in the deregulation on the transcription of the human IL-6 gene in human prostate cancer.

  20. MELCOR model for an experimental 17x17 spent fuel PWR assembly.

    Energy Technology Data Exchange (ETDEWEB)

    Cardoni, Jeffrey

    2010-11-01

    A MELCOR model has been developed to simulate a pressurized water reactor (PWR) 17 x 17 assembly in a spent fuel pool rack cell undergoing severe accident conditions. To the extent possible, the MELCOR model reflects the actual geometry, materials, and masses present in the experimental arrangement for the Sandia Fuel Project (SFP). The report presents an overview of the SFP experimental arrangement, the MELCOR model specifications, demonstration calculation results, and the input model listing.

  1. IL-17A/IL-17RA interaction promoted metastasis of osteosarcoma cells

    OpenAIRE

    Wang, Mingmin; Wang, Luanqiu; Ren, Tao; Lin XU; Wen, Zhenke

    2013-01-01

    Osteosarcoma (OS) is the most common human primary malignant bone tumor in children and young adults with poor prognosis because of their high metastatic potential. Identification of key factors that could regulate the aggressive biologic behavior of OS, particularly with respect to metastasis, would be necessary if significant improvements in therapeutic outcome are to occur. In this study, we carefully evaluated the potential role of IL-17A/IL-17RA interaction in metastasis of OS. We found ...

  2. Theoretical Investigation of the Exotic Structure of the Mirror Nuclei 17Ne and 17N

    Institute of Scientific and Technical Information of China (English)

    LIANG Yu-Jie; LI Xi-Han; DENG Fu-Guo; LIU Zu-Hua; ZHOU Hong-Yu

    2006-01-01

    @@ The exotic structures of the ground state of the mirror nuclei 17Ne and 17N are investigated by means of the asymptotic normalization coefficient (ANC) method to explore the role of the Coulomb interaction. The probabilities of a valence nucleon outside the binding-potential are P = 56.69±2.987.46%for 17Ne and P = 45.51 ±2.325.81% for 17N. The rms radii are 1/2 5.06±0.110.30 fm and 1/2 = 4.24±0.060.16 fm, respectively. The results obtained are nearly independent of the potential parameters. According to the halo occurrence conditions, it is suggested that 17 Ne is a two-proton halo and 17 N is a two-neutron skin. Moreover, two effects of the Coulomb interaction on the exotic structure are analysed. From the present results, the exotic structure of the nucleus in the proton-rich side is more obvious than that of its mirror nucleus because of the Coulomb interaction.

  3. Human Th17 cells in patients with cancer

    OpenAIRE

    Greten, Tim F.; Zhao, Fei; Gamrekelashvili, Jaba; Korangy, Firouzeh

    2012-01-01

    The role of interleukin-17 (IL-17)-secreting CD4+ T (Th17) cells in cancer is under intense investigation. We have demonstrated that CCR4+CCR6+ Th17 cells not only are increased in the peripheral blood of patients affected by hepatocellular carcinoma, but also suppress CD8+ T-cell functions in vitro. These results suggest that Th17 cells may exert immunosuppressive functions in hepatocellular carcinoma.

  4. IL-17A and Th17 Cells in Lung Inflammation: An Update on the Role of Th17 Cell Differentiation and IL-17R Signaling in Host Defense against Infection

    OpenAIRE

    Reen Wu; Li-Yin Hung; Hsing-Chuan Tsai; Sharlene Velichko

    2013-01-01

    The significance of Th17 cells and interleukin- (IL-)17A signaling in host defense and disease development has been demonstrated in various infection and autoimmune models. Numerous studies have indicated that Th17 cells and its signature cytokine IL-17A are critical to the airway's immune response against various bacteria and fungal infection. Cytokines such as IL-23, which are involved in Th17 differentiation, play a critical role in controlling Klebsiella pneumonia (K. pneumonia) infection...

  5. A guide to 17beta-hydroxysteroid dehydrogenases.

    Science.gov (United States)

    Adamski, J; Jakob, F J

    2001-01-22

    17beta-Hydroxysteroid dehydrogenases (17beta-HSD) are pivotal in controlling the biological potency of steroid hormones by catalyzing oxidation or reduction at position 17. Several 17beta-HSDs may as well metabolize further substrates including alcohols, bile acids, fatty acids and retinols. This review summarizes recent progress in the field of 17beta-HSD research provides an update of nomenclature. PMID:11165003

  6. Analysis list: Sox17 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Sox17 Pluripotent stem cell + mm9 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Sox...17.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Sox17.5.tsv http://dbarchive.bioscien...cedbc.jp/kyushu-u/mm9/target/Sox17.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Sox17.Pluripot

  7. Placental transfer and metabolism of 17 alpha-ethynylestradiol-17 beta and estradiol-17 beta in the rhesus monkey

    International Nuclear Information System (INIS)

    The synthetic estrogen component of many oral contraceptives, 17 alpha-ethynylestradiol-17 beta (EE2) and the naturally occurring estrogen, estradiol-17 beta (E2) were studied in four pregnant rhesus monkeys (71% term: 108-121 days gestational age). Under ketamine anesthesia, catheters were implanted in the maternal femoral artery and fetal interplacental artery. After simultaneous i.v. administration of [3H]EE2-[14C]E2 to the maternal animal, serial blood samples were drawn from both mother and fetus. The estrogens and metabolites were identified and quantified by the comigration of radioactivity with reference standards in several high-performance liquid chromatography systems and subsequent selective enzyme hydrolysis of the conjugates. Only estrone (E1), E1 sulfate, EE2 and EE2-3 sulfate were observed in the fetal circulation, whereas the major radiolabeled compounds in the maternal circulation consisted of the above plus E2, E1 glucuronide and EE2-3 glucuronide. In order to determine whether the placenta could convert E2 to its metabolite E1, the placentas of three term rhesus monkeys were perfused in situ via the umbilical artery with 120 ml (15 ml/min) of Hanks' balanced salt solution (pH 7.4) containing [3H]E2. High-performance liquid chromatographic analysis of umbilical vein samples revealed that 96% of the E2 was metabolized to E1. These studies indicate that the placenta can metabolize the potent naturally occurring estrogen E2 to the less potent E1. In contrast, the synthetic estrogen EE2 does not undergo this placental metabolic conversion and thus enters the fetal circulation as the parent compound

  8. Critical Role of the Interleukin-17/Interleukin-17 Receptor Axis in Regulating Host Susceptibility to Respiratory Infection with Chlamydia Species▿

    OpenAIRE

    Zhou, Xiaohui; Chen, Qiangwei; Moore, Jessica; Kolls, Jay K.; Halperin, Scott; Wang, Jun

    2009-01-01

    The specific contribution of interleukin-17/interleukin-17 receptor (IL-17/IL-17R)-mediated responses in regulating host susceptibility against obligatory intracellular Chlamydia infection was investigated in C57BL/6 and C3H/HeN mice during Chlamydia muridarum respiratory infection. We demonstrated that Chlamydia stimulated IL-17/IL-17R-associated responses in both Chlamydia-resistant C57BL/6 and Chlamydia-susceptible C3H/HeN mice. However, C3H/HeN mice developed a significantly greater IL-17...

  9. Plumbing carbon nanotubes

    Science.gov (United States)

    Jin, Chuanhong; Suenaga, Kazu; Iijima, Sumio

    2008-01-01

    Since their discovery, the possibility of connecting carbon nanotubes together like water pipes has been an intriguing prospect for these hollow nanostructures. The serial joining of carbon nanotubes in a controlled manner offers a promising approach for the bottom-up engineering of nanotube structures-from simply increasing their aspect ratio to making integrated carbon nanotube devices. To date, however, there have been few reports of the joining of two different carbon nanotubes. Here we demonstrate that a Joule heating process, and associated electro-migration effects, can be used to connect two carbon nanotubes that have the same (or similar) diameters. More generally, with the assistance of a tungsten metal particle, this technique can be used to seamlessly join any two carbon nanotubes-regardless of their diameters-to form new nanotube structures.

  10. Carbon-negative biofuels

    International Nuclear Information System (INIS)

    Current Kyoto-based approaches to reducing the earth's greenhouse gas problem involve looking for ways to reduce emissions. But these are palliative at best, and at worst will allow the problem to get out of hand. It is only through sequestration of atmospheric carbon that the problem can be solved. Carbon-negative biofuels represent the first potentially huge assault on the problem, in ways that are already technically feasible and practicable. The key to carbon negativity is to see it not as technically determined but as an issue of strategic choice, whereby farmers and fuel producers can decide how much carbon to return to the soil. Biochar amendment to the soil not only sequesters carbon but also enhances the fertility and vitality of the soil. The time is approaching when biofuels will be carbon negative by definition, and, as such, they will sweep away existing debates over their contribution to the solution of global warming. (author)

  11. Extended shelf life flavoured dairy drink using dissolved carbon dioxide.

    Science.gov (United States)

    Ravindra, Menon Rekha; Rao, K Jayaraj; Nath, B Surendra; Ram, Chand

    2014-01-01

    Cardamom flavoured dairy beverage prepared using standardized method was carbonated in glass bottles. Carbonation at 50 psi pressure for 30 s was recommended. The pasteurized flavoured drink, carbonated or otherwise was evaluated for sensory, chemical and microbial quality during its refrigerated storage. The uncarbonated control samples were found to be sensorily acceptable up to 14 days, while the carbonated beverage remained acceptable up to 30 days. Carbonation of drink significantly affected the pH and acidity of product without reducing its acceptability. Carbonation resulted in inhibition of microbes, the effect was pronounced on psychrotrophic count. There was a linear but marginal increase in the pH of the carbonated samples till the 17(th) day of storage; the values diminished thereafter. The carbonated samples also had significantly reduced contents of FFA and soluble nitrogen compared to that of uncarbonated control samples as storage progressed beyond 10 days and this was attributed to inhibited microbial growth. PMID:24426058

  12. Effects of land use alteration on tropical carbon exchange

    International Nuclear Information System (INIS)

    The net annual release of carbon from tropical forests of the world is estimated to range from 0.6 to 1.1 billion tons (Gt), based on computer model simulations. The simulations incorporate the most recent data on tropical land use change, regional differences in biomass and soil carbon density, and the conversion of forest to both shifting cultivation and to permanent agriculture. Carbon accumulation in fallow and immature forests and in organic soil wetlands also is included. In general, biomass increases with temperature and moisture. Model simulations indicate that releases of 0.30 to 0.48 Gt/yr occur in South America, the region with the largest forest area, although deforestation rates are lower than the global average. In Southeast Asia, where mean regional forest biomass is high, carbon release rates range from 0.17 to 0.34 Gt/yr. The simulated releases are significantly lower than those resulting from some earlier analyses which evaluated less detailed data on land-use change and carbon densities. The results suggest that tropical forests, when compared to fossil-fuel sources, are presently a relatively small carbon source. However, understanding of the biosphere's role in the global carbon cycle requires further refinement in analysis of the many asynchronous regional carbon pools. 61 refs., 2 figs., 7 tabs

  13. Carbon monoxide poisoning

    OpenAIRE

    Dolan, Michael C.

    1985-01-01

    Carbon monoxide poisoning is a significant cause of illness and death. Its protean symptoms probably lead to a gross underestimation of its true incidence. Low levels of carbon monoxide aggravate chronic cardiopulmonary problems, and high levels are associated with cardiac arrhythmias and cerebral edema. Patients who survive acute poisoning are at risk of delayed neurologic sequelae. The measurement of carboxyhemoglobin levels does not reveal the tissue levels of carbon monoxide but is useful...

  14. The carbon dioxide cycle

    Science.gov (United States)

    James, P.B.; Hansen, G.B.; Titus, T.N.

    2005-01-01

    The seasonal CO2 cycle on Mars refers to the exchange of carbon dioxide between dry ice in the seasonal polar caps and gaseous carbon dioxide in the atmosphere. This review focuses on breakthroughs in understanding the process involving seasonal carbon dioxide phase changes that have occurred as a result of observations by Mars Global Surveyor. ?? 2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

  15. Carbon monoxide poisoning (acute)

    OpenAIRE

    Olson, Kent; Smollin, Craig

    2010-01-01

    The main symptoms of carbon monoxide poisoning are non-specific in nature and relate to effects on the brain and heart. The symptoms correlate poorly with serum carboxyhaemoglobin levels. People with comorbidity, elderly or very young people, and pregnant women are most susceptible.Carbon monoxide is produced by the incomplete combustion of carbon fuels, including inadequately ventilated heaters and car exhausts, or from chemicals such as methylene chloride paint stripper.Poisoning is cons...

  16. Carbon nanotubes decorating methods

    OpenAIRE

    A.D. Dobrzańska-Danikiewicz; D. Łukowiec; D. Cichock; W. Wolany

    2013-01-01

    Purpose: The work is to present and characterise various methods of depositing carbon nanotubes with nanoparticles of precious metals, and also to present the results of own works concerning carbon nanotubes coated with platinum nanoparticles.Design/methodology/approach: Electron transmission and scanning microscopy has been used for imaging the structure and morphology of the nanocomposites obtained and the distribution of nanoparticles on the surface of carbon nanotubes.Findings: The studie...

  17. Functionalization of Carbon Nanotubes

    OpenAIRE

    Abraham, Jürgen

    2005-01-01

    Carbon nanotubes have an enormous potential due to their outstanding electronic, optical, and mechanical properties. However, any technological application is still hindered due to problems regarding the processibility of the pristine carbon nanotubes. In the past few years, it has been shown that the chemical modification of the carbon nanotubes is an inevitable step prior to their application. The first part of this work (chapter 3.1) was focused on the purification of pristine laser ablati...

  18. IL-17 expression by breast-cancer-associated macrophages: IL-17 promotes invasiveness of breast cancer cell lines

    OpenAIRE

    ZHU, XINGWU; Mulcahy, Lori A; Mohammed, Rabab AA; Lee, Andrew HS; Franks, Hester A; Kilpatrick, Laura; Yilmazer, Acelya; Paish, E. Claire; Ellis, Ian O; Patel, Poulam M; Jackson, Andrew M

    2008-01-01

    Introduction IL-17 plays an important role in autoimmunity, promoting autoimmunity, inflammation and invasion in multiple sclerosis, rheumatoid arthritis and type I diabetes. The role of IL-17 in cancer is unclear, however, as there are few studies examining IL-17 protein expression in cancer. We therefore examined IL-17 protein expression in human breast cancer and modelled its potential biological significance in vitro. Methods Immunohistochemistry was used to determine IL-17 expression in ...

  19. Functional effects of 17alpha-hydroxyprogesterone caproate (17P on human myometrial contractility in vitro

    Directory of Open Access Journals (Sweden)

    Morrison John J

    2004-12-01

    Full Text Available Abstract Background 17alpha-hydroxyprogesterone caproate (17P administration reportedly improves outcome for women with a previous spontaneous preterm delivery. This study, using in vitro strips of human uterine smooth muscle, aimed to investigate the direct non-genomic effects of 17P on spontaneous and induced contractions in tissues obtained during pregnancy, and in the non-pregnant state. Methods Biopsies of human myometrium were obtained at elective cesarean section, and from hysterectomy specimens, and dissected strips suspended for isometric recordings. The effects of 17P (1 nmol/L -10 micro mol/L on spontaneous and agonist-induced (oxytocin 0.5 nmol/L for pregnant, phenylephrine 10 μmol/L for non-pregnant contractions were measured. Integrals of contractile activity, including the mean maximal inhibition values (MMI observed at the maximal concentration, were compared with those from simultaneously run control strips. Results There was no significant direct effect exerted by 17P on pregnant or non-pregnant human myometrial contractility. The MMI ± SEM for spontaneous contractions in pregnant myometrium was 4.9% ± 7.2 (n = 6; P = 0.309 and for oxytocin-induced contractions was 2.2% ± 1.3 (n = 6; P = 0.128. For non-pregnant myometrium, the MMI ± SEM for spontaneous contractions was 8.8% ± 11.0 (n = 6; P = 0.121 and for phenylephrine induced contractions was -7.9% ± 6.5 (n = 6; P = 0.966. Conclusions The putative benefits of 17P for preterm labor prevention are not achieved, even partially, by a direct utero-relaxant effect. These findings outline the possibility that genomic effects of 17P, achieved over long periods of administration, are required for its reported therapeutic benefits.

  20. Th17细胞与银屑病%Th17 cells and psoriasis

    Institute of Scientific and Technical Information of China (English)

    王彦红; 许爱娥

    2008-01-01

    Psoriasis is traditionally viewed as a chronic inflammatory skin disease driven by Th1 cellular immune response. Recently, a novel and unique subset of interleukin (IL)-17 producing CD4+ effector T (Th17) cells, which are distinct from Th1 and Th2 cells, have been discovered. It may be crucial in the pathogenesis of various chronic inflammatory diseases that were formerly categorized as Th1-mediated disorders including psoriasis. Th17 cells may play a more important role than Th1 cells in the pathogenesis of psoriasis. This paper presents the significance of Th17 cells in the pathogenesis of psoriasis as well as in the identification of potential targets for the treatment of psoriasis.%银屑病是一种Th1细胞免疫反应介导的慢性炎症性皮肤病.近年发现一种新型的CD4+效应性T细胞--Th17细胞,不同于Th1和Th2细胞,特异性产生IL-17,在许多既往归类于Th1介导的慢性炎症性疾病中(包括银屑病)发挥重要作用.文中将介绍Th17细胞免疫反应在银屑病发病中的作用,同时介绍其在目前银屑病治疗方法中的意义和在新的潜在治疗靶位中的前景.

  1. Influence of Rare Earth Metals on Microstructure and Inclusions Morphology G17CrMo5-5 Cast Steel

    Directory of Open Access Journals (Sweden)

    Kasińska J.

    2014-10-01

    Full Text Available This paper presents influence of rare earth metals (REM on the microstructure and morphology of non-metallic inclusions of G17CrMo5-5 cast carbon steel The research has been performed on successive industrial melts. Each time about 2000 kg of liquid metal was modified. The REM was in the form of mishmetal of the composition 49, 8% Ce, 21, 8% La, 17, 1% Nd, 5, 5% Pr and 5, 35% the rest of REM. Therareearth metals were put into the ladle during tapping of heat melt from the furnace.

  2. Physics of carbon nanostructures

    International Nuclear Information System (INIS)

    Carbon is a prominent element that appears in various structures with new promising technological applications. The physics of carbon nanostructures is one of the hot topics in modern condensed matter theory. I plan to present a brief introduction into the theory of variously shaped carbon nanostructures paying special attention to generic field-theory models. The preliminary plan is the following: (1) a brief historical excursus, (2) the most interesting experimental observations, (3) generic models for the description of electronic states in carbon nanoparticles (Dirac-type equations, defects, geometry, etc.), (4) open problems. (author)

  3. Carbon Trading. Literature Overview

    International Nuclear Information System (INIS)

    From Pigou and Coase to the Kyoto Protocol, carbon trading has resulted in pricing of the negative externalities emanating from pollution. This report highlights leading literature and empirical findings on carbon trading, amongst others addressing the relevant carbon and related markets, the (lack of) success of carbon trading so far and room for improvement as well as its impact on investments in emission reduction. This report is part of a set of SEO-reports on finance and sustainability. The other reports deal with: Financing the Transition to Sustainable Energy; Innovations in financing environmental and social sustainability; and Sustainable investment.

  4. Nanoindentation of Carbon Nanostructures.

    Science.gov (United States)

    Kumar, Dinesh; Singh, Karamjit; Verma, Veena; Bhatti, H S

    2016-06-01

    In the present research paper carbon nanostructures viz. single walled carbon nanotubes, multi-walled carbon nanotubes, single walled carbon nanohorns and graphene nanoplatelets have been synthesized by CVD technique, hydrothermal method, DC arc discharge method in liquid nitrogen and microwave technique respectively. After synthesis 5 mm thick pallets of given nanomaterial are prepared by making a paste in isopropyl alcohol and using polyvinylidene difluoride as a binder and then these pallets were used for nanoindentation measurements. Hardness, reduced modulus, stiffness, contact height and contact area have been measured using nanoindenter. PMID:27427726

  5. Global Carbon Cycle

    OpenAIRE

    Probst, Jean-Luc; Faure, Hugues; Veizer, Jan

    1999-01-01

    The European Union of Geosciences held its 9th biannual meeting in Strasbourg, March 23–27, 1997. During this meeting, Symposium N8 18, Global carbon Cycle, was held under the sponsorship of the IGCP 1 n8404 on the «Terrestrial Carbon in the past 125 Ka», the INQUA 2 Carbon Commission and the ESCOBA-Biosphere 3 project of the EC Environment and Climate Programme. The «Global Carbon Cycle» Symposium attracted 28 oral and poster presentations and about one hundred par...

  6. Carbon Monoxide Toxicity

    Science.gov (United States)

    Aniol, Michael J.

    1992-01-01

    Of all fatal poisonings in the United States, an estimated half are due to carbon monoxide. The number of non-lethal poisonings due to carbon monoxide is difficult to estimate because signs and symptoms of carbon monoxide poisoning cover a wide spectrum and mimic other disorders. Misdiagnosis is serious, as the patient often returns to the contaminated environment. Those not receiving proper treatment are at significant risk, as high as 10% to 12%, of developing late neurological sequelae. The diagnosis of carbon monoxide poisoning depends upon precise history taking, careful physical examination, and a high index of suspicion. ImagesFigure 2 PMID:21221282

  7. Changing global carbon cycle

    International Nuclear Information System (INIS)

    Full text: The increase in atmospheric carbon dioxide (C02) is the single largest human perturbation on the earth's radiative balance contributing to climate change. Its rate of change reflects the balance between anthropogenic carbon emissions and the dynamics of a number of terrestrial and ocean processes that remove or emit C02. It is the long term evolution of this balance that will determine to large extent the speed and magnitude of the human induced climate change and the mitigation requirements to stabilise atmospheric C02 concentrations at any given level. In this talk, we show new trends in global carbon sources and sinks, with particularly focus on major shifts occurring since 2000 when the growth rate of atmospheric C02 has reached its highest level on record. The acceleration in the C02 growth results from the combination of several changes in properties of the carbon cycle, including: acceleration of anthropogenic carbon emissions; increased carbon intensity of the global economy, and decreased efficiency of natural carbon sinks. We discuss in more detail some of the possible causes of the reduced efficiency of natural carbon sinks on land and oceans, such as the decreased net sink in the Southern Ocean and on terrestrial mid-latitudes due to world-wide occurrence of drought. All these changes reported here characterise a carbon cycle that is generating stronger than expected climate forcing, and sooner than expected

  8. Carbonate concretions as a significant component of ancient marine carbon cycles: Insights from paired organic and inorganic carbon isotope analyses of a Cretaceous shale

    Science.gov (United States)

    Loyd, S. J.

    2014-12-01

    Carbonate concretions often occur within fine-grained, organic-rich sedimentary rocks. This association reflects the common production of diagenetic minerals through biologic cycling of organic matter. Chemical analysis of carbonate concretions provides the rare opportunity to explore ancient shallow diagenetic environments, which are inherently transient due to progressive burial but are an integral component of the marine carbon cycle. The late Cretaceous Holz Shale (~80 Ma) contains abundant calcite concretions that exhibit textural and geochemical characteristics indicative of relatively shallow formation (i.e., near the sediment-water interface). Sampled concretions contain between 5.4 and 9.8 wt.% total inorganic carbon (TIC), or ~45 and 82 wt.% CaCO3, compared to host shale values which average ~1.5 wt.% TIC. Organic carbon isotope compositions (δ13Corg) are relatively constant in host and concretion samples ranging from ­-26.3 to -24.0‰ (VPDB). Carbonate carbon isotope compositions (δ13Ccarb) range from -22.5 to -3.4‰, indicating a significant but not entirely organic source of carbon. Concretions of the lower Holz Shale exhibit considerably elevated δ13Ccarb values averaging -4.8‰, whereas upper Holz Shale concretions express an average δ13Ccarb value of -17.0‰. If the remaining carbonate for lower Holz Shale concretions is sourced from marine fluids and/or dissolved marine carbonate minerals (e.g., shells), a simple mass balance indicates that ~28% of concretion carbon was sourced from organic matter and ~72% from late Cretaceous marine inorganic carbon (with δ13C ~ +2.5‰). Upper Holz Shale calculations indicate a ~73% contribution from organic matter and a ~27% contribution from inorganic carbon. When normalized for carbonate, organic contents within the concretions are ~2-13 wt.% enriched compared to host contents. This potentially reflects the protective nature of cementation that acts to limit permeability and chemical destruction of

  9. Materials behaviour in liquid Pb-17Li

    International Nuclear Information System (INIS)

    The behaviour of austenitic 316L and Cr-Mn AMCR 0033 stainless steels in the presence of liquid Pb-17Li, together with the development of a sensitive method, based on the measurement of the electrical resistivities, of detecting composition changes in lithium-lead alloys, has been researched. The solubilities of nickel and manganese in Pb-17Li were determined and used to rationalise the destabilisation of both steels on exposure to Pb-17Li. Their corrosion and mass transfer behaviour was investigated using a small thermal convection loop. The 316L stainless steel specimens exhibited a uniform attack in the hot leg of the loop, the depth of the ferritic layer produced increasing linearly with time. The cold leg specimens showed extensive deposition of iron/chromium particles. The behaviour of Cr-Mn AMCR 0033 stainless steel was similar in character to that of 316L. The surface of the hot leg specimens was destabilised, by removal of manganese, to form a ferritic layer. However, the depth of the ferritic layer was not uniform over the whole specimen, indicating a non homogeneous nature in the AMCR 0033 stainless steel. The cold leg specimens showed extensive deposition of iron/chromium particles. Using an electrical resistivity monitor developed at Nottingham, the behaviour of lithium-lead alloys towards nitrogen, hydrogen, oxygen and water vapour was investigated. The results indicated that lithium-lead alloys were inert towards nitrogen and hydrogen but reacted with oxygen and water. The lithium:oxygen ratios of the products of these experiments were 2:1, indicating the formation of Li2O. (author)

  10. Molecular mapping of chromosomes 17 and X

    Energy Technology Data Exchange (ETDEWEB)

    Barker, D.F.

    1989-01-01

    The basic aims of this project are the construction of high density genetic maps of chromosomes 17 and X and the utilization of these maps for the subsequent isolation of a set of physically overlapping DNA segment clones. The strategy depends on the utilization of chromosome specific libraries of small (1--15 kb) segments from each of the two chromosomes. Since the time of submission of our previous progress report, we have refined the genetic map of markers which we had previously isolated for chromosome 17. We have completed our genetic mapping in CEPH reference and NF1 families of 15 markers in the pericentric region of chromosome 17. Physical mapping results with three probes, were shown be in very close genetic proximity to the NF1 gene, with respect to two translocation breakpoints which disrupt the activity of the gene. All three of the probes were found to lie between the centromere and the most proximal translocation breakpoint, providing important genetic markers proximal to the NF1 gene. Our primary focus has shifted to the X chromosome. We have isolated an additional 30 polymorphic markers, bringing the total number we have isolated to over 80. We have invested substantial effort in characterizing the polymorphisms at each of these loci and constructed plasmid subclones which reveal the polymorphisms for nearly all of the loci. These subclones are of practical value in that they produce simpler and stronger patterns on human genomic Southern blots, thus improving the efficiency of the genetic mapping experiments. These subclones may also be of value for deriving DNA sequence information at each locus, necessary for establishing polymerase chain reaction primers specific for each locus. Such information would allow the use of each locus as a sequence tagged site.

  11. Neutral atomic carbon in dense molecular clouds

    Science.gov (United States)

    Zmuidzinas, J.; Betz, A. L.; Boreiko, R. T.; Goldhaber, D. M.

    1988-01-01

    The 370 micron 3P2-3P1 fine-structure line of neutral carbon was detected in seven sources: OMC 1, NGC 2024, S140, W3, DR 21, M17, and W51. Simultaneous analysis of J = 2-1 data and available observations of the J = 1-0 line make it possible to deduce optical depths and excitation temperatures for these lines. These data indicate that both C I lines are likely to be optically thin, and that the ratio of C I to CO column densities in these clouds is typically about 0.1.

  12. Carbon Dioxide Mitigation by Microalgal Photosynthesis

    International Nuclear Information System (INIS)

    Algal growth studies of Chlorella strains were conducted in a batch mode with bench type experiments. Carbon dioxide fixation rates of the following green microalgae were determined: Chlorella sp. H84, Chlorella sp. A2, Chlorella sorokiniana UTEX 1230, Chlorella vulgaris, and Chlorella pyrenoidosa. C. vulgaris, among other strains of microalgae, showed the highest growth rate (1.17 optical density/5 days). Cultivating conditions for C. vulgaris that produced the highest growth rate were at concentrations of 243 μg CO2/mL, 10 mM ammonia, and 1 mM phosphate, with an initial pH range of 7-8

  13. Characterization of Biochar from Switchgrass Carbonization

    Directory of Open Access Journals (Sweden)

    Samy Sadaka

    2014-01-01

    Full Text Available Switchgrass is a high yielding, low-input intensive, native perennial grass that has been promoted as a major second-generation bioenergy crop. Raw switchgrass is not a readily acceptable feedstock in existing power plants that were built to accommodate coal and peat. The objective of this research was to elucidate some of the characteristics of switchgrass biochar produced via carbonization and to explore its potential use as a solid fuel. Samples were carbonized in a batch reactor under reactor temperatures of 300, 350 and 400 °C for 1, 2 and 3 h residence times. Biochar mass yield and volatile solids decreased from 82.6% to 35.2% and from 72.1% to 43.9%, respectively, by increasing carbonization temperatures from 300 °C to 400 °C and residence times from 1 h to 3 h. Conversely, biochar heating value (HV and fixed carbon content increased from 17.6 MJ kg−1 to 21.9 MJ kg−1 and from 22.5% to 44.9%, respectively, under the same conditions. A biomass discoloration index (BDI was created to quantify changes in biochar colors as affected by the two tested parameters. The maximum BDI of 77% was achieved at a carbonization temperature of 400 °C and a residence time of 3 h. The use of this index could be expanded to quantify biochar characteristics as affected by thermochemical treatments. Carbonized biochar could be considered a high quality solid fuel based on its energy content.

  14. Nytt om runer, Nr. 17 (2002)

    OpenAIRE

    2002-01-01

    Nytt om runer, syttende årgang, s. 3. Arbejdet ved Runologisk Laboratorium, København, s. 4. Die Runenarbeit am Seminar für deutsche Philologie (Arbeitsstelle: Germanische Altertumskunde), Göttingen, s. 12. Weitere angelsächsische Runen in Rom, s. 17. A Runic Fragment from Orkney, s. 18. Runeinnskrifter på omslaget til den islandske homilieboka, s. 20. Arbeidet ved Runearkivet, Oslo, s. 21. Verksamheten vid Runverket i Stockholm, s. 25. The “AVM” Stone from Minnesot...

  15. 17 Pseudoaneurysms Treated by Padding and Compression

    Institute of Scientific and Technical Information of China (English)

    WANGLu-ping; MEIXiao-rong; XUYu-lan; LIUYi; ZHENGCheng-fei; WANGGang

    2004-01-01

    To introduce the method and curative effect of treating pseudoaneurysms by padding and compression. Method: retrospectively analyze the curative effect of treating 17 pseudoaneurysms bypadding hard things and compression. Result: 15 of them was completely recovered by doing so,murmur disappeared and the local skin became even, there was no recurrences and complications after 0.5-3year's following up,but the other two were the same as before the therapy. Conclusion: pseudoaneurysms can be treated effectively by padding and compression

  16. Measurement of the activity coefficient of carbon in steels in liquid sodium

    International Nuclear Information System (INIS)

    In sodium cooled fast reactors carbon is both a carbon impurity and element of structural materials. Carbon transfert through liquid sodium can produce carburization or decarburization of structural materials. Carbon content in sodium is determined with thin foils of austenitic alloys, when equilibrium is reached thermodynamic activity of carbon in sodium is deduced from carbon activity in alloys. Studied alloys are FeMn 20%, FeNi 30%, Z2CN 18-10 and Z3CND17-13. Carbon activity of alloys in sodium was between 5.10-3 and 10-1 at 600 and 6500C. Calibration was obtained with the alloys FeNi 30% in gaseous mixtures He-CO-CO2 of known activity

  17. Are there carbon stars in the Bulge?

    CERN Document Server

    Ng, Y K

    1998-01-01

    The bulge carbon stars have been a mystery since their discovery, because they are about 2.5mag too faint to be regarded as genuine AGB stars, if located inside the metal-rich bulge (m-M=14.5mag). Part of the mystery can be solved if these carbon stars are related to the Sagittarius dwarf galaxy (SDG; m-M=17.0mag). They are in that case not old and metal-rich, but young, ~0.1 Gyr, with SMC-like metallicity. The sigma_RV=113+/-14 km/s radial velocity dispersion of the stars appears to be consistent with bulge membership. On the other hand, a similar velocity dispersion could be the result from an induced star formation event when the SDG crosses the galactic midplane. It is suggested that the carbon stars are tracers of such an event and that they therefore are located at distances related to the SDG. However, the majority of the carbon stars are not member of the SDG, nor are they similar to the C-stars which are member of the SDG. The radial velocities can be used to determine a possible membership to the SD...

  18. Arsenic and 17-β-estradiol bind to each other and neutralize each other's signaling effects.

    Science.gov (United States)

    Kumar, Sukhdeep; Mukherjee, Tapan K; Guptasarma, Purnananda

    2016-09-01

    We report that arsenic trioxide (ATO) and 17-beta-estradiol (E2) abolish each other's independent cell signaling effects in respect of cell survival and proliferation/migration of breast cancer (MCF-7) cells. The possibility that this is due to binding of ATO to E2 was confirmed through difference absorption spectroscopy, chromatography-coupled voltammometry and 1-D (1)H and (13)C NMR spectroscopy. Binding leads to attenuation of E2's hydroxyl (1)H peaks at its C17 and C3 carbon positions. The results suggest that ATO and E2 can titrate each other's levels, potentially explaining why sustained arsenic exposure tends to be associated with delays in age of menarche, advanced age of menopause, poorer sperm quality, higher overall morbidity in men, and lower incidences of breast cancer in women in some arsenic-contaminated areas. PMID:27346132

  19. [Estimation for vegetation carbon storage in Tiantong National Forest Park].

    Science.gov (United States)

    Guo, Chun-Zi; Wu, Yang-Yang; Ni, Jian

    2014-11-01

    Based on the field investigation and the data combination from literature, vegetation carbon storage, carbon density, and their spatial distribution were examined across six forest community types (Schima superba--Castanopsis fargesii community, S. superba--C. fargesii with C. sclerophylla community, S. superba--C. fargesii with Distylium myricoides community, Illicium lanceolatum--Choerospondias axillaris community, Liquidambar formosana--Pinus massoniana community and Hedyotis auricularia--Phylostachys pubescens community) in Tiantong National Forest Park, Zhejiang Province, by using the allometric biomass models for trees and shrubs. Results showed that: Among the six communities investigated, carbon storage and carbon density were highest in the S. superba--C. fargesii with C. sclerophylla community (storage: 12113.92 Mg C; density: 165.03 Mg C · hm(-2)), but lowest in the I. lanceolatum--C. axillaris community (storage: 680.95 Mg C; density: 101.26 Mg C · hm(-2)). Carbon storage was significantly higher in evergreen trees than in deciduous trees across six communities. Carbon density ranged from 76.08 to 144.95 Mg C · hm(-2), and from 0. 16 to 20. 62 Mg C · hm(-2) for evergreen trees and deciduous trees, respectively. Carbon storage was highest in stems among tree tissues in the tree layer throughout communities. Among vegetation types, evergreen broad-leaved forest had the highest carbon storage (23092.39 Mg C), accounting for 81.7% of the total carbon storage in all forest types, with a car- bon density of 126.17 Mg C · hm(-2). Total carbon storage for all vegetation types in Tiantong National Forest Park was 28254.22 Mg C, and the carbon density was 96.73 Mg C · hm(-2). PMID:25898604

  20. Current knowledge of the multifunctional 17β-hydroxysteroid dehydrogenase type 1 (HSD17B1).

    Science.gov (United States)

    He, Wanhong; Gauri, Misra; Li, Tang; Wang, Ruixuan; Lin, Sheng-Xiang

    2016-08-15

    At the late 1940s, 17β-HSD1 was discovered as the first member of the 17β-HSD family with its gene cloned. The three-dimensional structure of human 17β-HSD1 is the first example of any human steroid converting enzyme. The human enzyme's structure and biological function have thus been studied extensively in the last two decades. In humans, the enzyme is expressed in placenta, ovary, endometrium and breast. The high activity of estrogen activation provides the basis of 17β-HSD1's implication in estrogen-dependent diseases, such as breast cancer, endometriosis and non-small cell lung carcinomas. Its dual function in estrogen activation and androgen inactivation has been revealed in molecular and breast cancer cell levels, significantly stimulating the proliferation of such cells. The enzyme's overexpression in breast cancer was demonstrated by clinical samples. Inhibition of human 17β-HSD1 led to xenograft tumor shrinkage. Unfortunately, through decades of studies, there is still no drug using the enzyme's inhibitors available. This is due to the difficulty to get rid of the estrogenic activity of its inhibitors, which are mostly estrogen analogues. New non-steroid inhibitors for the enzyme provide new hope for non-estrogenic inhibitors of the enzyme. PMID:27102893

  1. Kinetics of Chronic Oxidation of NBG-17 Nuclear Graphite by Water Vapor

    Energy Technology Data Exchange (ETDEWEB)

    Contescu, Cristian I [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burchell, Timothy D [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mee, Robert [Univ. of Tennessee, Knoxville, TN (United States)

    2015-05-01

    This report presents the results of kinetic measurements during accelerated oxidation tests of NBG-17 nuclear graphite by low concentration of water vapor and hydrogen in ultra-high purity helium. The objective is to determine the parameters in the Langmuir-Hinshelwood (L-H) equation describing the oxidation kinetics of nuclear graphite in the helium coolant of high temperature gas-cooled reactors (HTGR). Although the helium coolant chemistry is strictly controlled during normal operating conditions, trace amounts of moisture (predictably < 0.2 ppm) cannot be avoided. Prolonged exposure of graphite components to water vapor at high temperature will cause very slow (chronic) oxidation over the lifetime of graphite components. This behavior must be understood and predicted for the design and safe operation of gas-cooled nuclear reactors. The results reported here show that, in general, oxidation by water of graphite NBG-17 obeys the L-H mechanism, previously documented for other graphite grades. However, the characteristic kinetic parameters that best describe oxidation rates measured for graphite NBG-17 are different than those reported previously for grades H-451 (General Atomics, 1978) and PCEA (ORNL, 2013). In some specific conditions, certain deviations from the generally accepted L-H model were observed for graphite NBG-17. This graphite is manufactured in Germany by SGL Carbon Group and is a possible candidate for the fuel elements and reflector blocks of HTGR.

  2. Improvement of cement concrete strength properties by carbon fiber additives

    Science.gov (United States)

    Nevsky, Andrey; Kudyakov, Konstantin; Danke, Ilia; Kudyakov, Aleksandr; Kudyakov, Vitaly

    2016-01-01

    The paper presents the results of studies of fiber-reinforced concrete with carbon fibers. The effectiveness of carbon fibers uniform distribution in the concrete was obtained as a result of its preliminary mechanical mixing in water solution with chemical additives. Additives are to be used in the concrete technology as modifiers at initial stage of concrete mix preparing. The technology of preparing of fiber-reinforced concrete mix with carbon fibers is developed. The superplasticizer is based on ether carboxylates as a separator for carbon fibers. The technology allows increasing of concrete compressive strength up to 43.4% and tensile strength up to 17.5% as well as improving stability of mechanical properties.

  3. Pathways of organic carbon oxidation in three continental margin sediments

    DEFF Research Database (Denmark)

    Canfield, Donald Eugene; Jørgensen, Bo Barker; Fossing, Henrik;

    1993-01-01

    important and of a similar magnitude. Overall, most of the measured O2 flux into the sediment was used to oxidized reduced inorganic species and not organic carbon. We suspect that the importance of O2 respiration in many coastal sediments has been overestimated, whereas metal oxide reduction (both Fe and......We have combined several different methodologies to quantify rates of organic carbon mineralization by the various electron acceptors in sediments from the coast of Denmark and Norway. Rates of NH4+ and Sigma CO2 liberation sediment incubations were used with O2 penetration depths to conclude that...... O2 respiration accounted for only between 3.6-17.4% of the total organic carbon oxidation. Dentrification was limited to a narrow zone just below the depth of O2 penetration, and was not a major carbon oxidation pathway. The processes of Fe reduction, Mn reduction and sulfate reduction dominated...

  4. Microstructural characterisation of carbon implanted austenitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, M.E. [Scientific Affairs Research Group, Stryker Orthopaedics, Raheen Business Park, Limerick (Ireland)]. E-mail: matthew.murphy@stryker.com; Insley, G.M. [Scientific Affairs Research Group, Stryker Orthopaedics, Raheen Business Park, Limerick (Ireland); Laugier, M.T. [Department of Physics, University of Limerick, Limerick (Ireland); Newcomb, S.B. [Sonsam Ltd., Glebe Laboratories, Newport, Tipperary (Ireland)

    2005-06-01

    Low carbon (316L) austenitic stainless steel has been implanted with carbon ions with a fluence of 5 x 10{sup 17} C ions/cm{sup 2} using an ion energy of 75 keV. The effect of carbon ion implantation on the microstructure of the austenitic steel has been examined in cross-section using transmission electron microscopy (TEM) both before and after implantation, and the implantation data correlated with a computer based simulation, TRIM (Transport and Range of Ions in Matter). It has been found that the high-fluence carbon ion implantation modified the microstructure of the steel, as demonstrated by the presence of two amorphous layers separated by a layer of expanded austenite.

  5. Microbially mediated mineral carbonation

    Science.gov (United States)

    Power, I. M.; Wilson, S. A.; Dipple, G. M.; Southam, G.

    2010-12-01

    Mineral carbonation involves silicate dissolution and carbonate precipitation, which are both natural processes that microorganisms are able to mediate in near surface environments (Ferris et al., 1994; Eq. 1). (Ca,Mg)SiO3 + 2H2CO3 + H2O → (Ca,Mg)CO3 + H2O + H4SiO4 + O2 (1) Cyanobacteria are photoautotrophs with cell surface characteristics and metabolic processes involving inorganic carbon that can induce carbonate precipitation. This occurs partly by concentrating cations within their net-negative cell envelope and through the alkalinization of their microenvironment (Thompson & Ferris, 1990). Regions with mafic and ultramafic bedrock, such as near Atlin, British Columbia, Canada, represent the best potential sources of feedstocks for mineral carbonation. The hydromagnesite playas near Atlin are a natural biogeochemical model for the carbonation of magnesium silicate minerals (Power et al., 2009). Field-based studies at Atlin and corroborating laboratory experiments demonstrate the ability of a microbial consortium dominated by filamentous cyanobacteria to induce the precipitation of carbonate minerals. Phototrophic microbes, such as cyanobacteria, have been proposed as a means for producing biodiesel and other value added products because of their efficiency as solar collectors and low requirement for valuable, cultivable land in comparison to crops (Dismukes et al., 2008). Carbonate precipitation and biomass production could be facilitated using specifically designed ponds to collect waters rich in dissolved cations (e.g., Mg2+ and Ca2+), which would allow for evapoconcentration and provide an appropriate environment for growth of cyanobacteria. Microbially mediated carbonate precipitation does not require large quantities of energy or chemicals needed for industrial systems that have been proposed for rapid carbon capture and storage via mineral carbonation (e.g., Lackner et al., 1995). Therefore, this biogeochemical approach may represent a readily

  6. Novel carbon nanostructures

    International Nuclear Information System (INIS)

    The discovery of carbon nanotubes in 1991 opened up a challenging new area of research, because they are expected to be ideal building blocks for nanoscale applications due to their extraordinary mechanical and electronic properties. Various production methods have been developed, however precise control of nanotube morphology (e.g. length, diameter) has yet to be realised, a fact which has delayed industrial exploitation. Thus a comprehensive understanding of nanotube growth is essential, and this thesis is concerned with this important problem, i.e. the controlled production of novel carbon nanomaterials. Chapter 1 surveys production methods for fullerenes, carbon nanotubes and other carbon-based materials, such as fibres, particles etc. The sophisticated tools required for this work, e.g. high resolution transmission electron microscopy (HRTEM), high resolution electron energy loss spectroscopy (HREELS), etc. are reviewed in Chapter 2. Chapter 3 describes a novel approach to carbon nanotubes, using laser etching techniques, which generates aligned tubes of uniform diameter and length. The mode of catalyst preparation, as well as the nature of the precursor, play crucial roles in this process. The preparation of modified carbon nanotubes by the pyrolysis of metallocene, e.g. ferrocene in conjunction with various hydrocarbons, is discussed in Chapter 4. Superconducting interference device measurements (SQUID) show that Fe-filled carbon nanotubes exhibit enhanced coercivities in the 430-1070 Oe range, i.e. greater than those reported for Ni and Co nanowires. Carbon nanotubes can be also modified by replacing atoms of the carbon network with nitrogen, boron or both. The creation of large arrays of nitrogen-doped carbon nanotubes, for example CNx nanofibres, as well as the formation of BxCyNz onions is described in Chapter 5. Electron irradiation of these onions generates pure carbon onions. Finally (Chapter 6), the catalytic behaviour of metal particles in different

  7. BATF: Bringing (in) Another Th17-regulating Factor

    Institute of Scientific and Technical Information of China (English)

    Gustavo J. Martinez; Chen Dong

    2009-01-01

    T helper (Th) 17 cells are a recently identified subset of T cells that regulate tissue inflammation, and RORγt and RORα have been shown to be Th17-specific transcription factors that mediate Th17 cell generation. A new study of Batf-deficient mice shows that this AP-1 family transcription factor also regulates Th17 cell differentiation by binding to Th17-associated gene promoters and by maintaining RORa and RORgt expression, shedding new lights on current clinical modulation of Th17 cell function in inflammatory diseases.

  8. Cloning and Characterization of Rainbow Trout Interleukin-17A/F2 (IL-17A/F2) and IL-17 Receptor A: Expression during Infection and Bioactivity of Recombinant IL-17A/F2

    OpenAIRE

    Monte, Milena M.; Wang, Tiehui; Holland, Jason W.; Zou, Jun; Christopher J. Secombes

    2013-01-01

    Lower vertebrates have been found to possess genes that have similar homology to both interleukin (IL)-17A and IL-17F, which have been termed IL-17A/F. In fish species, several of these genes can be present, but, to date, very little is known about their functional activity. This article describes the discovery and sequence analysis of a rainbow trout (Oncorhynchus mykiss) IL-17A/F2 molecule and an IL-17RA receptor. In addition, the bioactivity of the trout IL-17A/F2 is investigated for the f...

  9. Landfill gas at 0.17 NOK/kWh from Norwegian plants

    International Nuclear Information System (INIS)

    This article relates briefly to the utilization of bio gas from sanitary landfills in Norway. The annual cost of investment for the energy parts of plants is on an average of 0.9 NOK/kWh, and the total investment about 2.2 NOK/kWh. The calculated energy price for the recovery of 1 kWh of thermal energy from bio gas shows to be about 0.17 NOK/kWh. Bio gas from landfills consists of methane (40-55%) and carbon dioxide (25-40%), and the recovered volume of gas per ton of waste is 2.8 Nm3. 1 fig

  10. Method for Making a Carbon-Carbon Cylinder Block

    Science.gov (United States)

    Ransone, Phillip O. (Inventor)

    1997-01-01

    A method for making a lightweight cylinder block composed of carbon-carbon is disclosed. The use of carbon-carbon over conventional materials. such as cast iron or aluminum, reduces the weight of the cylinder block and improves thermal efficiency of the internal combustion reciprocating engine. Due to the negligible coefficient of thermal expansion and unique strength at elevated temperatures of carbon-carbon, the piston-to-cylinder wall clearance can be small, especially when the carbon-carbon cylinder block is used in conjunction with a carbon-carbon piston. Use of the carbon-carbon cylinder block has the effect of reducing the weight of other reciprocating engine components allowing the piston to run at higher speeds and improving specific engine performance.

  11. Leachability and heavy metal speciation of 17-year old stabilised/solidified contaminated site soils

    International Nuclear Information System (INIS)

    Highlights: • The effectiveness of the cement-based S/S at 17 years in West Drayton site is still satisfactory. • Major leaching of Cu, Zn, Ni, Cd and Pb in all mixes took place in the Fe/Mn oxides phase. • The hydration process has been fully completed and further carbonation took place at 17 years. • Microstructure analyses show that unreacted PFA exists. - Abstract: The long-term leachability, heavy metal speciation transformation and binding mechanisms in a field stabilised/solidified contaminated soil (made ground) from West Drayton site were recently investigated following in situ auger mixing treatment with a number of cement-based binders back in 1996. Two batch leaching tests (TCLP and BS EN 12457) and a modified five step sequential extraction procedure along with X-ray diffraction (XRD) and scanning electron microscopy (SEM) analyses were employed for the testing of the 17-year-old field soil. The results of batch leaching tests show that the treatment employed remained effective at 17 years of service time, with all BS EN 12457 test samples and most of TCLP test samples satisfied drinking water standards. Sequential extraction results illustrate that the leaching of Cu, Ni, Zn, Pb and Cd in all mixes mainly occurred at the Fe/Mn phase, ranging from 43% to 83%. Amongst the five metals tested, Ni was the most stable with around 40% remained in the residual phase for all the different cement-based binder stabilised/solidified samples. XRD and SEM analyses show that the hydration process has been fully completed and further carbonation took place. In summary, this study confirms that such cement-based stabilisation/solidification (S/S) treatment can achieve satisfactory durability and thus is a reliable technique for long-term remediation of heavy metal contaminated soil

  12. Preparation of Isolated Single-walled Carbon Nanotubes with High Hydrogen Storage Capacity

    Institute of Scientific and Technical Information of China (English)

    张艾飞; 刘吉平; 吕广庶; 刘华

    2006-01-01

    Isolated single-walled carbon nanotubes with high proportion of opening tips were synthesized by using alcohol as carbon source. The mechanism of cutting action of oxygen was proposed to explain its growth. Compared with carbon nanotubes synthesized with benzene as carbon source, their specific surface area was heightened by approximately 2.2 times (from 200.5 to 648 m2/g) and the hydrogen storage capacity was increased by approximately 6.5 times (from 0.95 to 7.17%, ω)which had exceeded DOE energy standard of vehicular hydrogen storage.

  13. World Carbon Black Output to Reach 12.7 Million Tons in 2015

    Institute of Scientific and Technical Information of China (English)

    Zhu Yongkang

    2012-01-01

    From April 13 to April 17, "Carbon Black China of 2012" (CBC2012) was held in Hangzhou, China. Mr. Paul Ita, the president of US marketing research institution Notch Consulting Group, announced that the prospect of carbon black industry was closely linked with the development of auto industry and tire industry. The demand for carbon black of 2010 increased by 15% compared with that of 2009; the growth rate of demand for carbon black was 5.8% in 2011 and the total output was 10.7 million tons, which increased by about 5.5% compared with that of 2010.

  14. Linking the exotic structure of ${}^{17}$C to its unbound mirror ${}^{17}$Na

    CERN Document Server

    Amos, Ken; Fraser, Paul; Karataglidis, Steven; Svenne, Juris; van der Knijff, Dirk

    2011-01-01

    The structure of ${}^{17}$C is used to define a nuclear interaction that, when used in a multichannel algebraic scattering theory for the $n+{}^{16}$C system, gives a credible definition of the (compound) excitation spectra. When couplings to the low-lying collective excitations of the ${}^{16}$C-core are taken into account, both sub-threshold and resonant states about the $n+{}^{16}$C threshold are found. Adding Coulomb potentials to that nuclear interaction, the method is used for the mirror system of $p+{}^{16}$Ne to specify the low-excitation spectrum of the particle unstable $^{17}$Na. We compare the results with those of a microscopic cluster model. A spectrum of low excitation resonant states in ${}^{17}$Na is found with some differences to that given by the microscopic-cluster model. The calculated resonance half-widths (for proton emission) range from $\\sim 2$ to $\\sim 672$ keV.

  15. Carbon isotope composition and its implications of Lower Cretaceous Aptian-Albian shallow water carbonates in the Cuoqin Basin, North Tibet

    Institute of Scientific and Technical Information of China (English)

    ZHU; Jingquan; LI; Yongtie; JIANG; Maosheng; CHEN; Daizha

    2004-01-01

    The δ13C values of Lower Cretaceous Aptian-Albian platform-type carbonates in the Cuoqin Basin, North Tibet vary between 2.48‰ and 5.46‰. The mean value is 3.93‰. The values are not only provided with positive excursion, but also 1.17‰ higher than those of contemporaneous pelagic carbonates which possess pretty high δ13C values. The origin is approached. During the oceanic anoxic events, a great number of organisms were rapidly buried, causing the increase of the δ13C value of oceanic total dissolved carbon (TDC) and generally promoting the values of marine carbonates. After that, owing to the organisms undergoing different isotopic fractionation in the paleo-ocean with stratified structure,δ13C values of shallow sea carbonate were obviously higher than those of pelagic carbonates.

  16. Carbon Stock and Carbon Cycle of Wetland Ecosystem

    OpenAIRE

    Zeng, Zhangquan; Zhang, Canming; LI, JIAO; Yang, Nan; Li, Xiquan; Niu, Yandong; Wu, Zijian

    2014-01-01

    Wetland ecosystem is an essential ecosystem in the world. Its organic carbon stock and carbon cycle are important basis of global carbon cycle researches and also major contents of global climate change researches. Researches have shown that wetland protection and restoration can promote carbon accumulation and reduce emission of greenhouse gases. This paper discussed influence of carbon stock and carbon balance of wetland ecosystem and emission of greenhouse gases, as well as the relationshi...

  17. Huntington's Disease (HD): Neurodegeneration of Brodmann's Primary Visual Area 17 (BA17).

    Science.gov (United States)

    Rüb, Udo; Seidel, Kay; Vonsattel, Jean Paul; Lange, Herwig W; Eisenmenger, Wolfgang; Götz, Monika; Del Turco, Domenico; Bouzrou, Mohamed; Korf, Horst-Werner; Heinsen, Helmut

    2015-11-01

    Huntington's disease (HD), an autosomal dominantly inherited polyglutamine or CAG repeat disease along with somatomotor, oculomotor, psychiatric and cognitive symptoms, presents clinically with impairments of elementary and complex visual functions as well as altered visual-evoked potentials (VEPs). Previous volumetric and pathoanatomical post-mortem investigations pointed to an involvement of Brodmann's primary visual area 17 (BA17) in HD. Because the involvement of BA17 could be interpreted as an early onset brain neurodegeneration, we further characterized this potential primary cortical site of HD-related neurodegeneration neuropathologically and performed an unbiased estimation of the absolute nerve cell number in thick gallocyanin-stained frontoparallel tissue sections through the striate area of seven control individuals and seven HD patients using Cavalieri's principle for volume and the optical disector for nerve and glial cell density estimations. This investigation showed a reduction of the estimated absolute nerve cell number of BA17 in the HD patients (71,044,037 ± 12,740,515 nerve cells) of 32% in comparison with the control individuals (104,075,067 ± 9,424,491 nerve cells) (Mann-Whitney U-test; P < 0.001). Additional pathoanatomical studies showed that nerve cell loss was most prominent in the outer pyramidal layer III, the inner granular layers IVa and IVc as well as in the multiform layer VI of BA17 of the HD patients. Our neuropathological results in BA17 confirm and extend previous post-mortem, biochemical and in vivo neuroradiological HD findings and offer suitable explanations for the elementary and complex visual dysfunctions, as well as for the altered VEP observed in HD patients. PMID:25495445

  18. Hydrogenation of the Exocyclic Olefinic Bond at C-16/C-17 Position of ent-Kaurane Diterpene Glycosides of Stevia rebaudiana Using Various Catalysts

    OpenAIRE

    Indra Prakash; Venkata Sai Prakash Chaturvedula

    2013-01-01

    Catalytic hydrogenation of the exocyclic double bond present between C16 and C17 carbons of the four ent-kaurane diterpene glycosides namely rebaudioside A, rebaudioside B, rebaudioside C, and rebaudioside D isolated from Stevia rebaudiana has been carried out using Pt/C, Pd(OH)2, Rh/C, Raney Ni, PtO2, and 5% Pd/BaCO3 to their corresponding dihydro derivatives with 17α and 17β methyl group isomers. Reactions were performed using the above-mentioned catalysts with the solvents methanol, water,...

  19. Carbon Monoxide Information Center

    Medline Plus

    Full Text Available ... Consumers Businesses Contact CPSC Website Design Feedback Consumers: Español Businesses: Español , 中文 , Tiếng Việt Connect with Us : Twitter YouTube ... Safely Home / Safety Education / Safety Education Centers En Español Carbon Monoxide Information Center The Invisible Killer Carbon ...

  20. Carbon dioxide recycling

    Science.gov (United States)

    The recycling of carbon dioxide to methanol and dimethyl ether is seen to offer a substantial route to renewable and environmentally carbon neutral fuels. One of the authors has championed the “Methanol Economy" in articles and a book. By recycling ambient CO2, the authors argue ...

  1. Carbon Capture and Storage

    NARCIS (Netherlands)

    Benson, S.M.; Bennaceur, K.; Cook, P.; Davison, J.; Coninck, H. de; Farhat, K.; Ramirez, C.A.; Simbeck, D.; Surles, T.; Verma, P.; Wright, I.

    2012-01-01

    Emissions of carbon dioxide, the most important long-lived anthropogenic greenhouse gas, can be reduced by Carbon Capture and Storage (CCS). CCS involves the integration of four elements: CO 2 capture, compression of the CO2 from a gas to a liquid or a denser gas, transportation of pressurized CO 2

  2. Carbon black recovery

    International Nuclear Information System (INIS)

    A process and apparatus for recovering carbon black from hot smoke which comprises passing the smoke through a cyclone separation zone following cooling, then through aggregate filter beds and regeneration of filter beds with clean off-gas which is recycled to the carbon black reaction zone as quench

  3. Seeing the Carbon Cycle

    Science.gov (United States)

    Drouin, Pamela; Welty, David J.; Repeta, Daniel; Engle-Belknap, Cheryl A.; Cramer, Catherine; Frashure, Kim; Chen, Robert

    2006-01-01

    In this article, the authors present a classroom experiment that was developed to introduce middle school learners to the carbon cycle. The experiment deals with transfer of CO[subscript 2] between liquid reservoirs and the effect CO[subscript 2] has on algae growth. It allows students to observe the influence of the carbon cycle on algae growth,…

  4. The carbon cycle revisited

    Science.gov (United States)

    Bolin, Bert; Fung, Inez

    1992-01-01

    Discussions during the Global Change Institute indicated a need to present, in some detail and as accurately as possible, our present knowledge about the carbon cycle, the uncertainties in this knowledge, and the reasons for these uncertainties. We discuss basic issues of internal consistency within the carbon cycle, and end by summarizing the key unknowns.

  5. Amorphous iron (II) carbonate

    DEFF Research Database (Denmark)

    Sel, Ozlem; Radha, A.V.; Dideriksen, Knud;

    2012-01-01

    Abstract The synthesis, characterization and crystallization energetics of amorphous iron (II) carbonate (AFC) are reported. AFC may form as a precursor for siderite (FeCO3). The enthalpy of crystallization (DHcrys) of AFC is similar to that of amorphous magnesium carbonate (AMC) and more...

  6. Fly ash carbon passivation

    Science.gov (United States)

    La Count, Robert B; Baltrus, John P; Kern, Douglas G

    2013-05-14

    A thermal method to passivate the carbon and/or other components in fly ash significantly decreases adsorption. The passivated carbon remains in the fly ash. Heating the fly ash to about 500 and 800 degrees C. under inert gas conditions sharply decreases the amount of surfactant adsorbed by the fly ash recovered after thermal treatment despite the fact that the carbon content remains in the fly ash. Using oxygen and inert gas mixtures, the present invention shows that a thermal treatment to about 500 degrees C. also sharply decreases the surfactant adsorption of the recovered fly ash even though most of the carbon remains intact. Also, thermal treatment to about 800 degrees C. under these same oxidative conditions shows a sharp decrease in surfactant adsorption of the recovered fly ash due to the fact that the carbon has been removed. This experiment simulates the various "carbon burnout" methods and is not a claim in this method. The present invention provides a thermal method of deactivating high carbon fly ash toward adsorption of AEAs while retaining the fly ash carbon. The fly ash can be used, for example, as a partial Portland cement replacement in air-entrained concrete, in conductive and other concretes, and for other applications.

  7. Carbon Monoxide Poisoning

    Science.gov (United States)

    ... natural gas, propane, oil, and methane) burn incompletely. ** Carbon Monoxide can have different effects on people based on its concentration in the air that people breathe, and the person’s health condition.**** Each year, carbon monoxide poisoning claims approximately 480 lives and sends another ...

  8. Carbon for sensing devices

    CERN Document Server

    Tagliaferro, Alberto

    2015-01-01

    This book reveals why carbon is playing such an increasingly prominent role as a sensing material. The various steps that transform a raw material in a sensing device are thoroughly presented and critically discussed.  The authors deal with all aspects of carbon-based sensors, starting from the various hybridization and allotropes of carbon, with specific focus on micro and nanosized carbons (e.g., carbon nanotubes, graphene) and their growth processes. The discussion then moves to the role of functionalization and the different routes to achieve it. Finally, a number of sensing applications in various fields are presented, highlighting the connection with the basic properties of the various carbon allotropes.  Readers will benefit from this book’s bottom-up approach, which starts from the local bonding in carbon solids and ends with sensing applications, linking the local hybridization of carbon atoms and its modification by functionalization to specific device performance. This book is a must-have in th...

  9. Carbon Dioxide Fountain

    Science.gov (United States)

    Kang, Seong-Joo; Ryu, Eun-Hee

    2007-01-01

    This article presents the development of a carbon dioxide fountain. The advantages of the carbon dioxide fountain are that it is odorless and uses consumer chemicals. This experiment also is a nice visual experiment that allows students to see evidence of a gaseous reagent being consumed when a pressure sensor is available. (Contains 3 figures.)…

  10. De-carbonizingChina

    Institute of Scientific and Technical Information of China (English)

    zhou; Xiaoyan

    2013-01-01

    Innovation in the energy sector will pave the way for the country’slow-carbon future Although its per-capita emission is roughly on par with the world’s average, China is the world’s largest carbon dioxide emitter,

  11. COMMITTED TO CARBON REDUCTION

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Chinese efforts to lower carbon emissions through environmentally friendly means begin gaining momentum Efforts to curb carbon emissions continue to take shape as China adheres to its pledge for a brighter, greener future. More importantly, as environmental measures take hold and develop

  12. Potential Involvement of IL-17F in Asthma

    Directory of Open Access Journals (Sweden)

    Kyoko Ota

    2014-01-01

    Full Text Available The expression of IL-17F is seen in the airway of asthmatics and its level is correlated with disease severity. Several studies have demonstrated that IL-17F plays a pivotal role in allergic airway inflammation and induces several asthma-related molecules such as CCL20. IL-17F-induced CCL20 may attract Th17 cells into the airway resulting in the recruitment of additional Th17 cells to enhance allergic airway inflammation. We have recently identified, for the first time, that bronchial epithelial cells are its novel cell source in response to IL-33 via ST2-ERK1/2-MSK1 signaling pathway. The receptor for IL-17F is the heterodimeric complex of IL-17RA and IL-17RC, and IL-17F activates many signaling pathways. In a case-control study of 867 unrelated Japanese subjects, a His161 to Arg161 (H161R substitution in the third exon of the IL-17F gene was associated with asthma. In atopic patients with asthma, prebronchodilator baseline FEV1/FVC values showed a significant association with the H161R variant. Moreover, this variant is a natural antagonist for the wild-type IL-17F. Moreover, IL-17F is involved in airway remodeling and steroid resistance. Hence, IL-17F may play an orchestrating role in the pathogenesis of asthma and may provide a valuable therapeutic target for development of novel strategies.

  13. RESTORING SUSTAINABLE FORESTS ON APPALACHIAN MINED LANDS FOR WOOD PRODUCTS, RENEWABLE ENERGY, CARBON SEQUESTRATION, AND OTHER ECOSYSTEM SERVICES

    Energy Technology Data Exchange (ETDEWEB)

    J. Burger; J. Galbraith; T. Fox; G. Amacher; J. Sullivan; C. Zipper

    2003-12-18

    The overall purpose of this project is to evaluate the biological and economic feasibility of restoring high-quality forests on mined land, and to measure carbon sequestration and wood production benefits that would be achieved from forest restoration procedures. In this quarterly report, we present a preliminary comparison of the carbon sequestration benefits for two forest types used to convert abandoned grasslands for carbon sequestration. Annual mixed hardwood benefits, based on total stand carbon volume present at the end of a given year, range from a minimum of $0/ton of carbon to a maximum of $5.26/ton of carbon (low prices). White pine benefits based on carbon volume range from a minimum of $0/ton of carbon to a maximum of $18.61/ton of carbon (high prices). The higher maximum white pine carbon payment can primarily be attributed to the fact that the shorter rotation means that payments for white pine carbon are being made on far less cumulative carbon tonnage than for that of the long-rotation hardwoods. Therefore, the payment per ton of white pine carbon needs to be higher than that of the hardwoods in order to render the conversion to white pine profitable by the end of a rotation. These carbon payments may seem appealingly low to the incentive provider. However, payments (not discounted) made over a full rotation may add up to approximately $17,493/ha for white pine (30-year rotation), and $18,820/ha for mixed hardwoods (60-year rotation). The literature suggests a range of carbon sequestration costs, from $0/ton of carbon to $120/ton of carbon, although the majority of studies suggest a cost below $50/ ton of carbon, with van Kooten et al. (2000) suggesting a cutoff cost of $20/ton of carbon sequestered. Thus, the ranges of carbon payments estimated for this study fall well within the ranges of carbon sequestration costs estimated in previous studies.

  14. Selective Oxidation of Soft Grade Carbon

    Directory of Open Access Journals (Sweden)

    Zecevic, N.

    2007-12-01

    into granules, and the most famous are the wet, semi-wet, and the dry process. In the oil-furnace process, the wet process of granulation is the most acceptable, in which the "fluffy" carbon black is mixed with water in an approximate ratio. After granulation, the carbon black is dried in a rotary drum at temperatures ranging between 180 to 210 °C. The period of drying is various, and depends on the production capacity and moisture fraction.The described laboratory procedure improvised successfully industrial conditions of granulating soft grade carbon black, and it is applicable to the conventional industrial method of producing soft grade oil-furnace carbon black at the Kutina plant, which is shown in Tables 1-7, and Figures 1-2.

  15. Correlation between acute myeloid leukemia and IL-17A, IL-17F, and IL-23R gene polymorphism

    OpenAIRE

    Zhu, Biao; Zhang, Jianbo; Wang, Xiaodong; Chen, Jiao; Li, Chenglong

    2015-01-01

    Recent studies have shown that Th17 cells may be involved in the pathological process of acute myeloid leukemia. This CD4+ cell subgroup secretes highly homologous interleukin (IL)-17A and IL-17F, and also expresses IL-23 receptor (IL-23R) on the cell surface. Our study aims to investigate the relationship of IL-17A, IL-17F, and IL23R with disease susceptibility, and clarify the relationship between gene polymorphism variation and serum IL-17 level. 62 acute myeloid leukemia patients and 125 ...

  16. 76 FR 7151 - Certain Carbon Steel Butt-Weld Pipe Fittings From Brazil, Japan, Taiwan, Thailand, and the People...

    Science.gov (United States)

    2011-02-09

    ... Order; Certain Carbon Steel Butt-Weld Pipe Fittings from Brazil, 51 FR 45152 (December 17, 1986... Fair Value; Certain Carbon Steel Butt-Weld Pipe Fittings From the People's Republic of China, 57 FR... of 1930, as amended (the Act). See Initiation of Five-Year (``Sunset'') Review, 75 FR 60731...

  17. 78 FR 55241 - Corrosion-Resistant Carbon Steel Flat Products From the Republic of Korea: Preliminary Results of...

    Science.gov (United States)

    2013-09-10

    ...: Certain Steel Products From Korea, 58 FR 43752 (August 17, 1993) (Order). \\3\\ See the ``Decision... International Trade Administration Corrosion-Resistant Carbon Steel Flat Products From the Republic of Korea... carbon steel flat products (CORE) from the Republic of Korea (Korea) for the period of review...

  18. Increased expression of interleukin 17 in inflammatory bowel disease

    OpenAIRE

    Fujino, S; Andoh, A; Bamba, S; Ogawa, A.; Hata, K.; Araki, Y; Bamba, T; Fujiyama, Y.

    2003-01-01

    Background and aim: Interleukin (IL) 17 is a cytokine which exerts strong proinflammatory activities. In this study we evaluated changes in IL-17 expression in the inflamed mucosa and in the serum of patients with inflammatory bowel disease (IBD).

  19. Targeting of interleukin-17 in the treatment of psoriasis

    OpenAIRE

    Lønnberg AS; Zachariae C; Skov L

    2014-01-01

    Ann Sophie Lønnberg, Claus Zachariae, Lone SkovDepartment of Dermato-Allergology, Gentofte Hospital, University of Copenhagen, Hellerup, DenmarkAbstract: “Psoriasis” is a chronic immune-mediated inflammatory disorder with epidermal hyperplasia. There is some evidence that the cytokine interleukin-17A (often known as IL-17), which is mainly produced by Th17 cells, has a role in the pathogenesis of psoriasis. “IL-17” is a pro-inflammatory cytokine mainly important...

  20. Endogenous IL-17 contributes to reduced tumor growth and metastasis

    OpenAIRE

    Kryczek, Ilona; Wei, Shuang; Szeliga, Wojciech; Vatan, Linhua; Zou, Weiping

    2009-01-01

    It has been reported that ectopically expressed interleukin-17 (IL-17) in tumor cells suppresses tumor progression through enhanced antitumor immunity in immune competent mice or promote tumor progression through an increase in inflammatory angiogenesis in immune-deficient mice. The role of endogenous IL-17 in tumor immunity remains undefined. Here we showed that tumor growth and lung metastasis were enhanced in IL-17–deficient mice, associated with decreased interferon-γ+ natural killer cell...

  1. NOTCH SIGNALING REGULATES MOUSE AND HUMAN TH17 DIFFERENTIATION

    OpenAIRE

    Keerthivasan, Shilpa; Suleiman, Reem; Lawlor, Rebecca; Roderick, Justine; Bates, Tonya; Minter, Lisa; Anguita, Juan; Juncadella, Ignacio; Nickoloff, Brian J; Le Poole, I. Caroline; Miele, Lucio; Osborne, Barbara A.

    2011-01-01

    T helper17 (Th17) cells are known to play a critical role in adaptive immune responses to several important extracellular pathogens. Additionally, Th17 cells are implicated in the pathogenesis of several autoimmune and inflammatory disorders as well as in cancer. Therefore, it is essential to understand the mechanisms that regulate Th17 differentiation. Notch signaling is known to be important at several stages of T cell development and differentiation. Here we report that Notch1 is activated...

  2. Sox17 is required for normal pulmonary vascular morphogenesis

    OpenAIRE

    Lange, Alexander W.; Haitchi, Hans Michael; LeCras, Timothy D.; Sridharan, Anusha; Xu, Yan; Wert, Susan E.; James, Jeanne; Udell, Nicholas; Thurner, Philipp J.; Whitsett, Jeffrey A.

    2014-01-01

    The SRY-box containing transcription factor Sox17 is required for endoderm formation and vascular morphogenesis during embryonic development. In the lung, Sox17 is expressed in mesenchymal progenitors of the embryonic pulmonary vasculature and is restricted to vascular endothelial cells in the mature lung. Conditional deletion of Sox17 in splanchnic mesenchyme-derivatives using Dermo1-Cre resulted in substantial loss of Sox17 from developing pulmonary vascular endothelial cells and caused pul...

  3. Exon: CBRC-HSAP-17-0053 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-HSAP-17-0053 atgatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat...catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat...catcatcatcatcatcatcatcatcatcatcatcatcatcatcaccatcatcatcatcatcatcatcatcatcaccatcatcatcatcatcaccatcatcat...caccaccatcatcatcaccattatcatcatcaccatcatcatcatcatcaccatcatcatcatcatcatcaccatcatcatcatcat...caccatcatcatcaccatcattatcatcatcgtcgccatcatcatcatcatcaccatcattatcatcatcaccatcaccaCTAC

  4. Tc17 Cells in Patients with Uterine Cervical Cancer

    OpenAIRE

    Yan Zhang; Fei Hou; Xin Liu; Daoxin Ma; Youzhong Zhang; Beihua Kong; Baoxia Cui

    2014-01-01

    BACKGROUND: The existence of Tc17 cells was recently shown in several types of infectious and autoimmune diseases, but their distribution and functions in uterine cervical cancer (UCC) have not been fully elucidated. METHODS: The frequency of Tc17 cells in peripheral blood samples obtained from UCC patients, cervical intraepithelial neoplasia (CIN) patients and healthy controls was determined by flow cytometry. Besides, the prevalence of Tc17 cells and their relationships to Th17 cells and Fo...

  5. Stercoral perforation in a 17-year old.

    LENUS (Irish Health Repository)

    McHugh, S

    2012-02-01

    INTRODUCTION: Stercoral perforation is a rare cause of perforation. This is the first reported case where a partial eating disorder (ED) is the primary causative differential. CASE PRESENTATION: We present the case of a 17-year-old girl who presented to her local Emergency Department with a 24-h history of left-sided abdominal pain. She subsequently deteriorated and a computed tomography scan of her abdomen showed gross distension of the large bowel with a sigmoid perforation. She underwent total colectomy with end ileostomy. Histology reported stercoral perforation but normal bowel ganglia. While an inpatient she was reviewed by the Psychiatric team who were concerned she was suffering from a partial ED. CONCLUSION: This case highlights the importance of a multidisciplinary approach in optimally treating patients such as these. Aggressive medical management with involvement of a psychiatric team and dietetics addresses any underlying causative psychiatric issues and helps prevent recurrence.

  6. Stercoral perforation in a 17-year old.

    LENUS (Irish Health Repository)

    McHugh, S

    2009-04-02

    INTRODUCTION: Stercoral perforation is a rare cause of perforation. This is the first reported case where a partial eating disorder (ED) is the primary causative differential. CASE PRESENTATION: We present the case of a 17-year-old girl who presented to her local Emergency Department with a 24-h history of left-sided abdominal pain. She subsequently deteriorated and a computed tomography scan of her abdomen showed gross distension of the large bowel with a sigmoid perforation. She underwent total colectomy with end ileostomy. Histology reported stercoral perforation but normal bowel ganglia. While an inpatient she was reviewed by the Psychiatric team who were concerned she was suffering from a partial ED. CONCLUSION: This case highlights the importance of a multidisciplinary approach in optimally treating patients such as these. Aggressive medical management with involvement of a psychiatric team and dietetics addresses any underlying causative psychiatric issues and helps prevent recurrence.

  7. 17th STAB/DGLR Symposium

    CERN Document Server

    Heller, Gerd; Kreplin, Hans-Peter; Nitsche, Wolfgang; Peltzer, Inken

    2013-01-01

    This volume contains the contributions to the 17th Symposium of STAB (German Aerospace Aerodynamics Association). STAB includes German scientists and engineers from universities, research establishments and industry doing research and project work in numerical and experimental fluid mechanics and aerodynamics, mainly for aerospace but also for other applications. Many of the contributions collected in this book present results from national and European Community sponsored projects. This volume gives a broad overview of the ongoing work in this field in Germany and spans a wide range of topics: airplane aerodynamics, multidisciplinary optimization and new configurations, hypersonic flows and aerothermodynamics, flow control (drag reduction and laminar flow control), rotorcraft aerodynamics, aeroelasticity and structural dynamics, numerical simulation, experimental simulation and test techniques, aeroacoustics as well as the new fields of biomedical flows, convective flows, aerodynamics and acoustics of high-s...

  8. Air Gap Effects in LX-17

    Energy Technology Data Exchange (ETDEWEB)

    Souers, P C; Ault, S; Avara, R; Bahl, K L; Boat, R; Cunningham, B; Gidding, D; Janzen, J; Kuklo, D; Lee, R; Lauderbach, L; Weingart, W C; Wu, B; Winer, K

    2005-09-26

    Three experiments done over twenty years on gaps in LX-17 are reported. For the detonation front moving parallel to the gaps, jets of gas products were seen coming from the gaps at velocities greater than the detonation velocity. A case can be made that the jet velocity increased with gap thickness but the data is scattered. For the detonation front moving transverse to the gap, time delays were seen. The delays roughly increase with gap width, going from 0-70 ns at 'zero gap' to around 300 ns at 0.5-1 mm gap. Larger gaps of up to 6 mm width almost certainly stopped the detonation, but this was not proved. Real-time resolution of the parallel jets and determination of the actual re-detonation or failure in the transverse case needs to be done in future experiments.

  9. Overexposure measurement on microtron MT-17

    International Nuclear Information System (INIS)

    On 11 November 1992, the Radiation accident happened at the channel of the high energy photon beam generated by stopping 15 MeV accelerated electron on the tungsten target of Microtron MT-17. One physicist has been exposed to the high energy photon beam. The purposes of this work are the determination of overexposure from backscatter and primary beams to estimate the whole body and hand doses received by the victim. It was found that the upper parts of his body may be received the dose from 1.0 Gy to 5.0 Gy per 4 min. of the exposure; the dose received by victim's hands is in interval of 30 - 50 Gy. (author). 3 refs., 5 figs., 5 tabs

  10. The ancient lunar crust, Apollo 17 region

    Science.gov (United States)

    James, O. B.

    1992-01-01

    The Apollo 17 highland collection is dominated by fragment-laden melt rocks, generally thought to represent impact melt from the Serenitatis basin-forming impact. Fortunately for our understanding of the lunar crust, the melt rocks contain unmelted clasts of preexisting rocks. Similar ancient rocks are also found in the regolith; most are probably clasts eroded out of melt rocks. The ancient rocks can be divided into groups by age, composition, and history. Oldest are plutonic igneous rocks, representing the magmatic components of the ancient crust. The younger are granulitic breccias, which are thoroughly recrystallized rocks of diverse parentages. The youngest are KREEPy basalts and felsites, products of relatively evolved magmas. Some characteristics of each group are given.

  11. Magnetic properties of Nd5 Fe17

    International Nuclear Information System (INIS)

    A new stable compound in the Nd-Fe system has been identified as Nd5 Fe17. The crystal structure belongs to the hexagonal space group P63 mcm, with a = 2.0214(8) nm and c = 1.2329(8) nm, and with 12 formula units per unit cell. This compound is a ferromagnetic with Tc = 503 K and magnetization 162 emu/g at 4.2 K. Moessbauer spectra have been measured at different temperatures and fitted with five Fe sites, yielding an average Beff = 30.7 tesla at T = 10 K, from which an average Fe moment of 2.12 Bohr magnetons is deduced. X-ray powder diagrams from magnetically aligned samples suggest basal anisotropy. (author)

  12. Persistence of Th17/Tc17 Cell Expression upon Smoking Cessation in Mice with Cigarette Smoke-Induced Emphysema

    Directory of Open Access Journals (Sweden)

    Min-Chao Duan

    2013-01-01

    Full Text Available Th17 and Tc17 cells may be involved in the pathogenesis of chronic obstructive pulmonary disease (COPD, a disease caused predominantly by cigarette smoking. Smoking cessation is the only intervention in the management of COPD. However, even after cessation, the airway inflammation may be present. In the current study, mice were exposed to room air or cigarette smoke for 24 weeks or 24 weeks followed by 12 weeks of cessation. Morphological changes were evaluated by mean linear intercepts (Lm and destructive index (DI. The frequencies of CD8+IL-17+(Tc17 and CD4+IL-17+(Th17 cells, the mRNA levels of ROR gamma and IL-17, and the levels of IL-8, TNF-alpha, and IFN-gamma in lungs or bronchoalveolar lavage fluid of mice were assayed. Here we demonstrated that alveolar enlargement and destruction induced by cigarette smoke exposure were irreversible and that cigarette smokeenhanced these T-cell subsets, and related cytokines were not significantly reduced after smoking cessation. In addition, the frequencies of Th17 and Tc17 cells in lungs of smoke-exposed mice and cessation mice were positively correlated with emphysematous lesions. More important, the frequencies of Tc17 cells were much higher than Th17 cells, and there was a significantly positive correlation between Th17 and Tc17. These results suggested that Th17/Tc17 infiltration in lungs may play a critical role in sustaining lung inflammation in emphysema. Blocking the abnormally increased numbers of Tc17 and Th17 cells may be a reasonable therapeutic strategy for emphysema.

  13. Persistence of Th17/Tc17 cell expression upon smoking cessation in mice with cigarette smoke-induced emphysema.

    Science.gov (United States)

    Duan, Min-Chao; Tang, Hai-Juan; Zhong, Xiao-Ning; Huang, Ying

    2013-01-01

    Th17 and Tc17 cells may be involved in the pathogenesis of chronic obstructive pulmonary disease (COPD), a disease caused predominantly by cigarette smoking. Smoking cessation is the only intervention in the management of COPD. However, even after cessation, the airway inflammation may be present. In the current study, mice were exposed to room air or cigarette smoke for 24 weeks or 24 weeks followed by 12 weeks of cessation. Morphological changes were evaluated by mean linear intercepts (Lm) and destructive index (DI). The frequencies of CD8(+)IL-17(+)(Tc17) and CD4(+)IL-17(+)(Th17) cells, the mRNA levels of ROR gamma and IL-17, and the levels of IL-8, TNF-alpha, and IFN-gamma in lungs or bronchoalveolar lavage fluid of mice were assayed. Here we demonstrated that alveolar enlargement and destruction induced by cigarette smoke exposure were irreversible and that cigarette smokeenhanced these T-cell subsets, and related cytokines were not significantly reduced after smoking cessation. In addition, the frequencies of Th17 and Tc17 cells in lungs of smoke-exposed mice and cessation mice were positively correlated with emphysematous lesions. More important, the frequencies of Tc17 cells were much higher than Th17 cells, and there was a significantly positive correlation between Th17 and Tc17. These results suggested that Th17/Tc17 infiltration in lungs may play a critical role in sustaining lung inflammation in emphysema. Blocking the abnormally increased numbers of Tc17 and Th17 cells may be a reasonable therapeutic strategy for emphysema. PMID:24489575

  14. Immersion francaise precoce: Musique 1-7 (Early French Immersion: Music for Grades 1-7).

    Science.gov (United States)

    Burt, Andy; And Others

    This curriculum guide in music is intended for use in grades 1-7 in the early French immersion program. The program is presented as one that contributes to the development of the child, calls for flexibility and diversification, and requires a solid music education on the part of the teacher. The guide presents the following topics: (1) statements…

  15. 17 CFR 270.30b1-7 - Monthly report for money market funds.

    Science.gov (United States)

    2010-04-01

    ... money market funds. (a) Report. Every registered open-end management investment company, or series thereof, that is regulated as a money market fund under § 270.2a-7 must file with the Commission a monthly... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Monthly report for...

  16. IMPORTANT ROLE OF 17α HYDROXY PROGESTERONE CAPROATE (17OHPC FOR THE PREVENTION OF PRETERM LABOUR

    Directory of Open Access Journals (Sweden)

    Manisha M

    2014-10-01

    Full Text Available OBJECTIVE: This is a prospective randomized case control study to evaluate the role of 17 α hydroxyprogesterone caproate (17OHPC in the prevention of preterm labor in high risk asymptomatic patients with a history of preterm delivery. METHODS: The study included 100 patients with a singleton pregnancy and having a prior preterm birth. They were divided in 2 groups, group I (treatment group included 50 asymptomatic patients who were given 17OHPC injections starting from 18-24 weeks till 36 weeks and group II (control group included 50 patients who did not receive any treatment. RESULTS: The incidence of preterm delivery was found to be 6.6%. The median gestational age at delivery was 36 weeks in group I and 34W5D in controls. 50% cases in group I and 80% of controls delivered prematurely in the group with a prior preterm birth between 20-28 weeks. Conclusion In patients who had a prior history of a preterm delivery the recurrence of a preterm birth was less in the treated group as compared to controls. The median gestational age at delivery was significantly higher in 17OHPC treated patients with history of earliest prior preterm delivery at 20-28 weeks.

  17. 27 CFR 17.103 - Bonds obtained from surety companies.

    Science.gov (United States)

    2010-04-01

    ... U.S.C. 9304, and 31 CFR part 223. (b) A bond executed by two or more surety companies shall be the... companies. 17.103 Section 17.103 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... NONBEVERAGE PRODUCTS Bonds and Consents of Sureties § 17.103 Bonds obtained from surety companies. (a)...

  18. 31 CFR 17.110 - Self-evaluation.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Self-evaluation. 17.110 Section 17... § 17.110 Self-evaluation. (a) The agency shall, by two years after the effective date of this part... handicaps, to participate in the self-evaluation process. (c) The agency shall, until three years...

  19. Purinergic Signaling as a Regulator of Th17 Cell Plasticity

    Science.gov (United States)

    Fernández, Dominique; Flores-Santibáñez, Felipe; Neira, Jocelyn; Osorio-Barrios, Francisco; Tejón, Gabriela; Nuñez, Sarah; Hidalgo, Yessia; Fuenzalida, Maria Jose; Meza, Daniel; Ureta, Gonzalo; Lladser, Alvaro; Pacheco, Rodrigo; Acuña-Castillo, Claudio; Guixé, Victoria; Quintana, Francisco J.; Bono, Maria Rosa; Rosemblatt, Mario; Sauma, Daniela

    2016-01-01

    T helper type 17 (Th17) lymphocytes, characterized by the production of interleukin-17 and other pro-inflammatory cytokines, are present in intestinal lamina propria and have been described as important players driving intestinal inflammation. Recent evidence, supporting the notion of a functional and phenotypic instability of Th17 cells, has shown that Th17 differentiate into type 1 regulatory (Tr1) T cells during the resolution of intestinal inflammation. Moreover, it has been suggested that the expression of CD39 ectonucleotidase endows Th17 cells with immunosuppressive properties. However, the exact role of CD39 ectonucleotidase in Th17 cells has not been studied in the context of intestinal inflammation. Here we show that Th17 cells expressing CD39 ectonucleotidase can hydrolyze ATP and survive to ATP-induced cell death. Moreover, in vitro-generated Th17 cells expressing the CD39 ectonucleotidase produce IL-10 and are less pathogenic than CD39 negative Th17 cells in a model of experimental colitis in Rag-/- mice. Remarkably, we show that CD39 activity regulates the conversion of Th17 cells to IL-10-producing cells in vitro, which is abrogated in the presence of ATP and the CD39-specific inhibitor ARL67156. All these data suggest that CD39 expression by Th17 cells allows the depletion of ATP and is crucial for IL-10 production and survival during the resolution of intestinal inflammation. PMID:27322617

  20. 9 CFR 201.17 - Requirements for filing tariffs.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Requirements for filing tariffs. 201.17 Section 201.17 Animals and Animal Products GRAIN INSPECTION, PACKERS AND STOCKYARDS ADMINISTRATION... ACT Schedules of Rates and Charges § 201.17 Requirements for filing tariffs. (a) Schedules of...